Improved Transient and Steady-State Performances of Series Resonant ZCS High-Frequency Inverter-Coupled Voltage Multiplier Converter with Dual Mode PFM Control Scheme

NASA Astrophysics Data System (ADS)

Chu, Enhui; Gamage, Laknath; Ishitobi, Manabu; Hiraki, Eiji; Nakaoka, Mutsuo

The A variety of switched-mode high voltage DC power supplies using voltage-fed type or current-fed type high-frequency transformer resonant inverters using MOS gate bipolar power transistors; IGBTs have been recently developed so far for a medical-use X-ray high power generator. In general, the high voltage high power X-ray generator using voltage-fed high frequency inverter with a high voltage transformer link has to meet some performances such as (i) short rising period in start transient of X-ray tube voltage (ii) no overshoot transient response in tube voltage, (iii) minimized voltage ripple in periodic steady-state under extremely wide load variations and filament heater current fluctuation conditions of the X-ray tube. This paper presents two lossless inductor snubber-assisted series resonant zero current soft switching high-frequency inverter using a diode-capacitor ladder type voltage multiplier called Cockcroft-Walton circuit, which is effectively implemented for a high DC voltage X-ray power generator. This DC high voltage generator which incorporates pulse frequency modulated series resonant inverter using IGBT power module packages is based on the operation principle of zero current soft switching commutation scheme under discontinuous resonant current and continuous resonant current transition modes. This series capacitor compensated for transformer resonant power converter with a high frequency transformer linked voltage boost multiplier can efficiently work a novel selectively-changed dual mode PFM control scheme in order to improve the start transient and steady-state response characteristics and can completely achieve stable zero current soft switching commutation tube filament current dependent for wide load parameter setting values with the aid of two lossless inductor snubbers. It is proved on the basis of simulation and experimental results in which a simple and low cost control implementation based on selectively-changed dual-mode PFM for high-voltage X-ray DC-DC power converter with a voltage multiplier strategy has some specified voltage pattern tracking voltage response performances under rapid rising time and no overshoot in start transient tube voltage as well as the minimized steady-state voltage ripple in tube voltage.

Transient AC voltage related phenomena for HVDC schemes connected to weak AC systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pilotto, L.A.S.; Szechtman, M.; Hammad, A.E.

1992-07-01

In this paper a didactic explanation of voltage stability associated phenomena at HVDC terminals is presented. Conditions leading to ac voltage collapse problems are identified. A mechanism that excites control-induced voltage oscillations is shown. The voltage stability factor is used for obtaining the maximum power limits of ac/dc systems operating with different control strategies. Correlation to Pd {times} Id curves is given. Solutions for eliminating the risks of voltage collapse and for avoiding control-induced oscillations are discussed. The results are supported by detailed digital simulations of a weak ac/dc system using EMTP.

Adaptive Hierarchical Voltage Control of a DFIG-Based Wind Power Plant for a Grid Fault

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Jinho; Muljadi, Eduard; Park, Jung-Wook

This paper proposes an adaptive hierarchical voltage control scheme of a doubly-fed induction generator (DFIG)-based wind power plant (WPP) that can secure more reserve of reactive power (Q) in the WPP against a grid fault. To achieve this, each DFIG controller employs an adaptive reactive power to voltage (Q-V) characteristic. The proposed adaptive Q-V characteristic is temporally modified depending on the available Q capability of a DFIG; it is dependent on the distance from a DFIG to the point of common coupling (PCC). The proposed characteristic secures more Q reserve in the WPP than the fixed one. Furthermore, it allowsmore » DFIGs to promptly inject up to the Q limit, thereby improving the PCC voltage support. To avert an overvoltage after the fault clearance, washout filters are implemented in the WPP and DFIG controllers; they can prevent a surplus Q injection after the fault clearance by eliminating the accumulated values in the proportional-integral controllers of both controllers during the fault. Test results demonstrate that the scheme can improve the voltage support capability during the fault and suppress transient overvoltage after the fault clearance under scenarios of various system and fault conditions; therefore, it helps ensure grid resilience by supporting the voltage stability.« less

An accurate reactive power control study in virtual flux droop control

NASA Astrophysics Data System (ADS)

Wang, Aimeng; Zhang, Jia

2017-12-01

This paper investigates the problem of reactive power sharing based on virtual flux droop method. Firstly, flux droop control method is derived, where complicated multiple feedback loops and parameter regulation are avoided. Then, the reasons for inaccurate reactive power sharing are theoretically analyzed. Further, a novel reactive power control scheme is proposed which consists of three parts: compensation control, voltage recovery control and flux droop control. Finally, the proposed reactive power control strategy is verified in a simplified microgrid model with two parallel DGs. The simulation results show that the proposed control scheme can achieve accurate reactive power sharing and zero deviation of voltage. Meanwhile, it has some advantages of simple control and excellent dynamic and static performance.

Multi-loop control of UPS inverter with a plug-in odd-harmonic repetitive controller.

PubMed

Razi, Reza; Karbasforooshan, Mohammad-Sadegh; Monfared, Mohammad

2017-03-01

This paper proposes an improved multi-loop control scheme for the single-phase uninterruptible power supply (UPS) inverter by using a plug-in odd-harmonic repetitive controller to regulate the output voltage. In the suggested control method, the output voltage and the filter capacitor current are used as the outer and inner loop feedback signals, respectively and the instantaneous value of the reference voltage feedforwarded to the output of the controller. Instead of conventional linear (proportional-integral/-resonant) and conventional repetitive controllers, a plug-in odd-harmonic repetitive controller is employed in the outer loop to regulate the output voltage, which occupies less memory space and offers faster tracking performance compared to the conventional one. Also, a simple proportional controller is used in the inner loop for active damping of possible resonances and improving the transient performance. The feedforward of the converter reference voltage enhances the robust performance of the system and simplifies the system modelling and the controller design. A step-by-step design procedure is presented for the proposed controller, which guarantees stability of the system under worst-case scenarios. Simulation and experimental results validate the excellent steady-state and transient performance of the proposed control scheme and provide the exact comparison of the proposed method with the conventional multi-loop control method. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Maximum power extraction under different vector-control schemes and grid-synchronization strategy of a wind-driven Brushless Doubly-Fed Reluctance Generator.

PubMed

Mousa, Mohamed G; Allam, S M; Rashad, Essam M

2018-01-01

This paper proposes an advanced strategy to synchronize the wind-driven Brushless Doubly-Fed Reluctance Generator (BDFRG) to the grid-side terminals. The proposed strategy depends mainly upon determining the electrical angle of the grid voltage, θ v and using the same transformation matrix of both the power winding and grid sides to ensure that the generated power-winding voltage has the same phase-sequence of the grid-side voltage. On the other hand, the paper proposes a vector-control (power-winding flux orientation) technique for maximum wind-power extraction under two schemes summarized as; unity power-factor operation and minimum converter-current. Moreover, a soft-starting method is suggested to avoid the employed converter over-current. The first control scheme is achieved by adjusting the command power-winding reactive power at zero for a unity power-factor operation. However, the second scheme depends on setting the command d-axis control-winding current at zero to maximize the ratio of the generator electromagnetic-torque per the converter current. This enables the system to get a certain command torque under minimum converter current. A sample of the obtained simulation and experimental results is presented to check the effectiveness of the proposed control strategies. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Evaluation of a “Field Cage” for Electric Field Control in GaN-Based HEMTs That Extends the Scalability of Breakdown Into the kV Regime

DOE PAGES

Tierney, Brian D.; Choi, Sukwon; DasGupta, Sandeepan; ...

2017-08-16

A distributed impedance “field cage” structure is proposed and evaluated for electric field control in GaN-based, lateral high electron mobility transistors (HEMTs) operating as kilovolt-range power devices. In this structure, a resistive voltage divider is used to control the electric field throughout the active region. The structure complements earlier proposals utilizing floating field plates that did not employ resistively connected elements. Transient results, not previously reported for field plate schemes using either floating or resistively connected field plates, are presented for ramps of dV ds /dt = 100 V/ns. For both DC and transient results, the voltage between the gatemore » and drain is laterally distributed, ensuring the electric field profile between the gate and drain remains below the critical breakdown field as the source-to-drain voltage is increased. Our scheme indicates promise for achieving breakdown voltage scalability to a few kV.« less

Evaluation of a “Field Cage” for Electric Field Control in GaN-Based HEMTs That Extends the Scalability of Breakdown Into the kV Regime

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tierney, Brian D.; Choi, Sukwon; DasGupta, Sandeepan

A distributed impedance “field cage” structure is proposed and evaluated for electric field control in GaN-based, lateral high electron mobility transistors (HEMTs) operating as kilovolt-range power devices. In this structure, a resistive voltage divider is used to control the electric field throughout the active region. The structure complements earlier proposals utilizing floating field plates that did not employ resistively connected elements. Transient results, not previously reported for field plate schemes using either floating or resistively connected field plates, are presented for ramps of dV ds /dt = 100 V/ns. For both DC and transient results, the voltage between the gatemore » and drain is laterally distributed, ensuring the electric field profile between the gate and drain remains below the critical breakdown field as the source-to-drain voltage is increased. Our scheme indicates promise for achieving breakdown voltage scalability to a few kV.« less

Feasibility of Stochastic Voltage/VAr Optimization Considering Renewable Energy Resources for Smart Grid

NASA Astrophysics Data System (ADS)

Momoh, James A.; Salkuti, Surender Reddy

2016-06-01

This paper proposes a stochastic optimization technique for solving the Voltage/VAr control problem including the load demand and Renewable Energy Resources (RERs) variation. The RERs often take along some inputs like stochastic behavior. One of the important challenges i. e., Voltage/VAr control is a prime source for handling power system complexity and reliability, hence it is the fundamental requirement for all the utility companies. There is a need for the robust and efficient Voltage/VAr optimization technique to meet the peak demand and reduction of system losses. The voltages beyond the limit may damage costly sub-station devices and equipments at consumer end as well. Especially, the RERs introduces more disturbances and some of the RERs are not even capable enough to meet the VAr demand. Therefore, there is a strong need for the Voltage/VAr control in RERs environment. This paper aims at the development of optimal scheme for Voltage/VAr control involving RERs. In this paper, Latin Hypercube Sampling (LHS) method is used to cover full range of variables by maximally satisfying the marginal distribution. Here, backward scenario reduction technique is used to reduce the number of scenarios effectively and maximally retain the fitting accuracy of samples. The developed optimization scheme is tested on IEEE 24 bus Reliability Test System (RTS) considering the load demand and RERs variation.

A multi-mode operation control strategy for flexible microgrid based on sliding-mode direct voltage and hierarchical controls.

PubMed

Zhang, Qinjin; Liu, Yancheng; Zhao, Youtao; Wang, Ning

2016-03-01

Multi-mode operation and transient stability are two problems that significantly affect flexible microgrid (MG). This paper proposes a multi-mode operation control strategy for flexible MG based on a three-layer hierarchical structure. The proposed structure is composed of autonomous, cooperative, and scheduling controllers. Autonomous controller is utilized to control the performance of the single micro-source inverter. An adaptive sliding-mode direct voltage loop and an improved droop power loop based on virtual negative impedance are presented respectively to enhance the system disturbance-rejection performance and the power sharing accuracy. Cooperative controller, which is composed of secondary voltage/frequency control and phase synchronization control, is designed to eliminate the voltage/frequency deviations produced by the autonomous controller and prepare for grid connection. Scheduling controller manages the power flow between the MG and the grid. The MG with the improved hierarchical control scheme can achieve seamless transitions from islanded to grid-connected mode and have a good transient performance. In addition the presented work can also optimize the power quality issues and improve the load power sharing accuracy between parallel VSIs. Finally, the transient performance and effectiveness of the proposed control scheme are evaluated by theoretical analysis and simulation results. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Initialize and Weak-Program Erasing Scheme for High-Performance and High-Reliability Ferroelectric NAND Flash Solid-State Drive

NASA Astrophysics Data System (ADS)

Miyaji, Kousuke; Yajima, Ryoji; Hatanaka, Teruyoshi; Takahashi, Mitsue; Sakai, Shigeki; Takeuchi, Ken

Initialize and weak-program erasing scheme is proposed to achieve high-performance and high-reliability Ferroelectric (Fe-) NAND flash solid-state drive (SSD). Bit-by-bit erase VTH control is achieved by the proposed erasing scheme and history effects in Fe-NAND is also suppressed. History effects change the future erase VTH shift characteristics by the past program voltage. The proposed erasing scheme decreases VTH shift variation due to history effects from ±40% to ±2% and the erase VTH distribution width is reduced from over 0.4V to 0.045V. As a result, the read and VPASS disturbance decrease by 42% and 37%, respectively. The proposed erasing scheme is immune to VTH variations and voltage stress. The proposed erasing scheme also suppresses the power and bandwidth degradation of SSD.

The research of full automatic oil filtering control technology of high voltage insulating oil

NASA Astrophysics Data System (ADS)

Gong, Gangjun; Zhang, Tong; Yan, Guozeng; Zhang, Han; Chen, Zhimin; Su, Chang

2017-09-01

In this paper, the design scheme of automatic oil filter control system for transformer oil in UHV substation is summarized. The scheme specifically includes the typical double tank filter connection control method of the transformer oil of the UHV substation, which distinguishes the single port and the double port connection structure of the oil tank. Finally, the design scheme of the temperature sensor and respirator is given in detail, and the detailed evaluation and application scenarios are given for reference.

Hybrid AC-High Voltage DC Grid Stability and Controls

NASA Astrophysics Data System (ADS)

Yu, Jicheng

The growth of energy demands in recent years has been increasing faster than the expansion of transmission facility construction. This tendency cooperating with the continuous investing on the renewable energy resources drives the research, development, and construction of HVDC projects to create a more reliable, affordable, and environmentally friendly power grid. Constructing the hybrid AC-HVDC grid is a significant move in the development of the HVDC techniques; the form of dc system is evolving from the point-to-point stand-alone dc links to the embedded HVDC system and the multi-terminal HVDC (MTDC) system. The MTDC is a solution for the renewable energy interconnections, and the MTDC grids can improve the power system reliability, flexibility in economic dispatches, and converter/cable utilizing efficiencies. The dissertation reviews the HVDC technologies, discusses the stability issues regarding the ac and HVDC connections, proposes a novel power oscillation control strategy to improve system stability, and develops a nonlinear voltage droop control strategy for the MTDC grid. To verify the effectiveness the proposed power oscillation control strategy, a long distance paralleled AC-HVDC transmission test system is employed. Based on the PSCAD/EMTDC platform simulation results, the proposed power oscillation control strategy can improve the system dynamic performance and attenuate the power oscillations effectively. To validate the nonlinear voltage droop control strategy, three droop controls schemes are designed according to the proposed nonlinear voltage droop control design procedures. These control schemes are tested in a hybrid AC-MTDC system. The hybrid AC-MTDC system, which is first proposed in this dissertation, consists of two ac grids, two wind farms and a five-terminal HVDC grid connecting them. Simulation studies are performed in the PSCAD/EMTDC platform. According to the simulation results, all the three design schemes have their unique salient features.

Voltage controlled current source

DOEpatents

Casne, Gregory M.

1992-01-01

A seven decade, voltage controlled current source is described for use in testing intermediate range nuclear instruments that covers the entire test current range of from 10 picoamperes to 100 microamperes. High accuracy is obtained throughout the entire seven decades of output current with circuitry that includes a coordinated switching scheme responsive to the input signal from a hybrid computer to control the input voltage to an antilog amplifier, and to selectively connect a resistance to the antilog amplifier output to provide a continuous output current source as a function of a preset range of input voltage. An operator controlled switch provides current adjustment for operation in either a real-time simulation test mode or a time response test mode.

Electro-optic resonant phase modulator

NASA Technical Reports Server (NTRS)

Chen, Chien-Chung (Inventor); Hemmati, Hamid (Inventor); Robinson, Deborah L. (Inventor)

1992-01-01

An electro-optic resonant cavity is used to achieve phase modulation with lower driving voltages. Laser damage thresholds are inherently higher than with previously used integrated optics due to the utilization of bulk optics. Phase modulation is achieved at higher speeds with lower driving voltages than previously obtained with non-resonant electro-optic phase modulators. The instant scheme uses a data locking dither approach as opposed to the conventional sinusoidal locking schemes. In accordance with a disclosed embodiment, a resonant cavity modulator has been designed to operate at a data rate in excess of 100 megabits per sec. By carefully choosing the cavity finesse and its dimension, it is possible to control the pulse switching time to within 4 nano-sec. and to limit the required switching voltage to within 10 V. This cavity locking scheme can be applied by using only the random data sequence, and without the need of dithering of the cavity. Compared to waveguide modulators, the resonant cavity has a comparable modulating voltage requirement. Because of its bulk geometry, the resonant cavity modulator has the potential of accommodating higher throughput power. Mode matching into the bulk device is easier and typically can be achieved with higher efficiency. An additional control loop is incorporated into the modulator to maintain the cavity on resonance.

Nonlinear neural control with power systems applications

NASA Astrophysics Data System (ADS)

Chen, Dingguo

1998-12-01

Extensive studies have been undertaken on the transient stability of large interconnected power systems with flexible ac transmission systems (FACTS) devices installed. Varieties of control methodologies have been proposed to stabilize the postfault system which would otherwise eventually lose stability without a proper control. Generally speaking, regular transient stability is well understood, but the mechanism of load-driven voltage instability or voltage collapse has not been well understood. The interaction of generator dynamics and load dynamics makes synthesis of stabilizing controllers even more challenging. There is currently increasing interest in the research of neural networks as identifiers and controllers for dealing with dynamic time-varying nonlinear systems. This study focuses on the development of novel artificial neural network architectures for identification and control with application to dynamic electric power systems so that the stability of the interconnected power systems, following large disturbances, and/or with the inclusion of uncertain loads, can be largely enhanced, and stable operations are guaranteed. The latitudinal neural network architecture is proposed for the purpose of system identification. It may be used for identification of nonlinear static/dynamic loads, which can be further used for static/dynamic voltage stability analysis. The properties associated with this architecture are investigated. A neural network methodology is proposed for dealing with load modeling and voltage stability analysis. Based on the neural network models of loads, voltage stability analysis evolves, and modal analysis is performed. Simulation results are also provided. The transient stability problem is studied with consideration of load effects. The hierarchical neural control scheme is developed. Trajectory-following policy is used so that the hierarchical neural controller performs as almost well for non-nominal cases as they do for the nominal cases. The adaptive hierarchical neural control scheme is also proposed to deal with the time-varying nature of loads. Further, adaptive neural control, which is based on the on-line updating of the weights and biases of the neural networks, is studied. Simulations provided on the faulted power systems with unknown loads suggest that the proposed adaptive hierarchical neural control schemes should be useful for practical power applications.

A novel transient rotor current control scheme of a doubly-fed induction generator equipped with superconducting magnetic energy storage for voltage and frequency support

NASA Astrophysics Data System (ADS)

Shen, Yang-Wu; Ke, De-Ping; Sun, Yuan-Zhang; Daniel, Kirschen; Wang, Yi-Shen; Hu, Yuan-Chao

2015-07-01

A novel transient rotor current control scheme is proposed in this paper for a doubly-fed induction generator (DFIG) equipped with a superconducting magnetic energy storage (SMES) device to enhance its transient voltage and frequency support capacity during grid faults. The SMES connected to the DC-link capacitor of the DFIG is controlled to regulate the transient dc-link voltage so that the whole capacity of the grid side converter (GSC) is dedicated to injecting reactive power to the grid for the transient voltage support. However, the rotor-side converter (RSC) has different control tasks for different periods of the grid fault. Firstly, for Period I, the RSC injects the demagnetizing current to ensure the controllability of the rotor voltage. Then, since the dc stator flux degenerates rapidly in Period II, the required demagnetizing current is low in Period II and the RSC uses the spare capacity to additionally generate the reactive (priority) and active current so that the transient voltage capability is corroborated and the DFIG also positively responds to the system frequency dynamic at the earliest time. Finally, a small amount of demagnetizing current is provided after the fault clearance. Most of the RSC capacity is used to inject the active current to further support the frequency recovery of the system. Simulations are carried out on a simple power system with a wind farm. Comparisons with other commonly used control methods are performed to validate the proposed control method. Project supported by the National Natural Science Foundation of China (Grant No. 51307124) and the Major Program of the National Natural Science Foundation of China (Grant No. 51190105).

Enhancement of Voltage Stability of DC Smart Grid During Islanded Mode by Load Shedding Scheme

NASA Astrophysics Data System (ADS)

Nassor, Thabit Salim; Senjyu, Tomonobu; Yona, Atsushi

2015-10-01

This paper presents the voltage stability of a DC smart grid based on renewable energy resources during grid connected and isolated modes. During the islanded mode the load shedding, based on the state of charge of the battery and distribution line voltage, was proposed for voltage stability and reservation of critical load power. The analyzed power system comprises a wind turbine, a photovoltaic generator, storage battery as controllable load, DC loads, and power converters. A fuzzy logic control strategy was applied for power consumption control of controllable loads and the grid-connected dual active bridge series resonant converters. The proposed DC Smart Grid operation has been verified by simulation using MATLAB® and PLECS® Blockset. The obtained results show the effectiveness of the proposed method.

Intelligent energy harvesting scheme for microbial fuel cells: Maximum power point tracking and voltage overshoot avoidance

NASA Astrophysics Data System (ADS)

Alaraj, Muhannad; Radenkovic, Miloje; Park, Jae-Do

2017-02-01

Microbial fuel cells (MFCs) are renewable and sustainable energy sources that can be used for various applications. The MFC output power depends on its biochemical conditions as well as the terminal operating points in terms of output voltage and current. There exists one operating point that gives the maximum possible power from the MFC, maximum power point (MPP), for a given operating condition. However, this MPP may vary and needs to be tracked in order to maintain the maximum power extraction from the MFC. Furthermore, MFC reactors often develop voltage overshoots that cause drastic drops in the terminal voltage, current, and the output power. When the voltage overshoot happens, an additional control measure is necessary as conventional MPPT algorithms will fail because of the change in the voltage-current relationship. In this paper, the extremum seeking (ES) algorithm was used to track the varying MPP and a voltage overshoot avoidance (VOA) algorithm is developed to manage the voltage overshoot conditions. The proposed ES-MPPT with VOA algorithm was able to extract 197.2 mJ during 10-min operation avoiding voltage overshoot, while the ES MPPT-only scheme stopped harvesting after only 18.75 mJ because of the voltage overshoot happened at 0.4 min.

An Energy Saving Green Plug Device for Nonlinear Loads

NASA Astrophysics Data System (ADS)

Bloul, Albe; Sharaf, Adel; El-Hawary, Mohamed

2018-03-01

The paper presents a low cost a FACTS Based flexible fuzzy logic based modulated/switched tuned arm filter and Green Plug compensation (SFC-GP) scheme for single-phase nonlinear loads ensuring both voltage stabilization and efficient energy utilization. The new Green Plug-Switched filter compensator SFC modulated LC-Filter PWM Switched Capacitive Compensation Devices is controlled using a fuzzy logic regulator to enhance power quality, improve power factor at the source and reduce switching transients and inrush current conditions as well harmonic contents in source current. The FACTS based SFC-GP Device is a member of family of Green Plug/Filters/Compensation Schemes used for efficient energy utilization, power quality enhancement and voltage/inrush current/soft starting control using a dynamic error driven fuzzy logic controller (FLC). The device with fuzzy logic controller is validated using the Matlab / Simulink Software Environment for enhanced power quality (PQ), improved power factor and reduced inrush currents. This is achieved using modulated PWM Switching of the Filter-Capacitive compensation scheme to cope with dynamic type nonlinear and inrush cyclical loads..

Finite Control Set Model Predictive Control for Multiple Distributed Generators Microgrids

NASA Astrophysics Data System (ADS)

Babqi, Abdulrahman Jamal

This dissertation proposes two control strategies for AC microgrids that consist of multiple distributed generators (DGs). The control strategies are valid for both grid-connected and islanded modes of operation. In general, microgrid can operate as a stand-alone system (i.e., islanded mode) or while it is connected to the utility grid (i.e., grid connected mode). To enhance the performance of a micrgorid, a sophisticated control scheme should be employed. The control strategies of microgrids can be divided into primary and secondary controls. The primary control regulates the output active and reactive powers of each DG in grid-connected mode as well as the output voltage and frequency of each DG in islanded mode. The secondary control is responsible for regulating the microgrid voltage and frequency in the islanded mode. Moreover, it provides power sharing schemes among the DGs. In other words, the secondary control specifies the set points (i.e. reference values) for the primary controllers. In this dissertation, Finite Control Set Model Predictive Control (FCS-MPC) was proposed for controlling microgrids. FCS-MPC was used as the primary controller to regulate the output power of each DG (in the grid-connected mode) or the voltage of the point of DG coupling (in the islanded mode of operation). In the grid-connected mode, Direct Power Model Predictive Control (DPMPC) was implemented to manage the power flow between each DG and the utility grid. In the islanded mode, Voltage Model Predictive Control (VMPC), as the primary control, and droop control, as the secondary control, were employed to control the output voltage of each DG and system frequency. The controller was equipped with a supplementary current limiting technique in order to limit the output current of each DG in abnormal incidents. The control approach also enabled smooth transition between the two modes. The performance of the control strategy was investigated and verified using PSCAD/EMTDC software platform. This dissertation also proposes a control and power sharing strategy for small-scale microgrids in both grid-connected and islanded modes based on centralized FCS-MPC. In grid-connected mode, the controller was capable of managing the output power of each DG and enabling flexible power regulation between the microgrid and the utility grid. In islanded mode, the controller regulated the microgrid voltage and frequency, and provided a precise power sharing scheme among the DGs. In addition, the power sharing can be adjusted flexibly by changing the sharing ratio. The proposed control also enabled plug-and-play operation. Moreover, a smooth transition between the two modes of operation was achieved without any disturbance in the system. Case studies were carried out in order to validate the proposed control strategy with the PSCAD/EMTDA software package.

CFAVC scheme for high frequency series resonant inverter-fed domestic induction heating system

NASA Astrophysics Data System (ADS)

Nagarajan, Booma; Reddy Sathi, Rama

2016-01-01

This article presents the investigations on the constant frequency asymmetric voltage cancellation control in the AC-AC resonant converter-fed domestic induction heating system. Conventional fixed frequency control techniques used in the high frequency converters lead to non-zero voltage switching operation and reduced output power. The proposed control technique produces higher output power than the conventional fixed-frequency control strategies. In this control technique, zero-voltage-switching operation is maintained during different duty cycle operation for reduction in the switching losses. Complete analysis of the induction heating power supply system with asymmetric voltage cancellation control is discussed in this article. Simulation and experimental study on constant frequency asymmetric voltage cancellation (CFAVC)-controlled full bridge series resonant inverter is performed. Time domain simulation results for the open and closed loop of the system are obtained using MATLAB simulation tool. The simulation results prove the control of voltage and power in a wide range. PID controller-based closed loop control system achieves the voltage regulation of the proposed system for the step change in load. Hardware implementation of the system under CFAVC control is done using the embedded controller. The simulation and experimental results validate the performance of the CFAVC control technique for series resonant-based induction cooking system.

A design of high-precision BLDCM drive with bus voltage protection

NASA Astrophysics Data System (ADS)

Lian, Xuezheng; Wang, Haitao; Xie, Meilin; Huang, Wei; Li, Dawei; Jing, Feng

2017-11-01

In the application of space satellite turntable, the design of balance wheel is very necessary. To solve the acquisition precision of Brushless DC motor speed is low, and the encoder is also more complex, this paper improves the original hall signal measurement methods. Using the logic device to achieve the six frequency multiplication of hall signal, the signal is used as speed feedback to achieve speed closed-loop control and improve the speed stability. At the same time, in order to prevent the E.M.F of BLDC motor to raise the voltage of the bus bar when reversing or braking, and affect the normal operation of other circuit modules, the analog circuit is used to protect the bus bar voltage by the way of energy consumption braking. The experimental results are consistent with the theoretical design, and the rationality and feasibility of the frequency multiplication scheme and bus voltage protection scheme are verified.

An Optimal Control Strategy for DC Bus Voltage Regulation in Photovoltaic System with Battery Energy Storage

PubMed Central

Daud, Muhamad Zalani; Mohamed, Azah; Hannan, M. A.

2014-01-01

This paper presents an evaluation of an optimal DC bus voltage regulation strategy for grid-connected photovoltaic (PV) system with battery energy storage (BES). The BES is connected to the PV system DC bus using a DC/DC buck-boost converter. The converter facilitates the BES power charge/discharge to compensate for the DC bus voltage deviation during severe disturbance conditions. In this way, the regulation of DC bus voltage of the PV/BES system can be enhanced as compared to the conventional regulation that is solely based on the voltage-sourced converter (VSC). For the grid side VSC (G-VSC), two control methods, namely, the voltage-mode and current-mode controls, are applied. For control parameter optimization, the simplex optimization technique is applied for the G-VSC voltage- and current-mode controls, including the BES DC/DC buck-boost converter controllers. A new set of optimized parameters are obtained for each of the power converters for comparison purposes. The PSCAD/EMTDC-based simulation case studies are presented to evaluate the performance of the proposed optimized control scheme in comparison to the conventional methods. PMID:24883374

An optimal control strategy for DC bus voltage regulation in photovoltaic system with battery energy storage.

PubMed

Daud, Muhamad Zalani; Mohamed, Azah; Hannan, M A

2014-01-01

This paper presents an evaluation of an optimal DC bus voltage regulation strategy for grid-connected photovoltaic (PV) system with battery energy storage (BES). The BES is connected to the PV system DC bus using a DC/DC buck-boost converter. The converter facilitates the BES power charge/discharge to compensate for the DC bus voltage deviation during severe disturbance conditions. In this way, the regulation of DC bus voltage of the PV/BES system can be enhanced as compared to the conventional regulation that is solely based on the voltage-sourced converter (VSC). For the grid side VSC (G-VSC), two control methods, namely, the voltage-mode and current-mode controls, are applied. For control parameter optimization, the simplex optimization technique is applied for the G-VSC voltage- and current-mode controls, including the BES DC/DC buck-boost converter controllers. A new set of optimized parameters are obtained for each of the power converters for comparison purposes. The PSCAD/EMTDC-based simulation case studies are presented to evaluate the performance of the proposed optimized control scheme in comparison to the conventional methods.

A Study on a Centralized Under-Voltage Load Shedding Scheme Considering the Load Characteristics

NASA Astrophysics Data System (ADS)

Deng, Jiyu; Liu, Junyong

Under-voltage load shedding is an important measure for maintaining voltage stability.Aiming at the optimal load shedding problem considering the load characteristics,firstly,the traditional under-voltage load shedding scheme based on a static load model may cause the analysis inaccurate is pointed out on the equivalent Thevenin circuit.Then,the dynamic voltage stability margin indicator is derived through local measurement.The derived indicator can reflect the voltage change of the key area in a myopia linear way.Dimensions of the optimal problem will be greatly simplified using this indicator.In the end,mathematical model of the centralized load shedding scheme is built with the indicator considering load characteristics.HSPPSO is introduced to slove the optimal problem.Simulation results on IEEE-39 system show that the proposed scheme display a good adaptability in solving the under-voltage load shedding considering dynamic load characteristics.

An Improved Distributed Secondary Control Method for DC Microgrids With Enhanced Dynamic Current Sharing Performance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Panbao; Lu, Xiaonan; Yang, Xu

This paper proposes an improved distributed secondary control scheme for dc microgrids (MGs), aiming at overcoming the drawbacks of conventional droop control method. The proposed secondary control scheme can remove the dc voltage deviation and improve the current sharing accuracy by using voltage-shifting and slope-adjusting approaches simultaneously. Meanwhile, the average value of droop coefficients is calculated, and then it is controlled by an additional controller included in the distributed secondary control layer to ensure that each droop coefficient converges at a reasonable value. Hence, by adjusting the droop coefficient, each participating converter has equal output impedance, and the accurate proportionalmore » load current sharing can be achieved with different line resistances. Furthermore, the current sharing performance in steady and transient states can be enhanced by using the proposed method. The effectiveness of the proposed method is verified by detailed experimental tests based on a 3 × 1 kW prototype with three interface converters.« less

Power-Quality Improvement in PFC Bridgeless SEPIC-Fed BLDC Motor Drive

NASA Astrophysics Data System (ADS)

Singh, Bhim; Bist, Vashist

2013-06-01

This article presents a design of a power factor correction (PFC)-based brushless DC (BLDC) motor drive. The speed control of BLDC motor is achieved by controlling the DC link voltage of the voltage source inverter (VSI) feeding BLDC motor using a single voltage sensor. A front-end bridgeless single-ended primary inductance converter (SEPIC) is used for DC link voltage control and PFC operation. A bridgeless SEPIC is designed to operate in discontinuous inductor current mode (DICM) thus utilizing a simple control scheme of voltage follower. An electronic commutation of BLDC motor is used for VSI to operate in a low-frequency operation for reduced switching losses in the VSI. Moreover, a bridgeless topology offers less conduction losses due to absence of diode bridge rectifier for further increasing the efficiency. The proposed BLDC motor drive is designed to operate over a wide range of speed control with an improved power-quality at the AC mains under the recommended international power-quality standards such as IEC 61000-3-2.

Modeling, simulation and control of pulsed DE-GMA welding process for joining of aluminum to steel

NASA Astrophysics Data System (ADS)

Zhang, Gang; Shi, Yu; Li, Jie; Huang, Jiankang; Fan, Ding

2014-09-01

Joining of aluminum to steel has attracted significant attention from the welding research community, automotive and rail transportation industries. Many current welding methods have been developed and applied, however, they can not precisely control the heat input to work-piece, they are high costs, low efficiency and consist lots of complex welding devices, and the generated intermetallic compound layer in weld bead interface is thicker. A novel pulsed double electrode gas metal arc welding(Pulsed DE-GMAW) method is developed. To achieve a stable welding process for joining of aluminum to steel, a mathematical model of coupled arc is established, and a new control scheme that uses the average feedback arc voltage of main loop to adjust the wire feed speed to control coupled arc length is proposed and developed. Then, the impulse control simulation of coupled arc length, wire feed speed and wire extension is conducted to demonstrate the mathematical model and predict the stability of welding process by changing the distance of contact tip to work-piece(CTWD). To prove the proposed PSO based PID control scheme's feasibility, the rapid prototyping experimental system is setup and the bead-on-plate control experiments are conducted to join aluminum to steel. The impulse control simulation shows that the established model can accurately represent the variation of coupled arc length, wire feed speed and the average main arc voltage when the welding process is disturbed, and the developed controller has a faster response and adjustment, only runs about 0.1 s. The captured electric signals show the main arc voltage gradually closes to the supposed arc voltage by adjusting the wire feed speed in 0.8 s. The obtained typical current waveform demonstrates that the main current can be reduced by controlling the bypass current under maintaining a relative large total current. The control experiment proves the accuracy of proposed model and feasibility of new control scheme further. The beautiful and smooth weld beads are also obtained by this method. Pulsed DE-GMAW can thus be considered as an alternative method for low cost, high efficiency joining of aluminum to steel.

Improving the mixing performance of side channel type micromixers using an optimal voltage control model.

PubMed

Wu, Chien-Hsien; Yang, Ruey-Jen

2006-06-01

Electroosmotic flow in microchannels is restricted to low Reynolds number regimes. Since the inertia forces are extremely weak in such regimes, turbulent conditions do not readily develop, and hence species mixing occurs primarily as a result of diffusion. Consequently, achieving a thorough species mixing generally relies upon the use of extended mixing channels. This paper aims to improve the mixing performance of conventional side channel type micromixers by specifying the optimal driving voltages to be applied to each channel. In the proposed approach, the driving voltages are identified by constructing a simple theoretical scheme based on a 'flow-rate-ratio' model and Kirchhoff's law. The numerical and experimental results confirm that the optimal voltage control approach provides a better mixing performance than the use of a single driving voltage gradient.

A variable-speed, constant-frequency wind power generation scheme using a slip-ring induction generator

NASA Astrophysics Data System (ADS)

Velayudhan, C.; Bundell, J. H.

This paper investigates a variable-speed, constant-frequency double output induction generator which is capable of absorbing the mechanical energy from a fixed pitch wind turbine and converting it into electrical energy at constant grid voltage and frequency. Rotor power at varying voltage and frequency is either fed to electronically controlled resistances and used as heat energy or is rectified, inverted by a controllable line-commutated inverter and returned to the grid. Optimal power tracking is by means of an adaptive controller which controls the developed torque of the generator by monitoring the shaft speed.

Sliding-mode control of single input multiple output DC-DC converter

NASA Astrophysics Data System (ADS)

Zhang, Libo; Sun, Yihan; Luo, Tiejian; Wan, Qiyang

2016-10-01

Various voltage levels are required in the vehicle mounted power system. A conventional solution is to utilize an independent multiple output DC-DC converter whose cost is high and control scheme is complicated. In this paper, we design a novel SIMO DC-DC converter with sliding mode controller. The proposed converter can boost the voltage of a low-voltage input power source to a controllable high-voltage DC bus and middle-voltage output terminals, which endow the converter with characteristics of simple structure, low cost, and convenient control. In addition, the sliding mode control (SMC) technique applied in our converter can enhance the performances of a certain SIMO DC-DC converter topology. The high-voltage DC bus can be regarded as the main power source to the high-voltage facility of the vehicle mounted power system, and the middle-voltage output terminals can supply power to the low-voltage equipment on an automobile. In the respect of control algorithm, it is the first time to propose the SMC-PID (Proportion Integration Differentiation) control algorithm, in which the SMC algorithm is utilized and the PID control is attended to the conventional SMC algorithm. The PID control increases the dynamic ability of the SMC algorithm by establishing the corresponding SMC surface and introducing the attached integral of voltage error, which endow the sliding-control system with excellent dynamic performance. At last, we established the MATLAB/SIMULINK simulation model, tested performance of the system, and built the hardware prototype based on Digital Signal Processor (DSP). Results show that the sliding mode control is able to track a required trajectory, which has robustness against the uncertainties and disturbances.

Sliding-mode control of single input multiple output DC-DC converter.

PubMed

Zhang, Libo; Sun, Yihan; Luo, Tiejian; Wan, Qiyang

2016-10-01

Various voltage levels are required in the vehicle mounted power system. A conventional solution is to utilize an independent multiple output DC-DC converter whose cost is high and control scheme is complicated. In this paper, we design a novel SIMO DC-DC converter with sliding mode controller. The proposed converter can boost the voltage of a low-voltage input power source to a controllable high-voltage DC bus and middle-voltage output terminals, which endow the converter with characteristics of simple structure, low cost, and convenient control. In addition, the sliding mode control (SMC) technique applied in our converter can enhance the performances of a certain SIMO DC-DC converter topology. The high-voltage DC bus can be regarded as the main power source to the high-voltage facility of the vehicle mounted power system, and the middle-voltage output terminals can supply power to the low-voltage equipment on an automobile. In the respect of control algorithm, it is the first time to propose the SMC-PID (Proportion Integration Differentiation) control algorithm, in which the SMC algorithm is utilized and the PID control is attended to the conventional SMC algorithm. The PID control increases the dynamic ability of the SMC algorithm by establishing the corresponding SMC surface and introducing the attached integral of voltage error, which endow the sliding-control system with excellent dynamic performance. At last, we established the MATLAB/SIMULINK simulation model, tested performance of the system, and built the hardware prototype based on Digital Signal Processor (DSP). Results show that the sliding mode control is able to track a required trajectory, which has robustness against the uncertainties and disturbances.

Advanced medium-voltage bidirectional dc-dc conversion systems for future electric energy delivery and management systems

NASA Astrophysics Data System (ADS)

Fan, Haifeng

2011-12-01

The distributed renewable energy generation and utilization are constantly growing, and are expected to be integrated with the conventional grid. The growing pressure for innovative solutions will demand power electronics to take an even larger role in future electric energy delivery and management systems, since power electronics are required for the conversion and control of electric energy by most dispersed generation systems Furthermore, power electronics systems can provide additional intelligent energy management, grid stability and power quality capabilities. Medium-voltage isolated dc-dc converter will become one of the key interfaces for grid components with moderate power ratings. To address the demand of medium voltage (MV) and high power capability for future electric energy delivery and management systems, the power electronics community and industry have been reacting in two different ways: developing semiconductor technology or directly connecting devices in series/parallel to reach higher nominal voltages and currents while maintaining conventional converter topologies; and by developing new converter topologies with traditional semiconductor technology, known as multilevel converters or modular converters. The modular approach uses the well-known, mature, and cheaper power semiconductor devices by adopting new converter topologies. The main advantages of the modular approach include: significant improvement in reliability by introducing desired level of redundancy; standardization of components leading to reduction in manufacturing cost and time; power systems can be easily reconfigured to support varying input-output specifications; and possibly higher efficiency and power density of the overall system. Input-series output-parallel (ISOP) modular configuration is a good choice to realize MV to low voltage (LV) conversion for utility application. However, challenges still remain. First of all, for the high-frequency MV utility application, the low switching loss and conduction loss are must-haves for high efficiency, while bidirectional power flow capability is a must for power management requirement. To address the demand, the phase-shift dual-halfbridge (DHB) is proposed as the constituent module of ISOP configuration for MV application. The proposed ISOP DHB converter employs zero-voltage-switching (ZVS) technique combined with LV MOSFETs to achieve low switching and conduction losses under high frequency operation, and therefore high efficiency and high power density, and bidirectional power flow as well. Secondly, a large load range of high efficiency is desired rather than only a specific load point due to the continuous operation and large load variation range of utility application, which is of high importance because of the rising energy cost. This work proposes a novel DHB converter with an adaptive commutation inductor. By utilizing an adaptive inductor as the main energy transfer element, the output power can be controlled by not only the phase shift but also the commutation inductance, which allows the circulating energy to be optimized for different load conditions to maintain ZVS under light load conditions and minimize additional conduction losses under heavy load conditions as well. As a result, the efficiency at both light and heavy load can be significantly improved compared with the conventional DHB converter, and therefore extended high-efficiency range can be achieved. In addition, current stress of switch devices can be reduced. The theoretical analysis is presented and validated by the experimental results on a 50 kHz, 1 kW dc-dc converter module. Thirdly, input-voltage sharing and output-current sharing are critical to assure the advantages of the ISOP modular configuration. To solve this issue, an identically distributed control scheme is proposed in this work. The proposed control scheme, using only one distributed voltage loop to realize both input-voltage and output-current sharing, provides plug-and-play capability, possible high-level fault tolerance, and easy implementation. Another unique advantage of the proposed ISOP DHB converter is the power rating can be easily extended further by directly connecting multiple ISOP DHB converters in input-parallel-outparallel (IPOP) while no additional control is needed. The proposed control scheme is elaborated using the large-signal average model. Further, the stability of the control schemes is analyzed in terms of the constituent modules' topology as well as the configuration, and then an important fact that the stability of control scheme depends on not only the configuration but also the constituent module topology is first revealed in this work. Finally, the simulation and experimental results of an ISOP DHB converter consisting of three modules are presented to verify the proposed control scheme and the high frequency high efficiency operation.

Enhanced High Performance Power Compensation Methodology by IPFC Using PIGBT-IDVR

PubMed Central

Arumugom, Subramanian; Rajaram, Marimuthu

2015-01-01

Currently, power systems are involuntarily controlled without high speed control and are frequently initiated, therefore resulting in a slow process when compared with static electronic devices. Among various power interruptions in power supply systems, voltage dips play a central role in causing disruption. The dynamic voltage restorer (DVR) is a process based on voltage control that compensates for line transients in the distributed system. To overcome these issues and to achieve a higher speed, a new methodology called the Parallel IGBT-Based Interline Dynamic Voltage Restorer (PIGBT-IDVR) method has been proposed, which mainly spotlights the dynamic processing of energy reloads in common dc-linked energy storage with less adaptive transition. The interline power flow controller (IPFC) scheme has been employed to manage the power transmission between the lines and the restorer method for controlling the reactive power in the individual lines. By employing the proposed methodology, the failure of a distributed system has been avoided and provides better performance than the existing methodologies. PMID:26613101

Electric-optic resonant phase modulator

NASA Technical Reports Server (NTRS)

Chen, Chien-Chung (Inventor); Robinson, Deborah L. (Inventor); Hemmati, Hamid (Inventor)

1994-01-01

An electro-optic resonant cavity is used to achieve phase modulation with lower driving voltages. Laser damage thresholds are inherently higher than with previously used integrated optics due to the utilization of bulk optics. Phase modulation is achieved at higher speeds with lower driving voltages than previously obtained with non-resonant electro-optic phase modulators. The instant scheme uses a data locking dither approach as opposed to the conventional sinusoidal locking schemes. In accordance with a disclosed embodiment, a resonant cavity modulator has been designed to operate at a data rate in excess of 100 Mbps. By carefully choosing the cavity finesse and its dimension, it is possible to control the pulse switching time to within 4 ns and to limit the required switching voltage to within 10 V. Experimentally, the resonant cavity can be maintained on resonance with respect to the input laser signal by monitoring the fluctuation of output intensity as the cavity is switched. This cavity locking scheme can be applied by using only the random data sequence, and without the need of additional dithering of the cavity. Compared to waveguide modulators, the resonant cavity has a comparable modulating voltage requirement. Because of its bulk geometry, resonant cavity modulator has the potential of accommodating higher throughput power. Furthermore, mode matching into a bulk device is easier and typically can be achieved with higher efficiency. On the other hand, unlike waveguide modulators which are essentially traveling wave devices, the resonant cavity modulator requires that the cavity be maintained in resonance with respect to the incoming laser signal. An additional control loop is incorporated into the modulator to maintain the cavity on resonance.

Voltage Drop Compensation Method for Active Matrix Organic Light Emitting Diode Displays

NASA Astrophysics Data System (ADS)

Choi, Sang-moo; Ryu, Do-hyung; Kim, Keum-nam; Choi, Jae-beom; Kim, Byung-hee; Berkeley, Brian

2011-03-01

In this paper, the conventional voltage drop compensation methods are reviewed and the novel design and driving scheme, the advanced power de-coupled (aPDC) driving method, is proposed to effectively compensate the voltage IR drop of active matrix light emitting diode (AMOLED) displays. The advanced PDC driving scheme can be applied to general AMOLED pixel circuits that have been developed with only minor modification or without requiring modification in pixel circuit. A 14-in. AMOLED panel with the aPDC driving scheme was fabricated. Long range uniformity (LRU) of the 14-in. AMOLED panel was improved from 43% without the aPDC driving scheme, to over 87% at the same brightness by using the scheme and the layout complexity of the panel with new design scheme is less than that of the panel with the conventional design scheme.

Performance Evaluation of UPQC under Nonlinear Unbalanced Load Conditions Using Synchronous Reference Frame Based Control

NASA Astrophysics Data System (ADS)

Kota, Venkata Reddy; Vinnakoti, Sudheer

2017-12-01

Today, maintaining Power Quality (PQ) is very important in the growing competent world. With new equipments and devices, new challenges are also being put before power system operators. Unified Power Quality Conditioner (UPQC) is proposed to mitigate many power quality problems and to improve the performance of the power system. In this paper, an UPQC with Fuzzy Logic controller for capacitor voltage balancing is proposed in Synchronous Reference Frame (SRF) based control with Modified Phased Locked Loop (MPLL). The proposed controller with SRF-MPLL based control is tested under non-linear and unbalanced load conditions. The system is developed in Matlab/Simulink and its performance is analyzed under various conditions like non-linear, unbalanced load and polluted supply voltage including voltage sag/swells. Active and reactive power flow in the system, power factor and %THD of voltages and currents before and after compensation are also analyzed in this work. Results prove the applicability of the proposed scheme for power quality improvement. It is observed that the fuzzy controller gives better performance than PI controller with faster capacitor voltage balancing and also improves the dynamic performance of the system.

Distributed control system for parallel-connected DC boost converters

DOEpatents

Goldsmith, Steven

2017-08-15

The disclosed invention is a distributed control system for operating a DC bus fed by disparate DC power sources that service a known or unknown load. The voltage sources vary in v-i characteristics and have time-varying, maximum supply capacities. Each source is connected to the bus via a boost converter, which may have different dynamic characteristics and power transfer capacities, but are controlled through PWM. The invention tracks the time-varying power sources and apportions their power contribution while maintaining the DC bus voltage within the specifications. A central digital controller solves the steady-state system for the optimal duty cycle settings that achieve a desired power supply apportionment scheme for a known or predictable DC load. A distributed networked control system is derived from the central system that utilizes communications among controllers to compute a shared estimate of the unknown time-varying load through shared bus current measurements and bus voltage measurements.

Study of a control strategy for grid side converter in doubly- fed wind power system

NASA Astrophysics Data System (ADS)

Zhu, D. J.; Tan, Z. L.; Yuan, F.; Wang, Q. Y.; Ding, M.

2016-08-01

The grid side converter is an important part of the excitation system of doubly-fed asynchronous generator used in wind power system. As a three-phase voltage source PWM converter, it can not only transfer slip power in the form of active power, but also adjust the reactive power of the grid. This paper proposed a control approach for improving its performance. In this control approach, the dc voltage is regulated by a sliding mode variable structure control scheme and current by a variable structure controller based on the input output linearization. The theoretical bases of the sliding mode variable structure control were introduced, and the stability proof was presented. Switching function of the system has been deduced, sliding mode voltage controller model has been established, and the output of the outer voltage loop is the instruction of the inner current loop. Affine nonlinear model of two input two output equations on d-q axis for current has been established its meeting conditions of exact linearization were proved. In order to improve the anti-jamming capability of the system, a variable structure control was added in the current controller, the control law was deduced. The dual-loop control with sliding mode control in outer voltage loop and linearization variable structure control in inner current loop was proposed. Simulation results demonstrate the effectiveness of the proposed control strategy even during the dc reference voltage and system load variation.

High-speed low-power voltage-programmed driving scheme for AMOLED displays

NASA Astrophysics Data System (ADS)

Xingheng, Xia; Weijing, Wu; Xiaofeng, Song; Guanming, Li; Lei, Zhou; Lirong, Zhang; Miao, Xu; Lei, Wang; Junbiao, Peng

2015-12-01

A new voltage-programmed driving scheme named the mixed parallel addressing scheme is presented for AMOLED displays, in which one compensation interval can be divided into the first compensation frame and the consequent N -1 post-compensation frames without periods of initialization and threshold voltage detection. The proposed driving scheme has the advantages of both high speed and low driving power due to the mixture of the pipeline technology and the threshold voltage one-time detection technology. Corresponding to the proposed driving scheme, we also propose a new voltage-programmed compensation pixel circuit, which consists of five TFTs and two capacitors (5T2C). In-Zn-O thin-film transistors (IZO TFTs) are used to build the proposed 5T2C pixel circuit. It is shown that the non-uniformity of the proposed pixel circuit is considerably reduced compared with that of the conventional 2T1C pixel circuit. The number of frames (N) preserved in the proposed driving scheme are measured and can be up to 35 with the variation of the OLED current remaining in an acceptable range. Moreover, the proposed voltage-programmed driving scheme can be more valuable for an AMOLED display with high resolution, and may also be applied to other compensation pixel circuits. Project supported by the State Key Development Program for Basic Research of China (No. 2015CB655000) the National Natural Science Foundation of China (Nos. 61204089, 61306099, 61036007, 51173049, U1301243), and the Fundamental Research Funds for the Central Universities (Nos. 2013ZZ0046, 2014ZZ0028).

Self-regulating control of parasitic loads in a fuel cell power system

NASA Technical Reports Server (NTRS)

Vasquez, Arturo (Inventor)

2011-01-01

A fuel cell power system comprises an internal or self-regulating control of a system or device requiring a parasitic load. The internal or self-regulating control utilizes certain components and an interconnection scheme to produce a desirable, variable voltage potential (i.e., power) to a system or device requiring parasitic load in response to varying operating conditions or requirements of an external load that is connected to a primary fuel cell stack of the system. Other embodiments comprise a method of designing such a self-regulated control scheme and a method of operating such a fuel cell power system.

Contribution of concentrator photovoltaic installations to grid stability and power quality

NASA Astrophysics Data System (ADS)

del Toro García, Xavier; Roncero-Sánchez, Pedro; Torres, Alfonso Parreño; Vázquez, Javier

2012-10-01

Large-scale integration of Photovoltaic (PV) generation systems, including Concentrator Photovoltaic (CPV) technologies, will require the contribution and support of these technologies to the management and stability of the grid. New regulations and grid codes for PV installations in countries such as Spain have recently included dynamic voltage control support during faults. The PV installation must stay connected to the grid during voltage dips and inject reactive power in order to enhance the stability of the system. The existing PV inverter technologies based on the Voltage-Source Converter (VSC) are in general well suited to provide advanced grid-support characteristics. Nevertheless, new advanced control schemes and monitoring techniques will be necessary to meet the most demanding requirements.

Energy Systems Integration News | Energy Systems Integration Facility |

Science.gov Websites

Control of Power Electronics in AC Systems and Microgrids. These courses will be part of a Professional Master's Program in Power Electronics offered through the university. Get more information on the program Scheme for the Voltage Control of a DFIG-Based Wind Power Plant, IEEE Transactions on Power Electronics

Design of transient light signal simulator based on FPGA

NASA Astrophysics Data System (ADS)

Kang, Jing; Chen, Rong-li; Wang, Hong

2014-11-01

A design scheme of transient light signal simulator based on Field Programmable gate Array (FPGA) was proposed in this paper. Based on the characteristics of transient light signals and measured feature points of optical intensity signals, a fitted curve was created in MATLAB. And then the wave data was stored in a programmed memory chip AT29C1024 by using SUPERPRO programmer. The control logic was realized inside one EP3C16 FPGA chip. Data readout, data stream cache and a constant current buck regulator for powering high-brightness LEDs were all controlled by FPGA. A 12-Bit multiplying CMOS digital-to-analog converter (DAC) DAC7545 and an amplifier OPA277 were used to convert digital signals to voltage signals. A voltage-controlled current source constituted by a NPN transistor and an operational amplifier controlled LED array diming to achieve simulation of transient light signal. LM3405A, 1A Constant Current Buck Regulator for Powering LEDs, was used to simulate strong background signal in space. Experimental results showed that the scheme as a transient light signal simulator can satisfy the requests of the design stably.

A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme

NASA Astrophysics Data System (ADS)

Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol

2018-02-01

We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.

Improved Control Strategy for Subsynchronous Resonance Mitigation with Fractional-order PI Controller

NASA Astrophysics Data System (ADS)

Raju, D. Koteswara; Umre, Bhimrao S.; Junghare, A. S.; Chitti Babu, B.

2016-12-01

This paper explores a robust Fractional-order PI (FOPI) controller to diminish Subsynchronous Resonance (SSR) using Static Synchronous series compensator (SSSC). The diminution of SSR is accomplished by increasing the network damping with the injection of voltage of subsynchronous component into the line at those frequencies which are proximate to the torsional mode frequency of the turbine-generator shaft. The voltage of subsynchronous frequency component is extracted from the transmission line and further the similar quantity of series voltage is injected by SSSC into the line to make the current of subsynchronous frequency component to zero which is the major source of oscillations in the turbine-generator shaft. The insertion and fine tuning of Fractional-order PI controller in the control scheme of SSSC the subsynchronous oscillations are reduced to 4 % as compared to conventional PI controller. The studied system is modelled and simulated using MATLAB-Simulink and the results are analysed to show the precision and robustness of the proposed control strategy.

Soft switching resonant converter with duty-cycle control in DC micro-grid system

NASA Astrophysics Data System (ADS)

Lin, Bor-Ren

2018-01-01

Resonant converter has been widely used for the benefits of low switching losses and high circuit efficiency. However, the wide frequency variation is the main drawback of resonant converter. This paper studies a new modular resonant converter with duty-cycle control to overcome this problem and realise the advantages of low switching losses, no reverse recovery current loss, balance input split voltages and constant frequency operation for medium voltage direct currentgrid or system network. Series full-bridge (FB) converters are used in the studied circuit in order to reduce the voltage stresses and power rating on power semiconductors. Flying capacitor is used between two FB converters to balance input split voltages. Two circuit modules are paralleled on the secondary side to lessen the current rating of rectifier diodes and the size of magnetic components. The resonant tank is operated at inductive load circuit to help power switches to be turned on at zero voltage with wide load range. The pulse-width modulation scheme is used to regulate output voltage. Experimental verifications are provided to show the performance of the proposed circuit.

Control of a lithium-ion battery storage system for microgrid applications

NASA Astrophysics Data System (ADS)

Pegueroles-Queralt, Jordi; Bianchi, Fernando D.; Gomis-Bellmunt, Oriol

2014-12-01

The operation of future microgrids will require the use of energy storage systems employing power electronics converters with advanced power management capacities. This paper presents the control scheme for a medium power lithium-ion battery bidirectional DC/AC power converter intended for microgrid applications. The switching devices of a bidirectional DC converter are commanded by a single sliding mode control law, dynamically shaped by a linear voltage regulator in accordance with the battery management system. The sliding mode controller facilitates the implementation and design of the control law and simplifies the stability analysis over the entire operating range. Control parameters of the linear regulator are designed to minimize the impact of commutation noise in the DC-link voltage regulation. The effectiveness of the proposed control strategy is illustrated by experimental results.

Modeling of power control schemes in induction cooking devices

NASA Astrophysics Data System (ADS)

Beato, Alessio; Conti, Massimo; Turchetti, Claudio; Orcioni, Simone

2005-06-01

In recent years, with remarkable advancements of power semiconductor devices and electronic control systems, it becomes possible to apply the induction heating technique for domestic use. In order to achieve the supply power required by these devices, high-frequency resonant inverters are used: the force commutated, half-bridge series resonant converter is well suited for induction cooking since it offers an appropriate balance between complexity and performances. Power control is a key issue to attain efficient and reliable products. This paper describes and compares four power control schemes applied to the half-bridge series resonant inverter. The pulse frequency modulation is the most common control scheme: according to this strategy, the output power is regulated by varying the switching frequency of the inverter circuit. Other considered methods, originally developed for induction heating industrial applications, are: pulse amplitude modulation, asymmetrical duty cycle and pulse density modulation which are respectively based on variation of the amplitude of the input supply voltage, on variation of the duty cycle of the switching signals and on variation of the number of switching pulses. Each description is provided with a detailed mathematical analysis; an analytical model, built to simulate the circuit topology, is implemented in the Matlab environment in order to obtain the steady-state values and waveforms of currents and voltages. For purposes of this study, switches and all reactive components are modelled as ideal and the "heating-coil/pan" system is represented by an equivalent circuit made up of a series connected resistance and inductance.

Examining System-Wide Impacts of Solar PV Control Systems with a Power Hardware-in-the-Loop Platform

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Tess L.; Fuller, Jason C.; Schneider, Kevin P.

2014-10-11

High penetration levels of distributed solar PV power generation can lead to adverse power quality impacts such as excessive voltage rise, voltage flicker, and reactive power values that result in unacceptable voltage levels. Advanced inverter control schemes have been proposed that have the potential to mitigate many power quality concerns. However, closed-loop control may lead to unintended behavior in deployed systems as complex interactions can occur between numerous operating devices. In order to enable the study of the performance of advanced control schemes in a detailed distribution system environment, a Hardware-in-the-Loop (HIL) platform has been developed. In the HIL system,more » GridLAB-D, a distribution system simulation tool, runs in real-time mode at the Pacific Northwest National Laboratory (PNNL) and supplies power system parameters at a point of common coupling to hardware located at the National Renewable Energy Laboratory (NREL). Hardware inverters interact with grid and PV simulators emulating an operational distribution system and power output from the inverters is measured and sent to PNNL to update the real-time distribution system simulation. The platform is described and initial test cases are presented. The platform is used to study the system-wide impacts and the interactions of controls applied to inverters that are integrated into a simulation of the IEEE 8500-node test feeder, with inverters in either constant power factor control or active volt/VAR control. We demonstrate that this HIL platform is well-suited to the study of advanced inverter controls and their impacts on the power quality of a distribution feeder. Additionally, the results from HIL are used to validate GridLAB-D simulations of advanced inverter controls.« less

Energy and Quality-Aware Multimedia Signal Processing

NASA Astrophysics Data System (ADS)

Emre, Yunus

Today's mobile devices have to support computation-intensive multimedia applications with a limited energy budget. In this dissertation, we present architecture level and algorithm-level techniques that reduce energy consumption of these devices with minimal impact on system quality. First, we present novel techniques to mitigate the effects of SRAM memory failures in JPEG2000 implementations operating in scaled voltages. We investigate error control coding schemes and propose an unequal error protection scheme tailored for JPEG2000 that reduces overhead without affecting the performance. Furthermore, we propose algorithm-specific techniques for error compensation that exploit the fact that in JPEG2000 the discrete wavelet transform outputs have larger values for low frequency subband coefficients and smaller values for high frequency subband coefficients. Next, we present use of voltage overscaling to reduce the data-path power consumption of JPEG codecs. We propose an algorithm-specific technique which exploits the characteristics of the quantized coefficients after zig-zag scan to mitigate errors introduced by aggressive voltage scaling. Third, we investigate the effect of reducing dynamic range for datapath energy reduction. We analyze the effect of truncation error and propose a scheme that estimates the mean value of the truncation error during the pre-computation stage and compensates for this error. Such a scheme is very effective for reducing the noise power in applications that are dominated by additions and multiplications such as FIR filter and transform computation. We also present a novel sum of absolute difference (SAD) scheme that is based on most significant bit truncation. The proposed scheme exploits the fact that most of the absolute difference (AD) calculations result in small values, and most of the large AD values do not contribute to the SAD values of the blocks that are selected. Such a scheme is highly effective in reducing the energy consumption of motion estimation and intra-prediction kernels in video codecs. Finally, we present several hybrid energy-saving techniques based on combination of voltage scaling, computation reduction and dynamic range reduction that further reduce the energy consumption while keeping the performance degradation very low. For instance, a combination of computation reduction and dynamic range reduction for Discrete Cosine Transform shows on average, 33% to 46% reduction in energy consumption while incurring only 0.5dB to 1.5dB loss in PSNR.

Adaptive Control for Buck Power Converter Using Fixed Point Inducting Control and Zero Average Dynamics Strategies

NASA Astrophysics Data System (ADS)

Hoyos Velasco, Fredy Edimer; García, Nicolás Toro; Garcés Gómez, Yeison Alberto

In this paper, the output voltage of a buck power converter is controlled by means of a quasi-sliding scheme. The Fixed Point Inducting Control (FPIC) technique is used for the control design, based on the Zero Average Dynamics (ZAD) strategy, including load estimation by means of the Least Mean Squares (LMS) method. The control scheme is tested in a Rapid Control Prototyping (RCP) system based on Digital Signal Processing (DSP) for dSPACE platform. The closed loop system shows adequate performance. The experimental and simulation results match. The main contribution of this paper is to introduce the load estimator by means of LMS, to make ZAD and FPIC control feasible in load variation conditions. In addition, comparison results for controlled buck converter with SMC, PID and ZAD-FPIC control techniques are shown.

Development of longitudinally excited CO2 laser

NASA Astrophysics Data System (ADS)

Masroon, N. S.; Tanaka, M.; Tei, M.; Uno, K.; Tsuyama, M.; Nakano, H.

2018-05-01

Simple, compact, and affordable discharged-pumped CO2 laser controlled by a fast high voltage solid state switch has been developed. In this study, longitudinal excitation scheme has been adapted for simple configuration. In the longitudinal excitation scheme, the discharge is produced along the direction of the laser axis, and the electrodes are well separated with a small discharge cross-section. Triggered spark gap switch is usually used to switch out the high voltage because of simple and low cost. However, the triggered spark gap operates in the arc mode and suffer from recovery problem causing a short life time and low efficiency for high repetition rate operation. As a result, there is now considerable interest in replacing triggered spark gap switch with solid state switches. Solid state switches have significant advantages compared to triggered spark gap switch which include longer service lifetime, low cost and stable high trigger pulse. We have developed simple and low cost fast high voltage solid state switch that consists of series connected-MOSFETs. It has been installed to the longitudinally excited CO2 laser to realize the gap switch less operation. Characteristics of laser oscillation by varying the discharge length, charging voltage, capacitance and gas pressure have been evaluated. Longer discharge length produce high power of laser oscillation. Optimum charging voltage and gas pressure were existed for longitudinally excited CO2 laser.

Analysis, control and design of a non-inverting buck-boost converter: A bump-less two-level T-S fuzzy PI control.

PubMed

Almasi, Omid Naghash; Fereshtehpoor, Vahid; Khooban, Mohammad Hassan; Blaabjerg, Frede

2017-03-01

In this paper, a new modified fuzzy Two-Level Control Scheme (TLCS) is proposed to control a non-inverting buck-boost converter. Each level of fuzzy TLCS consists of a tuned fuzzy PI controller. In addition, a Takagi-Sugeno-Kang (TSK) fuzzy switch proposed to transfer the fuzzy PI controllers to each other in the control system. The major difficulty in designing fuzzy TLCS which degrades its performance is emerging unwanted drastic oscillations in the converter output voltage during replacing the controllers. Thereby, the fuzzy PI controllers in each level of TLCS structure are modified to eliminate these oscillations and improve the system performance. Some simulations and digital signal processor based experiments are conducted on a non-inverting buck-boost converter to support the effectiveness of the proposed TLCS in controlling the converter output voltage. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Examining System-Wide Impacts of Solar PV Control Systems with a Power Hardware-in-the-Loop Platform

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Tess L.; Fuller, Jason C.; Schneider, Kevin P.

2014-06-08

High penetration levels of distributed solar PV power generation can lead to adverse power quality impacts, such as excessive voltage rise, voltage flicker, and reactive power values that result in unacceptable voltage levels. Advanced inverter control schemes have been developed that have the potential to mitigate many power quality concerns. However, local closed-loop control may lead to unintended behavior in deployed systems as complex interactions can occur between numerous operating devices. To enable the study of the performance of advanced control schemes in a detailed distribution system environment, a test platform has been developed that integrates Power Hardware-in-the-Loop (PHIL) withmore » concurrent time-series electric distribution system simulation. In the test platform, GridLAB-D, a distribution system simulation tool, runs a detailed simulation of a distribution feeder in real-time mode at the Pacific Northwest National Laboratory (PNNL) and supplies power system parameters at a point of common coupling. At the National Renewable Energy Laboratory (NREL), a hardware inverter interacts with grid and PV simulators emulating an operational distribution system. Power output from the inverters is measured and sent to PNNL to update the real-time distribution system simulation. The platform is described and initial test cases are presented. The platform is used to study the system-wide impacts and the interactions of inverter control modes—constant power factor and active Volt/VAr control—when integrated into a simulated IEEE 8500-node test feeder. We demonstrate that this platform is well-suited to the study of advanced inverter controls and their impacts on the power quality of a distribution feeder. Additionally, results are used to validate GridLAB-D simulations of advanced inverter controls.« less

[Invert transformer design for high frequency X-ray machine based on PWM controller SG 3525].

PubMed

Yu, Xue-fei; Li, Zhe

2005-07-01

This paper introduces the principle of invert transformer of high frequency X-ray machine, and analyzes its main constitution. Meanwhile, a scheme based on SG3525 for closed loop voltage regulation is given. The experimental result testifies its efficiency and utility.

Inverter for Interchangeable Use as Current Source Inverter and Voltage Source Inverter for Interconnecting to Grid

NASA Astrophysics Data System (ADS)

Teruya, Daisuke; Masukawa, Shigeo; Iida, Shoji

We propose a novel inverter that can be operated either as a Current Source Inverter (CSI) or as a Voltage Source Inverter (VSI) by changing only the control signals. It is proper to apply it to the interconnecting system with renewal energy, such as photovoltaic cells or wind generation systems, to a grid. This inverter is usually operated as the CSI connected to the grid. Even if the energy source has a lower voltage than the grid, the energy can be supplied to the grid through the proposed inverter. The power factor can be briefly maintained at almost unity. When power supply from the grid is interrupted, the proposed circuit should be operated as the VSI in the stand-alone operation mode. In this way, the circuit can maintain a constant output voltage to the loads. In this paper, the proposed circuit configuration and the control schemes for both the CSI and the VSI are described. Further, the circuit characteristics for both are discussed experimentally.

Compensation of PVT Variations in ToF Imagers with In-Pixel TDC

PubMed Central

Vornicu, Ion; Carmona-Galán, Ricardo; Rodríguez-Vázquez, Ángel

2017-01-01

The design of a direct time-of-flight complementary metal-oxide-semiconductor (CMOS) image sensor (dToF-CIS) based on a single-photon avalanche-diode (SPAD) array with an in-pixel time-to-digital converter (TDC) must contemplate system-level aspects that affect its overall performance. This paper provides a detailed analysis of the impact of process parameters, voltage supply, and temperature (PVT) variations on the time bin of the TDC array. Moreover, the design and characterization of a global compensation loop is presented. It is based on a phase locked loop (PLL) that is integrated on-chip. The main building block of the PLL is a voltage-controlled ring-oscillator (VCRO) that is identical to the ones employed for the in-pixel TDCs. The reference voltage that drives the master VCRO is distributed to the voltage control inputs of the slave VCROs such that their multiphase outputs become invariant to PVT changes. These outputs act as time interpolators for the TDCs. Therefore the compensation scheme prevents the time bin of the TDCs from drifting over time due to the aforementioned factors. Moreover, the same scheme is used to program different time resolutions of the direct time-of-flight (ToF) imager aimed at 3D ranging or depth map imaging. Experimental results that validate the analysis are provided as well. The compensation loop proves to be remarkably effective. The spreading of the TDCs time bin is lowered from: (i) 20% down to 2.4% while the temperature ranges from 0 °C to 100 °C; (ii) 27% down to 0.27%, when the voltage supply changes within ±10% of the nominal value; (iii) 5.2 ps to 2 ps standard deviation over 30 sample chips, due to process parameters’ variation. PMID:28486405

Compensation of PVT Variations in ToF Imagers with In-Pixel TDC.

PubMed

Vornicu, Ion; Carmona-Galán, Ricardo; Rodríguez-Vázquez, Ángel

2017-05-09

The design of a direct time-of-flight complementary metal-oxide-semiconductor (CMOS) image sensor (dToF-CIS) based on a single-photon avalanche-diode (SPAD) array with an in-pixel time-to-digital converter (TDC) must contemplate system-level aspects that affect its overall performance. This paper provides a detailed analysis of the impact of process parameters, voltage supply, and temperature (PVT) variations on the time bin of the TDC array. Moreover, the design and characterization of a global compensation loop is presented. It is based on a phase locked loop (PLL) that is integrated on-chip. The main building block of the PLL is a voltage-controlled ring-oscillator (VCRO) that is identical to the ones employed for the in-pixel TDCs. The reference voltage that drives the master VCRO is distributed to the voltage control inputs of the slave VCROs such that their multiphase outputs become invariant to PVT changes. These outputs act as time interpolators for the TDCs. Therefore the compensation scheme prevents the time bin of the TDCs from drifting over time due to the aforementioned factors. Moreover, the same scheme is used to program different time resolutions of the direct time-of-flight (ToF) imager aimed at 3D ranging or depth map imaging. Experimental results that validate the analysis are provided as well. The compensation loop proves to be remarkably effective. The spreading of the TDCs time bin is lowered from: (i) 20% down to 2.4% while the temperature ranges from 0 °C to 100 °C; (ii) 27% down to 0.27%, when the voltage supply changes within ±10% of the nominal value; (iii) 5.2 ps to 2 ps standard deviation over 30 sample chips, due to process parameters' variation.

High-frequency ac power distribution in Space Station

NASA Technical Reports Server (NTRS)

Tsai, Fu-Sheng; Lee, Fred C. Y.

1990-01-01

A utility-type 20-kHz ac power distribution system for the Space Station, employing resonant power-conversion techniques, is presented. The system converts raw dc voltage from photovoltaic cells or three-phase LF ac voltage from a solar dynamic generator into a regulated 20-kHz ac voltage for distribution among various loads. The results of EASY5 computer simulations of the local and global performance show that the system has fast response and good transient behavior. The ac bus voltage is effectively regulated using the phase-control scheme, which is demonstrated with both line and load variations. The feasibility of paralleling the driver-module outputs is illustrated with the driver modules synchronized and sharing a common feedback loop. An HF sinusoidal ac voltage is generated in the three-phase ac input case, when the driver modules are phased 120 deg away from one another and their outputs are connected in series.

Power supply system for negative ion source at IPR

NASA Astrophysics Data System (ADS)

Gahlaut, Agrajit; Sonara, Jashwant; Parmar, K. G.; Soni, Jignesh; Bandyopadhyay, M.; Singh, Mahendrajit; Bansal, Gourab; Pandya, Kaushal; Chakraborty, Arun

2010-02-01

The first step in the Indian program on negative ion beams is the setting up of Negative ion Experimental Assembly - RF based, where 100 kW of RF power shall be coupled to a plasma source producing plasma of density ~5 × 1012 cm-3, from which ~ 10 A of negative ion beam shall be produced and accelerated to 35 kV, through an electrostatic ion accelerator. The experimental system is modelled similar to the RF based negative ion source, BATMAN presently operating at IPP, Garching, Germany. The mechanical system for Negative Ion Source Assembly is close to the IPP source, remaining systems are designed and procured principally from indigenous sources, keeping the IPP configuration as a base line. High voltage (HV) and low voltage (LV) power supplies are two key constituents of the experimental setup. The HV power supplies for extraction and acceleration are rated for high voltage (~15 to 35kV), and high current (~ 15 to 35A). Other attributes are, fast rate of voltage rise (< 5ms), good regulation (< ±1%), low ripple (< ±2%), isolation (~50kV), low energy content (< 10J) and fast cut-off (< 100μs). The low voltage (LV) supplies required for biasing and providing heating power to the Cesium oven and the plasma grids; have attributes of low ripple, high stability, fast and precise regulation, programmability and remote operation. These power supplies are also equipped with over-voltage, over-current and current limit (CC Mode) protections. Fault diagnostics, to distinguish abnormal rise in currents (breakdown faults) with over-currents is enabled using fast response breakdown and over-current protection scheme. To restrict the fault energy deposited on the ion source, specially designed snubbers are implemented in each (extraction and acceleration) high voltage path to swap the surge energy. Moreover, the monitoring status and control signals from these power supplies are required to be electrically (~ 50kV) isolated from the system. The paper shall present the design basis, topology selection, manufacturing, testing, commissioning, integration and control strategy of these HVPS. A complete power interconnection scheme, which includes all protective devices and measuring devices, low & high voltage power supplies, monitoring and control signals etc. shall also be discussed. The paper also discusses the protocols involved in grounding and shielding, particularly in operating the system in RF environment.

Force analysis of magnetic bearings with power-saving controls

NASA Technical Reports Server (NTRS)

Johnson, Dexter; Brown, Gerald V.; Inman, Daniel J.

1992-01-01

Most magnetic bearing control schemes use a bias current with a superimposed control current to linearize the relationship between the control current and the force it delivers. For most operating conditions, the existence of the bias current requires more power than alternative methods that do not use conventional bias. Two such methods are examined which diminish or eliminate bias current. In the typical bias control scheme it is found that for a harmonic control force command into a voltage limited transconductance amplifier, the desired force output is obtained only up to certain combinations of force amplitude and frequency. Above these values, the force amplitude is reduced and a phase lag occurs. The power saving alternative control schemes typically exhibit such deficiencies at even lower command frequencies and amplitudes. To assess the severity of these effects, a time history analysis of the force output is performed for the bias method and the alternative methods. Results of the analysis show that the alternative approaches may be viable. The various control methods examined were mathematically modeled using nondimensionalized variables to facilitate comparison of the various methods.

Electromechanical Displacement Detection With an On-Chip High Electron Mobility Transistor Amplifier

NASA Astrophysics Data System (ADS)

Oda, Yasuhiko; Onomitsu, Koji; Kometani, Reo; Warisawa, Shin-ichi; Ishihara, Sunao; Yamaguchi, Hiroshi

2011-06-01

We developed a highly sensitive displacement detection scheme for a GaAs-based electromechanical resonator using an integrated high electron mobility transistor (HEMT). Piezoelectric voltage generated by the vibration of the resonator is applied to the gate of the HEMT, resulting in the on-chip amplification of the signal voltage. This detection scheme achieves a displacement sensitivity of ˜9 pm·Hz-1/2, which is one of the highest among on-chip purely electrical displacement detection schemes at room temperature.

An LMS Programming Scheme and Floating-Gate Technology Enabled Trimmer-Less and Low Voltage Flame Detection Sensor.

PubMed

Iglesias-Rojas, Juan Carlos; Gomez-Castañeda, Felipe; Moreno-Cadenas, Jose Antonio

2017-06-14

In this paper, a Least Mean Square (LMS) programming scheme is used to set the offset voltage of two operational amplifiers that were built using floating-gate transistors, enabling a 0.95 V RMS trimmer-less flame detection sensor. The programming scheme is capable of setting the offset voltage over a wide range of values by means of electron injection. The flame detection sensor consists of two programmable offset operational amplifiers; the first amplifier serves as a 26 μV offset voltage follower, whereas the second amplifier acts as a programmable trimmer-less voltage comparator. Both amplifiers form the proposed sensor, whose principle of functionality is based on the detection of the electrical changes produced by the flame ionization. The experimental results show that it is possible to measure the presence of a flame accurately after programming the amplifiers with a maximum of 35 LMS-algorithm iterations. Current commercial flame detectors are mainly used in absorption refrigerators and large industrial gas heaters, where a high voltage AC source and several mechanical trimmings are used in order to accurately measure the presence of the flame.

An LMS Programming Scheme and Floating-Gate Technology Enabled Trimmer-Less and Low Voltage Flame Detection Sensor

PubMed Central

Iglesias-Rojas, Juan Carlos; Gomez-Castañeda, Felipe; Moreno-Cadenas, Jose Antonio

2017-01-01

In this paper, a Least Mean Square (LMS) programming scheme is used to set the offset voltage of two operational amplifiers that were built using floating-gate transistors, enabling a 0.95 VRMS trimmer-less flame detection sensor. The programming scheme is capable of setting the offset voltage over a wide range of values by means of electron injection. The flame detection sensor consists of two programmable offset operational amplifiers; the first amplifier serves as a 26 μV offset voltage follower, whereas the second amplifier acts as a programmable trimmer-less voltage comparator. Both amplifiers form the proposed sensor, whose principle of functionality is based on the detection of the electrical changes produced by the flame ionization. The experimental results show that it is possible to measure the presence of a flame accurately after programming the amplifiers with a maximum of 35 LMS-algorithm iterations. Current commercial flame detectors are mainly used in absorption refrigerators and large industrial gas heaters, where a high voltage AC source and several mechanical trimmings are used in order to accurately measure the presence of the flame. PMID:28613250

Single Active Switch PV Inverter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramanan, V. R.; Pan, Zhiguo

This report presents a new PV inverter topology that uses only one active switch instead of 7 active switches in a conventional PV inverter. It has a buck boost converter and operates at discontinuous current control mode, which can reduce the output stage from an active switch bridge to a thyristor bridge. This concept, if successfully demonstrated, may have great cost and size/weight benefits over conventional solutions. Since the proposed topology is completely different from the traditional boost converter plus voltage source inverter approach, there is no existing control/modulation scheme available. A new modulation scheme for both the main switchmore » and the thyristors has been developed. An active clamping circuit has also been proposed to reduce switching losses and voltage spike during the switching transient. A simulation model has been set up to validate the control algorithm and clamping circuit. Simulated results show that a proposed 10 kW PV inverter can reach 5% total harmonic distortion (THD), 98.8% peak efficiency with only one main active switch, and an inductor weighing less than 3 kg. Based on that, a 10 kW prototype converter has been designed and built.« less

Synchronous inversion and charge extraction (SICE): a hybrid switching interface for efficient vibrational energy harvesting

NASA Astrophysics Data System (ADS)

Lallart, Mickaël; Wu, Wen-Jong; Hsieh, Yuchieh; Yan, Linjuan

2017-11-01

This paper aims at proposing an electrical interface taking advantage of nonlinear treatment for both significantly increasing the voltage of a piezoelectric device and extracting the corresponding electrostatic energy in an independent way from the connected electrical load. The principles of the proposed system lies in quickly inverting the piezoelectric voltage on each extremum (synchronized switch on inductor operations) for a given number of extremum occurrences, and then extracting the total electrostatic energy available on the piezoelectric element through the so-called synchronous electric charge extraction (SECE) for energy harvesting purpose. Compared to classical SECE approach, which consists in extracting the energy on each voltage extremum occurrence, the proposed scheme shows a significant improvement in low-coupled systems thanks to a fine control of the trade-off between voltage amplification and number of extraction events.

Sensorless optimal sinusoidal brushless direct current for hard disk drives

NASA Astrophysics Data System (ADS)

Soh, C. S.; Bi, C.

2009-04-01

Initiated by the availability of digital signal processors and emergence of new applications, market demands for permanent magnet synchronous motors have been surging. As its back-emf is sinusoidal, the drive current should also be sinusoidal for reducing the torque ripple. However, in applications like hard disk drives, brushless direct current (BLDC) drive is adopted instead of sinusoidal drive for simplification. The adoption, however, comes at the expense of increased harmonics, losses, torque pulsations, and acoustics. In this paper, we propose a sensorless optimal sinusoidal BLDC drive. First and foremost, the derivation for an optimal sinusoidal drive is presented, and a power angle control scheme is proposed to achieve an optimal sinusoidal BLDC. The scheme maintains linear relationship between the motor speed and drive voltage. In an attempt to execute the sensorless drive, an innovative power angle measurement scheme is devised, which takes advantage of the freewheeling diodes and measures the power angle through the detection of diode voltage drops. The objectives as laid out will be presented and discussed in this paper, supported by derivations, simulations, and experimental results. The proposed scheme is straightforward, brings about the benefits of sensorless sinusoidal drive, negates the need for current sensors by utilizing the freewheeling diodes, and does not incur additional cost.

Power Management Based Current Control Technique for Photovoltaic-Battery Assisted Wind-Hydro Hybrid System

NASA Astrophysics Data System (ADS)

Ram Prabhakar, J.; Ragavan, K.

2013-07-01

This article proposes new power management based current control strategy for integrated wind-solar-hydro system equipped with battery storage mechanism. In this control technique, an indirect estimation of load current is done, through energy balance model, DC-link voltage control and droop control. This system features simpler energy management strategy and necessitates few power electronic converters, thereby minimizing the cost of the system. The generation-demand (G-D) management diagram is formulated based on the stochastic weather conditions and demand, which would likely moderate the gap between both. The features of management strategy deploying energy balance model include (1) regulating DC-link voltage within specified tolerances, (2) isolated operation without relying on external electric power transmission network, (3) indirect current control of hydro turbine driven induction generator and (4) seamless transition between grid-connected and off-grid operation modes. Furthermore, structuring of the hybrid system with appropriate selection of control variables enables power sharing among each energy conversion systems and battery storage mechanism. By addressing these intricacies, it is viable to regulate the frequency and voltage of the remote network at load end. The performance of the proposed composite scheme is demonstrated through time-domain simulation in MATLAB/Simulink environment.

Energy Management of Smart Distribution Systems

NASA Astrophysics Data System (ADS)

Ansari, Bananeh

Electric power distribution systems interface the end-users of electricity with the power grid. Traditional distribution systems are operated in a centralized fashion with the distribution system owner or operator being the only decision maker. The management and control architecture of distribution systems needs to gradually transform to accommodate the emerging smart grid technologies, distributed energy resources, and active electricity end-users or prosumers. The content of this document concerns with developing multi-task multi-objective energy management schemes for: 1) commercial/large residential prosumers, and 2) distribution system operator of a smart distribution system. The first part of this document describes a method of distributed energy management of multiple commercial/ large residential prosumers. These prosumers not only consume electricity, but also generate electricity using their roof-top solar photovoltaics systems. When photovoltaics generation is larger than local consumption, excess electricity will be fed into the distribution system, creating a voltage rise along the feeder. Distribution system operator cannot tolerate a significant voltage rise. ES can help the prosumers manage their electricity exchanges with the distribution system such that minimal voltage fluctuation occurs. The proposed distributed energy management scheme sizes and schedules each prosumer's ES to reduce the electricity bill and mitigate voltage rise along the feeder. The second part of this document focuses on emergency energy management and resilience assessment of a distribution system. The developed emergency energy management system uses available resources and redundancy to restore the distribution system's functionality fully or partially. The success of the restoration maneuver depends on how resilient the distribution system is. Engineering resilience terminology is used to evaluate the resilience of distribution system. The proposed emergency energy management scheme together with resilience assessment increases the distribution system operator's preparedness for emergency events.

Speed Sensorless Induction Motor Drives for Electrical Actuators: Schemes, Trends and Tradeoffs

NASA Technical Reports Server (NTRS)

Elbuluk, Malik E.; Kankam, M. David

1997-01-01

For a decade, induction motor drive-based electrical actuators have been under investigation as potential replacement for the conventional hydraulic and pneumatic actuators in aircraft. Advantages of electric actuator include lower weight and size, reduced maintenance and operating costs, improved safety due to the elimination of hazardous fluids and high pressure hydraulic and pneumatic actuators, and increased efficiency. Recently, the emphasis of research on induction motor drives has been on sensorless vector control which eliminates flux and speed sensors mounted on the motor. Also, the development of effective speed and flux estimators has allowed good rotor flux-oriented (RFO) performance at all speeds except those close to zero. Sensorless control has improved the motor performance, compared to the Volts/Hertz (or constant flux) controls. This report evaluates documented schemes for speed sensorless drives, and discusses the trends and tradeoffs involved in selecting a particular scheme. These schemes combine the attributes of the direct and indirect field-oriented control (FOC) or use model adaptive reference systems (MRAS) with a speed-dependent current model for flux estimation which tracks the voltage model-based flux estimator. Many factors are important in comparing the effectiveness of a speed sensorless scheme. Among them are the wide speed range capability, motor parameter insensitivity and noise reduction. Although a number of schemes have been proposed for solving the speed estimation, zero-speed FOC with robustness against parameter variations still remains an area of research for speed sensorless control.

Improved Short-Circuit Protection for Power Cells in Series

NASA Technical Reports Server (NTRS)

Davies, Francis

2008-01-01

A scheme for protection against short circuits has been devised for series strings of lithium electrochemical cells that contain built-in short-circuit protection devices, which go into a high-resistance, current-limiting state when heated by excessive current. If cells are simply connected in a long series string to obtain a high voltage and a short circuit occurs, whichever short-circuit protection device trips first is exposed to nearly the full string voltage, which, typically, is large enough to damage the device. Depending on the specific cell design, the damage can defeat the protective function, cause a dangerous internal short circuit in the affected cell, and/or cascade to other cells. In the present scheme, reverse diodes rated at a suitably high current are connected across short series sub-strings, the lengths of which are chosen so that when a short-circuit protection device is tripped, the voltage across it does not exceed its rated voltage. This scheme preserves the resetting properties of the protective devices. It provides for bypassing of cells that fail open and limits cell reversal, though not as well as does the more-expensive scheme of connecting a diode across every cell.

Application of voltage oriented control technique in a fully renewable, wind powered, autonomous system with storage capabilities

NASA Astrophysics Data System (ADS)

Kondylis, Georgios P.; Vokas, Georgios A.; Anastasiadis, Anestis G.; Konstantinopoulos, Stavros A.

2017-02-01

The main purpose of this paper is to examine the technological feasibility of a small autonomous network, with electricity storage capability, which is completely electrified by wind energy. The excess energy produced, with respect to the load requirements, is sent to the batteries for storage. When the energy produced by the wind generator is not sufficient, load's energy requirement is covered by the battery system, ensuring, however, that voltage, frequency and other system characteristics are within the proper boundaries. For the purpose of this study, a Voltage Oriented Control system has been developed in order to monitor the autonomous operation and perform the energy management of the network. This system manages the power flows between the load and the storage system by properly controlling the Pulse Width Modulation pulses in the converter, thus ensuring power flows are adequate and frequency remains under control. The experimental results clearly indicate that a stand-alone wind energy system based on battery energy storage system is feasible and reliable. This paves the way for fully renewable and zero emission energy schemes.

A self-tuning automatic voltage regulator designed for an industrial environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flynn, D.; Hogg, B.W.; Swidenbank, E.

Examination of the performance of fixed parameter controllers has resulted in the development of self-tuning strategies for excitation control of turbogenerator systems. In conjunction with the advanced control algorithms, sophisticated measurement techniques have previously been adopted on micromachine systems to provide generator terminal quantities. In power stations, however, a minimalist hardware arrangement would be selected leading to relatively simple measurement techniques. The performance of a range of self-tuning schemes is investigated on an industrial test-bed, employing a typical industrial hardware measurement system. Individual controllers are implemented on a standard digital automatic voltage regulator, as installed in power stations. This employsmore » a VME platform, and the self-tuning algorithms are introduced by linking to a transputer network. The AVR includes all normal features, such as field forcing, VAR limiting and overflux protection. Self-tuning controller performance is compared with that of a fixed gain digital AVR.« less

A High Efficiency Boost Converter with MPPT Scheme for Low Voltage Thermoelectric Energy Harvesting

NASA Astrophysics Data System (ADS)

Guan, Mingjie; Wang, Kunpeng; Zhu, Qingyuan; Liao, Wei-Hsin

2016-11-01

Using thermoelectric elements to harvest energy from heat has been of great interest during the last decade. This paper presents a direct current-direct current (DC-DC) boost converter with a maximum power point tracking (MPPT) scheme for low input voltage thermoelectric energy harvesting applications. Zero current switch technique is applied in the proposed MPPT scheme. Theoretical analysis on the converter circuits is explored to derive the equations for parameters needed in the design of the boost converter. Simulations and experiments are carried out to verify the theoretical analysis and equations. A prototype of the designed converter is built using discrete components and a low-power microcontroller. The results show that the designed converter can achieve a high efficiency at low input voltage. The experimental efficiency of the designed converter is compared with a commercial converter solution. It is shown that the designed converter has a higher efficiency than the commercial solution in the considered voltage range.

Modeling, control, and simulation of battery storage photovoltaic-wave energy hybrid renewable power generation systems for island electrification in Malaysia.

PubMed

Samrat, Nahidul Hoque; Bin Ahmad, Norhafizan; Choudhury, Imtiaz Ahmed; Bin Taha, Zahari

2014-01-01

Today, the whole world faces a great challenge to overcome the environmental problems related to global energy production. Most of the islands throughout the world depend on fossil fuel importation with respect to energy production. Recent development and research on green energy sources can assure sustainable power supply for the islands. But unpredictable nature and high dependency on weather conditions are the main limitations of renewable energy sources. To overcome this drawback, different renewable sources and converters need to be integrated with each other. This paper proposes a standalone hybrid photovoltaic- (PV-) wave energy conversion system with energy storage. In the proposed hybrid system, control of the bidirectional buck-boost DC-DC converter (BBDC) is used to maintain the constant dc-link voltage. It also accumulates the excess hybrid power in the battery bank and supplies this power to the system load during the shortage of hybrid power. A three-phase complex vector control scheme voltage source inverter (VSI) is used to control the load side voltage in terms of the frequency and voltage amplitude. Based on the simulation results obtained from Matlab/Simulink, it has been found that the overall hybrid framework is capable of working under the variable weather and load conditions.

Modeling, Control, and Simulation of Battery Storage Photovoltaic-Wave Energy Hybrid Renewable Power Generation Systems for Island Electrification in Malaysia

PubMed Central

Samrat, Nahidul Hoque; Ahmad, Norhafizan Bin; Choudhury, Imtiaz Ahmed; Taha, Zahari Bin

2014-01-01

Today, the whole world faces a great challenge to overcome the environmental problems related to global energy production. Most of the islands throughout the world depend on fossil fuel importation with respect to energy production. Recent development and research on green energy sources can assure sustainable power supply for the islands. But unpredictable nature and high dependency on weather conditions are the main limitations of renewable energy sources. To overcome this drawback, different renewable sources and converters need to be integrated with each other. This paper proposes a standalone hybrid photovoltaic- (PV-) wave energy conversion system with energy storage. In the proposed hybrid system, control of the bidirectional buck-boost DC-DC converter (BBDC) is used to maintain the constant dc-link voltage. It also accumulates the excess hybrid power in the battery bank and supplies this power to the system load during the shortage of hybrid power. A three-phase complex vector control scheme voltage source inverter (VSI) is used to control the load side voltage in terms of the frequency and voltage amplitude. Based on the simulation results obtained from Matlab/Simulink, it has been found that the overall hybrid framework is capable of working under the variable weather and load conditions. PMID:24892049

Experimental study on the 300W class planar type solid oxide fuel cell stack: Investigation for appropriate fuel provision control and the transient capability of the cell performance

NASA Astrophysics Data System (ADS)

Komatsu, Y.; Brus, G.; Kimijima, S.; Szmyd, J. S.

2012-11-01

The present paper reports the experimental study on the dynamic behavior of a solid oxide fuel cell (SOFC). The cell stack consists of planar type cells with standard power output 300W. A Major subject of the present study is characterization of the transient response to the electric current change, assuming load-following operation. The present studies particularly focus on fuel provision control to the load change. Optimized fuel provision improves power generation efficiency. However, the capability of SOFC must be restricted by a few operative parameters. Fuel utilization factor, which is defined as the ratio of the consumed fuel to the supplied fuel is adopted for a reference in the control scheme. The fuel flow rate was regulated to keep the fuel utilization at 50%, 60% and 70% during the current ramping. Lower voltage was observed with the higher fuel utilization, but achieved efficiency was higher. The appropriate mass flow control is required not to violate the voltage transient behavior. Appropriate fuel flow manipulation can contribute to moderate the overshoot on the voltage that may appear to the current change. The overshoot on the voltage response resulted from the gradual temperature behavior in the SOFC stack module.

A 190 mV start-up and 59.2% efficiency CMOS gate boosting voltage doubler charge pump in 0.18 µm standard CMOS process for energy harvesting

NASA Astrophysics Data System (ADS)

Yoshida, Minori; Miyaji, Kousuke

2018-04-01

A start-up charge pump circuit for an extremely low input voltage (V IN) is proposed and demonstrated. The proposed circuit uses an inverter level shifter to generate a 2V IN voltage swing to the gate of both main NMOS and PMOS power transistors in a charge pump to reduce the channel resistance. The proposed circuit is fully implemented in a standard 0.18 µm CMOS process, and the measurement result shows that a minimum input voltage of 190 mV is achieved and output power increases by 181% compared with the conventional forward-body-bias scheme at a 300 mV input voltage. The proposed scheme achieves a maximum efficiency of 59.2% when the input voltage is 390 mV and the output current is 320 nA. The proposed circuit is suitable as a start-up circuit in ultralow power energy harvesting power management applications to boost-up from below threshold voltage.

Development of a digital solar simulator based on full-bridge converter

NASA Astrophysics Data System (ADS)

Liu, Chen; Feng, Jian; Liu, Zhilong; Tong, Weichao; Ji, Yibo

2014-02-01

With the development of solar photovoltaic, distribution schemes utilized in power grid had been commonly application, and photovoltaic (PV) inverter is an essential equipment in grid. In this paper, a digital solar simulator based on full-bridge structure is presented. The output characteristic curve of system is electrically similar to silicon solar cells, which can greatly simplify research methods of PV inverter, improve the efficiency of research and development. The proposed simulator consists on a main control board based on TM320F28335, phase-shifted zero-voltage-switching (ZVS) DC-DC full-bridge converter and voltage and current sampling circuit, that allows emulating the voltage-current curve with the open-circuit voltage (Voc) of 900V and the short-circuit current (Isc) of 18A .When the system connected to a PV inverter, the inverter can quickly track from the open-circuit to the maximum power point and keep stability.

Manipulating photoinduced voltage in metasurface with circularly polarized light.

PubMed

Bai, Qiang

2015-02-23

Recently, the concept of metasurface has provided one an unprecedented opportunity and ability to control the light in the deep subwavelength scale. However, so far most efforts are devoted to exploiting the novel scattering properties and applications of metasurface in optics. Here, I theoretically and numerically demonstrate that longitudinal and transverse photoinduced voltages can be simultaneously realized in the proposed metasurface utilizing the magnetic resonance under the normal incidence of circularly polarized light, which may extend the concept and functionality of metasurface into the electronics and may provide a potential scheme to realize a nanoscale tunable voltage source through a nanophotonic roadmap. The signs of longitudinal and transverse photoin-duced voltages can be manipulated by tuning the resonant frequency and the handedness of circularly polarized light, respectively. Analytical formulae of photoinduced voltage are presented based on the theory of symmetry of field. This work may bridge nanophotonics and electronics, expands the capability of metasurface and has many potential applications.

Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers.

PubMed

Dell' Anna, Francesco; Dong, Tao; Li, Ping; Wen, Yumei; Azadmehr, Mehdi; Casu, Mario; Berg, Yngvar

2018-04-17

This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs) powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE) for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs) for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

Charge Control Investigation of Rechargeable Lithium Cells

NASA Technical Reports Server (NTRS)

Otzinger, B.; Somoano, R.

1984-01-01

An ambient temperature rechargeable Li-TiS2 cell was cycled under conditions which simulate aerospace applications. A novel charge/discharge state-of-charge control scheme was used, together with tapered current charging, to overcome deleterious effects associated with end-of-charge and end-of-discharge voltages. The study indicates that Li-TiS2 cells hold promise for eventual synchronous satellite-type applications. Problem areas associated with performance degradation and reconditioning effects are identified.

Energy compression of nanosecond high-voltage pulses based on two-stage hybrid scheme

NASA Astrophysics Data System (ADS)

Ulmaskulov, M. R.; Mesyats, G. A.; Sadykova, A. G.; Sharypov, K. A.; Shpak, V. G.; Shunailov, S. A.; Yalandin, M. I.

2017-04-01

Test results of high-voltage subnanosecond pulse generator with a hybrid, two-stage energy compression scheme are presented. After the first compression section with a gas discharger, a ferrite-filled gyromagnetic nonlinear transmitting line is used. The offered technical solution makes it possible to increase the voltage pulse amplitude from -185 kV to -325 kV, with a 2-ns pulse rise time minimized down to ˜180 ps. For the small output voltage amplitude of -240 kV, the shortest pulse front of ˜85 ps was obtained. The generator with maximum amplitude was utilized to form an ultra-short flow of runaway electrons in air-filled discharge gap with particles' energy approaching to 700 keV.

Robust backstepping control of an interlink converter in a hybrid AC/DC microgrid based on feedback linearisation method

NASA Astrophysics Data System (ADS)

Dehkordi, N. Mahdian; Sadati, N.; Hamzeh, M.

2017-09-01

This paper presents a robust dc-link voltage as well as a current control strategy for a bidirectional interlink converter (BIC) in a hybrid ac/dc microgrid. To enhance the dc-bus voltage control, conventional methods strive to measure and feedforward the load or source power in the dc-bus control scheme. However, the conventional feedforward-based approaches require remote measurement with communications. Moreover, conventional methods suffer from stability and performance issues, mainly due to the use of the small-signal-based control design method. To overcome these issues, in this paper, the power from DG units of the dc subgrid imposed on the BIC is considered an unmeasurable disturbance signal. In the proposed method, in contrast to existing methods, using the nonlinear model of BIC, a robust controller that does not need the remote measurement with communications effectively rejects the impact of the disturbance signal imposed on the BIC's dc-link voltage. To avoid communication links, the robust controller has a plug-and-play feature that makes it possible to add a DG/load to or remove it from the dc subgrid without distorting the hybrid microgrid stability. Finally, Monte Carlo simulations are conducted to confirm the effectiveness of the proposed control strategy in MATLAB/SimPowerSystems software environment.

Power quality improvement by using STATCOM control scheme in wind energy generation interface to grid

NASA Astrophysics Data System (ADS)

Kirmani, Sheeraz; Kumar, Brijesh

2018-01-01

“Electric Power Quality (EPQ) is a term that refers to maintaining the near sinusoidal waveform of power distribution bus voltages and currents at rated magnitude and frequency”. Today customers are more aware of the seriousness that the power quality possesses, this prompt the utilities to assure good quality of power to their customer. The power quality is basically customer centric. Increased focus of utilities toward maintaining reliable power supply by employing power quality improvement tools has reduced the power outages and black out considerably. Good power quality is the characteristic of reliable power supply. Low power factor, harmonic pollution, load imbalance, fast voltage variations are some common parameters which are used to define the power quality. If the power quality issues are not checked i.e. the parameters that define power quality doesn't fall within the predefined standards than it will lead into high electricity bill, high running cost in industries, malfunctioning of equipments, challenges in connecting renewable. Capacitor banks, FACTS devices, harmonic filters, SVC’s (static voltage compensators), STATCOM (Static-Compensator) are the solutions to achieve the power quality. The performance of Wind turbine generators is affected by poor quality power, at the same time these wind power generating plant affects the power quality negatively. This paper presents the STATCOM-BESS (battery energy storage system) system and studies its impact on the power quality in a system which consists of wind turbine generator, non linear load, hysteresis controller for controlling the operation of STATCOM and grid. The model is simulated in the MATLAB/Simulink. This scheme mitigates the power quality issues, improves voltage profile and also reduces harmonic distortion of the waveforms. BESS level out the imbalances caused in real power due to intermittent nature of wind power available due to varying wind speeds.

Optimal Operation and Management for Smart Grid Subsumed High Penetration of Renewable Energy, Electric Vehicle, and Battery Energy Storage System

NASA Astrophysics Data System (ADS)

Shigenobu, Ryuto; Noorzad, Ahmad Samim; Muarapaz, Cirio; Yona, Atsushi; Senjyu, Tomonobu

2016-04-01

Distributed generators (DG) and renewable energy sources have been attracting special attention in distribution systems in all over the world. Renewable energies, such as photovoltaic (PV) and wind turbine generators are considered as green energy. However, a large amount of DG penetration causes voltage deviation beyond the statutory range and reverse power flow at interconnection points in the distribution system. If excessive voltage deviation occurs, consumer's electric devices might break and reverse power flow will also has a negative impact on the transmission system. Thus, mass interconnections of DGs has an adverse effect on both of the utility and the customer. Therefore, reactive power control method is proposed previous research by using inverters attached DGs for prevent voltage deviations. Moreover, battery energy storage system (BESS) is also proposed for resolve reverse power flow. In addition, it is possible to supply high quality power for managing DGs and BESSs. Therefore, this paper proposes a method to maintain voltage, active power, and reactive power flow at interconnection points by using cooperative controlled of PVs, house BESSs, EVs, large BESSs, and existing voltage control devices. This paper not only protect distribution system, but also attain distribution loss reduction and effectivity management of control devices. Therefore mentioned control objectives are formulated as an optimization problem that is solved by using the Particle Swarm Optimization (PSO) algorithm. Modified scheduling method is proposed in order to improve convergence probability of scheduling scheme. The effectiveness of the proposed method is verified by case studies results and by using numerical simulations in MATLAB®.

Power Control of New Wind Power Generation System with Induction Generator Excited by Voltage Source Converter

NASA Astrophysics Data System (ADS)

Morizane, Toshimitsu; Kimura, Noriyuki; Taniguchi, Katsunori

This paper investigates advantages of new combination of the induction generator for wind power and the power electronic equipment. Induction generator is popularly used for the wind power generation. The disadvantage of it is impossible to generate power at the lower rotor speed than the synchronous speed. To compensate this disadvantage, expensive synchronous generator with the permanent magnets is sometimes used. In proposed scheme, the diode rectifier is used to convert the real power from the induction generator to the intermediate dc voltage, while only the reactive power necessary to excite the induction generator is supplied from the voltage source converter (VSC). This means that the rating of the expensive VSC is minimized and total cost of the wind power generation system is decreased compared to the system with synchronous generator. Simulation study to investigate the control strategy of proposed system is performed. The results show the reduction of the VSC rating is prospective.

Analysis of field-oriented controlled induction motor drives under sensor faults and an overview of sensorless schemes.

PubMed

Arun Dominic, D; Chelliah, Thanga Raj

2014-09-01

To obtain high dynamic performance on induction motor drives (IMD), variable voltage and variable frequency operation has to be performed by measuring speed of rotation and stator currents through sensors and fed back them to the controllers. When the sensors are undergone a fault, the stability of control system, may be designed for an industrial process, is disturbed. This paper studies the negative effects on a 12.5 hp induction motor drives when the field oriented control system is subjected to sensor faults. To illustrate the importance of this study mine hoist load diagram is considered as shaft load of the tested machine. The methods to recover the system from sensor faults are discussed. In addition, the various speed sensorless schemes are reviewed comprehensively. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Improved control strategy for PI-R current of DFIG considering voltage and current harmonics compensation

NASA Astrophysics Data System (ADS)

Song, S. Y.; Liu, Q. H.; Zhao, Y. N.; Liu, S. Y.

2016-08-01

With the rapid development of wind power generation, the related research of wind power control and integration issues has attracted much attention, and the focus of the research are shifting away from the ideal power grid environment to the actual power grid environment. As the main stream wind turbine generator, a doubly-fed induction generator (DFIG) is connected to the power grid directly by its stator, so it is particularly sensitive to the power grid. This paper studies the improvement of DFIG control technology in the power grid harmonic environment. Based on the DFIG dynamic model considering the power grid harmonic environment, this paper introduces the shortcomings of the common control strategy of DFIG, and puts forward the enhanced method. The decoupling control of the system is realized by compensating the coupling between the rotor harmonic voltage and harmonic current, improving the control performance. In addition, the simulation experiments on PSCAD/EMTDC are carried out to verify the correctness and effectiveness of the improved scheme.

Electric power distribution and load transfer system

NASA Technical Reports Server (NTRS)

Bradford, Michael P. (Inventor); Parkinson, Gerald W. (Inventor); Grant, Ross M. (Inventor)

1987-01-01

A power distribution system includes a plurality of power sources and load transfer units including transistors and diodes connected in series and leading to a common power output, each of the transistors being controller switchable subject to voltage levels of the respective input and output sides of said transistors, and the voltage and current level of said common power output. The system is part of an interconnection scheme in which all but one of the power sources is connected to a single load transfer unit, enabling the survival of at least a single power source with the failure of one of the load transfer units.

Electric power distribution and load transfer system

NASA Technical Reports Server (NTRS)

Bradford, Michael P. (Inventor); Parkinson, Gerald W. (Inventor); Grant, Ross M. (Inventor)

1989-01-01

A power distribution system includes a plurality of power sources and load transfer units including transistors and diodes connected in series and leading to a common power output, each of the transistors being controller switchable subject to voltage levels of the respective input and output sides of said transistors, and the voltage and current level of said common power output. The system is part of an interconnection scheme in which all but one of the power sources is connected to a single load transfer unit, enabling the survival of at least a single power source with the failure of one of the load transfer units.

The role of optoelectronic feedback on Franz-Keldysh voltage modulation of transistor lasers

NASA Astrophysics Data System (ADS)

Chang, Chi-Hsiang; Chang, Shu-Wei; Wu, Chao-Hsin

2016-03-01

Possessing both the high-speed characteristics of heterojunction bipolar transistors (HBTs) and enhanced radiative recombination of quantum wells (QWs), the light-emitting transistor (LET) which operates in the regime of spontaneous emissions has achieved up to 4.3 GHz modulation bandwidth. A 40 Gbit/s transmission rate can be even achieved using transistor laser (TL). The transistor laser provides not only the current modulation but also direct voltage-controlled modulation scheme of optical signals via Franz-Keldysh (FK) photon-assisted tunneling effect. In this work, the effect of FK absorption on the voltage modulation of TLs is investigated. In order to analyze the dynamics and optical responses of voltage modulation in TLs, the conventional rate equations relevant to diode lasers (DLs) are first modified to include the FK effect intuitively. The theoretical results of direct-current (DC) and small-signal alternating-current (AC) characteristics of optical responses are both investigated. While the DC characteristics look physical, the intrinsic optical response of TLs under the FK voltage modulation shows an AC enhancement with a 20 dB peak, which however is not observed in experiment. A complete model composed of the intrinsic optical transfer function and an electrical transfer function fed back by optical responses is proposed to explain the behaviors of voltage modulation in TLs. The abnormal AC peak disappears through this optoelectronic feedback. With the electrical response along with FK-included photon-carrier rate equations taken into account, the complete voltage-controlled optical modulation response of TLs is demonstrated.

Technical Study of a Standalone Photovoltaic–Wind Energy Based Hybrid Power Supply Systems for Island Electrification in Malaysia

PubMed Central

Samrat, Nahidul Hoque; Ahmad, Norhafizan; Choudhury, Imtiaz Ahmed; Taha, Zahari

2015-01-01

Energy is one of the most important factors in the socioeconomic development of a country. In a developing country like Malaysia, the development of islands is mostly related to the availability of electric power. Power generated by renewable energy sources has recently become one of the most promising solutions for the electrification of islands and remote rural areas. But high dependency on weather conditions and the unpredictable nature of these renewable energy sources are the main drawbacks. To overcome this weakness, different green energy sources and power electronic converters need to be integrated with each other. This study presents a battery storage hybrid standalone photovoltaic-wind energy power supply system. In the proposed standalone hybrid system, a DC-DC buck-boost bidirectional converter controller is used to accumulates the surplus hybrid power in the battery bank and supplies this power to the load during the hybrid power shortage by maintaining the constant dc-link voltage. A three-phase voltage source inverter complex vector control scheme is used to control the load side voltage in terms of the voltage amplitude and frequency. Based on the simulation results obtained from MATLAB/Simulink, it has been found that the overall hybrid framework is capable of working under variable weather and load conditions. PMID:26121032

Technical Study of a Standalone Photovoltaic-Wind Energy Based Hybrid Power Supply Systems for Island Electrification in Malaysia.

PubMed

Samrat, Nahidul Hoque; Ahmad, Norhafizan; Choudhury, Imtiaz Ahmed; Taha, Zahari

2015-01-01

Energy is one of the most important factors in the socioeconomic development of a country. In a developing country like Malaysia, the development of islands is mostly related to the availability of electric power. Power generated by renewable energy sources has recently become one of the most promising solutions for the electrification of islands and remote rural areas. But high dependency on weather conditions and the unpredictable nature of these renewable energy sources are the main drawbacks. To overcome this weakness, different green energy sources and power electronic converters need to be integrated with each other. This study presents a battery storage hybrid standalone photovoltaic-wind energy power supply system. In the proposed standalone hybrid system, a DC-DC buck-boost bidirectional converter controller is used to accumulates the surplus hybrid power in the battery bank and supplies this power to the load during the hybrid power shortage by maintaining the constant dc-link voltage. A three-phase voltage source inverter complex vector control scheme is used to control the load side voltage in terms of the voltage amplitude and frequency. Based on the simulation results obtained from MATLAB/Simulink, it has been found that the overall hybrid framework is capable of working under variable weather and load conditions.

Design of DSP-based high-power digital solar array simulator

NASA Astrophysics Data System (ADS)

Zhang, Yang; Liu, Zhilong; Tong, Weichao; Feng, Jian; Ji, Yibo

2013-12-01

To satisfy rigid performance specifications, a feedback control was presented for zoom optical lens plants. With the increasing of global energy consumption, research of the photovoltaic(PV) systems get more and more attention. Research of the digital high-power solar array simulator provides technical support for high-power grid-connected PV systems research.This paper introduces a design scheme of the high-power digital solar array simulator based on TMS320F28335. A DC-DC full-bridge topology was used in the system's main circuit. The switching frequency of IGBT is 25kHz.Maximum output voltage is 900V. Maximum output current is 20A. Simulator can be pre-stored solar panel IV curves.The curve is composed of 128 discrete points .When the system was running, the main circuit voltage and current values was feedback to the DSP by the voltage and current sensors in real-time. Through incremental PI,DSP control the simulator in the closed-loop control system. Experimental data show that Simulator output voltage and current follow a preset solar panels IV curve. In connection with the formation of high-power inverter, the system becomes gridconnected PV system. The inverter can find the simulator's maximum power point and the output power can be stabilized at the maximum power point (MPP).

Effect of the scheme of plasmachemical processes on the calculated characteristics of a barrier discharge in xenon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avtaeva, S. V.; Kulumbaev, E. B.

2008-06-15

The dynamics of a repetitive barrier discharge in xenon at a pressure of 400 Torr is simulated using a one-dimensional drift-diffusion model. The thicknesses of identical barriers with a dielectric constant of 4 are 2 mm, and the gap length is 4 mm. The discharge is fed with an 8-kV ac voltage at a frequency of 25 or 50 kHz. The development of the ionization wave and the breakdown and afterglow phases of a barrier discharge are analyzed using two different kinetic schemes of elementary processes in a xenon plasma. It is shown that the calculated waveforms of the dischargemore » voltage and current, the instant of breakdown, and the number of breakdowns per voltage half-period depend substantially on the properties of the kinetic scheme of plasmachemical processes.« less

Development, Demonstration, and Control of a Testbed for Multiterminal HVDC System

DOE PAGES

Li, Yalong; Shi, Xiaojie M.; Liu, Bo; ...

2016-10-21

This paper presents the development of a scaled four-terminal high-voltage direct current (HVDC) testbed, including hardware structure, communication architecture, and different control schemes. The developed testbed is capable of emulating typical operation scenarios including system start-up, power variation, line contingency, and converter station failure. Some unique scenarios are also developed and demonstrated, such as online control mode transition and station re-commission. In particular, a dc line current control is proposed, through the regulation of a converter station at one terminal. By controlling a dc line current to zero, the transmission line can be opened by using relatively low-cost HVDC disconnectsmore » with low current interrupting capability, instead of the more expensive dc circuit breaker. Utilizing the dc line current control, an automatic line current limiting scheme is developed. As a result, when a dc line is overloaded, the line current control will be automatically activated to regulate current within the allowable maximum value.« less

Research on the supercapacitor support schemes for LVRT of variable-frequency drive in the thermal power plant

NASA Astrophysics Data System (ADS)

Han, Qiguo; Zhu, Kai; Shi, Wenming; Wu, Kuayu; Chen, Kai

2018-02-01

In order to solve the problem of low voltage ride through(LVRT) of the major auxiliary equipment’s variable-frequency drive (VFD) in thermal power plant, the scheme of supercapacitor paralleled in the DC link of VFD is put forward, furthermore, two solutions of direct parallel support and voltage boost parallel support of supercapacitor are proposed. The capacitor values for the relevant motor loads are calculated according to the law of energy conservation, and they are verified by Matlab simulation. At last, a set of test prototype is set up, and the test results prove the feasibility of the proposed schemes.

MicrofluIdic circuit designs for performing electrokinetic manipulations that reduce the number of voltage sources and fluid reservoirs

DOEpatents

Jacobson, Stephen C.; Ramsey, J. Michael

2000-01-01

A microfabricated device and method for proportioning and mixing electrokinetically manipulated biological or chemical materials is disclosed. The microfabricated device mixes a plurality of materials in volumetric proportions controlled by the electrical resistances of tributary reagent channels through which the materials are transported. The microchip includes two or more tributary reagent channels combining at one or more junctions to form one or more mixing channels. By varying the geometries of the channels (length, cross section, etc.), a plurality of reagent materials can be mixed at a junction such that the proportions of the reagent materials in the mixing channel depend on a ratio of the channel geometries and material properties. Such an approach facilitates voltage division on the microchip without relying on external wiring schemes and voltage division techniques external to the microchip. Microchannel designs that provide the necessary voltage division to accomplish electrokinetic valving operations using a single voltage source and a switch are also described. In addition, microchannel designs that accomplish fluidic operation utilizing a minimal number of fluidic reservoirs are disclosed.

Inverting Quasi-Resonant Switched-Capacitor Bidirectional Converter and Its Application to Battery Equalization

NASA Astrophysics Data System (ADS)

Lee, Yuang-Shung; Chiu, Yin-Yuan; Cheng, Ming-Wang; Ko, Yi-Pin; Hsiao, Sung-Hsin

The proposed quasi-resonant (QR) zero current switching (ZCS) switched-capacitor (SC) converter is a new type of bidirectional power flow control conversion scheme. The proposed converter is able to provide voltage conversion ratios from -3/-{1 \\over 3} (triple-mode/trisection-mode) to -n/-{1 \\over n} (-n-mode/-{1 \\over n}-mode) by adding a different number of switched-capacitors and power MOSFET switches with a small series connected resonant inductor for forward and reverse power flow control schemes. It possesses the advantages of low switching losses and current stress in this QR ZCS SC converter. The principle of operation, theoretical analysis of the proposed triple-mode/trisection-mode bidirectional power conversion scheme is described in detail with circuit model analysis. Simulation and experimental studies are carried out to verify the performance of the proposed inverting type ZCS SC QR bidirectional converter. The proposed converters can be applied to battery equalization for battery management system (BMS).

High speed, high performance, portable, dual-channel, optical fiber Bragg grating (FBG) demodulator

NASA Astrophysics Data System (ADS)

Zhang, Hongtao; Wei, Zhanxiong; Fan, Lingling; Wang, Pengfei; Zhao, Xilin; Wang, Zhenhua; Yang, Shangming; Cui, Hong-Liang

2009-10-01

A high speed, high performance, portable, dual-channel, optical Fiber Bragg Grating demodulator based on fiber Fabry- Pérot tunable filter (FFP-FT) is reported in this paper. The high speed demodulation can be achieved to detect the dynamical loads of vehicles with speed of 15 mph. However, the drifts of piezoelectric transducer (PZT) in the cavity of FFP-FT dramatically degrade the stability of system. Two schemes are implemented to improve the stability of system. Firstly, a temperature control system is installed to effectively remove the thermal drifts of PZT. Secondly, a scheme of changing the bias voltage of FFP-FT to restrain non-thermal drifts has been realized at lab and will be further developed to an automatic control system based on microcontroller. Although this demodulator is originally used in Weight-In- Motion (WIM) sensing system, it can be extended into other aspects and the schemes presented in this paper will be useful in many applications.

An 1.4 ppm/°C bandgap voltage reference with automatic curvature-compensation technique

NASA Astrophysics Data System (ADS)

Zhou, Zekun; Yu, Hongming; Shi, Yue; Zhang, Bo

2017-12-01

A high-precision Bandgap voltage reference (BGR) with a novel curvature-compensation scheme is proposed in this paper. The temperature coefficient (TC) can be automatically optimized with a built-in adaptive curvature-compensation technique, which is realized in a digitization control way. Firstly, an exponential curvature compensation method is adopted to reduce the TC in a certain degree, especially in low temperature range. Then, the temperature drift of BGR in higher temperature range can be further minimized by dynamic zero-temperature-coefficient point tracking with temperature changes. With the help of proposed adaptive signal processing, the output voltage of BGR can approximately maintain zero TC in a wider temperature range. Experiment results of the BGR proposed in this paper, which is implemented in 0.35-μm BCD process, illustrate that the TC of 1.4ppm/°C is realized under the power supply voltage of 3.6V and the power supply rejection of the proposed circuit is -67dB.

Close-loop Dynamic Stall Control on a Pitching Airfoil

NASA Astrophysics Data System (ADS)

Giles, Ian; Corke, Thomas

2017-11-01

A closed-loop control scheme utilizing a plasma actuator to control dynamic stall is presented. The plasma actuator is located at the leading-edge of a pitching airfoil. It initially pulses at an unsteady frequency that perturbs the boundary layer flow over the suction surface of the airfoil. As the airfoil approaches and enters stall, the amplification of the unsteady disturbance is detected by an onboard pressure sensor also located near the leading edge. Once detected, the actuator is switched to a higher voltage control state that in static airfoil experiments would reattach the flow. The threshold level of the detection is a parameter in the control scheme. Three stall regimes were examined: light, medium, and deep stall, that were defined by their stall penetration angles. The results showed that in general, the closed-loop control scheme was effective at controlling dynamic stall. The cycle-integrated lift improved in all cases, and increased by as much as 15% at the lowest stall penetration angle. As important, the cycle-integrated aerodynamic damping coefficient also increased in all cases, and was made to be positive at the light stall regime where it traditionally is negative. The latter is important in applications where negative damping can lead to stall flutter.

Improved transistorized AC motor controller for battery powered urban electric passenger vehicles

NASA Technical Reports Server (NTRS)

Peak, S. C.

1982-01-01

An ac motor controller for an induction motor electric vehicle drive system was designed, fabricated, tested, evaluated, and cost analyzed. A vehicle performance analysis was done to establish the vehicle tractive effort-speed requirements. These requirements were then converted into a set of ac motor and ac controller requirements. The power inverter is a three-phase bridge using power Darlington transistors. The induction motor was optimized for use with an inverter power source. The drive system has a constant torque output to base motor speed and a constant horsepower output to maximum speed. A gear shifting transmission is not required. The ac controller was scaled from the base 20 hp (41 hp peak) at 108 volts dec to an expanded horsepower and battery voltage range. Motor reversal was accomplished by electronic reversal of the inverter phase sequence. The ac controller can also be used as a boost chopper battery charger. The drive system was tested on a dynamometer and results are presented. The current-controlled pulse width modulation control scheme yielded improved motor current waveforms. The ac controller favors a higher system voltage.

A Real-Time Decision Support System for Voltage Collapse Avoidance in Power Supply Networks

NASA Astrophysics Data System (ADS)

Chang, Chen-Sung

This paper presents a real-time decision support system (RDSS) based on artificial intelligence (AI) for voltage collapse avoidance (VCA) in power supply networks. The RDSS scheme employs a fuzzy hyperrectangular composite neural network (FHRCNN) to carry out voltage risk identification (VRI). In the event that a threat to the security of the power supply network is detected, an evolutionary programming (EP)-based algorithm is triggered to determine the operational settings required to restore the power supply network to a secure condition. The effectiveness of the RDSS methodology is demonstrated through its application to the American Electric Power Provider System (AEP, 30-bus system) under various heavy load conditions and contingency scenarios. In general, the numerical results confirm the ability of the RDSS scheme to minimize the risk of voltage collapse in power supply networks. In other words, RDSS provides Power Provider Enterprises (PPEs) with a viable tool for performing on-line voltage risk assessment and power system security enhancement functions.

Neuro-fuzzy control of structures using acceleration feedback

NASA Astrophysics Data System (ADS)

Schurter, Kyle C.; Roschke, Paul N.

2001-08-01

This paper described a new approach for the reduction of environmentally induced vibration in constructed facilities by way of a neuro-fuzzy technique. The new control technique is presented and tested in a numerical study that involves two types of building models. The energy of each building is dissipated through magnetorheological (MR) dampers whose damping properties are continuously updated by a fuzzy controller. This semi-active control scheme relies on the development of a correlation between the accelerations of the building (controller input) and the voltage applied to the MR damper (controller output). This correlation forms the basis for the development of an intelligent neuro-fuzzy control strategy. To establish a context for assessing the effectiveness of the semi-active control scheme, responses to earthquake excitation are compared with passive strategies that have similar authority for control. According to numerical simulation, MR dampers are less effective control mechanisms than passive dampers with respect to a single degree of freedom (DOF) building model. On the other hand, MR dampers are predicted to be superior when used with multiple DOF structures for reduction of lateral acceleration.

A robust hybrid fuzzy-simulated annealing-intelligent water drops approach for tuning a distribution static compensator nonlinear controller in a distribution system

NASA Astrophysics Data System (ADS)

Bagheri Tolabi, Hajar; Hosseini, Rahil; Shakarami, Mahmoud Reza

2016-06-01

This article presents a novel hybrid optimization approach for a nonlinear controller of a distribution static compensator (DSTATCOM). The DSTATCOM is connected to a distribution system with the distributed generation units. The nonlinear control is based on partial feedback linearization. Two proportional-integral-derivative (PID) controllers regulate the voltage and track the output in this control system. In the conventional scheme, the trial-and-error method is used to determine the PID controller coefficients. This article uses a combination of a fuzzy system, simulated annealing (SA) and intelligent water drops (IWD) algorithms to optimize the parameters of the controllers. The obtained results reveal that the response of the optimized controlled system is effectively improved by finding a high-quality solution. The results confirm that using the tuning method based on the fuzzy-SA-IWD can significantly decrease the settling and rising times, the maximum overshoot and the steady-state error of the voltage step response of the DSTATCOM. The proposed hybrid tuning method for the partial feedback linearizing (PFL) controller achieved better regulation of the direct current voltage for the capacitor within the DSTATCOM. Furthermore, in the event of a fault the proposed controller tuned by the fuzzy-SA-IWD method showed better performance than the conventional controller or the PFL controller without optimization by the fuzzy-SA-IWD method with regard to both fault duration and clearing times.

An analog gamma correction scheme for high dynamic range CMOS logarithmic image sensors.

PubMed

Cao, Yuan; Pan, Xiaofang; Zhao, Xiaojin; Wu, Huisi

2014-12-15

In this paper, a novel analog gamma correction scheme with a logarithmic image sensor dedicated to minimize the quantization noise of the high dynamic applications is presented. The proposed implementation exploits a non-linear voltage-controlled-oscillator (VCO) based analog-to-digital converter (ADC) to perform the gamma correction during the analog-to-digital conversion. As a result, the quantization noise does not increase while the same high dynamic range of logarithmic image sensor is preserved. Moreover, by combining the gamma correction with the analog-to-digital conversion, the silicon area and overall power consumption can be greatly reduced. The proposed gamma correction scheme is validated by the reported simulation results and the experimental results measured for our designed test structure, which is fabricated with 0.35 μm standard complementary-metal-oxide-semiconductor (CMOS) process.

An Analog Gamma Correction Scheme for High Dynamic Range CMOS Logarithmic Image Sensors

PubMed Central

Cao, Yuan; Pan, Xiaofang; Zhao, Xiaojin; Wu, Huisi

2014-01-01

In this paper, a novel analog gamma correction scheme with a logarithmic image sensor dedicated to minimize the quantization noise of the high dynamic applications is presented. The proposed implementation exploits a non-linear voltage-controlled-oscillator (VCO) based analog-to-digital converter (ADC) to perform the gamma correction during the analog-to-digital conversion. As a result, the quantization noise does not increase while the same high dynamic range of logarithmic image sensor is preserved. Moreover, by combining the gamma correction with the analog-to-digital conversion, the silicon area and overall power consumption can be greatly reduced. The proposed gamma correction scheme is validated by the reported simulation results and the experimental results measured for our designed test structure, which is fabricated with 0.35 μm standard complementary-metal-oxide-semiconductor (CMOS) process. PMID:25517692

Low Power Photomultiplier Tube Circuit And Method Thereor

DOEpatents

Bochenski, Edwin B.; Skinner, Jack L.; Dentinger, Paul M.; Lindblom, Scott C.

2006-04-18

An electrical circuit for a photomultiplier tube (PMT) is disclosed that reduces power consumption to a point where the PMT may be powered for extended periods with a battery. More specifically, the invention concerns a PMT circuit comprising a low leakage switch and a high voltage capacitor positioned between a resistive divider and each of the PMT dynodes, and a low power control scheme for recharging the capacitors.

A SPAD-based 3D imager with in-pixel TDC for 145ps-accuracy ToF measurement

NASA Astrophysics Data System (ADS)

Vornicu, I.; Carmona-Galán, R.; Rodríguez-Vázquez, Á.

2015-03-01

The design and measurements of a CMOS 64 × 64 Single-Photon Avalanche-Diode (SPAD) array with in-pixel Time-to-Digital Converter (TDC) are presented. This paper thoroughly describes the imager at architectural and circuit level with particular emphasis on the characterization of the SPAD-detector ensemble. It is aimed to 2D imaging and 3D image reconstruction in low light environments. It has been fabricated in a standard 0.18μm CMOS process, i. e. without high voltage or low noise features. In these circumstances, we are facing a high number of dark counts and low photon detection efficiency. Several techniques have been applied to ensure proper functionality, namely: i) time-gated SPAD front-end with fast active-quenching/recharge circuit featuring tunable dead-time, ii) reverse start-stop scheme, iii) programmable time resolution of the TDC based on a novel pseudo-differential voltage controlled ring oscillator with fast start-up, iv) a global calibration scheme against temperature and process variation. Measurements results of individual SPAD-TDC ensemble jitter, array uniformity and time resolution programmability are also provided.

Slope seeking for autonomous lift improvement by plasma surface discharge

NASA Astrophysics Data System (ADS)

Benard, Nicolas; Moreau, Eric; Griffin, John; Cattafesta, Louis N., III

2010-05-01

The present paper describes an experimental investigation of closed-loop separation control using plasma actuators. The post-stall-separated flow over a NACA 0015 airfoil is controlled using a single dielectric barrier discharge actuator located at the leading edge. Open-loop measurements are first performed to highlight the effects of the voltage amplitude on the control authority for freestream velocities of 10-30 m/s (chord Re = 1.3 × 105 to 4 × 105). The results indicate that partial or full reattachment can be achieved and motivate the choice of the slope seeking approach as the control algorithm. A single-input/single-output algorithm is used to autonomously seek the optimal voltage required to achieve the control objective (full flow reattachment associated with maximum lift). The paper briefly introduces the concept of slope seeking, and a detailed parameterization of the controller is considered. Static (fixed speed) closed-loop experiments are then discussed, which demonstrate the capability of the algorithm. In each case, the flow can be reattached in an autonomous fashion. The last part of the paper demonstrates the robustness of the gradient-based, model-free scheme for dynamic freestream conditions. This paper highlights the capability of slope seeking to autonomously achieve high lift when used to drive the voltage of a plasma actuator. It also describes the advantages and drawbacks of such a closed-loop approach.

Shaping of nested potentials for electron cooling of highly-charged ions in a cooler Penning trap

NASA Astrophysics Data System (ADS)

Paul, Stefan; Kootte, Brian; Lascar, Daniel; Gwinner, Gerald; Dilling, Jens; Titan Collaboration

2016-09-01

TRIUMF's Ion Trap for Atomic and Nuclear science (TITAN) is dedicated to mass spectrometry and decay spectroscopy of short-lived radioactive nuclides in a series of ion traps including a precision Penning trap. In order to boost the achievable precision of mass measurements TITAN deploys an Electron Beam Ion Trap (EBIT) providing Highly-Charged Ions (HCI). However, the charge breeding process in the EBIT leads to an increase in the ion bunch's energy spread which is detrimental to the overall precision gain. To reduce this effect a new cylindrical Cooler PEnning Trap (CPET) is being commissioned to sympathetically cool the HCI via a simultaneously trapped electron plasma. Simultaneous trapping of ions and electrons requires a high level of control over the nested potential landscape and sophisticated switching schemes for the voltages on CPET's multiple ring electrodes. For this purpose, we are currently setting up a new experimental control system for multi-channel voltage switching. The control system employs a Raspberry Pi communicating with a digital-to-analog board via a serial peripheral interface. We report on the implementation of the voltage control system and its performance with respect to electron and ion manipulation in CPET. University of British Columbia, Vancouver, BC, Canada.

Characteristic investigation and control of a modular multilevel converter-based HVDC system under single-line-to-ground fault conditions

DOE PAGES

Shi, Xiaojie; Wang, Zhiqiang; Liu, Bo; ...

2014-05-16

This paper presents the analysis and control of a multilevel modular converter (MMC)-based HVDC transmission system under three possible single-line-to-ground fault conditions, with special focus on the investigation of their different fault characteristics. Considering positive-, negative-, and zero-sequence components in both arm voltages and currents, the generalized instantaneous power of a phase unit is derived theoretically according to the equivalent circuit model of the MMC under unbalanced conditions. Based on this model, a novel double-line frequency dc-voltage ripple suppression control is proposed. This controller, together with the negative-and zero-sequence current control, could enhance the overall fault-tolerant capability of the HVDCmore » system without additional cost. To further improve the fault-tolerant capability, the operation performance of the HVDC system with and without single-phase switching is discussed and compared in detail. Lastly, simulation results from a three-phase MMC-HVDC system generated with MATLAB/Simulink are provided to support the theoretical analysis and proposed control schemes.« less

High speed flux feedback for tuning a universal field oriented controller capable of operating in direct and indirect field orientation modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Doncker, Rik W. A. A.

The direct (d) and quadrature (q) components of flux, as sensed by flux sensors or determined from voltage and current measurements in a direct field orientation scheme, are processed rapidly and accurately to provide flux amplitude and angular position values for use by the vector rotator of a universal field-oriented (UFO) controller. Flux amplitude (linear or squared) is provided as feedback to tune the UFO controller for operation in direct and indirect field orientation modes and enables smooth transitions from one mode to the other.

High speed flux feedback for tuning a universal field oriented controller capable of operating in direct and indirect field orientation modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Doncker, R.W.A.A.

The direct (d) and quadrature (q) components of flux, as sensed by flux sensors or determined from voltage and current measurements in a direct field orientation scheme, are processed rapidly and accurately to provide flux amplitude and angular position values for use by the vector rotator of a universal field-oriented (UFO) controller. Flux amplitude (linear or squared) is provided as feedback to tune the UFO controller for operation in direct and indirect field orientation modes and enables smooth transitions from one mode to the other. 3 figs.

High speed flux feedback for tuning a universal field oriented controller capable of operating in direct and indirect field orientation modes

DOEpatents

De Doncker, R.W.A.A.

1992-09-01

The direct (d) and quadrature (q) components of flux, as sensed by flux sensors or determined from voltage and current measurements in a direct field orientation scheme, are processed rapidly and accurately to provide flux amplitude and angular position values for use by the vector rotator of a universal field-oriented (UFO) controller. Flux amplitude (linear or squared) is provided as feedback to tune the UFO controller for operation in direct and indirect field orientation modes and enables smooth transitions from one mode to the other. 3 figs.

Pattern Recognition Application of Support Vector Machine for Fault Classification of Thyristor Controlled Series Compensated Transmission Lines

NASA Astrophysics Data System (ADS)

Yashvantrai Vyas, Bhargav; Maheshwari, Rudra Prakash; Das, Biswarup

2016-06-01

Application of series compensation in extra high voltage (EHV) transmission line makes the protection job difficult for engineers, due to alteration in system parameters and measurements. The problem amplifies with inclusion of electronically controlled compensation like thyristor controlled series compensation (TCSC) as it produce harmonics and rapid change in system parameters during fault associated with TCSC control. This paper presents a pattern recognition based fault type identification approach with support vector machine. The scheme uses only half cycle post fault data of three phase currents to accomplish the task. The change in current signal features during fault has been considered as discriminatory measure. The developed scheme in this paper is tested over a large set of fault data with variation in system and fault parameters. These fault cases have been generated with PSCAD/EMTDC on a 400 kV, 300 km transmission line model. The developed algorithm has proved better for implementation on TCSC compensated line with its improved accuracy and speed.

A DFIG Islanding Detection Scheme Based on Reactive Power Infusion

NASA Astrophysics Data System (ADS)

Wang, M.; Liu, C.; He, G. Q.; Li, G. H.; Feng, K. H.; Sun, W. W.

2017-07-01

A lot of research has been done on photovoltaic (the “PV”) power system islanding detection in recent years. As a comparison, much less attention has been paid to islanding in wind turbines. Meanwhile, wind turbines can work in islanding conditions for quite a long period, which can be harmful to equipments and cause safety hazards. This paper presents and examines a double fed introduction generation (the “DFIG”) islanding detection scheme based on feedback of reactive power and frequency and uses a trigger signal of reactive power infusion which can be obtained by dividing the voltage total harmonic distortion (the "THD") by the voltage THD of last cycle to avoid the deterioration of power quality. This DFIG islanding detection scheme uses feedback of reactive power current loop to amplify the frequency differences in islanding and normal conditions. Simulation results show that the DFIG islanding detection scheme is effective.

Third-harmonic generation in tunable nonlinear hyperbolic metamaterial

NASA Astrophysics Data System (ADS)

Wicharn, Surawut; Buranasiri, Prathan

2018-03-01

In this research, a third-harmonic generation (THG) in a tunable nonlinear hyperbolic metamaterial (TNHM) has been investigated numerically. The TNHM is consisted of periodically arranging of multilayered graphene layers system for controlled optical properties purpose, and ordinary nonlinear dielectric layer. The possibility of TNHM permittivity dispersion controlled by number of graphene layers and external bias voltage to graphene layers was satisfied, then the structure has created the nearly perfect phase-matching scheme based on epsilon-near-zero (ENZ) behavior of the nonlinear medium. Finally, the optimal designed TNHM structure with sufficient bias voltage have given the forwardand backward-direction TH pulses, which the backward-forward TH intensity ratio is closely unity. The THG conversion efficiencies have been maximized after increasing the pumping level to 800 MW/cm2 . From this study, the optimal designed TNHM can be applied as a bi-directional nonlinear frequency converters in nanophotonic systems.

A nonlinear control scheme based on dynamic evolution path theory for improved dynamic performance of boost PFC converter working on nonlinear features.

PubMed

Mohanty, Pratap Ranjan; Panda, Anup Kumar

2016-11-01

This paper is concerned to performance improvement of boost PFC converter under large random load fluctuation, ensuring unity power factor (UPF) at source end and regulated voltage at load side. To obtain such performance, a nonlinear controller based on dynamic evolution path theory is designed and its robustness is examined under both heavy and light loading condition. In this paper, %THD and zero-cross-over dead-zone of input current is significantly reduced. Also, very less response time of input current and output voltage to that of load and reference variation is remarked. A simulation model of proposed system is designed and it is realized using dSPACE 1104 signal processor for a 390V DC , 500W prototype. The relevant experimental and simulation waveforms are presented. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Intelligent voltage control strategy for three-phase UPS inverters with output LC filter

NASA Astrophysics Data System (ADS)

Jung, J. W.; Leu, V. Q.; Dang, D. Q.; Do, T. D.; Mwasilu, F.; Choi, H. H.

2015-08-01

This paper presents a supervisory fuzzy neural network control (SFNNC) method for a three-phase inverter of uninterruptible power supplies (UPSs). The proposed voltage controller is comprised of a fuzzy neural network control (FNNC) term and a supervisory control term. The FNNC term is deliberately employed to estimate the uncertain terms, and the supervisory control term is designed based on the sliding mode technique to stabilise the system dynamic errors. To improve the learning capability, the FNNC term incorporates an online parameter training methodology, using the gradient descent method and Lyapunov stability theory. Besides, a linear load current observer that estimates the load currents is used to exclude the load current sensors. The proposed SFNN controller and the observer are robust to the filter inductance variations, and their stability analyses are described in detail. The experimental results obtained on a prototype UPS test bed with a TMS320F28335 DSP are presented to validate the feasibility of the proposed scheme. Verification results demonstrate that the proposed control strategy can achieve smaller steady-state error and lower total harmonic distortion when subjected to nonlinear or unbalanced loads compared to the conventional sliding mode control method.

New Driving Scheme to Improve Hysteresis Characteristics of Organic Thin Film Transistor-Driven Active-Matrix Organic Light Emitting Diode Display

NASA Astrophysics Data System (ADS)

Yamamoto, Toshihiro; Nakajima, Yoshiki; Takei, Tatsuya; Fujisaki, Yoshihide; Fukagawa, Hirohiko; Suzuki, Mitsunori; Motomura, Genichi; Sato, Hiroto; Tokito, Shizuo; Fujikake, Hideo

2011-02-01

A new driving scheme for an active-matrix organic light emitting diode (AMOLED) display was developed to prevent the picture quality degradation caused by the hysteresis characteristics of organic thin film transistors (OTFTs). In this driving scheme, the gate electrode voltage of a driving-OTFT is directly controlled through the storage capacitor so that the operating point for the driving-OTFT is on the same hysteresis curve for every pixel after signal data are stored in the storage capacitor. Although the number of OTFTs in each pixel for the AMOLED display is restricted because OTFT size should be large enough to drive organic light emitting diodes (OLEDs) due to their small carrier mobility, it can improve the picture quality for an OTFT-driven flexible OLED display with the basic two transistor-one capacitor circuitry.

Photovoltaic Impact Assessment of Smart Inverter Volt-VAR Control on Distribution System Conservation Voltage Reduction and Power Quality

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Fei; Nagarajan, Adarsh; Chakraborty, Sudipta

This report presents an impact assessment study of distributed photovoltaic (PV) with smart inverter Volt-VAR control on conservation voltage reduction (CVR) energy savings and distribution system power quality. CVR is a methodology of flattening and lowering a distribution system voltage profile in order to conserve energy. Traditional CVR relies on operating utility voltage regulators and switched capacitors. However, with the increased penetration of distributed PV systems, smart inverters provide the new opportunity to control local voltage and power factor by regulating the reactive power output, leading to a potential increase in CVR energy savings. This report proposes a methodology tomore » implement CVR scheme by operating voltage regulators, capacitors, and autonomous smart inverter Volt-VAR control in order to achieve increased CVR benefit. Power quality is an important consideration when operating a distribution system, especially when implementing CVR. It is easy to measure the individual components that make up power quality, but a comprehensive method to incorporate all of these values into a single score has yet to be undertaken. As a result, this report proposes a power quality scoring mechanism to measure the relative power quality of distribution systems using a single number, which is aptly named the 'power quality score' (PQS). Both the CVR and PQS methodologies were applied to two distribution system models, one obtained from the Hawaiian Electric Company (HECO) and another obtained from Pacific Gas and Electric (PG&E). These two models were converted to the OpenDSS platform using previous model conversion tools that were developed by NREL. Multiple scenarios including various PV penetration levels and smart inverter densities were simulated to analyze the impact of smart inverter Volt-VAR support on CVR energy savings and feeder power quality. In order to analyze the CVR benefit and PQS, an annual simulation was conducted for each scenario.« less

MATLAB Simulation of UPQC for Power Quality Mitigation Using an Ant Colony Based Fuzzy Control Technique

PubMed Central

Kumarasabapathy, N.; Manoharan, P. S.

2015-01-01

This paper proposes a fuzzy logic based new control scheme for the Unified Power Quality Conditioner (UPQC) for minimizing the voltage sag and total harmonic distortion in the distribution system consequently to improve the power quality. UPQC is a recent power electronic module which guarantees better power quality mitigation as it has both series-active and shunt-active power filters (APFs). The fuzzy logic controller has recently attracted a great deal of attention and possesses conceptually the quality of the simplicity by tackling complex systems with vagueness and ambiguity. In this research, the fuzzy logic controller is utilized for the generation of reference signal controlling the UPQC. To enable this, a systematic approach for creating the fuzzy membership functions is carried out by using an ant colony optimization technique for optimal fuzzy logic control. An exhaustive simulation study using the MATLAB/Simulink is carried out to investigate and demonstrate the performance of the proposed fuzzy logic controller and the simulation results are compared with the PI controller in terms of its performance in improving the power quality by minimizing the voltage sag and total harmonic distortion. PMID:26504895

High Performance ZVT with Bus Clamping Modulation Technique for Single Phase Full Bridge Inverters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xia, Yinglai; Ayyanar, Raja

2016-03-20

This paper proposes a topology based on bus clamping modulation and zero-voltage-transition (ZVT) technique to realize zero-voltage-switching (ZVS) for all the main switches of the full bridge inverters, and inherent ZVS and/or ZCS for the auxiliary switches. The advantages of the strategy include significant reduction in the turn-on loss of the ZVT auxiliary switches which typically account for a major part of the total loss in other ZVT circuits, and reduction in the voltage ratings of auxiliary switches. The modulation scheme and the commutation stages are analyzed in detail. Finally, a 1kW, 500 kHz switching frequency inverter of the proposedmore » topology using SiC MOSFETs has been built to validate the theoretical analysis. The ZVT with bus clamping modulation technique of fixed timing and adaptive timing schemes are implemented in DSP TMS320F28335 resulting in full ZVS for the main switches in the full bridge inverter. The proposed scheme can save up to 33 % of the switching loss compared with no ZVT case.« less

A compact bipolar pulse-forming network-Marx generator based on pulse transformers.

PubMed

Zhang, Huibo; Yang, Jianhua; Lin, Jiajin; Yang, Xiao

2013-11-01

A compact bipolar pulse-forming network (PFN)-Marx generator based on pulse transformers is presented in this paper. The high-voltage generator consisted of two sets of pulse transformers, 6 stages of PFNs with ceramic capacitors, a switch unit, and a matched load. The design is characterized by the bipolar pulse charging scheme and the compact structure of the PFN-Marx. The scheme of bipolar charging by pulse transformers increased the withstand voltage of the ceramic capacitors in the PFNs and decreased the number of the gas gap switches. The compact structure of the PFN-Marx was aimed at reducing the parasitic inductance in the generator. When the charging voltage on the PFNs was 35 kV, the matched resistive load of 48 Ω could deliver a high-voltage pulse with an amplitude of 100 kV. The full width at half maximum of the load pulse was 173 ns, and its rise time was less than 15 ns.

Microwatt power consumption maximum power point tracking circuit using an analogue differentiator for piezoelectric energy harvesting

NASA Astrophysics Data System (ADS)

Chew, Z. J.; Zhu, M.

2015-12-01

A maximum power point tracking (MPPT) scheme by tracking the open-circuit voltage from a piezoelectric energy harvester using a differentiator is presented in this paper. The MPPT controller is implemented by using a low-power analogue differentiator and comparators without the need of a sensing circuitry and a power hungry controller. This proposed MPPT circuit is used to control a buck converter which serves as a power management module in conjunction with a full-wave bridge diode rectifier. Performance of this MPPT control scheme is verified by using the prototyped circuit to track the maximum power point of a macro-fiber composite (MFC) as the piezoelectric energy harvester. The MFC was bonded on a composite material and the whole specimen was subjected to various strain levels at frequency from 10 to 100 Hz. Experimental results showed that the implemented full analogue MPPT controller has a tracking efficiency between 81% and 98.66% independent of the load, and consumes an average power of 3.187 μW at 3 V during operation.

Modular Cascaded H-Bridge Multilevel PV Inverter with Distributed MPPT for Grid-Connected Applications

DOE PAGES

Xiao, Bailu; Hang, Lijun; Mei, Jun; ...

2014-09-04

This paper presents a modular cascaded H-bridge multilevel photovoltaic (PV) inverter for single- or three-phase grid-connected applications. The modular cascaded multilevel topology helps to improve the efficiency and flexibility of PV systems. To realize better utilization of PV modules and maximize the solar energy extraction, a distributed maximum power point tracking (MPPT) control scheme is applied to both single-phase and three-phase multilevel inverters, which allows the independent control of each dc-link voltage. For three-phase grid-connected applications, PV mismatches may introduce unbalanced supplied power, leading to unbalanced grid current. To solve this issue, a control scheme with modulation compensation is alsomore » proposed. An experimental three-phase 7-level cascaded H-bridge inverter has been built utilizing 9 H-bridge modules (3 modules per phase). Each H-bridge module is connected to a 185 W solar panel. Simulation and experimental results are presented to verify the feasibility of the proposed approach.« less

Constant Switching Frequency DTC for Matrix Converter Fed Speed Sensorless Induction Motor Drive

NASA Astrophysics Data System (ADS)

Mir, Tabish Nazir; Singh, Bhim; Bhat, Abdul Hamid

2018-05-01

The paper presents a constant switching frequency scheme for speed sensorless Direct Torque Control (DTC) of Matrix Converter fed Induction Motor Drive. The use of matrix converter facilitates improved power quality on input as well as motor side, along with Input Power Factor control, besides eliminating the need for heavy passive elements. Moreover, DTC through Space Vector Modulation helps in achieving a fast control over the torque and flux of the motor, with added benefit of constant switching frequency. A constant switching frequency aids in maintaining desired power quality of AC mains current even at low motor speeds, and simplifies input filter design of the matrix converter, as compared to conventional hysteresis based DTC. Further, stator voltage estimation from sensed input voltage, and subsequent stator (and rotor) flux estimation is done. For speed sensorless operation, a Model Reference Adaptive System is used, which emulates the speed dependent rotor flux equations of the induction motor. The error between conventionally estimated rotor flux (reference model) and the rotor flux estimated through the adaptive observer is processed through PI controller to generate the rotor speed estimate.

Racetrack-shape fixed field induction accelerator for giant cluster ions

NASA Astrophysics Data System (ADS)

Takayama, Ken; Adachi, Toshikazu; Wake, Masayoshi; Okamura, Katsuya

2015-05-01

A novel scheme for a racetrack-shape fixed field induction accelerator (RAFFIA) capable of accelerating extremely heavy cluster ions (giant cluster ions) is described. The key feature of this scheme is rapid induction acceleration by localized induction cells. Triggering the induction voltages provided by the signals from the circulating bunch allows repeated acceleration of extremely heavy cluster ions. The given RAFFIA example is capable of realizing the integrated acceleration voltage of 50 MV per acceleration cycle. Using 90° bending magnets with a reversed field strip and field gradient is crucial for assuring orbit stability in the RAFFIA.

Design of neural network model-based controller in a fed-batch microbial electrolysis cell reactor for bio-hydrogen gas production

NASA Astrophysics Data System (ADS)

Azwar; Hussain, M. A.; Abdul-Wahab, A. K.; Zanil, M. F.; Mukhlishien

2018-03-01

One of major challenge in bio-hydrogen production process by using MEC process is nonlinear and highly complex system. This is mainly due to the presence of microbial interactions and highly complex phenomena in the system. Its complexity makes MEC system difficult to operate and control under optimal conditions. Thus, precise control is required for the MEC reactor, so that the amount of current required to produce hydrogen gas can be controlled according to the composition of the substrate in the reactor. In this work, two schemes for controlling the current and voltage of MEC were evaluated. The controllers evaluated are PID and Inverse neural network (NN) controller. The comparative study has been carried out under optimal condition for the production of bio-hydrogen gas wherein the controller output is based on the correlation of optimal current and voltage to the MEC. Various simulation tests involving multiple set-point changes and disturbances rejection have been evaluated and the performances of both controllers are discussed. The neural network-based controller results in fast response time and less overshoots while the offset effects are minimal. In conclusion, the Inverse neural network (NN)-based controllers provide better control performance for the MEC system compared to the PID controller.

Effect of Extended State Observer and Automatic Voltage Regulator on Synchronous Machine Connected to Infinite Bus Power System

NASA Astrophysics Data System (ADS)

Angu, Rittu; Mehta, R. K.

2018-04-01

This paper presents a robust controller known as Extended State Observer (ESO) in order to improve the stability and voltage regulation of a synchronous machine connected to an infinite bus power system through a transmission line. The ESO-based control scheme is implemented with an automatic voltage regulator in conjunction with an excitation system to enhance the damping of low frequency power system oscillations, as the Power System Stabilizer (PSS) does. The implementation of PSS excitation control techniques however requires reliable information about the entire states, though they are not always directly measureable. To address this issue, the proposed ESO provides the estimate of system states as well as disturbance state together in order to improve not only the damping but also compensates system efficiently in presence of parameter uncertainties and external disturbances. The Closed-Loop Poles (CLPs) of the system have been assigned by the symmetric root locus technique, with the desired level of system damping provided by the dominant CLPs. The performance of the system is analyzed through simulating at different operating conditions. The control method is not only capable of providing zero estimation error in steady-state, but also shows robustness in tracking the reference command under parametric variations and external disturbances. Illustrative examples have been provided to demonstrate the effectiveness of the developed methodology.

A Constant Energy-Per-Cycle Ring Oscillator Over a Wide Frequency Range for Wireless Sensor Nodes

PubMed Central

Lee, Inhee; Sylvester, Dennis; Blaauw, David

2016-01-01

This paper presents an energy-efficient oscillator for wireless sensor nodes (WSNs). It avoids short-circuit current by minimizing the time spent in the input voltage range from Vthn to [Vdd − |Vthp|]. A current-feeding scheme with gate voltage control enables the oscillator to operate over a wide frequency range. A test chip is fabricated in a 0.18 μm CMOS process. The measurements show that the proposed oscillator achieves a constant energy-per-cycle (EpC) of 0.8 pJ/cycle over the 21–60 MHz frequency range and is more efficient than a conventional current-starved ring oscillator (CSRO) below 300 kHz at 1.8 V supply voltage. As an application example, the proposed oscillator is implemented in a switched-capacitor DC–DC converter. The converter is 11%–56% more efficient for load power values ranging from 583 pW to 2.9 nW than a converter using a conventional CSRO. PMID:27546899

A Constant Energy-Per-Cycle Ring Oscillator Over a Wide Frequency Range for Wireless Sensor Nodes.

PubMed

Lee, Inhee; Sylvester, Dennis; Blaauw, David

2016-03-01

This paper presents an energy-efficient oscillator for wireless sensor nodes (WSNs). It avoids short-circuit current by minimizing the time spent in the input voltage range from V thn to [ V dd - | V thp |]. A current-feeding scheme with gate voltage control enables the oscillator to operate over a wide frequency range. A test chip is fabricated in a 0.18 μm CMOS process. The measurements show that the proposed oscillator achieves a constant energy-per-cycle (EpC) of 0.8 pJ/cycle over the 21-60 MHz frequency range and is more efficient than a conventional current-starved ring oscillator (CSRO) below 300 kHz at 1.8 V supply voltage. As an application example, the proposed oscillator is implemented in a switched-capacitor DC-DC converter. The converter is 11%-56% more efficient for load power values ranging from 583 pW to 2.9 nW than a converter using a conventional CSRO.

RTDS implementation of an improved sliding mode based inverter controller for PV system.

PubMed

Islam, Gazi; Muyeen, S M; Al-Durra, Ahmed; Hasanien, Hany M

2016-05-01

This paper proposes a novel approach for testing dynamics and control aspects of a large scale photovoltaic (PV) system in real time along with resolving design hindrances of controller parameters using Real Time Digital Simulator (RTDS). In general, the harmonic profile of a fast controller has wide distribution due to the large bandwidth of the controller. The major contribution of this paper is that the proposed control strategy gives an improved voltage harmonic profile and distribute it more around the switching frequency along with fast transient response; filter design, thus, becomes easier. The implementation of a control strategy with high bandwidth in small time steps of Real Time Digital Simulator (RTDS) is not straight forward. This paper shows a good methodology for the practitioners to implement such control scheme in RTDS. As a part of the industrial process, the controller parameters are optimized using particle swarm optimization (PSO) technique to improve the low voltage ride through (LVRT) performance under network disturbance. The response surface methodology (RSM) is well adapted to build analytical models for recovery time (Rt), maximum percentage overshoot (MPOS), settling time (Ts), and steady state error (Ess) of the voltage profile immediate after inverter under disturbance. A systematic approach of controller parameter optimization is detailed. The transient performance of the PSO based optimization method applied to the proposed sliding mode controlled PV inverter is compared with the results from genetic algorithm (GA) based optimization technique. The reported real time implementation challenges and controller optimization procedure are applicable to other control applications in the field of renewable and distributed generation systems. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Fuel Cell/Electrochemical Cell Voltage Monitor

NASA Technical Reports Server (NTRS)

Vasquez, Arturo

2012-01-01

A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.

Compact, Energy-Efficient High-Frequency Switched Capacitor Neural Stimulator With Active Charge Balancing.

PubMed

Hsu, Wen-Yang; Schmid, Alexandre

2017-08-01

Safety and energy efficiency are two major concerns for implantable neural stimulators. This paper presents a novel high-frequency, switched capacitor (HFSC) stimulation and active charge balancing scheme, which achieves high energy efficiency and well-controlled stimulation charge in the presence of large electrode impedance variations. Furthermore, the HFSC can be implemented in a compact size without any external component to simultaneously enable multichannel stimulation by deploying multiple stimulators. The theoretical analysis shows significant benefits over the constant-current and voltage-mode stimulation methods. The proposed solution was fabricated using a 0.18 μm high-voltage technology, and occupies only 0.035 mm 2 for a single stimulator. The measurement result shows 50% peak energy efficiency and confirms the effectiveness of active charge balancing to prevent the electrode dissolution.

Design and Implementation of Improved Electronic Load Controller for Self-Excited Induction Generator for Rural Electrification

PubMed Central

Kathirvel, C.; Porkumaran, K.; Jaganathan, S.

2015-01-01

This paper offers an alternative technique, namely, Improved Electronic Load Controller (IELC), which is proposal to improve power quality, maintaining voltage at frequency desired level for rural electrification. The design and development of IELC are considered as microhydroenergy system. The proposed work aims to concentrate on the new schemes for rural electrification with the help of different kinds of hybrid energy systems. The objective of the proposed scheme is to maintain the speed of generation against fluctuating rural demand. The Electronic Load Controller (ELC) is used to connect and disconnect the dump load during the operation of the system, and which absorbs the load when consumer are not in active will enhance the lifestyle of the rural population and improve the living standards. Hydroelectricity is a promising option for electrification of remote villages in India. The conventional methods are not suitable to act as standalone system. Hence, the designing of a proper ELC is essential. The improved electronic load control performance tested with simulation at validated through hardware setup. PMID:26783553

Design and Implementation of Improved Electronic Load Controller for Self-Excited Induction Generator for Rural Electrification.

PubMed

Kathirvel, C; Porkumaran, K; Jaganathan, S

2015-01-01

This paper offers an alternative technique, namely, Improved Electronic Load Controller (IELC), which is proposal to improve power quality, maintaining voltage at frequency desired level for rural electrification. The design and development of IELC are considered as microhydroenergy system. The proposed work aims to concentrate on the new schemes for rural electrification with the help of different kinds of hybrid energy systems. The objective of the proposed scheme is to maintain the speed of generation against fluctuating rural demand. The Electronic Load Controller (ELC) is used to connect and disconnect the dump load during the operation of the system, and which absorbs the load when consumer are not in active will enhance the lifestyle of the rural population and improve the living standards. Hydroelectricity is a promising option for electrification of remote villages in India. The conventional methods are not suitable to act as standalone system. Hence, the designing of a proper ELC is essential. The improved electronic load control performance tested with simulation at validated through hardware setup.

The electromagnetic environment in CFC structures

NASA Technical Reports Server (NTRS)

Hardwick, C. J.; Haigh, S. J.

1991-01-01

Extensive measurements of induced voltages and currents were made using a CFC (carbon fiber composites) horizontal stabilizer from the A320 as a test bed. The work was done to investigate the efficacy of various protection schemes to reduce the magnitudes of the induced voltages and validate a computer program INDCAL. Results indicate that a good understanding of the various induced voltage mechanisms including the long wave effect due to current redistribution was obtained.

Geosynchronous Performance of a Lithium-titanium Disulfide Battery

NASA Technical Reports Server (NTRS)

Otzinger, B.

1985-01-01

An ambient temperature rechargeable Lithium-Titanium disulfide (Li-TiS2) five cell battery has completed the first orbital year of accelerated synchronous orbit testing. A novel charge/discharge, state of charge (SOC) control scheme is utilized, together with taper current charge backup to overcome deleterious effects associated with high end of charge and low end of discharge voltages. It is indicated that 10 orbital years of simulated synchronous operation may be achieved. Preliminary findings associated with cell matching and battery performance are identified.

Robust control of the DC-DC boost converter based on the uncertainty and disturbance estimator

NASA Astrophysics Data System (ADS)

Oucheriah, Said

2017-11-01

In this paper, a robust non-linear controller based on the uncertainty and disturbance estimator (UDE) scheme is successfully developed and implemented for the output voltage regulation of the DC-DC boost converter. System uncertainties, external disturbances and unknown non-linear dynamics are lumped as a signal that is accurately estimated using a low-pass filter and their effects are cancelled by the controller. This methodology forms the basis of the UDE-based controller. A simple procedure is also developed that systematically determines the parameters of the controller to meet certain specifications. Using simulation, the effectiveness of the proposed controller is compared against the sliding-mode control (SMC). Experimental tests also show that the proposed controller is robust to system uncertainties, large input and load perturbations.

AC motor controller with 180 degree conductive switches

NASA Technical Reports Server (NTRS)

Oximberg, Carol A. (Inventor)

1995-01-01

An ac motor controller is operated by a modified time-switching scheme where the switches of the inverter are on for electrical-phase-and-rotation intervals of 180.degree. as opposed to the conventional 120.degree.. The motor is provided with three-phase drive windings, a power inverter for power supplied from a dc power source consisting of six switches, and a motor controller which controls the current controlled switches in voltage-fed mode. During full power, each switch is gated continuously for three successive intervals of 60.degree. and modulated for only one of said intervals. Thus, during each 60.degree. interval, the two switches with like signs are on continuously and the switch with the opposite sign is modulated.

Addressing On-Chip Power Converstion and Dissipation Issues in Many-Core System-on-a-Chip Based on Conventional Silicon and Emerging Nanotechnologies

NASA Astrophysics Data System (ADS)

Ashenafi, Emeshaw

Integrated circuits (ICs) are moving towards system-on-a-chip (SOC) designs. SOC allows various small and large electronic systems to be implemented in a single chip. This approach enables the miniaturization of design blocks that leads to high density transistor integration, faster response time, and lower fabrication costs. To reap the benefits of SOC and uphold the miniaturization of transistors, innovative power delivery and power dissipation management schemes are paramount. This dissertation focuses on on-chip integration of power delivery systems and managing power dissipation to increase the lifetime of energy storage elements. We explore this problem from two different angels: On-chip voltage regulators and power gating techniques. On-chip voltage regulators reduce parasitic effects, and allow faster and efficient power delivery for microprocessors. Power gating techniques, on the other hand, reduce the power loss incurred by circuit blocks during standby mode. Power dissipation (Ptotal = Pstatic and Pdynamic) in a complementary metal-oxide semiconductor (CMOS) circuit comes from two sources: static and dynamic. A quadratic dependency on the dynamic switching power and a more than linear dependency on static power as a form of gate leakage (subthreshold current) exist. To reduce dynamic power loss, the supply power should be reduced. A significant reduction in power dissipation occurs when portions of a microprocessor operate at a lower voltage level. This reduction in supply voltage is achieved via voltage regulators or converters. Voltage regulators are used to provide a stable power supply to the microprocessor. The conventional off-chip switching voltage regulator contains a passive floating inductor, which is difficult to be implemented inside the chip due to excessive power dissipation and parasitic effects. Additionally, the inductor takes a very large chip area while hampering the scaling process. These limitations make passive inductor based on-chip regulator design very unattractive for SOC integration and multi-/many-core environments. To circumvent the challenges, three alternative techniques based on active circuit elements to replace the passive LC filter of the buck convertor are developed. The first inductorless on-chip switching voltage regulator architecture is based on a cascaded 2nd order multiple feedback (MFB) low-pass filter (LPF). This design has the ability to modulate to multiple voltage settings via pulse-with modulation (PWM). The second approach is a supplementary design utilizing a hybrid low drop-out scheme to lower the output ripple of the switching regulator over a wider frequency range. The third design approach allows the integration of an entire power management system within a single chipset by combining a highly efficient switching regulator with an intermittently efficient linear regulator (area efficient), for robust and highly efficient on-chip regulation. The static power (Pstatic) or subthreshold leakage power (Pleak) increases with technology scaling. To mitigate static power dissipation, power gating techniques are implemented. Power gating is one of the popular methods to manage leakage power during standby periods in low-power high-speed IC design. It works by using transistor based switches to shut down part of the circuit block and put them in the idle mode. The efficiency of a power gating scheme involves minimum Ioff and high Ion for the sleep transistor. A conventional sleep transistor circuit design requires an additional header, footer, or both switches to turn off the logic block. This additional transistor causes signal delay and increases the chip area. We propose two innovative designs for next generation sleep transistor designs. For an above threshold operation, we present a sleep transistor design based on fully depleted silicon-on-insulator (FDSOI) device. For a subthreshold circuit operation, we implement a sleep transistor utilizing the newly developed silicon-on-ferroelectric-insulator field effect transistor (SOFFET). In both of the designs, the ability to control the threshold voltage via bias voltage at the back gate makes both devices more flexible for sleep transistors design than a bulk MOSFET. The proposed approaches simplify the design complexity, reduce the chip area, eliminate the voltage drop by sleep transistor, and improve power dissipation. In addition, the design provides a dynamically controlled Vt for times when the circuit needs to be in a sleep or switching mode.

Flyback CCM inverter for AC module applications: iterative learning control and convergence analysis

NASA Astrophysics Data System (ADS)

Lee, Sung-Ho; Kim, Minsung

2017-12-01

This paper presents an iterative learning controller (ILC) for an interleaved flyback inverter operating in continuous conduction mode (CCM). The flyback CCM inverter features small output ripple current, high efficiency, and low cost, and hence it is well suited for photovoltaic power applications. However, it exhibits the non-minimum phase behaviour, because its transfer function from control duty to output current has the right-half-plane (RHP) zero. Moreover, the flyback CCM inverter suffers from the time-varying grid voltage disturbance. Thus, conventional control scheme results in inaccurate output tracking. To overcome these problems, the ILC is first developed and applied to the flyback inverter operating in CCM. The ILC makes use of both predictive and current learning terms which help the system output to converge to the reference trajectory. We take into account the nonlinear averaged model and use it to construct the proposed controller. It is proven that the system output globally converges to the reference trajectory in the absence of state disturbances, output noises, or initial state errors. Numerical simulations are performed to validate the proposed control scheme, and experiments using 400-W AC module prototype are carried out to demonstrate its practical feasibility.

Strategies for dynamic soft-landing in capacitive microelectromechanical switches

NASA Astrophysics Data System (ADS)

Jain, Ankit; Nair, Pradeep R.; Alam, Muhammad A.

2011-06-01

Electromechanical dielectric degradation associated with the hard landing of movable electrode is a technology-inhibiting reliability concern for capacitive RF-MEMS switches. In this letter, we propose two schemes for dynamic soft-landing that obviate the need for external feedback circuitry. Instead, the proposed resistive and capacitive braking schemes can reduce impact velocity significantly without compromising other performance characteristics like pull-in voltage and pull-in time. Resistive braking is achieved by inserting a resistance in series with the voltage source whereas capacitive braking requires patterning of the electrode or the dielectric. Our results have important implications to the design and optimization of reliability aware electrostatically actuated MEMS switches.

Central safety factor and β N control on NSTX-U via beam power and plasma boundary shape modification, using TRANSP for closed loop simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyer, M. D.; Andre, R.; Gates, D. A.

The high-performance operational goals of NSTX-U will require development of advanced feedback control algorithms, including control of ßN and the safety factor profile. In this work, a novel approach to simultaneously controlling ßN and the value of the safety factor on the magnetic axis, q0, through manipulation of the plasma boundary shape and total beam power, is proposed. Simulations of the proposed scheme show promising results and motivate future experimental implementation and eventual integration into a more complex current profile control scheme planned to include actuation of individual beam powers, density, and loop voltage. As part of this work, amore » flexible framework for closed loop simulations within the high-fidelity code TRANSP was developed. The framework, used here to identify control-design-oriented models and to tune and test the proposed controller, exploits many of the predictive capabilities of TRANSP and provides a means for performing control calculations based on user-supplied data (controller matrices, target waveforms, etc.). The flexible framework should enable high-fidelity testing of a variety of control algorithms, thereby reducing the amount of expensive experimental time needed to implement new control algorithms on NSTX-U and other devices.« less

Central safety factor and βN control on NSTX-U via beam power and plasma boundary shape modification, using TRANSP for closed loop simulations

NASA Astrophysics Data System (ADS)

Boyer, M. D.; Andre, R.; Gates, D. A.; Gerhardt, S.; Goumiri, I. R.; Menard, J.

2015-05-01

The high-performance operational goals of NSTX-U will require development of advanced feedback control algorithms, including control of βN and the safety factor profile. In this work, a novel approach to simultaneously controlling βN and the value of the safety factor on the magnetic axis, q0, through manipulation of the plasma boundary shape and total beam power, is proposed. Simulations of the proposed scheme show promising results and motivate future experimental implementation and eventual integration into a more complex current profile control scheme planned to include actuation of individual beam powers, density, and loop voltage. As part of this work, a flexible framework for closed loop simulations within the high-fidelity code TRANSP was developed. The framework, used here to identify control-design-oriented models and to tune and test the proposed controller, exploits many of the predictive capabilities of TRANSP and provides a means for performing control calculations based on user-supplied data (controller matrices, target waveforms, etc). The flexible framework should enable high-fidelity testing of a variety of control algorithms, thereby reducing the amount of expensive experimental time needed to implement new control algorithms on NSTX-U and other devices.

Self-addressed diffractive lens schemes for the characterization of LCoS displays

NASA Astrophysics Data System (ADS)

Zhang, Haolin; Lizana, Angel; Iemmi, Claudio; Monroy-Ramírez, Freddy A.; Marquez, Andrés.; Moreno, Ignacio; Campos, Juan

2018-02-01

We proposed a self-calibration method to calibrate both the phase-voltage look-up table and the screen phase distribution of Liquid Crystal on Silicon (LCoS) displays by implementing different lens configurations on the studied device within a same optical scheme. On the one hand, the phase-voltage relation is determined from interferometric measurements, which are obtained by addressing split-lens phase distributions on the LCoS display. On the other hand, the surface profile is retrieved by self-addressing a diffractive micro-lens array to the LCoS display, in a way that we configure a Shack-Hartmann wavefront sensor that self-determines the screen spatial variations. Moreover, both the phase-voltage response and the surface phase inhomogeneity of the LCoS are measured within the same experimental set-up, without the necessity of further adjustments. Experimental results prove the usefulness of the above-mentioned technique for LCoS displays characterization.

30 CFR 75.800-2 - Approved circuit schemes.

Code of Federal Regulations, 2010 CFR

2010-07-01

... necessary protection to the circuits required by § 75.800: (a) Ground check relays may be used for undervoltage protection if the relay coils are designed to trip the circuit breaker when line voltage decreases to 40 percent to 60 percent of the nominal line voltage; (b) Ground trip relays on resistance...

30 CFR 75.800-2 - Approved circuit schemes.

Code of Federal Regulations, 2011 CFR

2011-07-01

... necessary protection to the circuits required by § 75.800: (a) Ground check relays may be used for undervoltage protection if the relay coils are designed to trip the circuit breaker when line voltage decreases to 40 percent to 60 percent of the nominal line voltage; (b) Ground trip relays on resistance...

Agent-based power sharing scheme for active hybrid power sources

NASA Astrophysics Data System (ADS)

Jiang, Zhenhua

The active hybridization technique provides an effective approach to combining the best properties of a heterogeneous set of power sources to achieve higher energy density, power density and fuel efficiency. Active hybrid power sources can be used to power hybrid electric vehicles with selected combinations of internal combustion engines, fuel cells, batteries, and/or supercapacitors. They can be deployed in all-electric ships to build a distributed electric power system. They can also be used in a bulk power system to construct an autonomous distributed energy system. An important aspect in designing an active hybrid power source is to find a suitable control strategy that can manage the active power sharing and take advantage of the inherent scalability and robustness benefits of the hybrid system. This paper presents an agent-based power sharing scheme for active hybrid power sources. To demonstrate the effectiveness of the proposed agent-based power sharing scheme, simulation studies are performed for a hybrid power source that can be used in a solar car as the main propulsion power module. Simulation results clearly indicate that the agent-based control framework is effective to coordinate the various energy sources and manage the power/voltage profiles.

Research on cost control and management in high voltage transmission line construction

NASA Astrophysics Data System (ADS)

Xu, Xiaobin

2017-05-01

Enterprises. The cost control is of vital importance to the construction enterprises. It is the key to the profitability of the transmission line project, which is related to the survival and development of the electric power construction enterprises. Due to the long construction line, complex and changeable construction terrain as well as large construction costs of transmission line, it is difficult for us to take accurate and effective cost control on the project implementation of entire transmission line. Therefore, the cost control of transmission line project is a complicated and arduous task. It is of great theoretical and practical significance to study the cost control scheme of transmission line project by a more scientific and efficient way. Based on the characteristics of the construction project of the transmission line project, this paper analyzes the construction cost structure of the transmission line project and the current cost control problem of the transmission line project, and demonstrates the necessity and feasibility of studying the cost control scheme of the transmission line project more accurately. In this way, the dynamic cycle cost control process including plan, implementation, feedback, correction, modification and re-implement is achieved to realize the accurate and effective cost control of entire electric power transmission line project.

Integration of offshore wind farms through high voltage direct current networks

NASA Astrophysics Data System (ADS)

Livermore, Luke

The integration of offshore wind farms through Multi Terminal DC (MTDC) networks into the GB network was investigated. The ability of Voltage Source Converter (VSC) High Voltage Direct Current (HVDC) to damp Subsynchronous Resonance (SSR) and ride through onshore AC faults was studied. Due to increased levels of wind generation in Scotland, substantial onshore and offshore reinforcements to the GB transmission network are proposed. Possible inland reinforcements include the use of series compensation through fixed capacitors. This potentially can lead to SSR. Offshore reinforcements are proposed by two HVDC links. In addition to its primary functions of bulk power transmission, a HVDC link can be used to provide damping against SSR, and this function has been modelled. Simulation studies have been carried out in PSCAD. In addition, a real-time hardware-in-the-loop HVDC test rig has been used to implement and validate the proposed damping scheme on an experimental platform. When faults occur within AC onshore networks, offshore MTDC networks are vulnerable to DC overvoltages, potentially damaging the DC plant and cables. Power reduction and power dissipation control systems were investigated to ride through onshore AC faults. These methods do not require dedicated fast communication systems. Simulations and laboratory experiments are carried out to evaluate the control systems, with the results from the two platforms compared..

A PDE-based methodology for modeling, parameter estimation and feedback control in structural and structural acoustic systems

NASA Technical Reports Server (NTRS)

Banks, H. T.; Brown, D. E.; Metcalf, Vern L.; Silcox, R. J.; Smith, Ralph C.; Wang, Yun

1994-01-01

A problem of continued interest concerns the control of vibrations in a flexible structure and the related problem of reducing structure-borne noise in structural acoustic systems. In both cases, piezoceramic patches bonded to the structures have been successfully used as control actuators. Through the application of a controlling voltage, the patches can be used to reduce structural vibrations which in turn lead to methods for reducing structure-borne noise. A PDE-based methodology for modeling, estimating physical parameters, and implementing a feedback control scheme for problems of this type is discussed. While the illustrating example is a circular plate, the methodology is sufficiently general so as to be applicable in a variety of structural and structural acoustic systems.

Adaptive control of base-isolated buildings using piezoelectric friction dampers against near-field earthquakes

NASA Astrophysics Data System (ADS)

Bitaraf, Maryam; Ozbulut, Osman E.; Hurlebaus, Stefan

2010-04-01

This paper investigates the effectiveness of two adaptive control strategies for modulating control force of piezoelectric friction dampers (PFDs) that are employed as semi-active devices in combination with laminated rubber bearings for seismic protection of buildings. The first controller developed in this study is a direct adaptive fuzzy logic controller. It consists of an upper-level and a sub-level direct fuzzy controller. In the hierarchical control scheme, higher-level controller modifies universe of discourse of both premise and consequent variables of the sub-level controller using scaling factors in order to determine command voltage of the damper according to current level of ground motion. The sub-level fuzzy controller employs isolation displacement and velocity as its premise variables and command voltage as its consequent variable. The second controller is based on the simple adaptive control (SAC) method, which is a type of direct adaptive control approach. The objective of the SAC method is to make the plant, the controlled system, track the behavior of the structure with the optimum performance. By using SAC strategy, any change in the characteristics of the structure or uncertainties in the modeling of the structure and in the external excitation would be considered because it continuously monitors its own performance to modify its parameters. Here, SAC methodology is employed to obtain the required force which results in the optimum performance of the structure. Then, the command voltage of the PFD is determined to generate the desired force. For comparison purposes, an optimal controller is also developed and considered in the simulations together with maximum passive operation of the friction damper. Time-history analyses of a base-isolated five-story building are performed to evaluate the performance of the controllers. Results reveal that developed adaptive controllers can successfully improve seismic response of the base-isolated buildings against various types of earthquakes.

A dual V t disturb-free subthreshold SRAM with write-assist and read isolation

NASA Astrophysics Data System (ADS)

Bhatnagar, Vipul; Kumar, Pradeep; Pandey, Neeta; Pandey, Sujata

2018-02-01

This paper presents a new dual V t 8T SRAM cell having single bit-line read and write, in addition to Write Assist and Read Isolation (WARI). Also a faster write back scheme is proposed for the half selected cells. A high V t device is used for interrupting the supply to one of the inverters for weakening the feedback loop for assisted write. The proposed cell provides an improved read static noise margin (RSNM) due to the bit-line isolation during the read. Static noise margins for data read (RSNM), write (WSNM), read delay, write delay, data retention voltage (DRV), leakage and average powers have been calculated. The proposed cell was found to operate properly at a supply voltage as small as 0.41 V. A new write back scheme has been suggested for half-selected cells, which uses a single NMOS access device and provides reduced delay, pulse timing hardware requirements and power consumption. The proposed new WARI 8T cell shows better performance in terms of easier write, improved read noise margin, reduced leakage power, and less delay as compared to the existing schemes that have been available so far. It was also observed that with proper adjustment of the cell ratio the supply voltage can further be reduced to 0.2 V.

MTPA control of mechanical sensorless IPMSM based on adaptive nonlinear control.

PubMed

Najjar-Khodabakhsh, Abbas; Soltani, Jafar

2016-03-01

In this paper, an adaptive nonlinear control scheme has been proposed for implementing maximum torque per ampere (MTPA) control strategy corresponding to interior permanent magnet synchronous motor (IPMSM) drive. This control scheme is developed in the rotor d-q axis reference frame using adaptive input-output state feedback linearization (AIOFL) method. The drive system control stability is supported by Lyapunov theory. The motor inductances are online estimated by an estimation law obtained by AIOFL. The estimation errors of these parameters are proved to be asymptotically converged to zero. Based on minimizing the motor current amplitude, the MTPA control strategy is performed by using the nonlinear optimization technique while considering the online reference torque. The motor reference torque is generated by a conventional rotor speed PI controller. By performing MTPA control strategy, the generated online motor d-q reference currents were used in AIOFL controller to obtain the SV-PWM reference voltages and the online estimation of the motor d-q inductances. In addition, the stator resistance is online estimated using a conventional PI controller. Moreover, the rotor position is detected using the online estimation of the stator flux and online estimation of the motor q-axis inductance. Simulation and experimental results obtained prove the effectiveness and the capability of the proposed control method. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Rapid flow fractionation of particles combining liquid and particulate dielectrophoresis

NASA Technical Reports Server (NTRS)

King, Michael R. (Inventor); Lomakin, Oleg (Inventor); Jones, Thomas B. (Inventor); Ahmed, Rajib (Inventor)

2007-01-01

Rapid, size-based, deposition of particles from liquid suspension is accomplished using a nonuniform electric field created by coplanar microelectrode strips patterned on an insulating substrate. The scheme uses the dielectrophoretic force both to distribute aqueous liquid containing particles and, simultaneously, to separate the particles. Size-based separation is found within nanoliter droplets formed along the structure after voltage removal. Bioparticles or macromolecules of similar size can also be separated based on subtle differences in dielectric property, by controlling the frequency of the AC current supplied to the electrodes.

A new deflection technique applied to an existing scheme of electrostatic accelerator for high energy neutral beam injection in fusion reactor devices

NASA Astrophysics Data System (ADS)

Pilan, N.; Antoni, V.; De Lorenzi, A.; Chitarin, G.; Veltri, P.; Sartori, E.

2016-02-01

A scheme of a neutral beam injector (NBI), based on electrostatic acceleration and magneto-static deflection of negative ions, is proposed and analyzed in terms of feasibility and performance. The scheme is based on the deflection of a high energy (2 MeV) and high current (some tens of amperes) negative ion beam by a large magnetic deflector placed between the Beam Source (BS) and the neutralizer. This scheme has the potential of solving two key issues, which at present limit the applicability of a NBI to a fusion reactor: the maximum achievable acceleration voltage and the direct exposure of the BS to the flux of neutrons and radiation coming from the fusion reactor. In order to solve these two issues, a magnetic deflector is proposed to screen the BS from direct exposure to radiation and neutrons so that the voltage insulation between the electrostatic accelerator and the grounded vessel can be enhanced by using compressed SF6 instead of vacuum so that the negative ions can be accelerated at energies higher than 1 MeV. By solving the beam transport with different magnetic deflector properties, an optimum scheme has been found which is shown to be effective to guarantee both the steering effect and the beam aiming.

A new deflection technique applied to an existing scheme of electrostatic accelerator for high energy neutral beam injection in fusion reactor devices.

PubMed

Pilan, N; Antoni, V; De Lorenzi, A; Chitarin, G; Veltri, P; Sartori, E

2016-02-01

A scheme of a neutral beam injector (NBI), based on electrostatic acceleration and magneto-static deflection of negative ions, is proposed and analyzed in terms of feasibility and performance. The scheme is based on the deflection of a high energy (2 MeV) and high current (some tens of amperes) negative ion beam by a large magnetic deflector placed between the Beam Source (BS) and the neutralizer. This scheme has the potential of solving two key issues, which at present limit the applicability of a NBI to a fusion reactor: the maximum achievable acceleration voltage and the direct exposure of the BS to the flux of neutrons and radiation coming from the fusion reactor. In order to solve these two issues, a magnetic deflector is proposed to screen the BS from direct exposure to radiation and neutrons so that the voltage insulation between the electrostatic accelerator and the grounded vessel can be enhanced by using compressed SF6 instead of vacuum so that the negative ions can be accelerated at energies higher than 1 MeV. By solving the beam transport with different magnetic deflector properties, an optimum scheme has been found which is shown to be effective to guarantee both the steering effect and the beam aiming.

An Intelligent Control for the Distributed Flexible Network Photovoltaic System using Autonomous Control and Agent

NASA Astrophysics Data System (ADS)

Park, Sangsoo; Miura, Yushi; Ise, Toshifumi

This paper proposes an intelligent control for the distributed flexible network photovoltaic system using autonomous control and agent. The distributed flexible network photovoltaic system is composed of a secondary battery bank and a number of subsystems which have a solar array, a dc/dc converter and a load. The control mode of dc/dc converter can be selected based on local information by autonomous control. However, if only autonomous control using local information is applied, there are some problems associated with several cases such as voltage drop on long power lines. To overcome these problems, the authors propose introducing agents to improve control characteristics. The autonomous control with agents is called as intelligent control in this paper. The intelligent control scheme that employs the communication between agents is applied for the model system and proved with simulation using PSCAD/EMTDC.

PAM4 silicon photonic microring resonator-based transceiver circuits

NASA Astrophysics Data System (ADS)

Palermo, Samuel; Yu, Kunzhi; Roshan-Zamir, Ashkan; Wang, Binhao; Li, Cheng; Seyedi, M. Ashkan; Fiorentino, Marco; Beausoleil, Raymond

2017-02-01

Increased data rates have motivated the investigation of advanced modulation schemes, such as four-level pulseamplitude modulation (PAM4), in optical interconnect systems in order to enable longer transmission distances and operation with reduced circuit bandwidth relative to non-return-to-zero (NRZ) modulation. Employing this modulation scheme in interconnect architectures based on high-Q silicon photonic microring resonator devices, which occupy small area and allow for inherent wavelength-division multiplexing (WDM), offers a promising solution to address the dramatic increase in datacenter and high-performance computing system I/O bandwidth demands. Two ring modulator device structures are proposed for PAM4 modulation, including a single phase shifter segment device driven with a multi-level PAM4 transmitter and a two-segment device driven by two simple NRZ (MSB/LSB) transmitters. Transmitter circuits which utilize segmented pulsed-cascode high swing output stages are presented for both device structures. Output stage segmentation is utilized in the single-segment device design for PAM4 voltage level control, while in the two-segment design it is used for both independent MSB/LSB voltage levels and impedance control for output eye skew compensation. The 65nm CMOS transmitters supply a 4.4Vppd output swing for 40Gb/s operation when driving depletion-mode microring modulators implemented in a 130nm SOI process, with the single- and two-segment designs achieving 3.04 and 4.38mW/Gb/s, respectively. A PAM4 optical receiver front-end is also described which employs a large input-stage feedback resistor transimpedance amplifier (TIA) cascaded with an adaptively-tuned continuous-time linear equalizer (CTLE) for improved sensitivity. Receiver linearity, critical in PAM4 systems, is achieved with a peak-detector-based automatic gain control (AGC) loop.

Bias voltage induced resistance switching effect in single-molecule magnets' tunneling junction.

PubMed

Zhang, Zhengzhong; Jiang, Liang

2014-09-12

An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be 'read out' by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.

One-third selection scheme for addressing a ferroelectric matrix arrangement

NASA Technical Reports Server (NTRS)

Tannas, Jr., Lawrence E. (Inventor)

1979-01-01

An improved scheme for selectively addressing a matrix arrangement comprised of ferroelectrics having x and y orthogonally disposed intersecting lines. A one-third selection scheme is utilized that includes normalized selection signals having amplitudes: V.sub.x =0; V.sub.x =2/3; V.sub.y =1/3; and V.sub.y =1, which signals can be applied to the intersection of an x and y-line. The instant selection scheme minimizes both hysteresis creep and the cross-coupling voltage between x and y-lines to prevent undesirable hysteresis switching of the ferroelectric matrix arrangement.

The simulation on diode-clamped five-level converters common-mode voltage suppression with zero-vector PWM strategy

NASA Astrophysics Data System (ADS)

Zhang, Yonggao; Gao, Yanli; Long, Lizhong

2012-04-01

More and more researchers have great concern on the issue of Common-mode voltage (CMV) in high voltage large power converter. A novel common-mode voltage suppression scheme based on zero-vector PWM strategy (ZVPWM) is present in this paper. Taking a diode-clamped five-level converter as example, the principle of zero vector PWM common-mode voltage (ZCMVPWM) suppression method is studied in detail. ZCMVPWM suppression strategy is including four important parts, which are locating the sector of reference voltage vector, locating the small triangular sub-sector of reference voltage vector, reference vector synthesis, and calculating the operating time of vector. The principles of four important pars are illustrated in detail and the corresponding MATLAB models are established. System simulation and experimental results are provided. It gives some consultation value for the development and research of multi-level converters.

Sliding mode controller with modified sliding function for DC-DC Buck Converter.

PubMed

Naik, B B; Mehta, A J

2017-09-01

This article presents design of Sliding Mode Controller with proportional integral type sliding function for DC-DC Buck Converter for the controlled power supply. The converter with conventional sliding mode controller results in a steady state error in load voltage. The proposed modified sliding function improves the steady state and dynamic performance of the Convertor and facilitates better choices of controller tuning parameters. The conditions for existence of sliding modes for proposed control scheme are derived. The stability of the closed loop system with proposed sliding mode control is proved and improvement in steady state performance is exemplified. The idea of adaptive tuning for the proposed controller to compensate load variations is outlined. The comparative study of conventional and proposed control strategy is presented. The efficacy of the proposed strategy is endowed by the simulation and experimental results. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhattarai, Bishnu; Kouzelis, Konstantinos; Mendaza, Iker

The gradual active load penetration in low voltage distribution grids is expected to challenge their network capacity in the near future. Distribution system operators should for this reason resort to either costly grid reinforcements or to demand side management mechanisms. Since demand side management implementation is usually cheaper, it is also the favorable solution. To this end, this article presents a framework for handling grid limit violations, both voltage and current, to ensure a secure and qualitative operation of the distribution grid. This framework consists of two steps, namely a proactive centralized and subsequently a reactive decentralized control scheme. Themore » former is employed to balance the one hour ahead load while the latter aims at regulating the consumption in real-time. In both cases, the importance of fair use of electricity demand flexibility is emphasized. Thus, it is demonstrated that this methodology aids in keeping the grid status within preset limits while utilizing flexibility from all flexibility participants.« less

Electrically tunable whispering gallery mode microresonator based on a grapefruit-microstructured optical fiber infiltrated with nematic liquid crystals.

PubMed

Yang, Chengkun; Zhang, Hao; Liu, Bo; Lin, Shiwei; Li, Yuetao; Liu, Haifeng

2017-08-01

An electrically tunable whispering gallery mode (WGM) microresonator based on an HF-etched microstructured optical fiber (MOF) infiltrated with nematic liquid crystals (NLCs) is proposed and experimentally demonstrated. Experimental results indicate that as the peak-to-peak voltage of the applied AC electric field increases from 160 to 220 V, WGM resonance peaks gradually move toward a shorter wavelength region by 0.527 nm with a wavelength sensitivity up to 0.01  nm/V for a TM1691 mode, and the Q-factor for each WGM resonance peak rapidly decreases with the increment of applied electric voltage. The proposed electrically controlled WGM tuning scheme shows a linear resonance wavelength shift with good spectral reversibility, which makes it a promising candidate to serve as an integrated functional photonic device in practical use and in related fundamental scientific studies.

Audio-frequency analysis of inductive voltage dividers based on structural models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avramov, S.; Oldham, N.M.; Koffman, A.D.

1994-12-31

A Binary Inductive Voltage Divider (BIVD) is compared with a Decade Inductive Voltage Divider (DIVD) in an automatic IVD bridge. New detection and injection circuitry was designed and used to evaluate the IVDs with either the input or output tied to ground potential. In the audio frequency range the DIVD and BIVD error patterns are characterized for both in-phase and quadrature components. Differences between results obtained using a new error decomposition scheme based on structural modeling, and measurements using conventional IVD standards are reported.

Modeling, Analysis and Mitigation of Sub-Synchronous Interactions between Full- and Partial-Scale Voltage-Source Converters and Power Networks

NASA Astrophysics Data System (ADS)

Alawasa, Khaled Mohammad

Voltage-source converters (VSCs) have gained widespread acceptance in modern power systems. The stability and dynamics of power systems involving these devices have recently become salient issues. In the small-signal sense, the dynamics of VSC-based systems is dictated by its incremental output impedance, which is formed by a combination of 'passive' circuit components and 'active' control elements. Control elements such as control parameters, control loops, and control topologies play a significant role in shaping the impedance profile. Depending on the control schemes and strategies used, VSC-based systems can exhibit different incremental impedance dynamics. As the control elements and dynamics are involved in the impedance structure, the frequency-dependent output impedance might have a negative real-part (i.e., a negative resistance). In the grid-connected mode, the negative resistance degrades the system damping and negatively impacts the stability. In high-voltage networks where high-power VSC-based systems are usually employed and where sub-synchronous dynamics usually exist, integrating large VSC-based systems might reduce the overall damping and results in unstable dynamics. The objectives of this thesis are to (1) investigate and analyze the output impedance properties under different control strategies and control functions, (2) identify and characterize the key contributors to the impedance and sub-synchronous damping profiles, and (3) propose mitigation techniques to minimize and eliminate the negative impact associated with integrating VSC-based systems into power systems. Different VSC configurations are considered in this thesis; in particular, the full-scale and partial-scale topologies (doubly fed-induction generators) are addressed. Additionally, the impedance and system damping profiles are studied under two different control strategies: the standard vector control strategy and the recently-developed power synchronization control strategy. Furthermore, this thesis proposes a simple and robust technique for damping the sub-synchronous resonance in a power system.

Design of a nonlinear backstepping control strategy of grid interconnected wind power system based PMSG

NASA Astrophysics Data System (ADS)

Errami, Y.; Obbadi, A.; Sahnoun, S.; Benhmida, M.; Ouassaid, M.; Maaroufi, M.

2016-07-01

This paper presents nonlinear backstepping control for Wind Power Generation System (WPGS) based Permanent Magnet Synchronous Generator (PMSG) and connected to utility grid. The block diagram of the WPGS with PMSG and the grid side back-to-back converter is established with the dq frame of axes. This control scheme emphasises the regulation of the dc-link voltage and the control of the power factor at changing wind speed. Besides, in the proposed control strategy of WPGS, Maximum Power Point Tracking (MPPT) technique and pitch control are provided. The stability of the regulators is assured by employing Lyapunov analysis. The proposed control strategy for the system has been validated by MATLAB simulations under varying wind velocity and the grid fault condition. In addition, a comparison of simulation results based on the proposed Backstepping strategy and conventional Vector Control is provided.

Steady-State Modeling of Modular Multilevel Converter Under Unbalanced Grid Conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Xiaojie M.; Wang, Zhiqiang; Liu, Bo

This paper presents a steady-state model of MMC for the second-order phase voltage ripple prediction under unbalanced conditions, taking the impact of negative-sequence current control into account. From the steady-state model, a circular relationship is found among current and voltage quantities, which can be used to evaluate the magnitudes and initial phase angles of different circulating current components. Moreover, in order to calculate the circulating current in a point-to-point MMC-based HVdc system under unbalanced grid conditions, the derivation of equivalent dc impedance of an MMC is discussed as well. According to the dc impedance model, an MMC inverter can bemore » represented as a series connected R-L-C branch, with its equivalent resistance and capacitance directly related to the circulating current control parameters. Experimental results from a scaled-down three-phase MMC system under an emulated single-line-to-ground fault are provided to support the theoretical analysis and derived model. In conclusion, this new models provides an insight into the impact of different control schemes on the fault characteristics and improves the understanding of the operation of MMC under unbalanced conditions.« less

Steady-State Modeling of Modular Multilevel Converter Under Unbalanced Grid Conditions

DOE PAGES

Shi, Xiaojie M.; Wang, Zhiqiang; Liu, Bo; ...

2016-11-16

This paper presents a steady-state model of MMC for the second-order phase voltage ripple prediction under unbalanced conditions, taking the impact of negative-sequence current control into account. From the steady-state model, a circular relationship is found among current and voltage quantities, which can be used to evaluate the magnitudes and initial phase angles of different circulating current components. Moreover, in order to calculate the circulating current in a point-to-point MMC-based HVdc system under unbalanced grid conditions, the derivation of equivalent dc impedance of an MMC is discussed as well. According to the dc impedance model, an MMC inverter can bemore » represented as a series connected R-L-C branch, with its equivalent resistance and capacitance directly related to the circulating current control parameters. Experimental results from a scaled-down three-phase MMC system under an emulated single-line-to-ground fault are provided to support the theoretical analysis and derived model. In conclusion, this new models provides an insight into the impact of different control schemes on the fault characteristics and improves the understanding of the operation of MMC under unbalanced conditions.« less

Aquarius Digital Processing Unit

NASA Technical Reports Server (NTRS)

Forgione, Joshua; Winkert, George; Dobson, Norman

2009-01-01

Three documents provide information on a digital processing unit (DPU) for the planned Aquarius mission, in which a radiometer aboard a spacecraft orbiting Earth is to measure radiometric temperatures from which data on sea-surface salinity are to be deduced. The DPU is the interface between the radiometer and an instrument-command-and-data system aboard the spacecraft. The DPU cycles the radiometer through a programmable sequence of states, collects and processes all radiometric data, and collects all housekeeping data pertaining to operation of the radiometer. The documents summarize the DPU design, with emphasis on innovative aspects that include mainly the following: a) In the radiometer and the DPU, conversion from analog voltages to digital data is effected by means of asynchronous voltage-to-frequency converters in combination with a frequency-measurement scheme implemented in field-programmable gate arrays (FPGAs). b) A scheme to compensate for aging and changes in the temperature of the DPU in order to provide an overall temperature-measurement accuracy within 0.01 K includes a high-precision, inexpensive DC temperature measurement scheme and a drift-compensation scheme that was used on the Cassini radar system. c) An interface among multiple FPGAs in the DPU guarantees setup and hold times.

Switching of High-Voltage Cable Lines with Shunt Reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheskin, E. B., E-mail: evgeniy.sheskin@gmail.com; Evdokunin, G. A.

2016-05-15

The problem of disconnecting high-voltage cable lines with shunt reactors by SF{sub 6} circuit breakers is discussed. In these schemes it is possible to have a significant aperiodic component of the circuit breaker current that can prevent opening of the breaker. The authors propose methods for application to cable transmission lines which they believe will be optimal for ensuring normal disconnects.

Measured effects of wind turbine generation at the Block Island Power Company

NASA Technical Reports Server (NTRS)

Wilreker, V. F.; Smith, R. F.; Stiller, P. H.; Scot, G. W.; Shaltens, R. K.

1984-01-01

Data measurements made on the NASA MOD-OA 200-kw wind-turbine generator (WTG) installed on a utility grid form the basis for an overall performance analysis. Fuel displacement/-savings, dynamic interactions, and WTG excitation (reactive-power) control effects are studied. Continuous recording of a large number of electrical and mechanical variables on FM magnetic tape permit evaluation and correlation of phenomena over a bandwidth of at least 20 Hz. Because the wind-power penetration reached peaks of 60 percent, the impact of wind fluctuation and wind-turbine/diesel-utility interaction is evaluated in a worst-case scenario. The speed-governor dynamics of the diesel units exhibited an underdamped response, and the utility operation procedures were not altered to optimize overall WTG/utility performance. Primary findings over the data collection period are: a calculated 6.7-percent reduction in fuel consumption while generating 11 percent of the total electrical energy; acceptable system voltage and frequency fluctuations with WTG connected; and applicability of WTG excitation schemes using voltage, power, or VARS as the controlled variable.

A high-resolution and intelligent dead pixel detection scheme for an electrowetting display screen

NASA Astrophysics Data System (ADS)

Luo, ZhiJie; Luo, JianKun; Zhao, WenWen; Cao, Yang; Lin, WeiJie; Zhou, GuoFu

2018-02-01

Electrowetting display technology is realized by tuning the surface energy of a hydrophobic surface by applying a voltage based on electrowetting mechanism. With the rapid development of the electrowetting industry, how to analyze efficiently the quality of an electrowetting display screen has a very important significance. There are two kinds of dead pixels on the electrowetting display screen. One is that the oil of pixel cannot completely cover the display area. The other is that indium tin oxide semiconductor wire connecting pixel and foil was burned. In this paper, we propose a high-resolution and intelligent dead pixel detection scheme for an electrowetting display screen. First, we built an aperture ratio-capacitance model based on the electrical characteristics of electrowetting display. A field-programmable gate array is used as the integrated logic hub of the system for a highly reliable and efficient control of the circuit. Dead pixels can be detected and displayed on a PC-based 2D graphical interface in real time. The proposed dead pixel detection scheme reported in this work has promise in automating electrowetting display experiments.

Analysis and elimination method of the effects of cables on LVRT testing for offshore wind turbines

NASA Astrophysics Data System (ADS)

Jiang, Zimin; Liu, Xiaohao; Li, Changgang; Liu, Yutian

2018-02-01

The current state, characteristics and necessity of the low voltage ride through (LVRT) on-site testing for grid-connected offshore wind turbines are introduced firstly. Then the effects of submarine cables on the LVRT testing are analysed based on the equivalent circuit of the testing system. A scheme for eliminating the effects of cables on the proposed LVRT testing method is presented. The specified voltage dips are guaranteed to be in compliance with the testing standards by adjusting the ratio between the current limiting impedance and short circuit impedance according to the steady voltage relationship derived from the equivalent circuit. Finally, simulation results demonstrate that the voltage dips at the high voltage side of wind turbine transformer satisfy the requirements of testing standards.

Temperature Induced Voltage Offset Drifts in Silicon Carbide Pressure Sensors

NASA Technical Reports Server (NTRS)

Okojie, Robert S.; Lukco, Dorothy; Nguyen, Vu; Savrun, Ender

2012-01-01

We report the reduction of transient drifts in the zero pressure offset voltage in silicon carbide (SiC) pressure sensors when operating at 600 C. The previously observed maximum drift of +/- 10 mV of the reference offset voltage at 600 C was reduced to within +/- 5 mV. The offset voltage drifts and bridge resistance changes over time at test temperature are explained in terms of the microstructure and phase changes occurring within the contact metallization, as analyzed by Auger electron spectroscopy and field emission scanning electron microscopy. The results have helped to identify the upper temperature reliable operational limit of this particular metallization scheme to be 605 C.

Finger-Powered Electro-Digital-Microfluidics.

PubMed

Peng, Cheng; Ju, Y Sungtaek

2017-01-01

Portable microfluidic devices are promising for point-of-care (POC) diagnosis and bio- and environmental surveillance in resource-constrained or non-laboratory environments. Lateral-flow devices, some built off paper or strings, have been widely developed but the fixed layouts of their underlying wicking/microchannel structures limit their flexibility and present challenges in implementing multistep reactions. Digital microfluidics can circumvent these difficulties by addressing discrete droplets individually. Existing approaches to digital microfluidics, however, often require bulky power supplies/batteries and high voltage circuits. We present a scheme to drive digital microfluidic devices by converting mechanical energy of human fingers to electrical energy using an array of piezoelectric elements. We describe the integration our scheme into two promising digital microfluidics platforms: one based on the electro-wetting-on-dielectric (EWOD) phenomenon and the other on the electrophoretic control of droplet (EPD). Basic operations of droplet manipulations, such as droplet transport, merging and splitting, are demonstrated using the finger-powered digital-microfluidics.

CMOS integration of high-k/metal gate transistors in diffusion and gate replacement (D&GR) scheme for dynamic random access memory peripheral circuits

NASA Astrophysics Data System (ADS)

Dentoni Litta, Eugenio; Ritzenthaler, Romain; Schram, Tom; Spessot, Alessio; O’Sullivan, Barry; Machkaoutsan, Vladimir; Fazan, Pierre; Ji, Yunhyuck; Mannaert, Geert; Lorant, Christophe; Sebaai, Farid; Thiam, Arame; Ercken, Monique; Demuynck, Steven; Horiguchi, Naoto

2018-04-01

Integration of high-k/metal gate stacks in peripheral transistors is a major candidate to ensure continued scaling of dynamic random access memory (DRAM) technology. In this paper, the CMOS integration of diffusion and gate replacement (D&GR) high-k/metal gate stacks is investigated, evaluating four different approaches for the critical patterning step of removing the N-type field effect transistor (NFET) effective work function (eWF) shifter stack from the P-type field effect transistor (PFET) area. The effect of plasma exposure during the patterning step is investigated in detail and found to have a strong impact on threshold voltage tunability. A CMOS integration scheme based on an experimental wet-compatible photoresist is developed and the fulfillment of the main device metrics [equivalent oxide thickness (EOT), eWF, gate leakage current density, on/off currents, short channel control] is demonstrated.

A 735 kV shunt reactors automatic switching system for Hydro-Quebec network

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernard, S.; Trudel, G.; Scott, G.

1996-11-01

In recent years, Hydro-Quebec has undertaken a major program to upgrade the reliability of its transmission system. Much efforts have been directed toward increasing the system`s capacity to withstand extreme contingencies, usually caused by multiple incidents or the successive tripping of transmission lines. In order to counter such events, Hydro-Quebec has adopted a defensive scheme. Based entirely on automatic action, this scheme will mainly rely on: a 735 kV shunt reactor switching system (called MAIS); a generation rejection and/or remote load-shedding system (called RPTC); an underfrequency load-shedding system. The MAIS system, which is the subject of this paper, will bemore » implemented in 22 substations and is required to control voltage on the system after a severe event. Each MAIS system, acting locally, is entirely independent and will close or trip shunt reactors in response to local conditions.« less

Solid-state transformer-based new traction drive system and control

NASA Astrophysics Data System (ADS)

Feng, Jianghua; Shang, Jing; Zhang, Zhixue; Liu, Huadong; Huang, Zihao

2017-11-01

A new type of traction drive system consisting of solid-state traction transformer (SSTT), inverter unit, auxiliary inverter, traction motor and other key components is built in order to suit the demand of developing the next-generation electric traction system which will be efficient and lightweight, with high power density. For the purpose of reducing system volume and weight and improving efficiency and grid-side power quality, an efficient SSTT optimized topology combining high-voltage cascaded rectifiers with high-power high-frequency LLC resonant converter is proposed. On this basis, an integrated control strategy built upon synchronous rotating reference frame is presented to achieve unified control over fundamental active, reactive and harmonic components. The carrier-interleaving phase shift modulation strategy is proposed to improve the harmonic performance of cascaded rectifiers. In view of the secondary pulsating existing in a single-phase system, the mathematical model of secondary power transfer is built, and the mechanism of pulsating voltage resulting in beat frequency of LLC resonant converter is revealed, so as to design optimum matching of system parameters. Simulation and experimental results have verified that the traction system and control scheme mentioned in this paper are reasonable and superior and that they meet the future application requirements for rail transit.

Enhancing the LVRT Capability of PMSG-Based Wind Turbines Based on R-SFCL

NASA Astrophysics Data System (ADS)

Xu, Lin; Lin, Ruixing; Ding, Lijie; Huang, Chunjun

2018-03-01

A novel low voltage ride-through (LVRT) scheme for PMSG-based wind turbines based on the Resistor Superconducting Fault Current Limiter (R-SFCL) is proposed in this paper. The LVRT scheme is mainly formed by R-SFCL in series between the transformer and the Grid Side Converter (GSC), and basic modelling has been discussed in detail. The proposed LVRT scheme is implemented to interact with PMSG model in PSCAD/EMTDC under three phase short circuit fault condition, which proves that the proposed scheme based on R-SFCL can improve the transient performance and LVRT capability to consolidate grid connection with wind turbines.

Concept Design for a 1-Lead Wearable/Implantable ECG Front-End: Power Management

PubMed Central

George, Libin; Gargiulo, Gaetano Dario; Lehmann, Torsten; Hamilton, Tara Julia

2015-01-01

Power supply quality and stability are critical for wearable and implantable biomedical applications. For this reason we have designed a reconfigurable switched-capacitor DC-DC converter that, aside from having an extremely small footprint (with an active on-chip area of only 0.04 mm2), uses a novel output voltage control method based upon a combination of adaptive gain and discrete frequency scaling control schemes. This novel DC-DC converter achieves a measured output voltage range of 1.0 to 2.2 V with power delivery up to 7.5 mW with 75% efficiency. In this paper, we present the use of this converter as a power supply for a concept design of a wearable (15 mm × 15 mm) 1-lead ECG front-end sensor device that simultaneously harvests power and communicates with external receivers when exposed to a suitable RF field. Due to voltage range limitations of the fabrication process of the current prototype chip, we focus our analysis solely on the power supply of the ECG front-end whose design is also detailed in this paper. Measurement results show not just that the power supplied is regulated, clean and does not infringe upon the ECG bandwidth, but that there is negligible difference between signals acquired using standard linear power-supplies and when the power is regulated by our power management chip. PMID:26610497

Concept Design for a 1-Lead Wearable/Implantable ECG Front-End: Power Management.

PubMed

George, Libin; Gargiulo, Gaetano Dario; Lehmann, Torsten; Hamilton, Tara Julia

2015-11-19

Power supply quality and stability are critical for wearable and implantable biomedical applications. For this reason we have designed a reconfigurable switched-capacitor DC-DC converter that, aside from having an extremely small footprint (with an active on-chip area of only 0.04 mm²), uses a novel output voltage control method based upon a combination of adaptive gain and discrete frequency scaling control schemes. This novel DC-DC converter achieves a measured output voltage range of 1.0 to 2.2 V with power delivery up to 7.5 mW with 75% efficiency. In this paper, we present the use of this converter as a power supply for a concept design of a wearable (15 mm × 15 mm) 1-lead ECG front-end sensor device that simultaneously harvests power and communicates with external receivers when exposed to a suitable RF field. Due to voltage range limitations of the fabrication process of the current prototype chip, we focus our analysis solely on the power supply of the ECG front-end whose design is also detailed in this paper. Measurement results show not just that the power supplied is regulated, clean and does not infringe upon the ECG bandwidth, but that there is negligible difference between signals acquired using standard linear power-supplies and when the power is regulated by our power management chip.

A new deflection technique applied to an existing scheme of electrostatic accelerator for high energy neutral beam injection in fusion reactor devices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pilan, N., E-mail: nicola.pilan@igi.cnr.it; Antoni, V.; De Lorenzi, A.

A scheme of a neutral beam injector (NBI), based on electrostatic acceleration and magneto-static deflection of negative ions, is proposed and analyzed in terms of feasibility and performance. The scheme is based on the deflection of a high energy (2 MeV) and high current (some tens of amperes) negative ion beam by a large magnetic deflector placed between the Beam Source (BS) and the neutralizer. This scheme has the potential of solving two key issues, which at present limit the applicability of a NBI to a fusion reactor: the maximum achievable acceleration voltage and the direct exposure of the BSmore » to the flux of neutrons and radiation coming from the fusion reactor. In order to solve these two issues, a magnetic deflector is proposed to screen the BS from direct exposure to radiation and neutrons so that the voltage insulation between the electrostatic accelerator and the grounded vessel can be enhanced by using compressed SF{sub 6} instead of vacuum so that the negative ions can be accelerated at energies higher than 1 MeV. By solving the beam transport with different magnetic deflector properties, an optimum scheme has been found which is shown to be effective to guarantee both the steering effect and the beam aiming.« less

Real-Time Load-Side Control of Electric Power Systems

NASA Astrophysics Data System (ADS)

Zhao, Changhong

Two trends are emerging from modern electric power systems: the growth of renewable (e.g., solar and wind) generation, and the integration of information technologies and advanced power electronics. The former introduces large, rapid, and random fluctuations in power supply, demand, frequency, and voltage, which become a major challenge for real-time operation of power systems. The latter creates a tremendous number of controllable intelligent endpoints such as smart buildings and appliances, electric vehicles, energy storage devices, and power electronic devices that can sense, compute, communicate, and actuate. Most of these endpoints are distributed on the load side of power systems, in contrast to traditional control resources such as centralized bulk generators. This thesis focuses on controlling power systems in real time, using these load side resources. Specifically, it studies two problems. (1) Distributed load-side frequency control: We establish a mathematical framework to design distributed frequency control algorithms for flexible electric loads. In this framework, we formulate a category of optimization problems, called optimal load control (OLC), to incorporate the goals of frequency control, such as balancing power supply and demand, restoring frequency to its nominal value, restoring inter-area power flows, etc., in a way that minimizes total disutility for the loads to participate in frequency control by deviating from their nominal power usage. By exploiting distributed algorithms to solve OLC and analyzing convergence of these algorithms, we design distributed load-side controllers and prove stability of closed-loop power systems governed by these controllers. This general framework is adapted and applied to different types of power systems described by different models, or to achieve different levels of control goals under different operation scenarios. We first consider a dynamically coherent power system which can be equivalently modeled with a single synchronous machine. We then extend our framework to a multi-machine power network, where we consider primary and secondary frequency controls, linear and nonlinear power flow models, and the interactions between generator dynamics and load control. (2) Two-timescale voltage control: The voltage of a power distribution system must be maintained closely around its nominal value in real time, even in the presence of highly volatile power supply or demand. For this purpose, we jointly control two types of reactive power sources: a capacitor operating at a slow timescale, and a power electronic device, such as a smart inverter or a D-STATCOM, operating at a fast timescale. Their control actions are solved from optimal power flow problems at two timescales. Specifically, the slow-timescale problem is a chance-constrained optimization, which minimizes power loss and regulates the voltage at the current time instant while limiting the probability of future voltage violations due to stochastic changes in power supply or demand. This control framework forms the basis of an optimal sizing problem, which determines the installation capacities of the control devices by minimizing the sum of power loss and capital cost. We develop computationally efficient heuristics to solve the optimal sizing problem and implement real-time control. Numerical experiments show that the proposed sizing and control schemes significantly improve the reliability of voltage control with a moderate increase in cost.

Effects of ramp reset pulses on the address discharge in a shadow mask plasma display panel

NASA Astrophysics Data System (ADS)

Yang, Lanlan; Tu, Yan; Zhang, Xiong; Jiang, Youyan; Zhang, Jian; Wang, Baoping

2007-05-01

A two-dimensional self-consistent numerical simulation model is used to analyse the effects of the ramp reset pulses on the address discharge in a shadow mask plasma display panel (SM-PDP). Some basic parameters such as the slope of the ramp pulse and the terminal voltage of the ramp reset period are varied to investigate their effects. The simulation results illustrate that the wall voltage is mainly decided by the terminal voltage and the firing voltage at the end of the ramp reset period. Moreover, the variation of the ramp slope will also bring a few modifications to the wall voltage. The priming particles in the beginning of the addressing period are related to the slope of the ramping down voltage pulse. The simulation results can help us optimize the driving scheme of the SM-PDP.

Feedback System Control Optimized Electrospinning for Fabrication of an Excellent Superhydrophobic Surface.

PubMed

Yang, Jian; Liu, Chuangui; Wang, Boqian; Ding, Xianting

2017-10-13

Superhydrophobic surface, as a promising micro/nano material, has tremendous applications in biological and artificial investigations. The electrohydrodynamics (EHD) technique is a versatile and effective method for fabricating micro- to nanoscale fibers and particles from a variety of materials. A combination of critical parameters, such as mass fraction, ratio of N, N-Dimethylformamide (DMF) to Tetrahydrofuran (THF), inner diameter of needle, feed rate, receiving distance, applied voltage as well as temperature, during electrospinning process, to determine the morphology of the electrospun membranes, which in turn determines the superhydrophobic property of the membrane. In this study, we applied a recently developed feedback system control (FSC) scheme for rapid identification of the optimal combination of these controllable parameters to fabricate superhydrophobic surface by one-step electrospinning method without any further modification. Within five rounds of experiments by testing totally forty-six data points, FSC scheme successfully identified an optimal parameter combination that generated electrospun membranes with a static water contact angle of 160 degrees or larger. Scanning electron microscope (SEM) imaging indicates that the FSC optimized surface attains unique morphology. The optimized setup introduced here therefore serves as a one-step, straightforward, and economic approach to fabricate superhydrophobic surface with electrospinning approach.

Tunable microwave metasurfaces for high-performance operations: dispersion compensation and dynamical switch

PubMed Central

Xu, He-Xiu; Tang, Shiwei; Ma, Shaojie; Luo, Weijie; Cai, Tong; Sun, Shulin; He, Qiong; Zhou, Lei

2016-01-01

Controlling the phase distributions on metasurfaces leads to fascinating effects such as anomalous light refraction/reflection, flat-lens focusing, and optics-vortex generation. However, metasurfaces realized so far largely reply on passive resonant meta-atoms, whose intrinsic dispersions limit such passive meta-devices’ performances at frequencies other than the target one. Here, based on tunable meta-atoms with varactor diodes involved, we establish a scheme to resolve these issues for microwave metasurfaces, in which the dispersive response of each meta-atom is precisely controlled by an external voltage imparted on the diode. We experimentally demonstrate two effects utilizing our scheme. First, we show that a tunable gradient metasurface exhibits single-mode high-efficiency operation within a wide frequency band, while its passive counterpart only works at a single frequency but exhibits deteriorated performances at other frequencies. Second, we demonstrate that the functionality of our metasurface can be dynamically switched from a specular reflector to a surface-wave convertor. Our approach paves the road to achieve dispersion-corrected and switchable manipulations of electromagnetic waves. PMID:27901088

Tunable microwave metasurfaces for high-performance operations: dispersion compensation and dynamical switch.

PubMed

Xu, He-Xiu; Tang, Shiwei; Ma, Shaojie; Luo, Weijie; Cai, Tong; Sun, Shulin; He, Qiong; Zhou, Lei

2016-11-30

Controlling the phase distributions on metasurfaces leads to fascinating effects such as anomalous light refraction/reflection, flat-lens focusing, and optics-vortex generation. However, metasurfaces realized so far largely reply on passive resonant meta-atoms, whose intrinsic dispersions limit such passive meta-devices' performances at frequencies other than the target one. Here, based on tunable meta-atoms with varactor diodes involved, we establish a scheme to resolve these issues for microwave metasurfaces, in which the dispersive response of each meta-atom is precisely controlled by an external voltage imparted on the diode. We experimentally demonstrate two effects utilizing our scheme. First, we show that a tunable gradient metasurface exhibits single-mode high-efficiency operation within a wide frequency band, while its passive counterpart only works at a single frequency but exhibits deteriorated performances at other frequencies. Second, we demonstrate that the functionality of our metasurface can be dynamically switched from a specular reflector to a surface-wave convertor. Our approach paves the road to achieve dispersion-corrected and switchable manipulations of electromagnetic waves.

Tunable microwave metasurfaces for high-performance operations: dispersion compensation and dynamical switch

NASA Astrophysics Data System (ADS)

Xu, He-Xiu; Tang, Shiwei; Ma, Shaojie; Luo, Weijie; Cai, Tong; Sun, Shulin; He, Qiong; Zhou, Lei

2016-11-01

Controlling the phase distributions on metasurfaces leads to fascinating effects such as anomalous light refraction/reflection, flat-lens focusing, and optics-vortex generation. However, metasurfaces realized so far largely reply on passive resonant meta-atoms, whose intrinsic dispersions limit such passive meta-devices’ performances at frequencies other than the target one. Here, based on tunable meta-atoms with varactor diodes involved, we establish a scheme to resolve these issues for microwave metasurfaces, in which the dispersive response of each meta-atom is precisely controlled by an external voltage imparted on the diode. We experimentally demonstrate two effects utilizing our scheme. First, we show that a tunable gradient metasurface exhibits single-mode high-efficiency operation within a wide frequency band, while its passive counterpart only works at a single frequency but exhibits deteriorated performances at other frequencies. Second, we demonstrate that the functionality of our metasurface can be dynamically switched from a specular reflector to a surface-wave convertor. Our approach paves the road to achieve dispersion-corrected and switchable manipulations of electromagnetic waves.

Scalable digital hardware for a trapped ion quantum computer

NASA Astrophysics Data System (ADS)

Mount, Emily; Gaultney, Daniel; Vrijsen, Geert; Adams, Michael; Baek, So-Young; Hudek, Kai; Isabella, Louis; Crain, Stephen; van Rynbach, Andre; Maunz, Peter; Kim, Jungsang

2016-12-01

Many of the challenges of scaling quantum computer hardware lie at the interface between the qubits and the classical control signals used to manipulate them. Modular ion trap quantum computer architectures address scalability by constructing individual quantum processors interconnected via a network of quantum communication channels. Successful operation of such quantum hardware requires a fully programmable classical control system capable of frequency stabilizing the continuous wave lasers necessary for loading, cooling, initialization, and detection of the ion qubits, stabilizing the optical frequency combs used to drive logic gate operations on the ion qubits, providing a large number of analog voltage sources to drive the trap electrodes, and a scheme for maintaining phase coherence among all the controllers that manipulate the qubits. In this work, we describe scalable solutions to these hardware development challenges.

Optimal scan strategy for mega-pixel and kilo-gray-level OLED-on-silicon microdisplay.

PubMed

Ji, Yuan; Ran, Feng; Ji, Weigui; Xu, Meihua; Chen, Zhangjing; Jiang, Yuxi; Shen, Weixin

2012-06-10

The digital pixel driving scheme makes the organic light-emitting diode (OLED) microdisplays more immune to the pixel luminance variations and simplifies the circuit architecture and design flow compared to the analog pixel driving scheme. Additionally, it is easily applied in full digital systems. However, the data bottleneck becomes a notable problem as the number of pixels and gray levels grow dramatically. This paper will discuss the digital driving ability to achieve kilogray-levels for megapixel displays. The optimal scan strategy is proposed for creating ultra high gray levels and increasing light efficiency and contrast ratio. Two correction schemes are discussed to improve the gray level linearity. A 1280×1024×3 OLED-on-silicon microdisplay, with 4096 gray levels, is designed based on the optimal scan strategy. The circuit driver is integrated in the silicon backplane chip in the 0.35 μm 3.3 V-6 V dual voltage one polysilicon layer, four metal layers (1P4M) complementary metal-oxide semiconductor (CMOS) process with custom top metal. The design aspects of the optimal scan controller are also discussed. The test results show the gray level linearity of the correction schemes for the optimal scan strategy is acceptable by the human eye.

Safety Performance of Small Lithium-Ion Cells in High Voltage Batteries

NASA Technical Reports Server (NTRS)

Cowles, Philip R.; Darcy, Eric C.; Davies, Frank J.; Jeevarajan, Judith A.; Spurrett, Robert P.

2003-01-01

Topics covered include: Small-cell EAPU work done by NASA-JSC & COM DEV; Looking at safety features (short circuit protection - PTCs); Early tests showed that long strings do not withstand short circuit; a) Some PTCs experience large negative voltages; b) Destructive results. Solution: group cells into shorter substrings, with bypass diodes Work included: a) Tests with single cells shorted; b) Tests with single cells with imposed-negative voltages; c) 6s, 7s and 8s string shorts; and d) Tests with protection scheme in place, on 12s and 41s x 5p.

High-voltage measurements on the 5 ppm relative uncertainty level with collinear laser spectroscopy

NASA Astrophysics Data System (ADS)

Krämer, J.; König, K.; Geppert, Ch; Imgram, P.; Maaß, B.; Meisner, J.; Otten, E. W.; Passon, S.; Ratajczyk, T.; Ullmann, J.; Nörtershäuser, W.

2018-04-01

We present the results of high-voltage collinear laser spectroscopy measurements on the 5 ppm relative uncertainty level using a pump and probe scheme at the 4s ^2S1/2 → 4p ^2P3/2 transition of {\\hspace{0pt}}40Ca+ involving the 3d ^2D5/2 metastable state. With two-stage laser interaction and a reference measurement we can eliminate systematic effects such as differences in the contact potentials due to different electrode materials and thermoelectric voltages, and the unknown starting potential of the ions in the ion source. Voltage measurements were performed between  -5 kV and  -19 kV and parallel measurements with stable high-voltage dividers calibrated to 5 ppm relative uncertainty were used as a reference. Our measurements are compatible with the uncertainty limits of the high-voltage dividers and demonstrate an unprecedented (factor of 20) increase in the precision of direct laser-based high-voltage measurements.

A distributed control approach for power and energy management in a notional shipboard power system

NASA Astrophysics Data System (ADS)

Shen, Qunying

The main goal of this thesis is to present a power control module (PCON) based approach for power and energy management and to examine its control capability in shipboard power system (SPS). The proposed control scheme is implemented in a notional medium voltage direct current (MVDC) integrated power system (IPS) for electric ship. To realize the control functions such as ship mode selection, generator launch schedule, blackout monitoring, and fault ride-through, a PCON based distributed power and energy management system (PEMS) is developed. The control scheme is proposed as two-layer hierarchical architecture with system level on the top as the supervisory control and zonal level on the bottom as the decentralized control, which is based on the zonal distribution characteristic of the notional MVDC IPS that was proposed as one of the approaches for Next Generation Integrated Power System (NGIPS) by Norbert Doerry. Several types of modules with different functionalities are used to derive the control scheme in detail for the notional MVDC IPS. Those modules include the power generation module (PGM) that controls the function of generators, the power conversion module (PCM) that controls the functions of DC/DC or DC/AC converters, etc. Among them, the power control module (PCON) plays a critical role in the PEMS. It is the core of the control process. PCONs in the PEMS interact with all the other modules, such as power propulsion module (PPM), energy storage module (ESM), load shedding module (LSHED), and human machine interface (HMI) to realize the control algorithm in PEMS. The proposed control scheme is implemented in real time using the real time digital simulator (RTDS) to verify its validity. To achieve this, a system level energy storage module (SESM) and a zonal level energy storage module (ZESM) are developed in RTDS to cooperate with PCONs to realize the control functionalities. In addition, a load shedding module which takes into account the reliability of power supply (in terms of quality of service) is developed. This module can supply uninterruptible power to the mission critical loads. In addition, a multi-agent system (MAS) based framework is proposed to implement the PCON based PEMS through a hardware setup that is composed of MAMBA boards and FPGA interface. Agents are implemented using Java Agent DEvelopment Framework (JADE). Various test scenarios were tested to validate the approach.

PWM-switching pattern-based diagnosis scheme for single and multiple open-switch damages in VSI-fed induction motor drives.

PubMed

Trabelsi, Mohamed; Boussak, Mohamed; Gossa, Moncef

2012-03-01

This paper deals with a fault detection technique for insulated-gate bipolar transistors (IGBTs) open-circuit faults in voltage source inverter (VSI)-fed induction motor drives. The novelty of this idea consists in analyzing the pulse-width modulation (PWM) switching signals and the line-to-line voltage levels during the switching times, under both healthy and faulty operating conditions. The proposed method requires line-to-line voltage measurement, which provides information about switching states and is not affected by the load. The fault diagnosis scheme is achieved using simple hardware and can be included in the existing inverter system without any difficulty. In addition, it allows not only accurate single and multiple faults diagnosis but also minimization of the fault detection time to a maximum of one switching period (T(c)). Simulated and experimental results on a 3-kW squirrel-cage induction motor drive are displayed to validate the feasibility and the effectiveness of the proposed strategy. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Design and implementation of co-operative control strategy for hybrid AC/DC microgrids

NASA Astrophysics Data System (ADS)

Mahmud, Rasel

This thesis is mainly divided in two major sections: 1) Modeling and control of AC microgrid, DC microgrid, Hybrid AC/DC microgrid using distributed co-operative control, and 2) Development of a four bus laboratory prototype of an AC microgrid system. At first, a distributed cooperative control (DCC) for a DC microgrid considering the state-of-charge (SoC) of the batteries in a typical plug-in-electric-vehicle (PEV) is developed. In DC microgrids, this methodology is developed to assist the load sharing amongst the distributed generation units (DGs), according to their ratings with improved voltage regulation. Subsequently, a DCC based control algorithm for AC microgrid is also investigated to improve the performance of AC microgrid in terms of power sharing among the DGs, voltage regulation and frequency deviation. The results validate the advantages of the proposed methodology as compared to traditional droop control of AC microgrid. The DCC-based control methodology for AC microgrid and DC microgrid are further expanded to develop a DCC-based power management algorithm for hybrid AC/DC microgrid. The developed algorithm for hybrid microgrid controls the power flow through the interfacing converter (IC) between the AC and DC microgrids. This will facilitate the power sharing between the DGs according to their power ratings. Moreover, it enables the fixed scheduled power delivery at different operating conditions, while maintaining good voltage regulation and improved frequency profile. The second section provides a detailed explanation and step-by-step design and development of an AC/DC microgrid testbed. Controllers for the three-phase inverters are designed and tested on different generation units along with their corresponding inductor-capacitor-inductor (LCL) filters to eliminate the switching frequency harmonics. Electric power distribution line models are developed to form the microgrid network topology. Voltage and current sensors are placed in the proper positions to achieve a full visibility over the microgrid. A running average filter (RAF) based enhanced phase-locked-loop (EPLL) is designed and implemented to extract frequency and phase angle information. A PLL-based synchronizing scheme is also developed to synchronize the DGs to the microgrid. The developed laboratory prototype runs on dSpace platform for real time data acquisition, communication and controller implementation.

Laser beam apparatus and method for analyzing solar cells

DOEpatents

Staebler, David L.

1980-01-01

A laser beam apparatus and method for analyzing, inter alia, the current versus voltage curve at the point of illumination on a solar cell and the open circuit voltage of a solar cell. The apparatus incorporates a lock-in amplifier, and a laser beam light chopper which permits the measurement of the AC current of the solar cell at an applied DC voltage at the position on the solar cell where the cell is illuminated and a feedback scheme which permits the direct scanning measurements of the open circuit voltage. The accuracy of the measurement is a function of the intensity and wavelength of the laser light with respect to the intensity and wavelength distribution of sunlight and the percentage the dark current is at the open circuit voltage to the short circuit current of the solar cell.

A simple recipe for setting up the flux equations of cyclic and linear reaction schemes of ion transport with a high number of states: The arrow scheme.

PubMed

Hansen, Ulf-Peter; Rauh, Oliver; Schroeder, Indra

2016-01-01

The calculation of flux equations or current-voltage relationships in reaction kinetic models with a high number of states can be very cumbersome. Here, a recipe based on an arrow scheme is presented, which yields a straightforward access to the minimum form of the flux equations and the occupation probability of the involved states in cyclic and linear reaction schemes. This is extremely simple for cyclic schemes without branches. If branches are involved, the effort of setting up the equations is a little bit higher. However, also here a straightforward recipe making use of so-called reserve factors is provided for implementing the branches into the cyclic scheme, thus enabling also a simple treatment of such cases.

A simple recipe for setting up the flux equations of cyclic and linear reaction schemes of ion transport with a high number of states: The arrow scheme

PubMed Central

Hansen, Ulf-Peter; Rauh, Oliver; Schroeder, Indra

2016-01-01

abstract The calculation of flux equations or current-voltage relationships in reaction kinetic models with a high number of states can be very cumbersome. Here, a recipe based on an arrow scheme is presented, which yields a straightforward access to the minimum form of the flux equations and the occupation probability of the involved states in cyclic and linear reaction schemes. This is extremely simple for cyclic schemes without branches. If branches are involved, the effort of setting up the equations is a little bit higher. However, also here a straightforward recipe making use of so-called reserve factors is provided for implementing the branches into the cyclic scheme, thus enabling also a simple treatment of such cases. PMID:26646356

A real-time and closed-loop control algorithm for cascaded multilevel inverter based on artificial neural network.

PubMed

Wang, Libing; Mao, Chengxiong; Wang, Dan; Lu, Jiming; Zhang, Junfeng; Chen, Xun

2014-01-01

In order to control the cascaded H-bridges (CHB) converter with staircase modulation strategy in a real-time manner, a real-time and closed-loop control algorithm based on artificial neural network (ANN) for three-phase CHB converter is proposed in this paper. It costs little computation time and memory. It has two steps. In the first step, hierarchical particle swarm optimizer with time-varying acceleration coefficient (HPSO-TVAC) algorithm is employed to minimize the total harmonic distortion (THD) and generate the optimal switching angles offline. In the second step, part of optimal switching angles are used to train an ANN and the well-designed ANN can generate optimal switching angles in a real-time manner. Compared with previous real-time algorithm, the proposed algorithm is suitable for a wider range of modulation index and results in a smaller THD and a lower calculation time. Furthermore, the well-designed ANN is embedded into a closed-loop control algorithm for CHB converter with variable direct voltage (DC) sources. Simulation results demonstrate that the proposed closed-loop control algorithm is able to quickly stabilize load voltage and minimize the line current's THD (<5%) when subjecting the DC sources disturbance or load disturbance. In real design stage, a switching angle pulse generation scheme is proposed and experiment results verify its correctness.

Studies on Radar Sensor Networks

DTIC Science & Technology

2007-08-08

scheme in which 2-D image was created via adding voltages with the appropriate time offset. Simulation results show that our DCT-based scheme works...using RSNs in terms of the probability of miss detection PMD and the root mean square error (RMSE). Simulation results showed that multi-target detection... Simulation results are presented to evaluate the feasibility and effectiveness of the proposed JMIC algorithm in a query surveillance region. 5 SVD-QR and

An improved fault detection classification and location scheme based on wavelet transform and artificial neural network for six phase transmission line using single end data only.

PubMed

Koley, Ebha; Verma, Khushaboo; Ghosh, Subhojit

2015-01-01

Restrictions on right of way and increasing power demand has boosted development of six phase transmission. It offers a viable alternative for transmitting more power, without major modification in existing structure of three phase double circuit transmission system. Inspite of the advantages, low acceptance of six phase system is attributed to the unavailability of a proper protection scheme. The complexity arising from large number of possible faults in six phase lines makes the protection quite challenging. The proposed work presents a hybrid wavelet transform and modular artificial neural network based fault detector, classifier and locator for six phase lines using single end data only. The standard deviation of the approximate coefficients of voltage and current signals obtained using discrete wavelet transform are applied as input to the modular artificial neural network for fault classification and location. The proposed scheme has been tested for all 120 types of shunt faults with variation in location, fault resistance, fault inception angles. The variation in power system parameters viz. short circuit capacity of the source and its X/R ratio, voltage, frequency and CT saturation has also been investigated. The result confirms the effectiveness and reliability of the proposed protection scheme which makes it ideal for real time implementation.

A 32 kb 9T near-threshold SRAM with enhanced read ability at ultra-low voltage operation

NASA Astrophysics Data System (ADS)

Kim, Tony Tae-Hyoung; Lee, Zhao Chuan; Do, Anh Tuan

2018-01-01

Ultra-low voltage SRAMs are highly sought-after in energy-limited systems such as battery-powered and self-harvested SoCs. However, ultra-low voltage operation diminishes SRAM read bitline (RBL) sensing margin significantly. This paper tackles this issue by presenting a novel 9T cell with data-independent RBL leakage in combination with an RBL boosting technique for enhancing the sensing margin. The proposed technique automatically tracks process, temperature and voltage (PVT) variations for robust sensing margin enhancement. A test chip fabricated in 65 nm CMOS technology shows that the proposed scheme significantly enlarges the sensing margin compared to the conventional bitline sensing scheme. It also achieves the minimum operating voltage of 0.18 V and the minimum energy consumption of 0.92 J/access at 0.4 V. He received 2016 International Low Power Design Contest Award from ISLPED, a best paper award at 2014 and 2011 ISOCC, 2008 AMD/CICC Student Scholarship Award, 2008 Departmental Research Fellowship from Univ. of Minnesota, 2008 DAC/ISSCC Student Design Contest Award, 2008, 2001, and 1999 Samsung Humantec Thesis Award and, 2005 ETRI Journal Paper of the Year Award. He is an author/co-author of +100 journal and conference papers and has 17 US and Korean patents registered. His current research interests include low power and high performance digital, mixed- mode, and memory circuit design, ultra-low voltage circuits and systems design, variation and aging tolerant circuits and systems, and circuit techniques for 3D ICs. He serves as an associate editor of IEEE Transactions on VLSI Systems. He is an IEEE senior member and the Chair of IEEE Solid-State Circuits Society Singapore Chapter. He has served numerous conferences as a committee member.

Blow molding electric drives of Mechanical Engineering

NASA Astrophysics Data System (ADS)

Bukhanov, S. S.; Ramazanov, M. A.; Tsirkunenko, A. T.

2018-03-01

The article considers the questions about the analysis of new possibilities, which gives the use of adjustable electric drives for blowing mechanisms of plastic production. Thus, the use of new semiconductor converters makes it possible not only to compensate the instability of the supply network by using special dynamic voltage regulators, but to improve (correct) the power factor. The calculation of economic efficiency in controlled electric drives of blowing mechanisms is given. On the basis of statistical analysis, the calculation of the reliability parameters of the regulated electric drives’ elements under consideration is given. It is shown that an increase in the reliability of adjustable electric drives is possible both due to overestimation of the electric drive’s installed power, and in simpler schemes with pulse-vector control.

Design of CMOS compatible and compact, thermally-compensated electro-optic modulator based on off-axis microring resonator for dense wavelength division multiplexing applications.

PubMed

Haldar, Raktim; Banik, Abhik D; Varshney, Shailendra K

2014-09-22

In this work, we propose and demonstrate the performance of silicon-on-insulator (SOI) off-axis microring resonator (MRR) as electro-optic modulator (EOM). Adding an extra off-axis inner-ring in conventional microring structure provides control to compensate thermal effects on EOM. It is shown that dynamically controlled bias-voltage applied to the outer ring has the potency to quell the thermal effects over a wide range of temperature. Thus, besides the appositely biased conventional microring, off-axis inner microring with pre-emphasized electrical input message signal enables our proposed structure suitable for high data-rate dense wavelength division multiplexing scheme of optical communication within a very compact device size.

High-frequency acoustic spectrum analyzer based on polymer integrated optics

NASA Astrophysics Data System (ADS)

Yacoubian, Araz

This dissertation presents an acoustic spectrum analyzer based on nonlinear polymer-integrated optics. The device is used in a scanning heterodyne geometry by zero biasing a Michelson interferometer. It is capable of detecting vibrations from DC to the GHz range. Initial low frequency experiments show that the device is an effective tool for analyzing an acoustic spectrum even in noisy environments. Three generations of integrated sensors are presented, starting with a very lossy (86 dB total insertion loss) initial device that detects vibrations as low as λ/10, and second and third generation improvements with a final device of 44 dB total insertion loss. The sensor was further tested for detecting a pulsed laser-excited vibration and resonances due to the structure of the sample. The data are compared to the acoustic spectrum measured using a low loss passive fiber interferometer detection scheme which utilizes a high speed detector. The peaks present in the passive detection scheme are clearly visible with our sensor data, which have a lower noise floor. Hybrid integration of GHz electronics is also investigated in this dissertation. A voltage controlled oscillator (VCO) is integrated on a polymer device using a new approach. The VCO is shown to operate as specified by the manufacturer, and the RF signal is efficiently launched onto the micro-strip line used for EO modulation. In the future this technology can be used in conjunction with the presented sensor to produce a fully integrated device containing high frequency drive electronics controlled by low DC voltage. Issues related to device fabrication, loss analysis, RF power delivery to drive circuitry, efficient poling of large area samples, and optimizing poling conditions are also discussed throughout the text.

New scheme for braiding Majorana fermions.

PubMed

Wu, Long-Hua; Liang, Qi-Feng; Hu, Xiao

2014-12-01

Non-Abelian statistics can be achieved by exchanging two vortices in topological superconductors with each grabbing a Majorana fermion (MF) as zero-energy quasi-particle at the cores. However, in experiments it is difficult to manipulate vortices. In the present work, we propose a way to braid MFs without moving vortices. The only operation required in the present scheme is to turn on and off local gate voltages, which liberates a MF from its original host vortex and transports it along the prepared track. We solve the time-dependent Bogoliubov-de Gennes equation numerically, and confirm that the MFs are protected provided the switching of gate voltages for exchanging MFs are adiabatic, which takes only several nano seconds given reasonable material parameters. By monitoring the time evolution of MF wave-functions, we show that non-Abelian statistics is achieved.

A 50 AH nickel cadmium battery activation and charge retention parametric study for LANDSAT-D

NASA Technical Reports Server (NTRS)

Tasevoli, M.

1982-01-01

An alternate nickel-cadmium cell activation scheme was developed which significantly reduces battery dissipation while maintaining the cell active material in the proper electrochemical state. The new procedure of charging at C/20 for 8 hours, C/10 for 6 hours and followed by C/5 to a voltage limit of 1.430 volt/cell significantly reduces the heat dissipation and charge period when compared to the standard activation practice of charging at C/20 for 48 hours. In addition, subsequent discharge voltage profiles using the new scheme are higher when compared to the standard practice. The effects of extended open-circuit periods on nickel-cadmium cell results in a capacity loss of approximately 0.7 percent and 1.4 percent per day at 23 and 35 degrees Celsius, respectively.

Voltage management of distribution networks with high penetration of distributed photovoltaic generation sources

NASA Astrophysics Data System (ADS)

Alyami, Saeed

Installation of photovoltaic (PV) units could lead to great challenges to the existing electrical systems. Issues such as voltage rise, protection coordination, islanding detection, harmonics, increased or changed short-circuit levels, etc., need to be carefully addressed before we can see a wide adoption of this environmentally friendly technology. Voltage rise or overvoltage issues are of particular importance to be addressed for deploying more PV systems to distribution networks. This dissertation proposes a comprehensive solution to deal with the voltage violations in distribution networks, from controlling PV power outputs and electricity consumption of smart appliances in real time to optimal placement of PVs at the planning stage. The dissertation is composed of three parts: the literature review, the work that has already been done and the future research tasks. An overview on renewable energy generation and its challenges are given in Chapter 1. The overall literature survey, motivation and the scope of study are also outlined in the chapter. Detailed literature reviews are given in the rest of chapters. The overvoltage and undervoltage phenomena in typical distribution networks with integration of PVs are further explained in Chapter 2. Possible approaches for voltage quality control are also discussed in this chapter, followed by the discussion on the importance of the load management for PHEVs and appliances and its benefits to electric utilities and end users. A new real power capping method is presented in Chapter 3 to prevent overvoltage by adaptively setting the power caps for PV inverters in real time. The proposed method can maintain voltage profiles below a pre-set upper limit while maximizing the PV generation and fairly distributing the real power curtailments among all the PV systems in the network. As a result, each of the PV systems in the network has equal opportunity to generate electricity and shares the responsibility of voltage regulation. The method does not require global information and can be implemented either under a centralized supervisory control scheme or in a distributed way via consensus control. Chapter 4 investigates autonomous operation schedules for three types of intelligent appliances (or residential controllable loads) without receiving external signals for cost saving and for assisting the management of possible photovoltaic generation systems installed in the same distribution network. The three types of controllable loads studied in the chapter are electric water heaters, refrigerators deicing loads, and dishwashers, respectively. Chapter 5 investigates the method to mitigate overvoltage issues at the planning stage. A probabilistic method is presented in the chapter to evaluate the overvoltage risk in a distribution network with different PV capacity sizes under different load levels. Kolmogorov--Smirnov test (K--S test) is used to identify the most proper probability distributions for solar irradiance in different months. To increase accuracy, an iterative process is used to obtain the maximum allowable injection of active power from PVs. Conclusion and discussions on future work are given in Chapter 6.

Improvement in Brightness Uniformity by Compensating for the Threshold Voltages of Both the Driving Thin-Film Transistor and the Organic Light-Emitting Diode for Active-Matrix Organic Light-Emitting Diode Displays

NASA Astrophysics Data System (ADS)

Ching-Lin Fan,; Hui-Lung Lai,; Jyu-Yu Chang,

2010-05-01

In this paper, we propose a novel pixel design and driving method for active-matrix organic light-emitting diode (AM-OLED) displays using low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs). The proposed threshold voltage compensation circuit, which comprised five transistors and two capacitors, has been verified to supply uniform output current by simulation work using the automatic integrated circuit modeling simulation program with integrated circuit emphasis (AIM-SPICE) simulator. The driving scheme of this voltage programming method includes four periods: precharging, compensation, data input, and emission. The simulated results demonstrate excellent properties such as low error rate of OLED anode voltage variation (<1%) and high output current. The proposed pixel circuit shows high immunity to the threshold voltage deviation characteristics of both the driving poly-Si TFT and the OLED.

Smart Grid Constraint Violation Management for Balancing and Regulating Purposes

DOE PAGES

Bhattarai, Bishnu; Kouzelis, Konstantinos; Mendaza, Iker; ...

2017-03-29

The gradual active load penetration in low voltage distribution grids is expected to challenge their network capacity in the near future. Distribution system operators should for this reason resort to either costly grid reinforcements or to demand side management mechanisms. Since demand side management implementation is usually cheaper, it is also the favorable solution. To this end, this article presents a framework for handling grid limit violations, both voltage and current, to ensure a secure and qualitative operation of the distribution grid. This framework consists of two steps, namely a proactive centralized and subsequently a reactive decentralized control scheme. Themore » former is employed to balance the one hour ahead load while the latter aims at regulating the consumption in real-time. In both cases, the importance of fair use of electricity demand flexibility is emphasized. Thus, it is demonstrated that this methodology aids in keeping the grid status within preset limits while utilizing flexibility from all flexibility participants.« less

A Wireless Self-Powered Urinary Incontinence Sensor System

NASA Astrophysics Data System (ADS)

Tanaka, Ami; Utsunomiya, Fumiyasu; Douseki, Takakuni

A self-powered urinary incontinence sensor system consisting of a urine-activated coin battery and a wireless transmitter has been developed as an application for wireless biosensor networks. The urine-activated battery makes possible both the sensing of urine leakage and self-powered operation. An intermittent power-supply circuit that uses an electric double-layer capacitor (EDLC) with a small internal resistance suppresses the supply voltage drop due to the large internal resistance of the battery. This circuit and a 1-V surface acoustic wave (SAW) oscillator reduce the power dissipation of a wireless transmitter. The SAW oscillator quickly responds to the on-off control of the power supply, which is suitable for intermittent operation. To verify the effectiveness of the circuit scheme, the authors fabricated a prototype sensor system. When the volume of urine is 0.2 ml, the battery outputs a voltage of over 1.3 V; and the sensor system can transmit signals over a distance of 5 m.

An electromechanical actuation system for an expendable launch vehicle

NASA Technical Reports Server (NTRS)

Burrows, Linda M.; Roth, Mary E.

1992-01-01

A major effort at NASA-Lewis in recent years has been to develop electro-mechanical actuators (EMA's) to replace the hydraulic systems used for thrust vector control (TVC) on launch vehicles. This is an attempt to overcome the inherent inefficiencies and costs associated with the existing hydraulic structures. General Dynamics Space Systems Division, under contract to NASA Lewis, is developing 18.6 kW (25 hp), 29.8 kW (40 hp), and 52.2 kW (70 hp) peak EMA systems to meet the power demands for TVC on a family of vehicles developed for the National Launch System. These systems utilize a pulse population modulated converter and field-oriented control scheme to obtain independent control of both the voltage and frequency. These techniques allow an induction motor to be operated at its maximum torque at all times.

Robust finite-time chaos synchronization of uncertain permanent magnet synchronous motors.

PubMed

Chen, Qiang; Ren, Xuemei; Na, Jing

2015-09-01

In this paper, a robust finite-time chaos synchronization scheme is proposed for two uncertain third-order permanent magnet synchronous motors (PMSMs). The whole synchronization error system is divided into two cascaded subsystems: a first-order subsystem and a second-order subsystem. For the first subsystem, we design a finite-time controller based on the finite-time Lyapunov stability theory. Then, according to the backstepping idea and the adding a power integrator technique, a second finite-time controller is constructed recursively for the second subsystem. No exogenous forces are required in the controllers design but only the direct-axis (d-axis) and the quadrature-axis (q-axis) stator voltages are used as manipulated variables. Comparative simulations are provided to show the effectiveness and superior performance of the proposed method. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Power-Aware Compiler Controllable Chip Multiprocessor

NASA Astrophysics Data System (ADS)

Shikano, Hiroaki; Shirako, Jun; Wada, Yasutaka; Kimura, Keiji; Kasahara, Hironori

A power-aware compiler controllable chip multiprocessor (CMP) is presented and its performance and power consumption are evaluated with the optimally scheduled advanced multiprocessor (OSCAR) parallelizing compiler. The CMP is equipped with power control registers that change clock frequency and power supply voltage to functional units including processor cores, memories, and an interconnection network. The OSCAR compiler carries out coarse-grain task parallelization of programs and reduces power consumption using architectural power control support and the compiler's power saving scheme. The performance evaluation shows that MPEG-2 encoding on the proposed CMP with four CPUs results in 82.6% power reduction in real-time execution mode with a deadline constraint on its sequential execution time. Furthermore, MP3 encoding on a heterogeneous CMP with four CPUs and four accelerators results in 53.9% power reduction at 21.1-fold speed-up in performance against its sequential execution in the fastest execution mode.

NOVEL TECHNIQUE OF POWER CONTROL IN MAGNETRON TRANSMITTERS FOR INTENSE ACCELERATORS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kazakevich, G.; Johnson, R.; Neubauer, M.

A novel concept of a high-power magnetron transmitter allowing dynamic phase and power control at the frequency of locking signal is proposed. The transmitter compensating parasitic phase and amplitude modulations inherent in Superconducting RF (SRF) cavities within closed feedback loops is intended for powering of the intensity-frontier superconducting accelerators. The con- cept uses magnetrons driven by a sufficient resonant (in- jection-locking) signal and fed by the voltage which can be below the threshold of self-excitation. This provides an extended range of power control in a single magnetron at highest efficiency minimizing the cost of RF power unit and the operationmore » cost. Proof-of-principle of the proposed concept demonstrated in pulsed and CW regimes with 2.45 GHz, 1kW magnetrons is discussed here. A conceptual scheme of the high-power transmitter allowing the dynamic wide-band phase and y power controls is presented and discussed.« less

A Hybrid LCC-VSC HVDC Transmission System Supplying a Passive Load

NASA Astrophysics Data System (ADS)

Kotb, Omar

High Voltage Direct Current (HVDC) transmission systems continue to be an excellent asset in modern power systems, mainly for their ability to overcome the problems of AC transmission, such as the interconnection of asynchronous grids, stability of long transmission lines, and use of long cables for power transmission. In the past 20 years, Voltage Source Converter (VSC)-HVDC transmission systems were developed and installed in many projects, thereby adding more operational benefits to DC transmission option, such as high controllability, ability to supply weak networks, and reduced converter reactive power demand. Nevertheless, VSC-HVDC transmission suffers from the disadvantages of high losses and cost. In this research, a hybrid HVDC employing a Line Commutated Converter (LCC) as rectifier and a VSC as inverter is used to supply a passive network through a DC cable. The hybrid system is best suited for unidirectional power transmission scenarios, such as power transmission to islands and remote load centers, where the construction of new transmission lines is prohibitively expensive. Control modes for the rectifier and inverter are selected and implemented using Proportional Integral (PI) controllers. Special control schemes are developed for abnormal operating conditions such as starting at light load and recovering from AC network faults. The system performance under steady state and transient conditions is investigated by EMTP-RV simulations. The results show the feasibility of the hybrid system.

Active-Matrix Organic Light Emission Diode Pixel Circuit for Suppressing and Compensating for the Threshold Voltage Degradation of Hydrogenated Amorphous Silicon Thin Film Transistors

NASA Astrophysics Data System (ADS)

Shin, Hee-Sun; Lee, Won-Kyu; Park, Sang-Guen; Kuk, Seung-Hee; Han, Min-Koo

2009-03-01

A new hydrogenated amorphous silicon (a-Si:H) thin film transistor (TFT) pixel circuit for active-matrix organic light emission diodes (AM-OLEDs), which significantly compensates the OLED current degradation by memorizing the threshold voltage of driving TFT and suppresses the threshold voltage shift of a-Si:H TFTs by negative bias annealing, is proposed and fabricated. During the first half of each frame, the driving TFT of the proposed pixel circuit supplies current to the OLED, which is determined by modified data voltage in the compensation scheme. The proposed pixel circuit was able to compensate the threshold voltage shift of the driving TFT as well as the OLED. During the remaining half of each frame, the proposed pixel circuit induces the recovery of the threshold voltage degradation of a-Si:H TFTs owing to the negative bias annealing. The experimental results show that the proposed pixel circuit was able to successfully compensate for the OLED current degradation and suppress the threshold voltage degradation of the driving TFT.

Automatic NMR field-frequency lock-pulsed phase locked loop approach.

PubMed

Kan, S; Gonord, P; Fan, M; Sauzade, M; Courtieu, J

1978-06-01

A self-contained deuterium frequency-field lock scheme for a high-resolution NMR spectrometer is described. It is based on phase locked loop techniques in which the free induction decay signal behaves as a voltage-controlled oscillator. By pulsing the spins at an offset frequency of a few hundred hertz and using a digital phase-frequency discriminator this method not only eliminates the usual phase, rf power, offset adjustments needed in conventional lock systems but also possesses the automatic pull-in characteristics that dispense with the use of field sweeps to locate the NMR line prior to closure of the lock loop.

Research on Three-phase Four-wire Inverter

NASA Astrophysics Data System (ADS)

Xin, W. D.; Li, X. K.; Huang, G. Z.; Fan, X. C.; Gong, X. J.; Sun, L.; Wang, J.; Zhu, D. W.

2017-05-01

The concept of Voltage Source Converter (VSC) based hybrid AC and DC distribution system architecture is proposed, which can solve the traditional AC distribution power quality problems and respond to the request of DC distribution development. At first, a novel VSC system structure combining the four-leg based three-phase four-wire with LC filter is adopted, using the overall coordination control scheme of the AC current tracking compensation based grid-interfaced VSC. In the end, the 75 kW simulation experimental system is designed and tested to verify the performance of the proposed VSC under DC distribution, distributed DC sources conditions, as well as power quality management of AC distribution.

Numerical study of read scheme in one-selector one-resistor crossbar array

NASA Astrophysics Data System (ADS)

Kim, Sungho; Kim, Hee-Dong; Choi, Sung-Jin

2015-12-01

A comprehensive numerical circuit analysis of read schemes of a one selector-one resistance change memory (1S1R) crossbar array is carried out. Three schemes-the ground, V/2, and V/3 schemes-are compared with each other in terms of sensing margin and power consumption. Without the aid of a complex analytical approach or SPICE-based simulation, a simple numerical iteration method is developed to simulate entire current flows and node voltages within a crossbar array. Understanding such phenomena is essential in successfully evaluating the electrical specifications of selectors for suppressing intrinsic drawbacks of crossbar arrays, such as sneaky current paths and series line resistance problems. This method provides a quantitative tool for the accurate analysis of crossbar arrays and provides guidelines for developing an optimal read scheme, array configuration, and selector device specifications.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noda, Akira; Iwashita, Yoshihisa; Souda, Hikaru

A phase rotation scheme of laser-produced ions from a solid target by the application of a synchronized RF electric voltage with a pulsed laser has been experimentally investigated with the use of a 100 TW laser, J-KAREN at JAEA, KPSI. Up to now, energy peaks of up to around 2.0 MeV have been created with a FWHM of 2.6% with good reproducibility using a two-gap resonator of a quarter wave length with the same frequency as the source laser (approx80 MHz). It is also found that the position of the peak can be well controlled by adjusting the relative phasemore » between the RF electric field and the laser, which is very promising for real applications of such laser-produced protons. In order to also apply such a phase rotation system for higher energy protons (<200 MeV), a scheme to use a small linear accelerator (LINAC) with multi-gaps is proposed as a phase rotator. With multi-gap structure, alternating focusing between longitudinal and transverse degrees of freedoms can be realized. From the point of compactness and realizing a small focused spot, however, a scheme combining separate quadrupole magnets just before and after the RF cavity excited with the Wideroee mode, might be more effective. The scheme presented here will realize laser-produced ions (protons) with good reproducibility by combining with RF technology.« less

Economics and a novel voltage conversion technique associated with exporting Wyoming's energy by HVDC transmission

NASA Astrophysics Data System (ADS)

Xu, Kaili

Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also simulated by using the Real Time Digital Simulator (RTDS) with a few assumptions. Simulation results of various operating conditions confirm the theoretical analysis results.

Low power, scalable multichannel high voltage controller

DOEpatents

Stamps, James Frederick [Livermore, CA; Crocker, Robert Ward [Fremont, CA; Yee, Daniel Dadwa [Dublin, CA; Dils, David Wright [Fort Worth, TX

2006-03-14

A low voltage control circuit is provided for individually controlling high voltage power provided over bus lines to a multitude of interconnected loads. An example of a load is a drive for capillary channels in a microfluidic system. Control is distributed from a central high voltage circuit, rather than using a number of large expensive central high voltage circuits to enable reducing circuit size and cost. Voltage is distributed to each individual load and controlled using a number of high voltage controller channel switches connected to high voltage bus lines. The channel switches each include complementary pull up and pull down photo isolator relays with photo isolator switching controlled from the central high voltage circuit to provide a desired bus line voltage. Switching of the photo isolator relays is further controlled in each channel switch using feedback from a resistor divider circuit to maintain the bus voltage swing within desired limits. Current sensing is provided using a switched resistive load in each channel switch, with switching of the resistive loads controlled from the central high voltage circuit.

Low power, scalable multichannel high voltage controller

DOEpatents

Stamps, James Frederick [Livermore, CA; Crocker, Robert Ward [Fremont, CA; Yee, Daniel Dadwa [Dublin, CA; Dils, David Wright [Fort Worth, TX

2008-03-25

A low voltage control circuit is provided for individually controlling high voltage power provided over bus lines to a multitude of interconnected loads. An example of a load is a drive for capillary channels in a microfluidic system. Control is distributed from a central high voltage circuit, rather than using a number of large expensive central high voltage circuits to enable reducing circuit size and cost. Voltage is distributed to each individual load and controlled using a number of high voltage controller channel switches connected to high voltage bus lines. The channel switches each include complementary pull up and pull down photo isolator relays with photo isolator switching controlled from the central high voltage circuit to provide a desired bus line voltage. Switching of the photo isolator relays is further controlled in each channel switch using feedback from a resistor divider circuit to maintain the bus voltage swing within desired limits. Current sensing is provided using a switched resistive load in each channel switch, with switching of the resistive loads controlled from the central high voltage circuit.

An Integrated Programmable Wide-range PLL for Switching Synchronization in Isolated DC-DC Converters

NASA Astrophysics Data System (ADS)

Fard, Miad

In this thesis, two Phase-Locked-Loop (PLL) based synchronization schemes are introduced and applied to a bi-directional Dual-Active-Bridge (DAB) dc-dc converter with an input voltage up to 80 V switching in the range of 250 kHz to 1 MHz. The two schemes synchronize gating signals across an isolated boundary without the need for an isolator per transistor. The Power Transformer Sensing (PTS) method utilizes the DAB power transformer to indirectly sense switching on the secondary side of the boundary, while the Digital Isolator Sensing (DIS) method utilizes a miniature transformer for synchronization and communication at up to 100 MHz. The PLL is implemented on-chip, and is used to control an external DAB power-stage. This work will lead to lower cost, high-frequency isolated dc-dc converters needed for a wide variety of emerging low power applications where isolator cost is relatively high and there is a demand for the reduction of parts.

Fuzzy-Wavelet Based Double Line Transmission System Protection Scheme in the Presence of SVC

NASA Astrophysics Data System (ADS)

Goli, Ravikumar; Shaik, Abdul Gafoor; Tulasi Ram, Sankara S.

2015-06-01

Increasing the power transfer capability and efficient utilization of available transmission lines, improving the power system controllability and stability, power oscillation damping and voltage compensation have made strides and created Flexible AC Transmission (FACTS) devices in recent decades. Shunt FACTS devices can have adverse effects on distance protection both in steady state and transient periods. Severe under reaching is the most important problem of relay which is caused by current injection at the point of connection to the system. Current absorption of compensator leads to overreach of relay. This work presents an efficient method based on wavelet transforms, fault detection, classification and location using Fuzzy logic technique which is almost independent of fault impedance, fault distance and fault inception angle. The proposed protection scheme is found to be fast, reliable and accurate for various types of faults on transmission lines with and without Static Var compensator at different locations and with various incidence angles.

A Spherical Electro Optic High Voltage Sensor

DTIC Science & Technology

1989-06-01

electro - optic (EO) crystal is introduced for photonic measurement of pulsed high-voltage fields. A spherical shape is used in order to reduce electric field gradients in the vicinity of the sensor. The sensor is pure dielectric and is interrogated remotely using a laser. The sensor does not require the connection of any conducting components, which results in the highest electrical isolation. The spherical nature of the crystal coupled with the incident laser beam, and crossed polarizers (intensity modulation scheme). automatically produces interference figures. The

Dynamic SVL and body bias for low leakage power and high performance in CMOS digital circuits

NASA Astrophysics Data System (ADS)

Deshmukh, Jyoti; Khare, Kavita

2012-12-01

In this article, a new complementary metal oxide semiconductor design scheme called dynamic self-controllable voltage level (DSVL) is proposed. In the proposed scheme, leakage power is controlled by dynamically disconnecting supply to inactive blocks and adjusting body bias to further limit leakage and to maintain performance. Leakage power measurements at 1.8 V, 75°C demonstrate power reduction by 59.4% in case of 1 bit full adder and by 43.0% in case of a chain of four inverters using SVL circuit as a power switch. Furthermore, we achieve leakage power reduction by 94.7% in case of 1 bit full adder and by 91.8% in case of a chain of four inverters using dynamic body bias. The forward body bias of 0.45 V applied in active mode improves the maximum operating frequency by 16% in case of 1 bit full adder and 5.55% in case of a chain of inverters. Analysis shows that additional benefits of using the DSVL and body bias include high performance, low leakage power consumption in sleep mode, single threshold implementation and state retention even in standby mode.

Low-to-Medium Power Single Chip Digital Controlled DC-DC Regulator for Point-of-Load Applications

NASA Technical Reports Server (NTRS)

Adell, Philippe C. (Inventor); Bakkaloglu, Bertan (Inventor); Vermeire, Bert (Inventor); Liu, Tao (Inventor)

2015-01-01

A DC-DC converter for generating a DC output voltage includes: a digitally controlled pulse width modulator (DPWM) for controlling a switching power stage to supply a varying voltage to an inductor; and a digital voltage feedback circuit for controlling the DPWM in accordance with a feedback voltage corresponding to the DC output voltage, the digital voltage feedback circuit including: a first voltage controlled oscillator for converting the feedback voltage into a first frequency signal and to supply the first frequency signal to a first frequency discriminator; a second voltage controlled oscillator for converting a reference voltage into a second frequency signal and to supply the second frequency signal to a second frequency discriminator; a digital comparator for comparing digital outputs of the first and second frequency discriminators and for outputting a digital feedback signal; and a controller for controlling the DPWM in accordance with the digital feedback signal.

Methods, systems and apparatus for controlling third harmonic voltage when operating a multi-space machine in an overmodulation region

DOEpatents

Perisic, Milun; Kinoshita, Michael H; Ranson, Ray M; Gallegos-Lopez, Gabriel

2014-06-03

Methods, system and apparatus are provided for controlling third harmonic voltages when operating a multi-phase machine in an overmodulation region. The multi-phase machine can be, for example, a five-phase machine in a vector controlled motor drive system that includes a five-phase PWM controlled inverter module that drives the five-phase machine. Techniques for overmodulating a reference voltage vector are provided. For example, when the reference voltage vector is determined to be within the overmodulation region, an angle of the reference voltage vector can be modified to generate a reference voltage overmodulation control angle, and a magnitude of the reference voltage vector can be modified, based on the reference voltage overmodulation control angle, to generate a modified magnitude of the reference voltage vector. By modifying the reference voltage vector, voltage command signals that control a five-phase inverter module can be optimized to increase output voltages generated by the five-phase inverter module.

Advanced simulation model for IPM motor drive with considering phase voltage and stator inductance

NASA Astrophysics Data System (ADS)

Lee, Dong-Myung; Park, Hyun-Jong; Lee, Ju

2016-10-01

This paper proposes an advanced simulation model of driving system for Interior Permanent Magnet (IPM) BrushLess Direct Current (BLDC) motors driven by 120-degree conduction method (two-phase conduction method, TPCM) that is widely used for sensorless control of BLDC motors. BLDC motors can be classified as SPM (Surface mounted Permanent Magnet) and IPM motors. Simulation model of driving system with SPM motors is simple due to the constant stator inductance regardless of the rotor position. Simulation models of SPM motor driving system have been proposed in many researches. On the other hand, simulation models for IPM driving system by graphic-based simulation tool such as Matlab/Simulink have not been proposed. Simulation study about driving system of IPMs with TPCM is complex because stator inductances of IPM vary with the rotor position, as permanent magnets are embedded in the rotor. To develop sensorless scheme or improve control performance, development of control algorithm through simulation study is essential, and the simulation model that accurately reflects the characteristic of IPM is required. Therefore, this paper presents the advanced simulation model of IPM driving system, which takes into account the unique characteristic of IPM due to the position-dependent inductances. The validity of the proposed simulation model is validated by comparison to experimental and simulation results using IPM with TPCM control scheme.

High-fidelity gates in quantum dot spin qubits

PubMed Central

Koh, Teck Seng; Coppersmith, S. N.; Friesen, Mark

2013-01-01

Several logical qubits and quantum gates have been proposed for semiconductor quantum dots controlled by voltages applied to top gates. The different schemes can be difficult to compare meaningfully. Here we develop a theoretical framework to evaluate disparate qubit-gating schemes on an equal footing. We apply the procedure to two types of double-dot qubits: the singlet–triplet and the semiconducting quantum dot hybrid qubit. We investigate three quantum gates that flip the qubit state: a DC pulsed gate, an AC gate based on logical qubit resonance, and a gate-like process known as stimulated Raman adiabatic passage. These gates are all mediated by an exchange interaction that is controlled experimentally using the interdot tunnel coupling g and the detuning ϵ, which sets the energy difference between the dots. Our procedure has two steps. First, we optimize the gate fidelity (f) for fixed g as a function of the other control parameters; this yields an that is universal for different types of gates. Next, we identify physical constraints on the control parameters; this yields an upper bound that is specific to the qubit-gate combination. We show that similar gate fidelities should be attainable for singlet-triplet qubits in isotopically purified Si, and for hybrid qubits in natural Si. Considerably lower fidelities are obtained for GaAs devices, due to the fluctuating magnetic fields ΔB produced by nuclear spins. PMID:24255105

Ion accelerator system mounting design and operating characteristics for a 5 kW 30-cm xenon ion engine

NASA Technical Reports Server (NTRS)

Aston, Graeme; Brophy, John R.

1987-01-01

Results from a series of experiments to determine the effect of accelerator grid mount geometry on the performance of the J-series ion optics assembly are described. Three mounting schemes, two flexible and one rigid, are compared for their relative ion extraction capability over a range of total accelerating voltages. The largest ion beam current, for the maximum total voltage investigated, is shown to occur using one of the flexible grid mounting geometries. However, at lower total voltages and reduced engine input power levels, the original rigid J-series ion optics accelerator grid mounts result in marginally better grid system performance at the same cold interelectrode gap.

Low driving voltage blue, green, yellow, red and white organic light-emitting diodes with a simply double light-emitting structure.

PubMed

Zhang, Zhensong; Yue, Shouzhen; Wu, Yukun; Yan, Pingrui; Wu, Qingyang; Qu, Dalong; Liu, Shiyong; Zhao, Yi

2014-01-27

Low driving voltage blue, green, yellow, red and white phosphorescent organic light-emitting diodes (OLEDs) with a common simply double emitting layer (D-EML) structure are investigated. Our OLEDs without any out-coupling schemes as well as n-doping strategies show low driving voltage, e.g. < 2.4 V for onset and < 3 V for 1000 cd/m2, and high efficiency of 32.5 lm/W (13.3%), 58.8 lm/W (14.3%), 55.1 lm/W (14.6%), 24.9 lm/W (13.7%) and 45.1 lm/W (13.5%) for blue, green, yellow, red and white OLED, respectively. This work demonstrates that the low driving voltages and high efficiencies can be simultaneously realized with a common simply D-EML structure.

Experimental studies of a prototype model of the multilevel 6KW-power inverter at supply by 12 accumulators

NASA Astrophysics Data System (ADS)

Taissariyeva, K.; Issembergenov, N.; Dzhobalaeva, G.; Usembaeva, S.

2016-09-01

The given paper considers the multilevel 6 kW-power transistor inverter at supply by 12 accumulators for transformation of solar battery energy to the electric power. At the output of the multilevel transistor inverter, it is possible to receive voltage close to a sinusoidal form. The main objective of this inverter is transformation of solar energy to the electric power of industrial frequency. The analysis of the received output curves of voltage on harmonicity has been carried out. In this paper it is set forth the developed scheme of the multilevel transistor inverter (DC-to-ac converter) which allows receiving at the output the voltage close to sinusoidal form, as well as to regulation of the output voltage level. In the paper, the results of computer modeling and experimental studies are presented.

Optimization and testing of solid thin film lubrication deposition processes

NASA Astrophysics Data System (ADS)

Danyluk, Michael J.

A novel method for testing solid thin films in rolling contact fatigue (RCF) under ultra-high vacuum (UHV) and high rotational speeds (130 Hz) is presented in this thesis. The UHV-RCF platform is used to quantify the adhesion and lubrication aspects of two thin film coatings deposited on ball-bearings using a physical vapor deposition ion plating process. Plasma properties during ion plating were measured using a Langmuir probe and there is a connection between ion flux, film stress, film adhesion, process voltage, pressure, and RCF life. The UHV-RCF platform and vacuum chamber were constructed using off-the-shelf components and 88 RCF tests in high vacuum have been completed. Maximum RCF life was achieved by maintaining an ion flux between 10 13 to 1015 (cm-2 s-1) with a process voltage and pressure near 1.5 kV and 15 mTorr. Two controller schemes were investigated to maintain optimal plasma conditions for maximum RCF life: PID and LQR. Pressure disturbances to the plasma have a detrimental effect on RCF life. Control algorithms that mitigate pressure and voltage disturbances already exist. However, feedback from the plasma to detect disturbances has not been explored related to deposition processes in the thin-film science literature. Manometer based pressure monitoring systems have a 1 to 2 second delay time and are too slow to detect common pressure bursts during the deposition process. Plasma diagnostic feedback is much faster, of the order of 0.1 second. Plasma total-current feedback was used successfully to detect a typical pressure disturbance associated with the ion plating process. Plasma current is related to ion density and process pressure. A real-time control application was used to detect the pressure disturbance by monitoring plasma-total current and converting it to feedback-input to a pressure control system. Pressure overshoot was eliminated using a nominal PID controller with feedback from a plasma-current diagnostic measurement tool.

Energy storage connection system

DOEpatents

Benedict, Eric L.; Borland, Nicholas P.; Dale, Magdelena; Freeman, Belvin; Kite, Kim A.; Petter, Jeffrey K.; Taylor, Brendan F.

2012-07-03

A power system for connecting a variable voltage power source, such as a power controller, with a plurality of energy storage devices, at least two of which have a different initial voltage than the output voltage of the variable voltage power source. The power system includes a controller that increases the output voltage of the variable voltage power source. When such output voltage is substantially equal to the initial voltage of a first one of the energy storage devices, the controller sends a signal that causes a switch to connect the variable voltage power source with the first one of the energy storage devices. The controller then causes the output voltage of the variable voltage power source to continue increasing. When the output voltage is substantially equal to the initial voltage of a second one of the energy storage devices, the controller sends a signal that causes a switch to connect the variable voltage power source with the second one of the energy storage devices.

Experimental Verification of Application of Looped System and Centralized Voltage Control in a Distribution System with Renewable Energy Sources

NASA Astrophysics Data System (ADS)

Hanai, Yuji; Hayashi, Yasuhiro; Matsuki, Junya

The line voltage control in a distribution network is one of the most important issues for a penetration of Renewable Energy Sources (RES). A loop distribution network configuration is an effective solution to resolve voltage and distribution loss issues concerned about a penetration of RES. In this paper, for a loop distribution network, the authors propose a voltage control method based on tap change control of LRT and active/reactive power control of RES. The tap change control of LRT takes a major role of the proposed voltage control. Additionally the active/reactive power control of RES supports the voltage control when voltage deviation from the upper or lower voltage limit is unavoidable. The proposed method adopts SCADA system based on measured data from IT switches, which are sectionalizing switch with sensor installed in distribution feeder. In order to check the validity of the proposed voltage control method, experimental simulations using a distribution system analog simulator “ANSWER” are carried out. In the simulations, the voltage maintenance capability in the normal and the emergency is evaluated.

To sort or not to sort: the impact of spike-sorting on neural decoding performance.

PubMed

Todorova, Sonia; Sadtler, Patrick; Batista, Aaron; Chase, Steven; Ventura, Valérie

2014-10-01

Brain-computer interfaces (BCIs) are a promising technology for restoring motor ability to paralyzed patients. Spiking-based BCIs have successfully been used in clinical trials to control multi-degree-of-freedom robotic devices. Current implementations of these devices require a lengthy spike-sorting step, which is an obstacle to moving this technology from the lab to the clinic. A viable alternative is to avoid spike-sorting, treating all threshold crossings of the voltage waveform on an electrode as coming from one putative neuron. It is not known, however, how much decoding information might be lost by ignoring spike identity. We present a full analysis of the effects of spike-sorting schemes on decoding performance. Specifically, we compare how well two common decoders, the optimal linear estimator and the Kalman filter, reconstruct the arm movements of non-human primates performing reaching tasks, when receiving input from various sorting schemes. The schemes we tested included: using threshold crossings without spike-sorting; expert-sorting discarding the noise; expert-sorting, including the noise as if it were another neuron; and automatic spike-sorting using waveform features. We also decoded from a joint statistical model for the waveforms and tuning curves, which does not involve an explicit spike-sorting step. Discarding the threshold crossings that cannot be assigned to neurons degrades decoding: no spikes should be discarded. Decoding based on spike-sorted units outperforms decoding based on electrodes voltage crossings: spike-sorting is useful. The four waveform based spike-sorting methods tested here yield similar decoding efficiencies: a fast and simple method is competitive. Decoding using the joint waveform and tuning model shows promise but is not consistently superior. Our results indicate that simple automated spike-sorting performs as well as the more computationally or manually intensive methods used here. Even basic spike-sorting adds value to the low-threshold waveform-crossing methods often employed in BCI decoding.

To sort or not to sort: the impact of spike-sorting on neural decoding performance

NASA Astrophysics Data System (ADS)

Todorova, Sonia; Sadtler, Patrick; Batista, Aaron; Chase, Steven; Ventura, Valérie

2014-10-01

Objective. Brain-computer interfaces (BCIs) are a promising technology for restoring motor ability to paralyzed patients. Spiking-based BCIs have successfully been used in clinical trials to control multi-degree-of-freedom robotic devices. Current implementations of these devices require a lengthy spike-sorting step, which is an obstacle to moving this technology from the lab to the clinic. A viable alternative is to avoid spike-sorting, treating all threshold crossings of the voltage waveform on an electrode as coming from one putative neuron. It is not known, however, how much decoding information might be lost by ignoring spike identity. Approach. We present a full analysis of the effects of spike-sorting schemes on decoding performance. Specifically, we compare how well two common decoders, the optimal linear estimator and the Kalman filter, reconstruct the arm movements of non-human primates performing reaching tasks, when receiving input from various sorting schemes. The schemes we tested included: using threshold crossings without spike-sorting; expert-sorting discarding the noise; expert-sorting, including the noise as if it were another neuron; and automatic spike-sorting using waveform features. We also decoded from a joint statistical model for the waveforms and tuning curves, which does not involve an explicit spike-sorting step. Main results. Discarding the threshold crossings that cannot be assigned to neurons degrades decoding: no spikes should be discarded. Decoding based on spike-sorted units outperforms decoding based on electrodes voltage crossings: spike-sorting is useful. The four waveform based spike-sorting methods tested here yield similar decoding efficiencies: a fast and simple method is competitive. Decoding using the joint waveform and tuning model shows promise but is not consistently superior. Significance. Our results indicate that simple automated spike-sorting performs as well as the more computationally or manually intensive methods used here. Even basic spike-sorting adds value to the low-threshold waveform-crossing methods often employed in BCI decoding.

Systems and methods for providing power to a load based upon a control strategy

DOEpatents

Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

2013-12-24

Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

Controlling heat and particle currents in nanodevices by quantum observation

NASA Astrophysics Data System (ADS)

Biele, Robert; Rodríguez-Rosario, César A.; Frauenheim, Thomas; Rubio, Angel

2017-07-01

We demonstrate that in a standard thermo-electric nanodevice the current and heat flows are not only dictated by the temperature and potential gradient, but also by the external action of a local quantum observer that controls the coherence of the device. Depending on how and where the observation takes place, the direction of heat and particle currents can be independently controlled. In fact, we show that the current and heat flow in a quantum material can go against the natural temperature and voltage gradients. Dynamical quantum observation offers new possibilities for the control of quantum transport far beyond classical thermal reservoirs. Through the concept of local projections, we illustrate how we can create and directionality control the injection of currents (electronic and heat) in nanodevices. This scheme provides novel strategies to construct quantum devices with application in thermoelectrics, spintronic injection, phononics, and sensing among others. In particular, highly efficient and selective spin injection might be achieved by local spin projection techniques.

Response characteristic of high-speed on/off valve with double voltage driving circuit

NASA Astrophysics Data System (ADS)

Li, P. X.; Su, M.; Zhang, D. B.

2017-07-01

High-speed on/off valve, an important part of turbocharging system, its quick response has a direct impact on the turbocharger pressure cycle. The methods of improving the response characteristic of high speed on/off valve include increasing the magnetic force of armature and the voltage, decreasing the mass and current of coil. The less coil number of turns, the solenoid force is smaller. The special armature structure and the magnetic material will raise cost. In this paper a new scheme of double voltage driving circuit is investigated, in which the original driving circuit of high-speed on/off valve is replaced by double voltage driving circuit. The detailed theoretical analysis and simulations were carried out on the double voltage driving circuit, it showed that the switching time and delay time of the valve respectively are 3.3ms, 5.3ms, 1.9ms and 1.8ms. When it is driven by the double voltage driving circuit, the switching time and delay time of this valve are reduced, optimizing its response characteristic. By the comparison related factors (such as duty cycle or working frequency) about influences on response characteristic, the superior of double voltage driving circuit has been further confirmed.

A splitting scheme based on the space-time CE/SE method for solving multi-dimensional hydrodynamical models of semiconductor devices

NASA Astrophysics Data System (ADS)

Nisar, Ubaid Ahmed; Ashraf, Waqas; Qamar, Shamsul

2016-08-01

Numerical solutions of the hydrodynamical model of semiconductor devices are presented in one and two-space dimension. The model describes the charge transport in semiconductor devices. Mathematically, the models can be written as a convection-diffusion type system with a right hand side describing the relaxation effects and interaction with a self consistent electric field. The proposed numerical scheme is a splitting scheme based on the conservation element and solution element (CE/SE) method for hyperbolic step, and a semi-implicit scheme for the relaxation step. The numerical results of the suggested scheme are compared with the splitting scheme based on Nessyahu-Tadmor (NT) central scheme for convection step and the same semi-implicit scheme for the relaxation step. The effects of various parameters such as low field mobility, device length, lattice temperature and voltages for one-space dimensional hydrodynamic model are explored to further validate the generic applicability of the CE/SE method for the current model equations. A two dimensional simulation is also performed by CE/SE method for a MESFET device, producing results in good agreement with those obtained by NT-central scheme.

Monolithic stacked blue light-emitting diodes with polarization-enhanced tunnel junctions.

PubMed

Kuo, Yen-Kuang; Shih, Ya-Hsuan; Chang, Jih-Yuan; Lai, Wei-Chih; Liu, Heng; Chen, Fang-Ming; Lee, Ming-Lun; Sheu, Jinn-Kong

2017-08-07

Monolithic stacked InGaN light-emitting diode (LED) connected by a polarization-enhanced GaN/AlN-based tunnel junction is demonstrated experimentally in this study. The typical stacked LEDs exhibit 80% enhancement in output power compared with conventional single LEDs because of the repeated use of electrons and holes for photon generation. The typical operation voltage of stacked LEDs is higher than twice the operation voltage of single LEDs. This high operation voltage can be attributed to the non-optimal tunneling junction in stacked LEDs. In addition to the analyses of experimental results, theoretical analysis of different schemes of tunnel junctions, including diagrams of energy bands, diagrams of electric fields, and current-voltage relation curves, are investigated using numerical simulation. The results shown in this paper demonstrate the feasibility in developing cost-effective and highly efficient tunnel-junction LEDs.

A high resolution on-chip delay sensor with low supply-voltage sensitivity for high-performance electronic systems.

PubMed

Sheng, Duo; Lai, Hsiu-Fan; Chan, Sheng-Min; Hong, Min-Rong

2015-02-13

An all-digital on-chip delay sensor (OCDS) circuit with high delay-measurement resolution and low supply-voltage sensitivity for efficient detection and diagnosis in high-performance electronic system applications is presented. Based on the proposed delay measurement scheme, the quantization resolution of the proposed OCDS can be reduced to several picoseconds. Additionally, the proposed cascade-stage delay measurement circuit can enhance immunity to supply-voltage variations of the delay measurement resolution without extra self-biasing or calibration circuits. Simulation results show that the delay measurement resolution can be improved to 1.2 ps; the average delay resolution variation is 0.55% with supply-voltage variations of ±10%. Moreover, the proposed delay sensor can be implemented in an all-digital manner, making it very suitable for high-performance electronic system applications as well as system-level integration.

An improved low-voltage ride-through performance of DFIG based wind plant using stator dynamic composite fault current limiter.

PubMed

Gayen, P K; Chatterjee, D; Goswami, S K

2016-05-01

In this paper, an enhanced low-voltage ride-through (LVRT) performance of a grid connected doubly fed induction generator (DFIG) has been presented with the usage of stator dynamic composite fault current limiter (SDCFCL). This protection circuit comprises of a suitable series resistor-inductor combination and parallel bidirectional semiconductor switch. The SDCFCL facilitates double benefits such as reduction of rotor induced open circuit voltage due to increased value of stator total inductance and concurrent increase of rotor impedance. Both effects will limit rotor circuit over current and over voltage situation more secured way in comparison to the conventional scheme like the dynamic rotor current limiter (RCL) during any type of fault situation. The proposed concept is validated through the simulation study of the grid integrated 2.0MW DFIG. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

niSWAP and NTCP gates realized in a circuit QED system

NASA Astrophysics Data System (ADS)

Essammouni, K.; Chouikh, A.; Said, T.; Bennai, M.

Based on superconducting qubit coupled to a resonator driven by a strong microwave field, we propose a method to implement two quantum logic gates (niSWAP and NTCP gates) of one qubit simultaneously controlling n qubits selected from N qubits in a circuit QED (1 < n < N) by introducing qubit-qubit interaction. The interaction between the qubits and the circuit QED can be achieved by tuning the gate voltage and the external flux. The operation times of the logic gates are much smaller than the decoherence time and dephasing time. Moreover, the numerical simulation under the influence of the gates operations shows that the scheme could be achieved efficiently with presently available techniques.

A single supply biopotential amplifier.

PubMed

Spinelli, E M; Martinez, N H; Mayosky, M A

2001-04-01

A biopotential amplifier for single supply operation is presented. It uses a Driven Right Leg Circuit (DRL) to drive the patient's body to a DC common mode voltage, centering biopotential signals with respect to the amplifier's input voltage range. This scheme ensures proper range operation when a single power supply is used. The circuit described is especially suited for low consumption, battery-powered applications, requiring a single battery and avoiding switching voltage inverters to achieve dual supplies. The generic circuit is described and, as an example, a biopotential amplifier with a gain of 60 dB and a DC input range of +/-200 mV was implemented using low power operational amplifiers. A Common Mode Rejection Ratio (CMRR) of 126 dB at 50 Hz was achieved without trimming.

Method and system for determining induction motor speed

DOEpatents

Parlos, Alexander G.; Bharadwaj, Raj M.

2004-03-30

A non-linear, semi-parametric neural network-based adaptive filter is utilized to determine the dynamic speed of a rotating rotor within an induction motor, without the explicit use of a speed sensor, such as a tachometer, is disclosed. The neural network-based filter is developed using actual motor current measurements, voltage measurements, and nameplate information. The neural network-based adaptive filter is trained using an estimated speed calculator derived from the actual current and voltage measurements. The neural network-based adaptive filter uses voltage and current measurements to determine the instantaneous speed of a rotating rotor. The neural network-based adaptive filter also includes an on-line adaptation scheme that permits the filter to be readily adapted for new operating conditions during operations.

Investigation of Spray Cooling Schemes for Dynamic Thermal Management

NASA Astrophysics Data System (ADS)

Yata, Vishnu Vardhan Reddy

This study aims to investigate variable flow and intermittent flow spray cooling characteristics for efficiency improvement in active two-phase thermal management systems. Variable flow spray cooling scheme requires control of pump input voltage (or speed), while intermittent flow spray cooling scheme requires control of solenoid valve duty cycle and frequency. Several testing scenarios representing dynamic heat load conditions are implemented to characterize the overall performance of variable flow and intermittent flow spray cooling cases in comparison with the reference, steady flow spray cooling case with constant flowrate, continuous spray cooling. Tests are conducted on a small-scale, closed loop spray cooling system featuring a pressure atomized spray nozzle. HFE-7100 dielectric liquid is selected as the working fluid. Two types of test samples are prepared on 10 mm x 10 mm x 2 mm copper substrates with matching size thick film resistors attached onto the opposite side, to generate heat and simulate high heat flux electronic devices. The test samples include: (i) plain, smooth surface, and (ii) microporous surface featuring 100 ?m thick copper-based coating prepared by dual stage electroplating technique. Experimental conditions involve HFE-7100 at atmospheric pressure and 30°C and 10°C subcooling. Steady flow spray cooling tests are conducted at flow rates of 2-5 ml/cm2.s, by controlling the heat flux in increasing steps, and recording the corresponding steady-state temperatures to obtain cooling curves in the form of surface superheat vs. heat flux. Variable flow and intermittent flow spray cooling tests are done at selected flowrate and subcooling conditions to investigate the effects of dynamic flow conditions on maintaining the target surface temperatures defined based on reference steady flow spray cooling performance.

High-speed, random-access fluorescence microscopy: I. High-resolution optical recording with voltage-sensitive dyes and ion indicators.

PubMed

Bullen, A; Patel, S S; Saggau, P

1997-07-01

The design and implementation of a high-speed, random-access, laser-scanning fluorescence microscope configured to record fast physiological signals from small neuronal structures with high spatiotemporal resolution is presented. The laser-scanning capability of this nonimaging microscope is provided by two orthogonal acousto-optic deflectors under computer control. Each scanning point can be randomly accessed and has a positioning time of 3-5 microseconds. Sampling time is also computer-controlled and can be varied to maximize the signal-to-noise ratio. Acquisition rates up to 200k samples/s at 16-bit digitizing resolution are possible. The spatial resolution of this instrument is determined by the minimal spot size at the level of the preparation (i.e., 2-7 microns). Scanning points are selected interactively from a reference image collected with differential interference contrast optics and a video camera. Frame rates up to 5 kHz are easily attainable. Intrinsic variations in laser light intensity and scanning spot brightness are overcome by an on-line signal-processing scheme. Representative records obtained with this instrument by using voltage-sensitive dyes and calcium indicators demonstrate the ability to make fast, high-fidelity measurements of membrane potential and intracellular calcium at high spatial resolution (2 microns) without any temporal averaging.

High-speed, random-access fluorescence microscopy: I. High-resolution optical recording with voltage-sensitive dyes and ion indicators.

PubMed Central

Bullen, A; Patel, S S; Saggau, P

1997-01-01

The design and implementation of a high-speed, random-access, laser-scanning fluorescence microscope configured to record fast physiological signals from small neuronal structures with high spatiotemporal resolution is presented. The laser-scanning capability of this nonimaging microscope is provided by two orthogonal acousto-optic deflectors under computer control. Each scanning point can be randomly accessed and has a positioning time of 3-5 microseconds. Sampling time is also computer-controlled and can be varied to maximize the signal-to-noise ratio. Acquisition rates up to 200k samples/s at 16-bit digitizing resolution are possible. The spatial resolution of this instrument is determined by the minimal spot size at the level of the preparation (i.e., 2-7 microns). Scanning points are selected interactively from a reference image collected with differential interference contrast optics and a video camera. Frame rates up to 5 kHz are easily attainable. Intrinsic variations in laser light intensity and scanning spot brightness are overcome by an on-line signal-processing scheme. Representative records obtained with this instrument by using voltage-sensitive dyes and calcium indicators demonstrate the ability to make fast, high-fidelity measurements of membrane potential and intracellular calcium at high spatial resolution (2 microns) without any temporal averaging. Images FIGURE 6 PMID:9199810

Coherent control of the Goos-Hänchen shift via Fano interference

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Shaopeng; Yang, Wen-Xing, E-mail: wenxingyang@seu.edu.cn; Zhu, Zhonghu

2016-04-14

A scheme of enhanced Goos-Hänchen (GH) shifts in reflected and transmitted light beams is exploited in a cavity, where an asymmetric double AlGaAs/GaAs quantum well structure with resonant tunneling to a common continuum is employed as the intracavity medium. With the help of Fano-type interference induced by resonant tunneling, the generated GH shifts that contain a negative lateral shift in reflected light beam and a positive lateral shift in transmitted light beam are found to be significantly enhanced. More interestingly, these GH shifts in reflected and transmitted light beams are modulated by means of a control beam and external biasmore » voltage, in which maximum negative shift of 1.86 mm and positive shift of 0.37 mm are achievable.« less

Modular high voltage power supply for chemical analysis

DOEpatents

Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

2007-01-09

A high voltage power supply for use in a system such as a microfluidics system, uses a DC--DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC--DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

Modular high voltage power supply for chemical analysis

DOEpatents

Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

2010-05-04

A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

Modular high voltage power supply for chemical analysis

DOEpatents

Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

2008-07-15

A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

Voltage-Load Sensitivity Matrix Based Demand Response for Voltage Control in High Solar Penetration Distribution Feeders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Xiangqi; Wang, Jiyu; Mulcahy, David

This paper presents a voltage-load sensitivity matrix (VLSM) based voltage control method to deploy demand response resources for controlling voltage in high solar penetration distribution feeders. The IEEE 123-bus system in OpenDSS is used for testing the performance of the preliminary VLSM-based voltage control approach. A load disaggregation process is applied to disaggregate the total load profile at the feeder head to each load nodes along the feeder so that loads are modeled at residential house level. Measured solar generation profiles are used in the simulation to model the impact of solar power on distribution feeder voltage profiles. Different casemore » studies involving various PV penetration levels and installation locations have been performed. Simulation results show that the VLSM algorithm performance meets the voltage control requirements and is an effective voltage control strategy.« less

An equivalent network representation of a clamped bimorph piezoelectric micromachined ultrasonic transducer with circular and annular electrodes using matrix manipulation techniques.

PubMed

Sammoura, Firas; Smyth, Katherine; Kim, Sang-Gook

2013-09-01

An electric circuit model for a clamped circular bimorph piezoelectric micromachined ultrasonic transducer (pMUT) was developed for the first time. The pMUT consisted of two piezoelectric layers sandwiched between three thin electrodes. The top and bottom electrodes were separated into central and annular electrodes by a small gap. While the middle electrode was grounded, the central and annular electrodes were biased with two independent voltage sources. The strain mismatch between the piezoelectric layers caused the plate to vibrate and transmit a pressure wave, whereas the received echo generated electric charges resulting from plate deformation. The clamped pMUT plate was separated into a circular and an annular plate, and the respective electromechanical transformation matrices were derived. The force and velocity vectors were properly selected using Hamilton's principle and the necessary boundary conditions were invoked. The electromechanical transformation matrix for the clamped circular pMUT was deduced using simple matrix manipulation techniques. The pMUT performance under three biasing schemes was elaborated: 1) central electrode only, 2) central and annular electrodes with voltages of the same magnitude and polarity, and 3) central and annular electrodes with voltages of the same magnitude and opposite polarity. The circuit parameters of the pMUT were extracted for each biasing scheme, including the transformer ratio, the clamped electric impedance, and the open-circuit mechanical impedance. Each pMUT scheme was characterized under different acoustic loadings using the theoretically developed model, which was verified with finite element modeling (FEM) simulation. The electrode size was optimized to maximize the electromechanical transformer ratio. As such, the developed model could provide more insight into the design, optimization, and characterization of pMUTs and allow for performance comparison with their cMUT counterparts.

Reconfigurable Resonant Regulating Rectifier With Primary Equalization for Extended Coupling- and Loading-Range in Bio-Implant Wireless Power Transfer.

PubMed

Li, Xing; Meng, Xiaodong; Tsui, Chi-Ying; Ki, Wing-Hung

2015-12-01

Wireless power transfer using reconfigurable resonant regulating (R(3)) rectification suffers from limited range in accommodating varying coupling and loading conditions. A primary-assisted regulation principle is proposed to mitigate these limitations, of which the amplitude of the rectifier input voltage on the secondary side is regulated by accordingly adjusting the voltage amplitude Veq on the primary side. A novel current-sensing method and calibration scheme track Veq on the primary side. A ramp generator simultaneously provides three clock signals for different modules. Both the primary equalizer and the R(3) rectifier are implemented as custom integrated circuits fabricated in a 0.35 μm CMOS process, with the global control implemented in FPGA. Measurements show that with the primary equalizer, the workable coupling and loading ranges are extended by 250% at 120 mW load and 300% at 1.2 cm coil distance compared to the same system without the primary equalizer. A maximum rectifier efficiency of 92.5% and a total system efficiency of 62.4% are demonstrated.

Multi-Objective Differential Evolution for Voltage Security Constrained Optimal Power Flow in Deregulated Power Systems

NASA Astrophysics Data System (ADS)

Roselyn, J. Preetha; Devaraj, D.; Dash, Subhransu Sekhar

2013-11-01

Voltage stability is an important issue in the planning and operation of deregulated power systems. The voltage stability problems is a most challenging one for the system operators in deregulated power systems because of the intense use of transmission line capabilities and poor regulation in market environment. This article addresses the congestion management problem avoiding offline transmission capacity limits related to voltage stability by considering Voltage Security Constrained Optimal Power Flow (VSCOPF) problem in deregulated environment. This article presents the application of Multi Objective Differential Evolution (MODE) algorithm to solve the VSCOPF problem in new competitive power systems. The maximum of L-index of the load buses is taken as the indicator of voltage stability and is incorporated in the Optimal Power Flow (OPF) problem. The proposed method in hybrid power market which also gives solutions to voltage stability problems by considering the generation rescheduling cost and load shedding cost which relieves the congestion problem in deregulated environment. The buses for load shedding are selected based on the minimum eigen value of Jacobian with respect to the load shed. In the proposed approach, real power settings of generators in base case and contingency cases, generator bus voltage magnitudes, real and reactive power demands of selected load buses using sensitivity analysis are taken as the control variables and are represented as the combination of floating point numbers and integers. DE/randSF/1/bin strategy scheme of differential evolution with self-tuned parameter which employs binomial crossover and difference vector based mutation is used for the VSCOPF problem. A fuzzy based mechanism is employed to get the best compromise solution from the pareto front to aid the decision maker. The proposed VSCOPF planning model is implemented on IEEE 30-bus system, IEEE 57 bus practical system and IEEE 118 bus system. The pareto optimal front obtained from MODE is compared with reference pareto front and the best compromise solution for all the cases are obtained from fuzzy decision making strategy. The performance measures of proposed MODE in two test systems are calculated using suitable performance metrices. The simulation results show that the proposed approach provides considerable improvement in the congestion management by generation rescheduling and load shedding while enhancing the voltage stability in deregulated power system.

Control designs for low-loss active magnetic bearings: Theory and implementation

NASA Astrophysics Data System (ADS)

Wilson, Brian Christopher David

Active Magnetic Bearings (AMB) have been proposed for use in Electromechanical Flywheel Batteries. In these devices, kinetic energy is stored in a magnetically levitated flywheel which spins in a vacuum. The AMB eliminates all mechanical losses, however, electrical loss, which is proportional to the square of the magnetic flux, is still significant. For efficient operation, the flux bias, which is typically introduced into the electromagnets to improve the AMB stiffness, must be reduced, preferably to zero. This zero-bias (ZB) mode of operation cripples the classical control techniques which are customarily used and nonlinear control is required. As a compromise between AMB stiffness and efficiency, a new flux bias scheme is proposed called the generalized complementary flux condition (gcfc). A flux-bias dependent trade-off exists between AMB stiffness, power consumption, and power loss. This work theoretically develops and experimentally verifies new low-loss AMB control designs which employ the gcfc condition. Particular attention is paid to the removal of the singularity present in the standard nonlinear control techniques when operating in ZB. Experimental verification is conduced on a 6-DOF AMB reaction wheel. Practical aspects of the gcfc implementation such as flux measurement and flux-bias implementation with voltage mode amplifiers using IR compensation are investigated. Comparisons are made between the gcfc bias technique and the standard constant-flux-sum (cfs) bias method. Under typical operating circumstances, theoretical analysis and experimental data show that the new gcfc bias scheme is more efficient in producing the control flux required for rotor stabilization than the ordinary cfs bias strategy.

An open design microfabricated nib-like nanoelectrospray emitter tip on a conducting silicon substrate for the application of the ionization voltage.

PubMed

Le Gac, Séverine; Rolando, Christian; Arscott, Steve

2006-01-01

This paper describes a novel emitter tip having the shape of a nib and based on an open structure for nano-electrospray ionization mass spectrometry (nanoESI-MS). The nib structure is fabricated with standard lithography techniques using SU-8, an epoxy-based negative photoresist. The tip is comprised of a reservoir, a capillary slot and a point-like feature, and is fabricated on a silicon wafer. We present here a novel scheme for interfacing such nib tips to MS by applying the ionization voltage directly onto the semi-conductor support. The silicon support is in direct contact with the liquid to be analyzed at the reservoir and microchannel level, thus allowing easy use in ESI-MS. This scheme is especially advantageous for automated analysis as the manual step of positioning a metallic wire into the reservoir is avoided. In addition, the analysis performance was enhanced compared with the former scheme, as demonstrated by the tests of standard peptides (gramicidin S, Glu-fibrinopeptide B). The limit of detection was determined to be lower than 10(-2) microM. Due to their enhanced performance, these microfabricated sources might be of great interest for analysis requiring very high sensitivity, such as proteomics analysis using nanoESI-MS.

Optimized pulsed write schemes improve linearity and write speed for low-power organic neuromorphic devices

NASA Astrophysics Data System (ADS)

Keene, Scott T.; Melianas, Armantas; Fuller, Elliot J.; van de Burgt, Yoeri; Talin, A. Alec; Salleo, Alberto

2018-06-01

Neuromorphic devices are becoming increasingly appealing as efficient emulators of neural networks used to model real world problems. However, no hardware to date has demonstrated the necessary high accuracy and energy efficiency gain over CMOS in both (1) training via backpropagation and (2) in read via vector matrix multiplication. Such shortcomings are due to device non-idealities, particularly asymmetric conductance tuning in response to uniform voltage pulse inputs. Here, by formulating a general circuit model for capacitive ion-exchange neuromorphic devices, we show that asymmetric nonlinearity in organic electrochemical neuromorphic devices (ENODes) can be suppressed by an appropriately chosen write scheme. Simulations based upon our model suggest that a nonlinear write-selector could reduce the switching voltage and energy, enabling analog tuning via a continuous set of resistance states (100 states) with extremely low switching energy (~170 fJ · µm‑2). This work clarifies the pathway to neural algorithm accelerators capable of parallelism during both read and write operations.

Measuring modules for the research of compensators of reactive power with voltage stabilization in MATLAB

NASA Astrophysics Data System (ADS)

Vlasayevsky, Stanislav; Klimash, Stepan; Klimash, Vladimir

2017-10-01

A set of mathematical modules was developed for evaluation the energy performance in the research of electrical systems and complexes in the MatLab. In the electrotechnical library SimPowerSystems of the MatLab software, there are no measuring modules of energy coefficients characterizing the quality of electricity and the energy efficiency of electrical apparatus. Modules are designed to calculate energy coefficients characterizing the quality of electricity (current distortion and voltage distortion) and energy efficiency indicators (power factor and efficiency) are presented. There are described the methods and principles of building the modules. The detailed schemes of modules built on the elements of the Simulink Library are presented, in this connection, these modules are compatible with mathematical models of electrical systems and complexes in the MatLab. Also there are presented the results of the testing of the developed modules and the results of their verification on the schemes that have analytical expressions of energy indicators.

High-fidelity gates in quantum dot spin qubits.

PubMed

Koh, Teck Seng; Coppersmith, S N; Friesen, Mark

2013-12-03

Several logical qubits and quantum gates have been proposed for semiconductor quantum dots controlled by voltages applied to top gates. The different schemes can be difficult to compare meaningfully. Here we develop a theoretical framework to evaluate disparate qubit-gating schemes on an equal footing. We apply the procedure to two types of double-dot qubits: the singlet-triplet and the semiconducting quantum dot hybrid qubit. We investigate three quantum gates that flip the qubit state: a DC pulsed gate, an AC gate based on logical qubit resonance, and a gate-like process known as stimulated Raman adiabatic passage. These gates are all mediated by an exchange interaction that is controlled experimentally using the interdot tunnel coupling g and the detuning [Symbol: see text], which sets the energy difference between the dots. Our procedure has two steps. First, we optimize the gate fidelity (f) for fixed g as a function of the other control parameters; this yields an f(opt)(g) that is universal for different types of gates. Next, we identify physical constraints on the control parameters; this yields an upper bound f(max) that is specific to the qubit-gate combination. We show that similar gate fidelities (~99:5%) should be attainable for singlet-triplet qubits in isotopically purified Si, and for hybrid qubits in natural Si. Considerably lower fidelities are obtained for GaAs devices, due to the fluctuating magnetic fields ΔB produced by nuclear spins.

A post Gurney quantum mechanical perspective on the electrolysis of water: ion neutralization in solution

NASA Astrophysics Data System (ADS)

Guo, Enyi; McKenzie, David R.

2017-11-01

Electron fluxes crossing the interface between a metallic conductor and an aqueous environment are important in many fields; hydrogen production, environmental scanning tunnelling microscopy, scanning electrochemical microscopy being some of them. Gurney (Gurney 1931 Proc. R. Soc. Lond. 134, 137 (doi:10.1098/rspa.1931.0187)) provided in 1931 a scheme for tunnelling during electrolysis and outlined conditions for it to occur. We measure the low-voltage current flows between gold electrodes in pure water and use the time-dependent behaviour at voltage switch-on and switch-off to evaluate the relative contribution to the steady current arising from tunnelling of electrons between the electrodes and ions in solution and from the neutralization of ions adsorbed onto the electrode surface. We ascribe the larger current contribution to quantum tunnelling of electrons to and from ions in solution near the electrodes. We refine Gurney's barrier scheme to include solvated electron states and quantify energy differences using updated information. We show that Gurney's conditions would prevent the current flow at low voltages we observe but outline how the ideas of Marcus (Marcus 1956 J. Chem. Phys. 24, 966-978 (doi:10.1063/1.1742723)) concerning solvation fluctuations enable the condition to be relaxed. We derive an average barrier tunnelling model and a multiple pathways tunnelling model and compare predictions with measurements of the steady-state current-voltage relation. The tunnelling barrier was found to be wide and low in agreement with other experimental studies. Applications as a biosensing mechanism are discussed that exploit the fast tunnelling pathways along molecules in solution.

A decentralized approach to reducing the social costs of cascading failures

NASA Astrophysics Data System (ADS)

Hines, Paul

Large cascading failures in electrical power networks come with enormous social costs. These can be direct financial costs, such as the loss of refrigerated foods in grocery stores, or more indirect social costs, such as the traffic congestion that results from the failure of traffic signals. While engineers and policy makers have made numerous technical and organizational changes to reduce the frequency and impact of large cascading failures, the existing data, as described in Chapter 2 of this work, indicate that the overall frequency and impact of large electrical blackouts in the United States are not decreasing. Motivated by the cascading failure problem, this thesis describes a new method for Distributed Model Predictive Control and a power systems application. The central goal of the method, when applied to power systems, is to reduce the social costs of cascading failures by making small, targeted reductions in load and generation and changes to generator voltage set points. Unlike some existing schemes that operate from centrally located control centers, the method is operated by software agents located at substations distributed throughout the power network. The resulting multi-agent control system is a new approach to decentralized control, combining Distributed Model Predictive Control and Reciprocal Altruism. Experimental results indicate that this scheme can in fact decrease the average size, and thus social costs, of cascading failures. Over 100 randomly generated disturbances to a model of the IEEE 300 bus test network, the method resulted in nearly an order of magnitude decrease in average event size (measured in cost) relative to cascading failure simulations without remedial control actions. Additionally, the communication requirements for the method are measured, and found to be within the bandwidth capabilities of current communications technology (on the order of 100kB/second). Experiments on several resistor networks with varying structures, including a random graph, a scale-free network and a power grid indicate that the effectiveness of decentralized control schemes, like the method proposed here, is a function of the structure of the network that is to be controlled.

Power Electronic Transformer based Three-Phase PWM AC Drives

NASA Astrophysics Data System (ADS)

Basu, Kaushik

A Transformer is used to provide galvanic isolation and to connect systems at different voltage levels. It is one of the largest and most expensive component in most of the high voltage and high power systems. Its size is inversely proportional to the operating frequency. The central idea behind a power electronic transformer (PET) also known as solid state transformer is to reduce the size of the transformer by increasing the frequency. Power electronic converters are used to change the frequency of operation. Steady reduction in the cost of the semiconductor switches and the advent of advanced magnetic materials with very low loss density and high saturation flux density implies economic viability and feasibility of a design with high power density. Application of PET is in generation of power from renewable energy sources, especially wind and solar. Other important application include grid tied inverters, UPS e.t.c. In this thesis non-resonant, single stage, bi-directional PET is considered. The main objective of this converter is to generate adjustable speed and magnitude pulse width modulated (PWM) ac waveforms from an ac or dc grid with a high frequency ac link. The windings of a high frequency transformer contains leakage inductance. Any switching transition of the power electronic converter connecting the inductive load and the transformer requires commutation of leakage energy. Commutation by passive means results in power loss, decrease in the frequency of operation, distortion in the output voltage waveform, reduction in reliability and power density. In this work a source based partially loss-less commutation of leakage energy has been proposed. This technique also results in partial soft-switching. A series of converters with novel PWM strategies have been proposed to minimize the frequency of leakage inductance commutation. These PETs achieve most of the important features of modern PWM ac drives including 1) Input power factor correction, 2) Common-mode voltage suppression at the load end, 3) High quality output voltage waveform (comparable to conventional space vector PWM modulated two level inverter) and 4) Minimization of output voltage loss, common-mode voltage switching and distortion of the load current waveform due to leakage inductance commutation. All of the proposed topologies along with the proposed control schemes have been analyzed and simulated in MATLABSimulink. A hardware prototype has been fabricated and tested. The simulation and experimental results verify the operation and advantages of the proposed topologies and their control.

Apparatus for Controlling Low Power Voltages in Space Based Processing Systems

NASA Technical Reports Server (NTRS)

Petrick, David J. (Inventor)

2017-01-01

A low power voltage control circuit for use in space missions includes a switching device coupled between an input voltage and an output voltage. The switching device includes a control input coupled to an enable signal, wherein the control input is configured to selectively turn the output voltage on or off based at least in part on the enable signal. A current monitoring circuit is coupled to the output voltage and configured to produce a trip signal, wherein the trip signal is active when a load current flowing through the switching device is determined to exceed a predetermined threshold and is inactive otherwise. The power voltage control circuit is constructed of space qualified components.

Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

PubMed

Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

2017-10-23

The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

Coordinative Voltage Control Strategy with Multiple Resources for Distribution Systems of High PV Penetration: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Xiangqi; Zhang, Yingchen

This paper presents an optimal voltage control methodology with coordination among different voltage-regulating resources, including controllable loads, distributed energy resources such as energy storage and photovoltaics (PV), and utility voltage-regulating devices such as voltage regulators and capacitors. The proposed methodology could effectively tackle the overvoltage and voltage regulation device distortion problems brought by high penetrations of PV to improve grid operation reliability. A voltage-load sensitivity matrix and voltage-regulator sensitivity matrix are used to deploy the resources along the feeder to achieve the control objectives. Mixed-integer nonlinear programming is used to solve the formulated optimization control problem. The methodology has beenmore » tested on the IEEE 123-feeder test system, and the results demonstrate that the proposed approach could actively tackle the voltage problem brought about by high penetrations of PV and improve the reliability of distribution system operation.« less

Design, conditioning, and performance of a high voltage, high brightness dc photoelectron gun with variable gap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxson, Jared; Bazarov, Ivan; Dunham, Bruce

2014-09-15

A new high voltage photoemission gun has been constructed at Cornell University which features a segmented insulator and a movable anode, allowing the cathode-anode gap to be adjusted. In this work, we describe the gun's overall mechanical and high voltage design, the surface preparation of components, as well as the clean construction methods. We present high voltage conditioning data using a 50 mm cathode-anode gap, in which the conditioning voltage exceeds 500 kV, as well as at smaller gaps. Finally, we present simulated emittance results obtained from a genetic optimization scheme using voltage values based on the conditioning data. Thesemore » results indicate that for charges up to 100 pC, a 30 mm gap at 400 kV has equal or smaller 100% emittance than a 50 mm gap at 450 kV, and also a smaller core emittance, when placed as the source for the Cornell energy recovery linac photoinjector with bunch length constrained to be <3 ps rms. For 100 pC up to 0.5 nC charges, the 50 mm gap has larger core emittance than the 30 mm gap, but conversely smaller 100% emittance.« less

Charge control microcomputer device for vehicle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morishita, M.; Kouge, S.

1986-08-26

A charge control microcomputer device is described for a vehicle, comprising: an AC generator driven by an engine for generating an output current, the generator having armature coils and a field coil; a battery charged by a rectified output of the generator and generating a terminal voltage; a voltage regulator for controlling a current flowing in the field coil, to control an output voltage of the generator to a predetermined value; an engine controlling microcomputer for receiving engine parameter data from the engine, to control the operation of the engine; a charge control microcomputer for processing input data including datamore » on at least one engine parameter output from the engine controlling microcomputer, and charge system data including at least one of battery terminal voltage data, generator voltage data and generator output current data, to provide a reference voltage for the voltage regulator.« less

Data-Mining-Based Intelligent Differential Relaying for Transmission Lines Including UPFC and Wind Farms.

PubMed

Jena, Manas Kumar; Samantaray, Subhransu Ranjan

2016-01-01

This paper presents a data-mining-based intelligent differential relaying scheme for transmission lines, including flexible ac transmission system device, such as unified power flow controller (UPFC) and wind farms. Initially, the current and voltage signals are processed through extended Kalman filter phasor measurement unit for phasor estimation, and 21 potential features are computed at both ends of the line. Once the features are extracted at both ends, the corresponding differential features are derived. These differential features are fed to a data-mining model known as decision tree (DT) to provide the final relaying decision. The proposed technique has been extensively tested for single-circuit transmission line, including UPFC and wind farms with in-feed, double-circuit line with UPFC on one line and wind farm as one of the substations with wide variations in operating parameters. The test results obtained from simulation as well as in real-time digital simulator testing indicate that the DT-based intelligent differential relaying scheme is highly reliable and accurate with a response time of 2.25 cycles from the fault inception.

Nonlinear adaptive control of grid-connected three-phase inverters for renewable energy applications

NASA Astrophysics Data System (ADS)

Mahdian-Dehkordi, N.; Namvar, M.; Karimi, H.; Piya, P.; Karimi-Ghartemani, M.

2017-01-01

Distributed generation (DG) units are often interfaced to the main grid using power electronic converters including voltage-source converters (VSCs). A VSC offers dc/ac power conversion, high controllability, and fast dynamic response. Because of nonlinearities, uncertainties, and system parameters' changes involved in the nature of a grid-connected renewable DG system, conventional linear control methods cannot completely and efficiently address all control objectives. In this paper, a nonlinear adaptive control scheme based on adaptive backstepping strategy is presented to control the operation of a grid-connected renewable DG unit. As compared to the popular vector control technique, the proposed controller offers smoother transient responses, and lower level of current distortions. The Lyapunov approach is used to establish global asymptotic stability of the proposed control system. Linearisation technique is employed to develop guidelines for parameters tuning of the controller. Extensive time-domain digital simulations are performed and presented to verify the performance of the proposed controller when employed in a VSC to control the operation of a two-stage DG unit and also that of a single-stage solar photovoltaic system. Desirable and superior performance of the proposed controller is observed.

Methods, systems and apparatus for controlling operation of two alternating current (AC) machines

DOEpatents

Gallegos-Lopez, Gabriel [Torrance, CA; Nagashima, James M [Cerritos, CA; Perisic, Milun [Torrance, CA; Hiti, Silva [Redondo Beach, CA

2012-02-14

A system is provided for controlling two AC machines. The system comprises a DC input voltage source that provides a DC input voltage, a voltage boost command control module (VBCCM), a five-phase PWM inverter module coupled to the two AC machines, and a boost converter coupled to the inverter module and the DC input voltage source. The boost converter is designed to supply a new DC input voltage to the inverter module having a value that is greater than or equal to a value of the DC input voltage. The VBCCM generates a boost command signal (BCS) based on modulation indexes from the two AC machines. The BCS controls the boost converter such that the boost converter generates the new DC input voltage in response to the BCS. When the two AC machines require additional voltage that exceeds the DC input voltage required to meet a combined target mechanical power required by the two AC machines, the BCS controls the boost converter to drive the new DC input voltage generated by the boost converter to a value greater than the DC input voltage.

Operation and biasing for single device equivalent to CMOS

DOEpatents

Welch, James D.

2001-01-01

Disclosed are semiconductor devices including at least one junction which is rectifying whether the semiconductor is caused to be N or P-type, by the presence of field induced carriers. In particular, inverting and non-inverting gate voltage channel induced semiconductor single devices with operating characteristics similar to conventional multiple device CMOS systems, which can be operated as modulators, are disclosed as are a non-latching SCR and an approach to blocking parasitic currents. Operation of the gate voltage channel induced semiconductor single devices with operating characteristics similar to multiple device CMOS systems under typical bias schemes is described, and simple demonstrative five mask fabrication procedures for the inverting and non-inverting gate voltage channel induced semiconductor single devices with operating characteristics similar to multiple device CMOS systems are also presented.

On the performance of voltage stepping for the simulation of adaptive, nonlinear integrate-and-fire neuronal networks.

PubMed

Kaabi, Mohamed Ghaith; Tonnelier, Arnaud; Martinez, Dominique

2011-05-01

In traditional event-driven strategies, spike timings are analytically given or calculated with arbitrary precision (up to machine precision). Exact computation is possible only for simplified neuron models, mainly the leaky integrate-and-fire model. In a recent paper, Zheng, Tonnelier, and Martinez (2009) introduced an approximate event-driven strategy, named voltage stepping, that allows the generic simulation of nonlinear spiking neurons. Promising results were achieved in the simulation of single quadratic integrate-and-fire neurons. Here, we assess the performance of voltage stepping in network simulations by considering more complex neurons (quadratic integrate-and-fire neurons with adaptation) coupled with multiple synapses. To handle the discrete nature of synaptic interactions, we recast voltage stepping in a general framework, the discrete event system specification. The efficiency of the method is assessed through simulations and comparisons with a modified time-stepping scheme of the Runge-Kutta type. We demonstrated numerically that the original order of voltage stepping is preserved when simulating connected spiking neurons, independent of the network activity and connectivity.

An Agile Beam Transmit Array Using Coupled Oscillator Phase Control

NASA Technical Reports Server (NTRS)

Pogorzelski, Ronald S.; Scaramastra, Rocco P.; Huang, John; Beckon, Robert J.; Petree, Steve M.; Chavez, Cosme

1993-01-01

A few years ago York and colleagues suggested that injection locking of voltage controlled oscillators could be used to implement beam steering in a phased array [I]. The scheme makes use of the fact that when an oscillator is injection locked to an external signal, the phase difference between the output of the oscillator and the injection signal is governed by the difference between the injection frequency and the free running frequency of the oscillator (the frequency to which the oscillator is tuned). Thus, if voltage controlled oscillators (VCOs) are used, this phase difference is controlled by an applied voltage. Now, if a set of such oscillators are coupled to nearest neighbors, they can be made to mutually injection lock and oscillate as an ensemble. If they are all tuned to the same frequency, they will all oscillate in phase. Thus, if the outputs are connected to radiating elements forming a linear array, the antenna will radiate normal to the line of elements. Scanning is accomplished by antisymmetrically detuning the end oscillators in the array by application of a pair of appropriate voltages to their tuning ports. This results in a linear phase progression across the array which is just the phasing required to scan the beam. The scan angle is determined by the degree of detuning. We have constructed a seven element one dimensional agile beam array at S-band based on the above principle. Although, a few such arrays have been built in the past, this array possesses two unique features. First, the VCO MMICs have buffer amplifiers which isolate the output from the tuning circuit, and second, the oscillators are weakly coupled to each other at their resonant circuits rather than their outputs. This results in a convenient isolation between the oscillator array design and the radiating aperture design. An important parameter in the design is the so called coupling phase which determines the phase shift of the signals passing from one oscillator to its neighbors. Using this array, we have been able to verify the theoretical predictions concerning the effect of this phase on both the locking range and ensemble frequency of the array. However, the scan range achieved fell somewhat short of the theoretical value because of the amplitude variation of the oscillator outputs with tuning.

Extended Constant Power Speed Range of the Brushless DC Motor Through Dual Mode Inverter Control

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lawler, J.S.

2000-06-23

The trapezoidal back electromotive force (emf) brushless direct current (dc) motor (BDCM) with surface-mounted magnets has high-power density and efficiency especially when rare-earth magnet materials are used. Traction applications, such as electric vehicles, could benefit significantly from the use of such motors. Unfortunately, a practical means for driving the motor over a constant power speed ratio (CPSR) of 5:1 or more has not yet been developed. A key feature of these motors is that they have low internal inductance. The phase advance method is effective in controlling the motor power over such a speed range, but the current at highmore » speed may be several times greater than that required at the base speed. The increase in current during high-speed operation is due to the low motor inductance and the action of the bypass diodes of the inverter. The use of such a control would require increased current rating of the inverter semiconductors and additional cooling for the inverter, where the conduction losses increase proportionally with current, and especially for the motor, where the losses increase with the square of the current. The high current problems of phase advance can be mitigated by adding series inductance; however, this reduces power density, requires significant increase in supply voltage, and leaves the CPSR performance of the system highly sensitive to variations in the available voltage. A new inverter topology and control scheme has been developed that can drive low-inductance BDCMs over the CPSR that would be required in electric vehicle applications. This new controller is called the dual-mode inverter control (DMIC). It is shown that the BDCM has an infinite CPSR when it is driven by the DMIC.« less

Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems

PubMed Central

Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

2017-01-01

The impact of high-voltage–high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between −13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers. PMID:29065526

A Multi-agent Based Cooperative Voltage and Reactive Power Control

NASA Astrophysics Data System (ADS)

Ishida, Masato; Nagata, Takeshi; Saiki, Hiroshi; Shimada, Ikuhiko; Hatano, Ryousuke

In order to maintain system voltage within the optimal range and prevent voltage instability phenomena before they occur, a variety of phase modifying equipment is installed in optimal locations throughout the power system network and a variety of methods of voltage reactive control are employed. The proposed system divided the traditional method to control voltage and reactive power into two sub problems; “voltage control” to adjust the secondary bus voltage of substations, and “reactive power control” to adjust the primary bus voltage. In this system, two types of agents are installed in substations in order to cooperate “voltage control” and “reactive power control”. In order to verify the performance of the proposed method, it has been applied to the model network system. The results confirm that our proposed method is able to control violent fluctuations in load.

30 CFR 77.515 - Bare signal or control wires; voltage.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Bare signal or control wires; voltage. 77.515... COAL MINES Electrical Equipment-General § 77.515 Bare signal or control wires; voltage. The voltage on bare signal or control wires accessible to personal contact shall not exceed 40 volts. ...

30 CFR 77.515 - Bare signal or control wires; voltage.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Bare signal or control wires; voltage. 77.515... COAL MINES Electrical Equipment-General § 77.515 Bare signal or control wires; voltage. The voltage on bare signal or control wires accessible to personal contact shall not exceed 40 volts. ...

Fast-responding short circuit protection system with self-reset for use in circuit supplied by DC power

NASA Technical Reports Server (NTRS)

Burns, Bradley M. (Inventor); Blalock, Norman N. (Inventor)

2011-01-01

A short circuit protection system includes an inductor, a switch, a voltage sensing circuit, and a controller. The switch and inductor are electrically coupled to be in series with one another. A voltage sensing circuit is coupled across the switch and the inductor. A controller, coupled to the voltage sensing circuit and the switch, opens the switch when a voltage at the output terminal of the inductor transitions from above a threshold voltage to below the threshold voltage. The controller closes the switch when the voltage at the output terminal of the inductor transitions from below the threshold voltage to above the threshold voltage.

High voltage bus and auxiliary heater control system for an electric or hybrid vehicle

DOEpatents

Murty, Balarama Vempaty

2000-01-01

A control system for an electric or hybrid electric vehicle includes a vehicle system controller and a control circuit having an electric immersion heater. The heater is electrically connected to the vehicle's high voltage bus and is thermally coupled to a coolant loop containing a heater core for the vehicle's climate control system. The system controller responds to cabin heat requests from the climate control system by generating a pulse width modulated signal that is used by the control circuit to operate the heater at a duty cycle appropriate for the amount of cabin heating requested. The control system also uses the heater to dissipate excess energy produced by an auxiliary power unit and to provide electric braking when regenerative braking is not desirable and manual braking is not necessary. The control system further utilizes the heater to provide a safe discharge of a bank of energy storage capacitors following disconnection of the battery or one of the high voltage connectors used to transmit high voltage operating power to the various vehicle systems. The control circuit includes a high voltage clamping circuit that monitors the voltage on the bus and operates the heater to clamp down the bus voltage when it exceeds a pre-selected maximum voltage. The control system can also be used to phase in operation of the heater when the bus voltage exceeds a lower threshold voltage and can be used to phase out the auxiliary power unit charging and regenerative braking when the battery becomes fully charged.

Failure of feedback as a putative common mechanism of spreading depolarizations in migraine and stroke

NASA Astrophysics Data System (ADS)

Dahlem, Markus A.; Schneider, Felix M.; Schöll, Eckehard

2008-06-01

The stability of cortical function depends critically on proper regulation. Under conditions of migraine and stroke a breakdown of transmembrane chemical gradients can spread through cortical tissue. A concomitant component of this emergent spatio-temporal pattern is a depolarization of cells detected as slow voltage variations. The propagation velocity of ˜3mm/min indicates a contribution of diffusion. We propose a mechanism for spreading depolarizations (SD) that rests upon a nonlocal or noninstantaneous feedback in a reaction-diffusion system. Depending upon the characteristic space and time scales of the feedback, the propagation of cortical SD can be suppressed by shifting the bifurcation line, which separates the parameter regime of pulse propagation from the regime where a local disturbance dies out. The optimization of this feedback is elaborated for different control schemes and ranges of control parameters.

Polaris Instrument Development and PARI Experience

NASA Astrophysics Data System (ADS)

Stewart, Nathan

2011-01-01

At the Pisgah Astronomical Research Institute (PARI) in Rosman, NC I spent 8 weeks as the NC Space Grant/J. Donald Cline Astronomy Scholar. I developed multiple projects and assisted as a mentor to PARI Space Science Lab and Duke TIP high school gifted student program which both took place during my stay. My main focus was the development of the Polaris imaging telescope. This telescope is used to take images of the pulsating variable star Polaris. These readings are used to make seeing estimates for the air column above PARI. The system stores and archives images and analyzes them for magnitude change and movement of the stellar image. In addition to the Polaris project I developed a solar panel voltage and charge monitoring system which involved me working with charge controllers and photovoltaic technology. I developed a charging scheme using Flexmax 60 charge controller. Data is recorded and transmitted via optical fiber for analysis and correlation with solar zenith angle.

Gate-controlled current and inelastic electron tunneling spectrum of benzene: a self-consistent study.

PubMed

Liang, Y Y; Chen, H; Mizuseki, H; Kawazoe, Y

2011-04-14

We use density functional theory based nonequilibrium Green's function to self-consistently study the current through the 1,4-benzenedithiol (BDT). The elastic and inelastic tunneling properties through this Au-BDT-Au molecular junction are simulated, respectively. For the elastic tunneling case, it is found that the current through the tilted molecule can be modulated effectively by the external gate field, which is perpendicular to the phenyl ring. The gate voltage amplification comes from the modulation of the interaction between the electrodes and the molecules in the junctions. For the inelastic case, the electron tunneling scattered by the molecular vibrational modes is considered within the self-consistent Born approximation scheme, and the inelastic electron tunneling spectrum is calculated.

Complementary spin transistor using a quantum well channel.

PubMed

Park, Youn Ho; Choi, Jun Woo; Kim, Hyung-Jun; Chang, Joonyeon; Han, Suk Hee; Choi, Heon-Jin; Koo, Hyun Cheol

2017-04-20

In order to utilize the spin field effect transistor in logic applications, the development of two types of complementary transistors, which play roles of the n- and p-type conventional charge transistors, is an essential prerequisite. In this research, we demonstrate complementary spin transistors consisting of two types of devices, namely parallel and antiparallel spin transistors using InAs based quantum well channels and exchange-biased ferromagnetic electrodes. In these spin transistors, the magnetization directions of the source and drain electrodes are parallel or antiparallel, respectively, depending on the exchange bias field direction. Using this scheme, we also realize a complementary logic operation purely with spin transistors controlled by the gate voltage, without any additional n- or p-channel transistor.

Vacuum-induced quantum memory in an opto-electromechanical system

NASA Astrophysics Data System (ADS)

Qin, Li-Guo; Wang, Zhong-Yang; Wu, Shi-Chao; Gong, Shang-Qing; Ma, Hong-Yang; Jing, Jun

2018-03-01

We propose a scheme to implement electrically controlled quantum memory based on vacuum-induced transparency (VIT) in a high-Q tunable cavity, which is capacitively coupled to a mechanically variable capacitor by a charged mechanical cavity mirror as an interface. We analyze the changes of the cavity photons arising from vacuum-induced-Raman process and discuss VIT in an atomic ensemble trapped in the cavity. By slowly adjusting the voltage on the capacitor, the VIT can be adiabatically switched on or off, meanwhile, the transfer between the probe photon state and the atomic spin state can be electrically and adiabatically modulated. Therefore, we demonstrate a vacuum-induced quantum memory by electrically manipulating the mechanical mirror of the cavity based on electromagnetically induced transparency mechanism.

Index-based reactive power compensation scheme for voltage regulation

NASA Astrophysics Data System (ADS)

Dike, Damian Obioma

2008-10-01

Increasing demand for electrical power arising from deregulation and the restrictions posed to the construction of new transmission lines by environment, socioeconomic, and political issues had led to higher grid loading. Consequently, voltage instability has become a major concern, and reactive power support is vital to enhance transmission grid performance. Improved reactive power support to distressed grid is possible through the application of relatively unfamiliar emerging technologies of "Flexible AC Transmission Systems (FACTS)" devices and "Distributed Energy Resources (DERS)." In addition to these infrastructure issues, a lack of situational awareness by system operators can cause major power outages as evidenced by the August 14, 2003 widespread North American blackout. This and many other recent major outages have highlighted the inadequacies of existing power system indexes. In this work, a novel "Index-based reactive compensation scheme" appropriate for both on-line and off-line computation of grid status has been developed. A new voltage stability index (Ls-index) suitable for long transmission lines was developed, simulated, and compared to the existing two-machine modeled L-index. This showed the effect of long distance power wheeling amongst regional transmission organizations. The dissertation further provided models for index modulated voltage source converters (VSC) and index-based load flow analysis of both FACTS and microgrid interconnected power systems using the Newton-Raphson's load flow model incorporated with multi-FACTS devices. The developed package has been made user-friendly through the embodiment of interactive graphical user interface and implemented on the IEEE 14, 30, and 300 bus systems. The results showed reactive compensation has system wide-effect, provided readily accessible system status indicators, ensured seamless DERs interconnection through new islanding modes and enhanced VSC utilization. These outcomes may contribute to optimal utilization of compensation devices and available transfer capability as well as reduce system outages through better regulation of power operating voltages.

Electromigration of intergranular voids in metal films for microelectronic interconnects

NASA Astrophysics Data System (ADS)

Averbuch, Amir; Israeli, Moshe; Ravve, Igor

2003-04-01

Voids and cracks often occur in the interconnect lines of microelectronic devices. They increase the resistance of the circuits and may even lead to a fatal failure. Voids may occur inside a single grain, but often they appear on the boundary between two grains. In this work, we model and analyze numerically the migration and evolution of an intergranular void subjected to surface diffusion forces and external voltage applied to the interconnect. The grain-void interface is considered one-dimensional, and the physical formulation of the electromigration and diffusion model results in two coupled fourth-order one-dimensional time-dependent PDEs. The boundary conditions are specified at the triple points, which are common to both neighboring grains and the void. The solution of these equations uses a finite difference scheme in space and a Runge-Kutta integration scheme in time, and is also coupled to the solution of a static Laplace equation describing the voltage distribution throughout the grain. Since the voltage distribution is required only along the interface line, the two-dimensional discretization of the grain interior is not needed, and the static problem is solved by the boundary element method at each time step. The motion of the intergranular void was studied for different ratios between the diffusion and the electric field forces, and for different initial configurations of the void.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dall'Anese, Emiliano

Past works that focused on addressing power-quality and reliability concerns related to renewable energy resources (RESs) operating with business-as-usual practices have looked at the design of Volt/VAr and Volt/Watt strategies to regulate real or reactive powers based on local voltage measurements, so that terminal voltages are within acceptable levels. These control strategies have the potential of operating at the same time scale of distribution-system dynamics, and can therefore mitigate disturbances precipitated fast time-varying loads and ambient conditions; however, they do not necessarily guarantee system-level optimality, and stability claims are mainly based on empirical evidences. On a different time scale, centralizedmore » and distributed optimal power flow (OPF) algorithms have been proposed to compute optimal steady-state inverter setpoints, so that power losses and voltage deviations are minimized and economic benefits to end-users providing ancillary services are maximized. However, traditional OPF schemes may offer decision making capabilities that do not match the dynamics of distribution systems. Particularly, during the time required to collect data from all the nodes of the network (e.g., loads), solve the OPF, and subsequently dispatch setpoints, the underlying load, ambient, and network conditions may have already changed; in this case, the DER output powers would be consistently regulated around outdated setpoints, leading to suboptimal system operation and violation of relevant electrical limits. The present work focuses on the synthesis of distributed RES-inverter controllers that leverage the opportunities for fast feedback offered by power-electronics interfaced RESs. The overarching objective is to bridge the temporal gap between long-term system optimization and real-time control, to enable seamless RES integration in large scale with stability and efficiency guarantees, while congruently pursuing system-level optimization objectives. The design of the control framework is based on suitable linear approximations of the AC power-flow equations as well as Lagrangian regularization methods. The proposed controllers enable an update of the power outputs at a time scale that is compatible with the underlying dynamics of loads and ambient conditions, and continuously drive the system operation towards OPF-based solutions.« less

Modulation and control of matrix converter for aerospace application

NASA Astrophysics Data System (ADS)

Kobravi, Keyhan

In the context of modern aircraft systems, a major challenge is power conversion to supply the aircraft's electrical instruments. These instruments are energized through a fixed-frequency internal power grid. In an aircraft, the available sources of energy are a set of variable-speed generators which provide variable-frequency ac voltages. Therefore, to energize the internal power grid of an aircraft, the variable-frequency ac voltages should be converted to a fixed-frequency ac voltage. As a result, an ac to ac power conversion is required within an aircraft's power system. This thesis develops a Matrix Converter to energize the aircraft's internal power grid. The Matrix Converter provides a direct ac to ac power conversion. A major challenge of designing Matrix Converters for aerospace applications is to minimize the volume and weight of the converter. These parameters are minimized by increasing the switching frequency of the converter. To design a Matrix Converter operating at a high switching frequency, this thesis (i) develops a scheme to integrate fast semiconductor switches within the current available Matrix Converter topologies, i.e., MOSFET-based Matrix Converter, and (ii) develops a new modulation strategy for the Matrix Converter. This Matrix Converter and the new modulation strategy enables the operation of the converter at a switching-frequency of 40kHz. To provide a reliable source of energy, this thesis also develops a new methodology for robust control of Matrix Converter. To verify the performance of the proposed MOSFET-based Matrix Converter, modulation strategy, and control design methodology, various simulation and experimental results are presented. The experimental results are obtained under operating condition present in an aircraft. The experimental results verify the proposed Matrix Converter provides a reliable power conversion in an aircraft under extreme operating conditions. The results prove the superiority of the proposed Matrix Converter technology for ac to ac power conversion regarding the existing technologies of Matrix Converters.

Dispatching power system for preventive and corrective voltage collapse problem in a deregulated power system

NASA Astrophysics Data System (ADS)

Alemadi, Nasser Ahmed

Deregulation has brought opportunities for increasing efficiency of production and delivery and reduced costs to customers. Deregulation has also bought great challenges to provide the reliability and security customers have come to expect and demand from the electrical delivery system. One of the challenges in the deregulated power system is voltage instability. Voltage instability has become the principal constraint on power system operation for many utilities. Voltage instability is a unique problem because it can produce an uncontrollable, cascading instability that results in blackout for a large region or an entire country. In this work we define a system of advanced analytical methods and tools for secure and efficient operation of the power system in the deregulated environment. The work consists of two modules; (a) contingency selection module and (b) a Security Constrained Optimization module. The contingency selection module to be used for voltage instability is the Voltage Stability Security Assessment and Diagnosis (VSSAD). VSSAD shows that each voltage control area and its reactive reserve basin describe a subsystem or agent that has a unique voltage instability problem. VSSAD identifies each such agent. VS SAD is to assess proximity to voltage instability for each agent and rank voltage instability agents for each contingency simulated. Contingency selection and ranking for each agent is also performed. Diagnosis of where, why, when, and what can be done to cure voltage instability for each equipment outage and transaction change combination that has no load flow solution is also performed. A security constrained optimization module developed solves a minimum control solvability problem. A minimum control solvability problem obtains the reactive reserves through action of voltage control devices that VSSAD determines are needed in each agent to obtain solution of the load flow. VSSAD makes a physically impossible recommendation of adding reactive generation capability to specific generators to allow a load flow solution to be obtained. The minimum control solvability problem can also obtain solution of the load flow without curtailing transactions that shed load and generation as recommended by VSSAD. A minimum control solvability problem will be implemented as a corrective control, that will achieve the above objectives by using minimum control changes. The control includes; (1) voltage setpoint on generator bus voltage terminals; (2) under load tap changer tap positions and switchable shunt capacitors; and (3) active generation at generator buses. The minimum control solvability problem uses the VSSAD recommendation to obtain the feasible stable starting point but completely eliminates the impossible or onerous recommendation made by VSSAD. This thesis reviews the capabilities of Voltage Stability Security Assessment and Diagnosis and how it can be used to implement a contingency selection module for the Open Access System Dispatch (OASYDIS). The OASYDIS will also use the corrective control computed by Security Constrained Dispatch. The corrective control would be computed off line and stored for each contingency that produces voltage instability. The control is triggered and implemented to correct the voltage instability in the agent experiencing voltage instability only after the equipment outage or operating changes predicted to produce voltage instability have occurred. The advantages and the requirements to implement the corrective control are also discussed.

Characterization and optimization of an optical and electronic architecture for photon counting

NASA Astrophysics Data System (ADS)

Correa, M. del M.; Pérez, F. R.

2018-04-01

This work shows a time-domain method for the discrimination and digitization of pulses coming from optical detectors, considering the presence of electronic noise and afterpulsing. The developed signal processing scheme is based on a time-to-digital converter (TDC) and a voltage discriminator. After setting appropriate parameters for taking spectra, acquisition data was corrected by wavelength, intensity response function, and noise suppression. The performance of this scheme is discussed by its characterization as well as the comparison of its spectra to those obtained by an Ocean Optics HR4000 commercial reference.

Systems and methods for providing power to a load based upon a control strategy

DOEpatents

Perisic, Milun; Lawrence, Christopher P; Ransom, Ray M; Kajouke, Lateef A

2014-11-04

Systems and methods are provided for an electrical system. The electrical system, for example, includes a first load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage through the interface and to provide a voltage and current to the first load. The controller may be further configured to, receive information on a second load electrically connected to the voltage source, determine an amount of reactive current to return to the voltage source such that a current drawn by the electrical system and the second load from the voltage source is substantially real, and provide the determined reactive current to the voltage source.

Linear Actuator Has Long Stroke and High Resolution

NASA Technical Reports Server (NTRS)

Cook, Brant T.; Moore, Donald M.; Braun, David F.; Koenig, John S.; Hankins, Steve M.

2009-01-01

The term precision linear actuator, direct drive ( PLADD ) refers to a robust linear actuator designed to be capable of repeatedly performing, over a lifetime of the order of 5 to 10 years, positioning maneuvers that include, variously, submicron increments or slews of the order of a centimeter. The PLADD is capable of both long stroke (120 mm) and high resolution (repeatable increments of 20 nm). Unlike precise linear actuators of prior design, the PLADD contains no gears, levers, or hydraulic converters. The PLADD, now at the prototype stage of development, is intended for original use as a coarse-positioning actuator in a spaceborne interferometer. The PLADD could also be adapted to terrestrial applications in which there are requirements for long stroke and high resolution: potential applications include medical imaging and fabrication of semiconductor devices. The PLADD (see figure) includes a commercially available ball-screw actuator driven directly by a commercially available three-phase brushless DC motor. The ball-screw actuator comprises a spring-preloaded ball nut on a ball screw that is restrained against rotation as described below. The motor is coupled directly (that is, without an intervening gear train) to a drive link that, in turn, is coupled to the ball nut. By eliminating the gear train, the direct-drive design eliminates the complexity, backlash, and potential for misalignment associated with a gear train. To prevent inadvertent movement, there is a brake that includes flexured levers compressed against the drive link by preload springs. This is a power-off brake: There are also piezoelectric stacks that can be activated to oppose the springs and push the levers away from the drive link. Hence, power must be applied to the piezoelectric stacks to release the drive link from braking. To help ensure long operational life, all of the mechanical drive components are immersed in an oil bath within hermetically sealed bellows. The outer end of the bellows holds the outer end of the ball screw, thereby preventing rotation of the ball screw. Positioning is controlled by an electronic control system that includes digital and analog subsystems that interact with the motor and brake and with two sensor/encoder units: a Hall-effect-sensor rotation encoder and a linear glass-scale encoder. This system implements a proportional + integral + derivative control algorithm that results in variation of voltage commands to each of the three pairs of windings of the brushless DC motor. In one of two alternative control modes, the voltages are applied to the windings in a trapezoidal commutation scheme on the basis of timing signals obtained from the Hall-effect sensors; this scheme yields relatively coarse positioning - 24 steps per motor revolution. The second control mode involves a sinusoidal commutation scheme in which the output of the linear glass-scale encoder is transposed to rotational increments to yield much finer position feedback - more than 400,000 steps per revolution.

An Incentive-based Online Optimization Framework for Distribution Grids

DOE PAGES

Zhou, Xinyang; Dall'Anese, Emiliano; Chen, Lijun; ...

2017-10-09

This article formulates a time-varying social-welfare maximization problem for distribution grids with distributed energy resources (DERs) and develops online distributed algorithms to identify (and track) its solutions. In the considered setting, network operator and DER-owners pursue given operational and economic objectives, while concurrently ensuring that voltages are within prescribed limits. The proposed algorithm affords an online implementation to enable tracking of the solutions in the presence of time-varying operational conditions and changing optimization objectives. It involves a strategy where the network operator collects voltage measurements throughout the feeder to build incentive signals for the DER-owners in real time; DERs thenmore » adjust the generated/consumed powers in order to avoid the violation of the voltage constraints while maximizing given objectives. Stability of the proposed schemes is analytically established and numerically corroborated.« less

An Incentive-based Online Optimization Framework for Distribution Grids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Xinyang; Dall'Anese, Emiliano; Chen, Lijun

This article formulates a time-varying social-welfare maximization problem for distribution grids with distributed energy resources (DERs) and develops online distributed algorithms to identify (and track) its solutions. In the considered setting, network operator and DER-owners pursue given operational and economic objectives, while concurrently ensuring that voltages are within prescribed limits. The proposed algorithm affords an online implementation to enable tracking of the solutions in the presence of time-varying operational conditions and changing optimization objectives. It involves a strategy where the network operator collects voltage measurements throughout the feeder to build incentive signals for the DER-owners in real time; DERs thenmore » adjust the generated/consumed powers in order to avoid the violation of the voltage constraints while maximizing given objectives. Stability of the proposed schemes is analytically established and numerically corroborated.« less

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Control of parallel manipulators using force feedback

NASA Technical Reports Server (NTRS)

Nanua, Prabjot

1994-01-01

Two control schemes are compared for parallel robotic mechanisms actuated by hydraulic cylinders. One scheme, the 'rate based scheme', uses the position and rate information only for feedback. The second scheme, the 'force based scheme' feeds back the force information also. The force control scheme is shown to improve the response over the rate control one. It is a simple constant gain control scheme better suited to parallel mechanisms. The force control scheme can be easily modified for the dynamic forces on the end effector. This paper presents the results of a computer simulation of both the rate and force control schemes. The gains in the force based scheme can be individually adjusted in all three directions, whereas the adjustment in just one direction of the rate based scheme directly affects the other two directions.

An In-Rush Current Suppression Technique for the Solid-State Transfer Switch System

NASA Astrophysics Data System (ADS)

Cheng, Po-Tai; Chen, Yu-Hsing

More and more utility companies provide dual power feeders as a premier service of high power quality and reliability. To take advantage of this, the solid-state transfer switch (STS) is adopted to protect the sensitive load against the voltage sag. However, the fast transfer process may cause in-rush current on the load-side transformer due to the resulting DC-offset in its magnetic flux as the load-transfer is completed. The in-rush current can reach 2∼6 p.u. and it may trigger the over-current protections on the power feeder. This paper develops a flux estimation scheme and a thyristor gating scheme based on the impulse commutation bridge STS (ICBSTS) to minimize the DC-offset on the magnetic flux. By sensing the line voltages of both feeders, the flux estimator can predict the peak transient flux linkage at the moment of load-transfer and evaluate a suitable moment for the transfer to minimize the in-rush current. Laboratory test results are presented to validate the performance of the proposed system.

Energy Conservation Using Dynamic Voltage Frequency Scaling for Computational Cloud

PubMed Central

Florence, A. Paulin; Shanthi, V.; Simon, C. B. Sunil

2016-01-01

Cloud computing is a new technology which supports resource sharing on a “Pay as you go” basis around the world. It provides various services such as SaaS, IaaS, and PaaS. Computation is a part of IaaS and the entire computational requests are to be served efficiently with optimal power utilization in the cloud. Recently, various algorithms are developed to reduce power consumption and even Dynamic Voltage and Frequency Scaling (DVFS) scheme is also used in this perspective. In this paper we have devised methodology which analyzes the behavior of the given cloud request and identifies the associated type of algorithm. Once the type of algorithm is identified, using their asymptotic notations, its time complexity is calculated. Using best fit strategy the appropriate host is identified and the incoming job is allocated to the victimized host. Using the measured time complexity the required clock frequency of the host is measured. According to that CPU frequency is scaled up or down using DVFS scheme, enabling energy to be saved up to 55% of total Watts consumption. PMID:27239551

Energy Conservation Using Dynamic Voltage Frequency Scaling for Computational Cloud.

PubMed

Florence, A Paulin; Shanthi, V; Simon, C B Sunil

2016-01-01

Cloud computing is a new technology which supports resource sharing on a "Pay as you go" basis around the world. It provides various services such as SaaS, IaaS, and PaaS. Computation is a part of IaaS and the entire computational requests are to be served efficiently with optimal power utilization in the cloud. Recently, various algorithms are developed to reduce power consumption and even Dynamic Voltage and Frequency Scaling (DVFS) scheme is also used in this perspective. In this paper we have devised methodology which analyzes the behavior of the given cloud request and identifies the associated type of algorithm. Once the type of algorithm is identified, using their asymptotic notations, its time complexity is calculated. Using best fit strategy the appropriate host is identified and the incoming job is allocated to the victimized host. Using the measured time complexity the required clock frequency of the host is measured. According to that CPU frequency is scaled up or down using DVFS scheme, enabling energy to be saved up to 55% of total Watts consumption.

Network-Cognizant Voltage Droop Control for Distribution Grids

DOE PAGES

Baker, Kyri; Bernstein, Andrey; Dall'Anese, Emiliano; ...

2017-08-07

Our paper examines distribution systems with a high integration of distributed energy resources (DERs) and addresses the design of local control methods for real-time voltage regulation. Particularly, the paper focuses on proportional control strategies where the active and reactive output-powers of DERs are adjusted in response to (and proportionally to) local changes in voltage levels. The design of the voltage-active power and voltage-reactive power characteristics leverages suitable linear approximation of the AC power-flow equations and is network-cognizant; that is, the coefficients of the controllers embed information on the location of the DERs and forecasted non-controllable loads/injections and, consequently, on themore » effect of DER power adjustments on the overall voltage profile. We pursued a robust approach to cope with uncertainty in the forecasted non-controllable loads/power injections. Stability of the proposed local controllers is analytically assessed and numerically corroborated.« less

Network-Cognizant Voltage Droop Control for Distribution Grids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baker, Kyri; Bernstein, Andrey; Dall'Anese, Emiliano

Our paper examines distribution systems with a high integration of distributed energy resources (DERs) and addresses the design of local control methods for real-time voltage regulation. Particularly, the paper focuses on proportional control strategies where the active and reactive output-powers of DERs are adjusted in response to (and proportionally to) local changes in voltage levels. The design of the voltage-active power and voltage-reactive power characteristics leverages suitable linear approximation of the AC power-flow equations and is network-cognizant; that is, the coefficients of the controllers embed information on the location of the DERs and forecasted non-controllable loads/injections and, consequently, on themore » effect of DER power adjustments on the overall voltage profile. We pursued a robust approach to cope with uncertainty in the forecasted non-controllable loads/power injections. Stability of the proposed local controllers is analytically assessed and numerically corroborated.« less

The CARIBU EBIS control and synchronization system

NASA Astrophysics Data System (ADS)

Dickerson, Clayton; Peters, Christopher

2015-01-01

The Californium Rare Isotope Breeder Upgrade (CARIBU) Electron Beam Ion Source (EBIS) charge breeder has been built and tested. The bases of the CARIBU EBIS electrical system are four voltage platforms on which both DC and pulsed high voltage outputs are controlled. The high voltage output pulses are created with either a combination of a function generator and a high voltage amplifier, or two high voltage DC power supplies and a high voltage solid state switch. Proper synchronization of the pulsed voltages, fundamental to optimizing the charge breeding performance, is achieved with triggering from a digital delay pulse generator. The control system is based on National Instruments realtime controllers and LabVIEW software implementing Functional Global Variables (FGV) to store and access instrument parameters. Fiber optic converters enable network communication and triggering across the platforms.

The theory and implementation of a high quality pulse width modulated waveform synthesiser applicable to voltage FED inverters

NASA Astrophysics Data System (ADS)

Lower, Kim Nigel

1985-03-01

Modulation processes associated with the digital implementation of pulse width modulation (PWM) switching strategies were examined. A software package based on a portable turnkey structure is presented. Waveform synthesizer implementation techniques are reviewed. A three phase PWM waveform synthesizer for voltage fed inverters was realized. It is based on a constant carrier frequency of 18 kHz and a regular sample, single edge, asynchronous PWM switching scheme. With high carrier frequencies, it is possible to utilize simple switching strategies and as a consequence, many advantages are highlighted, emphasizing the importance to industrial and office markets.

Systems and methods for initializing a charging system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perisic, Milun; Ransonm, Ray M.; Kojouke, Lateef A.

2017-09-26

Systems and methods are provided for charging a battery. The system, for example, includes, but is not limited to a first interface configured to receive a voltage from an AC voltage source, a matrix conversion module comprising a plurality of switches electrically connected to the first interface and configured to provide a charging voltage to the battery, and a controller communicatively connected to the matrix conversion module, wherein the controller is configured to: determine a voltage of the battery, determine an angle of the AC voltage source to initiate charging of the battery based upon the voltage of the battery,more » and control the plurality of switches to provide the charging voltage to the battery between the determined angle of the AC voltage source and a subsequent zero-crossing of the AC voltage source.« less

DISTINCT: Diversity in Solar Talent Through INnovative Curriculum and Training: An Integrated Research and Education Approach towards Creating Diversity and Advancing Utility-Scale Solar Technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnaswami, Hariharan

The DISTINCT project research objective is to develop an innovative N-port power converter for a utility-scale PV system that is modular, compact and cost-effective and that will enable the integration of a high-frequency, high-voltage solid-state transformer. The novelty of the proposed research is the electrical power conversion architecture using an N-port converter system that replaces the output 60Hz transformer with an integrated high-frequency low-weight solid-state transformer reducing power electronics and BOS costs to meet SunShot goals through modularity and direct high-voltage interconnection. A challenge in direct integration with a 13.8kV line is the high voltage handling capacity of the convertersmore » combined with high efficiency operation. The front-end converter for each port is a Neutral-Point Clamped (NPC) Multi-Level dc-dc Dual-Active Bridge (ML-DAB) which allows Maximum Power Point Tracking (MPPT). The integrated high frequency transformer provides the galvanic isolation between the PV and grid side and also steps up the low dc voltage from PV source. Following the ML-DAB stage, in each port, is an inverter with H-bridge configuration or NPC configuration. N number of NPC inverters’ outputs are cascaded to attain the per-phase line-to-neutral voltage to connect directly to the distribution grid (i.e. 13.8 kV). The cascaded inverters have the inherent advantage of using lower rated devices, smaller filters and low Total Harmonic Distortion (THD) required for PV grid interconnection. Our analysis and simulation results show improved performance on cost, efficiency, service life with zero downtime and THD. A comprehensive control scheme is presented to ensure the maximum power from each port and each phase are sent to the grid. A functional prototype of a 2-port converter with ML-DAB and cascaded H-bridges has been designed, built, and tested in a laboratory setup to verify the target technical metrics. The N-port converter system due to its modular structure with individual control per port can be easily adapted to integrate functionalities that go well beyond the conventional grid support functions and mitigates impacts of forecasted fast ramp downs or ramp ups and single-fault conditions by automatic reconfiguration of the output.« less

Corrosion study on high power feeding of telecomunication copper cable in 5 wt.% CaSO4.2H2O solution

NASA Astrophysics Data System (ADS)

Shamsudin, Shaiful Rizam; Hashim, Nabihah; Ibrahim, Mohd Saiful Bahri; Rahman, Muhammad Sayuzi Abdul; Idrus, Muhammad Amin; Hassan, Mohd Rezadzudin; Abdullah, Wan Razli Wan

2016-07-01

The studies were carried out to find out the best powering scheme over the copper telephone line. It was expected that the application of the higher power feeding could increase the data transfer and capable of providing the customer's satisfaction. To realize the application of higher remote power feeding, the potential of corrosion problem on Cu cables was studied. The natural corrosion behaviour of copper cable in the 0.5% CaSO4.2H2O solution was studied in term of open circuit potential for 30 days. The corrosion behaviour of higher power feeding was studied by the immersion and the planned interval test to determine the corrosion rate as well as the effect of voltage magnitudes and the current scheme i.e. positive direct (DC+) and alternating current (AC) at about 0.40 ± 0.01 mA/ cm2 current density. In the immersion test, both DC+ and AC scheme showed the increasing of feeding voltage magnitude has increased the corrosion rate of Cu samples starting from 60 to 100 volts. It was then reduced at about 100 - 120 volts which may due to the passive and transpassive mechanism. The corrosion rate was slowly reduced further from 120 to 200 volts. Visually, the positively charged of Cu cable was seems susceptible to severe corrosion, while AC scheme exhibited a slight corrosion reaction on the surface. However, the planned interval test and XRD results showed the corrosion activity of the copper cable in the studied solution was a relatively slow process and considered not to be corroded as a partially protective scale of copper oxide formed on the surface.

Unbalanced voltage control of virtual synchronous generator in isolated micro-grid

NASA Astrophysics Data System (ADS)

Cao, Y. Z.; Wang, H. N.; Chen, B.

2017-06-01

Virtual synchronous generator (VSG) control is recommended to stabilize the voltage and frequency in isolated micro-grid. However, common VSG control is challenged by widely used unbalance loads, and the linked unbalance voltage problem worsens the power quality of the micro-grid. In this paper, the mathematical model of VSG was presented. Based on the analysis of positive- and negative-sequence equivalent circuit of VSG, an approach was proposed to eliminate the negative-sequence voltage of VSG with unbalance loads. Delay cancellation method and PI controller were utilized to identify and suppress the negative-sequence voltages. Simulation results verify the feasibility of proposed control strategy.

Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

PubMed

Gómez-González, J F; Destexhe, A; Bal, T

2014-10-01

Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

Strategies for Energy Efficient Resource Management of Hybrid Programming Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Dong; Supinski, Bronis de; Schulz, Martin

2013-01-01

Many scientific applications are programmed using hybrid programming models that use both message-passing and shared-memory, due to the increasing prevalence of large-scale systems with multicore, multisocket nodes. Previous work has shown that energy efficiency can be improved using software-controlled execution schemes that consider both the programming model and the power-aware execution capabilities of the system. However, such approaches have focused on identifying optimal resource utilization for one programming model, either shared-memory or message-passing, in isolation. The potential solution space, thus the challenge, increases substantially when optimizing hybrid models since the possible resource configurations increase exponentially. Nonetheless, with the accelerating adoptionmore » of hybrid programming models, we increasingly need improved energy efficiency in hybrid parallel applications on large-scale systems. In this work, we present new software-controlled execution schemes that consider the effects of dynamic concurrency throttling (DCT) and dynamic voltage and frequency scaling (DVFS) in the context of hybrid programming models. Specifically, we present predictive models and novel algorithms based on statistical analysis that anticipate application power and time requirements under different concurrency and frequency configurations. We apply our models and methods to the NPB MZ benchmarks and selected applications from the ASC Sequoia codes. Overall, we achieve substantial energy savings (8.74% on average and up to 13.8%) with some performance gain (up to 7.5%) or negligible performance loss.« less

The CARIBU EBIS control and synchronization system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dickerson, Clayton, E-mail: cdickerson@anl.gov; Peters, Christopher, E-mail: cdickerson@anl.gov

2015-01-09

The Californium Rare Isotope Breeder Upgrade (CARIBU) Electron Beam Ion Source (EBIS) charge breeder has been built and tested. The bases of the CARIBU EBIS electrical system are four voltage platforms on which both DC and pulsed high voltage outputs are controlled. The high voltage output pulses are created with either a combination of a function generator and a high voltage amplifier, or two high voltage DC power supplies and a high voltage solid state switch. Proper synchronization of the pulsed voltages, fundamental to optimizing the charge breeding performance, is achieved with triggering from a digital delay pulse generator. Themore » control system is based on National Instruments realtime controllers and LabVIEW software implementing Functional Global Variables (FGV) to store and access instrument parameters. Fiber optic converters enable network communication and triggering across the platforms.« less

Variable Rail Voltage Control of a Brushless DC (BLDC) Motor

DTIC Science & Technology

2013-01-01

Variable Rail Voltage Control of a Brushless DC ( BLDC ) Motor by Yuan Chen, Joseph Conroy, and William Nothwang ARL-TR-6308 January 2013...TR-6308 January 2013 Variable Rail Voltage Control of a Brushless DC ( BLDC ) Motor Yuan Chen, Joseph Conroy, and William Nothwang Sensors...DATES COVERED (From - To) 4. TITLE AND SUBTITLE Variable Rail Voltage Control of a Brushless DC ( BLDC ) Motor 5a. CONTRACT NUMBER 5b. GRANT

The Researching on Evaluation of Automatic Voltage Control Based on Improved Zoning Methodology

NASA Astrophysics Data System (ADS)

Xiao-jun, ZHU; Ang, FU; Guang-de, DONG; Rui-miao, WANG; De-fen, ZHU

2018-03-01

According to the present serious phenomenon of increasing size and structure of power system, hierarchically structured automatic voltage control(AVC) has been the researching spot. In the paper, the reduced control model is built and the adaptive reduced control model is researched to improve the voltage control effect. The theories of HCSD, HCVS, SKC and FCM are introduced and the effect on coordinated voltage regulation caused by different zoning methodologies is also researched. The generic framework for evaluating performance of coordinated voltage regulation is built. Finally, the IEEE-96 stsyem is used to divide the network. The 2383-bus Polish system is built to verify that the selection of a zoning methodology affects not only the coordinated voltage regulation operation, but also its robustness to erroneous data and proposes a comprehensive generic framework for evaluating its performance. The New England 39-bus network is used to verify the adaptive reduced control models’ performance.

The voltage control for self-excited induction generator based on STATCOM

NASA Astrophysics Data System (ADS)

Yan, Dandan; Wang, Feifeng; Pan, Juntao; Long, Weijie

2018-05-01

The small independent induction generator can build up voltage under its remanent magnetizing and excitation capacitance, but it is prone to voltage sag and harmonic increment when running with load. Therefore, the controller for constant voltage is designed based on the natural coordinate system to adjust the static synchronous compensator (STATCOM), which provides two-way dynamic reactive power compensation for power generation system to achieve voltage stability and harmonic suppression. The control strategy is verified on Matlab/Sinmulik, and the results show that the STATCOM under the controller can effectively improve the load capacity and reliability of asynchronous generator.

Cascaded Converters for Integration and Management of Grid Level Energy Storage Systems

NASA Astrophysics Data System (ADS)

Alaas, Zuhair

This research work proposes two cascaded multilevel inverter structures for BESS. The gating and switching control of switching devices in both inverter typologies are done by using a phase-shifted PWM scheme. The first proposed isolated multilevel inverter is made up of three-phase six-switch inverter blocks with a reduced number of power components compared with traditional isolated CHB. The suggested isolated converter has only one battery string for three-phase system that can be used for high voltage and high power applications such as grid connected BESS and alternative energy systems. The isolated inverter enables dq frame based simple control and eliminates the issues of single-phase pulsating power, which can cause detrimental impacts on certain dc sources. Simulation studies have been carried out to compare the proposed isolated multi-level inverter with an H-bridge cascaded transformer inverter. The simulation results verified the performance of the isolated inverter. The second proposed topology is a Hierarchal Cascaded Multilevel Converter (HCMC) with phase to phase SOC balancing capability which also for high voltage and high power battery energy storage systems. The HCMC has a hybrid structure of half-bridge converters and H-bridge inverters and the voltage can be hierarchically cascaded to reach the desired value at the half-bridge and the H-bridge levels. The uniform SOC battery management is achieved by controlling the half-bridge converters that are connected to individual battery modules/cells. Simulation studies and experimental results have been carried on a large scale battery system under different operating conditions to verify the effectiveness of the proposed inverters. Moreover, this dissertation presents a new three-phase SOC equalizing circuit, called six-switch energy-level balancing circuit (SSBC), which can be used to realize uniform SOC operation for full utilization of the battery capacity in proposed HCMC or any CMI inverter while keeping balanced three-phase operation. A sinusoidal PWM modulation technique is used to control power transferring between phases. Simulation results have been carried out to verify the performance of the proposed SSBC circuit of uniform three-phase SOC balancing.

Method and apparatus for controlling a microturbine

DOEpatents

Garces, Luis Jose; Cardinal, Mark Edward; Sinha, Gautam; Dame, Mark Edward

2005-08-02

An apparatus for controlling a microturbine, the apparatus including: a rectifier adapted for converting at least one generated voltage from the microturbine to a DC link voltage; an inverter adapted for converting the DC link voltage to at least one inverter output voltage, the at least one inverter output voltage being electrically coupled to an external power bus; a starter drive adapted for converting at least one starter input voltage to at least one starter output voltage, the at least one starter input voltage being electrically coupled to the external power bus, the at least one starter output voltage being electrically coupled to the microturbine.

Pattern manipulation via on-chip phase modulation between orbital angular momentum beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Huanlu; School of Engineering, University of Glasgow, Rankine Building, Oakfield Avenue, Glasgow G12 8LP; Strain, Michael J.

2015-08-03

An integrated approach to thermal modulation of relative phase between two optical vortices with opposite chirality has been demonstrated on a silicon-on-insulator substrate. The device consists of a silicon-integrated optical vortex emitter and a phase controlled 3 dB coupler. The relative phase between two optical vortices can be actively modulated on chip by applying a voltage on the integrated heater. The phase shift is shown to be linearly proportional to applied electrical power, and the rotation angle of the interference pattern is observed to be inversely proportional to topological charge. This scheme can be used in lab-on-chip, communications and sensing applications.more » It can be intentionally implemented with other modulation elements to achieve more complicated applications.« less

Detection of Rooftop Cooling Unit Faults Based on Electrical Measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Armstrong, Peter R.; Laughman, C R.; Leeb, S B.

Non-intrusive load monitoring (NILM) is accomplished by sampling voltage and current at high rates and reducing the resulting start transients or harmonic contents to concise ''signatures''. Changes in these signatures can be used to detect, and in many cases directly diagnose, equipment and component faults associated with roof-top cooling units. Use of the NILM for fault detection and diagnosis (FDD) is important because (1) it complements other FDD schemes that are based on thermo-fluid sensors and analyses and (2) it is minimally intrusive (one measuring point in the relatively protected confines of the control panel) and therefore inherently reliable. Thismore » paper describes changes in the power signatures of fans and compressors that were found, experimentally and theoretically, to be useful for fault detection.« less

PRELIMINARY TEST RESULTS OF A PROTOTYPE FAST KICKER FOR APS MBA UPGRADE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, C.-Y.; Morrison, L.; Sun, X.

The APS multi-bend achromatic (MBA) upgrade storage ring plans to support two bunch fill patterns: a 48-bunch and a 324-bunch. A “swap out” injection scheme is required. In order to provide the required kick to injected beam, to minimize the beam loss and residual oscillation of injected beam, and to minimize the perturbation to stored beam during injection, the rise, fall, and flat-top parts of the kicker pulse must be within a 16.9-ns interval. Stripline-type kickers are chosen for both injection and extraction. We developed a prototype kicker that supports a ±15kV differential pulse voltage. We performed high voltage discharge,more » TDR measurement, high voltage pulse test and beam test of the kicker. We report the final design of the fast kicker and the test results.« less

Voltage Based Detection Method for High Impedance Fault in a Distribution System

NASA Astrophysics Data System (ADS)

Thomas, Mini Shaji; Bhaskar, Namrata; Prakash, Anupama

2016-09-01

High-impedance faults (HIFs) on distribution feeders cannot be detected by conventional protection schemes, as HIFs are characterized by their low fault current level and waveform distortion due to the nonlinearity of the ground return path. This paper proposes a method to identify the HIFs in distribution system and isolate the faulty section, to reduce downtime. This method is based on voltage measurements along the distribution feeder and utilizes the sequence components of the voltages. Three models of high impedance faults have been considered and source side and load side breaking of the conductor have been studied in this work to capture a wide range of scenarios. The effect of neutral grounding of the source side transformer is also accounted in this study. The results show that the algorithm detects the HIFs accurately and rapidly. Thus, the faulty section can be isolated and service can be restored to the rest of the consumers.

Closed-loop analysis and control of a non-inverting buck-boost converter

NASA Astrophysics Data System (ADS)

Chen, Zengshi; Hu, Jiangang; Gao, Wenzhong

2010-11-01

In this article, a cascade controller is designed and analysed for a non-inverting buck-boost converter. The fast inner current loop uses sliding mode control. The slow outer voltage loop uses the proportional-integral (PI) control. Stability analysis and selection of PI gains are based on the nonlinear closed-loop error dynamics incorporating both the inner and outer loop controllers. The closed-loop system is proven to have a nonminimum phase structure. The voltage transient due to step changes of input voltage or resistance is predictable. The operating range of the reference voltage is discussed. The controller is validated by a simulation circuit. The simulation results show that the reference output voltage is well-tracked under system uncertainties or disturbances, confirming the validity of the proposed controller.

Differential comparator cirucit

DOEpatents

Hickling, Ronald M.

1996-01-01

A differential comparator circuit for an Analog-to-Digital Converter (ADC) or other application includes a plurality of differential comparators and a plurality of offset voltage generators. Each comparator includes first and second differentially connected transistor pairs having equal and opposite voltage offsets. First and second offset control transistors are connected in series with the transistor pairs respectively. The offset voltage generators generate offset voltages corresponding to reference voltages which are compared with a differential input voltage by the comparators. Each offset voltage is applied to the offset control transistors of at least one comparator to set the overall voltage offset of the comparator to a value corresponding to the respective reference voltage. The number of offset voltage generators required in an ADC application can be reduced by a factor of approximately two by applying the offset voltage from each offset voltage generator to two comparators with opposite logical sense such that positive and negative offset voltages are produced by each offset voltage generator.

Alternator control for battery charging

DOEpatents

Brunstetter, Craig A.; Jaye, John R.; Tallarek, Glen E.; Adams, Joseph B.

2015-07-14

In accordance with an aspect of the present disclosure, an electrical system for an automotive vehicle has an electrical generating machine and a battery. A set point voltage, which sets an output voltage of the electrical generating machine, is set by an electronic control unit (ECU). The ECU selects one of a plurality of control modes for controlling the alternator based on an operating state of the vehicle as determined from vehicle operating parameters. The ECU selects a range for the set point voltage based on the selected control mode and then sets the set point voltage within the range based on feedback parameters for that control mode. In an aspect, the control modes include a trickle charge mode and battery charge current is the feedback parameter and the ECU controls the set point voltage within the range to maintain a predetermined battery charge current.

Symmetric voltage-controlled variable resistance

NASA Technical Reports Server (NTRS)

Vanelli, J. C.

1978-01-01

Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

Terahertz beam switching by electrical control of graphene-enabled tunable metasurface.

PubMed

Zhang, Yin; Feng, Yijun; Zhao, Junming; Jiang, Tian; Zhu, Bo

2017-10-26

Controlling the terahertz wave, especially the dynamical and full control of terahertz wavefront, is highly demanded due to the increasing development of practical devices and application systems. Recently considerable efforts have been made to fill the 'terahertz gap' with the help of artificial metamaterial or metasurface incorporated with graphene material. Here, we propose a scheme to design tunable metasurface consisting of metallic patch array on a grounded polymer substrate embedded with graphene layers to electrically control the electromagnetic beam reflection at terahertz frequency. By adjusting geometric dimension of the patch elements, 360 degree reflection phase range may be achieved, thus abrupt phase shifts can be introduced along the metasurface for tailoring the reflected wavefront. Moreover, the reflective phase gradient over the metasurface can be switched between 90 and 360 degree by controlling the Fermi energy of the embedded graphene through voltage biasing, hence dynamically switching the reflective beam directions. Numerical simulations demonstrate that either single beam or dual beam dynamically switching between normal and oblique reflection angles can be well attained at working frequency. The proposed approach will bring much freedom in the design of beam manipulation devices and may be applied to terahertz radiation control.

Robust Functionalization of Large Microelectrode Arrays by Using Pulsed Potentiostatic Deposition

PubMed Central

Rothe, Joerg; Frey, Olivier; Madangopal, Rajtarun; Rickus, Jenna; Hierlemann, Andreas

2016-01-01

Surface modification of microelectrodes is a central step in the development of microsensors and microsensor arrays. Here, we present an electrodeposition scheme based on voltage pulses. Key features of this method are uniformity in the deposited electrode coatings, flexibility in the overall deposition area, i.e., the sizes and number of the electrodes to be coated, and precise control of the surface texture. Deposition and characterization of four different materials are demonstrated, including layers of high-surface-area platinum, gold, conducting polymer poly(ethylenedioxythiophene), also known as PEDOT, and the non-conducting polymer poly(phenylenediamine), also known as PPD. The depositions were conducted using a fully integrated complementary metal-oxide-semiconductor (CMOS) chip with an array of 1024 microelectrodes. The pulsed potentiostatic deposition scheme is particularly suitable for functionalization of individual electrodes or electrode subsets of large integrated microelectrode arrays: the required deposition waveforms are readily available in an integrated system, the same deposition parameters can be used to functionalize the surface of either single electrodes or large arrays of thousands of electrodes, and the deposition method proved to be robust and reproducible for all materials tested. PMID:28025569

Change control microcomputer device for vehicle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morishita, M.; Kouge, S.

1986-08-19

A charge control microcomputer device for a vehicle is described which consists of: a clutch device for transmitting the rotary output of an engine; a charging generator driven by the clutch device; a battery charged by an output of the charging generator; a voltage regulator for controlling an output voltage of the charging generator to a predetermined value; an engine controlling microcomputer for receiving engine data, to control the engine; and a charge control microcomputer for processing the engine data from the engine controlling microcomputer and charge system data including terminal voltage data from the battery and generated voltage datamore » from the charging generator, to determine a reference voltage for the voltage regulator in accordance with the engine data and the charge system data, and for processing an engine rotation signal to generate and apply an operating instruction to the clutch device in accordance with the engine data and the charge system data, such that the charging generator is driven within a predetermined range of revolutions per minute at all times.« less

Harnessing quantum transport by transient chaos.

PubMed

Yang, Rui; Huang, Liang; Lai, Ying-Cheng; Grebogi, Celso; Pecora, Louis M

2013-03-01

Chaos has long been recognized to be generally advantageous from the perspective of control. In particular, the infinite number of unstable periodic orbits embedded in a chaotic set and the intrinsically sensitive dependence on initial conditions imply that a chaotic system can be controlled to a desirable state by using small perturbations. Investigation of chaos control, however, was largely limited to nonlinear dynamical systems in the classical realm. In this paper, we show that chaos may be used to modulate or harness quantum mechanical systems. To be concrete, we focus on quantum transport through nanostructures, a problem of considerable interest in nanoscience, where a key feature is conductance fluctuations. We articulate and demonstrate that chaos, more specifically transient chaos, can be effective in modulating the conductance-fluctuation patterns. Experimentally, this can be achieved by applying an external gate voltage in a device of suitable geometry to generate classically inaccessible potential barriers. Adjusting the gate voltage allows the characteristics of the dynamical invariant set responsible for transient chaos to be varied in a desirable manner which, in turn, can induce continuous changes in the statistical characteristics of the quantum conductance-fluctuation pattern. To understand the physical mechanism of our scheme, we develop a theory based on analyzing the spectrum of the generalized non-Hermitian Hamiltonian that includes the effect of leads, or electronic waveguides, as self-energy terms. As the escape rate of the underlying non-attracting chaotic set is increased, the imaginary part of the complex eigenenergy becomes increasingly large so that pointer states are more difficult to form, making smoother the conductance-fluctuation pattern.

Three-dimensional structural damage localization system and method using layered two-dimensional array of capacitance sensors

NASA Technical Reports Server (NTRS)

Curry, Mark A (Inventor); Senibi, Simon D (Inventor); Banks, David L (Inventor)

2010-01-01

A system and method for detecting damage to a structure is provided. The system includes a voltage source and at least one capacitor formed as a layer within the structure and responsive to the voltage source. The system also includes at least one sensor responsive to the capacitor to sense a voltage of the capacitor. A controller responsive to the sensor determines if damage to the structure has occurred based on the variance of the voltage of the capacitor from a known reference value. A method for sensing damage to a structure involves providing a plurality of capacitors and a controller, and coupling the capacitors to at least one surface of the structure. A voltage of the capacitors is sensed using the controller, and the controller calculates a change in the voltage of the capacitors. The method can include signaling a display system if a change in the voltage occurs.

Application of kinetic flux vector splitting scheme for solving multi-dimensional hydrodynamical models of semiconductor devices

NASA Astrophysics Data System (ADS)

Nisar, Ubaid Ahmed; Ashraf, Waqas; Qamar, Shamsul

In this article, one and two-dimensional hydrodynamical models of semiconductor devices are numerically investigated. The models treat the propagation of electrons in a semiconductor device as the flow of a charged compressible fluid. It plays an important role in predicting the behavior of electron flow in semiconductor devices. Mathematically, the governing equations form a convection-diffusion type system with a right hand side describing the relaxation effects and interaction with a self consistent electric field. The proposed numerical scheme is a splitting scheme based on the kinetic flux-vector splitting (KFVS) method for the hyperbolic step, and a semi-implicit Runge-Kutta method for the relaxation step. The KFVS method is based on the direct splitting of macroscopic flux functions of the system on the cell interfaces. The second order accuracy of the scheme is achieved by using MUSCL-type initial reconstruction and Runge-Kutta time stepping method. Several case studies are considered. For validation, the results of current scheme are compared with those obtained from the splitting scheme based on the NT central scheme. The effects of various parameters such as low field mobility, device length, lattice temperature and voltage are analyzed. The accuracy, efficiency and simplicity of the proposed KFVS scheme validates its generic applicability to the given model equations. A two dimensional simulation is also performed by KFVS method for a MESFET device, producing results in good agreement with those obtained by NT-central scheme.

Piezo Voltage Controlled Planar Hall Effect Devices

PubMed Central

Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K. W.; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

2016-01-01

The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials. PMID:27329068

Piezo Voltage Controlled Planar Hall Effect Devices.

PubMed

Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

2016-06-22

The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

Modeling of Single Noninactivating Na+ Channels: Evidence for Two Open and Several Fast Inactivated States

PubMed Central

The, Yu-Kai; Fernandes, Jacqueline; Popa, M. Oana; Alekov, Alexi K.; Timmer, Jens; Lerche, Holger

2006-01-01

Voltage-gated Na+ channels play a fundamental role in the excitability of nerve and muscle cells. Defects in fast Na+ channel inactivation can cause hereditary muscle diseases with hyper- or hypoexcitability of the sarcolemma. To explore the kinetics and gating mechanisms of noninactivating muscle Na+ channels on a molecular level, we analyzed single channel currents from wild-type and five mutant Na+ channels. The mutations were localized in different protein regions which have been previously shown to be important for fast inactivation (D3-D4-linker, D3/S4-S5, D4/S4-S5, D4/S6) and exhibited distinct grades of defective fast inactivation with varying levels of persistent Na+ currents caused by late channel reopenings. Different gating schemes were fitted to the data using hidden Markov models with a correction for time interval omission and compared statistically. For all investigated channels including the wild-type, two open states were necessary to describe our data. Whereas one inactivated state was sufficient to fit the single channel behavior of wild-type channels, modeling the mutants with impaired fast inactivation revealed evidence for several inactivated states. We propose a single gating scheme with two open and three inactivated states to describe the behavior of all five examined mutants. This scheme provides a biological interpretation of the collected data, based on previous investigations in voltage-gated Na+ and K+ channels. PMID:16513781

Reproducible and controllable induction voltage adder for scaled beam experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakai, Yasuo; Nakajima, Mitsuo; Horioka, Kazuhiko

2016-08-15

A reproducible and controllable induction adder was developed using solid-state switching devices and Finemet cores for scaled beam compression experiments. A gate controlled MOSFET circuit was developed for the controllable voltage driver. The MOSFET circuit drove the induction adder at low magnetization levels of the cores which enabled us to form reproducible modulation voltages with jitter less than 0.3 ns. Preliminary beam compression experiments indicated that the induction adder can improve the reproducibility of modulation voltages and advance the beam physics experiments.

Reducing Stator Current Harmonics for a Doubly-Fed Induction Generator Connected to a Distorted Grid

DTIC Science & Technology

2013-09-01

electric grid voltage harmonics, which is a potential obstacle for implementing stable wind -energy systems. Two existing rotor voltage controllers...electric grid voltage harmonics, which is a potential obstacle for implementing stable wind -energy systems. Two existing rotor voltage controllers...speed of the DFIG can be adjusted to optimize turbine efficiency for given wind conditions. A common method for controlling the operating speed is

Control of a Robotic Hand Using a Tongue Control System-A Prosthesis Application.

PubMed

Johansen, Daniel; Cipriani, Christian; Popovic, Dejan B; Struijk, Lotte N S A

2016-07-01

The aim of this study was to investigate the feasibility of using an inductive tongue control system (ITCS) for controlling robotic/prosthetic hands and arms. This study presents a novel dual modal control scheme for multigrasp robotic hands combining standard electromyogram (EMG) with the ITCS. The performance of the ITCS control scheme was evaluated in a comparative study. Ten healthy subjects used both the ITCS control scheme and a conventional EMG control scheme to complete grasping exercises with the IH1 Azzurra robotic hand implementing five grasps. Time to activate a desired function or grasp was used as the performance metric. Statistically significant differences were found when comparing the performance of the two control schemes. On average, the ITCS control scheme was 1.15 s faster than the EMG control scheme, corresponding to a 35.4% reduction in the activation time. The largest difference was for grasp 5 with a mean AT reduction of 45.3% (2.38 s). The findings indicate that using the ITCS control scheme could allow for faster activation of specific grasps or functions compared with a conventional EMG control scheme. For transhumeral and especially bilateral amputees, the ITCS control scheme could have a significant impact on the prosthesis control. In addition, the ITCS would provide bilateral amputees with the additional advantage of environmental and computer control for which the ITCS was originally developed.

On the use of an Arduino-based controller to control the charging process of a wind turbine

NASA Astrophysics Data System (ADS)

Mahmuddin, Faisal; Yusran, Ahmad Muhtam; Klara, Syerly

2017-02-01

In order to avoid an excessive charging voltage which can damage power storage when converting wind energy using a turbine, it is necessary to control the charging voltage of the turbine generator. In the present study, a charging controller which uses an Arduino microcontroller, is designed. 3 (three) indicator lights are installed to indicate the battery charging process, power diversion to dummy load and battery power level. The performance of the designed controller is evaluated by simulating 3 cases. In this simulation, a battery with maximum voltage of 12.4 V is used. Case 1 is performed with input voltage equals the one set in Arduino which is 10 V. In this case, the battery is charged up to 10.8 V. In case 2, the input voltage is 13 V while the maximum voltage set in Arduino is also 13 V. In this case, the battery is charged up to maximum voltage of the battery. Moreover, the dummy load indicator is ON and charging indicator is OFF after the maximum charging voltage is reached because the electricity is flowed to the dummy load. In the final case, the input voltage is set to be 16 V while the maximum voltage set in Arduino is 13 V. In this case, the charging indicator is OFF and dummy load indicator is ON which means that the Arduino has successfully switched the power to be flowed to dummy load. From the 3 (three) cases, it can be concluded that the designed controller works perfectly to control the charging process of the wind turbine. Moreover, the charging time needed in each case can also be determined.

Hybrid electric vehicle power management system

DOEpatents

Bissontz, Jay E.

2015-08-25

Level voltage levels/states of charge are maintained among a plurality of high voltage DC electrical storage devices/traction battery packs that are arrayed in series to support operation of a hybrid electric vehicle drive train. Each high voltage DC electrical storage device supports a high voltage power bus, to which at least one controllable load is connected, and at least a first lower voltage level electrical distribution system. The rate of power transfer from the high voltage DC electrical storage devices to the at least first lower voltage electrical distribution system is controlled by DC-DC converters.

A simple system for 160GHz optical terahertz wave generation and data modulation

NASA Astrophysics Data System (ADS)

Li, Yihan; He, Jingsuo; Sun, Xueming; Shi, Zexia; Wang, Ruike; Cui, Hailin; Su, Bo; Zhang, Cunlin

2018-01-01

A simple system based on two cascaded Mach-Zehnder modulators, which can generate 160GHz optical terahertz waves from 40GHz microwave sources, is simulated and tested in this paper. Fiber grating filter is used in the system to filter out optical carrier. By properly adjusting the modulator DC bias voltages and the signal voltages and phases, 4-tupling optical terahertz wave can be generated with fiber grating. This notch fiber grating filter is greatly suitable for terahertz over fiber (TOF) communication system. This scheme greatly reduces the cost of long-distance terahertz communication. Furthermore, 10Gbps digital signal is modulated in the 160GHz optical terahertz wave.

Regulation of the Output Voltage of an Inverter in Case of Load Variation

NASA Astrophysics Data System (ADS)

Diouri, Omar; Errahimi, Fatima; Es-Sbai, Najia

2018-05-01

In a DC/AC photovoltaic application, the stability of the output voltage of the inverter plays a very important role in the electrical systems. Such a photovoltaic system is constituted by an inverter, which makes it possible to convert the continuous energy to the alternative energy used in systems which operate under a voltage of 230V. The output of this inverter can be connected to a single load or more, at which time a second load is added in parallel with the first load. In this case, it proves a voltage drop at the output of the inverter. This problem influences the proper functioning of the electrical loads. Therefore, our contribution is to give a solution to this by compensating this voltage drop using a boost converter at the input of the inverter. This boost converter will play the role of the compensator that will provide the necessary voltage to the inverter in order to increase the voltage across the loads. But the use of this boost without controlling it is not enough because it generates a voltage that depends on the duty cycle of the control signal. To stabilize the output voltage of the inverter, we used a Proportional, Integral, and Derivative control (PID), which makes it possible to generate the necessary control signal for the voltage boost in order to have a good regulation of the output voltage of the inverter. Finally, we have solved the problem of the voltage drop even though there is loads variation.

RF lockout circuit for electronic locking system

NASA Astrophysics Data System (ADS)

Becker, Earl M., Jr.; Miller, Allen

1991-02-01

An electronics lockout circuit was invented that includes an antenna adapted to receive radio frequency signals from a transmitter, and a radio frequency detector circuit which converts the radio frequency signals into a first direct current voltage indicative of the relative strength of the field resulting from the radio frequency signals. The first direct current voltage is supplied to a trigger circuit which compares this direct current voltage to an adjustable direct current reference voltage. This provides a second direct current voltage at the output whenever the amplitude of the first direct current voltage exceeds the amplitude of the reference voltage provided by the comparator circuit. This is supplied to a disconnect relay circuit which, upon receiving a signal from the electronic control unit of an electronic combination lock during the time period at which the second direct current voltage is present, isolates the door strike coil of a security door from the electronic control unit. This prevents signals falsely generated by the electronic control unit because of radio frequency signals in the vicinity of the electronic control unit energizing the door strike coil and accidentally opening a security door.

Optimization design combined with coupled structural-electrostatic analysis for the electrostatically controlled deployable membrane reflector

NASA Astrophysics Data System (ADS)

Liu, Chao; Yang, Guigeng; Zhang, Yiqun

2015-01-01

The electrostatically controlled deployable membrane reflector (ECDMR) is a promising scheme to construct large size and high precision space deployable reflector antennas. This paper presents a novel design method for the large size and small F/D ECDMR considering the coupled structure-electrostatic problem. First, the fully coupled structural-electrostatic system is described by a three field formulation, in which the structure and passive electrical field is modeled by finite element method, and the deformation of the electrostatic domain is predicted by a finite element formulation of a fictitious elastic structure. A residual formulation of the structural-electrostatic field finite element model is established and solved by Newton-Raphson method. The coupled structural-electrostatic analysis procedure is summarized. Then, with the aid of this coupled analysis procedure, an integrated optimization method of membrane shape accuracy and stress uniformity is proposed, which is divided into inner and outer iterative loops. The initial state of relatively high shape accuracy and uniform stress distribution is achieved by applying the uniform prestress on the membrane design shape and optimizing the voltages, in which the optimal voltage is computed by a sensitivity analysis. The shape accuracy is further improved by the iterative prestress modification using the reposition balance method. Finally, the results of the uncoupled and coupled methods are compared and the proposed optimization method is applied to design an ECDMR. The results validate the effectiveness of this proposed methods.

Network based management for multiplexed electric vehicle charging

DOEpatents

Gadh, Rajit; Chung, Ching Yen; Qui, Li

2017-04-11

A system for multiplexing charging of electric vehicles, comprising a server coupled to a plurality of charging control modules over a network. Each of said charging modules being connected to a voltage source such that each charging control module is configured to regulate distribution of voltage from the voltage source to an electric vehicle coupled to the charging control module. Data collection and control software is provided on the server for identifying a plurality of electric vehicles coupled to the plurality of charging control modules and selectively distributing charging of the plurality of charging control modules to multiplex distribution of voltage to the plurality of electric vehicles.

Voltage regulator/amplifier is self-regulated

NASA Technical Reports Server (NTRS)

Day, W. E.; Phillips, D. E.

1967-01-01

Signal modulated, self-regulating voltage regulator/amplifier controls the output b-plus voltage in modulated regulator systems. It uses self-oscillation with feedback to a control circuit with a discontinuous amplitude action feedback loop.

Pixel-Level Digital-to-Analog Conversion Scheme with Compensation of Thin-Film-Transistor Variations for Compact Integrated Data Drivers of Active Matrix Organic Light Emitting Diodes

NASA Astrophysics Data System (ADS)

Kim, Tae-Wook; Park, Sang-Gyu; Choi, Byong-Deok

2011-03-01

The previous pixel-level digital-to-analog-conversion (DAC) scheme that implements a part of a DAC in a pixel circuit turned out to be very efficient for reducing the peripheral area of an integrated data driver fabricated with low-temperature polycrystalline silicon thin-film transistors (LTPS TFTs). However, how the pixel-level DAC can be compatible with the existing pixel circuits including compensation schemes of TFT variations and IR drops on supply rails, which is of primary importance for active matrix organic light emitting diodes (AMOLEDs) is an issue in this scheme, because LTPS TFTs suffer from random variations in their characteristics. In this paper, we show that the pixel-level DAC scheme can be successfully used with the previous compensation schemes by giving two examples of voltage- and current-programming pixels. The previous pixel-level DAC schemes require additional two TFTs and one capacitor, but for these newly proposed pixel circuits, the overhead is no more than two TFTs by utilizing the already existing capacitor. In addition, through a detailed analysis, it has been shown that the pixel-level DAC can be expanded to a 4-bit resolution, or be applied together with 1:2 demultiplexing driving for 6- to 8-in. diagonal XGA AMOLED display panels.

Design of A Grid Integrated PV System with MPPT Control and Voltage Oriented Controller using MATLAB/PLECES

NASA Astrophysics Data System (ADS)

Soreng, Bineeta; Behera, Pradyumna; Pradhan, Raseswari

2017-08-01

This paper presents model of a grid-integrated photovoltaic array with Maximum Power Point Tracker (MPPT) and voltage oriented controller. The MPPT of the PV array is usually an essential part of PV system as MPPT helps the operating point of the solar array to align its maximum power point. In this model, the MPPT along with a DC-DC converter lets a PV generator to produce continuous power, despite of the measurement conditions. The neutral-point-clamped converter (NPC) with a boost converter raises the voltage from the panels to the DC-link. An LCL-filter smoothens the current ripple caused by the PWM modulation of the grid-side inverter. In addition to the MPPT, the system has two more two controllers, such as voltage controller and a current controller. The voltage control has a PI controller to regulate the PV voltage to optimal level by controlling the amount of current injected into the boost stage. Here, the grid-side converter transfers the power from the DC-link into the grid and maintains the DC-link voltage. Three-phase PV inverters are used for off-grid or designed to create utility frequency AC. The PV system can be connected in series or parallel to get the desired output power. To justify the working of this model, the grid-integrated PV system has been designed in MATLAB/PLECS. The simulation shows the P-V curve of implemented PV Array consisting 4 X 20 modules, reactive, real power, grid voltage and current.

Effects of a chirped bias voltage on ion energy distributions in inductively coupled plasma reactors

NASA Astrophysics Data System (ADS)

Lanham, Steven J.; Kushner, Mark J.

2017-08-01

The metrics for controlling reactive fluxes to wafers for microelectronics processing are becoming more stringent as feature sizes continue to shrink. Recent strategies for controlling ion energy distributions to the wafer involve using several different frequencies and/or pulsed powers. Although effective, these strategies are often costly or present challenges in impedance matching. With the advent of matching schemes for wide band amplifiers, other strategies to customize ion energy distributions become available. In this paper, we discuss results from a computational investigation of biasing substrates using chirped frequencies in high density, electronegative inductively coupled plasmas. Depending on the frequency range and chirp duration, the resulting ion energy distributions exhibit components sampled from the entire frequency range. However, the chirping process also produces transient shifts in the self-generated dc bias due to the reapportionment of displacement and conduction with frequency to balance the current in the system. The dynamics of the dc bias can also be leveraged towards customizing ion energy distributions.

Dynamic Analysis and Test Results for an STC Stirling Generator

NASA Astrophysics Data System (ADS)

Qiu, Songgang; Peterson, Allen A.

2004-02-01

Long-life, high-efficiency generators based on free-piston Stirling machines are a future energy-conversion solution for both space and commercial applications. To aid in design and system integration efforts, Stirling Technology Company (STC) has developed dynamic simulation models for the internal moving subassemblies and for complete Stirling convertor assemblies. These dynamic models have been validated using test data from operating prototypes. Simplified versions of these models are presented to help explain the operating characteristics of the Stirling convertor. Power spectrum analysis is presented for the test data for casing acceleration, piston motion, displacer motion, and controller current/voltage during full power operation. The harmonics of a Stirling convertor and its moving components are identified for the STC zener-diode control scheme. The dynamic behavior of each moving component and its contribution to the system dynamics and resultant vibration forces are discussed. Additionally, the effects of a passive balancer and external suspension are predicted by another simplified system model.

Optically controlled low-power on-off mode resonant tunneling oscillator with a heterojunction phototransistor switch.

PubMed

Lee, Kiwon; Park, Jaehong; Lee, Jooseok; Yang, Kyounghoon

2015-03-15

We report an optically controlled low-power on-off mode oscillator based on a resonant tunneling diode (RTD) that is monolithically integrated with a heterojunction phototransistor (HPT) optical switch. In order to achieve a low-power operation at a wavelength of 1.55 μm an InP-based quantum-effect tunneling diode is used for microwave signal generation based on a unique negative differential conductance (NDC) characteristic of the RTD at a low applied voltage. In addition, the high-gain HPT is used for converting incident optical data to an electrical data signal. The fabricated on-off mode oscillator shows a low-power consumption of 5 mW and a high-data-rate of 1  Gb/s at an oscillation frequency of 4.7 GHz. A good energy efficiency of 5  pJ/bit has been obtained due to the low DC power consumption along with high-data-rate performance of the RTD-based optoelectronic integration scheme.

Collective phenomena in volume and surface barrier discharges

NASA Astrophysics Data System (ADS)

Kogelschatz, U.

2010-11-01

Barrier discharges are increasingly used as a cost-effective configuration to produce non-equilibrium plasmas at atmospheric pressure. This way, copious amounts of electrons, ions, free radicals and excited species can be generated without significant heating of the background gas. In most applications the barrier is made of dielectric material. Major applications utilizing mainly dielectric barriers include ozone generation, surface cleaning and modification, polymer and textile treatment, sterilization, pollution control, CO2 lasers, excimer lamps, plasma display panels (flat TV screens). More recent research efforts are devoted to biomedical applications and to plasma actuators for flow control. Sinusoidal feeding voltages at various frequencies as well as pulsed excitation schemes are used. Volume as well as surface barrier discharges can exist in the form of filamentary, regularly patterned or diffuse, laterally homogeneous discharges. The physical effects leading to collective phenomena in volume and surface barrier discharges are discussed in detail. Special attention is paid to self-organization of current filaments and pattern formation. Major similarities of the two types of barrier discharges are elaborated.

Automatic Control Of Length Of Welding Arc

NASA Technical Reports Server (NTRS)

Iceland, William F.

1991-01-01

Nonlinear relationships among current, voltage, and length stored in electronic memory. Conceptual microprocessor-based control subsystem maintains constant length of welding arc in gas/tungsten arc-welding system, even when welding current varied. Uses feedback of current and voltage from welding arc. Directs motor to set position of torch according to previously measured relationships among current, voltage, and length of arc. Signal paths marked "calibration" or "welding" used during those processes only. Other signal paths used during both processes. Control subsystem added to existing manual or automatic welding system equipped with automatic voltage control.

RF pulse shape control in the compact linear collider test facility

NASA Astrophysics Data System (ADS)

Kononenko, Oleksiy; Corsini, Roberto

2018-07-01

The Compact Linear Collider (CLIC) is a study for an electron-positron machine aiming at accelerating and colliding particles at the next energy frontier. The CLIC concept is based on the novel two-beam acceleration scheme, where a high-current low-energy drive beam generates RF in series of power extraction and transfer structures accelerating the low-current main beam. To compensate for the transient beam-loading and meet the energy spread specification requirements for the main linac, the RF pulse shape must be carefully optimized. This was recently modelled by varying the drive beam phase switch times in the sub-harmonic buncher so that, when combined, the drive beam modulation translates into the required voltage modulation of the accelerating pulse. In this paper, the control over the RF pulse shape with the phase switches, that is crucial for the success of the developed compensation model, is studied. The results on the experimental verification of this control method are presented and a good agreement with the numerical predictions is demonstrated. Implications for the CLIC beam-loading compensation model are also discussed.

Analysis of sensorless control of brushless DC motor using unknown input observer with different gains

NASA Astrophysics Data System (ADS)

Astik, Mitesh B.; Bhatt, Praghnesh; Bhalja, Bhavesh R.

2017-03-01

A sensorless control scheme based on an unknown input observer is presented in this paper in which back EMF of the Brushless DC Motor (BLDC) is continuously estimated from available line voltages and currents. During negative rotation of motor, actual and estimated speed fail to track the reference speed and if the corrective action is not taken by the observer, the motor goes into saturation. To overcome this problem, the speed estimation algorithm has been implemented in this paper to control the dynamic behavior of the motor during negative rotation. The Ackermans method was used to calculate the gains of an unknown input observer which is based on the appropriate choice of the eigenvalues in advance. The criteria to choose eigenvalue is to obtain a balance between faster convergence rate and the least noise level. Simulations have been carried out for different disturbances such as step changes in motor reference speed and load torque. The comparative simulation results clearly depict that the disturbance effects in actual and estimated responses minimizes as observer gain setting increases.

Active control of acoustic pressure fields using smart material technologies

NASA Technical Reports Server (NTRS)

Banks, H. T.; Smith, R. C.

1993-01-01

An overview describing the use of piezoceramic patches in reducing noise in a structural acoustics setting is presented. The passive and active contributions due to patches which are bonded to an Euler-Bernoulli beam or thin shell are briefly discussed and the results are incorporated into a 2-D structural acoustics model. In this model, an exterior noise source causes structural vibrations which in turn lead to interior noise as a result of nonlinear fluid/structure coupling mechanism. Interior sound pressure levels are reduced via patches bonded to the flexible boundary (a beam in this case) which generate pure bending moments when an out-of-phase voltage is applied. Well-posedness results for the infinite dimensional system are discussed and a Galerkin scheme for approximating the system dynamics is outlined. Control is implemented by using linear quadratic regulator (LQR) optimal control theory to calculate gains for the linearized system and then feeding these gains back into the nonlinear system of interest. The effectiveness of this strategy for this problem is illustrated in an example.

Controlling charge on levitating drops.

PubMed

Hilger, Ryan T; Westphall, Michael S; Smith, Lloyd M

2007-08-01

Levitation technologies are used in containerless processing of materials, as microscale manipulators and reactors, and in the study of single drops and particles. Presented here is a method for controlling the amount and polarity of charge on a levitating drop. The method uses single-axis acoustic levitation to trap and levitate a single, initially neutral drop with a diameter between 400 microm and 2 mm. This drop is then charged in a controllable manner using discrete packets of charge in the form of charged drops produced by a piezoelectric drop-on-demand dispenser equipped with a charging electrode. The magnitude of the charge on the dispensed drops can be adjusted by varying the voltage applied to the charging electrode. The polarity of the charge on the added drops can be changed allowing removal of charge from the trapped drop (by neutralization) and polarity reversal. The maximum amount of added charge is limited by repulsion of like charges between the drops in the trap. This charging scheme can aid in micromanipulation and the study of charged drops and particles using levitation.

Controlled n-Type Doping of Carbon Nanotube Transistors by an Organorhodium Dimer.

PubMed

Geier, Michael L; Moudgil, Karttikay; Barlow, Stephen; Marder, Seth R; Hersam, Mark C

2016-07-13

Single-walled carbon nanotube (SWCNT) transistors are among the most developed nanoelectronic devices for high-performance computing applications. While p-type SWCNT transistors are easily achieved through adventitious adsorption of atmospheric oxygen, n-type SWCNT transistors require extrinsic doping schemes. Existing n-type doping strategies for SWCNT transistors suffer from one or more issues including environmental instability, limited carrier concentration modulation, undesirable threshold voltage control, and/or poor morphology. In particular, commonly employed benzyl viologen n-type doping layers possess large thicknesses, which preclude top-gate transistor designs that underlie high-density integrated circuit layouts. To overcome these limitations, we report here the controlled n-type doping of SWCNT thin-film transistors with a solution-processed pentamethylrhodocene dimer. The charge transport properties of organorhodium-treated SWCNT thin films show consistent n-type behavior when characterized in both Hall effect and thin-film transistor geometries. Due to the molecular-scale thickness of the organorhodium adlayer, large-area arrays of top-gated, n-type SWCNT transistors are fabricated with high yield. This work will thus facilitate ongoing efforts to realize high-density SWCNT integrated circuits.

Dexter - A one-dimensional code for calculating thermionic performance of long converters.

NASA Technical Reports Server (NTRS)

Sawyer, C. D.

1971-01-01

This paper describes a versatile code for computing the coupled thermionic electric-thermal performance of long thermionic converters in which the temperature and voltage variations cannot be neglected. The code is capable of accounting for a variety of external electrical connection schemes, coolant flow paths and converter failures by partial shorting. Example problem solutions are given.

Effects of Distributed Generation on Overcurrent Relay Coordination and an Adaptive Protection Scheme

NASA Astrophysics Data System (ADS)

Ilik, Semih C.; Arsoy, Aysen B.

2017-07-01

Integration of distributed generation (DG) such as renewable energy sources to electrical network becomes more prevalent in recent years. Grid connection of DG has effects on load flow directions, voltage profile, short circuit power and especially protection selectivity. Applying traditional overcurrent protection scheme is inconvenient when system reliability and sustainability are considered. If a fault happens in DG connected network, short circuit contribution of DG, creates additional branch element feeding the fault current; compels to consider directional overcurrent (OC) protection scheme. Protection coordination might get lost for changing working conditions when DG sources are connected. Directional overcurrent relay parameters are determined for downstream and upstream relays when different combinations of DG connected singular or plural, on radial test system. With the help of proposed flow chart, relay parameters are updated and coordination between relays kept sustained for different working conditions in DigSILENT PowerFactory program.

A Charge-Based Low-Power High-SNR Capacitive Sensing Interface Circuit

PubMed Central

Peng, Sheng-Yu; Qureshi, Muhammad S.; Hasler, Paul E.; Basu, Arindam; Degertekin, F. L.

2008-01-01

This paper describes a low-power approach to capacitive sensing that achieves a high signal-to-noise ratio. The circuit is composed of a capacitive feedback charge amplifier and a charge adaptation circuit. Without the adaptation circuit, the charge amplifier only consumes 1 μW to achieve the audio band SNR of 69.34dB. An adaptation scheme using Fowler-Nordheim tunneling and channel hot electron injection mechanisms to stabilize the DC output voltage is demonstrated. This scheme provides a very low frequency pole at 0.2Hz. The measured noise spectrums show that this slow-time scale adaptation does not degrade the circuit performance. The DC path can also be provided by a large feedback resistance without causing extra power consumption. A charge amplifier with a MOS-bipolar pseudo-resistor feedback scheme is interfaced with a capacitive micromachined ultrasonic transducer to demonstrate the feasibility of this approach for ultrasound applications. PMID:18787650

An implementation of particle swarm optimization to evaluate optimal under-voltage load shedding in competitive electricity markets

NASA Astrophysics Data System (ADS)

Hosseini-Bioki, M. M.; Rashidinejad, M.; Abdollahi, A.

2013-11-01

Load shedding is a crucial issue in power systems especially under restructured electricity environment. Market-driven load shedding in reregulated power systems associated with security as well as reliability is investigated in this paper. A technoeconomic multi-objective function is introduced to reveal an optimal load shedding scheme considering maximum social welfare. The proposed optimization problem includes maximum GENCOs and loads' profits as well as maximum loadability limit under normal and contingency conditions. Particle swarm optimization (PSO) as a heuristic optimization technique, is utilized to find an optimal load shedding scheme. In a market-driven structure, generators offer their bidding blocks while the dispatchable loads will bid their price-responsive demands. An independent system operator (ISO) derives a market clearing price (MCP) while rescheduling the amount of generating power in both pre-contingency and post-contingency conditions. The proposed methodology is developed on a 3-bus system and then is applied to a modified IEEE 30-bus test system. The obtained results show the effectiveness of the proposed methodology in implementing the optimal load shedding satisfying social welfare by maintaining voltage stability margin (VSM) through technoeconomic analyses.

Research on the Control Strategy for Grid-side Converter of PWM Doubly Fed Induction Wind Power Generators

NASA Astrophysics Data System (ADS)

Liu, Yifang; Wang, Zhijie; Li, Renfu; Jiang, Xiuchen; Sheng, Gehao; Liu, Tianyu; Liu, Sanming

2017-05-01

When the grid voltage drop, over current of transient rotor and over voltage may damage the power electronic devices. The attenuation of electromagnetic torque will lead to speed up. This paper proposes an improved feed-forward control strategy and its application in the PWM converter. When the PWM converter on voltage drops, bus voltage will be more stable. So over current problems of the DFIG rotor side can be reduced, and it also can improve voltage regulation speed of the DC bus voltage and reduce the oscillation amplitude. Furthermore, the stability of doubly fed wind generator system can be improved. The simulation results verify the validity of the modified control strategy.

I/O impedance controller

DOEpatents

Ruesch, Rodney; Jenkins, Philip N.; Ma, Nan

2004-03-09

There is disclosed apparatus and apparatus for impedance control to provide for controlling the impedance of a communication circuit using an all-digital impedance control circuit wherein one or more control bits are used to tune the output impedance. In one example embodiment, the impedance control circuit is fabricated using circuit components found in a standard macro library of a computer aided design system. According to another example embodiment, there is provided a control for an output driver on an integrated circuit ("IC") device to provide for forming a resistor divider network with the output driver and a resistor off the IC device so that the divider network produces an output voltage, comparing the output voltage of the divider network with a reference voltage, and adjusting the output impedance of the output driver to attempt to match the output voltage of the divider network and the reference voltage. Also disclosed is over-sampling the divider network voltage, storing the results of the over sampling, repeating the over-sampling and storing, averaging the results of multiple over sampling operations, controlling the impedance with a plurality of bits forming a word, and updating the value of the word by only one least significant bit at a time.

Control voltage and power fluctuations when connecting wind farms

NASA Astrophysics Data System (ADS)

Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana

2015-12-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

An 11-bit 200 MS/s subrange SAR ADC with low-cost integrated reference buffer

NASA Astrophysics Data System (ADS)

He, Xiuju; Gu, Xian; Li, Weitao; Jiang, Hanjun; Li, Fule; Wang, Zhihua

2017-10-01

This paper presents an 11-bit 200 MS/s subrange SAR ADC with an integrated reference buffer in 65 nm CMOS. The proposed ADC employs a 3.5-bit flash ADC for coarse conversion, and a compact timing scheme at the flash/SAR boundary to speed up the conversion. The flash decision is used to control charge compensating for the reference voltage to reduce its input-dependent fluctuation. Measurement results show that the fabricated ADC has achieved significant improvement by applying the reference charge compensation. In addition, the ADC achieves a maximum signal-to-noise-and-distortion ratio of 59.3 dB at 200 MS/s. It consumes 3.91 mW from a 1.2 V supply, including the reference buffer. Project supported by the Zhongxing Telecommunication Equipment Corporation and Beijing Microelectronics Technology Institute.

Voltage droop Coordinating Control applied in UPFC and STATCOM system

NASA Astrophysics Data System (ADS)

Junhui, Huang; Zhuyi, Peng; Chengjie, Ni; Yiqing, Xu; Jiliang, Xue

2018-04-01

When UPFC, unified power flow controller is applied with other FACTS into power grid, it is possible that the voltage controlled vibrates constantly to response to a sudden reactive power turbulent in grid if the parameters of these FACTS are not coordinating reasonably. Moreover, the reactive power generated by these equipment will intertwine unexpectedly. The article proposes a method named voltage-reactive power droop control to allow the reference voltage fluctuating around the rating voltage so that the vibration is reduced and the power distribution is improved. Finally, the article cite a electric-magnetic simulation by EMTDC models of east-China power grid to prove it effective when applied to improve the response characteristics to sudden turbulence in power grid.

Simulation of temperature field for temperature-controlled radio frequency ablation using a hyperbolic bioheat equation and temperature-varied voltage calibration: a liver-mimicking phantom study.

PubMed

Zhang, Man; Zhou, Zhuhuang; Wu, Shuicai; Lin, Lan; Gao, Hongjian; Feng, Yusheng

2015-12-21

This study aims at improving the accuracy of temperature simulation for temperature-controlled radio frequency ablation (RFA). We proposed a new voltage-calibration method in the simulation and investigated the feasibility of a hyperbolic bioheat equation (HBE) in the RFA simulation with longer durations and higher power. A total of 40 RFA experiments was conducted in a liver-mimicking phantom. Four mathematical models with multipolar electrodes were developed by the finite element method in COMSOL software: HBE with/without voltage calibration, and the Pennes bioheat equation (PBE) with/without voltage calibration. The temperature-varied voltage calibration used in the simulation was calculated from an experimental power output and temperature-dependent resistance of liver tissue. We employed the HBE in simulation by considering the delay time τ of 16 s. First, for simulations by each kind of bioheat equation (PBE or HBE), we compared the differences between the temperature-varied voltage-calibration and the fixed-voltage values used in the simulations. Then, the comparisons were conducted between the PBE and the HBE in the simulations with temperature-varied voltage calibration. We verified the simulation results by experimental temperature measurements on nine specific points of the tissue phantom. The results showed that: (1) the proposed voltage-calibration method improved the simulation accuracy of temperature-controlled RFA for both the PBE and the HBE, and (2) for temperature-controlled RFA simulation with the temperature-varied voltage calibration, the HBE method was 0.55 °C more accurate than the PBE method. The proposed temperature-varied voltage calibration may be useful in temperature field simulations of temperature-controlled RFA. Besides, the HBE may be used as an alternative in the simulation of long-duration high-power RFA.

NREL Studies Voltage Regulation Strategies for Hawaiian Electric Companies

Science.gov Websites

, electric vehicles, and electric water heater control to understand their potential in supporting voltage locally. Meanwhile, NREL has also completed a pilot inverter control study, in which data from advanced voltage regulation, such as battery storage, water heater control, and electric vehicles, will be done

Characterization of Sensitivity Encoded Silicon Photomultiplier (SeSP) with 1-Dimensional and 2-Dimensional Encoding for High Resolution PET/MR

NASA Astrophysics Data System (ADS)

Omidvari, Negar; Schulz, Volkmar

2015-06-01

This paper evaluates the performance of a new type of PET detectors called sensitivity encoded silicon photomultiplier (SeSP), which allows a direct coupling of small-pitch crystal arrays to the detector with a reduction in the number of readout channels. Four SeSP devices with two separate encoding schemes of 1D and 2D were investigated in this study. Furthermore, both encoding schemes were manufactured in two different sizes of 4 ×4 mm2 and 7. 73 ×7. 9 mm2, in order to investigate the effect of size on detector parameters. All devices were coupled to LYSO crystal arrays with 1 mm pitch size and 10 mm height, with optical isolation between crystals. The characterization was done for the key parameters of crystal-identification, energy resolution, and time resolution as a function of triggering threshold and over-voltage (OV). Position information was archived using the center of gravity (CoG) algorithm and a least squares approach (LSQA) in combination with a mean light matrix around the photo-peak. The positioning results proved the capability of all four SeSP devices in precisely identifying all crystals coupled to the sensors. Energy resolution was measured at different bias voltages, varying from 12% to 18% (FWHM) and paired coincidence time resolution (pCTR) of 384 ps to 1.1 ns was obtained for different SeSP devices at about 18 °C room temperature. However, the best time resolution was achieved at the highest over-voltage, resulting in a noise ratio of 99.08%.

Dynamic performance of high speed solenoid valve with parallel coils

NASA Astrophysics Data System (ADS)

Kong, Xiaowu; Li, Shizhen

2014-07-01

The methods of improving the dynamic performance of high speed on/off solenoid valve include increasing the magnetic force of armature and the slew rate of coil current, decreasing the mass and stroke of moving parts. The increase of magnetic force usually leads to the decrease of current slew rate, which could increase the delay time of the dynamic response of solenoid valve. Using a high voltage to drive coil can solve this contradiction, but a high driving voltage can also lead to more cost and a decrease of safety and reliability. In this paper, a new scheme of parallel coils is investigated, in which the single coil of solenoid is replaced by parallel coils with same ampere turns. Based on the mathematic model of high speed solenoid valve, the theoretical formula for the delay time of solenoid valve is deduced. Both the theoretical analysis and the dynamic simulation show that the effect of dividing a single coil into N parallel sub-coils is close to that of driving the single coil with N times of the original driving voltage as far as the delay time of solenoid valve is concerned. A specific test bench is designed to measure the dynamic performance of high speed on/off solenoid valve. The experimental results also prove that both the delay time and switching time of the solenoid valves can be decreased greatly by adopting the parallel coil scheme. This research presents a simple and practical method to improve the dynamic performance of high speed on/off solenoid valve.

An Automatic Networking and Routing Algorithm for Mesh Network in PLC System

NASA Astrophysics Data System (ADS)

Liu, Xiaosheng; Liu, Hao; Liu, Jiasheng; Xu, Dianguo

2017-05-01

Power line communication (PLC) is considered to be one of the best communication technologies in smart grid. However, the topology of low voltage distribution network is complex, meanwhile power line channel has characteristics of time varying and attenuation, which lead to the unreliability of power line communication. In this paper, an automatic networking and routing algorithm is introduced which can be adapted to the "blind state" topology. The results of simulation and test show that the scheme is feasible, the routing overhead is small, and the load balance performance is good, which can achieve the establishment and maintenance of network quickly and effectively. The scheme is of great significance to improve the reliability of PLC.

Modular apparatus for electrostatic actuation of common atomic force microscope cantilevers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, Christian J., E-mail: christian.long@nist.gov; Maryland Nanocenter, University of Maryland, College Park, Maryland 20742; Cannara, Rachel J.

2015-07-15

Piezoelectric actuation of atomic force microscope (AFM) cantilevers often suffers from spurious mechanical resonances in the loop between the signal driving the cantilever and the actual tip motion. These spurious resonances can reduce the accuracy of AFM measurements and in some cases completely obscure the cantilever response. To address these limitations, we developed a specialized AFM cantilever holder for electrostatic actuation of AFM cantilevers. The holder contains electrical contacts for the AFM cantilever chip, as well as an electrode (or electrodes) that may be precisely positioned with respect to the back of the cantilever. By controlling the voltages on themore » AFM cantilever and the actuation electrode(s), an electrostatic force is applied directly to the cantilever, providing a near-ideal transfer function from drive signal to tip motion. We demonstrate both static and dynamic actuations, achieved through the application of direct current and alternating current voltage schemes, respectively. As an example application, we explore contact resonance atomic force microscopy, which is a technique for measuring the mechanical properties of surfaces on the sub-micron length scale. Using multiple electrodes, we also show that the torsional resonances of the AFM cantilever may be excited electrostatically, opening the door for advanced dynamic lateral force measurements with improved accuracy and precision.« less

A parametric study of motor starting for a 2- to 10-kilowatt Brayton power system

NASA Technical Reports Server (NTRS)

Cantoni, D. A.

1971-01-01

A study of the motor starting of a Brayton cycle power system was conducted to provide estimates of system sensitivity to several controllable parameters. These sensitivity estimates were used as a basis for selection of an optimum motor-start scheme to be implemented on the 2- to 10-kilowatt Brayton power system designed and presently under test. The studies were conducted with an analog simulation of the Brayton power system and covered a range of frequencies from 400 Hz (33 percent design) to 1200 Hz (design), voltage-to-frequency ratios of 0.050 (50 percent design) to 0.100 (design), turbine-inlet temperatures of 800 K (1440 R, 70 percent design) to 1140 K (2060 deg R, design), and prestart pressure levels of 14.5 psia to 29.0 psia. These studies have shown the effect of selected system variables on motor starting. The final selection of motor-start variables can therefore be made on the basis of motor-start inverter complexity, battery size and weight, desired steady-state pressure level after startup, and other operational limitations. In general, the study showed the time required for motor starting to be inversely proportional to motor frequency, voltage, turbine-inlet temperature, and pressure level. An increase in any of these parameters decreases startup time.

GaN-based metamaterial terahertz bandpass filter design: tunability and ultra-broad passband attainment.

PubMed

Khodaee, M; Banakermani, M; Baghban, H

2015-10-10

Engineering metamaterial-based devices such as terahertz bandpass filters (BPFs) play a definitive role in advancement of terahertz technology. In this article, we propose a design procedure to obtain a considerably broadband terahertz BPF at a normal incidence; it shows promising filtering characteristics, including a wide passband of ∼1.34  THz at a central frequency of 1.17 THz, a flat top in a broad band, and high transmission, compared to previous reports. Then, exploiting the voltage-dependent carrier density control in an AlGaN/GaN heterostructure with a Schottky gate configuration, we investigate the tuning of the transmission properties in a narrow-band terahertz filter. A combination of the ultra-wide, flat-top BPF in series with the tunable, narrow band filter designed in the current study offers the ability to tune the desired resonance frequency along with high out-of-band rejection and the suppression of unwanted resonances in a large spectral range. The proposed structure exhibits a frequency tunability of 103 GHz for a voltage change between -8 and 2 V, and a transmission amplitude change of ∼0.51. This scheme may open up a route for the improved design of terahertz filters and modulators.

Adaptive control system for pulsed megawatt klystrons

DOEpatents

Bolie, Victor W.

1992-01-01

The invention provides an arrangement for reducing waveform errors such as errors in phase or amplitude in output pulses produced by pulsed power output devices such as klystrons by generating an error voltage representing the extent of error still present in the trailing edge of the previous output pulse, using the error voltage to provide a stored control voltage, and applying the stored control voltage to the pulsed power output device to limit the extent of error in the leading edge of the next output pulse.

Cascaded resonant bridge converters

NASA Technical Reports Server (NTRS)

Stuart, Thomas A. (Inventor)

1989-01-01

A converter for converting a low voltage direct current power source to a higher voltage, high frequency alternating current output for use in an electrical system where it is desired to use low weight cables and other circuit elements. The converter has a first stage series resonant (Schwarz) converter which converts the direct current power source to an alternating current by means of switching elements that are operated by a variable frequency voltage regulator, a transformer to step up the voltage of the alternating current, and a rectifier bridge to convert the alternating current to a direct current first stage output. The converter further has a second stage series resonant (Schwarz) converter which is connected in series to the first stage converter to receive its direct current output and convert it to a second stage high frequency alternating current output by means of switching elements that are operated by a fixed frequency oscillator. The voltage of the second stage output is controlled at a relatively constant value by controlling the first stage output voltage, which is accomplished by controlling the frequency of the first stage variable frequency voltage controller in response to second stage voltage. Fault tolerance in the event of a load short circuit is provided by making the operation of the first stage variable frequency voltage controller responsive to first and second stage current limiting devices. The second stage output is connected to a rectifier bridge whose output is connected to the input of the second stage to provide good regulation of output voltage wave form at low system loads.

Tunable liquid crystal photonic devices

NASA Astrophysics Data System (ADS)

Fan, Yun-Hsing

2005-07-01

Liquid crystal (LC)-based adaptive optics are important for information processing, optical interconnections, photonics, integrated optics, and optical communications due to their tunable optical properties. In this dissertation, we describe novel liquid crystal photonic devices. In Chap. 3, we demonstrate a novel electrically tunable-efficiency Fresnel lens which is devised for the first time using nanoscale PDLC. The tunable Fresnel lens is very desirable to eliminate the need of external spatial light modulator. The nanoscale LC devices are polarization independent and exhibit a fast response time. Because of the small droplet sizes, the operating voltage is higher than 100 Vrms. To lower the driving voltage, in Chap. 2 and Chap. 3, we have investigated tunable Fresnel lens using polymer-network liquid crystal (PNLC) and phase-separated composite film (PSCOF). The operating voltage is below 12 Vrms. The PNLC and PSCOF devices are polarization dependent. To overcome this shortcoming, stacking two cells with orthogonal alignment directions is a possibility. Using PNLC, we also demonstrated LC blazed grating. The diffraction efficiency of these devices is continuously controlled by the electric field. We also develop a system with continuously tunable focal length. A conventional mechanical zooming system is bulky and power hungry. In Chap. 4, we developed an electrically tunable-focus flat LC spherical lens and microlens array. A huge tunable range from 0.6 m to infinity is achieved by the applied voltage. In Chap. 5, we describe a LC microlens array whose focal length can be switched from positive to negative by the applied voltage. The fast response time feature of our LC microlens array will be very helpful in developing 3-D animated images. In Chap. 6, we demonstrate polymer network liquid crystals for switchable polarizers and optical shutters. The use of dual-frequency liquid crystal and special driving scheme leads to a sub-millisecond response time. In Chap. 7, for the first time, we demonstrate a fast-response and scattering-free homogeneously-aligned PNLC light modulator. The PNLC response time is ˜300x faster than that of a pure LC mixture. The PNLC cell also holds promise for mid and long infrared applications where response time is a critical issue.

A Single-Phase Embedded Z-Source DC-AC Inverter

PubMed Central

Kim, Se-Jin; Lim, Young-Cheol

2014-01-01

In the conventional DC-AC inverter consisting of two DC-DC converters with unipolar output capacitors, the output capacitor voltages of the DC-DC converters must be higher than the DC input voltage. To overcome this weakness, this paper proposes a single-phase DC-AC inverter consisting of two embedded Z-source converters with bipolar output capacitors. The proposed inverter is composed of two embedded Z-source converters with a common DC source and output AC load. Though the output capacitor voltages of the converters are relatively low compared to those of a conventional inverter, an equivalent level of AC output voltages can be obtained. Moreover, by controlling the output capacitor voltages asymmetrically, the AC output voltage of the proposed inverter can be higher than the DC input voltage. To verify the validity of the proposed inverter, experiments were performed with a DC source voltage of 38 V. By controlling the output capacitor voltages of the converters symmetrically or asymmetrically, the proposed inverter can produce sinusoidal AC output voltages. The experiments show that efficiencies of up to 95% and 97% can be achieved with the proposed inverter using symmetric and asymmetric control, respectively. PMID:25133241

A single-phase embedded Z-source DC-AC inverter.

PubMed

Kim, Se-Jin; Lim, Young-Cheol

2014-01-01

In the conventional DC-AC inverter consisting of two DC-DC converters with unipolar output capacitors, the output capacitor voltages of the DC-DC converters must be higher than the DC input voltage. To overcome this weakness, this paper proposes a single-phase DC-AC inverter consisting of two embedded Z-source converters with bipolar output capacitors. The proposed inverter is composed of two embedded Z-source converters with a common DC source and output AC load. Though the output capacitor voltages of the converters are relatively low compared to those of a conventional inverter, an equivalent level of AC output voltages can be obtained. Moreover, by controlling the output capacitor voltages asymmetrically, the AC output voltage of the proposed inverter can be higher than the DC input voltage. To verify the validity of the proposed inverter, experiments were performed with a DC source voltage of 38 V. By controlling the output capacitor voltages of the converters symmetrically or asymmetrically, the proposed inverter can produce sinusoidal AC output voltages. The experiments show that efficiencies of up to 95% and 97% can be achieved with the proposed inverter using symmetric and asymmetric control, respectively.

Controllable Threshold Voltage in Organic Complementary Logic Circuits with an Electron-Trapping Polymer and Photoactive Gate Dielectric Layer.

PubMed

Dao, Toan Thanh; Sakai, Heisuke; Nguyen, Hai Thanh; Ohkubo, Kei; Fukuzumi, Shunichi; Murata, Hideyuki

2016-07-20

We present controllable and reliable complementary organic transistor circuits on a PET substrate using a photoactive dielectric layer of 6-[4'-(N,N-diphenylamino)phenyl]-3-ethoxycarbonylcoumarin (DPA-CM) doped into poly(methyl methacrylate) (PMMA) and an electron-trapping layer of poly(perfluoroalkenyl vinyl ether) (Cytop). Cu was used for a source/drain electrode in both the p-channel and n-channel transistors. The threshold voltage of the transistors and the inverting voltage of the circuits were reversibly controlled over a wide range under a program voltage of less than 10 V and under UV light irradiation. At a program voltage of -2 V, the inverting voltage of the circuits was tuned to be at nearly half of the supply voltage of the circuit. Consequently, an excellent balance between the high and low noise margins (NM) was produced (64% of NMH and 68% of NML), resulting in maximum noise immunity. Furthermore, the programmed circuits showed high stability, such as a retention time of over 10(5) s for the inverter switching voltage. Our findings bring about a flexible, simple way to obtain robust, high-performance organic circuits using a controllable complementary transistor inverter.

Analytical Approaches for Identification and Representation of Critical Protection Systems in Transient Stability Studies

NASA Astrophysics Data System (ADS)

Hedman, Mojdeh Khorsand

After a major disturbance, the power system response is highly dependent on protection schemes and system dynamics. Improving power systems situational awareness requires proper and simultaneous modeling of both protection schemes and dynamic characteristics in power systems analysis tools. Historical information and ex-post analysis of blackouts reaffirm the critical role of protective devices in cascading events, thereby confirming the necessity to represent protective functions in transient stability studies. This dissertation is aimed at studying the importance of representing protective relays in power system dynamic studies. Although modeling all of the protective relays within transient stability studies may result in a better estimation of system behavior, representing, updating, and maintaining the protection system data becomes an insurmountable task. Inappropriate or outdated representation of the relays may result in incorrect assessment of the system behavior. This dissertation presents a systematic method to determine essential relays to be modeled in transient stability studies. The desired approach should identify protective relays that are critical for various operating conditions and contingencies. The results of the transient stability studies confirm that modeling only the identified critical protective relays is sufficient to capture system behavior for various operating conditions and precludes the need to model all of the protective relays. Moreover, this dissertation proposes a method that can be implemented to determine the appropriate location of out-of-step blocking relays. During unstable power swings, a generator or group of generators may accelerate or decelerate leading to voltage depression at the electrical center along with generator tripping. This voltage depression may cause protective relay mis-operation and unintentional separation of the system. In order to avoid unintentional islanding, the potentially mis-operating relays should be blocked from tripping with the use of out-of-step blocking schemes. Blocking these mis-operating relays, combined with an appropriate islanding scheme, help avoid a system wide collapse. The proposed method is tested on data from the Western Electricity Coordinating Council. A triple line outage of the California-Oregon Intertie is studied. The results show that the proposed method is able to successfully identify proper locations of out-of-step blocking scheme.

Research to Assembly Scheme for Satellite Deck Based on Robot Flexibility Control Principle

NASA Astrophysics Data System (ADS)

Guo, Tao; Hu, Ruiqin; Xiao, Zhengyi; Zhao, Jingjing; Fang, Zhikai

2018-03-01

Deck assembly is critical quality control point in final satellite assembly process, and cable extrusion and structure collision problems in assembly process will affect development quality and progress of satellite directly. Aimed at problems existing in deck assembly process, assembly project scheme for satellite deck based on robot flexibility control principle is proposed in this paper. Scheme is introduced firstly; secondly, key technologies on end force perception and flexible docking control in the scheme are studied; then, implementation process of assembly scheme for satellite deck is described in detail; finally, actual application case of assembly scheme is given. Result shows that compared with traditional assembly scheme, assembly scheme for satellite deck based on robot flexibility control principle has obvious advantages in work efficiency, reliability and universality aspects etc.

ELECTRICAL CIRCUITS USING COLD-CATHODE TRIODE VALVES

DOEpatents

Goulding, F.S.

1957-11-26

An electrical circuit which may be utilized as a pulse generator or voltage stabilizer is presented. The circuit employs a cold-cathode triode valve arranged to oscillate between its on and off stages by the use of selected resistance-capacitance time constant components in the plate and trigger grid circuits. The magnitude of the d-c voltage applied to the trigger grid circuit effectively controls the repetition rate of the output pulses. In the voltage stabilizer arrangement the d-c control voltage is a portion of the supply voltage and the rectified output voltage is substantially constant.

Experimental Verification of a Dynamic Voltage Restorer Capable of Significantly Reducing an Energy-Storage Element

NASA Astrophysics Data System (ADS)

Jimichi, Takushi; Fujita, Hideaki; Akagi, Hirofumi

This paper deals with a dynamic voltage restorer (DVR) characterized by installing the shunt converter at the load side. The DVR can compensate for the load voltage when a voltage sag appears in the supply voltage. An existing DVR requires a large capacitor bank or other energy-storage elements such as double-layer capacitors or batteries. The DVR presented in this paper requires only a small dc capacitor intended for smoothing the dc-link voltage. Moreover, three control methods for the series converter are compared and discussed to reduce the series-converter rating, paying attention to the zero-sequence voltages included in the supply voltage and the compensating voltage. Experimental results obtained from a 200-V, 5-kW laboratory system are shown to verify the viability of the system configuration and the control methods.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shepard, Kenneth L.; Sturcken, Noah Andrew

Power controller includes an output terminal having an output voltage, at least one clock generator to generate a plurality of clock signals and a plurality of hardware phases. Each hardware phase is coupled to the at least one clock generator and the output terminal and includes a comparator. Each hardware phase is configured to receive a corresponding one of the plurality of clock signals and a reference voltage, combine the corresponding clock signal and the reference voltage to produce a reference input, generate a feedback voltage based on the output voltage, compare the reference input and the feedback voltage usingmore » the comparator and provide a comparator output to the output terminal, whereby the comparator output determines a duty cycle of the power controller. An integrated circuit including the power controller is also provided.« less

Hybrid Method for Power Control Simulation of a Single Fluid Plasma Thruster

NASA Astrophysics Data System (ADS)

Jaisankar, S.; Sheshadri, T. S.

2018-05-01

Propulsive plasma flow through a cylindrical-conical diverging thruster is simulated by a power controlled hybrid method to obtain the basic flow, thermodynamic and electromagnetic variables. Simulation is based on a single fluid model with electromagnetics being described by the equations of potential Poisson, Maxwell and the Ohm's law while the compressible fluid dynamics by the Navier Stokes in cylindrical form. The proposed method solved the electromagnetics and fluid dynamics separately, both to segregate the two prominent scales for an efficient computation and for the delivery of voltage controlled rated power. The magnetic transport is solved for steady state while fluid dynamics is allowed to evolve in time along with an electromagnetic source using schemes based on generalized finite difference discretization. The multistep methodology with power control is employed for simulating fully ionized propulsive flow of argon plasma through the thruster. Numerical solution shows convergence of every part of the solver including grid stability causing the multistep hybrid method to converge for a rated power delivery. Simulation results are reasonably in agreement with the reported physics of plasma flow in the thruster thus indicating the potential utility of this hybrid computational framework, especially when single fluid approximation of plasma is relevant.

Power conversion and control methods for renewable energy sources

NASA Astrophysics Data System (ADS)

Yu, Dachuan

2005-07-01

In recent years, there has been an increase in the use of renewable energy due to the growing concern over the pollution caused by fossil-fuel-based energy. Renewable energy sources, such as photovoltaic (PV) and fuel cell, can be used to enhance the safety, reliability, sustainability, and transmission efficiency of a power system. This dissertation focuses on the power conversion and control for two major renewable-energy sources: PV and fuel cell. Firstly, a current-based, maximum power-point tracking (MPPT) algorithm is proposed for PV energy. An economical converter system using the above scheme for converting the output from PV panels into 60 Hz AC voltage is developed and built. Secondly, a novel circuit model for the Proton Exchange Membrane (PEM) fuel-cell stack that is useful in the design and analysis of fuel-cell-based power systems is proposed. This Pspice-based model uses elements available in the Pspice library with some modifications to represent both the static and dynamic responses of a PEM fuel-cell module. The accuracy of the model is verified by comparing the simulation and experimental results. Thirdly, a DSP-controlled three-phase induction-motor drive using constant voltage over frequency is built and can be used in a fuel-cell automobile. A hydrogen sensor is used in the drive to both sound an alarm and shut down the inverter trigger pulses through the DSP. Finally, a hybrid power system consisting of PV panels and fuel cell is proposed and built. In the proposed system, PV panels can supply most of the power when the sunlight is available, and the excess power required by the load is supplied by a fuel cell. Load sharing between a fuel cell (FC) and the PV panel is investigated by both simulation and experiments.

Molecular electronics in pinnae of Mimosa pudica

PubMed Central

Foster, Justin C; Markin, Vladislav S

2010-01-01

Bioelectrochemical circuits operate in all plants including the sensitive plant Mimosa pudica Linn. The activation of biologically closed circuits with voltage gated ion channels can lead to various mechanical, hydrodynamical, physiological, biochemical and biophysical responses. Here the biologically closed electrochemical circuit in pinnae of Mimosa pudica is analyzed using the charged capacitor method for electrostimulation at different voltages. Also the equivalent electrical scheme of electrical signal transduction inside the plant's pinna is evaluated. These circuits remain linear at small potentials not exceeding 0.5 V. At higher potentials the circuits become strongly non-linear pointing to the opening of ion channels in plant tissues. Changing the polarity of electrodes leads to a strong rectification effect and to different kinetics of a capacitor. These effects can be caused by a redistribution of K+, Cl−, Ca2+ and H+ ions through voltage gated ion channels. The electrical properties of Mimosa pudica were investigated and equivalent electrical circuits within the pinnae were proposed to explain the experimental data. PMID:20448476

Molecular electronics in pinnae of Mimosa pudica.

PubMed

Volkov, Alexander G; Foster, Justin C; Markin, Vladislav S

2010-07-01

Bioelectrochemical circuits operate in all plants including the sensitive plant Mimosa pudica Linn. The activation of biologically closed circuits with voltage gated ion channels can lead to various mechanical, hydrodynamical, physiological, biochemical, and biophysical responses. Here the biologically closed electrochemical circuit in pinnae of Mimosa pudica is analyzed using the charged capacitor method for electrostimulation at different voltages. Also the equivalent electrical scheme of electrical signal transduction inside the plant's pinna is evaluated. These circuits remain linear at small potentials not exceeding 0.5 V. At higher potentials the circuits become strongly non-linear pointing to the opening of ion channels in plant tissues. Changing the polarity of electrodes leads to a strong rectification effect and to different kinetics of a capacitor. These effects can be caused by a redistribution of K(+), Cl(-), Ca(2+), and H(+) ions through voltage gated ion channels. The electrical properties of Mimosa pudica were investigated and equivalent electrical circuits within the pinnae were proposed to explain the experimental data.

Mechanisms underlying subunit independence in pyramidal neuron dendrites

PubMed Central

Behabadi, Bardia F.; Mel, Bartlett W.

2014-01-01

Pyramidal neuron (PN) dendrites compartmentalize voltage signals and can generate local spikes, which has led to the proposal that their dendrites act as independent computational subunits within a multilayered processing scheme. However, when a PN is strongly activated, back-propagating action potentials (bAPs) sweeping outward from the soma synchronize dendritic membrane potentials many times per second. How PN dendrites maintain the independence of their voltage-dependent computations, despite these repeated voltage resets, remains unknown. Using a detailed compartmental model of a layer 5 PN, and an improved method for quantifying subunit independence that incorporates a more accurate model of dendritic integration, we first established that the output of each dendrite can be almost perfectly predicted by the intensity and spatial configuration of its own synaptic inputs, and is nearly invariant to the rate of bAP-mediated “cross-talk” from other dendrites over a 100-fold range. Then, through an analysis of conductance, voltage, and current waveforms within the model cell, we identify three biophysical mechanisms that together help make independent dendritic computation possible in a firing neuron, suggesting that a major subtype of neocortical neuron has been optimized for layered, compartmentalized processing under in-vivo–like spiking conditions. PMID:24357611

Incentive-Based Voltage Regulation in Distribution Networks: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Xinyang; Chen, Lijun; Dall'Anese, Emiliano

This paper considers distribution networks fea- turing distributed energy resources, and designs incentive-based mechanisms that allow the network operator and end-customers to pursue given operational and economic objectives, while concurrently ensuring that voltages are within prescribed limits. Two different network-customer coordination mechanisms that require different amounts of information shared between the network operator and end-customers are developed to identify a solution of a well-defined social-welfare maximization prob- lem. Notably, the signals broadcast by the network operator assume the connotation of prices/incentives that induce the end- customers to adjust the generated/consumed powers in order to avoid the violation of the voltagemore » constraints. Stability of the proposed schemes is analytically established and numerically corroborated.« less

Incentive-Based Voltage Regulation in Distribution Networks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dall-Anese, Emiliano; Baker, Kyri A; Zhou, Xinyang

This paper considers distribution networks fea- turing distributed energy resources, and designs incentive-based mechanisms that allow the network operator and end-customers to pursue given operational and economic objectives, while concurrently ensuring that voltages are within prescribed limits. Two different network-customer coordination mechanisms that require different amounts of information shared between the network operator and end-customers are developed to identify a solution of a well-defined social-welfare maximization prob- lem. Notably, the signals broadcast by the network operator assume the connotation of prices/incentives that induce the end- customers to adjust the generated/consumed powers in order to avoid the violation of the voltagemore » constraints. Stability of the proposed schemes is analytically established and numerically corroborated.« less

Input-current shaped ac to dc converters

NASA Technical Reports Server (NTRS)

1986-01-01

The problem of achieving near unity power factor while supplying power to a dc load from a single phase ac source of power is examined. Power processors for this application must perform three functions: input current shaping, energy storage, and output voltage regulation. The methods available for performing each of these three functions are reviewed. Input current shaping methods are either active or passive, with the active methods divided into buck-like and boost-like techniques. In addition to large reactances, energy storage methods include resonant filters, active filters, and active storage schemes. Fast voltage regulation can be achieved by post regulation or by supplementing the current shaping topology with an extra switch. Some indications of which methods are best suited for particular applications concludes the discussion.

Harmonic Optimization in Voltage Source Inverter for PV Application using Heuristic Algorithms

NASA Astrophysics Data System (ADS)

Kandil, Shaimaa A.; Ali, A. A.; El Samahy, Adel; Wasfi, Sherif M.; Malik, O. P.

2016-12-01

Selective Harmonic Elimination (SHE) technique is the fundamental switching frequency scheme that is used to eliminate specific order harmonics. Its application to minimize low order harmonics in a three level inverter is proposed in this paper. The modulation strategy used here is SHEPWM and the nonlinear equations, that characterize the low order harmonics, are solved using Harmony Search Algorithm (HSA) to obtain the optimal switching angles that minimize the required harmonics and maintain the fundamental at the desired value. Total Harmonic Distortion (THD) of the output voltage is minimized maintaining selected harmonics within allowable limits. A comparison has been drawn between HSA, Genetic Algorithm (GA) and Newton Raphson (NR) technique using MATLAB software to determine the effectiveness of getting optimized switching angles.

Three-Level 48-Pulse STATCOM with Pulse Width Modulation

NASA Astrophysics Data System (ADS)

Singh, Bhim; Srinivas, Kadagala Venkata

2016-03-01

In this paper, a new control strategy of a three-level 48-pulse static synchronous compensator (STATCOM) is proposed with a constant dc link voltage and pulse width modulation at fundamental frequency switching. The proposed STATCOM is realized using eight units of three-level voltage source converters (VSCs) to form a three-level 48-pulse STATCOM. The conduction angle of each three-level VSC is modulated to control the ac converter output voltage, which controls the reactive power of the STATCOM. A fuzzy logic controller is used to control the STATCOM. The dynamic performance of the STATCOM is studied for the control of the reference reactive power, the reference terminal voltage and under the switching of inductive and capacitive loads.

DEXTER: A one-dimensional code for calculating thermionic performance of long converters

NASA Technical Reports Server (NTRS)

Sawyer, C. D.

1971-01-01

A versatile code is described for computing the coupled thermionic electric-thermal performance of long thermionic converters in which the temperature and voltage variations cannot be neglected. The code is capable of accounting for a variety of external electrical connection schemes, coolant flow paths and converter failures by partial shorting. Example problem solutions are included along with a user's manual.

ELECTRONIC MULTIPLIER

DOEpatents

Collier, D.M.; Meeks, L.A.; Palmer, J.P.

1961-01-31

S>An electronic multiplier is described for use in analog computers. Two electrical input signals are received; one controls the slope of a saw-tooth voltage wave while the other controls the time duration of the wave. A condenser and diode clamps are provided to sustain the crest voltage reached by the wave, and for storing that voltage to provide an output signal which is a steady d-c voltage.

Modeling, Development and Control of Multilevel Converters for Power System Application =

NASA Astrophysics Data System (ADS)

Vahedi, Hani

The main goal of this project is to develop a multilevel converter topology to be useful in power system applications. Although many topologies are introduced rapidly using a bunch of switches and isolated dc sources, having a single-dc-source multilevel inverter is still a matter of controversy. In fact, each isolated dc source means a bulky transformer and a rectifier that have their own losses and costs forcing the industries to avoid entering in this topic conveniently. On the other hand, multilevel inverters topologies with single-dc-source require associated controllers to regulate the dc capacitors voltages in order to have multilevel voltage waveform at the output. Thus, a complex controller would not interest investors properly. Consequently, developing a single-dc-source multilevel inverter topology along with a light and reliable voltage control is still a challenging topic to replace the 2-level inverters in the market effectively. The first effort in this project was devoted to the PUC7 inverter to design a simple and yet efficient controller. A new modelling is performed on the PUC7 inverter and it has been simplified to first order system. Afterwards, a nonlinear cascaded controller is designed and applied to regulate the capacitor voltage at 1/3 of the DC source amplitude and to generate 7 identical voltage levels at the output supplying different type of loads such as RL or rectifier harmonic ones. In next work, the PUC5 topology is proposed as a remedy to the PUC7 that requires a complicated controller to operate properly. The capacitor voltage is regulated at half of dc source amplitude to generate 5 voltage levels at the output. Although the 7-level voltage waveform is replaced by a 5-level one in PUC5 topology, it is shown that the PUC5 needs a very simple and reliable voltage balancing technique due to having some redundant switching states. Moreover, a sensor-less voltage balancing technique is designed and implemented on the PUC5 inverter successfully to work in both stand-alone and gridconnected mode of operation. Eventually, a modified configuration of the PUC5 topology is presented to work as a buck PFC rectifier. The internal performance of the rectifier is like a buck converter to generate stepped down DC voltages at the two output terminals while the grid sees a boost converter externally. As well, a decoupled voltage/current controller is designed and applied to balance the output voltages identically and synchronize the input current with grid voltage to have a PFC operation acceptably. A power balance analysis is done to show the load variation range limit. All the theoretical and simulation studies are validated by experimental results completely.

A digitally assisted, signal folding neural recording amplifier.

PubMed

Chen, Yi; Basu, Arindam; Liu, Lei; Zou, Xiaodan; Rajkumar, Ramamoorthy; Dawe, Gavin Stewart; Je, Minkyu

2014-08-01

A novel signal folding and reconstruction scheme for neural recording applications that exploits the 1/f(n) characteristics of neural signals is described in this paper. The amplified output is 'folded' into a predefined range of voltages by using comparison and reset circuits along with the core amplifier. After this output signal is digitized and transmitted, a reconstruction algorithm can be applied in the digital domain to recover the amplified signal from the folded waveform. This scheme enables the use of an analog-to-digital convertor with less number of bits for the same effective dynamic range. It also reduces the transmission data rate of the recording chip. Both of these features allow power and area savings at the system level. Other advantages of the proposed topology are increased reliability due to the removal of pseudo-resistors, lower harmonic distortion and low-voltage operation. An analysis of the reconstruction error introduced by this scheme is presented along with a behavioral model to provide a quick estimate of the post reconstruction dynamic range. Measurement results from two different core amplifier designs in 65 nm and 180 nm CMOS processes are presented to prove the generality of the proposed scheme in the neural recording applications. Operating from a 1 V power supply, the amplifier in 180 nm CMOS has a gain of 54.2 dB, bandwidth of 5.7 kHz, input referred noise of 3.8 μVrms and power dissipation of 2.52 μW leading to a NEF of 3.1 in spike band. It exhibits a dynamic range of 66 dB and maximum SNDR of 43 dB in LFP band. It also reduces system level power (by reducing the number of bits in the ADC by 2) as well as data rate to 80% of a conventional design. In vivo measurements validate the ability of this amplifier to simultaneously record spike and LFP signals.

Hybrid inverter for HVDC/weak AC system interconnection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, K.S.

1985-01-01

The concept of the hybrid converter is introduced. By independently controlling a naturally commutated converter (NCC) and an artificially commutated converter (ACC), real power and reactive power can be controlled independently. Alternatively, the ac bus voltage can be regulated without affecting the real power transfer. Independent control is feasible only within certain operating boundaries. Twelve pulse operation, sequential control, and complementary circuits may be viewed as variations of the hybrid converter. The concept of the hybrid converter is demonstrated by digital simulation. At the current state of technology, the NCC is best implemented by a 6-pulse bridge using thyristors asmore » the switching elements. A survey of power electronics applicable to HVDC applications reveals that the capacitively commutated current-sourced converters are either technically or economically better than the other alternatives for the implementation of the ACC. The digital simulation results show that the problems of operating an HVDC system into a weak ac system can be solved by using a hybrid inverter. A new control scheme, the zero Q control, is developed. With no reactive power interaction between the dc system and the ac system, the stability of the HVDC/weak ac system operation is significantly improved. System start-up and fault recovery is fast and stable.« less

Dynamic power flow controllers

DOEpatents

Divan, Deepakraj M.; Prasai, Anish

2017-03-07

Dynamic power flow controllers are provided. A dynamic power flow controller may comprise a transformer and a power converter. The power converter is subject to low voltage stresses and not floated at line voltage. In addition, the power converter is rated at a fraction of the total power controlled. A dynamic power flow controller controls both the real and the reactive power flow between two AC sources having the same frequency. A dynamic power flow controller inserts a voltage with controllable magnitude and phase between two AC sources; thereby effecting control of active and reactive power flows between two AC sources.

Improved Control of Charging Voltage for Li-Ion Battery

NASA Technical Reports Server (NTRS)

Timmerman, Paul; Bugga, Ratnakumar

2006-01-01

The protocol for charging a lithium-ion battery would be modified, according to a proposal, to compensate for the internal voltage drop (charging current internal resistance of the battery). The essence of the modification is to provide for measurement of the internal voltage drop and to increase the terminal-voltage setting by the amount of the internal voltage drop. Ordinarily, a lithium-ion battery is charged at constant current until its terminal voltage attains a set value equal to the nominal full-charge potential. The set value is chosen carefully so as not to exceed the lithium-plating potential, because plated lithium in metallic form constitutes a hazard. When the battery is charged at low temperature, the internal voltage drop is considerable because the electrical conductivity of the battery electrolyte is low at low temperature. Charging the battery at high current at any temperature also gives rise to a high internal voltage drop. In some cases, the internal voltage drop can be as high as 1 volt per cell. Because the voltage available for charging is less than the terminal voltage by the amount of the internal voltage drop, the battery is not fully charged (see figure), even when the terminal voltage reaches the set value. In the modified protocol, the charging current would be periodically interrupted so that the zero-current battery-terminal voltage indicative of the state of charge could be measured. The terminal voltage would also be measured at full charging current. The difference between the full-current and zero-current voltages would equal the internal voltage drop. The set value of terminal voltage would then be increased beyond the nominal full-charge potential by the amount of the internal voltage drop. This adjustment would be performed repeatedly, in real time, so that the voltage setting would track variations in the internal voltage drop to afford full charge without risk of lithium plating. If the charging current and voltage settings were controlled by a computer, then this method of charge control could readily be implemented in software.

Origin of negative resistance in anion migration controlled resistive memory

NASA Astrophysics Data System (ADS)

Banerjee, Writam; Wu, Facai; Hu, Yuan; Wu, Quantan; Wu, Zuheng; Liu, Qi; Liu, Ming

2018-03-01

Resistive random access memory (RRAM) is one of the most promising emerging nonvolatile technologies for the futuristic memory devices. Resistive switching behavior often shows negative resistance (NR), either voltage controlled or current controlled. In this work, the origin of a current compliance dependent voltage controlled NR effect during the resetting of anion migration based RRAM devices is discussed. The N-type voltage controlled NR is a high field driven phenomena. The current conduction within the range of a certain negative voltage is mostly dominated by space charge limited current. But with the higher negative voltage, a field induced tunneling effect is generated in the NR region. The voltage controlled NR is strongly dependent on the compliance current. The area independent behavior indicates the filamentary switching. The peak to valley ratio (PVR) is > 5. The variation of PVR as a function of the conduction band offset is achieved. Compared to other reported works, based on the PVR, it is possible to distinguish the RRAM types. Generally, due to the higher electric field effect on the metallic bridge during RESET, the electrochemical metallization type RRAM shows much higher PVR than the valance change type RRAM.

A Novel Series Connected Batteries State of High Voltage Safety Monitor System for Electric Vehicle Application

PubMed Central

Jiaxi, Qiang; Lin, Yang; Jianhui, He; Qisheng, Zhou

2013-01-01

Batteries, as the main or assistant power source of EV (Electric Vehicle), are usually connected in series with high voltage to improve the drivability and energy efficiency. Today, more and more batteries are connected in series with high voltage, if there is any fault in high voltage system (HVS), the consequence is serious and dangerous. Therefore, it is necessary to monitor the electric parameters of HVS to ensure the high voltage safety and protect personal safety. In this study, a high voltage safety monitor system is developed to solve this critical issue. Four key electric parameters including precharge, contact resistance, insulation resistance, and remaining capacity are monitored and analyzed based on the equivalent models presented in this study. The high voltage safety controller which integrates the equivalent models and control strategy is developed. By the help of hardware-in-loop system, the equivalent models integrated in the high voltage safety controller are validated, and the online electric parameters monitor strategy is analyzed and discussed. The test results indicate that the high voltage safety monitor system designed in this paper is suitable for EV application. PMID:24194677

A novel series connected batteries state of high voltage safety monitor system for electric vehicle application.

PubMed

Jiaxi, Qiang; Lin, Yang; Jianhui, He; Qisheng, Zhou

2013-01-01

Batteries, as the main or assistant power source of EV (Electric Vehicle), are usually connected in series with high voltage to improve the drivability and energy efficiency. Today, more and more batteries are connected in series with high voltage, if there is any fault in high voltage system (HVS), the consequence is serious and dangerous. Therefore, it is necessary to monitor the electric parameters of HVS to ensure the high voltage safety and protect personal safety. In this study, a high voltage safety monitor system is developed to solve this critical issue. Four key electric parameters including precharge, contact resistance, insulation resistance, and remaining capacity are monitored and analyzed based on the equivalent models presented in this study. The high voltage safety controller which integrates the equivalent models and control strategy is developed. By the help of hardware-in-loop system, the equivalent models integrated in the high voltage safety controller are validated, and the online electric parameters monitor strategy is analyzed and discussed. The test results indicate that the high voltage safety monitor system designed in this paper is suitable for EV application.

A new mathematical model and control of a three-phase AC-DC voltage source converter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blasko, V.; Kaura, V.

1997-01-01

A new mathematical model of the power circuit of a three-phase voltage source converter (VSC) was developed in the stationary and synchronous reference frames. The mathematical model was then used to analyze and synthesize the voltage and current control loops for the VSC. Analytical expressions were derived for calculating the gains and time constants of the current and voltage regulators. The mathematical model was used to control a 140-kW regenerative VSC. The synchronous reference frame model was used to define feedforward signals in the current regulators to eliminate the cross coupling between the d and q phases. It allowed themore » reduction of the current control loop to first-order plants and improved their tracking capability. The bandwidths of the current and voltage-control loops were found to be approximately 20 and 60 times (respectively) smaller than the sampling frequency. All control algorithms were implemented in a digital-signal processor. All results of the analysis were experimentally verified.« less

Control voltage and power fluctuations when connecting wind farms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com

2015-12-23

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid.more » FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.« less

Algorithms for adaptive stochastic control for a class of linear systems

NASA Technical Reports Server (NTRS)

Toda, M.; Patel, R. V.

1977-01-01

Control of linear, discrete time, stochastic systems with unknown control gain parameters is discussed. Two suboptimal adaptive control schemes are derived: one is based on underestimating future control and the other is based on overestimating future control. Both schemes require little on-line computation and incorporate in their control laws some information on estimation errors. The performance of these laws is studied by Monte Carlo simulations on a computer. Two single input, third order systems are considered, one stable and the other unstable, and the performance of the two adaptive control schemes is compared with that of the scheme based on enforced certainty equivalence and the scheme where the control gain parameters are known.

DC Motor control using motor-generator set with controlled generator field

DOEpatents

Belsterling, Charles A.; Stone, John

1982-01-01

A d.c. generator is connected in series opposed to the polarity of a d.c. power source supplying a d.c. drive motor. The generator is part of a motor-generator set, the motor of which is supplied from the power source connected to the motor. A generator field control means varies the field produced by at least one of the generator windings in order to change the effective voltage output. When the generator voltage is exactly equal to the d.c. voltage supply, no voltage is applied across the drive motor. As the field of the generator is reduced, the drive motor is supplied greater voltage until the full voltage of the d.c. power source is supplied when the generator has zero field applied. Additional voltage may be applied across the drive motor by reversing and increasing the reversed field on the generator. The drive motor may be reversed in direction from standstill by increasing the generator field so that a reverse voltage is applied across the d.c. motor.

Optical control system for high-voltage terminals

DOEpatents

Bicek, John J.

1978-01-01

An optical control system for the control of devices in the terminal of an electrostatic accelerator includes a laser that is modulated by a series of preselected codes produced by an encoder. A photodiode receiver is placed in the laser beam at the high-voltage terminal of an electrostatic accelerator. A decoder connected to the photodiode decodes the signals to provide control impulses for a plurality of devices at the high voltage of the terminal.

Parts, Materials, and Processes Control Program for Expendable Launch Vehicles

DTIC Science & Technology

2015-05-21

CSAM, thermal shock, voltage burn-in, electrical tests (DWV, room and hot IR, partial discharge when in corona region); perform DPA with SEM/EDX...controls to eliminate dielectric defects; proper voltage derating. Partial discharge testing, corona inception testing up to 60% of rated voltage...voltage burn-in; DWV; room and hot IR; life test; partial discharge when in corona region B-7 Table B-5. Metallized Plastic Capacitors

Biased low differential input impedance current receiver/converter device and method for low noise readout from voltage-controlled detectors

DOEpatents

Degtiarenko, Pavel V [Williamsburg, VA; Popov, Vladimir E [Newport News, VA

2011-03-22

A first stage electronic system for receiving charge or current from voltage-controlled sensors or detectors that includes a low input impedance current receiver/converter device (for example, a transimpedance amplifier), which is directly coupled to the sensor output, a source of bias voltage, and the device's power supply (or supplies), which use the biased voltage point as a baseline.

MOSFET Power Controller

NASA Technical Reports Server (NTRS)

Mitchell, J.; Jones, K.

1986-01-01

High current and voltage controlled remotely. Remote Power Conroller includes two series-connected banks of parallel-connected MOSFET's to withstand high current and voltage. Voltage sharing between switch banks, low-impedance, gate-drive circuits used. Provided controlled range for turn on. Individually trimmable to insure simultaneous switching within few nanoseconds during both turn on and turn off. Control circuit for each switch bank and over-current trip circuit float independently and supplied power via transformer T1 from inverter. Control of floating stages by optocouplers.

Power flow controller with a fractionally rated back-to-back converter

DOEpatents

Divan, Deepakraj M.; Kandula, Rajendra Prasad; Prasai, Anish

2016-03-08

A power flow controller with a fractionally rated back-to-back (BTB) converter is provided. The power flow controller provide dynamic control of both active and reactive power of a power system. The power flow controller inserts a voltage with controllable magnitude and phase between two AC sources at the same frequency; thereby effecting control of active and reactive power flows between the two AC sources. A transformer may be augmented with a fractionally rated bi-directional Back to Back (BTB) converter. The fractionally rated BTB converter comprises a transformer side converter (TSC), a direct-current (DC) link, and a line side converter (LSC). By controlling the switches of the BTB converter, the effective phase angle between the two AC source voltages may be regulated, and the amplitude of the voltage inserted by the power flow controller may be adjusted with respect to the AC source voltages.

Analysis of spacecraft battery charger systems

NASA Astrophysics Data System (ADS)

Kim, Seong J.; Cho, Bo H.

In spacecraft battery charger systems, switching regulators are widely used for bus voltage regulation, charge current regulation, and peak power tracking. Small-signal dynamic characteristics of the battery charging subsystem of direct energy transfer (DET) and peak power tracking (PPT) systems are analyzed to facilitate design of the control loop for optimum performance and stability. Control loop designs of the charger in various modes of operation are discussed. Analyses are verified through simulations. It is shown that when the charger operates in the bus voltage regulation mode, the control-to-voltage transfer function has a negative DC gain and two LHP zeros in both the DET and PPT systems. The control-to-inductor current transfer function also has a negative DC gain and a RHP zero. Thus, in the current-mode control, the current loop can no longer be used to stabilize the system. When the system operates in the charge current regulation mode, the charger operates with a fixed duty cycle which is determined by the regulated bus voltage and the battery voltage. Without an input filter, the converter becomes a first-order system. When the peak power tracker is inactive, the operating point of the solar array output moves to the voltage source region. Thus, the solar array behaves as a stiff voltage source to a constant power load.

State reference design and saturated control of doubly-fed induction generators under voltage dips

NASA Astrophysics Data System (ADS)

Tilli, Andrea; Conficoni, Christian; Hashemi, Ahmad

2017-04-01

In this paper, the stator/rotor currents control problem of doubly-fed induction generator under faulty line voltage is carried out. Common grid faults cause a steep decline in the line voltage profile, commonly denoted as voltage dip. This point is critical for such kind of machines, having their stator windings directly connected to the grid. In this respect, solid methodological nonlinear control theory arguments are exploited and applied to design a novel controller, whose main goal is to improve the system behaviour during voltage dips, endowing it with low voltage ride through capability, a fundamental feature required by modern Grid Codes. The proposed solution exploits both feedforward and feedback actions. The feedforward part relies on suitable reference trajectories for the system internal dynamics, which are designed to prevent large oscillations in the rotor currents and command voltages, excited by line perturbations. The feedback part uses state measurements and is designed according to Linear Matrix Inequalities (LMI) based saturated control techniques to further reduce oscillations, while explicitly accounting for the system constraints. Numerical simulations verify the benefits of the internal dynamics trajectory planning, and the saturated state feedback action, in crucially improving the Doubly-Fed Induction Machine response under severe grid faults.

Voltage scheduling for low power/energy

NASA Astrophysics Data System (ADS)

Manzak, Ali

2001-07-01

Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned to lower voltage levels (thus reducing the power consumption). A polynomial time resource and latency constrained scheduling algorithm is developed to distribute the available slack among the nodes such that power consumption is minimum. The algorithm is iterative and utilizes the slack based on the Lagrange multiplier method.

Modular Battery Charge Controller

NASA Technical Reports Server (NTRS)

Button, Robert; Gonzalez, Marcelo

2009-01-01

A new approach to masterless, distributed, digital-charge control for batteries requiring charge control has been developed and implemented. This approach is required in battery chemistries that need cell-level charge control for safety and is characterized by the use of one controller per cell, resulting in redundant sensors for critical components, such as voltage, temperature, and current. The charge controllers in a given battery interact in a masterless fashion for the purpose of cell balancing, charge control, and state-of-charge estimation. This makes the battery system invariably fault-tolerant. The solution to the single-fault failure, due to the use of a single charge controller (CC), was solved by implementing one CC per cell and linking them via an isolated communication bus [e.g., controller area network (CAN)] in a masterless fashion so that the failure of one or more CCs will not impact the remaining functional CCs. Each micro-controller-based CC digitizes the cell voltage (V(sub cell)), two cell temperatures, and the voltage across the switch (V); the latter variable is used in conjunction with V(sub cell) to estimate the bypass current for a given bypass resistor. Furthermore, CC1 digitizes the battery current (I1) and battery voltage (V(sub batt) and CC5 digitizes a second battery current (I2). As a result, redundant readings are taken for temperature, battery current, and battery voltage through the summation of the individual cell voltages given that each CC knows the voltage of the other cells. For the purpose of cell balancing, each CC periodically and independently transmits its cell voltage and stores the received cell voltage of the other cells in an array. The position in the array depends on the identifier (ID) of the transmitting CC. After eight cell voltage receptions, the array is checked to see if one or more cells did not transmit. If one or more transmissions are missing, the missing cell(s) is (are) eliminated from cell-balancing calculations. The cell-balancing algorithm is based on the error between the cell s voltage and the other cells and is categorized into four zones of operation. The algorithm is executed every second and, if cell balancing is activated, the error variable is set to a negative low value. The largest error between the cell and the other cells is found and the zone of operation determined. If the error is zero or negative, then the cell is at the lowest voltage and no balancing action is needed. If the error is less than a predetermined negative value, a Cell Bad Flag is set. If the error is positive, then cell balancing is needed, but a hysteretic zone is added to prevent the bypass circuit from triggering repeatedly near zero error. This approach keeps the cells within a predetermined voltage range.

A Study of Economical Incentives for Voltage Profile Control Method in Future Distribution Network

NASA Astrophysics Data System (ADS)

Tsuji, Takao; Sato, Noriyuki; Hashiguchi, Takuhei; Goda, Tadahiro; Tange, Seiji; Nomura, Toshio

In a future distribution network, it is difficult to maintain system voltage because a large number of distributed generators are introduced to the system. The authors have proposed “voltage profile control method” using power factor control of distributed generators in the previous work. However, the economical disbenefit is caused by the active power decrease when the power factor is controlled in order to increase the reactive power. Therefore, proper incentives must be given to the customers that corporate to the voltage profile control method. Thus, in this paper, we develop a new rules which can decide the economical incentives to the customers. The method is tested in one feeder distribution network model and its effectiveness is shown.

Novel switching method for single-phase NPC three-level inverter with neutral-point voltage control

NASA Astrophysics Data System (ADS)

Lee, June-Seok; Lee, Seung-Joo; Lee, Kyo-Beum

2018-02-01

This paper proposes a novel switching method with the neutral-point voltage control in a single-phase neutral-point-clamped three-level inverter (SP-NPCI) used in photovoltaic systems. A proposed novel switching method for the SP-NPCI improves the efficiency. The main concept is to fix the switching state of one leg. As a result, the switching loss decreases and the total efficiency is improved. In addition, it enables the maximum power-point-tracking operation to be performed by applying the proposed neutral-point voltage control algorithm. This control is implemented by modifying the reference signal. Simulation and experimental results provide verification of the performance of a novel switching method with the neutral-point voltage control.

Battery charging and discharging research based on the interactive technology of smart grid and electric vehicle

NASA Astrophysics Data System (ADS)

Zhang, Mingyang

2018-06-01

To further study the bidirectional flow problem of V2G (Vehicle to Grid) charge and discharge motor, the mathematical model of AC/DC converter and bi-directional DC/DC converter was established. Then, lithium battery was chosen as the battery of electric vehicle and its mathematical model was established. In order to improve the service life of lithium battery, bidirectional DC/DC converter adopted constant current and constant voltage control strategy. In the initial stage of charging, constant current charging was adopted with current single closed loop control. After reaching a certain value, voltage was switched to constant voltage charging controlled by voltage and current. Subsequently, the V2G system simulation model was built in MATLAB/Simulink. The simulation results verified the correctness of the control strategy and showed that when charging, constant current and constant voltage charging was achieved, the grid side voltage and current were in the same phase, and the power factor was about 1. When discharging, the constant current discharge was applied, and the grid voltage and current phase difference was r. To sum up, the simulation results are correct and helpful.

Charge control microcomputer device for vehicles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morishita, M.; Kouge, S.

1986-10-14

This patent describes a charge control microcomputer device for a vehicle, comprising: speed changing means for transmitting the output torque of an engine. The speed changing means includes a slip clutch means having an output with a variable slippage amount with respect to its input and controlled in accordance with an operating instruction. The speed changing means further includes a speed change gear for changing the rotational speed input thereto at an output thereto, the speed change gear receiving the output of the slip clutch means; a charging generator driven by the output of the speed change gear; a batterymore » charged by an output voltage of the charging generator; a voltage regulator for controlling the output voltage of the charging generator to a predetermined value; an engine controlling microcomputer for receiving data from the engine, to control the engine, the engine data comprising at least an engine speed signal; a charge control microcomputer for processing engine data from the engine controlling microcomputer and charge system data including terminal voltage data from the battery and generated voltage data from the changing generator; and a display unit for displaying detection data, including fault detection data, form the charge control microcomputer.« less

Lower Side Switching Modification of SHEPWM for Single H-Bridge Unipolar Inverter

NASA Astrophysics Data System (ADS)

Aihsan, M. Z.

2018-03-01

Selective Harmonic Elimination Pulse Width Modulation (SHEPWM) is a famous fundamental frequency method for both single stage H-bridge inverter and cascaded multilevel inverters. The main function of SHEPWM is to eliminate the selective lower order of odd harmonic such 3rd, 5th 7th and 9th of the output voltage of the inverter but maintain the fundamental component. In this paper, the 5kHz of the unipolar SHEPWM switching scheme of the inverter is developed and later will be compared to the modified SHEPWM switching scheme. The performance of this inverter is measured through the final total harmonic distortion (THD), the efficiency of the whole system and the natural shape of the output after LC filter.

Temperature controlled high voltage regulator

DOEpatents

Chiaro, Jr., Peter J.; Schulze, Gerald K.

2004-04-20

A temperature controlled high voltage regulator for automatically adjusting the high voltage applied to a radiation detector is described. The regulator is a solid state device that is independent of the attached radiation detector, enabling the regulator to be used by various models of radiation detectors, such as gas flow proportional radiation detectors.

3D Ta/TaO x /TiO2/Ti synaptic array and linearity tuning of weight update for hardware neural network applications

NASA Astrophysics Data System (ADS)

Wang, I.-Ting; Chang, Chih-Cheng; Chiu, Li-Wen; Chou, Teyuh; Hou, Tuo-Hung

2016-09-01

The implementation of highly anticipated hardware neural networks (HNNs) hinges largely on the successful development of a low-power, high-density, and reliable analog electronic synaptic array. In this study, we demonstrate a two-layer Ta/TaO x /TiO2/Ti cross-point synaptic array that emulates the high-density three-dimensional network architecture of human brains. Excellent uniformity and reproducibility among intralayer and interlayer cells were realized. Moreover, at least 50 analog synaptic weight states could be precisely controlled with minimal drifting during a cycling endurance test of 5000 training pulses at an operating voltage of 3 V. We also propose a new state-independent bipolar-pulse-training scheme to improve the linearity of weight updates. The improved linearity considerably enhances the fault tolerance of HNNs, thus improving the training accuracy.

Investigation of voltage swell mitigation using STATCOM

NASA Astrophysics Data System (ADS)

Razak, N. A. Abdul; >S Jaafar, I. S.

2013-06-01

STATCOM is one of the best applications of a self commutated FACTS device to control power quality problems in the distribution system. This project proposed a STATCOM model with voltage control mechanism. DQ transformation was implemented in the controller system to achieve better estimation. Then, the model was used to investigate and analyse voltage swell problem in distribution system. The simulation results show that voltage swell could contaminate distribution network with unwanted harmonic frequencies. Negative sequence frequencies give harmful effects to the network. System connected with proposed STATCOM model illustrates that it could mitigate this problems efficiently.

A low noise and high precision linear power supply with thermal foldback protection.

PubMed

Carniti, P; Cassina, L; Gotti, C; Maino, M; Pessina, G

2016-05-01

A low noise and high precision linear power supply was designed for use in rare event search experiments with macrobolometers. The circuit accepts at the input a "noisy" dual supply voltage up to ±15 V and gives at the output precise, low noise, and stable voltages that can be set between ±3.75 V and ±12.5 V in eight 1.25 V steps. Particular care in circuit design, component selection, and proper filtering results in a noise spectral density of 50nV/Hz at 1 Hz and 20nV/Hz white when the output is set to ±5 V. This corresponds to 125 nV RMS (0.8 μV peak to peak) between 0.1 Hz and 10 Hz, and 240 nV RMS (1.6 μV peak to peak) between 0.1 Hz and 100 Hz. The power supply rejection ratio (PSRR) of the circuit is 100 dB at low frequency, and larger than 40 dB up to high frequency, thanks to a proper compensation design. Calibration allows to reach a precision in the absolute value of the output voltage of ±70 ppm, or ±350 μV at ±5 V, and to reduce thermal drifts below ±1 ppm/(∘)C in the expected operating range. The maximum peak output current is about 6 A from each output. An original foldback protection scheme was developed that dynamically limits the maximum output current to keep the temperature of the output transistors within their safe operating range. An add-on card based on an ARM Cortex-M3 microcontroller is devoted to the monitoring and control of all circuit functionalities and provides remote communication via CAN bus.

Electrowetting on dielectric: experimental and model study of oil conductivity on rupture voltage

NASA Astrophysics Data System (ADS)

Zhao, Qing; Tang, Biao; Dong, Baoqin; Li, Hui; Zhou, Rui; Guo, Yuanyuan; Dou, Yingying; Deng, Yong; Groenewold, Jan; Henzen, Alexander Victor; Zhou, Guofu

2018-05-01

Electrowetting on dielectric devices uses a conducting (water) and insulating (oil) liquid phase in conjunction on a dielectric layer. In these devices, the wetting properties of the liquid phases can be manipulated by applying an electric field. The electric field can rupture the initially flat oil film and promotes further dewetting of the oil. Here, we investigate a problem in the operation of electrowetting on dielectric caused by a finite conductivity of the oil. In particular, we find that the voltage at which the oil film ruptures is sensitive to the application of relatively low DC voltages prior to switching. Here, we systematically investigate this dependence using controlled driving schemes. The mechanism behind these history effects point to charge transport processes in the dielectric and the oil, which can be modeled and characterized by a decay time. To quantify the effects the typical response timescales have been measured with a high-speed video camera. The results have been reproduced in simulations. In addition, a simplified yet accurate equivalent circuit model is developed to analyze larger data sets more conveniently. The experimental data support the hypothesis that each pixel can be characterized by a single decay time. We studied an ensemble of pixels and found that they showed a rather broad distribution of decay times with an average value of about 440 ms. This decay time can be interpreted as a discharge timescale of the oil, not to be confused with discharge of the entire system which is generally much faster (<1 ms). Through the equivalent circuit model, we also found that variations in the fluoropolymer (FP) conductivity cannot explain the distribution of decay times, while variations in oil conductivity can.

Variable speed induction motor operation from a 20-kHz power bus

NASA Technical Reports Server (NTRS)

Hansen, Irving G.

1989-01-01

Induction motors are recognized for their simple rugged construction. To date, however, their application to variable speed or servo drives was hampered by limitations on their control. Induction motor drives tend to be complex and to display troublesome low speed characteristics due in part to nonsinusoidal driving voltages. A technique was developed which involves direct synthesis of sinusoidal driving voltages from a high frequency power bus and independent control of frequency and voltages. Separation of frequency and voltage allows independent control of rotor and stator flux, full four quadrant operation, and instantaneous torque control. Recent test results, current status of the technology, and proposed aerospace applications will be discussed.

Variable speed induction motor operation from a 20-kHz power bus

NASA Technical Reports Server (NTRS)

Hansen, Irving G.

1989-01-01

Induction motors are recognized for their simple rugged construction to date, however, their application to variable speed or servo drives has been hampered by limitations on their control. Induction motor drives tend to be complex and to display troublesome low speed characteristics due in part to nonsinusoidal driving voltages. A technique was developed which involves direct synthesis of sinusoidal driving voltages from a high frequency power bus and independent control of frequency and voltages. Separation offrequency and voltage allows independent control of rotor and stator flux, full four-quadrant operation, and instantaneous torque control. Recent test results, current status of the technology, and proposed aerospace applications will be discussed.

An analog RF gap voltage regulation system for the Advanced Photon Source storage ring.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horan, D.

1999-04-13

An analog rf gap voltage regulation system has been designed and built at Argonne National Laboratory to maintain constant total storage ring rf gap voltage, independent of beam loading and cavity tuning effects. The design uses feedback control of the klystron mod-anode voltage to vary the amount of rf power fed to the storage ring cavities. The system consists of two independent feedback loops, each regulating the combined rf gap voltages of eight storage ring cavities by varying the output power of either one or two rf stations, depending on the mode of operation. It provides full operator control andmore » permissive logic to permit feedback control of the rf system output power only if proper conditions are met. The feedback system uses envelope-detected cavity field probe outputs as the feedback signal. Two different methods of combining the individual field probe signals were used to generate a relative DC level representing one-half of the total storage ring rf voltage, an envelope-detected vector sum of the field probe rf signals, and the DC sum of individual field probe envelope detector outputs. The merits of both methods are discussed. The klystron high-voltage power supply (HVPS) units are fitted with an analog interface for external control of the mod-anode voltage level, using a four-quadrant analog multiplier to modulate the HVPS mod-anode voltage regulator set-point in response to feedback system commands.« less

A comparison of calibration techniques for hot-wires operated in subsonic compressible slip flows

NASA Technical Reports Server (NTRS)

Jones, Gregory S.; Stainback, P. C.; Nagabushana, K. A.

1992-01-01

This paper focuses on the correlation of constant temperature anemometer voltages to velocity, density, and total temperature in the transonic slip flow regime. Three different calibration schemes were evaluated. The ultimate use of these hot-wire calibrations is to obtain fluctuations in the flow variables. Without the appropriate mean flow sensitivities of the heated wire, the measurements of these fluctuations cannot be accurately determined.

A hybrid indoor ambient light and vibration energy harvester for wireless sensor nodes.

PubMed

Yu, Hua; Yue, Qiuqin; Zhou, Jielin; Wang, Wei

2014-05-19

To take advantage of applications where both light and vibration energy are available, a hybrid indoor ambient light and vibration energy harvesting scheme is proposed in this paper. This scheme uses only one power conditioning circuit to condition the combined output power harvested from both energy sources so as to reduce the power dissipation. In order to more accurately predict the instantaneous power harvested from the solar panel, an improved five-parameter model for small-scale solar panel applying in low light illumination is presented. The output voltage is increased by using the MEMS piezoelectric cantilever arrays architecture. It overcomes the disadvantage of traditional MEMS vibration energy harvester with low voltage output. The implementation of the maximum power point tracking (MPPT) for indoor ambient light is implemented using analog discrete components, which improves the whole harvester efficiency significantly compared to the digital signal processor. The output power of the vibration energy harvester is improved by using the impedance matching technique. An efficient mechanism of energy accumulation and bleed-off is also discussed. Experiment results obtained from an amorphous-silicon (a-Si) solar panel of 4.8 × 2.0 cm2 and a fabricated piezoelectric MEMS generator of 11 × 12.4 mm2 show that the hybrid energy harvester achieves a maximum efficiency around 76.7%.

An effective and secure key-management scheme for hierarchical access control in E-medicine system.

PubMed

Odelu, Vanga; Das, Ashok Kumar; Goswami, Adrijit

2013-04-01

Recently several hierarchical access control schemes are proposed in the literature to provide security of e-medicine systems. However, most of them are either insecure against 'man-in-the-middle attack' or they require high storage and computational overheads. Wu and Chen proposed a key management method to solve dynamic access control problems in a user hierarchy based on hybrid cryptosystem. Though their scheme improves computational efficiency over Nikooghadam et al.'s approach, it suffers from large storage space for public parameters in public domain and computational inefficiency due to costly elliptic curve point multiplication. Recently, Nikooghadam and Zakerolhosseini showed that Wu-Chen's scheme is vulnerable to man-in-the-middle attack. In order to remedy this security weakness in Wu-Chen's scheme, they proposed a secure scheme which is again based on ECC (elliptic curve cryptography) and efficient one-way hash function. However, their scheme incurs huge computational cost for providing verification of public information in the public domain as their scheme uses ECC digital signature which is costly when compared to symmetric-key cryptosystem. In this paper, we propose an effective access control scheme in user hierarchy which is only based on symmetric-key cryptosystem and efficient one-way hash function. We show that our scheme reduces significantly the storage space for both public and private domains, and computational complexity when compared to Wu-Chen's scheme, Nikooghadam-Zakerolhosseini's scheme, and other related schemes. Through the informal and formal security analysis, we further show that our scheme is secure against different attacks and also man-in-the-middle attack. Moreover, dynamic access control problems in our scheme are also solved efficiently compared to other related schemes, making our scheme is much suitable for practical applications of e-medicine systems.

System and method for charging electrochemical cells in series

DOEpatents

DeLuca, William H.; Hornstra, Jr, Fred; Gelb, George H.; Berman, Baruch; Moede, Larry W.

1980-01-01

A battery charging system capable of equalizing the charge of each individual cell at a selected full charge voltage includes means for regulating charger current to first increase current at a constant rate until a bulk charging level is achieved or until any cell reaches a safe reference voltage. A system controller then begins to decrease the charging rate as long as any cell exceeds the reference voltage until an equalization current level is reached. At this point, the system controller activates a plurality of shunt modules to permit shunting of current around any cell having a voltage exceeding the reference voltage. Leads extending between the battery of cells and shunt modules are time shared to permit alternate shunting of current and voltage monitoring without the voltage drop caused by the shunt current. After each cell has at one time exceeded the reference voltage, the charging current is terminated.

Open-circuit voltage improvements in low-resistivity solar cells

NASA Technical Reports Server (NTRS)

Godlewski, M. P.; Klucher, T. M.; Mazaris, G. A.; Weizer, V. G.

1979-01-01

Mechanisms limiting the open-circuit voltage in 0.1 ohm-cm solar cells were investigated. It was found that a rather complicated multistep diffusion process could produce cells with significantly improved voltages. The voltage capabilities of various laboratory cells were compared independent of their absorption and collection efficiencies. This was accomplished by comparing the cells on the basis of their saturation currents or, equivalently, comparing their voltage outputs at a constant current-density level. The results show that for both the Lewis diffused emitter cell and the Spire ion-implanted emitter cell the base component of the saturation current is voltage controlling. The evidence for the University of Florida cells, although not very conclusive, suggests emitter control of the voltage in this device. The data suggest further that the critical voltage-limiting parameter for the Lewis cell is the electron mobility in the cell base.

Analysis of optical route in a micro high-speed magneto-optic switch

NASA Astrophysics Data System (ADS)

Weng, Zihua; Yang, Guoguang; Huang, Yuanqing; Chen, Zhimin; Zhu, Yun; Wu, Jinming; Lin, Shufen; Mo, Weiping

2005-02-01

A novel micro high-speed 2x2 magneto-optic switch and its optical route, which is used in high-speed all-optical communication network, is designed and analyzed in this paper. The study of micro high-speed magneto-optic switch mainly involves the optical route and high-speed control technique design. The optical route design covers optical route design of polarization in optical switch, the performance analysis and material selection of magneto-optic crystal and magnetic path design in Faraday rotator. The research of high-speed control technique involves the study of nanosecond pulse generator, high-speed magnetic field and its control technique etc. High-speed current transients from nanosecond pulse generator are used to switch the magnetization of the magneto-optic crystal, which propagates a 1550nm optical beam. The optical route design schemes and electronic circuits of high-speed control technique are both simulated on computer and test by the experiments respectively. The experiment results state that the nanosecond pulse generator can output the pulse with rising edge time 3~35ns, voltage amplitude 10~90V and pulse width 10~100ns. Under the control of CPU singlechip, the optical beam can be stably switched and the switching time is less than 1μs currently.

Control model design to limit DC-link voltage during grid fault in a dfig variable speed wind turbine

NASA Astrophysics Data System (ADS)

Nwosu, Cajethan M.; Ogbuka, Cosmas U.; Oti, Stephen E.

2017-08-01

This paper presents a control model design capable of inhibiting the phenomenal rise in the DC-link voltage during grid- fault condition in a variable speed wind turbine. Against the use of power circuit protection strategies with inherent limitations in fault ride-through capability, a control circuit algorithm capable of limiting the DC-link voltage rise which in turn bears dynamics that has direct influence on the characteristics of the rotor voltage especially during grid faults is here proposed. The model results so obtained compare favorably with the simulation results as obtained in a MATLAB/SIMULINK environment. The generated model may therefore be used to predict near accurately the nature of DC-link voltage variations during fault given some factors which include speed and speed mode of operation, the value of damping resistor relative to half the product of inner loop current control bandwidth and the filter inductance.

Synchronous Controlled Switching by VCB with Electromagnetic Operation Mechanism

NASA Astrophysics Data System (ADS)

Horinouchi, Katsuhiko; Tsukima, Mitsuru; Tohya, Nobumoto; Inoue, Ryuuichi; Sasao, Hiroyuki

Synchronously controlled switching to suppress transient overvoltage and overcurrent resulting from when the circuit breakers on medium voltage systems are closed is described. Firstly, by simulation it is found that if the closing time is synchronously controlled so that the contacts of the circuit breaker close completely at the instant when the voltage across contacts of the breaker at each of the three individual phases are zero, the resulting overvoltage and overcurrent is significantly suppressed when compared to conventional three phase simultaneous closing. Next, an algorithm for determining the closing timing based on a forecasted voltage zero waveform, obtained from voltage sampling data, is presented. Finally, a synchronous closing experiment of voltage 22kV utilizing a controller to implement the algorithm and a VCB with an electromagnetic operation mechanism is presented. The VCB was successfully closed at the zero point within a tolerance range of 200 microseconds.

Threshold voltage control in TmSiO/HfO2 high-k/metal gate MOSFETs

NASA Astrophysics Data System (ADS)

Dentoni Litta, E.; Hellström, P.-E.; Östling, M.

2015-06-01

High-k interfacial layers have been proposed as a way to extend the scalability of Hf-based high-k/metal gate CMOS technology, which is currently limited by strong degradations in threshold voltage control, channel mobility and device reliability when the chemical oxide (SiOx) interfacial layer is scaled below 0.4 nm. We have previously demonstrated that thulium silicate (TmSiO) is a promising candidate as a high-k interfacial layer, providing competitive advantages in terms of EOT scalability and channel mobility. In this work, the effect of the TmSiO interfacial layer on threshold voltage control is evaluated, showing that the TmSiO/HfO2 dielectric stack is compatible with threshold voltage control techniques commonly used with SiOx/HfO2 stacks. Specifically, we show that the flatband voltage can be set in the range -1 V to +0.5 V by the choice of gate metal and that the effective workfunction of the stack is properly controlled by the metal workfunction in a gate-last process flow. Compatibility with a gate-first approach is also demonstrated, showing that integration of La2O3 and Al2O3 capping layers can induce a flatband voltage shift of at least 150 mV. Finally, the effect of the annealing conditions on flatband voltage is investigated, finding that the duration of the final forming gas anneal can be used as a further process knob to tune the threshold voltage. The evaluation performed on MOS capacitors is confirmed by the fabrication of TmSiO/HfO2/TiN MOSFETs achieving near-symmetric threshold voltages at sub-nm EOT.

Frequency stabilization in nonlinear MEMS and NEMS oscillators

DOEpatents

Lopez, Omar Daniel; Antonio, Dario

2014-09-16

An illustrative system includes an amplifier operably connected to a phase shifter. The amplifier is configured to amplify a voltage from an oscillator. The phase shifter is operably connected to a driving amplitude control, wherein the phase shifter is configured to phase shift the amplified voltage and is configured to set an amplitude of the phase shifted voltage. The oscillator is operably connected to the driving amplitude control. The phase shifted voltage drives the oscillator. The oscillator is at an internal resonance condition, based at least on the amplitude of the phase shifted voltage, that stabilizes frequency oscillations in the oscillator.

DC attenuation meter

DOEpatents

Hargrove, Douglas L.

2004-09-14

A portable, hand-held meter used to measure direct current (DC) attenuation in low impedance electrical signal cables and signal attenuators. A DC voltage is applied to the signal input of the cable and feedback to the control circuit through the signal cable and attenuators. The control circuit adjusts the applied voltage to the cable until the feedback voltage equals the reference voltage. The "units" of applied voltage required at the cable input is the system attenuation value of the cable and attenuators, which makes this meter unique. The meter may be used to calibrate data signal cables, attenuators, and cable-attenuator assemblies.

Research of high power and stable laser in portable Raman spectrometer based on SHINERS technology

NASA Astrophysics Data System (ADS)

Cui, Yongsheng; Yin, Yu; Wu, Yulin; Ni, Xuxiang; Zhang, Xiuda; Yan, Huimin

2013-08-01

The intensity of Raman light is very weak, which is only from 10-12 to 10-6 of the incident light. In order to obtain the required sensitivity, the traditional Raman spectrometer tends to be heavy weight and large volume, so it is often used as indoor test device. Based on the Shell-Isolated Nanoparticle-Enhanced Raman Spectroscopy (SHINERS) method, Raman optical spectrum signal can be enhanced significantly and the portable Raman spectrometer combined with SHINERS method will be widely used in various fields. The laser source must be stable enough and able to output monochromatic narrow band laser with stable power in the portable Raman spectrometer based on the SHINERS method. When the laser is working, the change of temperature can induce wavelength drift, thus the power stability of excitation light will be affected, so we need to strictly control the working temperature of the laser, In order to ensure the stability of laser power and output current, this paper adopts the WLD3343 laser constant current driver chip of Wavelength Electronics company and MCU P89LPC935 to drive LML - 785.0 BF - XX laser diode(LD). Using this scheme, the Raman spectrometer can be small in size and the drive current can be constant. At the same time, we can achieve functions such as slow start, over-current protection, over-voltage protection, etc. Continuous adjustable output can be realized under control, and the requirement of high power output can be satisfied. Max1968 chip is adopted to realize the accurate control of the laser's temperature. In this way, it can meet the demand of miniaturization. In term of temperature control, integral truncation effect of traditional PID algorithm is big, which is easy to cause static difference. Each output of incremental PID algorithm has nothing to do with the current position, and we can control the output coefficients to avoid full dose output and immoderate adjustment, then the speed of balance will be improved observably. Variable integral incremental digital PID algorithm is used in the TEC temperature control system. The experimental results show that comparing with other schemes, the output power of laser in our scheme is more stable and reliable, moreover the peak value is bigger, and the temperature can be precisely controlled in +/-0.1°C, then the volume of the device is smaller. Using this laser equipment, the ideal Raman spectra of materials can be obtained combined with SHINERS technology and spectrometer equipment.

Electrochemically controlled charging circuit for storage batteries

DOEpatents

Onstott, E.I.

1980-06-24

An electrochemically controlled charging circuit for charging storage batteries is disclosed. The embodiments disclosed utilize dc amplification of battery control current to minimize total energy expended for charging storage batteries to a preset voltage level. The circuits allow for selection of Zener diodes having a wide range of reference voltage levels. Also, the preset voltage level to which the storage batteries are charged can be varied over a wide range.

Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins.

PubMed

Zeimpekis, I; Sun, K; Hu, C; Ditshego, N M J; Thomas, O; de Planque, M R R; Chong, H M H; Morgan, H; Ashburn, P

2016-04-22

We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH(-1) is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH(-1) measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.

Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins

NASA Astrophysics Data System (ADS)

Zeimpekis, I.; Sun, K.; Hu, C.; Ditshego, N. M. J.; Thomas, O.; de Planque, M. R. R.; Chong, H. M. H.; Morgan, H.; Ashburn, P.

2016-04-01

We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH-1 is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH-1 measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.

Bipolar square-wave current source for transient electromagnetic systems based on constant shutdown time

NASA Astrophysics Data System (ADS)

Wang, Shilong; Yin, Changchun; Lin, Jun; Yang, Yu; Hu, Xueyan

2016-03-01

Cooperative work of multiple magnetic transmitting sources is a new trend in the development of transient electromagnetic system. The key is the bipolar current waves shutdown, concurrently in the inductive load. In the past, it was difficult to use the constant clamping voltage technique to realize the synchronized shutdown of currents with different peak values. Based on clamping voltage technique, we introduce a new controlling method with constant shutdown time. We use the rising time to control shutdown time and use low voltage power source to control peak current. From the viewpoint of the circuit energy loss, by taking the high-voltage capacitor bypass resistance and the capacitor of the passive snubber circuit into account, we establish the relationship between the rising time and the shutdown time. Since the switch is not ideal, we propose a new method to test the shutdown time by the low voltage, the high voltage and the peak current. Experimental results show that adjustment of the current rising time can precisely control the value of the clamp voltage. When the rising time is fixed, the shutdown time is unchanged. The error for shutdown time deduced from the energy consumption is less than 6%. The new controlling method on current shutdown proposed in this paper can be used in the cooperative work of borehole and ground transmitting system.

Bipolar square-wave current source for transient electromagnetic systems based on constant shutdown time.

PubMed

Wang, Shilong; Yin, Changchun; Lin, Jun; Yang, Yu; Hu, Xueyan

2016-03-01

Cooperative work of multiple magnetic transmitting sources is a new trend in the development of transient electromagnetic system. The key is the bipolar current waves shutdown, concurrently in the inductive load. In the past, it was difficult to use the constant clamping voltage technique to realize the synchronized shutdown of currents with different peak values. Based on clamping voltage technique, we introduce a new controlling method with constant shutdown time. We use the rising time to control shutdown time and use low voltage power source to control peak current. From the viewpoint of the circuit energy loss, by taking the high-voltage capacitor bypass resistance and the capacitor of the passive snubber circuit into account, we establish the relationship between the rising time and the shutdown time. Since the switch is not ideal, we propose a new method to test the shutdown time by the low voltage, the high voltage and the peak current. Experimental results show that adjustment of the current rising time can precisely control the value of the clamp voltage. When the rising time is fixed, the shutdown time is unchanged. The error for shutdown time deduced from the energy consumption is less than 6%. The new controlling method on current shutdown proposed in this paper can be used in the cooperative work of borehole and ground transmitting system.

Feasibility of Traveling Wave Direct Energy Conversion of Fission Reaction Fragments

NASA Technical Reports Server (NTRS)

Tarditi, A. G.; George, J. A.; Miley, G. H.; Scott, J. H.

2013-01-01

Fission fragment direct energy conversion has been considered in the past for the purpose of increasing nuclear power plant efficiency and for advanced space propulsion. Since the fragments carry electric charge (typically in the order of 20 e) and have 100 MeV-range kinetic energy, techniques utilizing very high-voltage DC electrodes have been considered. This study is focused on a different approach: the kinetic energy of the charged fission fragments is converted into alternating current by means of a traveling wave coupling scheme (Traveling Wave Direct Energy Converter, TWDEC), thereby not requiring the utilization of high voltage technology. A preliminary feasibility analysis of the concept is introduced based on a conceptual level study and on a particle simulation model of the beam dynamics.

Note: Repetitive operation of the capacitor bank of the low-voltage miniature plasma focus at 50 Hz.

PubMed

Shukla, Rohit; Shyam, Anurag

2013-10-01

We have already reported the low-voltage operation of a plasma focus describing the operation of plasma focus at 4.2 kV which proposes possibility of making a repetitive system using compact driving source. Another recent article describes that the same capacitor-bank can drive the plasma focus for a measured ~5 × 10(4) neutrons per shot at 5 kV and 59 kA current. In the present work, repetitive operation of the capacitor-bank of plasma focus is done and that too is being reported at a very high repetition rate of 50 Hz using very simple scheme of charging and triggering the bank. The bank is continuously discharged to burst duration of 20 s in this configuration admeasuring a thousand shots.

An Improved Power Quality BIBRED Converter-Based VSI-Fed BLDC Motor Drive

NASA Astrophysics Data System (ADS)

Singh, Bhim; Bist, Vashist

2014-01-01

This paper presents an IHQRR (integrated high-quality rectifier regulator) BIBRED (boost integrated buck rectifier energy storage DC-DC) converter-based VSI (voltage source inverter)-fed BLDC (brushless DC) motor drive. The speed control of BLDC motor is achieved by controlling the DC link voltage of the VSI using a single voltage sensor. This allows VSI to operate in fundamental frequency switching mode for electronic commutation of BLDC motor which reduces the switching losses due to high-frequency switching used in conventional approach of PWM (pulse width modulation)-based VSI-fed BLDC motor drive. A BIBRED converter is operated in a dual-DCM (discontinuous conduction mode) thus using a voltage follower approach for PFC (power factor correction) and DC link voltage control. The performance of the proposed drive is evaluated for improved power quality over a wide range of speed control and supply voltage variation for demonstrating the behavior of proposed drive. The power quality indices thus obtained are within the recommended limits by international PQ (power quality) standards such as IEC 61000-3-2.

Voltage control in Z-source inverter using low cost microcontroller for undergraduate approach

NASA Astrophysics Data System (ADS)

Zulkifli, Shamsul Aizam; Sewang, Mohd Rizal; Salimin, Suriana; Shah, Noor Mazliza Badrul

2017-09-01

This paper is focussing on controlling the output voltage of Z-Source Inverter (ZSI) using a low cost microcontroller with MATLAB-Simulink that has been used for interfacing the voltage control at the output of ZSI. The key advantage of this system is the ability of a low cost microcontroller to process the voltage control blocks based on the mathematical equations created in MATLAB-Simulink. The Proportional Integral (PI) control equations are been applied and then, been downloaded to the microcontroller for observing the changes on the voltage output regarding to the changes on the reference on the PI. The system has been simulated in MATLAB and been verified with the hardware setup. As the results, the Raspberry Pi and Arduino that have been used in this work are able to respond well when there is a change of ZSI output. It proofed that, by applying/introducing this method to student in undergraduate level, it will help the student to understand more on the process of the power converter combine with a control feedback function that can be applied at low cost microcontroller.

Design and implementation of adaptive PI control schemes for web tension control in roll-to-roll (R2R) manufacturing.

PubMed

Raul, Pramod R; Pagilla, Prabhakar R

2015-05-01

In this paper, two adaptive Proportional-Integral (PI) control schemes are designed and discussed for control of web tension in Roll-to-Roll (R2R) manufacturing systems. R2R systems are used to transport continuous materials (called webs) on rollers from the unwind roll to the rewind roll. Maintaining web tension at the desired value is critical to many R2R processes such as printing, coating, lamination, etc. Existing fixed gain PI tension control schemes currently used in industrial practice require extensive tuning and do not provide the desired performance for changing operating conditions and material properties. The first adaptive PI scheme utilizes the model reference approach where the controller gains are estimated based on matching of the actual closed-loop tension control systems with an appropriately chosen reference model. The second adaptive PI scheme utilizes the indirect adaptive control approach together with relay feedback technique to automatically initialize the adaptive PI gains. These adaptive tension control schemes can be implemented on any R2R manufacturing system. The key features of the two adaptive schemes is that their designs are simple for practicing engineers, easy to implement in real-time, and automate the tuning process. Extensive experiments are conducted on a large experimental R2R machine which mimics many features of an industrial R2R machine. These experiments include trials with two different polymer webs and a variety of operating conditions. Implementation guidelines are provided for both adaptive schemes. Experimental results comparing the two adaptive schemes and a fixed gain PI tension control scheme used in industrial practice are provided and discussed. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Event-triggered attitude control of spacecraft

NASA Astrophysics Data System (ADS)

Wu, Baolin; Shen, Qiang; Cao, Xibin

2018-02-01

The problem of spacecraft attitude stabilization control system with limited communication and external disturbances is investigated based on an event-triggered control scheme. In the proposed scheme, information of attitude and control torque only need to be transmitted at some discrete triggered times when a defined measurement error exceeds a state-dependent threshold. The proposed control scheme not only guarantees that spacecraft attitude control errors converge toward a small invariant set containing the origin, but also ensures that there is no accumulation of triggering instants. The performance of the proposed control scheme is demonstrated through numerical simulation.

Virtually transparent epidermal imagery (VTEI): on new approaches to in vivo wireless high-definition video and image processing.

PubMed

Anderson, Adam L; Lin, Bingxiong; Sun, Yu

2013-12-01

This work first overviews a novel design, and prototype implementation, of a virtually transparent epidermal imagery (VTEI) system for laparo-endoscopic single-site (LESS) surgery. The system uses a network of multiple, micro-cameras and multiview mosaicking to obtain a panoramic view of the surgery area. The prototype VTEI system also projects the generated panoramic view on the abdomen area to create a transparent display effect that mimics equivalent, but higher risk, open-cavity surgeries. The specific research focus of this paper is on two important aspects of a VTEI system: 1) in vivo wireless high-definition (HD) video transmission and 2) multi-image processing-both of which play key roles in next-generation systems. For transmission and reception, this paper proposes a theoretical wireless communication scheme for high-definition video in situations that require extremely small-footprint image sensors and in zero-latency applications. In such situations the typical optimized metrics in communication schemes, such as power and data rate, are far less important than latency and hardware footprint that absolutely preclude their use if not satisfied. This work proposes the use of a novel Frequency-Modulated Voltage-Division Multiplexing (FM-VDM) scheme where sensor data is kept analog and transmitted via "voltage-multiplexed" signals that are also frequency-modulated. Once images are received, a novel Homographic Image Mosaicking and Morphing (HIMM) algorithm is proposed to stitch images from respective cameras, that also compensates for irregular surfaces in real-time, into a single cohesive view of the surgical area. In VTEI, this view is then visible to the surgeon directly on the patient to give an "open cavity" feel to laparoscopic procedures.

High voltage dc--dc converter with dynamic voltage regulation and decoupling during load-generated arcs

DOEpatents

Shimer, D.W.; Lange, A.C.

1995-05-23

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.

High voltage dc-dc converter with dynamic voltage regulation and decoupling during load-generated arcs

DOEpatents

Shimer, Daniel W.; Lange, Arnold C.

1995-01-01

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

An equivalent circuit for small atrial trabeculae of frog.

PubMed Central

Jakobsson, E; Barr, L; Connor, J A

1975-01-01

An equivalent electrical circuit has been constructed for small atrial trabecula of frog in a double sucrose gap voltage clamp apparatus. The basic strategy in constructing the circuit was to derive the distribution of membrane capacitance and extracellular resistance from the preparation's response to small voltage displacements near the resting condition, when the membrane conductance is presumably quite low. Then standard Hodgkin-Huxley channels were placed in parallel with the capacitance and the results of voltage clamp experiments were simulated. The results suggest that the membranes of the preparation cannot in fact be clamped near the control voltage nor can the ionic currents be measured directly with reasonable accuracy by axon standards. It may or may not be a realizable goal in the future to define the preparation's electrical behavior well enough to permit the ultimate quantitative description of the membrane's specific ion conductances. The result of this paper suggest that if this goal is achieved using the double sucrose gap voltage clamp, it will be by a detailed quantitative accounting for substantial irreducible errors in voltage control, rather than by experimental achievement of good voltage control. PMID:1203441

Developments of new force reflecting control schemes and an application to a teleoperation training simulator

NASA Technical Reports Server (NTRS)

Kim, Won S.

1992-01-01

Two schemes of force reflecting control, position-error based force reflection and low-pass-filtered force reflection, both combined with shared compliance control, were developed for dissimilar master-slave arms. These schemes enabled high force reflection gains, which were not possible with a conventional scheme when the slave arm was much stiffer than the master arm. The experimental results with a peg-in-hole task indicated that the newly force reflecting control schemes combined with compliance control resulted in best task performances. As a related application, a simulated force reflection/shared compliance control teleoperation trainer was developed that provided the operator with the feel of kinesthetic force virtual reality.

An architecture for rapid prototyping of control schemes for artificial ventricles.

PubMed

Ficola, Antonio; Pagnottelli, Stefano; Valigi, Paolo; Zoppitelli, Maurizio

2004-01-01

This paper presents an experimental system aimed at rapid prototyping of feedback control schemes for ventricular assist devices, and artificial ventricles in general. The system comprises a classical mock circulatory system, an actuated bellow-based ventricle chamber, and a software architecture for control schemes implementation and experimental data acquisition, visualization and storing. Several experiments have been carried out, showing good performance of ventricular pressure tracking control schemes.

Energy efficiency analysis of two-sided feed scheme of DC traction network with high asymmetry of feeders parameters

NASA Astrophysics Data System (ADS)

Abramov, E. Y.; Sopov, V. I.

2017-10-01

In a given research using the example of traction network area with high asymmetry of power supply parameters, the sequence of comparative assessment of power losses in DC traction network with parallel and traditional separated operating modes of traction substation feeders was shown. Experimental measurements were carried out under these modes of operation. The calculation data results based on statistic processing showed the power losses decrease in contact network and the increase in feeders. The changes proved to be critical ones and this demonstrates the significance of potential effects when converting traction network areas into parallel feeder operation. An analytical method of calculation the average power losses for different feed schemes of the traction network was developed. On its basis, the dependences of the relative losses were obtained by varying the difference in feeder voltages. The calculation results showed unreasonableness transition to a two-sided feed scheme for the considered traction network area. A larger reduction in the total power loss can be obtained with a smaller difference of the feeders’ resistance and / or a more symmetrical sectioning scheme of contact network.

Voltage controlled spintronic devices for logic applications

DOEpatents

You, Chun-Yeol; Bader, Samuel D.

2001-01-01

A reprogrammable logic gate comprising first and second voltage-controlled rotation transistors. Each transistor comprises three ferromagnetic layers with a spacer and insulating layer between the first and second ferromagnetic layers and an additional insulating layer between the second and third ferromagnetic layers. The third ferromagnetic layer of each transistor is connected to each other, and a constant external voltage source is applied to the second ferromagnetic layer of the first transistor. As input voltages are applied to the first ferromagnetic layer of each transistor, the relative directions of magnetization of the ferromagnetic layers and the magnitude of the external voltage determines the output voltage of the gate. By altering these parameters, the logic gate is capable of behaving as AND, OR, NAND, or NOR gates.

Electric Drive Study. Volume 1

DTIC Science & Technology

1987-12-21

CONDITIONER HIGH VOLTAGE DC ICONDITIONER 3 ,300-50 VOLT5), dCONTROL! Figure 5-4. Typical AC Drive System 20 system usable with an induction motor. The...controlling component in an AC drive is the motor power conditioner . This component changes the high voltage DC power to controlled AC power of...selected voltage and frequency which is applied to the drive motors. Since the vehicle gains stored energy as it is accelerated, the motor power conditioner

Voltage-Controlled Switching and Thermal Effects in VO2 Nano-Gap Junctions

DTIC Science & Technology

2014-06-09

Voltage-controlled switching and thermal effects in VO2 nano-gap junctions Arash Joushaghani,1 Junho Jeong,1 Suzanne Paradis,2 David Alain,2 J...2014) Voltage-controlled switching in lateral VO2 nano-gap junctions with different gap lengths and thermal properties was investigated. The effect of...indicate that the VO2 phase transition was likely initiated electroni- cally, which was sometimes followed by a secondary thermally-induced transition

Output Consensus of Heterogeneous Linear Multi-Agent Systems by Distributed Event-Triggered/Self-Triggered Strategy.

PubMed

Hu, Wenfeng; Liu, Lu; Feng, Gang

2016-09-02

This paper addresses the output consensus problem of heterogeneous linear multi-agent systems. We first propose a novel distributed event-triggered control scheme. It is shown that, with the proposed control scheme, the output consensus problem can be solved if two matrix equations are satisfied. Then, we further propose a novel self-triggered control scheme, with which continuous monitoring is avoided. By introducing a fixed timer into both event- and self-triggered control schemes, Zeno behavior can be ruled out for each agent. The effectiveness of the event- and self-triggered control schemes is illustrated by an example.