Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267
Peters, Colin H; Yu, Alec; Zhu, Wandi; Silva, Jonathan R; Ruben, Peter C
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.
NASA Astrophysics Data System (ADS)
Oh, Kyonghwan; Kwon, Oh-Kyong
2012-03-01
A threshold-voltage-shift compensation and suppression method for active matrix organic light-emitting diode (AMOLED) displays fabricated using a hydrogenated amorphous silicon thin-film transistor (TFT) backplane is proposed. The proposed method compensates for the threshold voltage variation of TFTs due to different threshold voltage shifts during emission time and extends the lifetime of the AMOLED panel. Measurement results show that the error range of emission current is from -1.1 to +1.7% when the threshold voltage of TFTs varies from 1.2 to 3.0 V.
Biosensing in a microelectrofluidic system using optical whispering-gallery mode spectroscopy
Huang, Lei; Guo, Zhixiong
2011-01-01
Label-free detection of biomolecules using an optical whispering-gallery mode sensor in a microelectrofluidic channel is simulated. Negatively charged bovine serum albumin is considered as the model protein analyte. The analyte transport in aqueous solution is controlled by an externally applied electrical field. The finite element method is employed for solving the equations of the charged species transport, the Poisson equation of electric potential, the equations of conservation of momentum and energy, and the Helmholtz equations of electromagnetic waves. The adsorption process of the protein molecules on the microsensor head surface is monitored by the resonance frequency shifts. Frequency shift caused by temperature variation due to Joule heating is analyzed and found to be negligible. The induced shifts behave in a manner similar to Langmuir-like adsorption kinetics; but the time constant increases due to the presence of the external electrical field. A correlation of the frequency shift, the analyte feed concentration in the solution, and the applied voltage gradient is obtained, in which an excellent linear relationship between the frequency shift and the analyte concentration is revealed. The applied voltage gradient enhances significantly the analyte concentration in the vicinity of the sensor surface; thus, the sensor sensitivity which has a power function of the voltage gradient with exponent 2.85 in the controlled voltage range. Simulated detection of extremely low protein concentration to the pico-molar level is carried out. PMID:22662041
Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen
2015-10-21
The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.
NASA Astrophysics Data System (ADS)
Kim, Tae-Soo; Lim, Seung-Young; Park, Yong-Keun; Jung, Gunwoo; Song, Jung-Hoon; Cha, Ho-Young; Han, Sang-Woo
2018-06-01
We investigated the distributions and the energy levels of defects in SiO2/AlGaN/GaN highelectron-mobility transistors (HEMTs) by using frequency-dependent ( F- D) capacitance-voltage ( C- V) measurements with resonant optical excitation. A Schottky barrier (SB) and a metal-oxidesemiconductor (MOS) HEMT were prepared to compare the effects of defects in their respective layers. We also investigated the effects of those layers on the threshold voltage ( V th ). A drastic voltage shift in the C- V curve at higher frequencies was caused by the large number of defect levels in the SiO2/GaN interface. A significant shift in V th with additional light illumination was observed due to a charging of the defect states in the SiO2/GaN interface. The voltage shifts were attributed to the detrapping of defect states at the SiO2/GaN interface.
NASA Astrophysics Data System (ADS)
Mondal, Sandip
2018-04-01
This experiment demonstrates the electrical behaviors of fully solution processed HfO2(MOS) in presence of different optical illumination. The capacitance voltage measurement was performed at frequency of 100 kHz with a DC gate sweep voltage of ±5V (with additional AC voltage of 100mV) in presence of deep UV (wavelength of 365nm with power of 25W) as well as white light (20W). It is found that there is a large shift in flatband voltage of 120mV due presence of white light during the CV measurement. However there is negligible change in flatband voltage (30mV) has been observed due to illumination of deep UV light.
NASA Astrophysics Data System (ADS)
Li, Yunlong; Suhard, Samuel; Van Huylenbroeck, Stefaan; Meersschaut, Johan; Van Besien, Els; Stucchi, Michele; Croes, Kristof; Beyer, Gerald; Beyne, Eric
2017-12-01
A Through Silicon Via (TSV) is a key component for 3D integrated circuit stacking technology, and the diameter of a TSV keeps scaling down to reduce the footprint in silicon. The TSV aspect ratio, defined as the TSV depth/diameter, tends to increase consequently. Starting from the aspect ratio of 10, to improve the TSV sidewall coverage and reduce the process thermal budget, the TSV dielectric liner deposition process has evolved from sub-atmospheric chemical vapour deposition to plasma-enhanced atomic layer deposition (PE-ALD). However, with this change, a strong negative shift in the flatband voltage is observed in the capacitance-voltage characteristic of the vertical metal-oxide-semiconductor (MOS) parasitic capacitor formed between the TSV copper metal and the p-Si substrate. And, no shift is present in planar MOS capacitors manufactured with the same PE-ALD oxide. By comparing the integration process of these two MOS capacitor structures, and by using Elastic Recoil Detection to study the elemental composition of our films, it is found that the origin of the negative flatband voltage shift is the positive charge trapping at the Si/SiO2 interface, due to the positive PE-ALD reactants confined to the narrow cavity of high aspect ratio TSVs. This interface charge trapping effect can be effectively mitigated by high temperature annealing. However, this is limited in the real process due to the high thermal budget. Further investigation on liner oxide process optimization is needed.
Breakdown in helium in high-voltage open discharge with subnanosecond current front rise
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schweigert, I. V., E-mail: ischweig@itam.nsc.ru; Alexandrov, A. L.; Bokhan, P. A.
Investigations of high-voltage open discharge in helium have shown a possibility of generation of current pulses with subnanosecond front rise, due to ultra-fast breakdown development. The open discharge is ignited between two planar cathodes with mesh anode in the middle between them. For gas pressure 6 Torr and 20 kV applied voltage, the rate of current rise reaches 500 A/(cm{sup 2} ns) for current density 200 A/cm{sup 2} and more. The time of breakdown development was measured for different helium pressures and a kinetic model of breakdown in open discharge is presented, based on elementary reactions for electrons, ions andmore » fast atoms. The model also includes various cathode emission processes due to cathode bombardment by ions, fast atoms, electrons and photons of resonant radiation with Doppler shift of frequency. It is shown, that the dominating emission processes depend on the evolution of the discharge voltage during the breakdown. In the simulations, two cases of voltage behavior were considered: (i) the voltage is kept constant during the breakdown; (ii) the voltage is reduced with the growth of current. For the first case, the exponentially growing current is maintained due to photoemission by the resonant photons with Doppler-shifted frequency. For the second case, the dominating factor of current growth is the secondary electron emission. In both cases, the subnanosecond rise of discharge current was obtained. Also the effect of gas pressure on breakdown development was considered. It was found that for 20 Torr gas pressure the time of current rise decreases to 0.1 ns, which is in agreement with experimental data.« less
NASA Astrophysics Data System (ADS)
Kim, Youngjun; Cho, Seongeun; Kim, Hyeran; Seo, Soonjoo; Lee, Hyun Uk; Lee, Jouhahn; Ko, Hyungduk; Chang, Mincheol; Park, Byoungnam
2017-09-01
Electric field-induced charge trapping and exciton dissociation were demonstrated at a penatcene/grapheme quantum dot (GQD) interface using a bottom contact bi-layer field effect transistor (FET) as an electrical nano-probe. Large threshold voltage shift in a pentacene/GQD FET in the dark arises from field-induced carrier trapping in the GQD layer or GQD-induced trap states at the pentacene/GQD interface. As the gate electric field increases, hysteresis characterized by the threshold voltage shift depending on the direction of the gate voltage scan becomes stronger due to carrier trapping associated with the presence of a GQD layer. Upon illumination, exciton dissociation and gate electric field-induced charge trapping simultaneously contribute to increase the threshold voltage window, which can potentially be exploited for photoelectric memory and/or photovoltaic devices through interface engineering.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rajachidambaram, Meena Suhanya; Pandey, Archana; Vilayur Ganapathy, Subramanian
The role of back channel surface chemistry on amorphous zinc tin oxide (ZTO) bottom gate thin film transistors (TFT) have been characterized by positive bias-stress measurements and x-ray photoelectron spectroscopy. Positive bias-stress turn-on voltage shifts for ZTO-TFTs were significantly reduced by passivation of back channel surfaces with self-assembled monolayers of n-hexylphosphonic acid (n-HPA) when compared to ZTO-TFTs with no passivation. These results indicate that adsorption of molecular species on exposed back channel of ZTO-TFTs strongly influence observed turn-on voltage shifts, as opposed to charge injection into the dielectric or trapping due to oxygen vacancies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abbaszadeh, D.; Wetzelaer, G. A. H.; Dutch Polymer Institute, P.O. Box 902, 5600 AX, Eindhoven
The quenching of excitons at the poly(3,4-ethylenedioxythiophene):poly(styrenesulfonic acid) (PEDOT:PSS) anode in blue polyalkoxyspirobifluorene-arylamine polymer light-emitting diodes is investigated. Due to the combination of a higher electron mobility and the presence of electron traps, the recombination zone shifts from the cathode to the anode with increasing voltage. The exciton quenching at the anode at higher voltages leads to an efficiency roll-off. The voltage dependence of the luminous efficiency is reproduced by a drift-diffusion model under the condition that quenching of excitons at the PEDOT:PSS anode and metallic cathode is of equal strength. Experimentally, the efficiency roll-off at high voltages due tomore » anode quenching is eliminated by the use of an electron-blocking layer between the anode and the light-emitting polymer.« less
NASA Astrophysics Data System (ADS)
Kim, Jong Beom; Lee, Dong Ryeol
2018-04-01
We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.
Modulation of spin dynamics via voltage control of spin-lattice coupling in multiferroics
Zhu, Mingmin; Zhou, Ziyao; Peng, Bin; ...
2017-02-03
Our work aims at magnonics manipulation by the magnetoelectric coupling effect and is motivated by the most recent progresses in both magnonics (spin dynamics) and multiferroics fields. Here, voltage control of magnonics, particularly the surface spin waves, is achieved in La 0.7Sr 0.3MnO 3/0.7Pb(Mg 1/3Nb 2/3)O 3-0.3PbTiO 3 multiferroic heterostructures. With the electron spin resonance method, a large 135 Oe shift of surface spin wave resonance (≈7 times greater than conventional voltage-induced ferromagnetic resonance shift of 20 Oe) is determined. A model of the spin-lattice coupling effect, i.e., varying exchange stiffness due to voltage-induced anisotropic lattice changes, has been establishedmore » to explain experiment results with good agreement. In addition, an “on” and “off” spin wave state switch near the critical angle upon applying a voltage is created. The modulation of spin dynamics by spin-lattice coupling effect provides a platform for realizing energy-efficient, tunable magnonics devices.« less
Side-gate modulation effects on high-quality BN-Graphene-BN nanoribbon capacitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yang; Chen, Xiaolong; Ye, Weiguang
High-quality BN-Graphene-BN nanoribbon capacitors with double side-gates of graphene have been experimentally realized. The double side-gates can effectively modulate the electronic properties of graphene nanoribbon capacitors. By applying anti-symmetric side-gate voltages, we observed significant upward shifting and flattening of the V-shaped capacitance curve near the charge neutrality point. Symmetric side-gate voltages, however, only resulted in tilted upward shifting along the opposite direction of applied gate voltages. These modulation effects followed the behavior of graphene nanoribbons predicted theoretically for metallic side-gate modulation. The negative quantum capacitance phenomenon predicted by numerical simulations for graphene nanoribbons modulated by graphene side-gates was not observed,more » possibly due to the weakened interactions between the graphene nanoribbon and side-gate electrodes caused by the Ga{sup +} beam etching process.« less
Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing
NASA Astrophysics Data System (ADS)
Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.
2015-08-01
A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.
Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patel, N.; Department of Electrical and Computer Engineering, MSC01 1100, University of New Mexico, Albuquerque, New Mexico 87131-0001; Branch, D. W.
2015-08-15
A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO{sub 3}) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5more » μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less
Comparative study of 0° X-cut and Y+36°-cut lithium niobate high-voltage sensing
Patel, N.; Branch, D. W.; Schamiloglu, E.; ...
2015-08-11
A comparison study between Y+36° and 0° X-cut lithium niobate (LiNbO 3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y+36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses tomore » both crystals, the voltage-induced shift scaled linearly with voltage. For the Y+36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y+36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y+36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. Furthermore, when the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less
Investigation of the flatband voltage (V(FB)) shift of Al2O3 on N2 plasma treated Si substrate.
Kim, Hyungchul; Lee, Jaesang; Jeon, Heeyoung; Park, Jingyu; Jeon, Hyeongtag
2013-09-01
The relationships between the physical and electrical characteristics of films treated with N2 plasma followed by forming gas annealing (FGA) were investigated. The Si substrates were treated with various radio frequency (RF) power levels under a N2 ambient. Al2O3 films were then deposited on Si substrates via remote plasma atomic-layer deposition. The plasma characteristics, such as the radical and ion density, were investigated using optical emission spectroscopy. Through X-ray photoelectron spectroscopy, the chemical-bonding configurations of the samples treated with N2 plasma and FGA were examined. The quantity of Si-N bonds increased as the RF power was increased, and Si--O--N bonds were generated after FGA. The flatband voltage (VFB) was shifted in the negative direction with increasing RF power, but the VFB values of the samples after FGA shifted in the positive direction due to the formation of Si--O--N bonds. N2 plasma treatment with various RF power levels slightly increased the leakage current due to the generation of defect sites.
Haddad, Georges A.
2011-01-01
The voltage sensors of voltage-gated ion channels undergo a conformational change upon depolarization of the membrane that leads to pore opening. This conformational change can be measured as gating currents and is thought to be transferred to the pore domain via an annealing of the covalent link between voltage sensor and pore (S4-S5 linker) and the C terminus of the pore domain (S6). Upon prolonged depolarizations, the voltage dependence of the charge movement shifts to more hyperpolarized potentials. This mode shift had been linked to C-type inactivation but has recently been suggested to be caused by a relaxation of the voltage sensor itself. In this study, we identified two ShakerIR mutations in the S4-S5 linker (I384N) and S6 (F484G) that, when mutated, completely uncouple voltage sensor movement from pore opening. Using these mutants, we show that the pore transfers energy onto the voltage sensor and that uncoupling the pore from the voltage sensor leads the voltage sensors to be activated at more negative potentials. This uncoupling also eliminates the mode shift occurring during prolonged depolarizations, indicating that the pore influences entry into the mode shift. Using voltage-clamp fluorometry, we identified that the slow conformational change of the S4 previously correlated with the mode shift disappears when uncoupling the pore. The effects can be explained by a mechanical load that is imposed upon the voltage sensors by the pore domain and allosterically modulates its conformation. Mode shift is caused by the stabilization of the open state but leads to a conformational change in the voltage sensor. PMID:21518834
NASA Astrophysics Data System (ADS)
Kim, Youngjun; Cho, Seongeun; Park, Byoungnam
2018-03-01
We report ultraviolet (UV)-induced optical gating in a Zn1-x Mg x O nanocrystal solid solution (NCSS) field effect transistor (FET) through a systematic study in which UV-induced charge transport properties are probed as a function of Mg composition. Change in the electrical properties of Zn1-x Mg x O NCSS associated with electronic traps is investigated by field effect-modulated current-voltage characteristic curves in the dark and under illumination. Under UV illumination, significant threshold voltage shift to a more negative value in an n-channel Zn1-x Mg x O NCSS FET is observed. Importantly, as the Mg composition increases, the effect of UV illumination on the threshold voltage shift is alleviated. We found that threshold voltage shift as a function of Mg composition in the dark and under illumination is due to difference in the deep trap density in the Zn1-x Mg x O NCSS. This is supported by Mg composition dependent photoluminescence intensity in the visible range and reduced FET mobility with Mg addition. The presence of the deep traps and the corresponding trap energy levels in the Zn1-x Mg x O NCSS are ensured by photoelectron spectroscopy in air.
Frequency stabilization in nonlinear MEMS and NEMS oscillators
Lopez, Omar Daniel; Antonio, Dario
2014-09-16
An illustrative system includes an amplifier operably connected to a phase shifter. The amplifier is configured to amplify a voltage from an oscillator. The phase shifter is operably connected to a driving amplitude control, wherein the phase shifter is configured to phase shift the amplified voltage and is configured to set an amplitude of the phase shifted voltage. The oscillator is operably connected to the driving amplitude control. The phase shifted voltage drives the oscillator. The oscillator is at an internal resonance condition, based at least on the amplitude of the phase shifted voltage, that stabilizes frequency oscillations in the oscillator.
Kumar, Satyendra; Kumar, Narendra; Panda, Siddhartha
2016-04-01
Miniaturization of the sandwich enzyme-based immunosensor has several advantages but could result in lower signal strength due to lower enzyme loading. Hence, technologies for amplification of the signal are needed. Signal amplification in a field effect-based electrochemical immunosensor utilizing chip-based ELISA is presented in this work. First, the molarities of phosphate buffer saline (PBS) and concentrations of KCl as ionic strength adjuster were optimized to maximize the GOx glucose-based enzymatic reactions in a beaker for signal amplification measured by change in the voltage shift with an EIS device (using 20 μl of solution) and validated with a commercial pH meter (using 3 ml of solution). The PBS molarity of 100 μM with 25 mM KCl provided the maximum voltage shift. These optimized buffer conditions were further verified for GOx immobilized on silicon chips, and similar trends with decreased PBS molarity were obtained; however, the voltage shift values obtained on chip reaction were lower as compared to the reactions occurring in the beaker. The decreased voltage shift with immobilized enzyme on chip could be attributed to the increased Km (Michaelis-Menten constant) values in the immobilized GOx. Finally, a more than sixfold signal enhancement (from 8 to 47 mV) for the chip-based sandwich immunoassay was obtained by altering the PBS molarity from 10 to 100 μM with 25 mM KCl.
Effect of 30 MeV Li3+ ion and 8 MeV electron irradiation on N-channel MOSFETs
NASA Astrophysics Data System (ADS)
Prakash, A. P. G.; Ganesh, K. C. P.; Nagesha, Y. N.; Umakanth, D.; Arora, S. K.; Siddappa, K.
The effect of 30 MeV Li3+ ion and 8 MeV electron irradiation on the threshold voltage (V-TH), the voltage shift due to interface trapped charge (DeltaV(Nit)), the voltage shift due to oxide trapped charge (DeltaV(Not)), the density of interface trapped charge (DeltaN(it)), the density of oxide trapped charge (DeltaN(ot) ) and the drain saturation current (I-D Sat) were studied as a function of fluence. Considerable increase in DeltaN(it) and DeltaN(ot) , and decrease in V-TH and I-D Sat were observed in both types of irradiation. The observed difference in the properties of Li3+ ion and electron irradiated MOSFETs are interpreted on the basis of energy loss process associated with the type of radiation. The study showed that the 30 MeV Li3+ ion irradiation produce more damage when compared to the 8 MeV electron irradiation because of the higher electronic energy loss value. High temperature annealing studies showed that trapped charge generated during ion and electron irradiation was annealed out at 500 degreesC.
Toward Quantifying the Electrostatic Transduction Mechanism in Carbon Nanotube Biomolecular Sensors
NASA Astrophysics Data System (ADS)
Lerner, Mitchell; Kybert, Nicholas; Mendoza, Ryan; Dailey, Jennifer; Johnson, A. T. Charlie
2013-03-01
Despite the great promise of carbon nanotube field-effect transistors (CNT FETs) for applications in chemical and biochemical detection, a quantitative understanding of sensor responses is lacking. To explore the role of electrostatics in sensor transduction, experiments were conducted with a set of similar compounds designed to adsorb onto the CNT FET via a pyrene linker group and take on a set of known charge states under ambient conditions. Acidic and basic species were observed to induce threshold voltage shifts of opposite sign, consistent with gating of the CNT FET by local charges due to protonation or deprotonation of the pyrene compounds by interfacial water. The magnitude of the gate voltage shift was controlled by the distance between the charged group and the CNT. Additionally, functionalization with an uncharged pyrene compound showed a threshold shift ascribed to its molecular dipole moment. This work illustrates a method for producing CNT FETs with controlled values of the turnoff gate voltage, and more generally, these results will inform the development of quantitative models for the response of CNT FET chemical and biochemical sensors. As an example, the results of an experiment detecting biomarkers of Lyme disease will be discussed in the context of this model.
NASA Astrophysics Data System (ADS)
Kawamura, Yumi; Tani, Mai; Hattori, Nozomu; Miyatake, Naomasa; Horita, Masahiro; Ishikawa, Yasuaki; Uraoka, Yukiharu
2012-02-01
We investigated zinc oxide (ZnO) thin films prepared by plasma assisted atomic layer deposition (PA-ALD), and thin-film transistors (TFTs) with the ALD ZnO channel layer for application to next-generation displays. We deposited the ZnO channel layer by PA-ALD at 100 or 300 °C, and fabricated TFTs. The transfer characteristic of the 300 °C-deposited ZnO TFT exhibited high mobility (5.7 cm2 V-1 s-1), although the threshold voltage largely shifted toward the negative (-16 V). Furthermore, we deposited Al2O3 thin film as a gate insulator by PA-ALD at 100 °C for the low-temperature TFT fabrication process. In the case of ZnO TFTs with the Al2O3 gate insulator, the shift of the threshold voltage improved (-0.1 V). This improvement of the negative shift seems to be due to the negative charges of the Al2O3 film deposited by PA-ALD. On the basis of the experimental results, we confirmed that the threshold voltage of ZnO TFTs is controlled by PA-ALD for the deposition of the gate insulator.
The effect of electrostatic and gravity force on offset wire inside tube
NASA Astrophysics Data System (ADS)
Oh, S. H.; Hazineh, D.; Wang, C.
2018-04-01
In a straw-tube detector, a wire that is offset with respect to the tube axis experiences a Coulomb force when high voltage is applied between the anode wire and the tube. This force results in a shifting of the wire and straw, in addition to the gravitational sag, and is a function of the tube and wire radius, initial offset, high voltage, tension and length. The presence of such effects is well known, but the precise magnitude of the shift for the anode wires under conditions of detector operation have not been previously documented with measurable confidence. In this work, we provide the first systematic measurements for the wire shift in straw-tube detectors due to gravity and the electrostatic force using an x-ray scanner developed for the Mu2e experiment. The data are compared to the solutions of the differential equations governing the system, and we find a good match between the two. The solutions can predict the final wire and straw positions from the initial positions measured without the high voltage, and the final wire and straw positions can then be used as an input to the track reconstruction software to improve the track position resolution.
Pathogenic plasticity of Kv7.2/3 channel activity is essential for the induction of tinnitus.
Li, Shuang; Choi, Veronica; Tzounopoulos, Thanos
2013-06-11
Tinnitus, the perception of phantom sound, is often a debilitating condition that affects many millions of people. Little is known, however, about the molecules that participate in the induction of tinnitus. In brain slices containing the dorsal cochlear nucleus, we reveal a tinnitus-specific increase in the spontaneous firing rate of principal neurons (hyperactivity). This hyperactivity is observed only in noise-exposed mice that develop tinnitus and only in the dorsal cochlear nucleus regions that are sensitive to high frequency sounds. We show that a reduction in Kv7.2/3 channel activity is essential for tinnitus induction and for the tinnitus-specific hyperactivity. This reduction is due to a shift in the voltage dependence of Kv7 channel activation to more positive voltages. Our in vivo studies demonstrate that a pharmacological manipulation that shifts the voltage dependence of Kv7 to more negative voltages prevents the development of tinnitus. Together, our studies provide an important link between the biophysical properties of the Kv7 channel and the generation of tinnitus. Moreover, our findings point to previously unknown biological targets for designing therapeutic drugs that may prevent the development of tinnitus in humans.
Effect of gate bias sweep rate on the threshold voltage of in-plane gate nanowire transistor
NASA Astrophysics Data System (ADS)
Liu, H. X.; Li, J.; Tan, R. R.
2018-01-01
In2O3 nanowire electric-double-layer (EDL) transistors with in-plane gate gated by SiO2 solid-electrolyte are fabricated on transparent glass substrates. The gate voltage sweep rates can effectively modulate the threshold voltage (Vth) of nanowire device. Both depletion mode and enhancement mode are realized, and the Vth shift of the nanowire transistors is estimated to be 0.73V (without light). This phenomenon is due to increased adsorption of oxygen on the nanowire surface by the slower gate voltage sweep rates. Adsorbed oxygens capture electrons and cause a surface of nanowire channel was depleted. The operation voltage of transistor was 1.0 V, because the EDL gate dielectric can lead to high gate dielectric capacitance. These transparent in-plane gate nanowire transistors are promising for “see-through” nanoscale sensors.
Upsets in Erased Floating Gate Cells With High-Energy Protons
Gerardin, S.; Bagatin, M.; Paccagnella, A.; ...
2017-01-01
We discuss upsets in erased floating gate cells, due to large threshold voltage shifts, using statistical distributions collected on a large number of memory cells. The spread in the neutral threshold voltage appears to be too low to quantitatively explain the experimental observations in terms of simple charge loss, at least in SLC devices. The possibility that memories exposed to high energy protons and heavy ions exhibit negative charge transfer between programmed and erased cells is investigated, although the analysis does not provide conclusive support to this hypothesis.
Temporal and voltage stress stability of high performance indium-zinc-oxide thin film transistors
NASA Astrophysics Data System (ADS)
Song, Yang; Katsman, Alexander; Butcher, Amy L.; Paine, David C.; Zaslavsky, Alexander
2017-10-01
Thin film transistors (TFTs) based on transparent oxide semiconductors, such as indium zinc oxide (IZO), are of interest due to their improved characteristics compared to traditional a-Si TFTs. Previously, we reported on top-gated IZO TFTs with an in-situ formed HfO2 gate insulator and IZO active channel, showing high performance: on/off ratio of ∼107, threshold voltage VT near zero, extracted low-field mobility μ0 = 95 cm2/V·s, and near-perfect subthreshold slope at 62 mV/decade. Since device stability is essential for technological applications, in this paper we report on the temporal and voltage stress stability of IZO TFTs. Our devices exhibit a small negative VT shift as they age, consistent with an increasing carrier density resulting from an increasing oxygen vacancy concentration in the channel. Under gate bias stress, freshly annealed TFTs show a negative VT shift during negative VG gate bias stress, while aged (>1 week) TFTs show a positive VT shift during negative VG stress. This indicates two competing mechanisms, which we identify as the field-enhanced generation of oxygen vacancies and the field-assisted migration of oxygen vacancies, respectively. A simplified kinetic model of the vacancy concentration evolution in the IZO channel under electrical stress is provided.
Response of pMOS dosemeters on gamma-ray irradiation during its re-use.
Pejovic, Milic M; Pejovic, Momcilo M; Jaksic, Aleksandar B
2013-08-01
Response of pMOS dosemeters during two successive irradiations with gamma-ray irradiation to a dose of 35 Gy and annealing at room and elevated temperature has been studied. The response was followed on the basis of threshold voltage shift, determined from transfer characteristics, as a function of absorbed dose or annealing time. It was shown that the threshold voltage shifts during first and second irradiation for the gate bias during irradiation of 5 and 2.5 V insignificantly differ although complete fading was not achieved after the first cycle of annealing. In order to analyse the defects formed in oxide and at the interface during irradiation and annealing, which are responsible for threshold voltage shift, midgap and charge-pumping techniques were used. It was shown that during first irradiation and annealing a dominant influence to threshold voltage shift is made by fixed oxide traps, while at the beginning of the second annealing cycle, threshold voltage shift is a consequence of both fixed oxide traps and slow switching traps.
NASA Astrophysics Data System (ADS)
Miyaji, Kousuke; Yajima, Ryoji; Hatanaka, Teruyoshi; Takahashi, Mitsue; Sakai, Shigeki; Takeuchi, Ken
Initialize and weak-program erasing scheme is proposed to achieve high-performance and high-reliability Ferroelectric (Fe-) NAND flash solid-state drive (SSD). Bit-by-bit erase VTH control is achieved by the proposed erasing scheme and history effects in Fe-NAND is also suppressed. History effects change the future erase VTH shift characteristics by the past program voltage. The proposed erasing scheme decreases VTH shift variation due to history effects from ±40% to ±2% and the erase VTH distribution width is reduced from over 0.4V to 0.045V. As a result, the read and VPASS disturbance decrease by 42% and 37%, respectively. The proposed erasing scheme is immune to VTH variations and voltage stress. The proposed erasing scheme also suppresses the power and bandwidth degradation of SSD.
NASA Astrophysics Data System (ADS)
Mativenga, Mallory; Kang, Dong Han; Lee, Ung Gi; Jang, Jin
2012-09-01
Bias instability of top-gate amorphous-indium-gallium-zinc-oxide thin-film transistors with source- and drain-offsets is reported. Positive and negative gate bias-stress (VG_STRESS) respectively induce reversible negative threshold-voltage shift (ΔVTH) and reduction in on-current. Migration of positive charges towards the offsets lowers the local resistance of the offsets, resulting in the abnormal negative ΔVTH under positive VG_STRESS. The reduction in on-current under negative VG_STRESS is due to increase in resistance of the offsets when positive charges migrate away from the offsets. Appropriate drain and source bias-stresses applied simultaneously with VG_STRESS either suppress or enhance the instability, verifying lateral ion migration to be the instability mechanism.
Modeling and simulation of floating gate nanocrystal FET devices and circuits
NASA Astrophysics Data System (ADS)
Hasaneen, El-Sayed A. M.
The nonvolatile memory market has been growing very fast during the last decade, especially for mobile communication systems. The Semiconductor Industry Association International Technology Roadmap for Semiconductors states that the difficult challenge for nonvolatile semiconductor memories is to achieve reliable, low power, low voltage performance and high-speed write/erase. This can be achieved by aggressive scaling of the nonvolatile memory cells. Unfortunately, scaling down of conventional nonvolatile memory will further degrade the retention time due to the charge loss between the floating gate and drain/source contacts and substrate which makes conventional nonvolatile memory unattractive. Using nanocrystals as charge storage sites reduces dramatically the charge leakage through oxide defects and drain/source contacts. Floating gate nanocrystal nonvolatile memory, FG-NCNVM, is a candidate for future memory because it is advantageous in terms of high-speed write/erase, small size, good scalability, low-voltage, low-power applications, and the capability to store multiple bits per cell. Many studies regarding FG-NCNVMs have been published. Most of them have dealt with fabrication improvements of the devices and device characterizations. Due to the promising FG-NCNVM applications in integrated circuits, there is a need for circuit a simulation model to simulate the electrical characteristics of the floating gate devices. In this thesis, a FG-NCNVM circuit simulation model has been proposed. It is based on the SPICE BSIM simulation model. This model simulates the cell behavior during normal operation. Model validation results have been presented. The SPICE model shows good agreement with experimental results. Current-voltage characteristics, transconductance and unity gain frequency (fT) have been studied showing the effect of the threshold voltage shift (DeltaVth) due to nanocrystal charge on the device characteristics. The threshold voltage shift due to nanocrystal charge has a strong effect on the memory characteristics. Also, the programming operation of the memory cell has been investigated. The tunneling rate from quantum well channel to quantum dot (nanocrystal) gate is calculated. The calculations include various memory parameters, wavefunctions, and energies of quantum well channel and quantum dot gate. The use of floating gate nanocrystal memory as a transistor with a programmable threshold voltage has been demonstrated. The incorporation of FG-NCFETs to design programmable integrated circuit building blocks has been discussed. This includes the design of programmable current and voltage reference circuits. Finally, we demonstrated the design of tunable gain op-amp incorporating FG-NCFETs. Programmable integrated circuit building blocks can be used in intelligent analog and digital systems.
Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke
2011-05-06
Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jae-Min; Kim, Doyoung; Kim, Hyungjun
We investigated the ultraviolet (UV) light photostability of plasma-enhanced and thermal atomic layer deposition of ZnO thin film transistor (TFT). The negative shift of threshold voltage was similarly observed in both cases by UV exposure due to the increment of carrier concentration. Additionally, the transfer curves of TFT using thermal ALD ZnO:N active layer were exhibited recovery characteristics.
Role of AlGaN/GaN interface traps on negative threshold voltage shift in AlGaN/GaN HEMT
NASA Astrophysics Data System (ADS)
Malik, Amit; Sharma, Chandan; Laishram, Robert; Bag, Rajesh Kumar; Rawal, Dipendra Singh; Vinayak, Seema; Sharma, Rajesh Kumar
2018-04-01
This article reports negative shift in the threshold-voltage in AlGaN/GaN high electron mobility transistor (HEMT) with application of reverse gate bias stress. The device is biased in strong pinch-off and low drain to source voltage condition for a fixed time duration (reverse gate bias stress), followed by measurement of transfer characteristics. Negative threshold voltage shift after application of reverse gate bias stress indicates the presence of more carriers in channel as compared to the unstressed condition. We propose the presence of AlGaN/GaN interface states to be the reason of negative threshold voltage shift, and developed a process to electrically characterize AlGaN/GaN interface states. We verified the results with Technology Computer Aided Design (TCAD) ATLAS simulation and got a good match with experimental measurements.
Low voltage to high voltage level shifter and related methods
NASA Technical Reports Server (NTRS)
Mentze, Erik J. (Inventor); Buck, Kevin M. (Inventor); Hess, Herbert L. (Inventor); Cox, David F. (Inventor)
2006-01-01
A shifter circuit comprises a high and low voltage buffer stages and an output buffer stage. The high voltage buffer stage comprises multiple transistors arranged in a transistor stack having a plurality of intermediate nodes connecting individual transistors along the stack. The transistor stack is connected between a voltage level being shifted to and an input voltage. An inverter of this stage comprises multiple inputs and an output. Inverter inputs are connected to a respective intermediate node of the transistor stack. The low voltage buffer stage has an input connected to the input voltage and an output, and is operably connected to the high voltage buffer stage. The low voltage buffer stage is connected between a voltage level being shifted away from and a lower voltage. The output buffer stage is driven by the outputs of the high voltage buffer stage inverter and the low voltage buffer stage.
Abdelfattah, Ahmed S.; Farhi, Samouil L.; Zhao, Yongxin; Brinks, Daan; Zou, Peng; Ruangkittisakul, Araya; Platisa, Jelena; Pieribone, Vincent A.; Ballanyi, Klaus; Cohen, Adam E.
2016-01-01
Optical imaging of voltage indicators based on green fluorescent proteins (FPs) or archaerhodopsin has emerged as a powerful approach for detecting the activity of many individual neurons with high spatial and temporal resolution. Relative to green FP-based voltage indicators, a bright red-shifted FP-based voltage indicator has the intrinsic advantages of lower phototoxicity, lower autofluorescent background, and compatibility with blue-light-excitable channelrhodopsins. Here, we report a bright red fluorescent voltage indicator (fluorescent indicator for voltage imaging red; FlicR1) with properties that are comparable to the best available green indicators. To develop FlicR1, we used directed protein evolution and rational engineering to screen libraries of thousands of variants. FlicR1 faithfully reports single action potentials (∼3% ΔF/F) and tracks electrically driven voltage oscillations at 100 Hz in dissociated Sprague Dawley rat hippocampal neurons in single trial recordings. Furthermore, FlicR1 can be easily imaged with wide-field fluorescence microscopy. We demonstrate that FlicR1 can be used in conjunction with a blue-shifted channelrhodopsin for all-optical electrophysiology, although blue light photoactivation of the FlicR1 chromophore presents a challenge for applications that require spatially overlapping yellow and blue excitation. SIGNIFICANCE STATEMENT Fluorescent-protein-based voltage indicators enable imaging of the electrical activity of many genetically targeted neurons with high spatial and temporal resolution. Here, we describe the engineering of a bright red fluorescent protein-based voltage indicator designated as FlicR1 (fluorescent indicator for voltage imaging red). FlicR1 has sufficient speed and sensitivity to report single action potentials and voltage fluctuations at frequencies up to 100 Hz in single-trial recordings with wide-field microscopy. Because it is excitable with yellow light, FlicR1 can be used in conjunction with blue-light-activated optogenetic actuators. However, spatially distinct patterns of optogenetic activation and voltage imaging are required to avoid fluorescence artifacts due to photoactivation of the FlicR1 chromophore. PMID:26911693
Fernandez, Fernando R.; Broicher, Tilman; Truong, Alan; White, John A.
2011-01-01
Modulating the gain of the input-output function of neurons is critical for processing of stimuli and network dynamics. Previous gain control mechanisms have suggested that voltage fluctuations play a key role in determining neuronal gain in vivo. Here we show that, under increased membrane conductance, voltage fluctuations restore Na+ current and reduce spike frequency adaptation in rat hippocampal CA1 pyramidal neurons in vitro. As a consequence, membrane voltage fluctuations produce a leftward shift in the f-I relationship without a change in gain, relative to an increase in conductance alone. Furthermore, we show that these changes have important implications for the integration of inhibitory inputs. Due to the ability to restore Na+ current, hyperpolarizing membrane voltage fluctuations mediated by GABAA-like inputs can increase firing rate in a high conductance state. Finally, our data show that the effects on gain and synaptic integration are mediated by voltage fluctuations within a physiologically relevant range of frequencies (10–40 Hz). PMID:21389243
Ding, Ziqian; Abbas, Gamal; Assender, Hazel E; Morrison, John J; Yeates, Stephen G; Patchett, Eifion R; Taylor, D Martin
2014-09-10
We report a systemic study of the stability of organic thin film transistors (OTFTs) both in storage and under operation. Apart from a thin polystyrene buffer layer spin-coated onto the gate dielectric, the constituent parts of the OTFTs were all prepared by vacuum evaporation. The OTFTs are based on the semiconducting small molecule dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT) deposited onto the surface of a polystyrene-buffered in situ polymerized diacrylate gate insulator. Over a period of 9 months, no degradation of the hole mobility occurred in devices stored either in the dark in dry air or in uncontrolled air and normal laboratory fluorescent lighting conditions. In the latter case, rather than decreasing, the mobility actually increased almost 2-fold to 1.5 cm(2)/(V · s). The devices also showed good stability during repeat on/off cycles in the dark in dry air. Exposure to oxygen and light during the on/off cycles led to a positive shift of the transfer curves due to electron trapping when the DNTT was biased into depletion by the application of positive gate voltage. When operated in accumulation, negative gate voltage under the same conditions, the transfer curves were stable. When voltage cycling in moist air in the dark, the transfer curves shifted to negative voltages, thought to be due to the generation of hole traps either in the semiconductor or its interface with the dielectric layer. When subjected to gate bias stress in dry air in the dark for at least 144 h, the device characteristics remained stable.
Transmembrane potential measurements on plant cells using the voltage-sensitive dye ANNINE-6.
Flickinger, Bianca; Berghöfer, Thomas; Hohenberger, Petra; Eing, Christian; Frey, Wolfgang
2010-11-01
The charging of the plasma membrane is a necessary condition for the generation of an electric-field-induced permeability increase of the plasmalemma, which is usually explained by the creation and the growth of aqueous pores. For cells suspended in physiological buffers, the time domain of membrane charging is in the submicrosecond range. Systematic measurements using Nicotiana tabacum L. cv. Bright Yellow 2 (BY-2) protoplasts stained with the fast voltage-sensitive fluorescence dye ANNINE-6 have been performed using a pulsed laser fluorescence microscopy setup with a time resolution of 5 ns. A clear saturation of the membrane voltage could be measured, caused by a strong membrane permeability increase, commonly explained by enhanced pore formation, which prevents further membrane charging by external electric field exposure. The field strength dependence of the protoplast's transmembrane potential V (M) shows strong asymmetric saturation characteristics due to the high resting potential of the plants plasmalemma. At the pole of the hyperpolarized hemisphere of the cell, saturation starts at an external field strength of 0.3 kV/cm, resulting in a measured transmembrane voltage shift of ∆V(M) = -150 mV, while on the cathodic (depolarized) cell pole, the threshold for enhanced pore formation is reached at a field strength of approximately 1.0 kV/cm and ∆V(M) = 450 mV, respectively. From this asymmetry of the measured maximum membrane voltage shifts, the resting potential of BY-2 protoplasts at the given experimental conditions can be determined to V(R) = -150 mV. Consequently, a strong membrane permeability increase occurs when the membrane voltage diverges |V(M)| = 300 mV from the resting potential of the protoplast. The largest membrane voltage change at a given external electric field occurs at the cell poles. The azimuthal dependence of the transmembrane potential, measured in angular intervals of 10° along the circumference of the cell, shows a flattening and a slight decrease at higher fields at the pole region due to enhanced pore formation. Additionally, at the hyperpolarized cell pole, a polarization reversal could be observed at an external field range around 1.0 kV/cm. This behavior might be attributed to a fast charge transfer through the membrane at the hyperpolarized pole, e.g., by voltage-gated channels.
Permeation and gating properties of the L-type calcium channel in mouse pancreatic beta cells
1993-01-01
Ba2+ currents through L-type Ca2+ channels were recorded from cell- attached patches on mouse pancreatic beta cells. In 10 mM Ba2+, single- channel currents were recorded at -70 mV, the beta cell resting membrane potential. This suggests that Ca2+ influx at negative membrane potentials may contribute to the resting intracellular Ca2+ concentration and thus to basal insulin release. Increasing external Ba2+ increased the single-channel current amplitude and shifted the current-voltage relation to more positive potentials. This voltage shift could be modeled by assuming that divalent cations both screen and bind to surface charges located at the channel mouth. The single- channel conductance was related to the bulk Ba2+ concentration by a Langmuir isotherm with a dissociation constant (Kd(gamma)) of 5.5 mM and a maximum single-channel conductance (gamma max) of 22 pS. A closer fit to the data was obtained when the barium concentration at the membrane surface was used (Kd(gamma) = 200 mM and gamma max = 47 pS), which suggests that saturation of the concentration-conductance curve may be due to saturation of the surface Ba2+ concentration. Increasing external Ba2+ also shifted the voltage dependence of ensemble currents to positive potentials, consistent with Ba2+ screening and binding to membrane surface charge associated with gating. Ensemble currents recorded with 10 mM Ca2+ activated at more positive potentials than in 10 mM Ba2+, suggesting that external Ca2+ binds more tightly to membrane surface charge associated with gating. The perforated-patch technique was used to record whole-cell currents flowing through L-type Ca2+ channels. Inward currents in 10 mM Ba2+ had a similar voltage dependence to those recorded at a physiological Ca2+ concentration (2.6 mM). BAY-K 8644 (1 microM) increased the amplitude of the ensemble and whole-cell currents but did not alter their voltage dependence. Our results suggest that the high divalent cation solutions usually used to record single L-type Ca2+ channel activity produce a positive shift in the voltage dependence of activation (approximately 32 mV in 100 mM Ba2+). PMID:7687645
Review of mixer design for low voltage - low power applications
NASA Astrophysics Data System (ADS)
Nurulain, D.; Musa, F. A. S.; Isa, M. Mohamad; Ahmad, N.; Kasjoo, S. R.
2017-09-01
A mixer is used in almost all radio frequency (RF) or microwave systems for frequency translation. Nowadays, the increase market demand encouraged the industry to deliver circuit designs to create proficient and convenient equipment with very low power (LP) consumption and low voltage (LV) supply in both digital and analogue circuits. This paper focused on different Complementary Metal Oxide Semiconductor (CMOS) design topologies for LV and LP mixer design. Floating Gate Metal Oxide Semiconductor (FGMOS) is an alternative technology to replace CMOS due to their high ability for LV and LP applications. FGMOS only required a few transistors per gate and can have a shift in threshold voltage (VTH) to increase the LP and LV performances as compared to CMOS, which makes an attractive option to replace CMOS.
Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P
2012-09-01
Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurishima, Kazunori, E-mail: ce41034@meiji.ac.jp; Nabatame, Toshihide, E-mail: NABATAME.Toshihide@nims.go.jp; Shimizu, Maki
To investigate the influence of ionic/covalent interface of Al{sub 2}O{sub 3}/SiO{sub 2} gate insulator on the electrical properties of thin-film transistors (TFTs) with ionic Ga-In-Zn-O (GIZO) semiconducting channel layers, Al{sub 2}O{sub 3} layers of different thickness were introduced between SiO{sub 2} and GIZO using plasma-enhanced atomic layer deposition. The GIZO layers were obtained by DC magnetron sputtering using a GIZO target (Ga:In:Zn = 1:1:1 mol. %). The GIZO TFTs with an Al{sub 2}O{sub 3}/SiO{sub 2} gate insulator exhibited positive threshold voltage (V{sub th}) shift (about 1.1 V), V{sub th} hysteresis suppression (0.23 V), and electron mobility degradation (about 13%) compared with thosemore » of a GIZO TFT with SiO{sub 2} gate insulator by the influence of ionic/ionic and ionic/covalent interface at Al{sub 2}O{sub 3}/GIZO and Al{sub 2}O{sub 3}/SiO{sub 2}, respectively. To clarify the origin of the positive V{sub th} shift, the authors estimated the shifts of flatband voltage (0.4 V) due to the dipole and the fixed charge (−1.1 × 10{sup 11}/cm{sup 2}) at Al{sub 2}O{sub 3}/SiO{sub 2} interface, from capacitance–voltage data for Pt/Al{sub 2}O{sub 3}/SiO{sub 2}/p-Si capacitors. Based on these experimental data, the authors found that the positive V{sub th} shift (1.1 V) could be divided into three components: the dipole (−0.4 V) and fixed charge (0.15 V) at the SiO{sub 2}/Al{sub 2}O{sub 3} interface, and the fixed charge (1.35 V) at the Al{sub 2}O{sub 3}/GIZO interface. Finally, it is noted that heterointerface of SiO{sub 2}/Al{sub 2}O{sub 3}/GIZO stacks is important not only to recognize mechanism of V{sub th} shift but also to design future TFTs with high-k dielectrics and low operating voltage.« less
Switching effects and spin-valley Andreev resonant peak shifting in silicene superconductor
NASA Astrophysics Data System (ADS)
Soodchomshom, Bumned; Niyomsoot, Kittipong; Pattrawutthiwong, Eakkarat
2018-03-01
The magnetoresistance and spin-valley transport properties in a silicene-based NM/FB/SC junction are investigated, where NM, FB and SC are normal, ferromagnetic and s-wave superconducting silicene, respectively. In the FB region, perpendicular electric and staggered exchange fields are applied. The quasiparticles may be described by Dirac Bogoliubov-de Gennes equation due to Cooper pairs formed by spin-valley massive fermions. The spin-valley conductances are calculated based on the modified Blonder-Tinkham-Klapwijk formalism. We find the spin-valley dependent Andreev resonant peaks in the junction shifted by applying exchange field. Perfect conductance switch generated by interplay of intrinsic spin orbit interaction and superconducting gap has been predicted. Spin and valley polarizations are almost linearly dependent on biased voltage near zero bias and then turn into perfect switch at biased voltage approaching the superconducting gap. The perfect switching of large magnetoresistance has been also predicted at biased energy near the superconducting gap. These switching effects may be due to the presence of spin-valley Andreev resonant peak near the superconducting gap. Our work reveals potential of silicene as applications of electronic switching devices and linear control of spin and valley polarizations.
Giga-seal formation alters properties of sodium channels of human myoballs.
Fahlke, C; Rüdel, R
1992-03-01
The influence of giga-seal formation on the properties of the Na+ channels within the covered membrane patch was investigated with a whole-cell pipette and a patch pipette applied to the same cell. Current kinetics, current/voltage relation and channel densities were determined in three combinations: (i) voltage-clamping and current recording with the whole-cell pipette, (ii) voltage-clamping with the whole-cell pipette and current recording with the patch pipette and, (iii) voltage-clamping and current recording with the patch pipette. The Hodgkin-Huxley (1952) parameters tau m and tau h were smaller for the patch currents than for the whole cell, and the h infinity curve was shifted in the negative direction. The channel density was of the order of 10 times smaller. All effects were independent of the extracellular Ca2+ concentration. The capacitive current generated in the patch by the whole-cell Na+ current and its effect on the transmembrane voltage of the patch were evaluated. The kinetic parameters of the Na+ channels in the patch did not depend on whether the voltage was clamped with the whole-cell pipette or the patch pipette. Thus, the results are not due to spurious voltage.
A Paramagnetic Molecular Voltmeter
Surek, Jack T.; Thomas, David D.
2008-01-01
We have developed a general electron paramagnetic resonance (EPR) method to measure electrostatic potential at spin labels on proteins to millivolt accuracy. Electrostatic potential is fundamental to energy-transducing proteins like myosin, because molecular energy storage and retrieval is primarily electrostatic. Quantitative analysis of protein electrostatics demands a site-specific spectroscopic method sensitive to millivolt changes. Previous electrostatic potential studies on macromolecules fell short in sensitivity, accuracy and/or specificity. Our approach uses fast-relaxing charged and neutral paramagnetic relaxation agents (PRAs) to increase nitroxide spin label relaxation rate solely through collisional spin exchange. These PRAs were calibrated in experiments on small nitroxides of known structure and charge to account for differences in their relaxation efficiency. Nitroxide longitudinal (R1) and transverse (R2) relaxation rates were separated by applying lineshape analysis to progressive saturation spectra. The ratio of measured R1 increases for each pair of charged and neutral PRAs measures the shift in local PRA concentration due to electrostatic potential. Voltage at the spin label is then calculated using the Boltzmann equation. Measured voltages for two small charged nitroxides agree with Debye-Hückel calculations. Voltage for spin-labeled myosin fragment S1 also agrees with calculation based on the pK shift of the reacted cysteine. PMID:17964835
NASA Astrophysics Data System (ADS)
Wu, Shikai; Xiao, Rongshi
2015-04-01
The effects of laser radiation on the characteristics of the DC tungsten inert gas (TIG) arc were investigated by applying a high power slab CO2 laser and a Yb:YAG disc laser. Experiment results reveal that the arc voltage-current curve shifts downwards, the arc column expands, and the arc temperature rises while the high power CO2 laser beam vertically interacts with the TIG arc in argon. With the increase of the laser power, the voltage-current curve of the arc shifts downwards more significantly, and the closer the laser beam impingement on the arc to the cathode, the more the decrease in arc voltage. Moreover, the arc column expansion and the arc temperature rise occur mainly in the region between the laser beam incident position and the anode. However, the arc characteristics hardly change in the cases of the CO2 laser-helium arc and YAG laser-arc interactions. The reason is that the inverse Bremsstrahlung absorption coefficients are greatly different due to the different electron densities of the argon and helium arcs and the different wave lengths of CO2 and YAG lasers.
Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg
2014-04-01
Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages without affecting QON-V. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Simulation of Dual-Electrode Capacitively Coupled Plasma Discharges
NASA Astrophysics Data System (ADS)
Lu, Yijia; Ji, Linhong; Cheng, Jia
2016-12-01
Dual-electrode capacitively coupled plasma discharges are investigated here to lower the non-uniformity of plasma density. The dual-electrode structure proposed by Jung splits the electrode region and increases the flexibility of fine tuning non-uniformity. Different RF voltages, frequencies, phase-shifts and electrode areas are simulated and the influences are discussed. RF voltage and electrode area have a non-monotonic effect on non-uniformity, while frequency has a monotonic effect. Phase-shift has a cyclical influence on non-uniformity. A special combination of 224 V voltage and 11% area ratio with 10 MHz lowers the non-uniformity of the original set (200 V voltage and 0% area ratio with 10 MHz) by 46.5%. The position of the plasma density peak at the probe line has been tracked and properly tuning the phase-shift can obtain the same trace as tuning frequency or voltage. supported by National Natural Science Foundation of China (No. 51405261)
Lashkari, Negin; Poshtan, Javad; Azgomi, Hamid Fekri
2015-11-01
The three-phase shift between line current and phase voltage of induction motors can be used as an efficient fault indicator to detect and locate inter-turn stator short-circuit (ITSC) fault. However, unbalanced supply voltage is one of the contributing factors that inevitably affect stator currents and therefore the three-phase shift. Thus, it is necessary to propose a method that is able to identify whether the unbalance of three currents is caused by ITSC or supply voltage fault. This paper presents a feedforward multilayer-perceptron Neural Network (NN) trained by back propagation, based on monitoring negative sequence voltage and the three-phase shift. The data which are required for training and test NN are generated using simulated model of stator. The experimental results are presented to verify the superior accuracy of the proposed method. Copyright © 2015. Published by Elsevier Ltd.
Microstructure of a-C:H films prepared on a microtrench and analysis of ions and radicals behavior
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hirata, Yuki; Choi, Junho, E-mail: choi@mech.t.u-tokyo.ac.jp
2015-08-28
Amorphous carbon films (a-C:H) were prepared on a microtrench (4-μm pitch and 4-μm depth), and the uniformity of film thickness and microstructure of the films on the top, sidewall, and bottom surfaces of the microtrench were evaluated by scanning electron microscopy and Raman spectroscopy. The a-C:H films were prepared by bipolar-type plasma based ion implantation and deposition (bipolar PBII&D), and the negative pulse voltage, which is the main parameter dominating the film structure, was changed from −1.0 to −15 kV. Moreover, the behavior of ions and radicals was analyzed simultaneously by combining the calculation methods of Particle-In-Cell/Monte Carlo Collision (PIC-MCC) andmore » Direct Simulation Monte Carlo (DSMC) to investigate the coating mechanism for the microtrench. The results reveal that the thickness uniformity of a-C:H films improves with decreasing negative pulse voltage due to the decreasing inertia of incoming ions from the trench mouth, although the film thickness on the sidewall tends to be much smaller than that on the top and bottom surfaces of the trench. The normalized flux and the film thickness show similar behavior, i.e., the normalized flux or thickness at the bottom surface increases at low negative pulse voltages and then saturates at a certain value, whereas at the sidewall it monotonically decreases with increasing negative voltage. The microstructure of a-C:H films on the sidewall surface is very different from that on the top and bottom surfaces. The film structure at a low negative pulse voltage shifts to more of a polymer-like carbon (PLC) structure due to the lower incident energy of ions. Although the radical flux on the sidewall increases slightly, the overall film structure is not significantly changed because this film formation at a low negative voltage is originally dominated by radicals. On the other hand, the flux of radicals is dominant on the sidewall in the case of high negative pulse voltage, resulting in a deviation from the Raman behavior of a-C:H films deposited by bipolar PBII&D. This tendency intensifies as the negative voltage becomes greater. Also, the energy of incident ions on the sidewall of the trench increases with increasing negative voltage, which causes a shift in the Raman data of the sidewall to the bottom right corner on the figure depicting the relationship of the FWHM(G) and the G-peak position, indicating increased graphitization of a-C:H film.« less
Microstructure of a-C:H films prepared on a microtrench and analysis of ions and radicals behavior
NASA Astrophysics Data System (ADS)
Hirata, Yuki; Choi, Junho
2015-08-01
Amorphous carbon films (a-C:H) were prepared on a microtrench (4-μm pitch and 4-μm depth), and the uniformity of film thickness and microstructure of the films on the top, sidewall, and bottom surfaces of the microtrench were evaluated by scanning electron microscopy and Raman spectroscopy. The a-C:H films were prepared by bipolar-type plasma based ion implantation and deposition (bipolar PBII&D), and the negative pulse voltage, which is the main parameter dominating the film structure, was changed from -1.0 to -15 kV. Moreover, the behavior of ions and radicals was analyzed simultaneously by combining the calculation methods of Particle-In-Cell/Monte Carlo Collision (PIC-MCC) and Direct Simulation Monte Carlo (DSMC) to investigate the coating mechanism for the microtrench. The results reveal that the thickness uniformity of a-C:H films improves with decreasing negative pulse voltage due to the decreasing inertia of incoming ions from the trench mouth, although the film thickness on the sidewall tends to be much smaller than that on the top and bottom surfaces of the trench. The normalized flux and the film thickness show similar behavior, i.e., the normalized flux or thickness at the bottom surface increases at low negative pulse voltages and then saturates at a certain value, whereas at the sidewall it monotonically decreases with increasing negative voltage. The microstructure of a-C:H films on the sidewall surface is very different from that on the top and bottom surfaces. The film structure at a low negative pulse voltage shifts to more of a polymer-like carbon (PLC) structure due to the lower incident energy of ions. Although the radical flux on the sidewall increases slightly, the overall film structure is not significantly changed because this film formation at a low negative voltage is originally dominated by radicals. On the other hand, the flux of radicals is dominant on the sidewall in the case of high negative pulse voltage, resulting in a deviation from the Raman behavior of a-C:H films deposited by bipolar PBII&D. This tendency intensifies as the negative voltage becomes greater. Also, the energy of incident ions on the sidewall of the trench increases with increasing negative voltage, which causes a shift in the Raman data of the sidewall to the bottom right corner on the figure depicting the relationship of the FWHM(G) and the G-peak position, indicating increased graphitization of a-C:H film.
Computer-aided design comparisons of monolithic and hybrid MEM-tunable VCSELs
NASA Astrophysics Data System (ADS)
Ochoa, Edward M.; Nelson, Thomas R., Jr.; Blum-Spahn, Olga; Lott, James A.
2003-07-01
We report and use our micro-electro-mechanically tunable vertical cavity surface emitting laser (MEM-TVCSEL) computer-aided design methodology to investigate the resonant frequency design space for monolithic and hybrid MEM-TVCSELs. For various initial optical air gap thickness, we examine the sensitivity of monolithic or hybrid MEM-TVCSEL resonant frequency by simulating zero, two, and four percent variations in III-V material growth thickness. As expected, as initial optical airgap increases, tuning range decreases due to less coupling between the active region and the tuning mirror. However, each design has different resonant frequency sensitivity to variations in III-V growth parameters. In particular, since the monolithic design is comprised of III-V material, the shift in all growth thicknesses significantly shifts the resonant frequency response. However, for hybrid MEMTVCSELs, less shift results, since the lower reflector is an Au mirror with reflectivity independent of III-V growth variations. Finally, since the hybrid design is comprised of a MUMPS polysilicon mechanical actuator, pull-in voltage remains independent of the initial optical airgap between the tuning reflector and the III-V material. Conversely, as the initial airgap increases in the monolithic design, the pull-in voltage significantly increases.
Field-Induced Disorder and Carrier Localization in Molecular Organic Transistors
NASA Astrophysics Data System (ADS)
Ando, M.; Minakata, T.; Duffy, C.; Sirringhaus, H.
2009-06-01
We propose a "field-induced polymorphous disorder" model to explain bias-stress instability in molecular organic thin-film transistors, based on the experimental results showing the strong correlation between the micro-structural change in semiconductor layer composed of penrtacene molecules and the threshold voltage (Vth) shift due to electron trapping in a reversible manner under the successive bias-stress, thermal annealing, and light irradiation.
Fully solution processed Al-TiO2-Si (MIS) structured photo-detector
NASA Astrophysics Data System (ADS)
Mondal, Sandip; Kumar, Arvind
2018-05-01
We demonstrate the fabrication of a high performance photo detector by fully solution processed technique. The detector is fabricated with photo sensitive, low temperature (200˚C) and sol-gel processed titanium dioxide (TiO2) dielectric material on silicon substrate in the form of MIS structure with top aluminum gate. The optical detection experiment is performed on Al—TiO2—Si (MIS) device by measuring the capacitance—voltage (CV at 100 kHz) curve within the visible region of light (365 — 700 nm). The presence of light shift the flat band voltage (VFB) from 290 mV to 360 mV due to the generation of photo activated charge carriers by UV (365 nm) and white light, respectively. Moreover, the generation of the charge carrier increases drastically by the combination of UV and white, which resulting as a very large shift (600 mV) in the VFB. The entire experiment was performed in normal lab conditions with open air environment, without any clean room facility.
Voltage Scaling of Graphene Device on SrTiO3 Epitaxial Thin Film.
Park, Jeongmin; Kang, Haeyong; Kang, Kyeong Tae; Yun, Yoojoo; Lee, Young Hee; Choi, Woo Seok; Suh, Dongseok
2016-03-09
Electrical transport in monolayer graphene on SrTiO3 (STO) thin film is examined in order to promote gate-voltage scaling using a high-k dielectric material. The atomically flat surface of thin STO layer epitaxially grown on Nb-doped STO single-crystal substrate offers good adhesion between the high-k film and graphene, resulting in nonhysteretic conductance as a function of gate voltage at all temperatures down to 2 K. The two-terminal conductance quantization under magnetic fields corresponding to quantum Hall states survives up to 200 K at a magnetic field of 14 T. In addition, the substantial shift of charge neutrality point in graphene seems to correlate with the temperature-dependent dielectric constant of the STO thin film, and its effective dielectric properties could be deduced from the universality of quantum phenomena in graphene. Our experimental data prove that the operating voltage reduction can be successfully realized due to the underlying high-k STO thin film, without any noticeable degradation of graphene device performance.
NASA Technical Reports Server (NTRS)
Asenov, Asen; Slavcheva, G.; Brown, A. R.; Davies, J. H.; Saini, S.
2000-01-01
In this paper we present a detailed simulation study of the influence of quantum mechanical effects in the inversion layer on random dopant induced threshold voltage fluctuations and lowering in sub 100 nm MOSFETs. The simulations have been performed using a 3-D implementation of the density gradient (DG) formalism incorporated in our established 3-D atomistic simulation approach. This results in a self-consistent 3-D quantum mechanical picture, which implies not only the vertical inversion layer quantisation but also the lateral confinement effects related to current filamentation in the 'valleys' of the random potential fluctuations. We have shown that the net result of including quantum mechanical effects, while considering statistical dopant fluctuations, is an increase in both threshold voltage fluctuations and lowering. At the same time, the random dopant induced threshold voltage lowering partially compensates for the quantum mechanical threshold voltage shift in aggressively scaled MOSFETs with ultrathin gate oxides.
Application of the superposition principle to solar-cell analysis
NASA Technical Reports Server (NTRS)
Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.
1979-01-01
The superposition principle of differential-equation theory - which applies if and only if the relevant boundary-value problems are linear - is used to derive the widely used shifting approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. Analytical methods are presented to treat cases where shifting is not strictly valid. Well-defined conditions necessary for superposition to apply are established. For high injection in the base region, the method of analysis accurately yields the dependence of the open-circuit voltage on the short-circuit current (or the illumination level).
Poly-Si TFTs integrated gate driver circuit with charge-sharing structure
NASA Astrophysics Data System (ADS)
Chen, Meng; Lei, Jiefeng; Huang, Shengxiang; Liao, Congwei; Deng, Lianwen
2017-06-01
A p-type low-temperature poly-Si thin film transistors (LTPS TFTs) integrated gate driver using 2 non-overlapped clocks is proposed. This gate driver features charge-sharing structure to turn off buffer TFT and suppresses voltage feed-through effects. It is analyzed that the conventional gate driver suffers from waveform distortions due to voltage uncertainty of internal nodes for the initial period. The proposed charge-sharing structure also helps to suppress the unexpected pulses during the initialization phases. The proposed gate driver shows a simple circuit, as only 6 TFTs and 1 capacitor are used for single-stage, and the buffer TFT is used for both pulling-down and pulling-up of output electrode. Feasibility of the proposed gate driver is proven through detailed analyses. Investigations show that voltage bootrapping can be maintained once the bootrapping capacitance is larger than 0.8 pF, and pulse of gate driver outputs can be reduced to 5 μs. The proposed gate driver can still function properly with positive {V}{TH} shift within 0.4 V and negative {V}{TH} shift within -1.2 V and it is robust and promising for high-resolution display. Project supported by the Science and Technology Project of Hunan Province, China (No. 2015JC3401)
NASA Astrophysics Data System (ADS)
Tsai, Jyun-Yu; Chang, Ting-Chang; Lo, Wen-Hung; Ho, Szu-Han; Chen, Ching-En; Chen, Hua-Mao; Tseng, Tseung-Yuen; Tai, Ya-Hsiang; Cheng, Osbert; Huang, Cheng-Tung
2013-09-01
This work investigates the channel hot carrier (CHC) effect in HfO2/Ti1-xNx p-channel metal oxide semiconductor field effect transistors (p-MOSFETs). Generally, the subthreshold swing (S.S.) should increase during CHC stress (CHCS), since interface states will be generated near the drain side under high electric field due to drain voltage (Vd). However, our experimental data indicate that S.S. has no evident change under CHCS, but threshold voltage (Vth) shifts positively. This result can be attributed to hot carrier injected into high-k dielectric near the drain side. Meanwhile, it is surprising that such Vth degradation is not observed in the saturation region during stress. Therefore, drain-induced-barrier-lowering (DIBL) as a result of CHC-induced electron trapping is proposed to explain the different Vth behaviors in the linear and saturation regions. Additionally, the influence of different nitrogen concentrations in HfO2/Ti1-xNx p-MOSFETs on CHCS is also investigated in this work. Since nitrogen diffuses to SiO2/Si interface induced pre-Nit occurring to degrades channel mobility during the annealing process, a device with more nitrogen shows slightly less impact ionization, leading to insignificant charge trapping-induced DIBL behavior.
Tanaka, Yasuaki; Rahmutula, Dolkun; Duggirala, Srikant; Nazer, Babak; Fang, Qizhi; Olgin, Jeffrey; Sievers, Richard; Gerstenfeld, Edward P
2016-02-01
Frequent premature ventricular contractions (PVCs) may lead to dilated cardiomyopathy. A leftward shift in the unipolar voltage distribution in patients with cardiomyopathy has also been described and attributed to increased fibrosis. We established a swine model of PVC-induced cardiomyopathy and assessed (1) whether an increase in left ventricular fibrosis occurs and (2) whether increased fibrosis leads to a leftward shift in the unipolar voltage distribution. Ten swine underwent implantation of ventricular pacemakers; 6 programmed to deliver a 50% PVC burden and 4 controls without pacing. Voltage maps were acquired at baseline and after 14 weeks of ventricular bigeminy. In the PVC group, left ventricular ejection fraction decreased from 67% ± 7% to 44% ± 15% (P < .05) with no change in controls (71% ± 6% to 73% ± 4%; P = .56). The fifth percentile of the bipolar and unipolar voltage distribution at baseline was 1.63 and 5.36 mV, respectively. In the control group, after 14 weeks of pacing there was no significant change in % bipolar voltage <1.5 mV (pre 1.2% vs post 2.2%; P = .34) or % unipolar voltage <5.5 mV (pre 4.0% vs post 3.5%; P = .20). In the PVC group, there was a significant increase in % unipolar voltage <5.5 mV (5.4% vs 12.6%; P < .01), with a leftward shift in the unipolar voltage distribution. Histologically, % fibrosis was increased in the PVC group (control 1.8% ± 1.3% vs PVC 3.4% ± 2.6%; P < .01). PVC-induced cardiomyopathy in swine leads to an increase in interstitial fibrosis and a leftward shift in the unipolar voltage distribution. These findings are consistent with findings in humans with PVC-induced cardiomyopathy. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Thouta, Samrat; Hull, Christina M; Shi, Yu Patrick; Sergeev, Valentine; Young, James; Cheng, Yen M; Claydon, Thomas W
2017-01-24
Slow deactivation of hERG channels is critical for preventing cardiac arrhythmia yet the mechanistic basis for the slow gating transition is unclear. Here, we characterized the temporal sequence of events leading to voltage sensor stabilization upon membrane depolarization. Progressive increase in step depolarization duration slowed voltage-sensor return in a biphasic manner (τ fast = 34 ms, τ slow = 2.5 s). The faster phase of voltage-sensor return slowing correlated with the kinetics of pore opening. The slower component occurred over durations that exceeded channel activation and was consistent with voltage sensor relaxation. The S4-S5 linker mutation, G546L, impeded the faster phase of voltage sensor stabilization without attenuating the slower phase, suggesting that the S4-S5 linker is important for communications between the pore gate and the voltage sensor during deactivation. These data also demonstrate that the mechanisms of pore gate-opening-induced and relaxation-induced voltage-sensor stabilization are separable. Deletion of the distal N-terminus (Δ2-135) accelerated off-gating current, but did not influence the relative contribution of either mechanism of stabilization of the voltage sensor. Lastly, we characterized mode-shift behavior in hERG channels, which results from stabilization of activated channel states. The apparent mode-shift depended greatly on recording conditions. By measuring slow activation and deactivation at steady state we found the "true" mode-shift to be ∼15 mV. Interestingly, the "true" mode-shift of gating currents was ∼40 mV, much greater than that of the pore gate. This demonstrates that voltage sensor return is less energetically favorable upon repolarization than pore gate closure. We interpret this to indicate that stabilization of the activated voltage sensor limits the return of hERG channels to rest. The data suggest that this stabilization occurs as a result of reconfiguration of the pore gate upon opening by a mechanism that is influenced by the S4-S5 linker, and by a separable voltage-sensor intrinsic relaxation mechanism. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Variations of intrathoracic amount of blood as a reason of ECG voltage changes.
Saltykova, Marina; Capderou, Andre; Atkov, Oleg; Gusakov, Victor; Konovalov, Gennagiy; Voronin, Leonid; Kaspranskiy, Rustem; Morgun, Valeriy; Bailliart, Olivier; Cermack, Milan; Vaïda, Pierre
2003-10-01
It is known that electroconduction of intrathoracic organs and tissues significantly influences the ECG voltage. It changes during therapy or exercise test due to redistribution and/or volume variations of blood and body fluids and their electroconductivity variations. This fact must be taken into consideration during interpretation of corresponding ECG. But there are no quantitative estimations of this influence on human ECG. The goals of this study were to estimate the influence of variations of thoracic electroconduction, and heart volume on QRS voltage in humans, due to gravity change. ECGs of 26 healthy volunteers were analyzed in upright and supine position. Experimental conditions-acute change of gravity--are created in a special aircraft flying on Kepler's parabola trajectory. Each parabola includes phases of normo-, hypergravity (blood shifts in caudal direction), and microgravity (blood redistributes in cranial direction). Amplitude of QRS in Frank leads in all phases has been analyzed. 2-D echo studies for six subjects were used for estimation of heart volume change. In an upright position during hypergravity the amplitude of R wave in Z increases in 95% of cases (mean 0.19 mV). During microgravity amplitude of R wave in Z decreases in 95% (mean 0.24 mV). In supine position changes of QRS voltage are not significantly. Blood redistribution during gravity change leads to changes of QRS voltage, which is more expressed and steady on R in Z lead: an average near 0.2 mV. It is due to the balance between two factors: (a). changes of degree of short circuiting by variations in the amount of blood in thorax (b). changes of distance between heart and electrodes as a result of change in the position, form, and volume of the heart.
Han, Su-Ting; Zhou, Ye; Yang, Qing Dan; Zhou, Li; Huang, Long-Biao; Yan, Yan; Lee, Chun-Sing; Roy, Vellaisamy A L
2014-02-25
Tunable memory characteristics are used in multioperational mode circuits where memory cells with various functionalities are needed in one combined device. It is always a challenge to obtain control over threshold voltage for multimode operation. On this regard, we use a strategy of shifting the work function of reduced graphene oxide (rGO) in a controlled manner through doping gold chloride (AuCl3) and obtained a gradient increase of rGO work function. By inserting doped rGO as floating gate, a controlled threshold voltage (Vth) shift has been achieved in both p- and n-type low voltage flexible memory devices with large memory window (up to 4 times for p-type and 8 times for n-type memory devices) in comparison with pristine rGO floating gate memory devices. By proper energy band engineering, we demonstrated a flexible floating gate memory device with larger memory window and controlled threshold voltage shifts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Y.; Wang, H. H.; Indacochea, J. E.
2011-12-15
Simple and low cost colorimetric sensors for explosives detection were explored and developed. Anodized aluminum oxide (AAO) with large surface area through its porous structure and light background color was utilized as the substrate for colorimetric sensors. Fabricated thin AAO films with thickness less than {approx} 500 nm allowed us to observe interference colors which were used as the background color for colorimetric detection. AAO thin films with various thickness and pore-to-pore distance were prepared through anodizing aluminum foils at different voltages and times in dilute sulfuric acid. Various interference colors were observed on these samples due to their differencemore » in structures. Accordingly, suitable anodization conditions that produce AAO samples with desired light background colors for optical applications were obtained. Thin film interference model was applied to analyze the UV-vis reflectance spectra and to estimate the thickness of the AAO membranes. We found that the thickness of produced AAO films increased linearly with anodization time in sulfuric acid. In addition, the growth rate was higher for AAO anodized using higher voltages. The thin film interference formulism was further validated with a well established layer by layer deposition technique. Coating poly(styrene sulfonate) sodium salt (PSS) and poly(allylamine hydrochloride) (PAH) layer by layer on AAO thin film consistently shifted its surface color toward red due to the increase in thickness. The red shift of UV-vis reflectance was correlated quantitatively to the number of layers been assembled. This sensitive red shift due to molecular attachment (increase in thickness) on AAO substrate was applied toward nitroaromatics detection. Aminopropyltrimethoxysilane (APTS) which can be attached onto AAO nanowells covalently through silanization and attract TNT molecules was coated and applied for TNT detection. UV-vis spectra of AAO with APTS shifted to the longer wavelength side due to TNT attachment. This red shift implied AAO thickness increased and positive detection of TNT molecules. It was also observed that both APTS and polyethyleneimine (PEI) were electron rich polymers which formed Meisenheimer complexes with TNT in solution and changed its color abruptly. This strong color change due to chemical reaction was applied as another approach for direct TNT detection. Commercial AAO films with long pores (60 {mu}m) and white background color were coated with APTS or PEI and then exposed to TNT in solution. These membranes turned to pink rapidly and eventually became visibly orange after a few hours with a strong absorption around 500 nm that was consistent with the formation of Meisenheimer complexes. The visible color change can be observed by unaided eyes and is suitable for nitroaromatics detection at higher concentration while interference color red shift in AAO thin film is designed for nitroaromatics detection at monolayer (nm) level.« less
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-01
Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.
Giant Dirac point shift of graphene phototransistors by doped silicon substrate current
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimatani, Masaaki; Ogawa, Shinpei, E-mail: Ogawa.Shimpei@eb.MitsubishiElectric.co.jp; Fujisawa, Daisuke
2016-03-15
Graphene is a promising new material for photodetectors due to its excellent optical properties and high-speed response. However, graphene-based phototransistors have low responsivity due to the weak light absorption of graphene. We have observed a giant Dirac point shift upon white light illumination in graphene-based phototransistors with n-doped Si substrates, but not those with p-doped substrates. The source-drain current and substrate current were investigated with and without illumination for both p-type and n-type Si substrates. The decay time of the drain-source current indicates that the Si substrate, SiO{sub 2} layer, and metal electrode comprise a metal-oxide-semiconductor (MOS) capacitor due tomore » the presence of defects at the interface between the Si substrate and SiO{sub 2} layer. The difference in the diffusion time of the intrinsic major carriers (electrons) and the photogenerated electron-hole pairs to the depletion layer delays the application of the gate voltage to the graphene channel. Therefore, the giant Dirac point shift is attributed to the n-type Si substrate current. This phenomenon can be exploited to realize high-performance graphene-based phototransistors.« less
Origin of positive fixed charge at insulator/AlGaN interfaces and its control by AlGaN composition
NASA Astrophysics Data System (ADS)
Matys, M.; Stoklas, R.; Blaho, M.; Adamowicz, B.
2017-06-01
The key feature for the precise tuning of Vth in GaN-based metal-insulator-semiconductor (MIS) high electron mobility transistors is the control of the positive fixed charge (Qf) at the insulator/III-N interfaces, whose amount is often comparable to the negative surface polarization charge ( Qp o l -). In order to clarify the origin of Qf, we carried out a comprehensive capacitance-voltage (C-V) characterization of SiO2/AlxGa1-xN/GaN and SiN/AlxGa1-xN/GaN structures with Al composition (x) varying from 0.15 to 0.4. For both types of structures, we observed a significant Vth shift in C-V curves towards the positive gate voltage with increasing x. On the contrary, the Schottky gate structures exhibited Vth shift towards the more negative biases. From the numerical simulations of C-V curves using the Poisson's equation supported by the analytical calculations of Vth, we showed that the Vth shift in the examined MIS structures is due to a significant decrease in the positive Qf with rising x. Finally, we examined this result with respect to various hypotheses developed in the literature to explain the origin of the positive Qf at insulator/III-N interfaces.
Sassani, Farrokh
2014-01-01
The simulation results for electromagnetic energy harvesters (EMEHs) under broad band stationary Gaussian random excitations indicate the importance of both a high transformation factor and a high mechanical quality factor to achieve favourable mean power, mean square load voltage, and output spectral density. The optimum load is different for random vibrations and for sinusoidal vibration. Reducing the total damping ratio under band-limited random excitation yields a higher mean square load voltage. Reduced bandwidth resulting from decreased mechanical damping can be compensated by increasing the electrical damping (transformation factor) leading to a higher mean square load voltage and power. Nonlinear EMEHs with a Duffing spring and with linear plus cubic damping are modeled using the method of statistical linearization. These nonlinear EMEHs exhibit approximately linear behaviour under low levels of broadband stationary Gaussian random vibration; however, at higher levels of such excitation the central (resonant) frequency of the spectral density of the output voltage shifts due to the increased nonlinear stiffness and the bandwidth broadens slightly. Nonlinear EMEHs exhibit lower maximum output voltage and central frequency of the spectral density with nonlinear damping compared to linear damping. Stronger nonlinear damping yields broader bandwidths at stable resonant frequency. PMID:24605063
GaN HEMTs with p-GaN gate: field- and time-dependent degradation
NASA Astrophysics Data System (ADS)
Meneghesso, G.; Meneghini, M.; Rossetto, I.; Canato, E.; Bartholomeus, J.; De Santi, C.; Trivellin, N.; Zanoni, E.
2017-02-01
GaN-HEMTs with p-GaN gate have recently demonstrated to be excellent normally-off devices for application in power conversion systems, thanks to the high and robust threshold voltage (VTH>1 V), the high breakdown voltage, and the low dynamic Ron increase. For this reason, studying the stability and reliability of these devices under high stress conditions is of high importance. This paper reports on our most recent results on the field- and time-dependent degradation of GaN-HEMTs with p-GaN gate submitted to stress with positive gate bias. Based on combined step-stress experiments, constant voltage stress and electroluminescence testing we demonstrated that: (i) when submitted to high/positive gate stress, the transistors may show a negative threshold voltage shift, that is ascribed to the injection of holes from the gate metal towards the p-GaN/AlGaN interface; (ii) in a step-stress experiment, the analyzed commercial devices fail at gate voltages higher than 9-10 V, due to the extremely high electric field over the p-GaN/AlGaN stack; (iii) constant voltage stress tests indicate that the failure is also time-dependent and Weibull distributed. The several processes that can explain the time-dependent failure are discussed in the following.
Ahern, Chris A; Vallejo, Paola; Mortenson, Lindsay; Coronado, Roberto
2001-01-01
Background The L-type Ca2+ channel formed by the dihydropyridine receptor (DHPR) of skeletal muscle senses the membrane voltage and opens the ryanodine receptor (RyR1). This channel-to-channel coupling is essential for Ca2+ signaling but poorly understood. We characterized a single-base frame-shift mutant of α1S, the pore subunit of the DHPR, that has the unusual ability to function voltage sensor for excitation-contraction (EC) coupling by virtue of expressing two complementary hemi-Ca2+ channel fragments. Results Functional analysis of cDNA transfected dysgenic myotubes lacking α1S were carried out using voltage-clamp, confocal Ca2+ indicator fluoresence, epitope immunofluorescence and immunoblots of expressed proteins. The frame-shift mutant (fs-α1S) expressed the N-terminal half of α1S (M1 to L670) and the C-terminal half starting at M701 separately. The C-terminal fragment was generated by an unexpected restart of translation of the fs-α1S message at M701 and was eliminated by a M701I mutation. Protein-protein complementation between the two fragments produced recovery of skeletal-type EC coupling but not L-type Ca2+ current. Discussion A premature stop codon in the II-III loop may not necessarily cause a loss of DHPR function due to a restart of translation within the II-III loop, presumably by a mechanism involving leaky ribosomal scanning. In these cases, function is recovered by expression of complementary protein fragments from the same cDNA. DHPR-RyR1 interactions can be achieved via protein-protein complementation between hemi-Ca2+ channel proteins, hence an intact II-III loop is not essential for coupling the DHPR voltage sensor to the opening of RyR1 channel. PMID:11806762
NASA Astrophysics Data System (ADS)
Deka, A. J.; Bharathi, P.; Pandya, K.; Bandyopadhyay, M.; Bhuyan, M.; Yadav, R. K.; Tyagi, H.; Gahlaut, A.; Chakraborty, A.
2018-01-01
The Doppler Shift Spectroscopy (DSS) diagnostic is in the conceptual stage to estimate beam divergence, stripping losses, and beam uniformity of the 100 keV hydrogen Diagnostics Neutral Beam of International Thermonuclear Experimental Reactor. This DSS diagnostic is used to measure the above-mentioned parameters with an error of less than 10%. To aid the design calculations and to establish a methodology for estimation of the beam divergence, DSS measurements were carried out on the existing prototype ion source RF Operated Beam Source in India for Negative ion Research. Emissions of the fast-excited neutrals that are generated from the extracted negative ions were collected in the target tank, and the line broadening of these emissions were used for estimating beam divergence. The observed broadening is a convolution of broadenings due to beam divergence, collection optics, voltage ripple, beam focusing, and instrumental broadening. Hence, for estimating the beam divergence from the observed line broadening, a systematic line profile analysis was performed. To minimize the error in the divergence measurements, a study on error propagation in the beam divergence measurements was carried out and the error was estimated. The measurements of beam divergence were done at a constant RF power of 50 kW and a source pressure of 0.6 Pa by varying the extraction voltage from 4 kV to10 kV and the acceleration voltage from 10 kV to 15 kV. These measurements were then compared with the calorimetric divergence, and the results seemed to agree within 10%. A minimum beam divergence of ˜3° was obtained when the source was operated at an extraction voltage of ˜5 kV and at a ˜10 kV acceleration voltage, i.e., at a total applied voltage of 15 kV. This is in agreement with the values reported in experiments carried out on similar sources elsewhere.
NASA Astrophysics Data System (ADS)
Chou, Kuan-Yu; Hsu, Nai-Wen; Su, Yi-Hsin; Chou, Chung-Tao; Chiu, Po-Yuan; Chuang, Yen; Li, Jiun-Yun
2018-02-01
We investigate DC characteristics of a two-dimensional electron gas (2DEG) in an undoped Si/SiGe heterostructure and its temperature dependence. An insulated-gate field-effect transistor was fabricated, and transfer characteristics were measured at 4 K-300 K. At low temperatures (T < 45 K), source electrons are injected into the buried 2DEG channel first and drain current increases with the gate voltage. By increasing the gate voltage further, the current saturates followed by a negative transconductance observed, which can be attributed to electron tunneling from the buried channel to the surface channel. Finally, the drain current is saturated again at large gate biases due to parallel conduction of buried and surface channels. By increasing the temperature, an abrupt increase in threshold voltage is observed at T ˜ 45 K and it is speculated that negatively charged impurities at the Al2O3/Si interface are responsible for the threshold voltage shift. At T > 45 K, the current saturation and negative transconductance disappear and the device acts as a normal transistor.
New Energy-Dependent Soft X-Rav Damage In MOS Devices
NASA Astrophysics Data System (ADS)
Chan, Tung-Yi; Gaw, Henry; Seligson, Daniel; Pan, Lawrence; King, Paul L.; Pianetta, Piero
1988-06-01
An energy-dependent soft x-ray-induced device damage has been discovered in MOS devices fabricated using standard CMOS process. MOS devices were irradiated by monochromatic x-rays in energy range just above and below the silicon K-edge (1.84 keV). Photons below the K-edge is found to create more damage in the oxide and oxide/silicon interface than photons above the K-edge. This energy-dependent damage effect is believed to be due to charge traps generated during device fabrication. It is found that data for both n- and p-type devices lie along a universal curve if normalized threshold voltage shifts are plotted against absorbed dose in the oxide. The threshold voltage shift saturates when the absorbed dose in the oxide exceeds 1.4X105 mJ/cm3, corresponding to 6 Mrad in the oxide. Using isochronal anneals, the trapped charge damage is found to recover with an activation energy of 0.38 eV. A discrete radiation-induced damage state appears in the low frequency C-V curve in a temperature range from 1750C to 325°C.
A microfabricated fringing field capacitive pH sensor with an integrated readout circuit
NASA Astrophysics Data System (ADS)
Arefin, Md Shamsul; Bulut Coskun, M.; Alan, Tuncay; Redoute, Jean-Michel; Neild, Adrian; Rasit Yuce, Mehmet
2014-06-01
This work presents a microfabricated fringe-field capacitive pH sensor using interdigitated electrodes and an integrated modulation-based readout circuit. The changes in capacitance of the sensor result from the permittivity changes due to pH variations and are converted to frequency shifts using a crossed-coupled voltage controlled oscillator readout circuit. The shift in resonant frequency of the readout circuit is 30.96 MHz for a change in pH of 1.0-5.0. The sensor can be used for the measurement of low pH levels, such as gastric acid, and can be integrated with electronic pills. The measurement results show high repeatability, low noise, and a stable output.
Interplay of Bias-Driven Charging and the Vibrational Stark Effect in Molecular Junctions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yajing; Zolotavin, Pavlo; Doak, Peter
We observe large, reversible, bias driven changes in the vibrational energies of PCBM based on simultaneous transport and surface-enhanced Raman spectroscopy (SERS) measurements on PCBM-gold junctions. A combination of linear and quadratic shifts in vibrational energies with voltage is analyzed and compared with similar measurements involving C-60-gold junctions. A theoretical model based on density functional theory (DFT) calculations suggests that both a vibrational Stark effect and bias-induced charging of the junction contribute to the shifts in vibrational energies. In the PCBM case, a linear vibrational Stark effect is observed due to the permanent electric dipole moment of PCBM. The vibrationalmore » Stark shifts shown here for PCBM junctions are comparable to or larger than the charging effects that dominate in C-60 junctions.« less
Interplay of Bias-Driven Charging and the Vibrational Stark Effect in Molecular Junctions
Li, Yajing; Zolotavin, Pavlo; Doak, Peter; ...
2016-01-27
We observe large, reversible, bias driven changes in the vibrational energies of PCBM based on simultaneous transport and surface-enhanced Raman spectroscopy (SERS) measurements on PCBM-gold junctions. A combination of linear and quadratic shifts in vibrational energies with voltage is analyzed and compared with similar measurements involving C-60-gold junctions. A theoretical model based on density functional theory (DFT) calculations suggests that both a vibrational Stark effect and bias-induced charging of the junction contribute to the shifts in vibrational energies. In the PCBM case, a linear vibrational Stark effect is observed due to the permanent electric dipole moment of PCBM. The vibrationalmore » Stark shifts shown here for PCBM junctions are comparable to or larger than the charging effects that dominate in C-60 junctions.« less
Muroi, Yukiko; Chanda, Baron
2009-01-01
Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.
Lateral and Vertical Organic Transistors
NASA Astrophysics Data System (ADS)
Al-Shadeedi, Akram
An extensive study has been performed to provide a better understanding of the operation principles of doped organic field-effect transistors (OFETs), organic p-i-n diodes, Schottky diodes, and organic permeable base transistors (OPBTs). This has been accomplished by a combination of electrical and structural characterization of these devices. The discussion of doped OFETs focuses on the shift of the threshold voltage due to increased doping concentrations and the generation and transport of minority charge carriers. Doping of pentacene OFETs is achieved by co-evaporation of pentacene with the n-dopant W2(hpp)4. It is found that pentacene thin film are efficiently doped and that a conductivity in the range of 2.6 x 10-6 S cm-1 for 1 wt% to 2.5 x 10-4 S cm-1 for 16 wt% is reached. It is shown that n-doped OFET consisting of an n-doped channel and n-doped contacts are ambipolar. This behavior is surprising, as n-doping the contacts should suppress direct injection of minority charge carriers (holes). It was proposed that minority charge carrier injection and hence the ambipolar characteristic of n-doped OFETs can be explained by Zener tunneling inside the intrinsic pentacene layer underneath the drain electrode. It is shown that the electric field in this layer is indeed in the range of the breakdown field of pentacene based p-i-n Zener homodiodes. Doping the channel has a profound influence on the onset voltage of minority (hole) conduction. The onset voltage can be shifted by lightly n-doping the channel. The shift of onset voltage can be explained by two mechanisms: first, due to a larger voltage that has to be applied to the gate in order to fully deplete the n-doped layer. Second, it can be attributed to an increase in hole trapping by inactive dopants. Moreover, it has been shown that the threshold voltage of majority (electron) conduction is shifted by an increase in the doping concentration, and that the ambipolar OFETs can be turned into unipolar OFETs at high doping concentrations. In subsequent chapters, the working mechanisms of OPBTs are discussed. OPBTs consist of two Schottky diodes (top and bottom diode), and the charge transport in these C60-based Schottky diodes is studied first. Two transport regimes can be distinguished in forward direction - injection limited currents (ILCs) and space charge limited currents (SCLCs). It is found that the current increases exponentially with applied voltage in the ILC regime and depends quadratically on the applied voltage in the SCLC regime. Furthermore, it is observed that the forward and backward currents of the Schottky diode are increased by decreasing the C60 layer thickness, increasing the active area, and increasing the temperature. Furthermore, in order to reach a high performance, various treatments have been applied. Air exposure, a variation of the thickness of the top electrode, as well as annealing of the diodes are used to optimize the diodes. OPBTs are processed by using the semiconductor C60 due its high charge carrier mobility and good film-forming properties. Again, the working mechanism of OPBTs is studied by electrical characterization (base-sweep measurements and output characteristics). To achieve a high performance of OPBTs, various treatments and techniques have been applied. The annealing of the OPBTs after fabrication changes the morphology of the base electrode. Thus, openings (pinholes) are formed in the base electrode, which enables a high current transfer from the upper to lower semiconductor layer. The formation of openings is proved by analyzing SEM and TEM image of the base electrode. Adding a doped layer at the emitter is another process to optimize the OPBTs. The doped layer ensures a high charge carrier injection at the emitter, leading to a high transmission and current gain. Furthermore, it has been observed that the ON/OFF ratio and transconductance of OPBTs increases by decreasing their active area. A very high transconductance gm of 37 S/cm2 is reached, which has the potential to boost the switching speed of organic transistors to 5 MHz. Furthermore, it is shown that the base electrode thickness is an essential parameter for OPBTs. The current gain beta decreases by increasing thickness of base electrode, whereas the ON/OFF ratio increases for thicker base electrodes.
Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins.
Zeimpekis, I; Sun, K; Hu, C; Ditshego, N M J; Thomas, O; de Planque, M R R; Chong, H M H; Morgan, H; Ashburn, P
2016-04-22
We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH(-1) is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH(-1) measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.
Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins
NASA Astrophysics Data System (ADS)
Zeimpekis, I.; Sun, K.; Hu, C.; Ditshego, N. M. J.; Thomas, O.; de Planque, M. R. R.; Chong, H. M. H.; Morgan, H.; Ashburn, P.
2016-04-01
We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH-1 is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH-1 measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.
Redundancy Technology With A Focused Ion Beam
NASA Astrophysics Data System (ADS)
Komano, Haruki; Hashimoto, Kazuhiko; Takigawa, Tadahiro
1989-08-01
Fuse cutting with a focused ion beam to activate redundancy circuits is proposed. In order to verify its potential usefulness, experiments have been performed. Fuse-cutting time was evaluated using aluminum fuses with a thin passivation layer, which are difficult to cut by conventional laser-beam technology due to the material's high reflectivity. The fuse width and thickness were 2 and 0.8 μm, respectively. The fuse was cut in 5 seconds with a 30 keV focused ion beam of 0.3 A/cm2 current density. Since the fuses used in DRAMs will be smaller, their cutting time will become shorter by scanning an ion beam on narrower areas. Moreover, it can be shortened by increasing current density. Fuses for redundancy technology in 256 k CMOS SRAMs were cut with a focused ion beam. The operation of the memories was checked with a memory tester. It was confirmed that memories which had failure cells operated normally after focused-ion-beam fuse-cutting. Focused ion beam irradiation effects upon a device have been studied. When a 30 keV gallium focused ion beam was irradiated near the gate of MOSFETs, a threshold voltage shift was not observed at an ion dose of 0.3 C/cm2 which corresponded to the ion dose in cutting a fuse. However, when irradiated on the gate, a threshold voltage shift was observed at ion doses of more than 8 x 10-4 C/cm2. The voltage shift was caused by the charge of ions within the passivation layer. It is necessary at least not to irradiate a focused ion beam on a device in cutting fuses. It is concluded that the focused-ion-beam method will be advantageous for future redundancy technology application.
Rani, Renu; Kundu, Anirban; Balal, Mohammad; Sheet, Goutam; Hazra, Kiran Shankar
2018-08-24
Unlike graphene nanostructures, various physical properties of nanostructured MoS 2 have remained unexplored due to the lack of established fabrication routes. Herein, we have reported unique electrostatic properties of MoS 2 nanostructures, fabricated in a controlled manner of different geometries on 2D flake by using focused laser irradiation technique. Electrostatic force microscopy has been carried out on MoS 2 nanostructures by varying tip bias voltage and lift height. The analysis depicts no contrast flip in phase image of the patterned nanostructure due to the absence of free surface charges. However, prominent change in phase shift at the patterned area is observed. Such contrast changes signify the capacitive interaction between tip and nanostructures at varying tip bias voltage and lift height, irrespective of their shape and size. Such unperturbed capacitive behavior of the MoS 2 nanostructures offer modulation of capacitance in periodic array on 2D MoS 2 flake for potential application in capacitive devices.
A ZnO nanowire-based photo-inverter with pulse-induced fast recovery.
Raza, Syed Raza Ali; Lee, Young Tack; Hosseini Shokouh, Seyed Hossein; Ha, Ryong; Choi, Heon-Jin; Im, Seongil
2013-11-21
We demonstrate a fast response photo-inverter comprised of one transparent gated ZnO nanowire field-effect transistor (FET) and one opaque FET respectively as the driver and load. Under ultraviolet (UV) light the transfer curve of the transparent gate FET shifts to the negative side and so does the voltage transfer curve (VTC) of the inverter. After termination of UV exposure the recovery of photo-induced current takes a long time in general. This persistent photoconductivity (PPC) is due to hole trapping on the surface of ZnO NWs. Here, we used a positive voltage short pulse after UV exposure, for the first time resolving the PPC issue in nanowire-based photo-detectors by accumulating electrons at the ZnO/dielectric interface. We found that a pulse duration as small as 200 ns was sufficient to reach a full recovery to the dark state from the UV induced state, realizing a fast UV detector with a voltage output.
Feng, Xing-Yao; Liu, Hong-Xia; Wang, Xing; Zhao, Lu; Fei, Chen-Xi; Liu, He-Lei
2016-12-01
The mechanism of flat band voltage (VFB) shift for alternate La2O3/Al2O3 multilayer stack structures in different annealing condition is investigated. The samples were prepared for alternate multilayer structures, which were annealed in different conditions. The capacitance-voltage (C-V) measuring results indicate that the VFB of samples shift negatively for thinner bottom Al2O3 layer, increasing annealing temperature or longer annealing duration. Simultaneously, the diffusion of high-k material to interfaces in different multilayer structures and annealing conditions is observed by X-ray photoelectron spectroscopy (XPS). Based on the dipole theory, a correlation between the diffusion effect of La towards bottom Al2O3/Si interface and VFB shift is found. Without changing the dielectric constant k of films, VFB shift can be manipulated by controlling the single-layer cycles and annealing conditions of alternate high-k multilayer stack.
A CMOS matrix for extracting MOSFET parameters before and after irradiation
NASA Technical Reports Server (NTRS)
Blaes, B. R.; Buehler, M. G.; Lin, Y.-S.; Hicks, K. A.
1988-01-01
An addressable matrix of 16 n- and 16 p-MOSFETs was designed to extract the dc MOSFET parameters for all dc gate bias conditions before and after irradiation. The matrix contains four sets of MOSFETs, each with four different geometries that can be biased independently. Thus the worst-case bias scenarios can be determined. The MOSFET matrix was fabricated at a silicon foundry using a radiation-soft CMOS p-well LOCOS process. Co-60 irradiation results for the n-MOSFETs showed a threshold-voltage shift of -3 mV/krad(Si), whereas the p-MOSFETs showed a shift of 21 mV/krad(Si). The worst-case threshold-voltage shift occurred for the n-MOSFETs, with a gate bias of 5 V during the anneal. For the p-MOSFETs, biasing did not affect the shift in the threshold voltage. A parasitic MOSFET dominated the leakage of the n-MOSFET biased with 5 V on the gate during irradiation. Co-60 test results for other parameters are also presented.
ZnO thin-film transistors with a polymeric gate insulator built on a polyethersulfone substrate
NASA Astrophysics Data System (ADS)
Hyung, Gun Woo; Park, Jaehoon; Koo, Ja Ryong; Choi, Kyung Min; Kwon, Sang Jik; Cho, Eou Sik; Kim, Yong Seog; Kim, Young Kwan
2012-03-01
Zinc oxide (ZnO) thin-film transistors (TFTs) with a cross-linked poly(vinyl alcohol) (c-PVA) insulator are fabricated on a polyethersulfone substrate. The ZnO film, formed by atomic layer deposition, shows a polycrystalline hexagonal structure with a band gap energy of about 3.37 eV. The fabricated ZnO TFT exhibits a field-effect mobility of 0.38 cm2/Vs and a threshold voltage of 0.2 V. The hysteresis of the device is mainly caused by trapped electrons at the c-PVA/ZnO interface, whereas the positive threshold voltage shift occurs as a consequence of constant positive gate bias stress after 5000 s due to an electron injection from the ZnO film into the c-PVA insulator.
NASA Astrophysics Data System (ADS)
Shin, Hee-Sun; Lee, Won-Kyu; Park, Sang-Guen; Kuk, Seung-Hee; Han, Min-Koo
2009-03-01
A new hydrogenated amorphous silicon (a-Si:H) thin film transistor (TFT) pixel circuit for active-matrix organic light emission diodes (AM-OLEDs), which significantly compensates the OLED current degradation by memorizing the threshold voltage of driving TFT and suppresses the threshold voltage shift of a-Si:H TFTs by negative bias annealing, is proposed and fabricated. During the first half of each frame, the driving TFT of the proposed pixel circuit supplies current to the OLED, which is determined by modified data voltage in the compensation scheme. The proposed pixel circuit was able to compensate the threshold voltage shift of the driving TFT as well as the OLED. During the remaining half of each frame, the proposed pixel circuit induces the recovery of the threshold voltage degradation of a-Si:H TFTs owing to the negative bias annealing. The experimental results show that the proposed pixel circuit was able to successfully compensate for the OLED current degradation and suppress the threshold voltage degradation of the driving TFT.
Method, memory media and apparatus for detection of grid disconnect
Ye, Zhihong [Clifton Park, NY; Du, Pengwei [Troy, NY
2008-09-23
A phase shift procedure for detecting a disconnect of a power grid from a feeder that is connected to a load and a distributed generator. The phase shift procedure compares a current phase shift of the output voltage of the distributed generator with a predetermined threshold and if greater, a command is issued for a disconnect of the distributed generator from the feeder. To extend the range of detection, the phase shift procedure is used when a power mismatch between the distributed generator and the load exceeds a threshold and either or both of an under/over frequency procedure and an under/over voltage procedure is used when any power mismatch does not exceed the threshold.
NASA Astrophysics Data System (ADS)
Wang, Wenwu; Akiyama, Koji; Mizubayashi, Wataru; Nabatame, Toshihide; Ota, Hiroyuki; Toriumi, Akira
2009-03-01
We systematically studied what effect Al diffusion from high-k dielectrics had on the flatband voltage (Vfb) of Al-incorporated high-k gate stacks. An anomalous positive shift fin Vfb with the decreasing equivalent oxide thickness (EOT) of high-k gate stacks is reported. As the SiO2 interfacial layer is aggressively thinned in Al-incorporated HfxAl1-xOy gate stacks with a metal-gate electrode, the Vfb first lies on the well known linear Vfb-EOT plot and deviates toward the positive-voltage direction (Vfb roll-up), followed by shifting toward negative voltage (Vfb roll-off). We demonstrated that the Vfb roll-up behavior remarkably decreases the threshold voltage (Vth) of p-type metal-oxide-semiconductor field-effect transistors (p-MOSFETs), and does not cause severe degradation in the characteristics of hole mobility. The Vfb roll-up behavior, which is independent of gate materials but strongly dependent on high-k dielectrics, was ascribed to variations in fixed charges near the SiO2/Si interface, which are caused by Al diffusion from HfxAl1-xOy through SiO2 to the SiO2/Si interface. These results indicate that anomalous positive shift in Vfb, i.e., Vfb roll-up, should be taken into consideration in quantitatively adjusting Vfb in thin EOT regions and that it could be used to further tune Vth in p-MOSFETs.
NASA Astrophysics Data System (ADS)
Zupac, Dragan; Kosier, Steven L.; Schrimpf, Ronald D.; Galloway, Kenneth F.; Baum, Keith W.
1991-10-01
The effect of noncatastrophic positive human body model (HBM) electrostatic discharge (ESD) stress on n-channel power MOSFETs is radically different from that on p-channel MOSFETs. In n-channel transistors, the stress causes negative shifts of the current-voltage characteristics indicative of positive charge trapping in the gate oxide. In p-channel transistors, the stress increases the drain-to-source leakage current, probably due to localized avalanche electron injection from the p-doped drain.
A new low voltage level-shifted FVF current mirror with enhanced bandwidth and output resistance
NASA Astrophysics Data System (ADS)
Aggarwal, Bhawna; Gupta, Maneesha; Gupta, Anil Kumar; Sangal, Ankur
2016-10-01
This paper proposes a new high-performance level-shifted flipped voltage follower (LSFVF) based low-voltage current mirror (CM). The proposed CM utilises the low-supply voltage and low-input resistance characteristics of a flipped voltage follower (FVF) CM. In the proposed CM, level-shifting configuration is used to obtain a wide operating current range and resistive compensation technique is employed to increase the operating bandwidth. The peaking in frequency response is reduced by using an additional large MOSFET. Moreover, a very high output resistance (in GΩ range) along with low-current transfer error is achieved through super-cascode configuration for a wide current range (0-440 µA). Small signal analysis is carried out to show the improvements achieved at each step. The proposed CM is simulated by Mentor Graphics Eldospice in TSMC 0.18 µm CMOS, BSIM3 and Level 53 technology. In the proposed CM, a bandwidth of 6.1799 GHz, 1% settling time of 0.719 ns, input and output resistances of 21.43 Ω and 1.14 GΩ, respectively, are obtained with a single supply voltage of 1 V. The layout of the proposed CM has been designed and post-layout simulation results have been shown. The post-layout simulation results for Monte Carlo and temperature analysis have also been included to show the reliability of the CM against the variations in process parameters and temperature changes.
NASA Astrophysics Data System (ADS)
Lükens, G.; Yacoub, H.; Kalisch, H.; Vescan, A.
2016-05-01
The interface charge density between the gate dielectric and an AlGaN/GaN heterostructure has a significant impact on the absolute value and stability of the threshold voltage Vth of metal-insulator-semiconductor (MIS) heterostructure field effect transistor. It is shown that a dry-etching step (as typically necessary for normally off devices engineered by gate-recessing) before the Al2O3 gate dielectric deposition introduces a high positive interface charge density. Its origin is most likely donor-type trap states shifting Vth to large negative values, which is detrimental for normally off devices. We investigate the influence of oxygen plasma annealing techniques of the dry-etched AlGaN/GaN surface by capacitance-voltage measurements and demonstrate that the positive interface charge density can be effectively compensated. Furthermore, only a low Vth hysteresis is observable making this approach suitable for threshold voltage engineering. Analysis of the electrostatics in the investigated MIS structures reveals that the maximum Vth shift to positive voltages achievable is fundamentally limited by the onset of accumulation of holes at the dielectric/barrier interface. In the case of the Al2O3/Al0.26Ga0.74N/GaN material system, this maximum threshold voltage shift is limited to 2.3 V.
NASA Astrophysics Data System (ADS)
Mukherjee, Shantanu; Lee, Wei-Cheng
2015-12-01
The quasiparticle interferences (QPIs) of the featureless Mott insulators are investigated by a T -matrix formalism implemented with the dynamical mean field theory (T -DMFT). In the Mott insulating state, due to the singularity at zero frequency in the real part of the electron self-energy [Re Σ (ω )˜η /ω ] predicted by DMFT, where η can be considered as the "order parameter" for the Mott insulating state, QPIs are completely washed out at small bias voltages. However, a further analysis shows that Re Σ (ω ) serves as an energy-dependent chemical potential shift. As a result, the effective bias voltage seen by the system is e V'=e V -Re Σ (e V ) , which leads to a critical bias voltage e Vc˜√{η } satisfying e V'=0 if and only if η is nonzero. Consequently, the same QPI patterns produced by the noninteracting Fermi surfaces appear at this critical bias voltage e Vc in the Mott insulating state. We propose that this reentry of noninteracting QPI patterns at e Vc could serve as an experimental signature of the Mott insulating state, and the order parameter can be experimentally measured as η ˜(eVc) 2 .
Performance analysis of resistive switching devices based on BaTiO3 thin films
NASA Astrophysics Data System (ADS)
Samardzic, Natasa; Kojic, Tijana; Vukmirovic, Jelena; Tripkovic, Djordjije; Bajac, Branimir; Srdic, Vladimir; Stojanovic, Goran
2016-03-01
Resitive switching devices, memristors, have recenty attracted much attention due to promising performances and potential applications in the field of logic and memory devices. Here, we present thin film BaTiO3 based memristor fabricated using ink-jet printing technique. Active material is a single layer barium titanate film with thickness of ̴100 nm, sandwitched between metal electodes. Printing parameters were optimized aiming to achieve stable drop flow and uniform printed layer. Current-voltage characteristics show typical memristive behavior with pinched hysteresis loop crossed at the origin, with marked differences between High Resistive State (HRS) and Low Resistive State (LRS). Obtained resistive states are stable during numerous switching processes. The device also shows unipolar switching effect for negative voltage impulses. Variable voltage impulse amplitudes leads to the shifting of the energy levels of electode contacts resulting in changing of the overall current through the device. Structural charcterization have been performed using XRD analysis and SEM micrography. High-temperature current-voltage measurements combined with transport parameter analysis using Hall efect measurement system (HMS 3000) and Impedance Analyzer AC measurements allows deeper insigth into conduction mechanism of ferroelectric memristors.
NASA Astrophysics Data System (ADS)
Hung, Cheng-Chun; Lin, Yow-Jon
2018-01-01
The effect of H2O2 treatment on the surface properties of SiO2 is studied. H2O2 treatment leads to the formation of Si(sbnd OH)x at the SiO2 surface that serves to reduce the number of trap states, inducing the shift of the Fermi level toward the conduction band minimum. H2O2 treatment also leads to a noticeable reduction in the value of the SiO2 capacitance per unit area. The effect of SiO2 layers with H2O2 treatment on the behavior of carrier transports for the pentacene/SiO2-based organic thin-film transistor (OTFT) is also studied. Experimental identification confirms that the shift of the threshold voltage towards negative gate-source voltages is due to the reduced number of trap states in SiO2 near the pentacene/SiO2 interface. The existence of a hydrogenated layer between pentacene and SiO2 leads to a change in the pentacene-SiO2 interaction, increasing the value of the carrier mobility.
MOSFET and MOS capacitor responses to ionizing radiation
NASA Technical Reports Server (NTRS)
Benedetto, J. M.; Boesch, H. E., Jr.
1984-01-01
The ionizing radiation responses of metal oxide semiconductor (MOS) field-effect transistors (FETs) and MOS capacitors are compared. It is shown that the radiation-induced threshold voltage shift correlates closely with the shift in the MOS capacitor inversion voltage. The radiation-induced interface-state density of the MOSFETs and MOS capacitors was determined by several techniques. It is shown that the presence of 'slow' states can interfere with the interface-state measurements.
NASA Astrophysics Data System (ADS)
Jizhi, Liu; Xingbi, Chen
2009-12-01
A new quasi-three-dimensional (quasi-3D) numeric simulation method for a high-voltage level-shifting circuit structure is proposed. The performances of the 3D structure are analyzed by combining some 2D device structures; the 2D devices are in two planes perpendicular to each other and to the surface of the semiconductor. In comparison with Davinci, the full 3D device simulation tool, the quasi-3D simulation method can give results for the potential and current distribution of the 3D high-voltage level-shifting circuit structure with appropriate accuracy and the total CPU time for simulation is significantly reduced. The quasi-3D simulation technique can be used in many cases with advantages such as saving computing time, making no demands on the high-end computer terminals, and being easy to operate.
The use of hydrogenous material for sensitizing pMOS dosimeters to neutrons
NASA Astrophysics Data System (ADS)
Kronenberg, S.; Brucker, G. J.
1995-02-01
This paper is concerned with the application of pMOS dosimeters to measuring neutron dose by the use of hydrogenous materials to convert incident neutron flux to recoil protons. These latter charged particles can generate electron-hole pairs, and consequently, charge trapping takes place at the MOS interfaces, and threshold voltage shifts are produced. The use of pMOS devices for measuring gamma doses has been described extensively in the literature. Clearly, if measurable voltage shifts could be generated in a MOS device by neutrons, then a radiation detection instrument containing two MOS devices, back to back, with hydrogenous shields, and one MOS dosimeter without a converter would allow 4/spl pi/ measurements of neutron and gamma doses to be made. The results obtained in this study indicate that paraffin or polyethylene will convert incident, 2.82 MeV neutrons to recoil protons, which subsequently cause measurable voltage shifts.
NASA Astrophysics Data System (ADS)
Zhang, Z. L.; Nie, Q. Y.; Zhang, X. N.; Wang, Z. B.; Kong, F. R.; Jiang, B. H.; Lim, J. W. M.
2018-04-01
The dielectric barrier discharge (DBD) is a promising technology to generate high density and uniform cold plasmas in atmospheric pressure gases. The effective independent tuning of key plasma parameters is quite important for both application-focused and fundamental studies. In this paper, based on a one-dimensional fluid model with semi-kinetics treatment, numerical studies of ionization asymmetry effects on the properties modulation of atmospheric DBD sustained by tailored voltage waveforms are reported. The driving voltage waveform is characterized by an asymmetric-slope fundamental sinusoidal radio frequency signal superimposing one or more harmonics, and the effects of the number of harmonics, phase shift, as well as the fluctuation of harmonics on the sheath dynamics, impact ionization of electrons and key plasma parameters are investigated. The results have shown that the electron density can exhibit a substantial increase due to the effective electron heating by a spatially asymmetric sheath structure. The strategic modulation of harmonics number and phase shift is capable of raising the electron density significantly (e.g., nearly three times in this case), but without a significant increase in the gas temperature. Moreover, by tailoring the fluctuation of harmonics with a steeper slope, a more profound efficiency in electron impact ionization can be achieved, and thus enhancing the electron density effectively. This method then enables a novel alternative approach to realize the independent control of the key plasma parameters under atmospheric pressure.
NASA Astrophysics Data System (ADS)
Caraveo-Frescas, J. A.; Hedhili, M. N.; Wang, H.; Schwingenschlögl, U.; Alshareef, H. N.
2012-03-01
It is shown that the well-known negative flatband voltage (VFB) shift, induced by rare-earth oxide capping in metal gate stacks, can be completely reversed in the absence of the silicon overlayer. Using TaN metal gates and Gd2O3-doped dielectric, we measure a ˜350 mV negative shift with the Si overlayer present and a ˜110 mV positive shift with the Si overlayer removed. This effect is correlated to a positive change in the average electrostatic potential at the TaN/dielectric interface which originates from an interfacial dipole. The dipole is created by the replacement of interfacial oxygen atoms in the HfO2 lattice with nitrogen atoms from TaN.
NASA Astrophysics Data System (ADS)
Sometani, Mitsuru; Okamoto, Mitsuo; Hatakeyama, Tetsuo; Iwahashi, Yohei; Hayashi, Mariko; Okamoto, Dai; Yano, Hiroshi; Harada, Shinsuke; Yonezawa, Yoshiyuki; Okumura, Hajime
2018-04-01
We investigated methods of measuring the threshold voltage (V th) shift of 4H-silicon carbide (SiC) metal–oxide–semiconductor field-effect transistors (MOSFETs) under positive DC, negative DC, and AC gate bias stresses. A fast measurement method for V th shift under both positive and negative DC stresses revealed the existence of an extremely large V th shift in the short-stress-time region. We then examined the effect of fast V th shifts on drain current (I d) changes within a pulse under AC operation. The fast V th shifts were suppressed by nitridation. However, the I d change within one pulse occurred even in commercially available SiC MOSFETs. The correlation between I d changes within one pulse and V th shifts measured by a conventional method is weak. Thus, a fast and in situ measurement method is indispensable for the accurate evaluation of I d changes under AC operation.
Ion related problems for the XLS ring
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bozoki, E.; Halama, H.
1989-07-11
The electron beam in the XLS will collide with the residual gas in the vacuum chamber. The positive ions will be trapped in the potential well of the electron beam. They will perform stable or unstable oscillations around the beam under the repetitive Coulomb force of the bunches. If not cleared, the captured ions will lead to partial or total neutralization of the beam, causing both, a decrease of life-time and a change in the vertical tunes as well as an increase in the tune-spread. They can also cause coherent transverse instabilities. The degree of neutralization {theta} that one canmore » tolerate, is primarily determined by the allowable tune shift, which of the XLS is between 1 and 5 10{sup {minus}3}. Electrostatic clearing electrodes will be used to keep the neutralization below the desired limit. In order to determine their location and the necessary clearing-rate and voltage, we examine the ion production rate, longitudinal velocity of ions in field-free regions and in the dipoles to see what distance the ions can travel without clearing before the neutralization of the beam reaches the prescribed limit, beam potential to see the locations of the potential wells, voltage requirements for ion clearing, critical mass for ion capture in the bunched beam, tune shift caused by neutralization of the beam, pressure rise due to the trapped ions and power dissipation due to beam image current. 13 refs., 3 figs., 4 tabs.« less
Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene.
Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen
2018-07-01
Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. Graphical Abstract ᅟ.
Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene
NASA Astrophysics Data System (ADS)
Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen
2018-04-01
Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. [Figure not available: see fulltext.
Hardening measures for bipolar transistors against microwave-induced damage
NASA Astrophysics Data System (ADS)
Chai, Chang-Chun; Ma, Zhen-Yang; Ren, Xing-Rong; Yang, Yin-Tang; Zhao, Ying-Bo; Yu, Xin-Hai
2013-06-01
In the present paper we study the influences of the bias voltage and the external components on the damage progress of a bipolar transistor induced by high-power microwaves. The mechanism is presented by analyzing the variation in the internal distribution of the temperature in the device. The findings show that the device becomes less vulnerable to damage with an increase in bias voltage. Both the series diode at the base and the relatively low series resistance at the emitter, Re, can obviously prolong the burnout time of the device. However, Re will aid damage to the device when the value is sufficiently high due to the fact that the highest hot spot shifts from the base-emitter junction to the base region. Moreover, the series resistance at the base Rb will weaken the capability of the device to withstand microwave damage.
NASA Technical Reports Server (NTRS)
Patterson, R. E.
1973-01-01
The purpose of the short-circuit voltage transducer is to provide engineering data to aid the evaluation of array performance during flight. The design, fabrication, calibration, and in-flight performance of the transducers onboard the Mariner 6, 7 and 9 spacecrafts are described. No significant differences were observed in the in-flight electrical performance of the three transducers. The transducers did experience significant losses due to coverslides or adhesive darkening, increased surface reflection, or spectral shifts within coverslide assembly. Mariner 6, 7 and 9 transducers showed non-cell current degradations of 3-1/2%, 3%, and 4%, respectively at Mars encounter and 6%, 3%, and 4-12%, respectively at end of mission. Mariner 9 solar Array Test 2 showed 3-12% current degradation while the transducer showed 4-12% degradation.
Silicon nanowires: electron holography studies of doped p-n junctions and biased Schottky barriers.
He, Kai; Cho, Jeong-Hyun; Jung, Yeonwoong; Picraux, S Tom; Cumings, John
2013-03-22
We report an in situ examination of individual Si p-n junction nanowires (NWs) using off-axis electron holography (EH) during transmission electron microscopy. The SiNWs were synthesized by chemical vapor deposition with an axial dopant profile from n- to p-type, and then placed inside the transmission electron microscope as a cantilever geometry in contact with a movable Pt probe for in situ biasing measurements during simultaneous EH observations. The phase shift from EH indicates the potential shift between the p- and n-segments to be 1.03 ± 0.17 V due to the built-in voltage. The I-V characteristics of a single SiNW indicate the formation of a Schottky barrier between the NW tip and the movable Pt contact. EH observations show a strong concentration of electric field at this contact, preventing a change in the Si energy bands in the p-n junction region due to the applied bias.
Factors affecting the appearance of the hump charge movement component in frog cut twitch fibers.
Hui, C S
1991-08-01
Charge movement was measured in frog cut twitch fibers with the double Vaseline gap technique. Five manipulations listed below were applied to investigate their effects on the hump component (I gamma) in the ON segments of TEST minus CONTROL current traces. When external Cl-1 was replaced by MeSO3- to eliminate Cl current, I gamma peaked earlier due to a few millivolts shift of the voltage dependence of I gamma kinetics in the negative direction. The Q-V plots in the TEA.Cl and TEA.MeSO3 solutions were well fitted by a sum of two Boltzmann distribution functions. The more steeply voltage-dependent component (Q gamma) had a V approximately 6 mV more negative in the TEA.MeSO3 solution than in the TEA.Cl solution. These voltage shifts were partially reversible. When creatine phosphate in the end pool solution was removed, the I gamma hump disappeared slowly over the course of 20-30 min, partly due to a suppression of Q gamma. The hump reappeared when creatine phosphate was restored. When 0.2-1.0 mM Cd2+ was added to the center pool solution to block inward Ca current, the I gamma hump became less prominent due to a prolongation in the time course of I gamma but not to a suppression of Q gamma. When the holding potential was changed from -90 to -120 mV, the amplitude of I beta was increased, thereby obscuring the I gamma hump. Finally, when a cut fiber was stimulated repetitively, I gamma lost its hump appearance because its time course was prolonged. In an extreme case, a 5-min resting interval was insufficient for a complete recovery of the waveform. In general, a stimulation rate of once per minute had a negligible effect on the shape of I gamma. Of the five manipulations, MeSO3- has the least perturbation on the appearance of I gamma and is potentially a better substitute for Cl- than SO2-(4) in eliminating Cl current if the appearance of the I gamma hump is to be preserved.
Infant breathing rate counter based on variable resistor for pneumonia
NASA Astrophysics Data System (ADS)
Sakti, Novi Angga; Hardiyanto, Ardy Dwi; La Febry Andira R., C.; Camelya, Kesa; Widiyanti, Prihartini
2016-03-01
Pneumonia is one of the leading causes of death in new born baby in Indonesia. According to WHO in 2002, breathing rate is very important index to be the symptom of pneumonia. In the Community Health Center, the nurses count with a stopwatch for exactly one minute. Miscalculation in Community Health Center occurs because of long time concentration and focus on two object at once. This calculation errors can cause the baby who should be admitted to the hospital only be attended at home. Therefore, an accurate breathing rate counter at Community Health Center level is necessary. In this work, resistance change of variable resistor is made to be breathing rate counter. Resistance change in voltage divider can produce voltage change. If the variable resistance moves periodically, the voltage will change periodically too. The voltage change counted by software in the microcontroller. For the every mm shift at the variable resistor produce average 0.96 voltage change. The software can count the number of wave generated by shifting resistor.
Estacion, Mark
2017-01-01
The Nav1.7 sodium channel is preferentially expressed within dorsal root ganglion (DRG) and sympathetic ganglion neurons. Gain-of-function mutations that cause the painful disorder inherited erythromelalgia (IEM) shift channel activation in a hyperpolarizing direction. When expressed within DRG neurons, these mutations produce a depolarization of resting membrane potential (RMP). The biophysical basis for the depolarized RMP has to date not been established. To explore the effect on RMP of the shift in activation associated with a prototypical IEM mutation (L858H), we used dynamic-clamp models that represent graded shifts that fractionate the effect of the mutation on activation voltage dependence. Dynamic-clamp recording from DRG neurons using a before-and-after protocol for each cell made it possible, even in the presence of cell-to-cell variation in starting RMP, to assess the effects of these graded mutant models. Our results demonstrate a nonlinear, progressively larger effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. The observed differences in RMP were predicted by the “late” current of each mutant model. Since the depolarization of RMP imposed by IEM mutant channels is known, in itself, to produce hyperexcitability of DRG neurons, the development of pharmacological agents that normalize or partially normalize activation voltage dependence of IEM mutant channels merits further study. NEW & NOTEWORTHY Inherited erythromelalgia (IEM), the first human pain disorder linked to a sodium channel, is widely regarded as a genetic model of neuropathic pain. IEM is produced by Nav1.7 mutations that hyperpolarize activation. These mutations produce a depolarization of resting membrane potential (RMP) in dorsal root ganglion neurons. Using dynamic clamp to explore the effect on RMP of the shift in activation, we demonstrate a nonlinear effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. PMID:28148645
NASA Astrophysics Data System (ADS)
Dong, Xiaofei; Xu, Jianping; Shi, Shaobo; Zhang, Xiaosong; Li, Lan; Yin, Shougen
2017-05-01
We report tunable electroluminescence (EL) from solution-processed ZnCuInS/ZnS (ZCIS/ZnS) quantum dots (QDs)/poly(9-vinlycarbazole) multilayer films. The EL spectra exhibit a red shift as the QD layer thickness increases. By analyzing the dependence of the applied voltage and the ZCIS/ZnS QD layer thickness on the EL spectra, the origin of the red shift is associated with the increased trap density of QDs that induces the injected electrons to be trapped in the deep donor level. The current conduction mechanism based on the current density-voltage curves at different voltage regions was discussed.
Charge movement in gating-locked HCN channels reveals weak coupling of voltage sensors and gate.
Ryu, Sujung; Yellen, Gary
2012-11-01
HCN (hyperpolarization-activated cyclic nucleotide gated) pacemaker channels have an architecture similar to that of voltage-gated K(+) channels, but they open with the opposite voltage dependence. HCN channels use essentially the same positively charged voltage sensors and intracellular activation gates as K(+) channels, but apparently these two components are coupled differently. In this study, we examine the energetics of coupling between the voltage sensor and the pore by using cysteine mutant channels for which low concentrations of Cd(2+) ions freeze the open-closed gating machinery but still allow the sensors to move. We were able to lock mutant channels either into open or into closed states by the application of Cd(2+) and measure the effect on voltage sensor movement. Cd(2+) did not immobilize the gating charge, as expected for strict coupling, but rather it produced shifts in the voltage dependence of voltage sensor charge movement, consistent with its effect of confining transitions to either closed or open states. From the magnitude of the Cd(2+)-induced shifts, we estimate that each voltage sensor produces a roughly three- to sevenfold effect on the open-closed equilibrium, corresponding to a coupling energy of ∼1.3-2 kT per sensor. Such coupling is not only opposite in sign to the coupling in K(+) channels, but also much weaker.
Effects of acidic pH on voltage-gated ion channels in rat trigeminal mesencephalic nucleus neurons.
Han, Jin-Eon; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung
2017-03-01
The effects of acidic pH on several voltage-dependent ion channels, such as voltage-dependent K + and Ca 2+ channels, and hyperpolarization-gated and cyclic nucleotide-activated cation (HCN) channels, were examined using a whole-cell patch clamp technique on mechanically isolated rat mesencephalic trigeminal nucleus neurons. The application of a pH 6.5 solution had no effect on the peak amplitude of voltage-dependent K + currents. A pH 6.0 solution slightly, but significantly inhibited the peak amplitude of voltage-dependent K + currents. The pH 6.0 also shifted both the current-voltage and conductance-voltage relationships to the depolarization range. The application of a pH 6.5 solution scarcely affected the peak amplitude of membrane currents mediated by HCN channels, which were profoundly inhibited by the general HCN channel blocker Cs + (1 mM). However, the pH 6.0 solution slightly, but significantly inhibited the peak amplitude of HCN-mediated currents. Although the pH 6.0 solution showed complex modulation of the current-voltage and conductance-voltage relationships, the midpoint voltages for the activation of HCN channels were not changed by acidic pH. On the other hand, voltage-dependent Ca 2+ channels were significantly inhibited by an acidic pH. The application of an acidic pH solution significantly shifted the current-voltage and conductance-voltage relationships to the depolarization range. The modulation of several voltage-dependent ion channels by an acidic pH might affect the excitability of mesencephalic trigeminal nucleus neurons, and thus physiological functions mediated by the mesencephalic trigeminal nucleus could be affected in acidic pH conditions.
NASA Astrophysics Data System (ADS)
Liao, Po-Yung; Chang, Ting-Chang; Su, Wan-Ching; Chen, Bo-Wei; Chen, Li-Hui; Hsieh, Tien-Yu; Yang, Chung-Yi; Chang, Kuan-Chang; Zhang, Sheng-Dong; Huang, Yen-Yu; Chang, Hsi-Ming; Chiang, Shin-Chuan
2017-06-01
This letter investigates repeated uniaxial mechanical stress-induced degradation behavior in flexible amorphous In-Ga-Zn-O thin-film transistors (TFTs) of different geometric structures. Two types of via-contact structure TFTs are investigated: symmetrical and UI structure (TFTs with I- and U-shaped asymmetric electrodes). After repeated mechanical stress, I-V curves for the symmetrical structure show a significant negative threshold voltage (VT) shift, due to mechanical stress-induced oxygen vacancy generation. However, degradation in the UI structure TFTs after stress is a negative VT shift along with the parasitic transistor characteristic in the forward-operation mode, with this hump not evident in the reverse-operation mode. This asymmetrical degradation is clarified by the mechanical strain simulation of the UI TFTs.
NASA Astrophysics Data System (ADS)
Tang, Lan-Feng; Yu, Guang; Lu, Hai; Wu, Chen-Fei; Qian, Hui-Min; Zhou, Dong; Zhang, Rong; Zheng, You-Dou; Huang, Xiao-Ming
2015-08-01
The influence of white light illumination on the stability of an amorphous InGaZnO thin film transistor is investigated in this work. Under prolonged positive gate bias stress, the device illuminated by white light exhibits smaller positive threshold voltage shift than the device stressed under dark. There are simultaneous degradations of field-effect mobility for both stressed devices, which follows a similar trend to that of the threshold voltage shift. The reduced threshold voltage shift under illumination is explained by a competition between bias-induced interface carrier trapping effect and photon-induced carrier detrapping effect. It is further found that white light illumination could even excite and release trapped carriers originally exiting at the device interface before positive gate bias stress, so that the threshold voltage could recover to an even lower value than that in an equilibrium state. The effect of photo-excitation of oxygen vacancies within the a-IGZO film is also discussed. Project supported by the State Key Program for Basic Research of China (Grant Nos. 2011CB301900 and 2011CB922100) and the Priority Academic Program Development of Jiangsu Higher Education Institutions, China.
Wang, Liang; Zhang, En Xia; Schrimpf, Ronald D.; ...
2015-12-17
Here, the total ionizing dose response of Ge channel pFETs with raised Si 0.55Ge 0.45 source/drain is investigated under different radiation bias conditions. Threshold-voltage shifts and transconductance degradation are noticeable only for negative-bias (on state) irradiation, and are mainly due to negative bias-temperature instability (NBTI). Nonmonotonic leakage changes during irradiation are observed, which are attributed to the competition of radiation-induced field transistor leakage and S/D junction leakage.
Choi, Sungjin; Lee, Junhyuk; Kim, Donghyoun; Oh, Seulki; Song, Wangyu; Choi, Seonjun; Choi, Eunsuk; Lee, Seung-Beck
2011-12-01
We report on the fabrication and capacitance-voltage characteristics of double layer nickel-silicide nanocrystals with Si3N4 interlayer tunnel barrier for nano-floating gate memory applications. Compared with devices using SiO2 interlayer, the use of Si3N4 interlayer separation reduced the average size (4 nm) and distribution (+/- 2.5 nm) of NiSi2 nanocrystal (NC) charge traps by more than 50% and giving a two fold increase in NC density to 2.3 x 10(12) cm(-2). The increased density and reduced NC size distribution resulted in a significantly decrease in the distribution of the device C-V characteristics. For each program voltage, the distribution of the shift in the threshold voltage was reduced by more than 50% on average to less than 0.7 V demonstrating possible multi-level-cell operation.
NASA Astrophysics Data System (ADS)
Zonno, Irene; Martinez-Otero, Alberto; Hebig, Jan-Christoph; Kirchartz, Thomas
2017-03-01
The Mott-Schottky analysis in the dark is a frequently used method to determine the doping concentration of semiconductors from capacitance-voltage measurements, even for such complex systems as polymer:fullerene blends used for organic solar cells. While the analysis of capacitance-voltage measurements in the dark is relatively well established, the analysis of data taken under illumination is currently not fully understood. Here, we present experiments and simulations to show which physical mechanisms affect the Mott-Schottky analysis under illumination. We show that the mobility of the blend has a major influence on the shape of the capacitance-voltage curve and can be obtained from data taken under reverse bias. In addition, we show that the apparent shift of the built-in voltage observed previously can be explained by a shift of the onset of space-charge-limited collection with illumination intensity.
Cheng, Lan; Sanguinetti, Michael C
2009-05-01
Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chun, Minkyu; Um, Jae Gwang; Park, Min Sang
We report the abnormal behavior of the threshold voltage (V{sub TH}) shift under positive bias Temperature stress (PBTS) and negative bias temperature stress (NBTS) at top/bottom gate in dual gate amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors (TFTs). It is found that the PBTS at top gate shows negative transfer shift and NBTS shows positive transfer shift for both top and bottom gate sweep. The shift of bottom/top gate sweep is dominated by top gate bias (V{sub TG}), while bottom gate bias (V{sub BG}) is less effect than V{sub TG}. The X-ray photoelectron spectroscopy (XPS) depth profile provides the evidence of Inmore » metal diffusion to the top SiO{sub 2}/a-IGZO and also the existence of large amount of In{sup +} under positive top gate bias around top interfaces, thus negative transfer shift is observed. On the other hand, the formation of OH{sup −} at top interfaces under the stress of negative top gate bias shows negative transfer shift. The domination of V{sub TG} both on bottom/top gate sweep after PBTS/NBTS is obviously occurred due to thin active layer.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niang, K. M.; Flewitt, A. J., E-mail: ajf@eng.cam.ac.uk; Barquinha, P. M. C.
Thin film transistors (TFTs) employing an amorphous indium gallium zinc oxide (a-IGZO) channel layer exhibit a positive shift in the threshold voltage under the application of positive gate bias stress (PBS). The time and temperature dependence of the threshold voltage shift was measured and analysed using the thermalization energy concept. The peak energy barrier to defect conversion is extracted to be 0.75 eV and the attempt-to-escape frequency is extracted to be 10{sup 7} s{sup −1}. These values are in remarkable agreement with measurements in a-IGZO TFTs under negative gate bias illumination stress (NBIS) reported recently (Flewitt and Powell, J. Appl. Phys.more » 115, 134501 (2014)). This suggests that the same physical process is responsible for both PBS and NBIS, and supports the oxygen vacancy defect migration model that the authors have previously proposed.« less
Weiss, Jonathan D.
1997-01-01
A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field.
Capacitance-voltage measurement in memory devices using ferroelectric polymer
NASA Astrophysics Data System (ADS)
Nguyen, Chien A.; Lee, Pooi See
2006-01-01
Application of thin polymer film as storing mean for non-volatile memory devices is investigated. Capacitance-voltage (C-V) measurement of metal-ferroelectric-metal device using ferroelectric copolymer P(VDF-TrFE) as dielectric layer shows stable 'butter-fly' curve. The two peaks in C-V measurement corresponding to the largest capacitance are coincidental at the coercive voltages that give rise to zero polarization in the polarization hysteresis measurement. By comparing data of C-V and P-E measurement, a correlation between two types of hysteresis is established in which it reveals simultaneous electrical processes occurring inside the device. These processes are caused by the response of irreversible and reversible polarization to the applied electric field that can be used to present a memory window. The memory effect of ferroelectric copolymer is further demonstrated for fabricating polymeric non-volatile memory devices using metal-ferroelectric-insulator-semiconductor structure (MFIS). By applying different sweeping voltages at the gate, bidirectional flat-band voltage shift is observed in the ferroelectric capacitor. The asymmetrical shift after negative sweeping is resulted from charge accumulation at the surface of Si substrate caused by the dipole direction in the polymer layer. The effect is reversed for positive voltage sweeping.
Digitally controlled distributed phase shifter
Hietala, V.M.; Kravitz, S.H.; Vawter, G.A.
1993-08-17
A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.
Digitally controlled distributed phase shifter
Hietala, Vincent M.; Kravitz, Stanley H.; Vawter, Gregory A.
1993-01-01
A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.
Son, Dong-Ick; Park, Dong-Hee; Choi, Won Kook; Cho, Sung-Hwan; Kim, Won-Tae; Kim, Tae Whan
2009-05-13
The bistable effects of ZnO nanoparticles embedded in an insulating poly(methyl methacrylate) (PMMA) polymer single layer by using flexible polyethylene terephthalate (PET) substrates were investigated. Transmission electron microscopy (TEM) images revealed that ZnO nanoparticles were formed inside the PMMA polymer layer. Current-voltage (I-V) measurement on the Al/ZnO nanoparticles embedded in an insulating PMMA polymer layer/ITO/PET structures at 300 K showed a nonvolatile electrical bistability behavior with a flat-band voltage shift due to the existence of the ZnO nanoparticles, indicative of trapping, storing, and emission of charges in the electronic states of the ZnO nanoparticles. The carrier transport mechanism of the bistable behavior for the fabricated organic bistable device (OBD) structures is described on the basis of the I-V results by analyzing the effect of space charge.
Design of multi-wavelength tunable filter based on Lithium Niobate
NASA Astrophysics Data System (ADS)
Zhang, Ailing; Yao, Yuan; Zhang, Yue; Song, Hongyun
2018-05-01
A multi-wavelength tunable filter is designed. It consists of multiple waveguides among multiple waveguide gratings. A pair of electrodes were placed on both sides of each waveguide. The tunable filter uses the electro-optic effect of Lithium Niobate to tune the phase caused by each waveguide. Consequently, the wavelength and wavelength spacing of the filter are tuned by changing external voltages added on the electrode pairs. The tunable property of the filter is analyzed by phase matching condition and transfer-matrix method. Numerical results show that not only multiple wavelengths with narrow bandwidth are tuned with nearly equal spacing by synchronously changing the voltages added on all electrode pairs, but also the number of wavelengths is determined by the number of phase shifts caused by electrode pairs. Furthermore, due to the electro-optic effect of Lithium Niobate, the tuning speed of the filter can reach the order of ns.
Arc Inception Mechanism on a Solar Array Immersed in a Low-Density Plasma
NASA Technical Reports Server (NTRS)
Vayner, B.; Galofaro, J.; Ferguson, D.
2001-01-01
In this report, results are presented of an experimental and theoretical study of arc phenomena and snapover for two samples of solar arrays immersed in argon plasma. The effects of arcing and snapover are investigated. I-V curves are measured, and arc and snapover inception voltages and arc rates are determined within the wide range of plasma parameters. A considerable increase in arc rate due to absorption of molecules from atmospheric air has been confirmed. It is shown that increasing gas pressure causes increasing ion current collection and, consequently, arc rate even though the effect of conditioning also takes place. Arc sites have been determined by employing a video-camera. It is confirmed that keeping sample under high vacuum for a long time results in shifting arc threshold voltage well below -300 V. The results obtained seem to be important for the understanding of arc inception mechanism.
Cumulative dose 60Co gamma irradiation effects on AlGaN/GaN Schottky diodes and its area dependence
NASA Astrophysics Data System (ADS)
Sharma, Chandan; Laishram, Robert; Rawal, Dipendra Singh; Vinayak, Seema; Singh, Rajendra
2018-04-01
Cumulative dose gamma radiation effects on current-voltage characteristics of GaN Schottky diodes have been investigated. The different area diodes have been fabricated on AlGaN/GaN high electron mobility transistor (HEMT) epi-layer structure grown over SiC substrate and irradiated with a dose up to the order of 104 Gray (Gy). Post irradiation characterization shows a shift in the turn-on voltage and improvement in reverse leakage current. Other calculated parameters include Schottky barrier height, ideality factor and reverse saturation current. Schottky barrier height has been decreased whereas reverse saturation current shows an increase in the value post irradiation with improvement in the ideality factor. Transfer length measurement (TLM) characterization shows an improvement in the contact resistance. Finally, diodes with larger area have more variation in the calculated parameters due to the induced local heating effect.
Detection of ionized gas molecules in air by graphene and carbon nanotube networks
NASA Astrophysics Data System (ADS)
Hao, Ji; Li, Bo; Yung, Hyun Young; Liu, Fangze; Hong, Sanghyung; Jung, Yung Joon; Kar, Swastik
The liquid phase ions sensing by graphene and carbon nanotube has been demonstrated in many publications due to the minimum gate voltage easily shift induced by ionic gating effect, but it is still unclear for vapor phase ions sensing. Here we want to report that the ionized gas molecules in air can be also very sensitively detected by graphene and carbon nanotube networks under very low applied voltage, which shows the very high charge to current amplification factor, the value can be up to 108 A/C, and the direction of current-change can be used to differentiate the positive and negative ions. In further, the field effect of graphene device induced by vapor phase ions was discussed. NSF ECCS 1202376, NSF ECCS CAREER 1351424 and NSF DMREF 1434824, a Northeastern University Provost's Tier-1 seed Grant for interdisciplinary research, Technology Innovation Program (10050481) from Ministry of Trade, Industry & Energy of Republic of Korea.
Barbiturates Block Sodium and Potassium Conductance Increases in Voltage-Clamped Lobster Axons
Blaustein, M. P.
1968-01-01
Sodium pentobarbital and sodium thiopental decrease both the peak initial (Na) and late steady-state (K) currents and reduce the maximum sodium and potassium conductance increases in voltage-clamped lobster giant axons. These barbiturates also slow the rate at which the sodium conductance turns on, and shift the normalized sodium conductance vs. voltage curves in the direction of depolarization along the voltage axis. Since pentobarbital (pKa = 8.0) blocks the action potential more effectively at pH 8.5 than at pH 6.7, the anionic form of the drug appears to be active. The data suggest that these drugs affect the axon membrane directly, rather than secondarily through effects on intermediary metabolism. It is suggested that penetration of the lipid layer of the membrane by the nonpolar portion of the barbiturate molecules may cause the decrease in membrane conductances, while electrostatic interactions involving the anionic group on the barbiturate, divalent cations, and "fixed charges" in the membrane could account for the slowing of the rate of sodium conductance turn-on and the shift of the normalized conductance curves along the voltage axis. PMID:5648829
Proof-of-principle Experiment of a Ferroelectric Tuner for the 1.3 GHz Cavity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi,E.M.; Hahn, H.; Shchelkunov, S. V.
2009-01-01
A novel tuner has been developed by the Omega-P company to achieve fast control of the accelerator RF cavity frequency. The tuner is based on the ferroelectric property which has a variable dielectric constant as function of applied voltage. Tests using a Brookhaven National Laboratory (BNL) 1.3 GHz electron gun cavity have been carried out for a proof-of-principle experiment of the ferroelectric tuner. Two different methods were used to determine the frequency change achieved with the ferroelectric tuner (FT). The first method is based on a S11 measurement at the tuner port to find the reactive impedance change when themore » voltage is applied. The reactive impedance change then is used to estimate the cavity frequency shift. The second method is a direct S21 measurement of the frequency shift in the cavity with the tuner connected. The estimated frequency change from the reactive impedance measurement due to 5 kV is in the range between 3.2 kHz and 14 kHz, while 9 kHz is the result from the direct measurement. The two methods are in reasonable agreement. The detail description of the experiment and the analysis are discussed in the paper.« less
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channelmore » expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.« less
A mathematical approach for evaluating nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Leibecki, H. F.
1986-01-01
A mathematical equation is presented which gives a quantitative relationship between time-voltage discharge curves, when a cell's ampere-hour capacity is determined at a constant discharge current. In particular the equation quantifies the initial exponential voltage decay; the rate of voltage decay; the overall voltage shift of the curve and the total capacity of the cell at the given discharge current. The results of 12 nickel-hydrogen boiler plate cells cycled to 80 percent depth-of-discharge (DOD) are discussed in association with these equations.
Raman spectrum method for characterization of pull-in voltages of graphene capacitive shunt switches
NASA Astrophysics Data System (ADS)
Li, Peng; You, Zheng; Cui, Tianhong
2012-12-01
An approach using Raman spectrum method is reported to measure pull-in voltages of graphene capacitive shunt switches. When the bias excesses the pull-in voltage, the Raman spectrum's intensity largely decreases. Two factors that contribute to the intensity reduction are investigated. Moreover, by monitoring the frequency shift of G peak and 2D band, we are able to detect the pull-in voltage and measure the strain change in graphene beams during switching.
Barai, Pallab; Smith, Kandler; Chen, Chien -Fan; ...
2015-06-17
In this paper, a one-dimensional computational framework is developed that can solve for the evolution of voltage and current in a lithium-ion battery electrode under different operating conditions. A reduced order model is specifically constructed to predict the growth of mechanical degradation within the active particles of the carbon anode as a function of particle size and C-rate. Using an effective diffusivity relation, the impact of microcracks on the diffusivity of the active particles has been captured. Reduction in capacity due to formation of microcracks within the negative electrode under different operating conditions (constant current discharge and constant current constantmore » voltage charge) has been investigated. At the beginning of constant current discharge, mechanical damage to electrode particles predominantly occurs near the separator. As the reaction front shifts, mechanical damage spreads across the thickness of the negative electrode and becomes relatively uniform under multiple discharge/charge cycles. Mechanical degradation under different drive cycle conditions has been explored. It is observed that electrodes with larger particle sizes are prone to capacity fade due to microcrack formation. Finally, under drive cycle conditions, small particles close to the separator and large particles close to the current collector can help in reducing the capacity fade due to mechanical degradation.« less
Rosenkranz, J. Amiel
2012-01-01
The amygdala has a fundamental role in driving affective behaviors in response to sensory cues. To accomplish this, neurons of the lateral nucleus (LAT) must integrate a large number of synaptic inputs. A wide range of factors influence synaptic integration, including membrane potential, voltage-gated ion channels and GABAergic inhibition. However, little is known about how these factors modulate integration of synaptic inputs in LAT neurons in vivo. The purpose of this study was to determine the voltage-dependent factors that modify in vivo integration of synaptic inputs in the soma of LAT neurons. In vivo intracellular recordings from anesthetized rats were used to measure post-synaptic potentials (PSPs) and clusters of PSPs across a range of membrane potentials. These studies found that the relationship between membrane potential and PSP clusters was sublinear, due to a reduction of cluster amplitude and area at depolarized membrane potentials. In combination with intracellular delivery of pharmacological agents, it was found that the voltage-dependent suppression of PSP clusters was sensitive to tetraethylammonium (TEA), but not cesium or a blocker of fast GABAergic inhibition. These findings indicate that integration of PSPs in LAT neurons in vivo is strongly modified by somatic membrane potential, likely through voltage-dependent TEA-sensitive potassium channels. Conditions that lead to a shift in membrane potential, or a modulation of the number or function of these ion channels will lead to a more uniform capacity for integration across voltages, and perhaps greatly facilitate amygdala-dependent behaviors. PMID:22989917
NASA Technical Reports Server (NTRS)
1997-01-01
Frank Nola invented the Power Factor Controller (PFC) at Marshall Space Flight Center more than a decade ago. Nola came up with a way to curb power wastage in AC induction motors. The PFC matches voltage with the motor's actual need by continuously sensing shifts between voltage and current. When it senses a light load it cuts the voltage to the minimum needed. Potential energy savings range from 8 to 65 percent.
1997-01-01
Frank Nola invented the Power Factor Controller (PFC) at Marshall Space Flight Center more than a decade ago. Nola came up with a way to curb power wastage in AC induction motors. The PFC matches voltage with the motor's actual need by continuously sensing shifts between voltage and current. When it senses a light load it cuts the voltage to the minimum needed. Potential energy savings range from 8 to 65 percent.
Weiss, J.D.
1997-01-14
A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field. 6 figs.
van der Wel, C M; Kortschot, R J; Bakelaar, I A; Erné, B H; Kuipers, B W M
2013-03-01
The sensitivity of an imperfectly balanced impedance bridge is limited by the remaining offset voltage. Here, we present a procedure for offset reduction in impedance measurements using a lock-in amplifier, by applying a complex compensating voltage external to the bridge. This procedure takes into account instrumental damping and phase shifting, which generally occur at the high end of the operational frequency range. Measurements demonstrate that the output of the circuit rapidly converges to the instrumentally limited noise at any frequency.
Basic corrections to predictions of solar cell performance required by nonlinearities
NASA Technical Reports Server (NTRS)
Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.
1976-01-01
The superposition principle is used to derive the approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. The derivation requires the linearity of the boundary value problems that underlie the electrical characteristics. The shifting approximation is invalid if considerable photocurrent and considerable dark current both occur within the junction space-charge region; it is invalid also if sizable series resistance is present or if high-injection concentrations of holes and electrons exist within the quasi-neutral regions.
Mauger, Scott A.; Steirer, K. Xerxes; Boe, Jonas; ...
2016-01-19
Here, this work focuses on the role of humidity in the formation of ZnO thin films from a reactive diethylzinc precursor solution for use as the electron contact layer (ECL) in organic photovoltaic (OPV) devices. This method is well suited for flexible devices because the films are annealed at 120 °C, making the process compatible with polymer substrates. ZnO films were prepared by spin coating and annealing at different relative humidity (RH) levels. It is found that RH during coating and annealing affects the chemical and physical properties of the ZnO films. Using x-ray photoelectron spectroscopy it is found thatmore » increasing RH during the formation steps produces a more stoichiometric oxide and a higher Zn/O ratio. Spectroscopic ellipsometry data shows a small decrease in the optical band gap with increased humidity, consistent with a more stoichiometric oxide. Kelvin probe measurements show that increased RH during formation results in a larger work function (i.e. further from vacuum). Consistent with these data, but counter to what might be expected, when these ZnO films are used as ECLs in OPV devices those with ZnO ECLs processed in low RH (less stoichiometric) had higher power conversion efficiency than those with high-RH processed ZnO due to improved open-circuit voltage. The increase in open-circuit voltage with decreasing humidity was observed with two different donor polymers and fullerene acceptors, which shows the trend is due to changes in ZnO. The observed changes in open-circuit voltage follow the same trend as the ZnO work function indicating that the increase in open-circuit voltage with decreasing humidity is the result of improved energetics at the interface between the bulk-heterojunction and the ZnO layer due to a vacuum level shift.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Wei, E-mail: wwei99@jlu.edu.cn; Han, Jinhua; Ying, Jun
2014-09-22
Two types of floating-gate based organic thin-film transistor nonvolatile memories (FG-OTFT-NVMs) were demonstrated, with poly(methyl methacrylate co glycidyl methacrylate) (P(MMA-GMA)) and tetratetracontane (TTC) as the tunneling layer, respectively. Their device performances were measured and compared. In the memory with a P(MMA-GMA) tunneling layer, typical unipolar hole transport was obtained with a relatively small mobility of 0.16 cm{sup 2}/V s. The unidirectional shift of turn-on voltage (V{sub on}) due to only holes trapped/detrapped in/from the floating gate resulted in a small memory window of 12.5 V at programming/erasing voltages (V{sub P}/V{sub E}) of ±100 V and a nonzero reading voltage. Benefited from the well-ordered moleculemore » orientation and the trap-free surface of TTC layer, a considerably high hole mobility of 1.7 cm{sup 2}/V s and a visible feature of electrons accumulated in channel and trapped in floating-gate were achieved in the memory with a TTC tunneling layer. High hole mobility resulted in a high on current and a large memory on/off ratio of 600 at the V{sub P}/V{sub E} of ±100 V. Both holes and electrons were injected into floating-gate and overwritten each other, which resulted in a bidirectional V{sub on} shift. As a result, an enlarged memory window of 28.6 V at the V{sub P}/V{sub E} of ±100 V and a zero reading voltage were achieved. Based on our results, a strategy is proposed to optimize FG-OTFT-NVMs by choosing a right tunneling layer to improve the majority carrier mobility and realize ambipolar carriers injecting and trapping in the floating-gate.« less
Tsai, Cheng-Tao; Tseng, Sheng-Yu
2013-01-01
This paper presents comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier. In high current capability and high step-down voltage conversion, a phase-shift full-bridge converter with a conventional current-doubler rectifier has the common limitations of extremely low duty ratio and high component stresses. To overcome these limitations, a phase-shift full-bridge converter with a noncoupled current-doubler rectifier (NCDR) or a coupled current-doubler rectifier (CCDR) is, respectively, proposed and implemented. In this study, performance analysis and efficiency obtained from a 500 W phase-shift full-bridge converter with two improved current-doubler rectifiers are presented and compared. From their prototypes, experimental results have verified that the phase-shift full-bridge converter with NCDR has optimal duty ratio, lower component stresses, and output current ripple. In component count and efficiency comparison, CCDR has fewer components and higher efficiency at full load condition. For small size and high efficiency requirements, CCDR is relatively suitable for high step-down voltage and high efficiency applications. PMID:24381521
Tsai, Cheng-Tao; Su, Jye-Chau; Tseng, Sheng-Yu
2013-01-01
This paper presents comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier. In high current capability and high step-down voltage conversion, a phase-shift full-bridge converter with a conventional current-doubler rectifier has the common limitations of extremely low duty ratio and high component stresses. To overcome these limitations, a phase-shift full-bridge converter with a noncoupled current-doubler rectifier (NCDR) or a coupled current-doubler rectifier (CCDR) is, respectively, proposed and implemented. In this study, performance analysis and efficiency obtained from a 500 W phase-shift full-bridge converter with two improved current-doubler rectifiers are presented and compared. From their prototypes, experimental results have verified that the phase-shift full-bridge converter with NCDR has optimal duty ratio, lower component stresses, and output current ripple. In component count and efficiency comparison, CCDR has fewer components and higher efficiency at full load condition. For small size and high efficiency requirements, CCDR is relatively suitable for high step-down voltage and high efficiency applications.
NASA Astrophysics Data System (ADS)
Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong
2017-08-01
This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.
NASA Astrophysics Data System (ADS)
Lee, Pui Fai
2007-12-01
Nanocrystals (NC) embedded in dielectrics have attracted a great deal of attention recently because they can potentially be applied in nonvolatile, high-speed, high-density and low-power memory devices. This device benefits from a relatively low operating voltage, high endurance, fast write-erase speeds and better immunity to soft errors. The nanocrystal materials suitable for such an application can be either metals or semiconductors. Recent studies have shown that high-k dielectrics, instead of SiO2 , for the tunneling layer in nanocrystal floating gate memory can improve the trade-off between data retention and program efficiency due to the unique band alignment of high-k dielectrics in the programming and retention modes. In this project, HfAlO has been selected as the high- k dielectric for the nanocrystal floating gate memory structure. The trilayer structure (HfAlO/Ge-NC/HfAlO) on Si was fabricated by PLD. Results revealed that relatively low substrate temperature and growth rate are favourable for the formation of smaller-size Ge nanocrystals. Effects of size/density of the Ge nanocrystal, the tunneling and control oxide layer thicknesses and the oxygen partial pressure during their growth on the charge storage and charge retention characteristics have also been studied. The island structure of the Ge nanocrystal suggests that the growth is based on the Volmer-Webber mode. The self-organized Ge nanocrystals so formed were uniform in size (5--20 nm diameter) and distribution with a density approaching 1012--1013cm-2. Flat-band voltage shift (DeltaVFB) of about 3.6 V and good retention property have been achieved. By varying aggregation distance, sputtering gas pressure and ionization power of the nanocluster source, nanoclusters of Ge with different sizes can be formed. The memory effect of the trilayer structure so formed with 10 nm Ge nanoclusters are manifested by the counter-clockwise hysteresis loop in the C-V curves and a maximum flat-band voltage shift of 5.0 V has been achieved. For comparison purposes, metal nanocrystals have also been investigated by utilizing both of the physical deposition methods as mentioned above. Silver (Ag) nanocrystals with size of 10--40 nm have been embedded in HfAlO matrix in the trilayer capacitor structure and a flat-band voltage shift of 2.0 V has been achieved.
Inhibitory effects of magnolol on voltage-gated Na+ and K+ channels of NG108-15 cells.
Gong, Chi-Li; Wong, Kar-Lok; Cheng, Ka-Shun; Kuo, Chang-Shin; Chao, Chia-Chia; Tsai, Min-Fan; Leung, Yuk-Man
2012-05-05
Magnolol, a polyphenolic compound isolated from Houpu, a Chinese herb from the bark of Magnolia officinalis, has been reported to have in vitro and in vivo neuroprotective effects. In spite of these reported beneficial effects, studies on the direct impact of magnolol on neuronal ion channels have been scarce. Whether magnolol affects voltage-gated Na(+) channels (VGSC) and voltage-gated K(+) (Kv) channels is unknown. Using the whole-cell voltage-clamp method, we studied the effects of magnolol on voltage-gated ion channels in neuronal NG108-15 cells. Magnolol inhibited VGSC channels with mild state-dependence (IC(50) of 15 and 30 μM, at holding potentials of -70 and -100 mV, respectively). No frequency-dependence was observed in magnolol block. Magnolol caused a left-shift of 18 mV in the steady-state inactivation curve but did not affect the voltage-dependence of activation. Magnolol inhibited Kv channels with an IC(50) of 21 μM, and it caused a 20-mV left-shift in the steady-state inactivation curve without affecting the voltage-dependence of activation. In conclusion, magnolol is an inhibitor of both VGSC and Kv channels and these inhibitory effects may in part contribute to some of the reported neuroprotective effects of magnolol. Copyright © 2012 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Xiaodong; Pan, Ming; Hou, Liwei
2014-01-07
The gain and photoresponse characteristics have been numerically studied for back-illuminated separate absorption and multiplication (SAM) GaN avalanche photodiodes (APDs). The parameters of fundamental models are calibrated by simultaneously comparing the simulated dark and light current characteristics with the experimental results. Effects of environmental temperatures and device dimensions on gain characteristics have been investigated, and a method to achieve the optimum thickness of charge layer is obtained. The dependence of gain characteristics and breakdown voltage on the doping concentration of the charge layer is also studied in detail to get the optimal charge layer. The bias-dependent spectral responsivity and quantummore » efficiency are then presented to study the photoresponse mechanisms inside SAM GaN APDs. It is found the responsivity peak red-shifts at first due to the Franz-Keldysh effect and then blue-shifts due to the reach-through effect of the absorption layer. Finally, a new SAM GaN/AlGaN heterojunction APD structure is proposed for optimizing SAM GaN APDs.« less
Yang, Shiqian; Wang, Qin; Zhang, Manhong; Long, Shibing; Liu, Jing; Liu, Ming
2010-06-18
Titanium-tungsten nanocrystals (NCs) were fabricated by a self-assembly rapid thermal annealing (RTA) process. Well isolated Ti(0.46)W(0.54) NCs were embedded in the gate dielectric stack of SiO(2)/Al(2)O(3). A metal-oxide-semiconductor (MOS) capacitor was fabricated to investigate its application in a non-volatile memory (NVM) device. It demonstrated a large memory window of 6.2 V in terms of flat-band voltage (V(FB)) shift under a dual-directional sweeping gate voltage of - 10 to 10 V. A 1.1 V V(FB) shift under a low dual-directional sweeping gate voltage of - 4 to 4 V was also observed. The retention characteristic of this MOS capacitor was demonstrated by a 0.5 V memory window after 10(4) s of elapsed time at room temperature. The endurance characteristic was demonstrated by a program/erase cycling test.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J
2008-11-01
External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.
2008-01-01
External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222
Electromechanical properties of biomembranes and nerves
NASA Astrophysics Data System (ADS)
Heimburg, T.; Blicher, A.; Mosgaard, L. D.; Zecchi, K.
2014-12-01
Lipid membranes are insulators and capacitors, which can be charged by an external electric field. This phenomenon plays an important role in the field of electrophysiology, for instance when describing nerve pulse conduction. Membranes are also made of polar molecules meaning that they contain molecules with permanent electrical dipole moments. Therefore, the properties of membranes are subject to changes in trans-membrane voltage. Vice versa, mechanical forces on membranes lead to changes in the membrane potential. Associated effects are flexoelectricity, piezoelectricity, and electrostriction. Lipid membranes can melt from an ordered to a disordered state. Due to the change of membrane dimensions associated with lipid membrane melting, electrical properties are linked to the melting transition. Melting of the membrane can induce changes in trans-membrane potential, and application of voltage can lead to a shift of the melting transition. Further, close to transitions membranes are very susceptible to piezoelectric phenomena. We discuss these phenomena in relation with the occurrence of lipid ion channels. Close to melting transitions, lipid membranes display step-wise ion conduction events, which are indistinguishable from protein ion channels. These channels display a voltage-dependent open probability. One finds asymmetric current-voltage relations of the pure membrane very similar to those found for various protein channels. This asymmetry falsely has been considered a criterion to distinguish lipid channels from protein channels. However, we show that the asymmetry can arise from the electromechanical properties of the lipid membrane itself. Finally, we discuss electromechanical behavior in connection with the electromechanical theory of nerve pulse transduction. It has been found experimentally that nerve pulses are related to changes in nerve thickness. Thus, during the nerve pulse a solitary mechanical pulse travels along the nerve. Due to electromechanical coupling it is unavoidable that this pulse generates a trans-membrane voltage. In the past, we have proposed that this electromechanical pulse is the origin of the action potential in nerves.
A SONOS device with a separated charge trapping layer for improvement of charge injection
NASA Astrophysics Data System (ADS)
Ahn, Jae-Hyuk; Moon, Dong-Il; Ko, Seung-Won; Kim, Chang-Hoon; Kim, Jee-Yeon; Kim, Moon-Seok; Seol, Myeong-Lok; Moon, Joon-Bae; Choi, Ji-Min; Oh, Jae-Sub; Choi, Sung-Jin; Choi, Yang-Kyu
2017-03-01
A charge trapping layer that is separated from the primary gate dielectric is implemented on a FinFET SONOS structure. By virtue of the reduced effective oxide thickness of the primary gate dielectric, a strong gate-to-channel coupling is obtained and thus short-channel effects in the proposed device are effectively suppressed. Moreover, a high program/erase speed and a large shift in the threshold voltage are achieved due to the improved charge injection by the reduced effective oxide thickness. The proposed structure has potential for use in high speed flash memory.
Nano-Transistor Modeling: Two Dimensional Green's Function Method
NASA Technical Reports Server (NTRS)
Svizhenko, Alexei; Anantram, M. P.; Govindan, T. R.; Biegel, Bryan
2001-01-01
Two quantum mechanical effects that impact the operation of nanoscale transistors are inversion layer energy quantization and ballistic transport. While the qualitative effects of these features are reasonably understood, a comprehensive study of device physics in two dimensions is lacking. Our work addresses this shortcoming and provides: (a) a framework to quantitatively explore device physics issues such as the source-drain and gate leakage currents, DIBL (Drain Induced Barrier Lowering), and threshold voltage shift due to quantization, and b) a means of benchmarking quantum corrections to semiclassical models (such as density-gradient and quantum-corrected MEDICI).
NASA Technical Reports Server (NTRS)
1986-01-01
The power factor controller (PFC) was invented by a NASA engineer. It matches voltage with a motor's actual need by sensing shifts in the relationship between voltage and current flow. With the device, power can be trimmed as much as 65%. Intellinet adopted this technology and designed "soft start" and "load-responsive" control modes to start engines gradually and recycle voltage without reducing motor speed. Other features are lower motor heat and faster fault identification.
A finite state machine read-out chip for integrated surface acoustic wave sensors
NASA Astrophysics Data System (ADS)
Rakshit, Sambarta; Iliadis, Agis A.
2015-01-01
A finite state machine based integrated sensor circuit suitable for the read-out module of a monolithically integrated SAW sensor on Si is reported. The primary sensor closed loop consists of a voltage controlled oscillator (VCO), a peak detecting comparator, a finite state machine (FSM), and a monolithically integrated SAW sensor device. The output of the system oscillates within a narrow voltage range that correlates with the SAW pass-band response. The period of oscillation is of the order of the SAW phase delay. We use timing information from the FSM to convert SAW phase delay to an on-chip 10 bit digital output operating on the principle of time to digital conversion (TDC). The control inputs of this digital conversion block are generated by a second finite state machine operating under a divided system clock. The average output varies with changes in SAW center frequency, thus tracking mass sensing events in real time. Based on measured VCO gain of 16 MHz/V our system will convert a 10 kHz SAW frequency shift to a corresponding mean voltage shift of 0.7 mV. A corresponding shift in phase delay is converted to a one or two bit shift in the TDC output code. The system can handle alternate SAW center frequencies and group delays simply by adjusting the VCO control and TDC delay control inputs. Because of frequency to voltage and phase to digital conversion, this topology does not require external frequency counter setups and is uniquely suitable for full monolithic integration of autonomous sensor systems and tags.
NASA Astrophysics Data System (ADS)
Kim, Woo-Byung; Lee, Dong Keun; Ryu, Sang Ouk
2014-07-01
The a-IGZO deposited by using the rf sputtering method features a conductive or an insulator characteristic based on amount of oxygen. We demonstrated that a post-treatment affects the resistance patterns of particular-sized InGaZnO(IGZO) thin films in a-IGZO thin-film transistors (TFTs). Post-annealing shifted the driving voltage of a-IGZO TFT to positive or negative values, depending on the annealing temperatures. Post-annealing may introduce oxygen vacancies or desorbed oxygen in the IGZO thin film. The changed driving voltage of IGZO TFTs coincides with the shift of the resistance pattern of IGZO. The fabricated a-IGZO TFTs exhibited a field effect mobility of 6.2 cm2/Vs, an excellent subthreshold gate swing of 0.32 V/decade, and a high I on/off ratio of > 109. Under positive bias illumination stress (PBIS) and negative bias illumination stress (NBIS), after 3,600 seconds, the device threshold voltage shifted about 0.2 V and 0.3 V, respectively.
Stability study of solution-processed zinc tin oxide thin-film transistors
NASA Astrophysics Data System (ADS)
Zhang, Xue; Ndabakuranye, Jean Pierre; Kim, Dong Wook; Choi, Jong Sun; Park, Jaehoon
2015-11-01
In this study, the environmental dependence of the electrical stability of solution-processed n-channel zinc tin oxide (ZTO) thin-film transistors (TFTs) is reported. Under a prolonged negative gate bias stress, a negative shift in threshold voltage occurs in atmospheric air, whereas a negligible positive shift in threshold voltage occurs under vacuum. In the positive bias-stress experiments, a positive shift in threshold voltage was invariably observed both in atmospheric air and under vacuum. In this study, the negative gate-bias-stress-induced instability in atmospheric air is explained through an internal potential in the ZTO semiconductor, which can be generated owing to the interplay between H2O molecules and majority carrier electrons at the surface of the ZTO film. The positive bias-stress-induced instability is ascribed to electron-trapping phenomenon in and around the TFT channel region, which can be further augmented in the presence of air O2 molecules. These results suggest that the interaction between majority carriers and air molecules will have crucial implications for a reliable operation of solution-processed ZTO TFTs. [Figure not available: see fulltext.
State memory in solution gated epitaxial graphene
NASA Astrophysics Data System (ADS)
Butko, A. V.; Butko, V. Y.; Lebedev, S. P.; Lebedev, A. A.; Davydov, V. Y.; Smirnov, A. N.; Eliseyev, I. A.; Dunaevskiy, M. S.; Kumzerov, Y. A.
2018-06-01
We studied electrical transport in transistors fabricated on a surface of high quality epitaxial graphene with density of defects as low as 5·1010 cm-2 and observed quasistatic hysteresis with a time constant in a scale of hours. This constant is in a few orders of magnitude greater than the constant previously reported in CVD graphene. The hysteresis observed here can be described as a shift of ∼+2V of the Dirac point measured during a gate voltage increase from the position of the Dirac point measured during a gate voltage decrease. This hysteresis can be characterized as a nonvolatile quasistatic state memory effect in which the state of the gated graphene is determined by its initial state prior to entering the hysteretic region. Due to this effect the difference in resistance of the gated graphene measured in the hysteretic region at the same applied voltages can be as high as 70%. The observed effect can be explained by assuming that charge carriers in graphene and oppositely charged molecular ions from the solution form quasistable interfacial complexes at the graphene interface. These complexes likely preserve the initial state by preventing charge carriers in graphene from discharging in the hysteretic region.
Bio-optical sensor for brain activity measurement based on whispering gallery modes
NASA Astrophysics Data System (ADS)
Ali, Amir R.; Massoud, Yasmin M.
2017-05-01
In this paper, a high-resolution bio-optical sensor is developed for brain activity measurement. The aim is to develop an optical sensor with enough sensitivity to detect small electric field perturbations caused by neuronal action potential. The sensing element is a polymeric dielectric micro-resonator fabricated in a spherical shape with a few hundred microns in diameter. They are made of optical quality polymers that are soft which make them mechanically compatible with tissue. The sensors are attached to or embedded in optical fibers which serve as input/output conduits for the sensors. Hundreds or even thousands of spheres can be attached to a single fiber to detect and transmit signals at different locations. The high quality factor for the optical resonator makes it significantly used in such bio-medical applications. The sensing phenomenon is based on whispering gallery modes (WGM) shifts of the optical sensor. To mimic the brain signals, the spherical resonator is immersed in a homogeneous electrical field that is created by applying potential difference across two metallic plates. One of the plates has a variable voltage while the volt on the other plate kept fixed. Any small perturbations of the potential difference (voltage) lead to change in the electric field intensity. In turn the sensor morphology will be affected due to the change in the electrostriction force acting on it causing change in its WGM. By tracking these WGM shift on the transmission spectrum, the induced potential difference (voltage change) could be measured. Results of a mathematical model simulation agree well with the preliminary experiments. Also, the results show that the brain activity could be measured using this principle.
Chiu, Tien-Lung; Lee, Pei-Yu
2012-01-01
In this paper, we investigate the carrier injection and transport characteristics in iridium(III)bis[4,6-(di-fluorophenyl)-pyridinato-N,C2′]picolinate (FIrpic) doped phosphorescent organic light-emitting devices (OLEDs) with oxadiazole (OXD) as the bipolar host material of the emitting layer (EML). When doping Firpic inside the OXD, the driving voltage of OLEDs greatly decreases because FIrpic dopants facilitate electron injection and electron transport from the electron-transporting layer (ETL) into the EML. With increasing dopant concentration, the recombination zone shifts toward the anode side, analyzed with electroluminescence (EL) spectra. Besides, EL redshifts were also observed with increasing driving voltage, which means the electron mobility is more sensitive to the electric field than the hole mobility. To further investigate carrier injection and transport characteristics, FIrpic was intentionally undoped at different positions inside the EML. When FIrpic was undoped close to the ETL, driving voltage increased significantly which proves the dopant-assisted-electron-injection characteristic in this OLED. When the undoped layer is near the electron blocking layer, the driving voltage is only slightly increased, but the current efficiency is greatly reduced because the main recombination zone was undoped. However, non-negligible FIrpic emission is still observed which means the recombination zone penetrates inside the EML due to certain hole-transporting characteristics of the OXD. PMID:22837713
NASA Astrophysics Data System (ADS)
Emadi, Tahereh Arezoo; Buchanan, Douglas A.
2014-03-01
A robust capacitive micromachined ultrasonic transducer has been developed. In this novel configuration, a stack of two deflectable membranes are suspended over a fixed bottom electrode. Similar to conventional capacitive ultrasonic transducers, a generated electrostatic force between the electrodes causes the membranes to deflect and vibrate. However, in this new configuration the transducer effective cavity height is reduced due to the deflection of two membranes. Therefore, the transducer spring constant is more susceptible to bias voltage, which in return reduces the required bias voltage. The transducers have been produced employing a MEMS sacrificial technique where two different membrane anchoring (curved- and flat- anchors) structures, with similar membrane radii were fabricated. Highly doped polysilicon was used as the membrane material. The resonant frequencies of the two transducers have been investigated. It was found that the transducers with curved membrane anchors exhibits a larger resonant frequency shift compared to the transducers with flat membranes for a given bias voltage. Comparison has been made between the spring constant of the flat membrane transducer and that of a conventional single membrane transducer. It is shown that the multiple moving membrane transducer exhibits a larger reduction in the spring constant compared to the conventional transducer, when driven with the same bias voltage. This results in a transducer with a higher power generation capability and sensitivity.
NASA Astrophysics Data System (ADS)
Sakamoto, Yuri; Uemura, Kohei; Ikuta, Takashi; Maehashi, Kenzo
2018-04-01
We have succeeded in fabricating a hydrogen gas sensor based on palladium-modified graphene field-effect transistors (FETs). The negative-voltage shift in the transfer characteristics was observed with exposure to hydrogen gas, which was explained by the change in work function. The hydrogen concentration dependence of the voltage shift was investigated using graphene FETs with palladium deposited by three different evaporation processes. The results indicate that the hydrogen detection sensitivity of the palladium-modified graphene FETs is strongly dependent on the palladium configuration. Therefore, the palladium-modified graphene FET is a candidate for breath analysis.
Photocurrent Suppression of Transparent Organic Thin Film Transistors
NASA Astrophysics Data System (ADS)
Chuang, Chiao-Shun; Tsai, Shu-Ting; Lin, Yung-Sheng; Chen, Fang-Chung; Shieh, Hang-Ping D.
2007-12-01
Organic thin-film transistors (OTFTs) with high transmittance and low photosensitivity have been demonstrated. By using titanium dioxide nanoparticles as the additives in the polymer gate insulators, the level of device photoresponse has been reduced. The device shows simultaneously a high transparence and a minimal threshold voltage shift under white light illumination. It is inferred that the localized energy levels deep in the energy gap of pentacene behave as the recombination centers, enhancing substantially the recombination process in the conducting channel of the OTFTs. Therefore, the electron trapping is relieved and the shift of threshold voltage is reduced upon illumination.
Investigation of AlGaN/GaN HEMTs degradation with gate pulse stressing at cryogenic temperature
NASA Astrophysics Data System (ADS)
Wang, Ning; Wang, Hui; Lin, Xinpeng; Qi, Yongle; Duan, Tianli; Jiang, Lingli; Iervolino, Elina; Cheng, Kai; Yu, Hongyu
2017-09-01
Degradation on DC characteristics of AlGaN/GaN high electron mobility transistors (HEMTs) after applying pulsed gate stress at cryogenic temperatures is presented in this paper. The nitrogen vacancy near to the AlGaN/GaN interface leads to threshold voltage of stress-free sample shifting positively at low temperature. The anomalous behavior of threshold voltage variation (decrease first and then increase) under gate stressing as compared to stress-free sample is observed when lowing temperature. This can be correlated with the pre-existing electron traps in SiNX layer or at SiNX/AlGaN interface which can be de-activated and the captured electrons inject back to channel with lowering temperature, which counterbalances the influence of nitrogen vacancy on threshold voltage shift.
NASA Astrophysics Data System (ADS)
Shin, Min-Seok; Jo, Yun-Rae; Kwon, Oh-Kyong
2011-03-01
In this paper, we propose a driving method for compensating the electrical instability of hydrogenated amorphous silicon (a-Si:H) thin film transistors (TFTs) and the luminance degradation of organic light-emitting diode (OLED) devices for large active matrix OLED (AMOLED) displays. The proposed driving method senses the electrical characteristics of a-Si:H TFTs and OLEDs using current integrators and compensates them by an external compensation method. Threshold voltage shift is controlled a using negative bias voltage. After applying the proposed driving method, the measured error of the maximum emission current ranges from -1.23 to +1.59 least significant bit (LSB) of a 10-bit gray scale under the threshold voltage shift ranging from -0.16 to 0.17 V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chida, K.; Yamauchi, Y.; Arakawa, T.
2013-12-04
We performed the resistively-detected nuclear magnetic resonance (RDNMR) to study the electron spin polarization in the non-equilibrium quantum Hall regime. By measuring the Knight shift, we derive source-drain bias voltage dependence of the electron spin polarization in quantum wires. The electron spin polarization shows minimum value around the threshold voltage of the dynamic nuclear polarization.
NASA Technical Reports Server (NTRS)
1983-01-01
The power factor controller (PFC) senses shifts in the relationship between voltage and current, and matches them with a motor's need. This prevents waste as motors do not need a high voltage when they are not operating at full load conditions. PFC is manufactured by Nordic Controls Company, among others, and has proved extremely cost effective.
Voltage gating of mechanosensitive PIEZO channels.
Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R
2018-03-15
Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.
Frequency Invariability of (Pb,La)(Zr,Ti)O₃ Antiferroelectric Thick-Film Micro-Cantilevers.
An, Kun; Jin, Xuechen; Meng, Jiang; Li, Xiao; Ren, Yifeng
2018-05-13
Micro-electromechanical systems comprising antiferroelectric layers can offer both actuation and transduction to integrated technologies. Micro-cantilevers based on the (Pb 0.97 La 0.02 )(Zr 0.95 Ti 0.05 )O₃ (PLZT) antiferroelectric thick film are fabricated by the micro-nano manufacturing process, to utilize the effect of phase transition induced strain and sharp phase switch of antiferroelectric materials. When micro-cantilevers made of antiferroelectric thick films were driven by sweep voltages, there were two resonant peaks corresponding to the natural frequency shift from 27.8 to 27.0 kHz, before and after phase transition. This is the compensation principle for the PLZT micro-cantilever to tune the natural frequency by the amplitude modulation of driving voltage, rather than of frequency modulation. Considering the natural frequency shift about 0.8 kHz and the frequency tuning ability about 156 Hz/V before the phase transition, this can compensate the frequency shift caused by increasing temperature by tuning only the amplitude of driving voltage, when the ultrasonic micro-transducer made of antiferroelectric thick films works for such a long period. Therefore, antiferroelectric thick films with hetero-structures incorporated into PLZT micro-cantilevers not only require a lower driving voltage (no more than 40 V) than rival bulk piezoelectric ceramics, but also exhibit better performance of frequency invariability, based on the amplitude modulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bakhtinov, A. P., E-mail: chimsp@ukrpost.ua; Vodopyanov, V. N.; Netyaga, V. V.
2012-03-15
Features of the formation of Au/Ni/ Left-Pointing-Angle-Bracket C Right-Pointing-Angle-Bracket /n-Ga{sub 2}O{sub 3} hybrid nanostructures on a Van der Waals surface (0001) of 'layered semiconductor-ferroelectric' composite nanostructures (p-GaSe Left-Pointing-Angle-Bracket KNO{sub 3} Right-Pointing-Angle-Bracket ) are studied using atomic-force microscopy. The room-temperature current-voltage characteristics and the dependence of the impedance spectrum of hybrid structures on a bias voltage are studied. The current-voltage characteristic includes a resonance peak and a portion with negative differential resistance. The current attains a maximum at a certain bias voltage, when electric polarization switching in nanoscale three-dimensional inclusions in the layered GaSe matrix occurs. In the high-frequency region (fmore » > 10{sup 6} Hz), inductive-type impedance (a large negative capacitance of structures, {approx}10{sup 6} F/mm{sup 2}) is detected. This effect is due to spinpolarized electron transport in a series of interconnected semiconductor composite nanostructures with multiple p-GaSe Left-Pointing-Angle-Bracket KNO{sub 3} Right-Pointing-Angle-Bracket quantum wells and a forward-biased 'ferromagnetic metal-semiconductor' polarizer (Au/Ni/ Left-Pointing-Angle-Bracket C Right-Pointing-Angle-Bracket /n{sup +}-Ga{sub 2}O{sub 3}/n-Ga{sub 2}O{sub 3}). A shift of the maximum (current hysteresis) is detected in the current-voltage characteristics for various directions of the variations in bias voltage.« less
Connor, E. A.; Parsons, R. L.
1984-01-01
Barium-induced alterations in fast excitatory postsynaptic currents (e.p.s.cs) have been studied in voltage-clamped bullfrog sympathetic ganglion B cells. In the presence of 2-8 mM barium, e.p.s.c. decay was prolonged and in many cells the e.p.s.c. decay phase deviated from a single exponential function. The decay phase in these cases was more accurately described as the sum of two exponential functions. The frequency of occurrence of a complex decay increased both with increasing barium concentration and with hyperpolarization. Miniature e.p.s.c. decay also was prolonged in barium-treated cells. E.p.s.c. amplitude was not markedly affected by barium (2-8 mM) in cells voltage-clamped to -50 mV whereas at -90 mV there was a progressive increase in peak size with increasing barium concentration. In control cells the e.p.s.c.-voltage relationship was linear between -20 and -100 mV; however, this relationship became progressively non-linear with membrane hyperpolarization in barium-treated cells. The e.p.s.c. reversal potential was shifted to a more negative value in the presence of barium. There was a voltage-dependent increase in charge movement during the e.p.s.c. in barium-treated cells which was not present in control cells. We conclude that the voltage-dependent alteration in e.p.s.c. decay time course, peak amplitude and charge movement in barium-treated cells is due to a direct postsynaptic action of barium on the kinetics of receptor-channel gating in postganglionic sympathetic neurones. PMID:6333261
Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo
2017-08-29
Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.
Resistive switching characteristics of thermally oxidized TiN thin films
NASA Astrophysics Data System (ADS)
Biju, K. P.
2018-04-01
Resistive switching characteristics of thermally oxidized TiN thin films and mechanisms were investigated.XPS results indicates Ti-O content decreases with sputter etching and Ti 2p peak shift towards lower binding energy due to formation of Ti-O-N and Ti-N. Pt/TiO2/TiON/TiN stack exhibits both clockwise switching (CWS) and counter clockwise switching(CCWS) characteristic depending on polarity of the applied voltage. However the transition from CCWS to CWS is irreversible. Two stable switching modes with opposite switching polarity and different electrical characteristics are found to coexist in the same memory cell. Clockwise switching shows filamentary characteristics that lead to faster switching with excellent retention at high temperature. Counter-clockwise switching exhibits homogeneous conduction with slower switching and moderate retention. The field-induced switching in both CCWS and CWS might be due to inhomogeneous defect distribution due to thermal oxidation.
Effects of Various Passivation Layers on Electrical Properties of Multilayer MoS₂ Transistors.
Ma, Jiyeon; Yoo, Geonwook
2018-09-01
So far many of research on transition metal dichalcogenides (TMDCs) are based on a bottomgate device structure due to difficulty with depositing a dielectric film on top of TMDs channel layer. In this work, we study different effects of various passivation layers on electrical properties of multilayer MoS2 transistors: spin-coated CYTOP, SU-8, and thermal evaporated MoOX. The SU-8 passivation layer alters device performance least significantly, and MoOX induces positive threshold voltage shift of ~8.0 V due to charge depletion at the interface, and the device with CYTOP layer exhibits decreased field-effect mobility by ~50% due to electric dipole field effect of C-F bonds in the end groups. Our results imply that electrical properties of the multilayer MoS2 transistors can be modulated using a passivation layer, and therefore a proper passivation layer should be considered for MoS2 device structures.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff <5 msec). However, the signal was small (ΔF/F= 0.6%/200 mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
NASA Astrophysics Data System (ADS)
Francis, Laurent A.; Sedki, Amor; André, Nicolas; Kilchytska, Valéria; Gérard, Pierre; Ali, Zeeshan; Udrea, Florin; Flandre, Denis
2018-01-01
In this paper, we study the recovery of onmembrane semiconductor components, such as N-type Field-Effect Transistors (FETs) available in two different channel widths and a Complementary Metal-Oxide-Semiconductor (CMOS) inverter, after the exposure to high dose of proton radiation. Due to the ionizing effect, the electrical characteristics of the components established remarkable shifts, where the threshold voltages showed an average shift of -480 mV and -280 mV respectively for 6 μm and 24 μm N-channel transistors, likewise the inversion point of the inverter showed an important shift of -690 mV. The recovery concept is based mainly on a micro-hotplate, fabricated with backside MEMS micromachining structure and a Silicon-On-Insulator (SOI) technology, ensuring rapid, low power and in situ annealing technique, this method proved its reliability in recent works. Annealing the N-channel transistors and the inverter for 16 min with a temperature of the heater up to 385 °C, guaranteed a partial recovery of the semiconductor based components with a maximum power consumption of 66 mW.
NASA Astrophysics Data System (ADS)
Lin, Yi-Hsin; Chen, Ming-Syuan; Lin, Wei-Chih; Tsou, Yu-Shih
2012-07-01
A polarization-independent liquid crystal phase modulation using polymer-network liquid crystals in a 90° twisted cell (T-PNLC) is demonstrated. T-PNLC consists of three layers. Liquid crystal (LC) directors in the two layers near glass substrates are orthogonal to each other and those two layers modulate two eigen-polarizations of an incident light. As a result, two eigen-polarizations of an incident light experience the same phase shift. In the middle layer, LC directors are perpendicular to the glass substrate and contribute no phase shift. The phase shift of T-PNLC is electrically tunable and polarization-independent. T-PNLC does not require any bias voltage for operation. The phase shift is 0.28 π rad for the voltage of 30 Vrms. By measuring and analyzing the optical phase shift of T-PNLC at the oblique incidence of transverse magnetic wave, the pretilt angle of LC directors and the effective thickness of three layers are obtained and discussed. The potential applications are spatial light modulators, laser beam steering, and micro-lens arrays.
Water-based thixotropic polymer gel electrolyte for dye-sensitized solar cells.
Park, Se Jeong; Yoo, Kichoen; Kim, Jae-Yup; Kim, Jin Young; Lee, Doh-Kwon; Kim, Bongsoo; Kim, Honggon; Kim, Jong Hak; Cho, Jinhan; Ko, Min Jae
2013-05-28
For the practical application of dye-sensitized solar cells (DSSCs), it is important to replace the conventional organic solvents based electrolyte with environmentally friendly and stable ones, due to the toxicity and leakage problems. Here we report a noble water-based thixotropic polymer gel electrolyte containing xanthan gum, which satisfies both the environmentally friendliness and stability against leakage and water intrusion. For application in DSSCs, it was possible to infiltrate the prepared electrolyte into the mesoporous TiO2 electrode at the fluidic state, resulting in sufficient penetration. As a result, this electrolyte exhibited similar conversion efficiency (4.78% at 100 mW cm(-2)) and an enhanced long-term stability compared to a water-based liquid electrolyte. The effects of water on the photovoltaic properties were examined elaborately from the cyclic voltammetry curves and impedance spectra. Despite the positive shift in the conduction band potential of the TiO2 electrode, the open-circuit voltage was enhanced by addition of water in the electrolyte due to the greater positive shift in the I(-)/I3(-) redox potential. However, due to the dye desorption and decreased diffusion coefficient caused by the water content, the short-circuit photocurrent density was reduced. These results will provide great insight into the development of efficient and stable water-based electrolytes.
Effects of post-deposition annealing on sputtered SiO2/4H-SiC metal-oxide-semiconductor
NASA Astrophysics Data System (ADS)
Lee, Suhyeong; Kim, Young Seok; Kang, Hong Jeon; Kim, Hyunwoo; Ha, Min-Woo; Kim, Hyeong Joon
2018-01-01
Reactive sputtering followed by N2, NH3, O2, and NO post-deposition annealing (PDA) of SiO2 on 4H-SiC was investigated in this study. The results of ellipsometry, an etching test, and X-ray photoemission spectroscopy showed that N2 and NH3 PDA nitrified the SiO2. Devices using N2 and NH3 PDA exhibited a high gate leakage current and low breakdown field due to oxygen vacancies and incomplete oxynitride. SiO2/4H-SiC MOS capacitors were also fabricated and their electrical characteristics measured. The average breakdown fields of the devices using N2, NH3, O2, and NO PDA were 0.12, 0.17, 4.71 and 2.63 MV/cm, respectively. The shifts in the flat-band voltage after O2 and NO PDA were 0.95 and -2.56 V, respectively, compared with the theoretical value. The extracted effective oxide charge was -4.11 × 1011 cm-2 for O2 PDA and 1.11 × 1012 cm-2 for NO PDA. NO PDA for 2 h at 1200 °C shifted the capacitance-voltage curve in the negative direction. The oxygen containing PDA showed better electrical properties than non-oxygen PDA. The sputtering method described can be applied to 4H-SiC MOS fabrication.
Nagel, Wolfram; Katz, Uri
2003-02-01
The effect of xanthine derivatives on the voltage-activated Cl(-) conductance (G(Cl)) of amphibian skin was analyzed. 3-Isobutyl-1-methylxanthine (IBMX) and the recently synthesized xanthine derivatives 3,7-dimethyl-1-propyl xanthine (X-32) and 3,7-dimethyl-1-isobutyl xanthine (X-33), which lack inhibitory effects on phosphodiesterases in CHO and Calu-3 cells, increased voltage-activated G(Cl) without effect on baseline conductance at inactivating voltage. Half-maximal stimulation of G(Cl) occurred at 108 +/- 9 microM for X-32 and X-33 after apical or basolateral application. The stimulation of G(Cl), which occurs only in the presence of Cl(-) in the mucosal solution, is caused by a shift of the voltage sensitivity to lower clamp potentials and an increase of the maximally activated level. Furosemide reversed both the shift of sensitivity and the increase in magnitude. These patterns are fundamentally different from those seen after application of membrane-permeant, nonmetabolized analogs of cAMP, and they indicate that the xanthines stimulate G(Cl) directly. This notion is strengthened by the lack of influence on intracellular cAMP content, which is consistent with the observations in CHO and Calu-3 cells. We propose that the xanthine derivatives increase the voltage sensitivity of a regulative component in the conductive Cl(-) pathway across amphibian skin.
NASA Astrophysics Data System (ADS)
Li, Min; Lan, Linfeng; Xu, Miao; Wang, Lei; Xu, Hua; Luo, Dongxiang; Zou, Jianhua; Tao, Hong; Yao, Rihui; Peng, Junbiao
2011-11-01
Thin-film transistors (TFTs) using indium zinc oxide as the active layer and anodic aluminium oxide (Al2O3) as the gate dielectric layer were fabricated. The device showed an electron mobility of as high as 10.1 cm2 V-1 s-1, an on/off current ratio of as high as ~108, and a turn-on voltage (Von) of only -0.5 V. Furthermore, this kind of TFTs was very stable under positive bias illumination stress. However, when the device experienced negative bias illumination stress, the threshold voltage shifted to the positive direction. It was found that the instability under negative bias illumination stress (NBIS) was due to the electrons from the Al gate trapping into the Al2O3 dielectric when exposed to the illuminated light. Using a stacked structure of Al2O3/SiO2 dielectrics, the device became more stable under NBIS.
Bin, Haijun; Gao, Liang; Zhang, Zhi-Guo; Yang, Yankang; Zhang, Yindong; Zhang, Chunfeng; Chen, Shanshan; Xue, Lingwei; Yang, Changduk; Xiao, Min; Li, Yongfang
2016-01-01
Simutaneously high open circuit voltage and high short circuit current density is a big challenge for achieving high efficiency polymer solar cells due to the excitonic nature of organic semdonductors. Herein, we developed a trialkylsilyl substituted 2D-conjugated polymer with the highest occupied molecular orbital level down-shifted by Si–C bond interaction. The polymer solar cells obtained by pairing this polymer with a non-fullerene acceptor demonstrated a high power conversion efficiency of 11.41% with both high open circuit voltage of 0.94 V and high short circuit current density of 17.32 mA cm−2 benefitted from the complementary absorption of the donor and acceptor, and the high hole transfer efficiency from acceptor to donor although the highest occupied molecular orbital level difference between the donor and acceptor is only 0.11 eV. The results indicate that the alkylsilyl substitution is an effective way in designing high performance conjugated polymer photovoltaic materials. PMID:27905397
Bin, Haijun; Gao, Liang; Zhang, Zhi-Guo; Yang, Yankang; Zhang, Yindong; Zhang, Chunfeng; Chen, Shanshan; Xue, Lingwei; Yang, Changduk; Xiao, Min; Li, Yongfang
2016-12-01
Simutaneously high open circuit voltage and high short circuit current density is a big challenge for achieving high efficiency polymer solar cells due to the excitonic nature of organic semdonductors. Herein, we developed a trialkylsilyl substituted 2D-conjugated polymer with the highest occupied molecular orbital level down-shifted by Si-C bond interaction. The polymer solar cells obtained by pairing this polymer with a non-fullerene acceptor demonstrated a high power conversion efficiency of 11.41% with both high open circuit voltage of 0.94 V and high short circuit current density of 17.32 mA cm -2 benefitted from the complementary absorption of the donor and acceptor, and the high hole transfer efficiency from acceptor to donor although the highest occupied molecular orbital level difference between the donor and acceptor is only 0.11 eV. The results indicate that the alkylsilyl substitution is an effective way in designing high performance conjugated polymer photovoltaic materials.
NASA Astrophysics Data System (ADS)
Zhang, Z.; Cardwell, D.; Sasikumar, A.; Kyle, E. C. H.; Chen, J.; Zhang, E. X.; Fleetwood, D. M.; Schrimpf, R. D.; Speck, J. S.; Arehart, A. R.; Ringel, S. A.
2016-04-01
The impact of proton irradiation on the threshold voltage (VT) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of VT was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 1014 cm-2. Silvaco Atlas simulations of VT shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different VT dependences on proton irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed VT shifts. The proton irradiation induced VT shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Deflection amplifier for image dissectors
NASA Technical Reports Server (NTRS)
Salomon, P. M.
1977-01-01
Balanced symmetrical y-axis amplifier uses zener-diode level shifting to interface operational amplifiers to high voltage bipolar output stages. Nominal voltage transfer characteristic is 40 differential output volts per input volt; bandwidth, between -3-dB points, is approximately 8 kHz; loop gain is nominally 89 dB with closed loop gain of 26 dB.
Organic memory capacitor device fabricated with Ag nanoparticles.
Kim, Yo-Han; Jung, Sung Mok; Hu, Quanli; Kim, Yong-Sang; Yoon, Tae-Sik; Lee, Hyun Ho
2011-07-01
In this study, it is demonstrated that an organic memory structure using pentacene and citrate-stabilized silver nanoparticles (Ag NPs) as charge storage elements on dielectric SiO2 layer and silicon substrate. The Ag NPs were synthesized by thermal reduction method of silver trifluoroacetate with oleic acid. The synthesized Ag NPs were analyzed with high resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED) for their crystalline structure. The capacitance versus voltage (C-V) curves obtained for the Ag NPs embedded capacitor exhibited flat-band voltage shifts, which demonstrated the presence of charge storages. The citrate-capping of the Ag NPs was confirmed by ultraviolet-visible (UV-VIS) and Fourier transformed infrared (FTIR) spectroscopy. With voltage sweeping of +/-7 V, a hysteresis loop having flatband voltage shift of 7.1 V was obtained. The hysteresis loop showed a counter-clockwise direction. In addition, electrical performance test for charge storage showed more than 10,000 second charge retention time. The device with Ag NPs can be applied to an organic memory device for flexible electronics.
NASA Astrophysics Data System (ADS)
Han, Chang-Wook; Han, Min-Koo; Choi, Nack-Bong; Kim, Chang-Dong; Kim, Ki-Yong; Chung, In-Jae
2007-07-01
Hydrogenated amorphous silicon (a-Si:H) thin-film transistors (TFTs) were fabricated on a flexible stainless-steel (SS) substrate. The stability of the a-Si:H TFT is a key issue for active matrix organic light-emitting diodes (AMOLEDs). The drain current decreases because of the threshold voltage shift (Δ VTH) during OLED driving. A negative voltage at a floated gate can be induced by a negative substrate bias through a capacitor between the substrate and the gate electrode without additional circuits. The negative voltage biased at the SS substrate can recover Δ VTH and reduced drain current of the driving TFT. The VTH of the TFT increased by 2.3 V under a gate bias of +15 V and a drain bias of +15 V at 65 °C applied for 3,500 s. The VTH decreased by -2.3 V and the drain current recovered 97% of its initial value under a substrate bias of -23 V at 65 °C applied for 3,500 s.
IGZO TFT-based circuit with tunable threshold voltage by laser annealing
NASA Astrophysics Data System (ADS)
Huang, Xiaoming; Yu, Guang; Wu, Chenfei
2017-11-01
In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.
NASA Astrophysics Data System (ADS)
Chen, Ming-Syuan; Lin, Wei-Chih; Tsou, Yu-Shih; Lin, Yi-Hsin
2012-10-01
A polarization-independent liquid crystal (LC) phase modulation using polymer-network liquid crystals with orthogonal alignments layers (T-PNLC) is demonstrated. T-PNLC consists of three layers. LC directors in the two layers near glass substrates are orthogonal to each other. In the middle layer, LC directors are perpendicular to the glass substrate. The advantages of such T-PNLC include polarizer-free, larger phase shift (~0.4π rad) than the residual phase type (<0.05π rad), and low operating voltage (< 30Vrms). It does not require bias voltage for avoiding scattering because the refractive index of liquid crystals matches that of polymers. The phase shift of T-PNLC is affected by the cell gap and the curing voltages. The potential applications are laser beam steering, spatial light modulators and electrically tunable micro-lens arrays.
Metal-oxide thin-film transistor-based pH sensor with a silver nanowire top gate electrode
NASA Astrophysics Data System (ADS)
Yoo, Tae-Hee; Sang, Byoung-In; Wang, Byung-Yong; Lim, Dae-Soon; Kang, Hyun Wook; Choi, Won Kook; Lee, Young Tack; Oh, Young-Jei; Hwang, Do Kyung
2016-04-01
Amorphous InGaZnO (IGZO) metal-oxide-semiconductor thin-film transistors (TFTs) are one of the most promising technologies to replace amorphous and polycrystalline Si TFTs. Recently, TFT-based sensing platforms have been gaining significant interests. Here, we report on IGZO transistor-based pH sensors in aqueous medium. In order to achieve stable operation in aqueous environment and enhance sensitivity, we used Al2O3 grown by using atomic layer deposition (ALD) and a porous Ag nanowire (NW) mesh as the top gate dielectric and electrode layers, respectively. Such devices with a Ag NW mesh at the top gate electrode rapidly respond to the pH of solutions by shifting the turn-on voltage. Furthermore, the output voltage signals induced by the voltage shifts can be directly extracted by implantation of a resistive load inverter.
Sheets, Michael F; Chen, Tiehua; Hanck, Dorothy A
2013-10-15
To determine the roles of the individual S4 segments in domains I and II to activation and inactivation kinetics of sodium current (INa) in NaV1.5, we used a tethered biotin and avidin approach after a site-directed cysteine substitution was made in the second outermost Arg in each S4 (DI-R2C and DII-R2C). We first determined the fraction of gating charge contributed by the individual S4's to maximal gating current (Qmax), and found that the outermost Arg residue in each S4 contributed ∼19% to Qmax with minimal contributions by other arginines. Stabilization of the S4's in DI-R2C and DII-R2C was confirmed by measuring the expected reduction in Qmax. In DI-R2C, stabilization resulted in a decrease in peak INa of ∼45%, while its peak current-voltage (I-V) and voltage-dependent Na channel availability (SSI) curves were nearly unchanged from wild type (WT). In contrast, stabilization of the DII-R2C enhanced activation with a negative shift in the peak I-V relationship by -7 mV and a larger -17 mV shift in the voltage-dependent SSI curve. Furthermore, its INa decay time constants and time-to-peak INa became more rapid than WT. An explanation for these results is that the depolarized conformation of DII-S4, but not DI-S4, affects the receptor for the inactivation particle formed by the interdomain linker between DIII and IV. In addition, the leftward shifts of both activation and inactivation and the decrease in Gmax after stabilization of the DII-S4 support previous studies that showed β-scorpion toxins trap the voltage sensor of DII in an activated conformation.
Park, Byoungnam; Whitham, Kevin; Bian, Kaifu; Lim, Yee-Fun; Hanrath, Tobias
2014-12-21
We used a bilayer field effect transistor (FET) consisting of a thin PbS nanocrystals (NCs) film interfaced with vacuum-deposited pentacene to probe trap states in NCs. We interpret the observed threshold voltage shift in context of charge carrier trapping by PbS NCs and relate the magnitude of the threshold voltage shift to the number of trapped carriers. We explored a series of NC surface ligands to modify the interface between PbS NCs and pentacene and demonstrate the impact of interface chemistry on charge carrier density and the FET mobility in a pentacene FET.
Effect of gamma-ray irradiation on the surface states of MOS tunnel junctions
NASA Technical Reports Server (NTRS)
Ma, T. P.; Barker, R. C.
1974-01-01
Gamma-ray irradiation with doses up to 8 megarad produces no significant change on either the C(V) or the G(V) characteristics of MOS tunnel junctions with intermediate oxide thicknesses (40-60 A), whereas the expected flat-band shift toward negative electrode voltages occurs in control thick oxide capacitors. A simple tunneling model would explain the results if the radiation-generated hole traps are assumed to lie below the valence band of the silicon. The experiments also suggest that the observed radiation-generated interface states in conventional MOS devices are not due to the radiation damage of the silicon surface.
Instability of phosphorous doped SiO2 in 4H-SiC MOS capacitors at high temperatures
NASA Astrophysics Data System (ADS)
Idris, M. I.; Weng, M. H.; Chan, H.-K.; Murphy, A. E.; Clark, D. T.; Young, R. A. R.; Ramsay, E. P.; Wright, N. G.; Horsfall, A. B.
2016-12-01
In this paper, the effect of inclusion of phosphorous (at a concentration below 1%) on the high temperature characteristics (up to 300 °C) of the SiO2/SiC interface is investigated. Capacitance-voltage measurements taken for a range of frequencies have been utilized to extract parameters including flatband voltage, threshold voltage, effective oxide charge, and interface state density. The variation of these parameters with temperature has been investigated for bias sweeps in opposing directions and a comparison made between phosphorous doped and as-grown oxides. At room temperature, the effective oxide charge for SiO2 may be reduced by the phosphorous termination of dangling bonds at the interface. However, at high temperatures, the effective charge in the phosphorous doped oxide remains unstable and effects such as flatband voltage shift and threshold voltage shift dominate the characteristics. The instability in these characteristics was found to result from the trapped charges in the oxide (±1012 cm-3) or near interface traps at the interface of the gate oxide and the semiconductor (1012-1013 cm-2 eV-1). Hence, the performance enhancements observed for phosphorous doped oxides are not realised in devices operated at elevated temperatures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiang, Lanyi; Ying, Jun; Han, Jinhua
2016-04-25
In this letter, we demonstrate a high reliable and stable organic field-effect transistor (OFET) based nonvolatile memory (NVM) with a polymer poly(4-vinyl phenol) (PVP) as the charge trapping layer. In the unipolar OFETs, the inreversible shifts of the turn-on voltage (V{sub on}) and severe degradation of the memory window (ΔV{sub on}) at programming (P) and erasing (E) voltages, respectively, block their application in NVMs. The obstacle is overcome by using a pn-heterojunction as the active layer in the OFET memory, which supplied a holes and electrons accumulating channel at the supplied P and E voltages, respectively. Both holes and electronsmore » transferring from the channels to PVP layer and overwriting the trapped charges with an opposite polarity result in the reliable bidirectional shifts of V{sub on} at P and E voltages, respectively. The heterojunction OFET exhibits excellent nonvolatile memory characteristics, with a large ΔV{sub on} of 8.5 V, desired reading (R) voltage at 0 V, reliable P/R/E/R dynamic endurance over 100 cycles and a long retention time over 10 years.« less
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)<5ms). However, the signal was small (ΔF/F=0.4%/200mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June
2017-01-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition. PMID:29093633
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
NASA Astrophysics Data System (ADS)
Wang, Hongjuan; Liu, Yan; Liu, Mingshan; Zhang, Qingfang; Zhang, Chunfu; Ma, Xiaohua; Zhang, Jincheng; Hao, Yue; Han, Genquan
2015-07-01
We design a novel GeSn-based heterojunction-enhanced p-channel tunneling field-effect transistor (HE-PTFET) with a Ge0.92Sn0.08/Ge heterojunction located in channel region, at a distance of LT-H from the Ge0.92Sn0.08 source-channel tunneling junction (TJ). HE-PTFETs demonstrate the negative shift of onset voltage VONSET, the steeper subthreshold swing S, and the improved on-state current ION compared to Ge0.92Sn0.08 homo-PTFET. At low VGS, the suppression of BTBT due to the widening of the tunneling barrier caused by the heterojunction leads to a negative shift of VONSET in HE-PTFETs. At high VGS, ION enhancement in HE-PTFETs is achieved over the homo device, which is attributed to the confinement of BTBT in Ge0.92Sn0.08 source-channel TJ region by the heterojunction, where the short tunneling paths lead to a high tunneling probability. Due to the steeper average S, HE-PTFET with a 6 nm LT-H achieves a 4 times higher ION compared to homo device at a VDD of -0.3 V.
Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.
Carvalho-de-Souza, Joao L; Bezanilla, Francisco
2018-02-05
Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018 Carvalho-de-Souza and Bezanilla.
Flash Memory Featuring Low-Voltage Operation by Crystalline ZrTiO4 Charge-Trapping Layer
NASA Astrophysics Data System (ADS)
Shen, Yung-Shao; Chen, Kuen-Yi; Chen, Po-Chun; Chen, Teng-Chuan; Wu, Yung-Hsien
2017-03-01
Crystalline ZrTiO4 (ZTO) in orthorhombic phase with different plasma treatments was explored as the charge-trapping layer for low-voltage operation flash memory. For ZTO without any plasma treatment, even with a high k value of 45.2, it almost cannot store charges due the oxygen vacancies-induced shallow-level traps that make charges easy to tunnel back to Si substrate. With CF4 plasma treatment, charge storage is still not improved even though incorporated F atoms could introduce additional traps since the F atoms disappear during the subsequent thermal annealing. On the contrary, nevertheless the k value degrades to 40.8, N2O plasma-treated ZTO shows promising performance in terms of 5-V hysteresis memory window by ±7-V sweeping voltage, 2.8-V flatband voltage shift by programming at +7 V for 100 μs, negligible memory window degradation with 105 program/erase cycles and 81.8% charge retention after 104 sec at 125 °C. These desirable characteristics are ascribed not only to passivation of oxygen vacancies-related shallow-level traps but to introduction of a large amount of deep-level bulk charge traps which have been proven by confirming thermally excited process as the charge loss mechanism and identifying traps located at energy level beneath ZTO conduction band by 0.84 eV~1.03 eV.
Flash Memory Featuring Low-Voltage Operation by Crystalline ZrTiO4 Charge-Trapping Layer.
Shen, Yung-Shao; Chen, Kuen-Yi; Chen, Po-Chun; Chen, Teng-Chuan; Wu, Yung-Hsien
2017-03-08
Crystalline ZrTiO 4 (ZTO) in orthorhombic phase with different plasma treatments was explored as the charge-trapping layer for low-voltage operation flash memory. For ZTO without any plasma treatment, even with a high k value of 45.2, it almost cannot store charges due the oxygen vacancies-induced shallow-level traps that make charges easy to tunnel back to Si substrate. With CF 4 plasma treatment, charge storage is still not improved even though incorporated F atoms could introduce additional traps since the F atoms disappear during the subsequent thermal annealing. On the contrary, nevertheless the k value degrades to 40.8, N 2 O plasma-treated ZTO shows promising performance in terms of 5-V hysteresis memory window by ±7-V sweeping voltage, 2.8-V flatband voltage shift by programming at +7 V for 100 μs, negligible memory window degradation with 10 5 program/erase cycles and 81.8% charge retention after 10 4 sec at 125 °C. These desirable characteristics are ascribed not only to passivation of oxygen vacancies-related shallow-level traps but to introduction of a large amount of deep-level bulk charge traps which have been proven by confirming thermally excited process as the charge loss mechanism and identifying traps located at energy level beneath ZTO conduction band by 0.84 eV~1.03 eV.
Multilevel cascade voltage source inverter with seperate DC sources
Peng, Fang Zheng; Lai, Jih-Sheng
1997-01-01
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.
Multilevel cascade voltage source inverter with seperate DC sources
Peng, Fang Zheng; Lai, Jih-Sheng
2002-01-01
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.
Multilevel cascade voltage source inverter with seperate DC sources
Peng, Fang Zheng; Lai, Jih-Sheng
2001-04-03
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.
Multilevel cascade voltage source inverter with separate DC sources
Peng, F.Z.; Lai, J.S.
1997-06-24
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations. 15 figs.
NASA Astrophysics Data System (ADS)
Singh, Subhash; Mohapatra, Y. N.
2016-07-01
There is a growing need to understand mechanisms of photoresponse in devices based on organic semiconductor thin films and interfaces. The phenomenon of persistent photocurrent (PPC) has been systematically investigated in solution processed TIPS-Pentacene based organic thin film transistors (OTFTs) as an important example of an organic semiconductor material system. With increasing light intensity from dark to 385 mW/cm2, there is a significant shift in threshold voltage (VTh) while the filed-effect mobility remains unchanged. The OTFT shows large photoresponse under white light illumination due to exponential tail states with characteristic energy parameter of 86 meV. The photo-induced current is observed to persist even for several hours after turning the light off. To investigate the origin of PPC, its quenching mechanism is investigated by a variety of methods involving a combination of gate bias, illumination and temperature. We show that a coherent model of trap-charge induced carrier concentration is able to account for the quenching behavior. Analysis of isothermal transients using time-analyzed transient spectroscopy shows that the emission rates are activated and are also field enhanced due to Poole-Frankel effect. The results shed light on the nature, origin, and energetic distribution of the traps controlling PPC in solution processed organic semiconductors and their interfaces.
NASA Astrophysics Data System (ADS)
Mahata, C.; Bera, M. K.; Bose, P. K.; Maiti, C. K.
2009-02-01
Internal photoemission and magnetic resonance studies have been performed to investigate the charge trapping behavior and chemical nature of defects in ultrathin (~14 nm) high-k ZrO2 dielectric films deposited on p-Ge (1 0 0) substrates at low temperature (<200 °C) by plasma-enhanced chemical vapor deposition (PECVD) in a microwave (700 W, 2.45 GHz) plasma at a pressure of ~65 Pa. Both the band and defect-related electron states have been characterized using electron paramagnetic resonance, internal photoemission, capacitance-voltage and current-voltage measurements under UV illumination. Capacitance-voltage and photocurrent-voltage measurements were used to determine the centroid of oxide charge within the high-k gate stack. The observed shifts in photocurrent response of the Al/ZrO2/GeO2/p-Ge metal-insulator-semiconductor (MIS) capacitors indicate the location of the centroids to be within the ZrO2 dielectric near to the gate electrode. Moreover, the measured flat band voltage and photocurrent shifts also indicate a large density of traps in the dielectric. The impact of plasma nitridation on the interfacial quality of the oxides has been investigated. Different N sources, such as NO and NH3, have been used for nitrogen engineering. Oxynitride samples show a lower defect density and trapping over the non-nitrided samples. The charge trapping and detrapping properties of MIS capacitors under stressing in constant current and voltage modes have been investigated in detail.
Perchlorate enhances transmission in skeletal muscle excitation- contraction coupling
1993-01-01
The effects of the anion perchlorate (present extracellularly at 8 mM) were studied on functional skeletal muscle fibers from Rana pipiens, voltage-clamped in a Vaseline gap chamber. Established methods were used to monitor intramembranous charge movement and flux of Ca release from the sarcoplasmic reticulum (SR) during pulse depolarization. Saponin permeabilization of the end portions of the fiber segment (Irving, M., J. Maylie, N. L. Sizto, and W. K. Chandler. 1987. Journal of General Physiology. 89:1-41) substantially reduced the amount of charge moving during conventional control pulses, thus minimizing a technical error that plagued our previous studies. Perchlorate prolonged the ON time course of charge movement, especially at low and intermediate voltages. The OFFs were also made slower, the time constant increasing twofold. The hump kinetic component was exaggerated by ClO4- or was made to appear in fibers that did not have it in reference conditions. ClO4- had essentially no kinetic ON effects at high voltages (> or = 10 mV). ClO4- changed the voltage distribution of mobile charge. In single Boltzmann fits, the midpoint potential V was shifted -20 mV and the steepness parameter K was reduced by 4.7 mV (or 1.78-fold), but the maximum charge was unchanged (n = 9). Total Ca content in the SR, estimated using the method of Schneider et al. (Schneider, M. F., B. J. Simon, and G. Szucs. 1987. Journal of Physiology. 392:167-192) for correcting for depletion, stayed constant over tens of minutes in reference conditions but decayed in ClO4- at an average rate of 0.3 mumol/liter myoplasmic water per s. ClO4- changed the kinetics of release flux, reducing the fractional inactivation of release after the peak. ClO4- shifted the voltage dependence of Ca release flux. In particular, the threshold voltage for Ca release was shifted by about -20 mV, and the activation of the steady component of release flux was shifted by > 20 mV in the negative direction. The shift of release activation was greater than that of mobile charge. Thus the threshold charge, defined as the minimum charge moved for eliciting a detectable Ca transient, was reduced from 6 nC/microF (0.55, n = 7) to 3.4 (0.53). The average of the paired differences was 2.8 (0.33, P < 0.01). The effects of ClO4- were then studied in fibers in modified functional situations. Depletion of Ca in the SR, achieved by high frequency pulsing in the presence of intracellular BAPTA and EGTA, simplified but did not eliminate the effects of ClO4-.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8245817
Temporal differentiation of pH-dependent capacitive current from dopamine.
Yoshimi, Kenji; Weitemier, Adam
2014-09-02
Voltammetric recording of dopamine (DA) with fast-scan cyclic voltammetry (FSCV) on carbon fiber microelectrodes have been widely used, because of its high sensitivity to dopamine. However, since an electric double layer on a carbon fiber surface in a physiological ionic solution behaves as a capacitor, fast voltage manipulation in FSCV induces large capacitive current. The faradic current from oxidation/reduction of target chemicals must be extracted from this large background current. It is known that ionic shifts, including H(+), influence this capacitance, and pH shift can cause confounding influences on the FSCV recordings within a wide range of voltage. Besides FSCV with a triangular waveform, we have been using rectangular pulse voltammetry (RPV) for dopamine detection in the brain. In this method, the onset of a single pulse causes a large capacitive current, but unlike FSCV, the capacitive current is restricted to a narrow temporal window of just after pulse onset (<5 ms). In contrast, the peak of faradic current from dopamine oxidation occurs after a delay of more than a few milliseconds. Taking advantage of the temporal difference, we show that RPV could distinguish dopamine from pH shifts clearly and easily. In addition, the early onset current was useful to evaluate pH shifts. The narrow voltage window of our RPV pulse allowed a clear differentiation of dopamine and serotonin (5-HT), as we have shown previously. Additional recording with RPV, alongside FSCV, would improve identification of chemicals such as dopamine, pH, and 5-HT.
Matiukas, Arvydas; Mitrea, Bogdan G; Qin, Maochun; Pertsov, Arkady M; Shvedko, Alexander G; Warren, Mark D; Zaitsev, Alexey V; Wuskell, Joseph P; Wei, Mei-de; Watras, James; Loew, Leslie M
2007-11-01
Styryl voltage-sensitive dyes (e.g., di-4-ANEPPS) have been used successfully for optical mapping in cardiac cells and tissues. However, their utility for probing electrical activity deep inside the myocardial wall and in blood-perfused myocardium has been limited because of light scattering and high absorption by endogenous chromophores and hemoglobin at blue-green excitation wavelengths. The purpose of this study was to characterize two new styryl dyes--di-4-ANBDQPQ (JPW-6003) and di-4-ANBDQBS (JPW-6033)--optimized for blood-perfused tissue and intramural optical mapping. Voltage-dependent spectra were recorded in a model lipid bilayer. Optical mapping experiments were conducted in four species (mouse, rat, guinea pig, and pig). Hearts were Langendorff perfused using Tyrode's solution and blood (pig). Dyes were loaded via bolus injection into perfusate. Transillumination experiments were conducted in isolated coronary-perfused pig right ventricular wall preparations. The optimal excitation wavelength in cardiac tissues (650 nm) was >70 nm beyond the absorption maximum of hemoglobin. Voltage sensitivity of both dyes was approximately 10% to 20%. Signal decay half-life due to dye internalization was 80 to 210 minutes, which is 5 to 7 times slower than for di-4-ANEPPS. In transillumination mode, DeltaF/F was as high as 20%. In blood-perfused tissues, DeltaF/F reached 5.5% (1.8 times higher than for di-4-ANEPPS). We have synthesized and characterized two new near-infrared dyes with excitation/emission wavelengths shifted >100 nm to the red. They provide both high voltage sensitivity and 5 to 7 times slower internalization rate compared to conventional dyes. The dyes are optimized for deeper tissue probing and optical mapping of blood-perfused tissue, but they also can be used for conventional applications.
D242N, a KV7.1 LQTS mutation uncovers a key residue for IKs voltage dependence.
Moreno, Cristina; Oliveras, Anna; Bartolucci, Chiara; Muñoz, Carmen; de la Cruz, Alicia; Peraza, Diego A; Gimeno, Juan R; Martín-Martínez, Mercedes; Severi, Stefano; Felipe, Antonio; Lambiase, Pier D; Gonzalez, Teresa; Valenzuela, Carmen
2017-09-01
K V 7.1 and KCNE1 co-assemble to give rise to the I Ks current, one of the most important repolarizing currents of the cardiac action potential. Its relevance is underscored by the identification of >500 mutations in K V 7.1 and, at least, 36 in KCNE1, that cause Long QT Syndrome (LQTS). The aim of this study was to characterize the biophysical and cellular consequences of the D242N K V 7.1 mutation associated with the LQTS. The mutation is located in the S4 transmembrane segment, within the voltage sensor of the K V 7.1 channel, disrupting the conserved charge balance of this region. Perforated patch-clamp experiments show that, unexpectedly, the mutation did not disrupt the voltage-dependent activation but it removed the inactivation and slowed the activation kinetics of D242N K V 7.1 channels. Biotinylation of cell-surface protein and co-immunoprecipitation experiments revealed that neither plasma membrane targeting nor co-assembly between K V 7.1 and KCNE1 was altered by the mutation. However, the association of D242N K V 7.1 with KCNE1 strongly shifted the voltage dependence of activation to more depolarized potentials (+50mV), hindering I Ks current at physiologically relevant membrane potentials. Both functional and computational analysis suggest that the clinical phenotype of the LQTS patients carrying the D242N mutation is due to impaired action potential adaptation to exercise and, in particular, to increase in heart rate. Moreover, our data identify D242 aminoacidic position as a potential residue involved in the KCNE1-mediated regulation of the voltage dependence of activation of the K V 7.1 channel. Copyright © 2017 Elsevier Ltd. All rights reserved.
New Modulation Method and Control Strategies for Power Electronics Inverters
NASA Astrophysics Data System (ADS)
Aleenejad, Mohsen
The DC to AC power Converters (so-called Inverters) are widely used in industrial applications. The MLIs are becoming increasingly popular in industrial apparatus aimed at medium to high power conversion applications. In comparison to the conventional inverters, they feature superior characteristics such as lower total harmonic distortion (THD), higher efficiency, and lower switching voltage stress. Nevertheless, the superior characteristics come at the price of a more complex topology with an increased number of power electronic switches. The increased number of power electronics switches results in more complicated control strategies for the inverter. Moreover, as the number of power electronic switches increases, the chances of fault occurrence of the switches increases, and thus the inverter's reliability decreases. Due to the extreme monetary ramifications of the interruption of operation in commercial and industrial applications, high reliability for power inverters utilized in these sectors is critical. As a result, developing simple control strategies for normal and fault-tolerant operation of MLIs has always been an interesting topic for researchers in related areas. The purpose of this dissertation is to develop new control and fault-tolerant strategies for the multilevel power inverter. For the normal operation of the inverter, a new high switching frequency technique is developed. The proposed method extends the utilization of the dc link voltage while minimizing the dv/dt of the switches. In the event of a fault, the line voltages of the faulty inverters are unbalanced and cannot be applied to the 3-phase loads. For the faulty condition of the inverter, three novel fault-tolerant techniques are developed. The proposed fault-tolerant strategies generate balanced line voltages without bypassing any healthy and operative inverter element, makes better use of the inverter capacity and generates higher output voltage. These strategies exploit the advantages of the Selective Harmonic Elimination (SHE) and Space Vector Modulation (SVM) methods in conjunction with a slightly modified Fundamental Phase Shift Compensation (FPSC) technique to generate balanced voltages and manipulate voltage harmonics at the same time. The proposed strategies are applicable to several classes of MLIs with three or more voltage levels.
New design of a passive type RADFET reader for enhanced sensitivity
NASA Astrophysics Data System (ADS)
Lee, Dae-Hee
2016-07-01
We present a new design of a passive type RADFET reader with enhanced radiation sensitivity. Using a electostatic plate, we have applied a static electric field to the gate voltage, which impacts a positive biasing on the p-type MOSFET. The resultant effect shows that 1.8 times of radiation sensitivity increased when we measured the threshold voltage shift of the RADFET exposed to 30 krad irradiation. We discuss further about the characteristic changes of a RADFET according to the positive biasing on the gate voltage.
Carvacrol modulates voltage-gated sodium channels kinetics in dorsal root ganglia.
Joca, Humberto Cavalcante; Vieira, Daiana Cardoso Oliveira; Vasconcelos, Aliny Perreira; Araújo, Demetrius Antônio Machado; Cruz, Jader Santos
2015-06-05
Recent studies have shown that many of plant-derived compounds interact with specific ion channels and thereby modulate many sensing mechanisms, such as nociception. The monoterpenoid carvacrol (5-isopropyl-2-methylphenol) has an anti-nociceptive effect related to a reduction in neuronal excitability and voltage-gated Na(+) channels (NaV) inhibition in peripheral neurons. However, the detailed mechanisms of carvacrol-induced inhibition of neuronal NaV remain elusive. This study explores the interaction between carvacrol and NaV in isolated dorsal root ganglia neurons. Carvacrol reduced the total voltage-gated Na(+) current and tetrodotoxin-resistant (TTX-R) Na(+) current component in a concentration-dependent manner. Carvacrol accelerates current inactivation and induced a negative-shift in voltage-dependence of steady-state fast inactivation in total and TTX-R Na(+) current. Furthermore, carvacrol slowed the recovery from inactivation. Carvacrol provoked a leftward shift in both the voltage-dependence of steady-state inactivation and activation of the TTX-R Na(+) current component. In addition, carvacrol-induced inhibition of TTX-R Na(+) current was enhanced by an increase in stimulation frequency and when neurons were pre-conditioned with long depolarization pulse (5s at -50 mV). Taken all results together, we herein demonstrated that carvacrol affects NaV gating properties. The present findings would help to explain the mechanisms underlying the analgesic activity of carvacrol. Copyright © 2015 Elsevier B.V. All rights reserved.
Kim, Beomjin; Park, Youngil; Kim, Seungho; Lee, Younggu; Park, Jongwook
2014-08-01
DPPZ showed UV-Vis. and PL maximum values of 412 and 638 nm, meaning the large stokes shift. Blue host compound, TAT was synthesized and used for co-mixed white emission. TAT exhibited UV-Vis. and PL maximum values of 403 nm and 445 nm in film state. Thus, when two compounds are used as co-mixed emitter in OLED device, there is no energy transfer from blue emission of TAT to DPPZ due to large stokes shift of DPPZ. Based on the PL result, it is available to realize two-colored white in PL and EL spectra. As a result of this, two-mixed compounds showed vivid their own PL emission peaks of 449 and 631 nm in film state. Also, white OLED device using two-mixed compounds system was fabricated. EL spectrum shows 457 and 634 nm peaks and two separate EL peaks, respectively. As the operation voltage is increased from 7 to 11 V, EL spectrum does not change the peak shape and maximum wavelength values. EL performance of white device showed 0.29 cd/A, 0.14 lm/W, and CIE (0.325, 0.195) at 7 V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bean, Bruce Palmer
The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in themore » hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.« less
Nonlinear electro-optic tuning of plasmonic nano-filter
NASA Astrophysics Data System (ADS)
Kotb, Rehab; Ismail, Yehea; Swillam, Mohamed A.
2015-03-01
Efficient, easy and accurate tuning techniques to a plasmonic nano-filter are investigated. The proposed filter supports both blue and red shift in the resonance wavelength. By varying the refractive index with a very small change (in the order of 10-3), the resonance wavelength can be controlled efficiently. Using Pockels material, an electrical tuning to the response of the filter is demonstrated. In addition, the behavior of the proposed filter can be controlled optically using Kerr material. A new approach of multi-stage electro-optic controlling is introduced. By cascading two stages and filling the first stage with pockels material and the second stage with kerr material, the output response of the second stage can be controlled by controlling the output response of the first stage electrically. Due to the sharp response of the proposed filter, 60nm shift in the resonance wavelength per 10 voltages is achieved. This nano-filter has compact size, low loss, sharp response and wide range of tunabilty which is highly demandable in many biological and sensing applications.
NASA Astrophysics Data System (ADS)
Selvaraj, Seenivasan; Moon, Hee; Kim, Do-Heyoung
2018-01-01
Photo-electrochemical water splitting with hematite photo-anodes under solar irradiation has attracted considerable attention as regards the production of renewable hydrogen energy. However, many challenges remain unresolved, as the full contribution of the catalytic over-layers has not been fully realized. Herein, we incorporate uniform spinel nickel-ferrite over-layers in hematite photo-anodes to obtain an improved understanding of the associated intrinsic changes. We achieve a 1.5-mA/cm2 photo-current density at 1.23 VRHE (RHE: reversible hydrogen electrode) under one-sun illumination conditions, along with a negative shift of 200 mV in the onset potential, for NiFe2O4-coated Sn-doped hematite photo-anodes. Fundamental electrochemical analyses clearly show that the shift in the onset potential is predominantly due to the enhanced photo-voltage development inside the hematite, rather than being purely caused by the interfacial kinetics. These insights reveal a new direction for fundamental research on photo-anodes towards fabrication of more efficient photo-anode systems.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred
2016-01-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857
Welding Experiments of Aluminum Alloy by Space GHTA Welding at ISS Orbital Pressure
NASA Astrophysics Data System (ADS)
Suita, Yoshikazu; Takai, Daisuke; Sugiyama, Satoshi; Terajima, Noboru; Tsukuda, Yoshiyuki; Fujisawa, Shoichiro; Imagawa, Kichiro
As a feasible welding method in space, the authors previously proposed the space GHTA (Gas Hollow Tungsten Arc) welding process. However, space GHTA welding with a high-frequency device for arc start may cause electromagnetic noise problems for the computer equipment placed on the ISS (International Space Station). Therefore, in this report, welding experiments of space GHTA welding using aluminum alloy with a high-voltage DC device for arc start were carried out at the ISS orbital pressure, 10-5 Pa. It is clear from the experiments using a high-voltage DC device in a high-vacuum condition, that there is a shifting phenomenon in which the spark discharge shifts to either a glow discharge or an arc discharge when starting the arc. Welding projects in space need an arc discharge, so we investigated the effects of welding parameters on the arc formation ratio. As a result, space GHTA welding with a high-voltage DC device can be used for arc start when welding at the ISS orbital pressure.
Apparatus and method for monitoring the presence of a conductive media
DuVall, Bruce W.; Valentine, James W.; Morey, Kenneth O.
1979-01-01
An inductive level sensor has inductively coupled primary and secondary windings. Circuitry drives the primary with an AC signal of constant current magnitude and selected frequency f to induce in the secondary, a voltage signal V of magnitude .vertline.V.vertline., frequency f and phase difference .phi. from the driving signal. Circuitry operates to generate a voltage output signal proportional to .vertline.V.vertline. cos (.phi.-.theta.), where .theta. is a selectively set phase shift factor. By properly and selectively adjusting the frequency f and phase shift factor .theta., an output signal .vertline.V.vertline. cos (.phi.-.theta.) can be provided which self-compensates for changes in mutual inductance caused by operating temperature variations so that an output signal is produced which is substantially linearly proportional to changes in the level of a pool of liquid metal being monitored. Disclosed also is calibration circuitry and circuitry for converting the voltage signal .vertline.V.vertline. cos (.phi.-.theta.) into a current signal.
Colcombet, Jean; Lelièvre, Françoise; Thomine, Sébastien; Barbier-Brygoo, Hélène; Frachisse, Jean-Marie
2005-07-01
Variations in both intracellular and extracellular pH are known to be involved in a wealth of physiological responses. Using the patch-clamp technique on Arabidopsis hypocotyl cells, it is shown that rapid-type and slow-type anion channels at the plasma membrane are both regulated by pH via distinct mechanisms. Modifications of pH modulate the voltage-dependent gating of the rapid channel. While intracellular alkalinization facilitates channel activation by shifting the voltage gate towards negative potentials, extracellular alkalinization shifts the activation threshold to more positive potentials, away from physiological resting membrane potentials. By contrast, pH modulates slow anion channel activity in a voltage-independent manner. Intracellular acidification and extracellular alkalinization increase slow anion channel currents. The possible role of these distinct modulations in physiological processes involving anion efflux and modulation of extracellular and/or intracellular pH, such as elicitor and ABA signalling, are discussed.
External protons destabilize the activated voltage sensor in hERG channels.
Shi, Yu Patrick; Cheng, Yen May; Van Slyke, Aaron C; Claydon, Tom W
2014-03-01
Extracellular acidosis shifts hERG channel activation to more depolarized potentials and accelerates channel deactivation; however, the mechanisms underlying these effects are unclear. External divalent cations, e.g., Ca(2+) and Cd(2+), mimic these effects and coordinate within a metal ion binding pocket composed of three acidic residues in hERG: D456 and D460 in S2 and D509 in S3. A common mechanism may underlie divalent cation and proton effects on hERG gating. Using two-electrode voltage clamp, we show proton sensitivity of hERG channel activation (pKa = 5.6), but not deactivation, was greatly reduced in the presence of Cd(2+) (0.1 mM), suggesting a common binding site for the Cd(2+) and proton effect on activation and separable effects of protons on activation and deactivation. Mutational analysis confirmed that D509 plays a critical role in the pH dependence of activation, as shown previously, and that cooperative actions involving D456 and D460 are also required. Importantly, neutralization of all three acidic residues abolished the proton-induced shift of activation, suggesting that the metal ion binding pocket alone accounts for the effects of protons on hERG channel activation. Voltage-clamp fluorimetry measurements demonstrated that protons shifted the voltage dependence of S4 movement to more depolarized potentials. The data indicate a site and mechanism of action for protons on hERG activation gating; protonation of D456, D460 and D509 disrupts interactions between these residues and S4 gating charges to destabilize the activated configuration of S4.
Anode reactive bleed and injector shift control strategy
Cai, Jun [Rochester, NY; Chowdhury, Akbar [Pittsford, NY; Lerner, Seth E [Honeoye Falls, NY; Marley, William S [Rush, NY; Savage, David R [Rochester, NY; Leary, James K [Rochester, NY
2012-01-03
A system and method for correcting a large fuel cell voltage spread for a split sub-stack fuel cell system. The system includes a hydrogen source that provides hydrogen to each split sub-stack and bleed valves for bleeding the anode side of the sub-stacks. The system also includes a voltage measuring device for measuring the voltage of each cell in the split sub-stacks. The system provides two levels for correcting a large stack voltage spread problem. The first level includes sending fresh hydrogen to the weak sub-stack well before a normal reactive bleed would occur, and the second level includes sending fresh hydrogen to the weak sub-stack and opening the bleed valve of the other sub-stack when the cell voltage spread is close to stack failure.
Membrane permeable local anesthetics modulate NaV1.5 mechanosensitivity
Beyder, Arthur; Strege, Peter R.; Bernard, Cheryl; Farrugia, Gianrico
2012-01-01
Voltage-gated sodium selective ion channel NaV1.5 is expressed in the heart and the gastrointestinal tract, which are mechanically active organs. NaV1.5 is mechanosensitive at stimuli that gate other mechanosensitive ion channels. Local anesthetic and antiarrhythmic drugs act upon NaV1.5 to modulate activity by multiple mechanisms. This study examined whether NaV1.5 mechanosensitivity is modulated by local anesthetics. NaV1.5 channels wereexpressed in HEK-293 cells, and mechanosensitivity was tested in cell-attached and excised inside-out configurations. Using a novel protocol with paired voltage ladders and short pressure pulses, negative patch pressure (-30 mmHg) in both configurations produced a hyperpolarizing shift in the half-point of the voltage-dependence of activation (V1/2a) and inactivation (V1/2i) by about -10 mV. Lidocaine (50 µM) inhibited the pressure-induced shift of V1/2a but not V1/2i. Lidocaine inhibited the tonic increase in pressure-induced peak current in a use-dependence protocol, but it did not otherwise affect use-dependent block. The local anesthetic benzocaine, which does not show use-dependent block, also effectively blocked a pressure-induced shift in V1/2a. Lidocaine inhibited mechanosensitivity in NaV1.5 at the local anesthetic binding site mutated (F1760A). However, a membrane impermeable lidocaine analog QX-314 did not affect mechanosensitivity of F1760A NaV1.5 when applied from either side of the membrane. These data suggest that the mechanism of lidocaine inhibition of the pressure-induced shift in the half-point of voltage-dependence of activation is separate from the mechanisms of use-dependent block. Modulation of NaV1.5 mechanosensitivity by the membrane permeable local anesthetics may require hydrophobic access and may involve membrane-protein interactions. PMID:22874086
Electro-optic voltage sensor for sensing voltage in an E-field
Woods, G.K.; Renak, T.W.
1999-04-06
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 18 figs.
Electro-optic voltage sensor for sensing voltage in an E-field
Woods, Gregory K.; Renak, Todd W.
1999-01-01
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.
Bias temperature instability in tunnel field-effect transistors
NASA Astrophysics Data System (ADS)
Mizubayashi, Wataru; Mori, Takahiro; Fukuda, Koichi; Ishikawa, Yuki; Morita, Yukinori; Migita, Shinji; Ota, Hiroyuki; Liu, Yongxun; O'uchi, Shinichi; Tsukada, Junichi; Yamauchi, Hiromi; Matsukawa, Takashi; Masahara, Meishoku; Endo, Kazuhiko
2017-04-01
We systematically investigated the bias temperature instability (BTI) of tunnel field-effect transistors (TFETs). The positive BTI and negative BTI mechanisms in TFETs are the same as those in metal-oxide-semiconductor FETs (MOSFETs). In TFETs, although traps are generated in high-k gate dielectrics by the bias stress and/or the interface state is degraded at the interfacial layer/channel interface, the threshold voltage (V th) shift due to BTI degradation is caused by the traps and/or the degradation of the interface state locating the band-to-band tunneling (BTBT) region near the source/gate edge. The BTI lifetime in n- and p-type TFETs is improved by applying a drain bias corresponding to the operation conditions.
Microdose analysis of ion strikes on SRAM cells
NASA Astrophysics Data System (ADS)
Scheick, L.
2003-12-01
A method of measuring the effect from exposure to highly localized ionizing radiation on microstructures is described. The voltage at which a commercial SRAM cell cannot hold a programmed state changes with microdose. The microdose distribution across the array, in addition to the analysis of the occurrence of anomalous shifts in operating bias due to rare, large energy-deposition events is studied. The effect of multiple hits on a SRAM cell is presented. A general theory on multiple hits from which basic device parameters can be extracted is presented. SPICE, as well as analysis of basic device physics, is used to analyze the damage to individual transistors and the response of a SRAM cell.
Inverse spin Hall and spin rectification effects in NiFe/FeMn exchange-biased thin films
NASA Astrophysics Data System (ADS)
Garcia, W. J. S.; Seeger, R. L.; da Silva, R. B.; Harres, A.
2017-11-01
Materials presenting high spin-orbit coupling are able to convert spin currents in charge currents. The phenomenon, known as inverse spin Hall effect, promises to revolutionize spintronic technology enabling the electrical detection of spin currents. It has been observed in a variety of systems, usually non-magnetic metals. We study the voltage emerging in exchange biased Ta/NiFe/FeMn/Ta thin films near the ferromagnetic resonance. Measured signals are related to both inverse spin Hall and spin rectification effects, and two distinct protocols were employed to separate their contributions.The curve shift due to the exchange bias effect may enable high frequency applications without an external applied magnetic field.
Voltage-Clamp Studies on Uterine Smooth Muscle
Anderson, Nels C.
1969-01-01
These studies have developed and tested an experimental approach to the study of membrane ionic conductance mechanisms in strips of uterine smooth muscle. The experimental and theoretical basis for applying the double sucrose-gap technique is described along with the limitations of this system. Nonpropagating membrane action potentials were produced in response to depolarizing current pulses under current-clamp conditions. The stepwise change of membrane potential under voltage-clamp conditions resulted in a family of ionic currents with voltage- and time-dependent characteristics. In sodium-free solution the peak transient current decreased and its equilibrium potential shifted along the voltage axis toward a more negative internal potential. These studies indicate a sodium-dependent, regenerative excitation mechanism. PMID:5796366
Crebanine inhibits voltage-dependent Na+ current in guinea-pig ventricular myocytes.
Xiao-Shan, He; Qing, Lin; Yun-Shu, Ma; Ze-Pu, Yu
2014-01-01
To study the effects of crebanine on voltage-gated Na(+) channels in cardiac tissues. Single ventricular myocytes were enzymatically dissociated from adult guinea-pig heart. Voltage-dependent Na(+) current was recorded using the whole cell voltage-clamp technique. Crebanine reversibly inhibited Na(+) current with an IC50 value of 0.283 mmol·L(-1) (95% confidence range: 0.248-0.318 mmol·L(-1)). Crebanine at 0.262 mmol·L(-1) caused a negative shift (about 12 mV) in the voltage-dependence of steady-state inactivation of Na(+) current, and retarded its recovery from inactivation, but did not affect its activation curve. In addition to blocking other voltage-gated ion channels, crebanine blocked Na(+) channels in guinea-pig ventricular myocytes. Crebanine acted as an inactivation stabilizer of Na(+) channels in cardiac tissues. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Voltage and frequency dependence of prestin-associated charge transfer
Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.
2009-01-01
Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917
Rotstein, Horacio G
2014-01-01
We investigate the dynamic mechanisms of generation of subthreshold and phase resonance in two-dimensional linear and linearized biophysical (conductance-based) models, and we extend our analysis to account for the effect of simple, but not necessarily weak, types of nonlinearities. Subthreshold resonance refers to the ability of neurons to exhibit a peak in their voltage amplitude response to oscillatory input currents at a preferred non-zero (resonant) frequency. Phase-resonance refers to the ability of neurons to exhibit a zero-phase (or zero-phase-shift) response to oscillatory input currents at a non-zero (phase-resonant) frequency. We adapt the classical phase-plane analysis approach to account for the dynamic effects of oscillatory inputs and develop a tool, the envelope-plane diagrams, that captures the role that conductances and time scales play in amplifying the voltage response at the resonant frequency band as compared to smaller and larger frequencies. We use envelope-plane diagrams in our analysis. We explain why the resonance phenomena do not necessarily arise from the presence of imaginary eigenvalues at rest, but rather they emerge from the interplay of the intrinsic and input time scales. We further explain why an increase in the time-scale separation causes an amplification of the voltage response in addition to shifting the resonant and phase-resonant frequencies. This is of fundamental importance for neural models since neurons typically exhibit a strong separation of time scales. We extend this approach to explain the effects of nonlinearities on both resonance and phase-resonance. We demonstrate that nonlinearities in the voltage equation cause amplifications of the voltage response and shifts in the resonant and phase-resonant frequencies that are not predicted by the corresponding linearized model. The differences between the nonlinear response and the linear prediction increase with increasing levels of the time scale separation between the voltage and the gating variable, and they almost disappear when both equations evolve at comparable rates. In contrast, voltage responses are almost insensitive to nonlinearities located in the gating variable equation. The method we develop provides a framework for the investigation of the preferred frequency responses in three-dimensional and nonlinear neuronal models as well as simple models of coupled neurons.
Imanidis, Georgios; Luetolf, Peter
2006-07-01
An extended model for iontophoretic enhancement of transdermal drug permeation under constant voltage is described based on the previously modified Nernst-Planck equation, which included the effect of convective solvent flow. This model resulted in an analytical expression for the enhancement factor as a function of applied voltage, convective flow velocity due to electroosmosis, ratio of lipid to aqueous pathway passive permeability, and weighted average net ionic valence of the permeant in the aqueous epidermis domain. The shift of pH in the epidermis compared to bulk caused by the electrical double layer at the lipid-aqueous domain interface was evaluated using the Poisson-Boltzmann equation. This was solved numerically for representative surface charge densities and yielded pH differences between bulk and epidermal aqueous domain between 0.05 and 0.4 pH units. The developed model was used to analyze the experimental enhancement of an amphoteric weak electrolyte measured in vitro using human cadaver epidermis and a voltage of 250 mV at different pH values. Parameter values characterizing the involved factors were determined that yielded the experimental enhancement factors and passive permeability coefficients at all pH values. The model provided a very good agreement between experimental and calculated enhancement and passive permeability. The deduced parameters showed (i) that the pH shift in the aqueous permeation pathway had a notable effect on the ionic valence and the partitioning of the drug in this domain for a high surface charge density and depending on the pK(a) and pI of the drug in relation to the bulk pH; (ii) the magnitude and the direction of convective transport due to electroosmosis typically reflected the density and sign, respectively, of surface charge of the tissue and its effect on enhancement was substantial for bulk pH values differing from the pI of epidermal tissue; (iii) the aqueous pathway predominantly determined passive permeability of the studied compound despite its measurable lipophilicity and therefore the lipid pathway did not notably affect enhancement. Hence, the proposed model can provide a good quantitative insight into the interplay between different phenomena and permeant properties influencing iontophoresis and can potentially be used as a predictive tool of the process.
Lau, H W; Tan, O K; Liu, Y; Trigg, D A; Chen, T P
2006-08-28
In this work, we report on the fabrication of tetraethylorthosilicate (TEOS) thin dielectric film containing silicon nanocrystals (Si nc), synthesized by solid-state reaction, in a capacitor structure. A metal-insulator-semi-conductor (MIS) capacitor, with 28 nm thick Si nc in a TEOS thin film, has been fabricated. For this MIS, both electron and hole trapping in the Si nc are possible, depending on the polarity of the bias voltage. A V(FB) shift greater than 1 V can be experienced by a bias voltage of 16 V applied to the metal electrode for 1 s. Though there is no top control oxide, the discharge time for 10% of charges can be up to 4480 s when it is biased at 16 V for 1 s. It is further demonstrated that charging and discharging mechanisms are due to the Si nc rather than the TEOS oxide defects. This form of Si nc in a TEOS thin film capacitor provides the possibility of memory applications at low cost.
NASA Astrophysics Data System (ADS)
Han, Genquan; Zhao, Bin; Liu, Yan; Wang, Hongjuan; Liu, Mingshan; Zhang, Chunfu; Hu, Shengdong; Hao, Yue
2015-12-01
We design a heterojunction-enhanced n-channel tunneling field effect transistor (HE-TFET) with an InAs/In1-xGaxAs heterojunction located in channel region with a distance of LT-H from source/channel tunneling junction. The influence of LT-H on the performance of HE-TFETs is investigated by simulation. Compared with InAs homo-NTFET, the positive shift of onset voltage, the steeper subthreshold swing (SS), and the enhanced on-state current ION are achieved in HE-NTFETs, which is attributed to the modulation of the heterojunction on band-to-band tunneling. At a supply voltage of 0.3 V, ION of InAs/In0.9Ga0.1As HE-NTFET with a LT-H of 6 nm demonstrates an enhancement of 119.3% in comparison with the homo device. Furthermore, the impact of Ga composition on the performance of HE-NTFETs is studied. As the Ga composition increases, the average SS characteristics of HE-NTFETs are improved, while the drive current of devices is reduced due to the increasing of tunneling barrier.
NASA Astrophysics Data System (ADS)
Hossain Chowdhury, Md Delwar; Migliorato, Piero; Jang, Jin
2013-04-01
We have investigated the temperature dependence of negative bias under illumination stress and recovery. The transfer characteristics exhibits a non-rigid shift towards negative gate voltages. For both stress and recovery, the voltage shift in deep depletion is twice that in accumulation. The results support the mechanism we previously proposed, which is creation and annealing of a double donor, likely to be an oxygen vacancy. The time dependence of stress and recovery can be fitted to stretched exponentials. Both processes are thermally activated with activation energies 1.06 eV and 1.25 eV for stress and recovery, respectively. A potential energy diagram is proposed to explain the results.
Triple voltage dc-to-dc converter and method
Su, Gui-Jia
2008-08-05
A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.
NASA Astrophysics Data System (ADS)
Sarathi, R.; Giridhar, A. V.; Sethupathi, K.
2011-02-01
The UHF signals are generated due to PD formed by particle movement in liquid nitrogen under AC voltages. The levitation voltage of a particle in liquid nitrogen measured through UHF technique and by conventional PD measurement technique is the same, confirming the sensitivity of UHF technique for identification of PD activity. The frequency content of UHF signal generated due to particle movement in liquid nitrogen, under AC voltages, lies in the range 0.5-1.5 GHz. The characteristics of UHF signal generated due to particle movement between the barrier and high voltage/ground electrode is much similar to the signal generated by particle movement in clean electrode gap. Pseudo resonance phenomena can occur in liquid nitrogen due to particle movement. It is also observed that the partial discharge magnitude, in general, be high when the particle moves between the barrier and high voltage electrode when compared to the barrier and the ground electrode. Percentage of clay in epoxy nanocomposites has not altered the levitation voltage of the particle in the electrode gap. Zero span analysis clearly indicates that pseudo resonance occurs when particle moves (in a short gap) between the barrier and high voltage/ground electrode.
Ri, Y; Ballesteros, J A; Abrams, C K; Oh, S; Verselis, V K; Weinstein, H; Bargiello, T A
1999-01-01
We have explored the role of a proline residue located at position 87 in the second transmembrane segment (TM2) of gap junctions in the mechanism of voltage-dependent gating of connexin32 (Cx32). Substitution of this proline (denoted Cx32P87) with residues G, A, or V affects channel function in a progressive manner consistent with the expectation that a proline kink (PK) motif exists in the second transmembrane segment (TM2) of this connexin. Mutations of the preceding threonine residue T86 to S, A, C, V, N, or L shift the conductance-voltage relation of wild-type Cx32, such that the mutated channels close at smaller transjunctional voltages. The observed shift in voltage dependence is consistent with a reduction in the open probability of the mutant hemichannels at a transjunctional voltage (Vj) of 0 mV. In both cases in which kinetics were examined, the time constants for reaching steady state were faster for T86N and T86A than for wild type at comparable voltages, suggesting that the T86 mutations cause the energetic destabilization of the open state relative to the other states of the channel protein. The structural underpinnings of the observed effects were explored with Monte Carlo simulations. The conformational space of TM2 helices was found to differ for the T86A, V, N, and L mutants, which produce a less bent helix ( approximately 20 degrees bend angle) compared to the wild type, which has a approximately 37 degrees bend angle. The greater bend angle of the wild-type helix reflects the propensity of the T86 residue to hydrogen bond with the backbone carbonyl of amino acid residue I82. The relative differences in propensity for hydrogen bonding of the mutants relative to the wild-type threonine residue in the constructs we studied (T86A, V, N, L, S, and C) correlate with the shift in the conductance-voltage relation observed for T86 mutations. The data are consistent with a structural model in which the open conformation of the Cx32 channel corresponds to a more bent TM2 helix, and the closed conformation corresponds to a less bent helix. We propose that the modulation of the hydrogen-bonding potential of the T86 residue alters the bend angle of the PK motif and mediates conformational changes between open and closed channel states. PMID:10354417
Physical Theory of Voltage Fade in Lithium- and Manganese-Rich Transition Metal Oxides
Rinaldo, Steven G.; Gallagher, Kevin G.; Long, Brandon R.; ...
2015-03-04
Lithium- and manganese-rich (LMR) transition metal oxide cathodes are of interest for lithium-ion battery applications due to their increased energy density and decreased cost. However, the advantages in energy density and cost are offset, in part, due to the phenomena of voltage fade. Specifically, the voltage profiles (voltage as a function of capacity) of LMR cathodes transform from a high energy configuration to a lower energy configuration as they are repeatedly charged (Li removed) and discharged (Li inserted). Here, we propose a physical model of voltage fade that accounts for the emergence of a low voltage Li phase due tomore » the introduction of transition metal ion defects within a parent Li phase. The phenomenological model was re-cast in a general form and experimental LMR charge profiles were de-convoluted to extract the evolutionary behavior of various components of LMR capacitance profiles. Evolution of the voltage fade component was found to follow a universal growth curve with a maximal voltage fade capacity of ≈ 20% of the initial total capacity.« less
Electro-optical voltage sensor head
Woods, Gregory K.
1998-01-01
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.
Electro-optical voltage sensor head
Woods, G.K.
1998-03-24
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 6 figs.
Nonlinear focal shift beyond the geometrical focus in moderately focused acoustic beams.
Camarena, Francisco; Adrián-Martínez, Silvia; Jiménez, Noé; Sánchez-Morcillo, Víctor
2013-08-01
The phenomenon of the displacement of the position along the axis of the pressure, intensity, and radiation force maxima of focused acoustic beams under increasing driving voltages (nonlinear focal shift) is studied for the case of a moderately focused beam. The theoretical and experimental results show the existence of this shift along the axis when the initial pressure in the transducer increases until the acoustic field reaches the fully developed nonlinear regime of propagation. Experimental data show that at high amplitudes and for moderate focusing, the position of the on-axis pressure maximum and radiation force maximum can surpass the geometrical focal length. On the contrary, the on-axis pressure minimum approaches the transducer under increasing driving voltages, increasing the distance between the positive and negative peak pressure in the beam. These results are in agreement with numerical KZK model predictions and the existed data of other authors and can be explained according to the effect of self-refraction characteristic of the nonlinear regime of propagation.
NASA Astrophysics Data System (ADS)
Makov, Y. N.; Espinosa, V.; Sánchez-Morcillo, V. J.; Ramis, J.; Cruañes, J.; Camarena, F.
2006-05-01
On the basis of theoretical concepts, an accurate and complete experimental and numerical examination of the on-axis distribution and the corresponding temporal profiles for low-Fresnel-number focused ultrasound beams under increasing transducer input voltage has been performed. For a real focusing transducer with sufficiently small Fresnel number, a strong initial (linear) shift of the main on-axis pressure maximum from geometrical focal point towards the transducer, and its following displacement towards the focal point and backward motion as the driving transducer voltage increase until highly nonlinear regimes were fixed. The simultaneous monitoring of the temporal waveform modifications determines the real roles and interplay between different nonlinear effects (refraction and attenuation) in the observed dynamics of on-axis pressure maximum. The experimental results are in good agreement with numerical solutions of KZK equation, confirming that the observed dynamic shift of the maximum pressure point is related only to the interplay between diffraction, dissipation and nonlinearity of the acoustic wave.
NASA Technical Reports Server (NTRS)
1988-01-01
M.H. Marks Enterprises' Power Factor Controller (PFC) matches voltage with motor's actual need. Plugged into a motor, PFC continuously determines motor load by sensing shifts between voltage and current flow. When it senses a light load, it cuts voltage to the minimum needed. It offers potential energy savings ranging from eight percent up to 65 percent depending on the application. Myles Marks started out with the notion of writing an article for Popular Electronics magazine at the same time offering to furnish kits to readers interested in assembling PFC's. Within two weeks from publication he had orders for 500 kits and orders are still coming three years later.
Zhao, Wenjing; Li, Hua; Furuta, Mamoru
2018-01-01
In this study, the initial electrical properties, positive gate bias stress (PBS), and drain current stress (DCS)-induced instabilities of amorphous indium gallium zinc oxide (a-IGZO) thin-film transistors (TFTs) with various active layer thicknesses (TIGZO) are investigated. As the TIGZO increased, the turn-on voltage (Von) decreased, while the subthreshold swing slightly increased. Furthermore, the mobility of over 13 cm2·V−1·s−1 and the negligible hysteresis of ~0.5 V are obtained in all of the a-IGZO TFTs, regardless of the TIGZO. The PBS results exhibit that the Von shift is aggravated as the TIGZO decreases. In addition, the DCS-induced instability in the a-IGZO TFTs with various TIGZO values is revealed using current–voltage and capacitance–voltage (C–V) measurements. An anomalous hump phenomenon is only observed in the off state of the gate-to-source (Cgs) curve for all of the a-IGZO TFTs. This is due to the impact ionization that occurs near the drain side of the channel and the generated holes that flow towards the source side along the back-channel interface under the lateral electric field, which cause a lowered potential barrier near the source side. As the TIGZO value increased, the hump in the off state of the Cgs curve was gradually weakened. PMID:29621154
Towards highly stable polymer electronics (Conference Presentation)
NASA Astrophysics Data System (ADS)
Nikolka, Mark; Nasrallah, Iyad; Broch, Katharina; Sadhanala, Aditya; Hurhangee, Michael; McCulloch, Iain; Sirringhaus, Henning
2016-11-01
Due to their ease of processing, organic semiconductors are promising candidates for applications in high performance flexible displays and fast organic electronic circuitry. Recently, a lot of advances have been made on organic semiconductors exhibiting surprisingly high performance and carrier mobilities exceeding those of amorphous silicon. However, there remain significant concerns about their operational and environmental stability, particularly in the context of applications that require a very high level of threshold voltage stability, such as active-matrix addressing of organic light-emitting diode (OLED) displays. Here, we report a novel technique for dramatically improving the operational stress stability, performance and uniformity of high mobility polymer field-effect transistors by the addition of specific small molecule additives to the polymer semiconductor film. We demonstrate for the first time polymer FETs that exhibit stable threshold voltages with threshold voltage shifts of less than 1V when subjected to a constant current operational stress for 1 day under conditions that are representative for applications in OLED active matrix displays. The approach constitutes in our view a technological breakthrough; it also makes the device characteristics independent of the atmosphere in which it is operated, causes a significant reduction in contact resistance and significantly improves device uniformity. We will discuss in detail the microscopic mechanism by which the molecular additives lead to this significant improvement in device performance and stability.
A model of VDAC structural rearrangement in the presence of a salt activity gradient
NASA Astrophysics Data System (ADS)
Levadny, Victor; Colombini, Marco; Aguilella, Vicente M.
2001-11-01
We have considered the structural transformations of a voltage dependent anion-selective channel (VDAC) known as `gating'. We analysed the redistribution of VDAC among its states. The difference in electrostatic energy between the trans-closed and cis-closed states of VDAC is shown to be the cause of changes in the voltage dependence of the gating in the presence of a salt activity gradient. The asymmetry in the voltage dependence of the open probability about zero millivolts was connected with the apparent location of the voltage sensor. The theory describes the experimental data satisfactorily and explains the nature of the shift of the probability curve as well as the differences found in the asymmetry of the curve for different salts.
Electroluminescence in CdSe/PVA nanocomposites
NASA Astrophysics Data System (ADS)
Kumari, Sarita; Ramrakhiani, M.; Khare, P. K.
2018-05-01
The synthesis of II-VI nanocrystal into the polymer matrix to form nanocomposites with adjustable nanocrystal is of great interest size is a big challenge to the scientific community. In present work semiconducting CdSe/PVA thin film were synthesized by single step solution method with different concentration of CdSe. The as-prepared products were characterized by UV-Visible absorption spectra and FESEM. Absorption spectra of CdSe/PVA nanocomposites indicated that the position of absorption edge shifts to smaller wavelength by increasing the concentration of CdSe. For Electroluminescence a turn on voltage is required for light emission and brightness increases with voltage. Turn on voltage is found to decrease as CdSe concentration is increased. The voltage-current curve represents ohmic nature for all EL cells.
Electron refrigeration in hybrid structures with spin-split superconductors
NASA Astrophysics Data System (ADS)
Rouco, M.; Heikkilä, T. T.; Bergeret, F. S.
2018-01-01
Electron tunneling between superconductors and normal metals has been used for an efficient refrigeration of electrons in the latter. Such cooling is a nonlinear effect and usually requires a large voltage. Here we study the electron cooling in heterostructures based on superconductors with a spin-splitting field coupled to normal metals via spin-filtering barriers. The cooling power shows a linear term in the applied voltage. This improves the coefficient of performance of electron refrigeration in the normal metal by shifting its optimum cooling to lower voltage, and also allows for cooling the spin-split superconductor by reverting the sign of the voltage. We also show how tunnel coupling spin-split superconductors with regular ones allows for a highly efficient refrigeration of the latter.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Z.; Cardwell, D.; Sasikumar, A.
2016-04-28
The impact of proton irradiation on the threshold voltage (V{sub T}) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of V{sub T} was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 10{sup 14} cm{sup −2}. Silvaco Atlas simulations of V{sub T} shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different V{sub T} dependences on protonmore » irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed V{sub T} shifts. The proton irradiation induced V{sub T} shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.« less
NASA Astrophysics Data System (ADS)
Djezzar, Boualem; Tahi, Hakim; Benabdelmoumene, Abdelmadjid; Chenouf, Amel; Kribes, Youcef
2012-11-01
In this paper, we present a new method, named on the fly oxide trap (OTFOT), to extract the bias temperature instability (BTI) in MOS transistors. The OTFOT method is based on charge pumping technique (CP) at low and high frequencies. We emphasize on the theoretical-based concept, giving a clear insight on the easy-use of the OTFOT methodology and demonstrating its viability to characterize the negative BTI (NBTI). Using alternatively high and low frequencies, OTFOT method separates the interface-traps (ΔNit) and border-trap (ΔNbt) (switching oxide-trap) densities independently and also their contributions to the threshold voltage shift (ΔVth), without needing additional methods. The experimental results, from two experimental scenarios, showing the extraction of NBTI-induced shifts caused by interface- and oxide-trap increases are also presented. In the first scenario, all stresses are performed on the same transistor. It exhibits an artifact value of exponent n. In the second scenario, each voltage stress is applied only on one transistor. Its results show an average n of 0.16, 0.05, and 0.11 for NBTI-induced ΔNit, ΔNbt, ΔVth, respectively. Therefore, OTFOT method can contribute to further understand the behavior of the NBTI degradation, especially through the threshold voltage shift components such as ΔVit and ΔVot caused by interface-trap and border-trap, respectively.
Davidson, James R.; Lassahn, Gordon D.
2001-01-01
A small sized electro-optic voltage sensor capable of accurate measurement of high levels of voltages without contact with a conductor or voltage source is provided. When placed in the presence of an electric field, the sensor receives an input beam of electromagnetic radiation into the sensor. A polarization beam displacer serves as a filter to separate the input beam into two beams with orthogonal linear polarizations. The beam displacer is oriented in such a way as to rotate the linearly polarized beams such that they enter a Pockels crystal at a preferred angle of 45 degrees. The beam displacer is therefore capable of causing a linearly polarized beam to impinge a crystal at a desired angle independent of temperature. The Pockels electro-optic effect induces a differential phase shift on the major and minor axes of the input beam as it travels through the Pockels crystal, which causes the input beam to be elliptically polarized. A reflecting prism redirects the beam back through the crystal and the beam displacer. On the return path, the polarization beam displacer separates the elliptically polarized beam into two output beams of orthogonal linear polarization representing the major and minor axes. In crystals that introduce a phase differential attributable to temperature, a compensating crystal is provided to cancel the effect of temperature on the phase differential of the input beam. The system may include a detector for converting the output beams into electrical signals, and a signal processor for determining the voltage based on an analysis of the output beams. The output beams are amplitude modulated by the frequency of the electric field and the amplitude of the output beams is proportional to the magnitude of the electric field, which is related to the voltage being measured.
NASA Technical Reports Server (NTRS)
Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav
2014-01-01
The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.
Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert
2011-04-01
The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges.
Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert
2011-01-01
Abstract The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges. PMID:21300746
Coherent control of the Goos-Hänchen shift via Fano interference
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Shaopeng; Yang, Wen-Xing, E-mail: wenxingyang@seu.edu.cn; Zhu, Zhonghu
2016-04-14
A scheme of enhanced Goos-Hänchen (GH) shifts in reflected and transmitted light beams is exploited in a cavity, where an asymmetric double AlGaAs/GaAs quantum well structure with resonant tunneling to a common continuum is employed as the intracavity medium. With the help of Fano-type interference induced by resonant tunneling, the generated GH shifts that contain a negative lateral shift in reflected light beam and a positive lateral shift in transmitted light beam are found to be significantly enhanced. More interestingly, these GH shifts in reflected and transmitted light beams are modulated by means of a control beam and external biasmore » voltage, in which maximum negative shift of 1.86 mm and positive shift of 0.37 mm are achievable.« less
Total Ionizing Dose Effects in MOS Oxides and Devices
NASA Technical Reports Server (NTRS)
Oldham, Timothy R.; McLean, F. B.
2003-01-01
The development of military and space electronics technology has traditionally been heavily influenced by the commercial semiconductor industry. The development of MOS technology, and particularly CMOS technology, as dominant commercial technologies has occurred entirely within the lifetime of the NSREC. For this reason, it is not surprising that the study of radiation interactions with MOS materials, devices and circuits has been a major theme of this conference for most of its history. The basic radiation problem in a MOS transistor is illustrated. The application of an appropriate gate voltage causes a conducting channel to form between the source and drain, so that current flows when the device is turned on. In Fig. lb, the effect of ionizing radiation is illustrated. Radiation-induced trapped charge has built up in the gate oxide, which causes a shift in the threshold voltage (that is, a change in the voltage which must be applied to turn the device on). If this shift is large enough, the device cannot be turned off, even at zero volts applied, and the device is said to have failed by going depletion mode.
NASA Astrophysics Data System (ADS)
Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo
2018-04-01
The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.
Study of SiO2-Si and metal-oxide-semiconductor structures using positrons
NASA Astrophysics Data System (ADS)
Leung, T. C.; Asoka-Kumar, P.; Nielsen, B.; Lynn, K. G.
1993-01-01
Studies of SiO2-Si and metal-oxide-semiconductor (MOS) structures using positrons are summarized and a concise picture of the present understanding of positrons in these systems is provided. Positron annihilation line-shape S data are presented as a function of the positron incident energy, gate voltage, and annealing, and are described with a diffusion-annihilation equation for positrons. The data are compared with electrical measurements. Distinct annihilation characteristics were observed at the SiO2-Si interface and have been studied as a function of bias voltage and annealing conditions. The shift of the centroid (peak) of γ-ray energy distributions in the depletion region of the MOS structures was studied as a function of positron energy and gate voltage, and the shifts are explained by the corresponding variations in the strength of the electric field and thickness of the depletion layer. The potential role of the positron annihilation technique as a noncontact, nondestructive, and depth-sensitive characterization tool for the technologically important, deeply buried interface is shown.
NASA Astrophysics Data System (ADS)
Verbeeck, J.; Leroux, P.; Steyaert, M.
2011-01-01
A differential voltage amplifier with a gain-bandwidth product of 2.5Ghz and using adaptive biasing has been designed in a standard CMOS technology and assessed under radiation and temperature variations. The principle used in this ASIC will be employed in the design of a Gbps TIA with improved tolerance for γ-irradiation and temperature for an optical instrumentation (LIDAR) receiver aiming at operation in harsh environments. The voltage amplifier was tested under gamma radiation and features a gain degradation of merely 4.5% up to a total dose of 100kGy. In order to verify the radiation effects on the IC, the threshold voltage shift of the separate transistors has been investigated. Temperature characterization has shown that the amplifier features a reduction of the voltage gain by only 5.6% for a temperature range of -40 till 130 °C.
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna
2013-03-01
The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.
NASA Astrophysics Data System (ADS)
Chen, Te-Chih; Kuo, Yue; Chang, Ting-Chang; Chen, Min-Chen; Chen, Hua-Mao
2017-10-01
Device characteristics changes in an a-IGZO thin film transistor under light illumination and at raised temperature have been investigated. Light exposure causes a large leakage current, which is more obvious with an increase in the illumination energy, power and the temperature. The increase in the leakage current is due to the trap assisted photon excitation process that generates electron-hole pairs and the mechanism is enhanced with the additional thermal energy. The leakage current comes from the source side because holes generated in the process drift to the source side and therefore lower the barrier height. The above mechanism has been further verified with experiments of drain bias induced shifts in the threshold voltage and the subthreshold slope.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wahle, Markus, E-mail: markus.wahle@uni-paderborn.de; Kitzerow, Heinz-Siegfried
2015-11-16
We present a liquid crystal (LC) infiltrated photonic crystal fiber, which enables the electrical tuning of the position of zero dispersion wavelengths (ZDWs). A dual frequency addressable liquid crystal is aligned perpendicular on the inclusion walls of a photonic crystal fiber, which results in an escaped radial director field. The orientation of the LC is controlled by applying an external electric field. Due to the high index of the liquid crystal the fiber guides light by the photonic band gap effect. Multiple ZDWs exist in the visible and near infrared. The positions of the ZDWs can be either blue ormore » red shifted depending on the frequency of the applied voltage.« less
Oxygen effects on the performance of XeCl excimer lasers
NASA Astrophysics Data System (ADS)
Jeon, S. H.; Soh, B. S.; Kim, Y. P.
2018-03-01
We have investigated the degradation of window transmittance of XeCl excimer laser with oxygen, from which it was analyzed the laser performances such as stability of output energy, pre-ionization voltage, and spatial shift of laser beam. We found that oxygen suppressed the generation of by-products due to the chemical reactions between electrode material and chlorine. The degradation of transmittance ratio of laser window with oxygen improved from 10.4% to 1.4% after 20 million shots compared to without oxygen. Analyzing XPS spectrum for the contaminated window, we have confirmed that W and Cu on window surface were reduced in case of with oxygen, which means oxygen has a role to suppress the contamination on window surface.
Holographic Structuring of Elastomer Actuator: First True Monolithic Tunable Elastomer Optics.
Ryabchun, Alexander; Kollosche, Matthias; Wegener, Michael; Sakhno, Oksana
2016-12-01
Volume diffraction gratings (VDGs) are inscribed selectively by diffusive introduction of benzophenone and subsequent UV-holographic structuring into an electroactive dielectric elastomer actuator (DEA), to afford a continuous voltage-controlled grating shift of 17%. The internal stress coupling of DEA and optical domain allows for a new generation of true monolithic tunable elastomer optics with voltage controlled properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Greene, Derek L; Kang, Seungwoo; Hoshi, Naoto
2017-07-01
M-channel inhibitors, especially XE991, are being used increasingly in animal experiments; however, insufficient characterization of XE991 at times confounds the interpretation of results when using this compound. Here, we demonstrate that XE991 and linopirdine are state-dependent inhibitors that favor the activated-subunit of neuronal Kv7/KCNQ channels. We performed patch-clamp experiments on homomeric Kv7.2 or heteromeric Kv7.2/3 channels expressed in Chinese hamster ovary cells to characterize XE991 and linopirdine. Neither inhibitor was efficacious around the resting membrane potential of cells in physiologic conditions. Inhibition of Kv7.2 and Kv7.2/3 channels by XE991 was closely related with channel activation. When the voltage dependence of activation was left-shifted by retigabine or right-shifted by the mutation, Kv7.2(R214D), the shift in half-activation voltage proportionally coincided with the shift in the half-effective potential for XE991 inhibition. Inhibition kinetics during XE991 wash-in was facilitated at depolarized potentials. Ten-minute washout of XE991 resulted in ∼30% current recovery, most of which was attributed to surface transport of Kv7.2 channels. Linopirdine also exhibited similar inhibition characteristics, with the exception of near- complete current recovery after washout at depolarized potentials. Inhibition kinetics of both XE991 and linopirdine was not as sensitive to changes in voltage as would be predicted by open- channel inhibition. Instead, they were well explained by binding to a single activated subunit. The characteristics of XE991 and linopirdine should be taken into account when these M-channel inhibitors are used in experiments. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Voltage-dependent formation of gramicidin channels in lipid bilayers.
Sandblom, J; Galvanovskis, J; Jilderos, B
2001-01-01
The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628
Kim, Beomjin; Park, Youngil; Shin, Yunseop; Lee, Jiwon; Shin, Hwangyu; Park, Jongwook
2014-07-01
New red dopant, DPPZ based on porphyrin moiety was synthesized. DPPZ showed UV-Vis and PL maximum values of 412 and 638 nm, indicating the large stokes shift. New blue host compound, TATa was also synthesized and used for co-mixed white emission. TATa exhibited UV-Vis. and PL maximum values of 403 nm and 463 nm in film state. Thus, when two compounds are used as co-mixed emitter in OLED device, there is no energy transfer from blue emission of TATa to DPPZ due to large stokes shift of DPPZ. Based on the PL result, it is available to realize two-colored white in PL and EL spectra. As a result of this, two-mixed compounds showed vivid their own PL emission peaks of 466 and 638 nm in film state. Also, white OLED device using two-mixed compounds system was fabricated. EL spectrum shows 481 and 646 nm peaks and two separate EL peaks. As the operation voltage is increased from 8 to 11 V, EL spectrum does not change the peak shape and maximum wavelength values. EL performance of white device showed 0.041 cd/A, 0.018 Im/W, and CIE (0.457, 0.331) at 8 V.
Saeki, Hiroyuki; Hirohara, Kazuto; Koshiba, Yasuko; Horie, Satoshi; Misaki, Masahiro; Takeshita, Kimiya; Ishida, Kenji; Ueda, Yasukiyo
2010-01-01
The current-voltage characteristics of benzoporphine-fullerene solar cells were measured subsequent to the deposition of Al as a cathode material. Even in vacuum, a shift in the open circuit voltage was observed at 20 min after Al deposition. Moreover, the displacement of inert gases (N2or Ar) in the evaporation chamber enhanced the photovoltaic parameters. The power conversion efficiency was increased by 24% over the initial characteristics (from 1.04% to 1.29%), which indicates that the structure of the organic-metal interface changed rapidly after Al deposition, even if the process was performed in an air-free glovebox. PMID:21151322
Organic memory device with self-assembly monolayered aptamer conjugated nanoparticles
NASA Astrophysics Data System (ADS)
Oh, Sewook; Kim, Minkeun; Kim, Yejin; Jung, Hunsang; Yoon, Tae-Sik; Choi, Young-Jin; Jung Kang, Chi; Moon, Myeong-Ju; Jeong, Yong-Yeon; Park, In-Kyu; Ho Lee, Hyun
2013-08-01
An organic memory structure using monolayered aptamer conjugated gold nanoparticles (Au NPs) as charge storage nodes was demonstrated. Metal-pentacene-insulator-semiconductor device was adopted for the non-volatile memory effect through self assembly monolayer of A10-aptamer conjugated Au NPs, which was formed on functionalized insulator surface with prostate-specific membrane antigen protein. The capacitance versus voltage (C-V) curves obtained for the monolayered Au NPs capacitor exhibited substantial flat-band voltage shift (ΔVFB) or memory window of 3.76 V under (+/-)7 V voltage sweep. The memory device format can be potentially expanded to a highly specific capacitive sensor for the aptamer-specific biomolecule detection.
Temperature dependence of frequency response characteristics in organic field-effect transistors
NASA Astrophysics Data System (ADS)
Lu, Xubing; Minari, Takeo; Liu, Chuan; Kumatani, Akichika; Liu, J.-M.; Tsukagoshi, Kazuhito
2012-04-01
The frequency response characteristics of semiconductor devices play an essential role in the high-speed operation of electronic devices. We investigated the temperature dependence of dynamic characteristics in pentacene-based organic field-effect transistors and metal-insulator-semiconductor capacitors. As the temperature decreased, the capacitance-voltage characteristics showed large frequency dispersion and a negative shift in the flat-band voltage at high frequencies. The cutoff frequency shows Arrhenius-type temperature dependence with different activation energy values for various gate voltages. These phenomena demonstrate the effects of charge trapping on the frequency response characteristics, since decreased mobility prevents a fast charge response for alternating current signals at low temperatures.
A pH sensor with a double-gate silicon nanowire field-effect transistor
NASA Astrophysics Data System (ADS)
Ahn, Jae-Hyuk; Kim, Jee-Yeon; Seol, Myeong-Lok; Baek, David J.; Guo, Zheng; Kim, Chang-Hoon; Choi, Sung-Jin; Choi, Yang-Kyu
2013-02-01
A pH sensor composed of a double-gate silicon nanowire field-effect transistor (DG Si-NW FET) is demonstrated. The proposed DG Si-NW FET allows the independent addressing of the gate voltage and hence improves the sensing capability through an application of asymmetric gate voltage between the two gates. One gate is a driving gate which controls the current flow, and the other is a supporting gate which amplifies the shift of the threshold voltage, which is a sensing metric, and which arises from changes in the pH. The pH signal is also amplified through modulation of the gate oxide thickness.
Hot-Electron-Induced Device Degradation during Gate-Induced Drain Leakage Stress
NASA Astrophysics Data System (ADS)
Kim, Kwang-Soo; Han, Chang-Hoon; Lee, Jun-Ki; Kim, Dong-Soo; Kim, Hyong-Joon; Shin, Joong-Shik; Lee, Hea-Beoum; Choi, Byoung-Deog
2012-11-01
We studied the interface state generation and electron trapping by hot electrons under gate-induced drain leakage (GIDL) stress in p-type metal oxide semiconductor field-effect transistors (P-MOSFETs), which are used as the high-voltage core circuit of flash memory devices. When negative voltage was applied to a drain in the off-state, a GIDL current was generated, but when high voltage was applied to the drain, electrons had a high energy. The hot electrons produced the interface state and electron trapping. As a result, the threshold voltage shifted and the off-state leakage current (trap-assisted drain junction leakage current) increased. On the other hand, electron trapping mitigated the energy band bending near the drain and thus suppressed the GIDL current generation.
Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana
Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing
2015-01-01
Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363
NASA Technical Reports Server (NTRS)
Reid, M. A.; Gahn, R. F.
1977-01-01
Performance of the iron-titanium redox flow cell was studied as a function of acid concentration. Anion permeable membranes separated the compartments. Electrodes were graphite cloth. Current densities ranged up to 25 mA/square centimeter. Open-circuit and load voltages decreased as the acidity was increased on the iron side as predicted. On the titanium side, open-circuit voltages decreased as the acidity was increased in agreement with theory, but load voltages increased due to decreased polarization with increasing acidity. High acidity on the titanium side coupled with low acidity on the iron side gives the best load voltage, but such cells show voltage losses as they are repeatedly cycled. Analyses show that the bulk of the voltage losses are due to diffusion of acid through the membrane.
The Study of Phase-shift Super-Frequency Induction Heating Power Supply
NASA Astrophysics Data System (ADS)
Qi, Hairun; Peng, Yonglong; Li, Yabin
This paper combines pulse-width phase-shift power modulation with fixed-angle phase-locked-control to adjust the inverter's output power, this method not only meets the work conditions of voltage inverter, but also realizes the large-scale of power modulation, and the main circuit is simple, the switching devices realize soft switching. This paper analyzes the relationship between the output power and phase-shift angle, the control strategy is simulated by Matlab/Simulink, and the results show that the method is feasible and meets the theoretical analysis
Vicente, M Inês; Costa, Pedro F; Lima, Pedro A
2010-05-25
Galantamine, one of the major drugs used in Alzheimer's disease therapy, is a relatively weak acetylcholinesterase inhibitor and an allosteric potentiating ligand of nicotinic acetylcholine receptors. However, a role in the control of excitability has also been attributed to galantamine via modulation of K+ currents in central neurones. To further investigate the effect of galantamine on voltage-activated K+ currents, we performed whole-cell voltage-clamp recordings in differentiated neuroblastoma N1E-115 cells and in dissociated rat CA1 neurones. In both cell models, one can identify two main voltage-activated K+ current components: a relatively fast inactivating component (Ifast; time constant approximately hundred milliseconds) and a slowly inactivating one (Islow; time constant approximately 1 s). We show that galantamine (1 pM-300 microM) inhibits selectively Islow, exhibiting a dual dose-response relationship, in both differentiated N1E-115 cells and CA1 neurones. We also demonstrate that, in contrast with what was previously reported, galantamine-induced inhibition is not due to a shift on the steady-state inactivation and activation curves. Additionally, we characterized a methodological artefact that affects voltage-dependence as a function of time in whole-cell configuration, observed in both cell models. By resolving an inhibitory role on K+ currents in a non-central neuronal system and in hippocampal neurones, we are attributing a widespread role of galantamine on the modulation of cell excitability. The present results are relevant in the clinical context, since the effects at low dosages suggest that galantamine-induced K+ current inhibition may contribute to the efficiency of galantamine in the treatment of Alzheimer's disease. Copyright 2010 Elsevier B.V. All rights reserved.
Modeling the instability behavior of thin film devices: Fermi Level Pinning
NASA Astrophysics Data System (ADS)
Moeini, Iman; Ahmadpour, Mohammad; Gorji, Nima E.
2018-05-01
We investigate the underlying physics of degradation/recovery of a metal/n-CdTe Schottcky junction under reverse or forward bias stressing conditions. We used Sah-Noyce-Shockley (SNS) theory to investigate if the swept of Fermi level pinning at different levels (under forward/reverse bias) is the origin of change in current-voltage characteristics of the device. This theory is based on Shockley-Read-Hall recombination within the depletion width and takes into account the interface defect levels. Fermi Level Pinning theory was primarily introduced by Ponpon and developed to thin film solar cells by Dharmadasa's group in Sheffield University-UK. The theory suggests that Fermi level pinning at multiple levels occurs due to high concentration of electron-traps or acceptor-like defects at the interface of a Schottky or pn junction and this re-arranges the recombination rate and charage collection. Shift of these levels under stress conditions determines the change in current-voltage characteristics of the cell. This theory was suggested for several device such as metal/n-CdTe, CdS/CdTe, CIGS/CdS or even GaAs solar cells without a modeling approach to clearly explain it's physics. We have applied the strong SNS modeling approach to shed light on Fermi Level Pinning theory. The modeling confirms that change in position of Fermi Level and it's pining in a lower level close to Valence band increases the recombination and reduces the open-circuit voltage. In contrast, Fermi Level pinning close to conduction band strengthens the electric field at the junction which amplifies the carrier collection and boosts the open-circuit voltage. This theory can well explain the stress effect on device characteristics of various solar cells or Schottky junctions by simply finding the right Fermi level pinning position at every specific stress condition.
Obrosov, Aleksei; Gulyaev, Roman; Zak, Andrzej; Ratzke, Markus; Naveed, Muhammad; Dudzinski, Wlodzimierz; Weiß, Sabine
2017-01-01
MAX phases (M = transition metal, A = A-group element, and X = C/N) are of special interest because they possess a unique combination of the advantages of both metals and ceramics. Most attention is attracted to the ternary carbide Cr2AlC because of its excellent high-temperature oxidation, as well as hot corrosion resistance. Despite lots of publications, up to now the influence of bias voltage on the chemical bonding structure, surface morphology, and mechanical properties of the film is still not well understood. In the current study, Cr-Al-C films were deposited on silicon wafers (100) and Inconel 718 super alloy by dc magnetron sputtering with different substrate bias voltages and investigated using Scanning Electron Microscopy (SEM), X-ray Photoelectron Spectroscopy (XPS), X-ray Diffraction (XRD), Atomic Force Microscopy (AFM), and nanoindentation. Transmission Electron Microscopy (TEM) was used to analyze the correlation between the growth of the films and the coating microstructure. The XPS results confirm the presence of Cr2AlC MAX phase due to a negative shift of 0.6–0.9 eV of the Al2p to pure aluminum carbide peak. The XRD results reveal the presence of Cr2AlC MAX Phase and carbide phases, as well as intermetallic AlCr2. The film thickness decreases from 8.95 to 6.98 µm with increasing bias voltage. The coatings deposited at 90 V exhibit the lowest roughness (33 nm) and granular size (76 nm) combined with the highest hardness (15.9 GPa). The ratio of Al carbide to carbide-like carbon state changes from 0.12 to 0.22 and correlates with the mechanical properties of the coatings. TEM confirms the columnar structure, with a nanocrystalline substructure, of the films. PMID:28772516
Nitrogen recovery from pig slurry in a two-chambered bioelectrochemical system.
Sotres, A; Cerrillo, M; Viñas, M; Bonmatí, A
2015-10-01
Abiotic batch experiments showed that ammonia migration from anode to cathode was favored by an increase in voltage, from 39.9% to 44.6%, using synthetic media. A slight increase in ammonia migration was observed when using pig slurry, reaching a maximum of 49.9%. In a continuously MFC fed with pig slurry with a stripping/absorption unit coupled to the cathode chamber, the highest nitrogen flux (7.2 g N d(-1) m(-2)) was achieved using buffer as catholyte. Nitrogen flux increased to 10.3 g N d(-1) m(-2) when shifting to MEC mode. A clear improvement in nitrogen flux (25.5 g N d(-1) m(-2)) was observed when using NaCl as catholyte. Besides, ammonia stripping was favored, reaching a nitrogen recovery of 94.3% in the absorption column, due to the high pH reached in the cathode. The microbial community analysis revealed an enrichment of certain taxonomic Eubacterial and Archaeal groups when the system shifted from MFC to MEC mode. Copyright © 2015 Elsevier Ltd. All rights reserved.
White organic light-emitting diodes based on doped and ultrathin Rubrene layer
NASA Astrophysics Data System (ADS)
Li, Yi; Jiang, Yadong; Wen, Wen; Yu, Junsheng
2010-10-01
Based on a yellow fluorescent dye of 5, 6, 11, 12-tetraphenylnaphthacene (Rubrene), WOLEDs were fabricated, with doping structure and ultrathin layer structure utilized in the devices. By doping Rubrene into blue-emitting N,N'-bis-(1- naphthyl)-N,N'-biphenyl-1,1'-biphenyl-4,4'-diamine (NPB), the device with a structure of indium-tin-oxide (ITO)/NPB (40 nm)/NPB:Rubrene (0.25 wt%, 7 nm)/2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline (BCP) (30 nm)/Mg:Ag exhibited a warm white light with Commissions Internationale De L'Eclairage (CIE) coordinates of (0.38, 0.41) at 12 V. The electroluminescent spectrum of the OLED consisted of blue and yellow fluorescent emissions, the intensity of blue emission increased gradually relative to the orange emission with increasing voltage. This is mainly due to the recombination zone shifted towards the anode side as the transmission rate of electrons grows faster than that of holes under higher bias voltage. A maximum luminance of 7300 cd/m2 and a maximum power efficiency of 0.57 lm/W were achieved. Comparatively, by utilizing ultrathin dopant layer, the device with a structure of ITO/NPB (40 nm)/Rubrene (0.3 nm)/NPB (7 nm)/BCP (30 nm)/Mg:Ag achieved a low turn-on voltage of 3 V and a more stable white light. The peaks of EL spectra located at 430 and 560 nm corresponding to the CIE coordinates of (0.32, 0.32) under bias voltage ranging from 5 to 15 V. A maximum luminance of 5630 cd/m2 and a maximum power efficiency of 0.6 lm/W were achieved. The balanced spectra were attributed to the stable confining of charge carriers and exciton by the thin emitting layers. Hence, with simple device structure and fabricating process, the device with ultrathin layer achieved low turn-on voltage, stable white light emitting and higher power efficiency.
NASA Astrophysics Data System (ADS)
Ko, Seung-Pil; Shin, Jong Mok; Jang, Ho Kyun; You, Min Youl; Jin, Jun-Eon; Choi, Miri; Cho, Jiung; Kim, Gyu-Tae
2018-02-01
Doping effects in devices based on two-dimensional (2D) materials have been widely studied. However, detailed analysis and the mechanism of the doping effect caused by encapsulation layers has not been sufficiently explored. In this work, we present experimental studies on the n-doping effect in WSe2 field effect transistors (FETs) with a high-k encapsulation layer (Al2O3) grown by atomic layer deposition. In addition, we demonstrate the mechanism and origin of the doping effect. After encapsulation of the Al2O3 layer, the threshold voltage of the WSe2 FET negatively shifted with the increase of the on-current. The capacitance-voltage measurements of the metal insulator semiconductor (MIS) structure proved the presence of the positive fixed charges within the Al2O3 layer. The flat-band voltage of the MIS structure of Au/Al2O3/SiO2/Si was shifted toward the negative direction on account of the positive fixed charges in the Al2O3 layer. Our results clearly revealed that the fixed charges in the Al2O3 encapsulation layer modulated the Fermi energy level via the field effect. Moreover, these results possibly provide fundamental ideas and guidelines to design 2D materials FETs with high-performance and reliability.
Palette of fluorinated voltage-sensitive hemicyanine dyes
Yan, Ping; Acker, Corey D.; Zhou, Wen-Liang; Lee, Peter; Bollensdorff, Christian; Negrean, Adrian; Lotti, Jacopo; Sacconi, Leonardo; Antic, Srdjan D.; Kohl, Peter; Mansvelder, Huibert D.; Pavone, Francesco S.; Loew, Leslie M.
2012-01-01
Optical recording of membrane potential permits spatially resolved measurement of electrical activity in subcellular regions of single cells, which would be inaccessible to electrodes, and imaging of spatiotemporal patterns of action potential propagation in excitable tissues, such as the brain or heart. However, the available voltage-sensitive dyes (VSDs) are not always spectrally compatible with newly available optical technologies for sensing or manipulating the physiological state of a system. Here, we describe a series of 19 fluorinated VSDs based on the hemicyanine class of chromophores. Strategic placement of the fluorine atoms on the chromophores can result in either blue or red shifts in the absorbance and emission spectra. The range of one-photon excitation wavelengths afforded by these new VSDs spans 440–670 nm; the two-photon excitation range is 900–1,340 nm. The emission of each VSD is shifted by at least 100 nm to the red of its one-photon excitation spectrum. The set of VSDs, thus, affords an extended toolkit for optical recording to match a broad range of experimental requirements. We show the sensitivity to voltage and the photostability of the new VSDs in a series of experimental preparations ranging in scale from single dendritic spines to whole heart. Among the advances shown in these applications are simultaneous recording of voltage and calcium in single dendritic spines and optical electrophysiology recordings using two-photon excitation above 1,100 nm. PMID:23169660
NASA Astrophysics Data System (ADS)
Yu, Kyeong Min; Bae, Byung Seong; Jung, Myunghee; Yun, Eui-Jung
2016-06-01
We investigate the effects of high temperatures in the range of 292 - 393 K on the electrical properties of solution-processed amorphous zinc-tin-oxide (a-ZTO) thin-film transistors (TFTs) operated in the saturation region. The fabricated a-ZTO TFTs have a non-patterned bottom gate and top contact structure, and they use a heavily-doped Si wafer and SiO2 as a gate electrode and a gate insulator layer, respectively. In a-ZTO TFTs, the trap release energy ( E TR ) was deduced by using Maxwell-Boltzmann statistics. The decreasing E TR toward zero with increasing gate voltage (the density of trap states ( n s )) in the a-ZTO active layer can be attributed to a shift of the Fermi level toward the mobility edge with increasing gate voltage. The TFTs with low gate voltage (low n s ) exhibit multiple trap and release characteristics and show thermally-activated behavior. In TFTs with a high gate voltage (high n s ), however, we observe decreasing mobility and conductivity with increasing temperature at temperatures ranging from 303 to 363 K. This confirms that the E TR can drop to zero, indicating a shift of the Fermi level beyond the mobility edge. Hence, the mobility edge is detected at the cusp between thermally-activated transport and band transport.
Tian, Kun; He, Cong-Cong; Xu, Hui-Nan; Wang, Yu-Xiang; Wang, Hong-Gang; An, Di; Heng, Bin; Pang, Wei; Jiang, Yu-Gang; Liu, Yan-Qiang
2017-05-01
In the present study, cultured rat primary neurons were exposed to a medium containing N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), a specific cell membrane-permeant Zn 2+ chelator, to establish a model of free Zn 2+ deficiency in neurons. The effects of TPEN-mediated free Zn 2+ ion reduction on neuronal viability and on the performance of voltage-gated sodium channels (VGSCs) and potassium channels (Kvs) were assessed. Free Zn 2+ deficiency 1) markedly reduced the neuronal survival rate, 2) reduced the peak amplitude of I Na , 3) shifted the I Na activation curve towards depolarization, 4) modulated the sensitivity of sodium channel voltage-dependent inactivation to a depolarization voltage, and 5) increased the time course of recovery from sodium channel inactivation. In addition, free Zn 2+ deficiency by TPEN notably enhanced the peak amplitude of transient outward K + currents (I A ) and delayed rectifier K + currents (I K ), as well as caused hyperpolarization and depolarization directional shifts in their steady-state activation curves, respectively. Zn 2+ supplementation reversed the effects induced by TPEN. Our results indicate that free Zn 2+ deficiency causes neuronal damage and alters the dynamic characteristics of VGSC and Kv currents. Thus, neuronal injury caused by free Zn 2+ deficiency may correlate with its modulation of the electrophysiological properties of VGSCs and Kvs. Copyright © 2017 Elsevier GmbH. All rights reserved.
Cherny, Vladimir V.; DeCoursey, Thomas E.
1999-01-01
Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017
Voltage-sensing phosphatase modulation by a C2 domain.
Castle, Paul M; Zolman, Kevin D; Kohout, Susy C
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function.
Voltage-sensing phosphatase modulation by a C2 domain
Castle, Paul M.; Zolman, Kevin D.; Kohout, Susy C.
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function. PMID:25904865
Effect of Fluorine Diffusion on Amorphous-InGaZnO-Based Thin-Film Transistors.
Jiang, Jingxin; Furuta, Mamoru
2018-08-01
This study investigated the effect of fluorine (F) diffusion from a fluorinated siliconnitride passivation layer (SiNX:F-Pa) into amorphous-InGaZnO-based thin-film transistors (a-IGZO TFTs). The results of thermal desorption spectroscopy and secondary ion mass spectrometry revealed that F was introduced into the SiOX etch-stopper layer (SiOX-ES) during the deposition of a SiNX:F-Pa, and did not originate from desorption of Si-F bonds; and that long annealing times enhanced F diffusion from the SiOX-ES layer to the a-IGZO channel. Improvements to the performance and threshold-voltage (Vth) negative shift of IGZO TFTs were achieved when annealing time increased from 1 h to 3 h; and capacitance-voltage results indicated that F acted as a shallow donor near the source side in a-IGZO and induced the negative Vth shift. In addition, it was found that when IGZO TFTs with SiNX:F-Pa were annealed 4 h, a low-resistance region was formed at the backchannel of the TFT, leading to a drastic negative Vth shift.
NASA Astrophysics Data System (ADS)
Arjmand, T.; Tagani, M. Bagheri; Soleimani, H. Rahimpour
2018-01-01
Bilayer germanene nanoribbons are investigated in different stacks like buckled and flat armchair and buckled zigzag germanene nanoribbons by performing theoretical calculations using the nonequilibrium Greens function method combined with density functional theory. In these bilayer types, the current oscillates with change of interlayer distances or intra-layer overlaps and is dependent on the type of the bilayer. Band gap of AA-stacked of shifted flat bilayer armchair germanene nanoribbon oscillates by change of interlayer distance which is in contrast to buckled bilayer armchair germanene nanoribbon. So, results show the buckling makes system tend to be a semiconductor with wide band gap. Therefore, AA-stacked of shifted flat bilayer armchair germanene nanoribbon has properties between zigzag and armchair edges, the higher current under bias voltages similar to zigzag edge and also oscillations in current like buckled armchair edges. Also, it is found that HOMO-LUMO band gap strongly affects oscillation in currents and their I-V characteristic. This kind of junction improves the switching properties at low voltages around the band gap.
ERIC Educational Resources Information Center
Physics Education, 1982
1982-01-01
Describes: (1) an apparatus which provides a simple method for measuring Stefan's constant; (2) a simple phase shifting circuit; (3) a radioactive decay computer program (for ZX81); and (4) phase difference between transformer voltages. (Author/JN)
Electrocution fatalities in military personnel in Ankara, Turkey
Tugcu, Harun; Ozsoy, Sait; Balandiz, Huseyin
2015-01-01
Objectives: To investigate various cases of death caused by electrical injuries among Turkish military personnel. Methods: We retrospectively reviewed fatality cases of military personnel between 1994 and 2013 at the Department of Forensic Medicine, Gulhane Military Medical Academy, School of Medicine, Ankara, Turkey, the only forensic medicine center for the Turkish Armed Forces. Medical records and autopsy reports of cases of electrical fatalities were reviewed and analyzed in terms of age and gender-specific incidence, voltage, contact details, body region distribution, location, and season of incident, site, and severity of injuries sustained, and histopathological and toxicological findings. Results: Sixteen (3.5%) out of the 450 autopsy cases involved electrocution. All deaths were accidental and most frequently occurred outdoors (75%). Eight (50%) died due to high voltage while 6 (37.5%) died due to low voltage. The entry and exit lesions were determined most frequently in cases with high voltage injury. The low voltage deaths commonly occurred at the scene of the event (66.6%), while almost all high voltage deaths occurred in the hospital (87.5%, p=0.03). Electrical burns were most commonly detected in the upper extremities (32.6%, n=14). Conclusion: The present study shows that deaths due to high voltage electrocution are more frequent than low voltage electrocution among military personnel. PMID:25630009
NASA Astrophysics Data System (ADS)
Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In
2017-08-01
In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.
pH-dependent electron-transport properties of carbon nanotubes.
Back, Ju Hee; Shim, Moonsub
2006-11-30
Carbon nanotube electrochemical transistors integrated with microfluidic channels are utilized to examine the effects of aqueous electrolyte solutions on the electron-transport properties of single isolated carbon nanotubes. In particular, pH and concentration of supporting inert electrolytes are examined. A systematic threshold voltage shift with pH is observed while the transconductance and subthreshold swing remain independent of pH and concentration. Decreasing pH leads to a negative shift of the threshold voltage, indicating that protonation does not lead to hole doping. Changing the type of contact metal does not alter the observed pH response. The pH-dependent charging of SiO2 substrate is ruled out as the origin based on measurements with suspended nanotube transistors. Increasing the ionic strength leads to reduced pH response. Contributions from possible surface chargeable chemical groups are considered.
Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons.
Brown, Maile R; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H; Kaczmarek, Leonard K
2016-07-01
Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express "high threshold" voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. Copyright © 2016 the American Physiological Society.
Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons
Brown, Maile R.; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H.
2016-01-01
Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express “high threshold” voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. PMID:27052580
Mori, Daichi; Oka, Hiroshi; Hosoi, Takuji; ...
2016-09-02
The energy difference between the oxide and bulk peaks in X-ray photoelectron spectroscopy (XPS) spectra was investigated in this paper for both GeO 2/Ge and SiO 2/Si structures with thickness-controlled water films. This was achieved by obtaining XPS spectra at various values of relative humidity (RH) of up to ~15%. The increase in the energy shift is more significant for thermal GeO 2 on Ge than for thermal SiO 2 on Si above ~10 -4% RH, which is due to the larger amount of water molecules that infiltrate into the GeO 2 film to form hydroxyls. Analyzing the origins ofmore » this energy shift, we propose that the positive charging of a partially hydroxylated GeO 2 film, which is unrelated to X-ray irradiation, causes the larger energy shift for GeO 2/Ge than for SiO 2/Si. A possible microscopic mechanism of this intrinsic positive charging is the emission of electrons from adsorbed water species in the suboxide layer of the GeO 2 film to the Ge bulk, leaving immobile cations or positively charged states in the oxide. Finally, this may be related to the reported negative shift of flat band voltages in metal-oxide-semiconductor diodes with an air-exposed GeO 2 layer.« less
NASA Astrophysics Data System (ADS)
Ho, Ching-Yuan; Chang, Yaw-Jen
2016-02-01
Both aluminum (Al) and copper (Cu), acting as transmission lines in the hydrogenated amorphous silicon of a thin film transistor (a-Si:H TFT), were studied to investigate electrical degradation including electron-migration (EM) and threshold voltage (Vt) stability and recovery performance. Under long-term current stress, the Cu material exhibited excellent resistance to EM properties, but a passivated SiNx crack was observed due to fast heat conductivity. By applying electrical stress on the gate and drain for 5 × 104 s, the power-law time dependency of the threshold voltage shift (ΔVt) indicated that the defective state creation dominated the TFT device's instability. The presence of drain stress increased the overall ΔVt because the high longitudinal field induced impact ionization and then, enhanced hot-carrier-induced electron trapping within the gate SiNx dielectric. An annealing effect prompted a stressed a-Si:H TFT back to virgin status. This study proposes better ΔVt stability and excellent resistance against electron-migration in a Cu gate device which can be considered as a candidate for a transmission line on prolonged TFT applications.
Controlling the electric charge of gold nanoplatelets on an insulator by field emission nc-AFM
NASA Astrophysics Data System (ADS)
Baris, Bulent; Alchaar, Mohanad; Prasad, Janak; Gauthier, Sébastien; Dujardin, Erik; Martrou, David
2018-03-01
Charging of 2D Au nanoplatelets deposited on an insulating SiO2 substrate to or from the tip of a non-contact atomic force microscope (nc-AFM) is demonstrated. Charge transfer is controlled by monitoring the resonance frequency shift Δf(V) during the bias voltage ramp V applied to the tip-back electrode junction. The onset of charge transfer is revealed by a transition from a capacitive parabolic behavior to a constant Δf(V) region for both polarities. An analytical model, based on charging by electron field emission, shows that the field-emitted current saturates shortly after the onset of the charging, due to the limiting effect of the charge-induced rise of the Au platelet potential. The value of this current plateau depends only on the rate of the bias voltage ramp and on the value of the platelet/SiO2/back electrode capacitance. This analysis is confirmed by numerical simulations based on a virtual nc-AFM model that faithfully matches the experimental data. Our charging protocol could be used to tune the potential of the platelets at the single charge level.
NASA Astrophysics Data System (ADS)
Kamei, Masayuki; Takao, Yoshinori; Eriguchi, Koji; Ono, Kouichi
2014-01-01
We clarified in this study how plasma-induced charging damage (PCD) affects the so-called “random telegraph noise (RTN)” — a principal concern in designing ultimately scaled large-scale integrated circuits (LSIs). Metal-oxide-semiconductor field-effect transistors (MOSFETs) with SiO2 and high-k gate dielectric were exposed to an inductively coupled plasma (ICP) with Ar gas. Drain current vs gate voltage (Ids-Vg) characteristics were obtained before and after the ICP plasma exposure for the same device. Then, the time evolution of Ids fluctuation defined as Ids/μIds was measured, where μIds is the mean Ids. This value corresponds to an RTN feature, and RTN was obtained under various gate voltages (Vg) by a customized measurement technique. We focused on the statistical distribution width of (Ids/μIds), δ(Ids/μIds), in order to clarify the effects of PCD on RTN. δ(Ids/μIds) was increased by PCD for both MOSFETs with the SiO2 and high-k gate dielectrics, suggesting that RTN can be used as a measure of PCD, i.e., a distribution width increase directly indicates the presence of PCD. The dependence of δ(Ids/μIds) on the overdrive voltage Vg-Vth, where Vth is the threshold voltage, was investigated by the present technique. It was confirmed that δ(Ids/μIds) increased with a decrease in the overdrive voltage for MOSFETs with the SiO2 and high-k gate dielectrics. The presence of created carrier trap sites with PCD was characterized by the time constants for carrier capture and emission. The threshold voltage shift (ΔVth) induced by PCD was also evaluated and compared with the RTN change, to correlate the RTN increase with ΔVth induced by PCD. Although the estimated time constants exhibited complex behaviors due to the nature of trap sites created by PCD, δ(Ids/μIds) showed a straightforward tendency in accordance with the amount of PCD. These findings provide an in-depth understanding of plasma-induced RTN characteristic changes in future MOSFETs.
Wang, Dapeng; Zhao, Wenjing; Li, Hua; Furuta, Mamoru
2018-04-05
In this study, the initial electrical properties, positive gate bias stress (PBS), and drain current stress (DCS)-induced instabilities of amorphous indium gallium zinc oxide (a-IGZO) thin-film transistors (TFTs) with various active layer thicknesses ( T IGZO ) are investigated. As the T IGZO increased, the turn-on voltage ( V on ) decreased, while the subthreshold swing slightly increased. Furthermore, the mobility of over 13 cm²·V −1 ·s −1 and the negligible hysteresis of ~0.5 V are obtained in all of the a-IGZO TFTs, regardless of the T IGZO . The PBS results exhibit that the V on shift is aggravated as the T IGZO decreases. In addition, the DCS-induced instability in the a-IGZO TFTs with various T IGZO values is revealed using current–voltage and capacitance–voltage ( C – V ) measurements. An anomalous hump phenomenon is only observed in the off state of the gate-to-source ( C gs ) curve for all of the a-IGZO TFTs. This is due to the impact ionization that occurs near the drain side of the channel and the generated holes that flow towards the source side along the back-channel interface under the lateral electric field, which cause a lowered potential barrier near the source side. As the T IGZO value increased, the hump in the off state of the C gs curve was gradually weakened.
Quantitative Analysis Method of Output Loss due to Restriction for Grid-connected PV Systems
NASA Astrophysics Data System (ADS)
Ueda, Yuzuru; Oozeki, Takashi; Kurokawa, Kosuke; Itou, Takamitsu; Kitamura, Kiyoyuki; Miyamoto, Yusuke; Yokota, Masaharu; Sugihara, Hiroyuki
Voltage of power distribution line will be increased due to reverse power flow from grid-connected PV systems. In the case of high density grid connection, amount of voltage increasing will be higher than the stand-alone grid connection system. To prevent the over voltage of power distribution line, PV system's output will be restricted if the voltage of power distribution line is close to the upper limit of the control range. Because of this interaction, amount of output loss will be larger in high density case. This research developed a quantitative analysis method for PV systems output and losses to clarify the behavior of grid connected PV systems. All the measured data are classified into the loss factors using 1 minute average of 1 second data instead of typical 1 hour average. Operation point on the I-V curve is estimated to quantify the loss due to the output restriction using module temperature, array output voltage, array output current and solar irradiance. As a result, loss due to output restriction is successfully quantified and behavior of output restriction is clarified.
Broadband linear high-voltage amplifier for radio frequency ion traps.
Kuhlicke, Alexander; Palis, Klaus; Benson, Oliver
2014-11-01
We developed a linear high-voltage amplifier for small capacitive loads consisting of a high-voltage power supply and a transistor amplifier. With this cost-effective circuit including only standard parts sinusoidal signals with a few volts can be amplified to 1.7 kVpp over a usable frequency range at large-signal response spanning four orders of magnitude from 20 Hz to 100 kHz under a load of 10 pF. For smaller output voltages the maximum frequency shifts up to megahertz. We test different capacitive loads to probe the influence on the performance. The presented amplifier is sustained short-circuit proof on the output side, which is a significant advantage over other amplifier concepts. The amplifier can be used to drive radio frequency ion traps for single charged nano- and microparticles, which will be presented in brief.
Plenoptic camera based on a liquid crystal microlens array
NASA Astrophysics Data System (ADS)
Lei, Yu; Tong, Qing; Zhang, Xinyu; Sang, Hongshi; Xie, Changsheng
2015-09-01
A type of liquid crystal microlens array (LCMLA) with tunable focal length by the voltage signals applied between its top and bottom electrodes, is fabricated and then the common optical focusing characteristics are tested. The relationship between the focal length and the applied voltage signals is given. The LCMLA is integrated with an image sensor and further coupled with a main lens so as to construct a plenoptic camera. Several raw images at different voltage signals applied are acquired and contrasted through the LCMLA-based plenoptic camera constructed by us. Our experiments demonstrate that through utilizing a LCMLA in a plenoptic camera, the focused zone of the LCMLA-based plenoptic camera can be shifted effectively only by changing the voltage signals loaded between the electrodes of the LCMLA, which is equivalent to the extension of the depth of field.
Low-voltage all-inorganic perovskite quantum dot transistor memory
NASA Astrophysics Data System (ADS)
Chen, Zhiliang; Zhang, Yating; Zhang, Heng; Yu, Yu; Song, Xiaoxian; Zhang, Haiting; Cao, Mingxuan; Che, Yongli; Jin, Lufan; Li, Yifan; Li, Qingyan; Dai, Haitao; Yang, Junbo; Yao, Jianquan
2018-05-01
An all-inorganic cesium lead halide quantum dot (QD) based Au nanoparticle (NP) floating-gate memory with a solution processed layer-by-layer method is demonstrated. Easy synthesis at room temperature and excellent stability make all-inorganic CsPbBr3 perovskite QDs suitable as a semiconductor layer in low voltage nonvolatile transistor memory. The bipolarity of QDs has both electrons and holes stored in the Au NP floating gate, resulting in bidirectional shifts of initial threshold voltage according to the applied programing and erasing pulses. Under low operation voltage (±5 V), the memory achieved a great memory window (˜2.4 V), long retention time (>105 s), and stable endurance properties after 200 cycles. So the proposed memory device based on CsPbBr3 perovskite QDs has a great potential in the flash memory market.
A theoretical approach to study the optical sensitivity of a MESFET
NASA Astrophysics Data System (ADS)
Dutta, Sutanu
2018-05-01
A theoretical model to study the optical sensitivity of a metal-semiconductor field effect transistor has been proposed for a relatively high drain field. An analytical expression of drain current of the device has been derived for a MESFET under optical illumination considering field dependent mobility of electrons across the channel. The variation of drain current with and without optical illumination has been studied with drain and gate voltages. The optical sensitivity of the drain current has been studied for different biasing conditions and gate lengths. In addition, the shift in threshold voltage of a MESFET under optical illumination is determined and optical sensitivity of the device in terms of its threshold voltage has been studied.
Direct electronic probing of biological complexes formation
NASA Astrophysics Data System (ADS)
Macchia, Eleonora; Magliulo, Maria; Manoli, Kyriaki; Giordano, Francesco; Palazzo, Gerardo; Torsi, Luisa
2014-10-01
Functional bio-interlayer organic field - effect transistors (FBI-OFET), embedding streptavidin, avidin and neutravidin as bio-recognition element, have been studied to probe the electronic properties of protein complexes. The threshold voltage control has been achieved modifying the SiO2 gate diaelectric surface by means of the deposition of an interlayer of bio-recognition elements. A threshold voltage shift with respect to the unmodified dielectric surface toward more negative potential values has been found for the three different proteins, in agreement with their isoelectric points. The relative responses in terms of source - drain current, mobility and threshold voltage upon exposure to biotin of the FBI-OFET devices have been compared for the three bio-recognition elements.
Addressable inverter matrix for process and device characterization
NASA Technical Reports Server (NTRS)
Buehler, M. G.; Sayah, H. R.
1985-01-01
The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.
FIBER AND INTEGRATED OPTICS: Nonlinearity of a channel-waveguide phase modulator
NASA Astrophysics Data System (ADS)
Parygin, V. N.; Zhmakin, I. N.; Baglikov, V. B.
1993-09-01
The phase velocity of light in a channel waveguide using a LiNbO3 crystal is analyzed as a function of the voltage applied to the crystal. A refinement of the method of an effective refractive index is proposed. This refinement makes it possible to use the method near the cutoff for a waveguide mode. At voltages on the order of 10 V, the nonlinearity of the phase characteristic amounts to ~ 5 · 10- 4 of the linear phase shift.
Choo, Dong Chul; Bang, Hyun Sung; Kim, Tae Whan; Seo, Ji Hyun; Kim, Young Kwan
2012-02-01
The electrical and the optical properties of phosphorescent organic light-emitting devices (PHOLEDs) fabricated utilizing a mixed host emitting layer (EML) consisting of N,N'-dicarbazolyl-3,5-benzene (mCP) and 1,3,5-tri(phenyl-2-benzimidazole)-benzene (TPBi) were investigated to clarify the carrier transport mechanisms of PHOLEDs. While the operating voltage of the PHOLEDs with a mixed host EML significantly decreased due to the insertion of TPBi with a high electron mobility, the quantum efficiency of the PHOLEDs decreased due to the hindrance of the exciton energy transfer by TPBi molecules. The electroluminescence spectra for the PHOLEDs with an tris(2-phenylpyridine)iridium-doped mixed host EML showed that the TPBi molecules in the mixed host EML increased the electron injection into the mixed host EML, resulting in a decrease of the shift length of the recombination zone in comparison with a single host EML.
Ågren, Richard; Sahlholm, Kristoffer; Nilsson, Johanna; Århem, Peter
2018-01-29
The muscarinic M 2 receptor (M 2 R) has been shown to display voltage-sensitive agonist binding, based on G protein-activated inward rectifier potassium channel (GIRK) opening and radioligand binding at different membrane voltages. A conserved aspartate in transmembrane segment (TM) II of M 2 R, D69, has been proposed as the voltage sensor. While a recent paper instead presented evidence of tyrosines in TMs III, VI, and VII acting as voltage sensors, these authors were not able to record GIRK channel activation by a D69N mutant M 2 R. In the present study, we succeeded in recording ACh-induced GIRK channel activation by this mutant at -80 and 0 mV. The acetylcholine EC 50 was about 2.5-fold higher at 0 mV, a potency shift very similar to that observed at wild-type M 2 R, indicating that voltage sensitivity persists at the D69N mutant. Thus, our present observations corroborate the notion that D69 is not responsible for voltage sensitivity of the M 2 R. Copyright © 2018 Elsevier Inc. All rights reserved.
Improved frequency/voltage converters for fast quartz crystal microbalance applications.
Torres, R; García, J V; Arnau, A; Perrot, H; Kim, L To Thi; Gabrielli, C
2008-04-01
The monitoring of frequency changes in fast quartz crystal microbalance (QCM) applications is a real challenge in today's instrumentation. In these applications, such as ac electrogravimetry, small frequency shifts, in the order of tens of hertz, around the resonance of the sensor can occur up to a frequency modulation of 1 kHz. These frequency changes have to be monitored very accurately both in magnitude and phase. Phase-locked loop techniques can be used for obtaining a high performance frequency/voltage converter which can provide reliable measurements. Sensitivity higher than 10 mVHz, for a frequency shift resolution of 0.1 Hz, with very low distortion in tracking both the magnitude and phase of the frequency variations around the resonance frequency of the sensor are required specifications. Moreover, the resonance frequency can vary in a broad frequency range from 5 to 10 MHz in typical QCM sensors, which introduces an additional difficulty. A new frequency-voltage conversion system based on a double tuning analog-digital phase-locked loop is proposed. The reported electronic characterization and experimental results obtained with conducting polymers prove its reliability for ac-electrogravimetry measurements and, in general, for fast QCM applications.
An All Oxide-Based Imperceptible Thin-Film Transistor with Humidity Sensing Properties
Kim, Kyung Su; Ahn, Cheol Hyoun; Kang, Won Jun; Cho, Sung Woon; Jung, Sung Hyeon; Yoon, Dae Ho; Cho, Hyung Koun
2017-01-01
We have examined the effects of oxygen content and thickness in sputtered InSnO (ITO) electrodes, especially for the application of imperceptible amorphous-InGaZnO (a-IGZO) thin-film transistors (TFTs) in humidity sensors. The imperceptible a-IGZO TFT with 50-nm ITO electrodes deposited at Ar:O2 = 29:0.3 exhibited good electrical performances with Vth of −0.23 V, SS of 0.34 V/dec, µFE of 7.86 cm2/V∙s, on/off ratio of 8.8 × 107, and has no degradation for bending stress up to a 3.5-mm curvature. The imperceptible oxide TFT sensors showed the highest sensitivity for the low and wide gate bias of −1~2 V under a wide range of relative humidity (40–90%) at drain voltage 1 V, resulting in low power consumption by the sensors. Exposure to water vapor led to a negative shift in the threshold voltage (or current enhancement), and an increase in relative humidity induced continuous threshold voltage shift. In particular, compared to conventional resistor-type sensors, the imperceptible oxide TFT sensors exhibited extremely high sensitivity from a current amplification of >103. PMID:28772888
An All Oxide-Based Imperceptible Thin-Film Transistor with Humidity Sensing Properties.
Kim, Kyung Su; Ahn, Cheol Hyoun; Kang, Won Jun; Cho, Sung Woon; Jung, Sung Hyeon; Yoon, Dae Ho; Cho, Hyung Koun
2017-05-13
We have examined the effects of oxygen content and thickness in sputtered InSnO (ITO) electrodes, especially for the application of imperceptible amorphous-InGaZnO ( a -IGZO) thin-film transistors (TFTs) in humidity sensors. The imperceptible a -IGZO TFT with 50-nm ITO electrodes deposited at Ar:O₂ = 29:0.3 exhibited good electrical performances with V th of -0.23 V, SS of 0.34 V/dec, µ FE of 7.86 cm²/V∙s, on/off ratio of 8.8 × 10⁷, and has no degradation for bending stress up to a 3.5-mm curvature. The imperceptible oxide TFT sensors showed the highest sensitivity for the low and wide gate bias of -1~2 V under a wide range of relative humidity (40-90%) at drain voltage 1 V, resulting in low power consumption by the sensors. Exposure to water vapor led to a negative shift in the threshold voltage (or current enhancement), and an increase in relative humidity induced continuous threshold voltage shift. In particular, compared to conventional resistor-type sensors, the imperceptible oxide TFT sensors exhibited extremely high sensitivity from a current amplification of >10³.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pfeffer, H.; Saewert, G.
This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less
Improved frequency/voltage converters for fast quartz crystal microbalance applications
NASA Astrophysics Data System (ADS)
Torres, R.; García, J. V.; Arnau, A.; Perrot, H.; Kim, L. To Thi; Gabrielli, C.
2008-04-01
The monitoring of frequency changes in fast quartz crystal microbalance (QCM) applications is a real challenge in today's instrumentation. In these applications, such as ac electrogravimetry, small frequency shifts, in the order of tens of hertz, around the resonance of the sensor can occur up to a frequency modulation of 1kHz. These frequency changes have to be monitored very accurately both in magnitude and phase. Phase-locked loop techniques can be used for obtaining a high performance frequency/voltage converter which can provide reliable measurements. Sensitivity higher than 10mV/Hz, for a frequency shift resolution of 0.1Hz, with very low distortion in tracking both the magnitude and phase of the frequency variations around the resonance frequency of the sensor are required specifications. Moreover, the resonance frequency can vary in a broad frequency range from 5to10MHz in typical QCM sensors, which introduces an additional difficulty. A new frequency-voltage conversion system based on a double tuning analog-digital phase-locked loop is proposed. The reported electronic characterization and experimental results obtained with conducting polymers prove its reliability for ac-electrogravimetry measurements and, in general, for fast QCM applications.
ZnS-Based ZnSTe:N/n-ZnS Light-Emitting Diodes
NASA Astrophysics Data System (ADS)
Ichino, Kunio; Kojima, Takahiro; Obata, Shunsuke; Kuroyanagi, Takuma; Nakazawa, Shoichi; Kashiyama, Shota
2013-11-01
ZnS1-xTex:N/n-ZnS diodes have been fabricated in an attempt to convert ZnS into p-type by Te incorporation and the resulting upward shift of the valence band maximum. The diodes exhibit clear rectification in the current-voltage characteristic and a peak of the electron-beam-induced current at the ZnS1-xTex:N/n-ZnS interface. Furthermore, a ZnS0.85Te0.15:N/n-ZnS diode exhibits blue-green electroluminescence due to self-activated emission in n-ZnS at 290 K under a forward current. These results suggest p-type conduction in ZnS1-xTex:N, and thus the LED operation of a ZnS-based pn-junction.
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L.; Thiel, Gerhard
2013-01-01
The modular architecture of voltage-gated K+ (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates KvSynth1, a functional voltage-gated, outwardly rectifying K+ channel. KvSynth1 displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V1/2 = +56 mV; z of ∼1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains. PMID:23440279
NASA Astrophysics Data System (ADS)
Yang, Paul; Kim, Hyung Jun; Zheng, Hong; Beom, Geon Won; Park, Jong-Sung; Kang, Chi Jung; Yoon, Tae-Sik
2017-06-01
A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.
Yang, Paul; Jun Kim, Hyung; Zheng, Hong; Won Beom, Geon; Park, Jong-Sung; Jung Kang, Chi; Yoon, Tae-Sik
2017-06-02
A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.
Chen, Horng-Shyang; Liu, Zhan Hui; Shih, Pei-Ying; Su, Chia-Ying; Chen, Chih-Yen; Lin, Chun-Han; Yao, Yu-Feng; Kiang, Yean-Woei; Yang, C C
2014-04-07
A reverse-biased voltage is applied to either device in the vertical configuration of two light-emitting diodes (LEDs) grown on patterned and flat Si (110) substrates with weak and strong quantum-confined Stark effects (QCSEs), respectively, in the InGaN/GaN quantum wells for independently controlling the applied voltage across and the injection current into the p-i-n junction in the lateral configuration of LED operation. The results show that more carrier supply is needed in the LED of weaker QCSE to produce a carrier screening effect for balancing the potential tilt in increasing the forward-biased voltage, when compared with the LED of stronger QCSE. The small spectral shift range in increasing injection current in the LED of weaker QCSE is attributed not only to the weaker QCSE, but also to its smaller device resistance such that a given increment of applied voltage leads to a larger increment of injection current. From a viewpoint of practical application in LED operation, by applying a reverse-biased voltage in the vertical configuration, the applied voltage and injection current in the lateral configuration can be independently controlled by adjusting the vertical voltage for keeping the emission spectral peak fixed.
Tilt-effect of holograms and images displayed on a spatial light modulator.
Harm, Walter; Roider, Clemens; Bernet, Stefan; Ritsch-Marte, Monika
2015-11-16
We show that a liquid crystal spatial light modulator (LCOS-SLM) can be used to display amplitude images, or phase holograms, which change in a pre-determined way when the display is tilted, i.e. observed under different angles. This is similar to the tilt-effect (also called "latent image effect") known from various security elements ("kinegrams") on credit cards or bank notes. The effect is achieved without any specialized optical components, simply by using the large phase shifting capability of a "thick" SLM, which extends over several multiples of 2π, in combination with the angular dependence of the phase shift. For hologram projection one can use the fact that the phase of a monochromatic wave is only defined modulo 2π. Thus one can design a phase pattern extending over several multiples of 2π, which transforms at different readout angles into different 2π-wrapped phase structures, due to the angular dependence of the modulo 2π operation. These different beams then project different holograms at the respective readout angles. In amplitude modulation mode (with inserted polarizer) the intensity of each SLM pixel oscillates over several periods when tuning its control voltage. Since the oscillation period depends on the readout angle, it is possible to find a certain control voltage which produces two (or more) selectable gray levels at a corresponding number of pre-determined readout angles. This is done with all SLM pixels individually, thus constructing different images for the selected angles. We experimentally demonstrate the reconstruction of multiple (Fourier- and Fresnel-) holograms, and of different amplitude images, by readout of static diffractive patterns in a variable angular range between 0° and 60°.
NASA Astrophysics Data System (ADS)
Stomp, Romain-Pierre
This thesis is devoted to the studies of self-assembled InAs quantum dots (QD) by low-temperature Atomic Force Microscopy (AFM) in frequency modulation mode. Several spectroscopic methods are developed to investigate single electron charging from a two-dimensional electron gas (2DEG) to an individual InAs QD. Furthermore, a new technique to measure the absolute tip-sample capacitance is also demonstrated. The main observables are the electrostatic force between the metal-coated AFM tip and sample as well as the sample-induced energy dissipation, and therefore no tunneling current has to be collected at the AFM tip. Measurements were performed by recording simultaneously the shift in the resonant frequency and the Q-factor degradation of the oscillating cantilever either as a function of tip-sample voltage or distance. The signature of single electron charging was detected as an abrupt change in the frequency shift as well as corresponding peaks in the dissipation. The main experimental features in the force agree well with the semi-classical theory of Coulomb blockade by considering the free energy of the system. The observed dissipation peaks can be understood as a back-action effect on the oscillating cantilever beam due to the fluctuation in time of electrons tunneling back and forth between the 2DEG and the QD. It was also possible to extract the absolute value of the tip-sample capacitance, as a consequence of the spectroscopic analysis of the electrostic force as a function of tip-sample distance for different values of the applied voltage. At the same time, the contact potential difference and the residual non-capacitive force could also be determined as a function of tip-sample distance.
Grier, Andrew; Dean, Paul; Valavanis, Alexander; Keeley, James; Kundu, Iman; Cooper, Jonathan D; Agnew, Gary; Taimre, Thomas; Lim, Yah Leng; Bertling, Karl; Rakić, Aleksandar D; Li, Lianhe H; Harrison, Paul; Linfield, Edmund H; Ikonić, Zoran; Davies, A Giles; Indjin, Dragan
2016-09-19
We explain the origin of voltage variations due to self-mixing in a terahertz (THz) frequency quantum cascade laser (QCL) using an extended density matrix (DM) approach. Our DM model allows calculation of both the current-voltage (I-V) and optical power characteristics of the QCL under optical feedback by changing the cavity loss, to which the gain of the active region is clamped. The variation of intra-cavity field strength necessary to achieve gain clamping, and the corresponding change in bias required to maintain a constant current density through the heterostructure is then calculated. Strong enhancement of the self-mixing voltage signal due to non-linearity of the (I-V) characteristics is predicted and confirmed experimentally in an exemplar 2.6 THz bound-to-continuum QCL.
Charging and breakdown in amorphous dielectrics: Phenomenological modeling approach and applications
NASA Astrophysics Data System (ADS)
Palit, Sambit
Amorphous dielectrics of different thicknesses (nm to mm) are used in various applications. Low temperature processing/deposition of amorphous thin-film dielectrics often result in defect-states or electronic traps. These traps are responsible for increased leakage currents and bulk charge trapping in many associated applications. Additional defects may be generated during regular usage, leading to electrical breakdown. Increased leakage currents, charge trapping and defect generation/breakdown are important and pervasive reliability concerns in amorphous dielectrics. We first explore the issue of charge accumulation and leakage in amorphous dielectrics. Historically, charge transport in amorphous dielectrics has been presumed, depending on the dielectric thickness, to be either bulk dominated (Frenkel-Poole (FP) emission) or contact dominated (Fowler-Nordheim tunneling). We develop a comprehensive dielectric charging modeling framework which solves for the transient and steady state charge accumulation and leakage currents in an amorphous dielectric, and show that for intermediate thickness dielectrics, the conventional assumption of FP dominated current transport is incorrect, and may lead to false extraction of dielectric parameters. We propose an improved dielectric characterization methodology based on an analytical approximation of our model. Coupled with ab-initio computed defect levels, the dielectric charging model explains measured leakage currents more accurately with lesser empiricism. We study RF-MEMS capacitive switches as one of the target applications of intermediate thickness amorphous dielectrics. To achieve faster analysis and design of RF-MEMS switches in particular, and electro-mechanical actuators in general, we propose a set of fundamental scaling relationships which are independent of specific physical dimensions and material properties; the scaling relationships provide an intrinsic classification of all electro-mechanical actuators. However, RF-MEMS capacitive switches are plagued by the reliability issue of temporal shifts of actuation voltages due to dielectric charge accumulation, often resulting in failure due to membrane stiction. Using the dielectric charging model, we show that in spite of unpredictable roughness of deposited dielectrics, there are predictable shifts in actuation voltages due to dielectric charging in RF-MEMS switches. We also propose a novel non-obtrusive, non-contact, fully electronic resonance based technique to characterize charging driven actuation shifts in RF-MEMS switches which overcomes limitations in conventionally used methods. Finally, we look into the issue of defect generation and breakdown in thick polymer dielectrics. Polymer materials often face premature electrical breakdown due to high electric fields and frequencies, and exposure to ambient humidity conditions. Using a field-driven correlated defect generation model, coupled with a model for temperature rise due to dielectric heating at AC stresses, we explain measured trends in time-to-breakdown and breakdown electric fields in polymer materials. Using dielectric heating we are able to explain the observed lifetime and dielectric strength reduction with increasing dielectric thicknesses. Performing lifetime measurements after exposure to controlled humidity conditions, we find that moisture ingress into a polymer material reduces activation barriers for chain breakage and increases dielectric heating. Overall, this thesis develops a comprehensive framework of dielectric charging, leakage and degradation of insulators of different thicknesses that have broad applications in multiple technologies.
Yarov-Yarovoy, V; Brown, J; Sharp, E M; Clare, J J; Scheuer, T; Catterall, W A
2001-01-05
Mutations of amino acid residues in the inner two-thirds of the S6 segment in domain III of the rat brain type IIA Na(+) channel (G1460A to I1473A) caused periodic positive and negative shifts in the voltage dependence of activation, consistent with an alpha-helix having one face on which mutations to alanine oppose activation. Mutations in the outer one-third of the IIIS6 segment all favored activation. Mutations in the inner half of IIIS6 had strong effects on the voltage dependence of inactivation from closed states without effect on open-state inactivation. Only three mutations had strong effects on block by local anesthetics and anticonvulsants. Mutations L1465A and I1469A decreased affinity of inactivated Na(+) channels up to 8-fold for the anticonvulsant lamotrigine and its congeners 227c89, 4030w92, and 619c89 as well as for the local anesthetic etidocaine. N1466A decreased affinity of inactivated Na(+) channels for the anticonvulsant 4030w92 and etidocaine by 3- and 8-fold, respectively, but had no effect on affinity of the other tested compounds. Leu-1465, Asn-1466, and Ile-1469 are located on one side of the IIIS6 helix, and mutation of each caused a positive shift in the voltage dependence of activation. Evidently, these amino acid residues face the lumen of the pore, contribute to formation of the high-affinity receptor site for pore-blocking drugs, and are involved in voltage-dependent activation and coupling to closed-state inactivation.
von Stein, Richard T.
2012-01-01
Sodium channel inhibitor (SCI) insecticides selectively target voltage-gated sodium (Nav) channels in the slow-inactivated state by binding at or near the local anesthetic receptor within the sodium channel pore. Metaflumizone is a new insecticide for the treatment of fleas on domesticated pets and has recently been reported to block insect sodium channels in the slow-inactivated state, thereby implying that it is also a member of the SCI class. Using the two-electrode voltage-clamp technique, we examined metaflumizone inhibition of rat Nav1.4 sodium channels expressed in Xenopus laevis oocytes. Metaflumizone selectively inhibited Nav1.4 channels at potentials that promoted slow inactivation and shifted the voltage dependence of slow inactivation in the direction of hyperpolarization. Metaflumizone perfusion at a hyperpolarized holding potential also shifted the conductance-voltage curve for activation in the direction of depolarization and antagonized use-dependent lidocaine inhibition of fast-inactivated sodium channels, actions not previously observed with other SCI insecticides. We expressed mutated Nav1.4/F1579A and Nav1.4/Y1586A channels to investigate whether metaflumizone shares the domain IV segment S6 (DIV-S6) binding determinants identified for other SCI insecticides. Consistent with previous investigations of SCI insecticides on rat Nav1.4 channels, the F1579A mutation reduced sensitivity to block by metaflumizone, whereas the Y1586A mutation paradoxically increased the sensitivity to metaflumizone. We conclude that metaflumizone selectively inhibits slow-inactivated Nav1.4 channels and shares DIV-S6 binding determinants with other SCI insecticides and therapeutic drugs. However, our results suggest that metaflumizone interacts with resting and fast-inactivated channels in a manner that is distinct from other compounds in this insecticide class. PMID:22127519
Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S
2010-04-28
The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.
Effect of substrate thinning on the electronic transport characteristics of AlGaN/GaN HEMTs
NASA Astrophysics Data System (ADS)
Zhu, Hui; Meng, Xiao; Zheng, Xiang; Yang, Ying; Feng, Shiwei; Zhang, Yamin; Guo, Chunsheng
2018-07-01
We studied how substrate thinning affected the electronic transport characteristics of AlGaN/GaN HEMTs. By thinning their sapphire substrate from 460 μm to 80 μm, we varied the residual stress in these HEMTs. The thinned sample showed decreased drain-source current and occurrence of kink effect. Furthermore, shown by current transient measurements and time constant analysis, the detrapping behaviors of trap states shifted toward a larger time constant, and the detrapping behavior under the gate and in the gate-drain access region showed increased amplitude. By using pulsed current-voltage measurements, the thinned sample showed a positive shift of the threshold voltage, a decrease in peak transconductance, and an aggravation in current collapse, as compared with the thick one. The degradation of electrical behavior were associated with the structural degradation, as confirmed by the increase of pit density on the thinned sample surface.
Tunneling calculations for GaAs-Al(x)Ga(1-x)As graded band-gap sawtooth superlattices
NASA Technical Reports Server (NTRS)
Forrest, Kathrine; Meijer, Paul H. E.
1990-01-01
The transmission resonance spectra and tunneling current-voltage characteristics for direct conduction band electrons in sawtooth GaAs-Al(x)Ga(1-x)As superlattices are computed. Only direct-gap interfaces are considered. It is found that sawtooth superlattices exhibit resonant tunneling similar to that in step superlattices, manifested by correlation of peaks and regions of negative differential resistance in the current-voltage curves with transmission resonances. The Stark shift of the resonances of step-barrier superlattices is a linear function of the field, whereas in sawtooth superlattices under strong fields the shift is not a simple function of the field. This follows from the different ways in which the two structures deform under uniform electric fields: the sawtooth deforms into a staircase, at which field strength all barriers to tunneling are eradicated. The step-barrier superlattice always presents some barrier to tunneling, no matter how high the electric field strength.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Won Lee, Sang; Suh, Dongseok, E-mail: energy.suh@skku.edu; Department of Energy Science and Department of Physics, Sungkyunkwan University, Suwon 440-746
A prior requirement of any developed transistor for practical use is the stability test. Random network carbon nanotube-thin film transistor (CNT-TFT) was fabricated on SiO{sub 2}/Si. Gate bias stress stability was investigated with various passivation layers of HfO{sub 2} and Al{sub 2}O{sub 3}. Compared to the threshold voltage shift without passivation layer, the measured values in the presence of passivation layers were reduced independent of gate bias polarity except HfO{sub 2} under positive gate bias stress (PGBS). Al{sub 2}O{sub 3} capping layer was found to be the best passivation layer to prevent ambient gas adsorption, while gas adsorption on HfO{submore » 2} layer was unavoidable, inducing surface charges to increase threshold voltage shift in particular for PGBS. This high performance in the gate bias stress test of CNT-TFT even superior to that of amorphous silicon opens potential applications to active TFT industry for soft electronics.« less
1994-01-01
Previous studies reveal that the pH of the apoplastic solution in the guard cell walls may vary between 7.2 and 5.1 in closed and open stomata, respectively. During these aperture and pH changes, massive K+ fluxes cross the cellular plasma membrane driving the osmotic turgor and volume changes of guard cells. Therefore, we examined the effect of extracellular pH on the depolarization-activated K channels (KD channels), which constitute the K+ efflux pathway, in the plasma membrane of Vicia faba guard cell protoplasts. We used patch clamp, both in whole cells as well as in excised outside-out membrane patches. Approximately 500 KD channels, at least, could be activated by depolarization in one protoplast (density: approximately 0.6 micron-2). Acidification from ph 8.1 to 4.4 decreased markedly the whole-cell conductance, GK, of the KD channels, shifted its voltage dependence, GK- EM, to the right on the voltage axis, slowed the rate of activation and increased the rate of deactivation, whereas the single channel conductance was not affected significantly. Based on the GK-EM shifts, the estimated average negative surface charge spacing near the KD channel is 39 A. To quantify the effects of protons on the rates of transitions between the hypothesized conformational states of the channels, we fitted the experimental macroscopic steady state conductance-voltage relationship and the voltage dependence of time constants of activation and deactivation, simultaneously, with a sequential three-state model CCO. In terms of this model, protonation affects the voltage-dependent properties via a decrease in localized, rather than homogeneous, surface charge sensed by the gating moieties. In terms of either the CO or CCO model, the protonation of a site with a pKa of 4.8 decreases the voltage-independent number of channels, N, that are available for activation by depolarization. PMID:8035163
A study of charged particles/radiation damage to VLSI device materials
NASA Technical Reports Server (NTRS)
Okyere, John G.
1987-01-01
Future spacecraft systems such as the manned space station will be subjected to low-dose long term radiation particles. Most electronic systems are affected by such particles. There is therefore a great need to understand device physics and failure mechanisms affected by radiation and to design circuits that would be less susceptible to radiation. Using 2 MeV electron radiation and bias temperature aging, it was found that MOS capacitors that were prepositively biased have lower flatband voltage shift and lesser increase in density of surface state charge than those that were not prepositively biased. In addition, it was shown that there is continued recovery of flatband voltage and density of state charge in irradiated capacitors during both room temperature anneal and 137 degree anneal. When nMOS transistors were subjected to 1 MeV proton radiation, charge pumping and current versus voltage measurements indicated that transconductance degradation, threshold voltage shifts and changes in interface states density may be the primary cause of nMOS transistor failure after radiation. Simulation studies using SPICE were performed on CMOS SRAM cells of various transistor sizes. It is shown that transistor sizing affects the noise margins of CMOS SRAM cells, and that as the beta ratio of the transistors of the CMOS SRAM cell decreases, the effective noise margin of the SRAM cell increases. Some suggestions were made in connection with the design of CMOS SRAMS that are hardened against single event upsets.
NASA Astrophysics Data System (ADS)
Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei
2017-03-01
The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.
NASA Astrophysics Data System (ADS)
Wang, Ruo Zheng; Wu, Sheng Li; Li, Xin Yu; Zhang, Jin Tao
2017-07-01
In this study, we set out to fabricate an amorphous indium gallium zinc oxide (a-IGZO) thin-film transistor (TFT) with SiNx/HfO2/SiNx (SHS) sandwiched dielectrics. The J-V and C-V of this SHS film were extracted by the Au/p-Si/SHS/Ti structure. At room temperature the a-IGZO with SHS dielectrics showed the following electrical properties: a threshold voltage of 2.9 V, a subthreshold slope of 0.35 V/decade, an on/off current ratio of 3.5 × 107, and a mobility of 12.8 cm2 V-1 s-1. Finally, we tested the influence of gate bias stress on the TFT, and the result showed that the threshold voltage shifted to a positive voltage when applying a positive gate voltage to the TFT.
Post, Richard F.
2016-02-23
A circuit-based technique enhances the power output of electrostatic generators employing an array of axially oriented rods or tubes or azimuthal corrugated metal surfaces for their electrodes. During generator operation, the peak voltage across the electrodes occurs at an azimuthal position that is intermediate between the position of minimum gap and maximum gap. If this position is also close to the azimuthal angle where the rate of change of capacity is a maximum, then the highest rf power output possible for a given maximum allowable voltage at the minimum gap can be attained. This rf power output is then coupled to the generator load through a coupling condenser that prevents suppression of the dc charging potential by conduction through the load. Optimized circuit values produce phase shifts in the rf output voltage that allow higher power output to occur at the same voltage limit at the minimum gap position.
Phosphatidic acid modulation of Kv channel voltage sensor function.
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-10-06
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid.
Investigation of the novel attributes in double recessed gate SiC MESFETs at drain side
NASA Astrophysics Data System (ADS)
Orouji, Ali A.; Razavi, S. M.; Ebrahim Hosseini, Seyed; Amini Moghadam, Hamid
2011-11-01
In this paper, the potential impact of drain side-double recessed gate (DS-DRG) on silicon carbide (SiC)-based metal semiconductor field effect transistors (MESFETs) is studied. We investigate the device performance focusing on breakdown voltage, threshold voltage, drain current and dc output conductance with two-dimensional and two-carrier device simulation. Our simulation results demonstrate that the channel thickness under the gate in the drain side is an important factor in the breakdown voltage. Also, the positive shift in the threshold voltage for the DS-DRG structure is larger in comparison with that for the source side-double recessed gate (SS-DRG) SiC MESFET. The saturated drain current for the DS-DRG structure is larger compared to that for the SS-DRG structure. The maximum dc output conductance in the DS-DRG structure is smaller than that in the SS-DRG structure.
Development of a digital solar simulator based on full-bridge converter
NASA Astrophysics Data System (ADS)
Liu, Chen; Feng, Jian; Liu, Zhilong; Tong, Weichao; Ji, Yibo
2014-02-01
With the development of solar photovoltaic, distribution schemes utilized in power grid had been commonly application, and photovoltaic (PV) inverter is an essential equipment in grid. In this paper, a digital solar simulator based on full-bridge structure is presented. The output characteristic curve of system is electrically similar to silicon solar cells, which can greatly simplify research methods of PV inverter, improve the efficiency of research and development. The proposed simulator consists on a main control board based on TM320F28335, phase-shifted zero-voltage-switching (ZVS) DC-DC full-bridge converter and voltage and current sampling circuit, that allows emulating the voltage-current curve with the open-circuit voltage (Voc) of 900V and the short-circuit current (Isc) of 18A .When the system connected to a PV inverter, the inverter can quickly track from the open-circuit to the maximum power point and keep stability.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lustikova, J., E-mail: lustikova@imr.tohoku.ac.jp; Shiomi, Y.; Handa, Y.
2015-02-21
We report on the deformation of microwave absorption spectra and of the inverse spin Hall voltage signals in thin film bilayers of yttrium iron garnet (YIG) and platinum at high microwave power levels in a 9.45-GHz TE{sub 011} cavity. As the microwave power increases from 0.15 to 200 mW, the resonance field shifts to higher values, and the initially Lorentzian spectra of the microwave absorption intensity as well as the inverse spin Hall voltage signals become asymmetric. The contributions from opening of the magnetization precession cone and heating of YIG cannot well reproduce the data. Control measurements of inverse spinmore » Hall voltages on thin-film YIG|Pt systems with a range of line widths underscore the role of spin-wave excitations in spectral deformation.« less
Modelling voltage sag mitigation using dynamic voltage restorer and analyzing power quality issue
NASA Astrophysics Data System (ADS)
Ismail, Nor Laili; Hidzir, Hizrin Dayana Mohd; Thanakodi, Suresh; Nazar, Nazatul Shiema Moh; Ibrahim, Pungut; Ali, Che Ku Muhammad Sabri Che Ku
2018-02-01
Power quality problem which are arise due to a fault or a pulsed load can have caused an interruption of critical load. The modern power systems are becoming more sensitive to the quality of the power supplied by the utility company. Voltage sags and swells, flicker, interruptions, harmonic distortion and other distortion to the sinusoidal waveform are the examples of the power quality problems. The most affected due to these problems is industrial customers who use a lot of sensitive equipment. There has suffered a huge loss to these problems. Resulting of broken or damage equipment if voltage sag exceeds the sensitive threshold of the equipment. Thus, device such as Static Synchronous Compensator (STATCOM) and Dynamic Voltage Restorer (DVR) has been created to solve this problem among users. DVR is a custom power device that most effective and efficient. This paper intended to report the DVR operations during voltage sag compensation.
Flow-induced voltage generation in non-ionic liquids over monolayer graphene
NASA Astrophysics Data System (ADS)
Ho Lee, Seung; Jung, Yousung; Kim, Soohyun; Han, Chang-Soo
2013-02-01
To clarify the origin of the flow-induced voltage generation in graphene, we prepared a new experimental device whose electrodes were aligned perpendicular to the flow with a non-ionic liquid. We found that significant voltage in our device was generated with increasing flow velocity, thereby confirming that voltage was due to an intrinsic interaction between graphene and the flowing liquid. To understand the mechanism of the observed flow-induced voltage generation, we systematically varied several important experimental parameters: flow velocity, electrode alignment, liquid polarity, and liquid viscosity. Based on these measurements, we suggest that polarity of the fluid is a significant factor in determining the extent of the voltage generated, and the major mechanism can be attributed to instantaneous potential differences induced in the graphene due to an interaction with polar liquids and to the momentum transferred from the flowing liquid to the graphene.
NASA Astrophysics Data System (ADS)
Sarathi, R.; Giridhar, A. V.; Sethupathi, K.
2010-01-01
Liquid nitrogen (LN 2) is used as an insulant as well as coolant in high temperature superconducting power equipments. Particle contamination in liquid nitrogen is one of the major cause for formation of partial discharges during operation. An attempt has been made in the present study to understand the feasibility of using Ultra High Frequency (UHF) sensors for identification of partial discharge (PD) formed due to particle movement in liquid nitrogen under AC voltages. It is observed that the partial discharge formed in LN 2 radiates UHF signal. The results of the study indicate that the conventional partial discharge measurement and UHF peak amplitude measurement have direct correlation. The Phase Resolved Partial Discharge (PRPD) analysis indicates that the partial discharge formed due to particle movement occurs in the entire phase windows of the AC voltage. The PD magnitude increases with increase in applied voltage. The frequency content of UHF signal generated due to particle movement in liquid nitrogen under AC voltages lies in the range of 0.5-1.5 GHz. The UHF sensor output signal analyzed using spectrum analyzer by operating it in zero-span mode, indicates that burst type PD occurs due to particle movement.
Advanced p-MOSFET Ionizing-Radiation Dosimeter
NASA Technical Reports Server (NTRS)
Buehler, Martin G.; Blaes, Brent R.
1994-01-01
Circuit measures total dose of ionizing radiation in terms of shift in threshold gate voltage of doped-channel metal oxide/semiconductor field-effect transistor (p-MOSFET). Drain current set at temperature-independent point to increase accuracy in determination of radiation dose.
NASA Astrophysics Data System (ADS)
Amrani, Aumeur El; Es-saghiri, Abdeljabbar; Boufounas, El-Mahjoub; Lucas, Bruno
2018-06-01
The performance of a pentacene based organic thin film transistor (OTFT) with polymethylmethacrylate as a dielectric insulator and indium tin oxide based electrical gate is investigated. On the one hand, we showed that the threshold voltage increases with gate voltage, and on the other hand that it decreases with drain voltage. Thus, we noticed that the onset voltage shifts toward positive voltage values with the drain voltage increase. In addition, threshold-onset differential voltage (TODV) is proposed as an original approach to estimate an averaged carrier density in pentacene. Indeed, a value of about 4.5 × 1016 cm-3 is reached at relatively high gate voltage of -50 V; this value is in good agreement with that reported in literature with other technique measurements. However, at a low applied gate voltage, the averaged pentacene carrier density remains two orders of magnitude lower; it is of about 2.8 × 1014 cm-3 and remains similar to that obtained from space charge limited current approach for low applied bias voltage of about 2.2 × 1014 cm-3. Furthermore, high IOn/IOff and IOn/IOnset current ratios of 5 × 106 and 7.5 × 107 are reported for lower drain voltage, respectively. The investigated OTFTs also showed good electrical performance including carrier mobility increasing with gate voltage; mobility values of 4.5 × 10-2 cm2 V-1 s-1 and of 4.25 × 10-2 cm2 V-1 s-1 are reached for linear and saturation regimes, respectively. These results remain enough interesting since current modulation ratio exceeds a value of 107 that is a quite important requirement than high mobility for some particular logic gate applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Bingjun; Soderlund, David M., E-mail: dms6@cornell.edu
We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased inmore » the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin shifted channel gating to hyperpolarized potentials. • The β1 subunit had opposite effects on the actions of tefluthrin and deltamethrin. • Auxiliary subunits are required for full reconstitution of channel function. • Channels in HEK293 cells exhibit properties similar to channels in neurons.« less
Analog circuit for controlling acoustic transducer arrays
Drumheller, Douglas S.
1991-01-01
A simplified ananlog circuit is presented for controlling electromechanical transducer pairs in an acoustic telemetry system. The analog circuit of this invention comprises a single electrical resistor which replaces all of the digital components in a known digital circuit. In accordance with this invention, a first transducer in a transducer pair of array is driven in series with the resistor. The voltage drop across this resistor is then amplified and used to drive the second transducer. The voltage drop across the resistor is proportional and in phase with the current to the transducer. This current is approximately 90 degrees out of phase with the driving voltage to the transducer. This phase shift replaces the digital delay required by the digital control circuit of the prior art.
An inductor-based converter with EMI reduction for low-voltage thermoelectric energy harvesting
NASA Astrophysics Data System (ADS)
Wang, Chuang; Zhao, Kai; Li, Zunchao
2017-07-01
This paper presents a self-powered inductor-based converter which harvests thermoelectric energy and boosts extremely low voltage to a typical voltage level for supplying body sensor nodes. Electromagnetic interference (EMI) of the converter is reduced by spreading spectrum of fundamental frequency and harmonics via pseudo-random modulation, which is obtained via combining the linear feedback shift register and digitally controlled oscillator. Besides, the methods, namely extracting energy near MPP and reducing the power dissipation, are employed to improve the power efficiency. The presented inductor-based converter is designed and verified in CSMC CMOS 0.18-µm 1P6M process. The results reveal that it achieves the high efficiency and EMI reduction at the same time.
Transport Signatures of Quasiparticle Poisoning in a Majorana Island.
Albrecht, S M; Hansen, E B; Higginbotham, A P; Kuemmeth, F; Jespersen, T S; Nygård, J; Krogstrup, P; Danon, J; Flensberg, K; Marcus, C M
2017-03-31
We investigate effects of quasiparticle poisoning in a Majorana island with strong tunnel coupling to normal-metal leads. In addition to the main Coulomb blockade diamonds, "shadow" diamonds appear, shifted by 1e in gate voltage, consistent with transport through an excited (poisoned) state of the island. Comparison to a simple model yields an estimate of parity lifetime for the strongly coupled island (∼1 μs) and sets a bound for a weakly coupled island (>10 μs). Fluctuations in the gate-voltage spacing of Coulomb peaks at high field, reflecting Majorana hybridization, are enhanced by the reduced lever arm at strong coupling. When converted from gate voltage to energy units, fluctuations are consistent with previous measurements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Junfeng; Institute of Materials Science, Darmstadt University of Technology, Petersenstr. 23, 64287 Darmstadt; Liao, Cheng, E-mail: Cliao@pku.edu.cn
2011-02-15
Graphical abstract: From XPS core level spectras, compared with as-depositing CdS (sample A), the Fermi level is shifting closer to the conduction band after annealing treatment in the oxygen (sample B) while it is shifting closer to the valence band after annealing treatment in the argon-hydrogen (sample C). That might be the main reason of the different performance of the final devices. The open circuit voltage of the CdS/CdTe solar cell increases when the CBD CdS is annealed with oxygen, while the performance of the solar cell decreases when the CBD CdS is annealed with argon-hydrogen. Research highlights: {yields} Twomore » different methods (oxidation and reduction) were used to anneal CdS films for CdTe solar cells. {yields} Electrical properties were analyzed by XPS (Fermi levels of CdS films). {yields} Annealing treatment in oxidation atmosphere could shift Fermi level of CdS film to higher position and consequently improve the CdS/CdTe junction and performance of solar cells. -- Abstract: CdS layers grown by chemical bath deposition (CBD) are annealed in the oxygen and argon-hydrogen atmosphere respectively. It has been found that the open circuit voltage of the CdS/CdTe solar cell increases when the CBD CdS is annealed with oxygen before the deposition of CdTe by close spaced sublimation (CSS), while the performance of the solar cell decreases when the CBD CdS is annealed with argon-hydrogen. Electronic properties of the CdS films are investigated using X-ray photo-electron spectroscopy (XPS), which indicates that the Fermi level is shifting closer to the conduction band after annealing in the oxygen and consequently a higher open circuit voltage of the solar cell can be obtained.« less
NASA Technical Reports Server (NTRS)
Thaller, Lawrence H.; Quinzio, Michael V.
1997-01-01
The investigation of an aberrant cell voltage during the filling of a large lithium thionyl chloride cell summary is at: an aberrant voltage trace was noted during the review of cell filling data; incident was traced to an interruption during filling; experimentation suggested oxidizable sites within the carbon electrode were responsible for the drop in voltage; the voltage anomaly could be reproduced by interrupting the filling of similar cells; and anomalous voltage dip was not due to a short.
NASA Astrophysics Data System (ADS)
Kwon, Dae Woong; Kim, Jang Hyun; Chang, Ji Soo; Kim, Sang Wan; Sun, Min-Chul; Kim, Garam; Kim, Hyun Woo; Park, Jae Chul; Song, Ihun; Kim, Chang Jung; Jung, U. In; Park, Byung-Gook
2010-11-01
A comprehensive study is done regarding stabilities under simultaneous stress of light and dc-bias in amorphous hafnium-indium-zinc-oxide thin film transistors. The positive threshold voltage (Vth) shift is observed after negative gate bias and light stress, and it is completely different from widely accepted phenomenon which explains that negative-bias stress results in Vth shift in the left direction by bias-induced hole-trapping. Gate current measurement is performed to explain the unusual positive Vth shift under simultaneous application of light and negative gate bias. As a result, it is clearly found that the positive Vth shift is derived from electron injection from gate electrode to gate insulator.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mori, Daichi; Kawai, Kentaro; Morita, Mizuho
2016-09-07
The energy difference between the oxide and bulk peaks in X-ray photoelectron spectroscopy (XPS) spectra was investigated for both GeO{sub 2}/Ge and SiO{sub 2}/Si structures with thickness-controlled water films. This was achieved by obtaining XPS spectra at various values of relative humidity (RH) of up to ∼15%. The increase in the energy shift is more significant for thermal GeO{sub 2} on Ge than for thermal SiO{sub 2} on Si above ∼10{sup −4}% RH, which is due to the larger amount of water molecules that infiltrate into the GeO{sub 2} film to form hydroxyls. Analyzing the origins of this energy shift,more » we propose that the positive charging of a partially hydroxylated GeO{sub 2} film, which is unrelated to X-ray irradiation, causes the larger energy shift for GeO{sub 2}/Ge than for SiO{sub 2}/Si. A possible microscopic mechanism of this intrinsic positive charging is the emission of electrons from adsorbed water species in the suboxide layer of the GeO{sub 2} film to the Ge bulk, leaving immobile cations or positively charged states in the oxide. This may be related to the reported negative shift of flat band voltages in metal-oxide-semiconductor diodes with an air-exposed GeO{sub 2} layer.« less
Ion track etching revisited: II. Electronic properties of aged tracks in polymers
NASA Astrophysics Data System (ADS)
Fink, D.; Muñoz Hernández, G.; Cruz, S. A.; Garcia-Arellano, H.; Vacik, J.; Hnatowicz, V.; Kiv, A.; Alfonta, L.
2018-02-01
We compile here electronic ion track etching effects, such as capacitive-type currents, current spike emission, phase shift, rectification and background currents that eventually emerge upon application of sinusoidal alternating voltages across thin, aged swift heavy ion-irradiated polymer foils during etching. Both capacitive-type currents and current spike emission occur as long as obstacles still prevent a smooth continuous charge carrier passage across the foils. In the case of sufficiently high applied electric fields, these obstacles are overcome by spike emission. These effects vanish upon etchant breakthrough. Subsequent transmitted currents are usually of Ohmic type, but shortly after breakthrough (during the track' core etching) often still exhibit deviations such as strong positive phase shifts. They stem from very slow charge carrier mobility across the etched ion tracks due to retarding trapping/detrapping processes. Upon etching the track's penumbra, one occasionally observes a split-up into two transmitted current components, one with positive and another one with negative phase shifts. Usually, these phase shifts vanish when bulk etching starts. Current rectification upon track etching is a very frequent phenomenon. Rectification uses to inverse when core etching ends and penumbra etching begins. When the latter ends, rectification largely vanishes. Occasionally, some residual rectification remains which we attribute to the aged polymeric bulk itself. Last not least, we still consider background currents which often emerge transiently during track etching. We could assign them clearly to differences in the electrochemical potential of the liquids on both sides of the etched polymer foils. Transient relaxation effects during the track etching cause their eventually chaotic behaviour.
A Microwave Tunable Bandpass Filter for Liquid Crystal Applications
NASA Astrophysics Data System (ADS)
Cao, Weiping; Jiang, Di; Liu, Yupeng; Yang, Yuanwang; Gan, Baichuan
2017-07-01
In this paper, a novel microwave continuously tunable band-pass filter, based on nematic liquid crystals (LCs), is proposed. It uses liquid crystal (LC) as the electro-optic material to mainly realize frequency shift at microwave band by changing the dielectric anisotropy, when applying the bias voltage. According to simulation results, it achieves 840 MHz offset. Comparing to the existing tunable filter, it has many advantages, such as continuously tunable, miniaturization, low processing costs, low tuning voltage, etc. Thus, it has shown great potentials in frequency domain and practical applications in modern communication.
2009-12-22
b) From top to bottom, (i) AFM topograph of the p-i-n SiNW, (ii) plot of EFM phase-shift vs . position recorded along the nanowire axis and (iii...c) Current vs . applied voltage curve for a typical SiNW p-i-n junction at room temperature. (d) Current vs . applied reverse voltage data of a p-i...incident laser power. Iph vs . laser power (Figure 3c) measured at 22, 20 and 18 V show linear dependences with slopes of 1.16, 0.94 and 0.72 nA/μW
Ibrahim, Yehia M.; Smith, Richard D.
2016-01-26
An ion trap device is disclosed. The device includes a series of electrodes that define an ion flow path. A radio frequency (RF) field is applied to the series of electrodes such that each electrode is phase shifted approximately 180 degrees from an adjacent electrode. A DC voltage is superimposed with the RF field to create a DC gradient to drive ions in the direction of the gradient. A second RF field or DC voltage is applied to selectively trap and release the ions from the device. Further, the device may be gridless and utilized at high pressure.
Effect of Photogenerated Carriers on Ferroelectric Polarization Reversal
NASA Astrophysics Data System (ADS)
Weis, Martin; Li, Jun; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2011-12-01
Three non-symmetric switching peaks were observed in current-voltage (J-V) characteristic of the pentacene/poly(vinylidene fluoride-trifluoroethylene) double-layer device. However, upon illumination only two symmetric switching peaks appeared during the same J-V measurement. The similar difference between dark and illumination were also obtained in capacitance-voltage characteristics. These results showed the strong influence of internal fields by photogenerated carriers, which modifies the polarization reversal process of ferroelectric layer. The gradual shift of the polarization reversal with increase of illumination intensity is assigned to the space-charge field of trapped electrons.
An alternating voltage battery with two salt-water oscillators
NASA Astrophysics Data System (ADS)
Cervellati, Rinaldo; Soldà, Roberto
2001-05-01
We built a simple alternating voltage battery that periodically reverses value and sign of its electromotive force (emf). This battery consists of two coupled concentration salt-water oscillators that are phase shifted by initially extracting some drops of salt solution from one of the two oscillators. Although the actual frequency (period: ˜30 s) and emf (˜±55 mV) is low, our battery is suitable to demonstrate a practical application of oscillating systems in the physical, chemical, or biological laboratory for undergraduates. Interpretation of the phenomenon is given.
NASA Astrophysics Data System (ADS)
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Microwave differential dilatometer measures 10 - 12 m, at 1 Hz
NASA Astrophysics Data System (ADS)
Aschero, G.; Mango, F.; Gizdulich, P.
1996-12-01
To check and measure the converse piezoelectric effect in bone samples, we had to detect displacements in the range of 1-100 pm with three kinds of restrictions: (1) the biological nature of the samples imposes severe limits in selecting a suitable device and method; (2) such a method has to take into account some clinical applications to which the experiment is devoted; (3) the piezoelectric behavior of bone samples is particularly interesting at low frequencies, around 1 Hz. For such reasons we modified an existing dilatometer based on a microwave differential spectrometer. A 14 GHz klystron, linearly modulated in frequency by a triangular 50 Hz voltage applied to the repeller, is connected, via magic T, to two identical cavities tunable around 14 GHz and whose resonance curves are recorded by crystal detectors. When one of the two cavities changes its height according to the length variations of the sample, its resonance frequency varies resulting in a shift of the resonant curve with respect to the resonance curve of the other cavity acting as reference. The comparison between the cavities' responses is performed by a pulse technique transforming the frequency shifts into time intervals, that are then converted into dc voltages. The differential character of this measurement avoids the need for the microwave source stabilization. The relative shift in frequency is measured with an accuracy better than 500 Hz. This accuracy allows us to measure displacements smaller than 7 nm in the cavity's height. After 2 h of warmup, thanks to the differential arrangement of the system, thermal or other drifts are not detectable within a lapse of time of 12 h. This feature allows coherent signal averaging over long periods. With a piezoelectric ceramic stack moving 100 pm in square wave fashion at 50 mHz we found that the signal to noise ratio was 20 dB after 1000 cycles of signal averaging, when our bandpass filter was tuned at 1 Hz. In conclusion, this system can detect periodic displacements as small as 1 pm in a short time and reliably. Due to the operational simplicity and stability, at room temperature and humidity, the device is suitable for dilatometric measurements on biological samples.
Wang, Huiliang; Wei, Peng; Li, Yaoxuan; Han, Jeff; Lee, Hye Ryoung; Naab, Benjamin D.; Liu, Nan; Wang, Chenggong; Adijanto, Eric; Tee, Benjamin C.-K.; Morishita, Satoshi; Li, Qiaochu; Gao, Yongli; Cui, Yi; Bao, Zhenan
2014-01-01
Tuning the threshold voltage of a transistor is crucial for realizing robust digital circuits. For silicon transistors, the threshold voltage can be accurately controlled by doping. However, it remains challenging to tune the threshold voltage of single-wall nanotube (SWNT) thin-film transistors. Here, we report a facile method to controllably n-dope SWNTs using 1H-benzoimidazole derivatives processed via either solution coating or vacuum deposition. The threshold voltages of our polythiophene-sorted SWNT thin-film transistors can be tuned accurately and continuously over a wide range. Photoelectron spectroscopy measurements confirmed that the SWNT Fermi level shifted to the conduction band edge with increasing doping concentration. Using this doping approach, we proceeded to fabricate SWNT complementary inverters by inkjet printing of the dopants. We observed an unprecedented noise margin of 28 V at VDD = 80 V (70% of 1/2VDD) and a gain of 85. Additionally, robust SWNT complementary metal−oxide−semiconductor inverter (noise margin 72% of 1/2VDD) and logic gates with rail-to-rail output voltage swing and subnanowatt power consumption were fabricated onto a highly flexible substrate. PMID:24639537
Sodium channel dysfunction in intractable childhood epilepsy with generalized tonic–clonic seizures
Rhodes, Thomas H; Vanoye, Carlos G; Ohmori, Iori; Ogiwara, Ikuo; Yamakawa, Kazuhiro; George, Alfred L
2005-01-01
Mutations in SCN1A, the gene encoding the brain voltage-gated sodium channel α1 subunit (NaV1.1), are associated with genetic forms of epilepsy, including generalized epilepsy with febrile seizures plus (GEFS+ type 2), severe myoclonic epilepsy of infancy (SMEI) and related conditions. Several missense SCN1A mutations have been identified in probands affected by the syndrome of intractable childhood epilepsy with generalized tonic–clonic seizures (ICEGTC), which bears similarity to SMEI. To test whether ICEGTC arises from molecular mechanisms similar to those involved in SMEI, we characterized eight ICEGTC missense mutations by whole-cell patch clamp recording of recombinant human SCN1A heterologously expressed in cultured mammalian cells. Two mutations (G979R and T1709I) were non-functional. The remaining alleles (T808S, V983A, N1011I, V1611F, P1632S and F1808L) exhibited measurable sodium current, but had heterogeneous biophysical phenotypes. Mutant channels exhibited lower (V983A, N1011I and F1808L), greater (T808S) or similar (V1611F and P1632S) peak sodium current densities compared with wild-type (WT) SCN1A. Three mutations (V1611F, P1632S and F1808L) displayed hyperpolarized conductance–voltage relationships, while V983A exhibited a strong depolarizing shift in the voltage dependence of activation. All mutants except T808S had hyperpolarized shifts in the voltage dependence of steady-state channel availability. Three mutants (V1611F, P1632S and F1808L) exhibited persistent sodium current ranging from ∼1–3% of peak current amplitude that was significantly greater than WT-SCN1A. Several mutants had impaired slow inactivation, with V983A showing the most prominent effect. Finally, all of the functional alleles exhibited reduced use-dependent channel inhibition. In summary, SCN1A mutations associated with ICEGTC result in a wide spectrum of biophysical defects, including mild-to-moderate gating impairments, shifted voltage dependence and reduced use dependence. The constellation of biophysical abnormalities for some mutants is distinct from those previously observed for GEFS+ and SMEI, suggesting possible, but complex, genotype–phenotype correlations. PMID:16210358
Liu, Guoxia; Zakharov, Sergey I.; Yao, Yongneng
2015-01-01
The large-conductance, voltage- and Ca2+-gated K+ (BK) channel consists of four α subunits, which form a voltage- and Ca2+-gated channel, and up to four modulatory β subunits. The β1 subunit is expressed in smooth muscle, where it slows BK channel kinetics and shifts the conductance–voltage (G-V) curve to the left at [Ca2+] > 2 µM. In addition to the six transmembrane (TM) helices, S1–S6, conserved in all voltage-dependent K+ channels, BK α has a unique seventh TM helix, S0, which may contribute to the unusual rightward shift in the G-V curve of BK α in the absence of β1 and to a leftward shift in its presence. Such a role is supported by the close proximity of S0 to S3 and S4 in the voltage-sensing domain. Furthermore, on the extracellular side of the membrane, one of the two TM helices of β1, TM2, is adjacent to S0. We have now analyzed induced disulfide bond formation between substituted Cys residues on the cytoplasmic side of the membrane. There, in contrast, S0 is closest to the S2–S3 loop, from which position it is displaced on the addition of β1. The cytoplasmic ends of β1 TM1 and TM2 are adjacent and are located between the S2–S3 loop of one α subunit and S1 of a neighboring α subunit and are not adjacent to S0; i.e., S0 and TM2 have different trajectories through the membrane. In the absence of β1, 70% of disulfide bonding of W43C (S0) and L175C (S2–S3) has no effect on V50 for activation, implying that the cytoplasmic end of S0 and the S2–S3 loop move in concert, if at all, during activation. Otherwise, linking them together in one state would obstruct the transition to the other state, which would certainly change V50. PMID:25667410
Ionic currents in the guinea-pig taenia coli.
Inomata, H; Kao, C Y
1976-01-01
Short segments of portions of taenia coli of the guinea-pig averaging 54 mum X 219 mum X ca. 200 mum have been studied by a double sucrose-gap voltage-clamp technique. 2. The average total capacitance was 0-4 muF, corresponding to approximately 10(4) cells, if a specific membrane capacitance of 3 muF/cm2 were assumed. 3. A significant resistance, averaging 11-4omega, was in series with the membrane, and seriously limited the accuracy of the voltage control possible. 4. On depolarization, an early transient inward current was followed by a late maintained outwary current. 5. The late current was carried mainly by K+, because its direction could be reversed if the preparation were first depolarized in isotonic K2SO4 and held back to the original resting potential. 6. After appropriate corrections for residual capacitative and leakage currents, a reversal potential for the late current (Eb) was determined to be 15-20 mV more negative than the natural resting potential. It was not affected by the amplitude or the duration of the activating voltage step, but could be changed by prolonged applications of holding current. 7. At rest, the ratio of PNa:PK was 0-16:1; for Eb it was 0-05:1. 8. The reversal potential for the transient early inward current (Ea) averaged 22 mV in Krebs-bicarbonate solution, but was shifted to about 35 mV when the late current was first suppressed with tetraethylammonium ion. The shift suggested that there was some overlap of the early and late currents. 9. Reduction of [Na+]o to 50% of normal, or replacement of all Na+ with dimethyldiethanol ammonium ion and choline ion, failed to cause any significant shifts in the reversal potential of the early current or reduce the magnitude of the early current. 10. Reduction of [Ca2+]o to 0-25 or 0-1 of the normal caused shifts of the Ea toward the negative and reductions in the early current. These changes can occur without changes in the maximum chord conductance of the early current, such as might happen in ordinary Krebs-bicarbonate solution, or in preparations which had been depolarized by prior treatment with isotonic K2SO4 and then held back to the original membrane voltage. 11. Increase of [Ca2+]o to 5 times normal increased the early inward current, and the maximum chord conductances of the early and late currents, but did not shift the Ea. 12. In preparations pretreated with TEA, increasing [Ca2+]o to 5 times normal shifted Ea toward 45 mV. 13. The various observations are interpreted to mean that the early current in the taenia coli is carried principally by influx of Ca2+, and not by Na+. PMID:1255524
Voltage Dependence of a Neuromodulator-Activated Ionic Current.
Gray, Michael; Golowasch, Jorge
2016-01-01
The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca(2+), but that, in conditions of low Ca(2+), calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca(2+)/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Shin, Hyewon; Song, Jin-Ho
2014-09-05
Microglial dysfunction and neuroinflammation are thought to contribute to the pathogenesis of schizophrenia. Some antipsychotic drugs have anti-inflammatory activity and can reduce the secretion of pro-inflammatory cytokines and reactive oxygen species from activated microglial cells. Voltage-gated proton channels on the microglial cells participate in the generation of reactive oxygen species and neuronal toxicity by supporting NADPH oxidase activity. In the present study, we examined the effects of two typical antipsychotics, chlorpromazine and haloperidol, on proton currents in microglial BV2 cells using the whole-cell patch clamp method. Chlorpromazine and haloperidol potently inhibited proton currents with IC50 values of 2.2 μM and 8.4 μM, respectively. Chlorpromazine and haloperidol are weak bases that can increase the intracellular pH, whereby they reduce the proton gradient and affect channel gating. Although the drugs caused a marginal positive shift of the activation voltage, they did not change the reversal potential. This suggested that proton current inhibition was not due to an alteration of the intracellular pH. Chlorpromazine and haloperidol are strong blockers of dopamine receptors. While dopamine itself did not affect proton currents, it also did not alter proton current inhibition by the two antipsychotics, indicating dopamine receptors are not likely to mediate the proton current inhibition. Given that proton channels are important for the production of reactive oxygen species and possibly pro-inflammatory cytokines, the anti-inflammatory and antipsychotic activities of chlorpromazine and haloperidol may be partly derived from their ability to inhibit microglial proton currents. Copyright © 2014 Elsevier B.V. All rights reserved.
Advanced Materials for High Temperature, High Performance, Wide Bandgap Power Modules
NASA Astrophysics Data System (ADS)
O'Neal, Chad B.; McGee, Brad; McPherson, Brice; Stabach, Jennifer; Lollar, Richard; Liederbach, Ross; Passmore, Brandon
2016-01-01
Advanced packaging materials must be utilized to take full advantage of the benefits of the superior electrical and thermal properties of wide bandgap power devices in the development of next generation power electronics systems. In this manuscript, the use of advanced materials for key packaging processes and components in multi-chip power modules will be discussed. For example, to date, there has been significant development in silver sintering paste as a high temperature die attach material replacement for conventional solder-based attach due to the improved thermal and mechanical characteristics as well as lower processing temperatures. In order to evaluate the bond quality and performance of this material, shear strength, thermal characteristics, and void quality for a number of silver sintering paste materials were analyzed as a die attach alternative to solder. In addition, as high voltage wide bandgap devices shift from engineering samples to commercial components, passivation materials become key in preventing premature breakdown in power modules. High temperature, high dielectric strength potting materials were investigated to be used to encapsulate and passivate components internal to a power module. The breakdown voltage up to 30 kV and corresponding leakage current for these materials as a function of temperature is also presented. Lastly, high temperature plastic housing materials are important for not only discrete devices but also for power modules. As the operational temperature of the device and/or ambient temperature increases, the mechanical strength and dielectric properties are dramatically reduced. Therefore, the electrical characteristics such as breakdown voltage and leakage current as a function of temperature for housing materials are presented.
Origin of the transition voltage in gold-vacuum-gold atomic junctions.
Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin
2013-01-18
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments.
A 6 kV arbitrary waveform generator for the Tevatron Electron Lens
Pfeffer, H.; Saewert, G.
2011-11-09
This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less
NASA Astrophysics Data System (ADS)
Hosoi, Takuji; Kutsuki, Katsuhiro; Okamoto, Gaku; Saito, Marina; Shimura, Takayoshi; Watanabe, Heiji
2009-05-01
Improvement in electrical properties of thermally grown GeO2/Ge metal-oxide-semiconductor (MOS) capacitors, such as significantly reduced flatband voltage (VFB) shift, small hysteresis, and minimized minority carrier response in capacitance-voltage (C-V) characteristics, has been demonstrated by in situ low temperature vacuum annealing prior to gate electrode deposition. Thermal desorption analysis has revealed that not only water but also hydrocarbons are easily infiltrated into GeO2 layers during air exposure and desorbed at around 300 °C, indicating that organic molecules within GeO2/Ge MOS structures are possible origins of electrical defects. The inversion capacitance, indicative of minority carrier generation, increases with air exposure time for Au/GeO2/Ge MOS capacitors, while maintaining an interface state density (Dit) of about a few 1011 cm-2 eV-1. Unusual increase in inversion capacitance was found to be suppressed by Al2O3 capping (Au/Al2O3/GeO2/Ge structures). This suggests that electrical defects induced outside the Au electrode by infiltrated molecules may enhance the minority carrier generation, and thus acting as a minority carrier source just like MOS field-effect transistors.
Yuan, Huijun; Lan, Tonghan; Lin, Jiarui
2005-01-01
Nano-Selenium, a novel Nano technology production, was demonstrated to be useful in medical and scientific researches. Here, we investigated the effects of Nano-Selenium on tetrodotoxin-sensitive (TTX-S) voltage-dependent Na+channels in isolated rat dorsal root ganglion neurons, using whole-cell patch-clamp method. Nano-Selenium irreversibly decreased TTX-S Na+current (I
Clock jitter generator with picoseconds resolution
NASA Astrophysics Data System (ADS)
Jovanović, Goran; Stojčev, Mile; Nikolić, Tatjana
2013-06-01
The clock is one of the most critical signals in any synchronous system. As CMOS technology has scaled, supply voltages have dropped chip power consumption has increased and the effects of jitter due to clock frequency increase have become critical and jitter budget has become tighter. This article describes design and development of low-cost mixed-signal programmable jitter generator with high resolution. The digital technique is used for coarse-grain and an analogue technique for fine-grain clock phase shifting. Its structure allows injection of various random and deterministic jitter components in a controllable and programmable fashion. Each jitter component can be switched on or off. The jitter generator can be used in jitter tolerance test and jitter transfer function measurement of high-speed synchronous digital circuits. At operating system clock frequency of 220 MHz, a jitter with 4 ps resolution can be injected.
Two-Dimensional Quantum Model of a Nanotransistor
NASA Technical Reports Server (NTRS)
Govindan, T. R.; Biegel, B.; Svizhenko, A.; Anantram, M. P.
2009-01-01
A mathematical model, and software to implement the model, have been devised to enable numerical simulation of the transport of electric charge in, and the resulting electrical performance characteristics of, a nanotransistor [in particular, a metal oxide/semiconductor field-effect transistor (MOSFET) having a channel length of the order of tens of nanometers] in which the overall device geometry, including the doping profiles and the injection of charge from the source, gate, and drain contacts, are approximated as being two-dimensional. The model and software constitute a computational framework for quantitatively exploring such device-physics issues as those of source-drain and gate leakage currents, drain-induced barrier lowering, and threshold voltage shift due to quantization. The model and software can also be used as means of studying the accuracy of quantum corrections to other semiclassical models.
Oniki, Yusuke; Koumo, Hideo; Iwazaki, Yoshitaka; Ueno, Tomo
2010-06-15
The relation between germanium monoxide (GeO) desorption and either improvement or deterioration in electrical characteristics of metalGeO(2)Ge capacitors fabricated by thermal oxidation has been investigated. In the metalGeO(2)Ge stack, two processes of GeO desorption at different sites and at different temperatures were observed by thermal desorption spectroscopy measurements. The electrical characteristics of as-oxidized metalGeO(2)Ge capacitors shows a large flat-band voltage shift and minority carrier generation due to the GeO desorption from the GeO(2)Ge interface during oxidation of Ge substrates. On the other hand, the electrical properties were drastically improved by a postmetallization annealing at low temperature resulting in a metal catalyzed GeO desorption from the top interface.
Microsecond-range optical shutter for unpolarized light with chiral nematic liquid crystal
NASA Astrophysics Data System (ADS)
Mohammadimasoudi, Mohammad; Shin, Jungsoon; Lee, Keechang; Neyts, Kristiaan; Beeckman, Jeroen
2015-04-01
A fast electro-optic shutter is fabricated and demonstrated. The device works independently of the polarization state of the incoming light beam. Modulation between 3% transmission and 60% transmission is obtained within a wavelength range of 50 nm with a response time of 20 μs. The device consists of two partly polymerized chiral nematic liquid crystal layers separated by a half wave plate. The transmission modulation is due to a 50 nm wavelength shift of the photonic band gap of the chiral liquid crystal realized by applying an electric field over a mixture of photo-polymerized LC and non-reactive nematic LC containing a chiral dopant. The shutter features high reflectivity in the photonic band gap. We investigate the influence of the amplitude of the applied voltage on the width and the depth of the reflection band.
NASA Astrophysics Data System (ADS)
Chien, Feng-Tso; Chen, Jian-Liang; Chen, Chien-Ming; Chen, Chii-Wen; Cheng, Ching-Hwa; Chiu, Hsien-Chin
2017-11-01
In this paper, a novel step gate-overlapped lightly doped drain (GOLDD) with raised source/drain (RSD) structure (SGORSD) is proposed for TFT electronic device application. The new SGORSD structure could obtain a low electric field at channel near the drain side owing to a step GOLDD design. Compared to the conventional device, the SGORSD TFT exhibits a better kink effect and higher breakdown performance due to the reduced drain electric field (D-EF). In addition, the leakage current also can be suppressed. Moreover, the device stability, such as the threshold voltage shift and drain current degradation under a high gate bias, is improved by the design of SGORSD structure. Therefore, this novel step GOLDD structure can be a promising design to be used in active-matrix flat panel electronics.
Combine Flash-Based FPGA TID and Long-Term Retention Reliabilities Through VT Shift
NASA Astrophysics Data System (ADS)
Wang, Jih-Jong; Rezzak, Nadia; Dsilva, Durwyn; Xue, Fengliang; Samiee, Salim; Singaraju, Pavan; Jia, James; Nguyen, Victor; Hawley, Frank; Hamdy, Esmat
2016-08-01
Reliability test results of data retention and total ionizing dose (TID) in 65 nm Flash-based field programmable gate array (FPGA) are presented. Long-chain inverter design is recommended for reliability evaluation because it is the worst case design for both effects. Based on preliminary test data, both issues are unified and modeled by one natural decay equation. The relative contributions of TID induced threshold-voltage shift and retention mechanisms are evaluated by analyzing test data.
Electro-optic voltage sensor for sensing voltage in an E-field
Davidson, James R.; Crawford, Thomas M.; Seifert, Gary D.
2002-03-26
A miniature electro-optic voltage sensor and system capable of accurate operation at high voltages has a sensor body disposed in an E-field. The body receives a source beam of electromagnetic radiation. A polarization beam displacer separates the source light beam into two beams with orthogonal linear polarizations. A wave plate rotates the linear polarization to rotated polarization. A transducer utilizes Pockels electro-optic effect and induces a differential phase shift on the major and minor axes of the rotated polarization in response to the E-field. A prism redirects the beam back through the transducer, wave plate, and polarization beam displacer. The prism also converts the rotated polarization to circular or elliptical polarization. The wave plate rotates the major and minor axes of the circular or elliptical polarization to linear polarization. The polarization beam displacer separates the beam into two beams of orthogonal linear polarization representing the major and minor axes. The system may have a transmitter for producing the beam of electro-magnetic radiation; a detector for converting the two beams into electrical signals; and a signal processor for determining the voltage.
Design and construction of a home-made and cheaper argon arc lamp
NASA Astrophysics Data System (ADS)
Sabaeian, Mohammad; Nazari-Tarkarani, Zeinab; Ebrahimzadeh, Azadeh
2018-05-01
The authors report on the design and construction of an argon arc lamp which provides noticeably a cheaper instrument for laser and medical applications. Cesium-doped tungsten and pure tungsten rods were used, respectively, for the lamp cathode and anode. To seal the glassy tube, a 50-50 Fe-Ni alloy was successfully used as a medium to attach the tungsten electrodes to the borosilicate glass tube. Starting voltage of the lamp versus the gas pressure, operation voltage-current diagram at various gas pressures, and lamp spectrum in the various pressures were measured. A comparison was made with krypton arc lamp. The lamp operation was satisfactory without any crack or fracture during lightening operation. The results showed that the lamp-lightening threshold voltage depends linearly on the pressure and arc length in such a way that there is an increase in the voltage by raising these two parameters. We have also observed that by increasing the argon pressure, there is a shifting in emission spectrum from the ultraviolet to the visible region. Comparison with krypton arc lamp indicated that argon lamp needs a higher threshold lightening voltage.
Meshik, Xenia; Choi, Min; Baker, Adam; Malchow, R Paul; Covnot, Leigha; Doan, Samuel; Mukherjee, Souvik; Farid, Sidra; Dutta, Mitra; Stroscio, Michael A
2017-04-01
This study examines the ability of optically-excited titanium dioxide nanoparticles to influence voltage-gated ion channels in retinal horizontal cells. Voltage clamp recordings were obtained in the presence and absence of TiO 2 and ultraviolet laser excitation. Significant current changes were observed in response to UV light, particularly in the -40 mV to +40 mV region where voltage-gated Na + and K + channels have the highest conductance. Cells in proximity to UV-excited TiO 2 exhibited a left-shift in the current-voltage relation of around 10 mV in the activation of Na + currents. These trends were not observed in control experiments where cells were excited with UV light without being exposed to TiO 2 . Electrostatic force microscopy confirmed that electric fields can be induced in TiO 2 with UV light. Simulations using the Hodgkin-Huxley model yielded results which agreed with the experimental data and showed the I-V characteristics of individual ion channels in the presence of UV-excited TiO 2 . Copyright © 2016 Elsevier Inc. All rights reserved.
Action of certain tropine esters on voltage-clamped lobster axon.
Blaustein, M P
1968-03-01
Tropine p-tolylacetate (TPTA) and its quaternary analogue, tropine p-tolylacetate methiodide (TPTA MeI) decrease the early transient (Na) and late (K) currents in the voltage-clamped lobster giant axon. These agents, which block the nerve action potential, reduce the maximum Na and K conductance increases associated with membrane depolarization. They also slow the rate at which the sodium conductance is increased and shift the (normalized) membrane conductance vs. voltage curves in the direction of depolarization along the voltage axis. All these effects are qualitatively similar to those resulting from the action of procaine on the voltage-clamped axon. One unusual effect of the tropine esters, noticeable particularly at large depolarization steps, is that they cause the late, K current to reach a peak and then fall off with increasing pulse duration. This effect has not been reported to occur as a result of procaine action. Tropine p-chlorophenyl acetate (TPClphiA), which differs from TPTA only by the substitution of a p-Cl for a p-CH(3) group on the benzene ring, had a negligible effect on axonal excitability.
Action of Certain Tropine Esters on Voltage-Clamped Lobster Axon
Blaustein, M. P.
1968-01-01
Tropine p-tolylacetate (TPTA) and its quaternary analogue, tropine p-tolylacetate methiodide (TPTA MeI) decrease the early transient (Na) and late (K) currents in the voltage-clamped lobster giant axon. These agents, which block the nerve action potential, reduce the maximum Na and K conductance increases associated with membrane depolarization. They also slow the rate at which the sodium conductance is increased and shift the (normalized) membrane conductance vs. voltage curves in the direction of depolarization along the voltage axis. All these effects are qualitatively similar to those resulting from the action of procaine on the voltage-clamped axon. One unusual effect of the tropine esters, noticeable particularly at large depolarization steps, is that they cause the late, K current to reach a peak and then fall off with increasing pulse duration. This effect has not been reported to occur as a result of procaine action. Tropine p-chlorophenyl acetate (TPClφA), which differs from TPTA only by the substitution of a p-Cl for a p-CH3 group on the benzene ring, had a negligible effect on axonal excitability. PMID:5648830
Yamaguchi, Shinji; Kurokawa, Tatsuki; Taira, Ikuko; Aoki, Naoya; Sakata, Souhei; Okamura, Yasushi; Homma, Koichi J
2014-04-01
Voltage-sensing phosphatase, VSP, consists of the transmembrane domain, operating as the voltage sensor, and the cytoplasmic domain with phosphoinositide-phosphatase activities. The voltage sensor tightly couples with the cytoplasmic phosphatase and membrane depolarization induces dephosphorylation of several species of phosphoinositides. VSP gene is conserved from urochordate to human. There are some diversities among VSP ortholog proteins; range of voltage of voltage sensor motions as well as substrate selectivity. In contrast with recent understandings of biophysical mechanisms of VSPs, little is known about its physiological roles. Here we report that chick ortholog of VSP (designated as Gg-VSP) induces morphological feature of cell process outgrowths with round cell body in DF-1 fibroblasts upon its forced expression. Expression of the voltage sensor mutant, Gg-VSPR153Q with shifted voltage dependence to a lower voltage led to more frequent changes of cell morphology than the wild-type protein. Coexpression of PTEN that dephosphorylates PI(3,4)P2 suppressed this effect by Gg-VSP, indicating that the increase of PI(3,4)P2 leads to changes of cell shape. In addition, visualization of PI(3,4)P2 with the fluorescent protein fused with the TAPP1-derived pleckstrin homology (PH) domain suggested that Gg-VSP influenced the distribution of PI(3,4)P2 . These findings raise a possibility that one of the VSP's functions could be to regulate cell morphology through voltage-sensitive tuning of phosphoinositide profile. © 2013 Wiley Periodicals, Inc.
Electronic structure of oxygen-vacancy defects in amorphous In-Ga-Zn-O semiconductors
NASA Astrophysics Data System (ADS)
Noh, Hyeon-Kyun; Chang, K. J.; Ryu, Byungki; Lee, Woo-Jin
2011-09-01
We perform first-principles density functional calculations to investigate the atomic and electronic properties of various O-vacancy (VO) defects in amorphous indium gallium zinc oxides (a-IGZO). The formation energies of VO have a tendency to increase with increasing number of neighboring Ga atoms, whereas they are generally low in the environment surrounded with In atoms. Thus, adding Ga atoms suppresses the formation of O-deficiency defects, which are considered as the origin of device instability in a-IGZO-based thin film transistors. The conduction band edge state is characterized by the In s orbital and insensitive to disorder, in good agreement with the experimental finding that increasing the In content enhances the carrier density and mobility. In a-IGZO, while most VO defects are deep donors, some of the defects act as shallow donors due to local environments different from those in crystalline oxides. As ionized O vacancies can capture electrons, it is suggested that these defects are responsible for positive shifts of the threshold voltage observed under positive gate bias stress. Under light illumination stress, VO defects can be ionized, becoming VO2+ defects due to the negative-U behavior. When electrons are captured by applying a negative bias voltage, ionized VO2+ defects return to the original neutral charge state. Through molecular dynamics simulations, we find that the initial neutral state is restored by annealing, in good agreement with experiments, although the annealing temperature depends on the local environment. Our calculations show that VO defects play an important role in the instability of a-IGZO-based devices.
NASA Astrophysics Data System (ADS)
Sarkar, Arup; Suresh, K. A.
2018-04-01
We find negative differential resistance (NDR) at room temperature in ultrathin films of nickel (II) 1,4,8,11,15,18,22,25-octabutoxy-29H,31H-phthalocyanine [NiPc(OBu)8] deposited on highly ordered pyrolytic graphite (HOPG) substrate [NiPc(OBu)8/HOPG] and NiPc(OBu)8 on graphene oxide (GO) deposited on HOPG [NiPc(OBu)8/GO/HOPG]. For the NiPc(OBu)8/HOPG system, NiPc(OBu)8 was transferred four times onto HOPG by the Langmuir-Blodgett (LB) technique. We have prepared a stable Langmuir monolayer of amphiphilic GO at the air-water interface and transferred it onto HOPG by the LB technique. Further, the monolayer of NiPc(OBu)8 was transferred four times for good coverage on GO to obtain the NiPc(OBu)8/GO/HOPG system. The current-voltage characteristics were carried out using a current sensing atomic force microscope (CSAFM) with a platinum (Pt) tip that forms Pt/NiPc(OBu)8/HOPG and Pt/NiPc(OBu)8/GO/HOPG junctions. The CSAFM, UV-visible spectroscopy, and cyclic voltammetry studies show that the NDR effect occurs due to molecular resonant tunneling. In the Pt/NiPc(OBu)8/GO/HOPG junction, we find that due to the presence of GO, the features of NDR become more prominent. Also, GO causes a shift in NDR voltage towards a lower value in the negative bias direction. We attribute this behavior to the role of GO in injecting holes into the NiPc(OBu)8 film.
Han, Chunmiao; Zhang, Zhensong; Xu, Hui; Xie, Guohua; Li, Jing; Zhao, Yi; Deng, Zhaopeng; Liu, Shiyong; Yan, Pengfei
2013-01-02
The controllable tuning of the excited states in a series of phosphine-oxide hosts (DPExPOCzn) was realized through introducing carbazolyl and diphenylphosphine-oxide (DPPO) moieties to adjust the frontier molecular orbitals, molecular rigidity, and the location of the triplet excited states by suppressing the intramolecular interplay of the combined multi-insulating and meso linkage. On increasing the number of substituents, simultaneous lowering of the first singlet energy levels (S(1)) and raising of the first triplet energy levels (T(1), about 3.0 eV) were achieved. The former change was mainly due to the contribution of the carbazolyl group to the HOMOs and the extended conjugation. The latter change was due to an enhanced molecular rigidity and the shift of the T(1) states from the diphenylether group to the carbazolyl moieties. This kind of convergent modulation of excited states not only facilitates the exothermic energy transfer to the dopants in phosphorescent organic light-emitting diodes (PHOLEDs), but also realizes the fine-tuning of electrical properties to achieve the balanced carrier injection and transportation in the emitting layers. As the result, the favorable performance of blue-light-emitting PHOLEDs was demonstrated, including much-lower driving voltages of 2.6 V for onset and 3.0 V at 100 cd m(-2), as well as a remarkably improved E.Q.E. of 12.6%. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
High-Frequency Response and Voltage Noise in Magnetic Nanocomposites
NASA Astrophysics Data System (ADS)
Buznikov, N. A.; Iakubov, I. T.; Rakhmanov, A. L.; Kugel, K. I.; Sboychakov, A. O.
We study the noise spectra and high-frequency permeability of inhomogeneous magnetic materials consisting of single-domain magnetic nanoparticles embedded into an insulating matrix. Possible mechanisms of 1/f voltage noise in phase-separated manganites is analyzed. The material is modelled by a system of small ferromagnetic metallic droplets (magnetic polarons or ferrons) in insulating antiferromagnetic or paramagnetic matrix. The electron transport is related to tunnelling of charge carriers between droplets. One of the sources of the 1/f noise in such a system stems from fluctuations of the number of droplets with extra electron. In the case of strong magnetic anisotropy, the 1/f noise can arise also due to the fluctuations of the magnetic moments of ferrons. The high frequency magnetic permeability of nanocomposite film with magnetic particles in insulating non-magnetic matrix is studied in detail. The case of strong magnetic dipole interaction and strong magnetic anisotropy of ferromagnetic granules is considered. The composite is modelled by a cubic regular array of ferromagnetic particles. The high-frequency permeability tensor components are found as a functions of frequency, temperature, ferromagnetic phase content, and magnetic anisotropy. The results demonstrate that magnetic dipole interaction leads to a shift of the resonance frequencies towards higher values, and nanocomposite film could have rather high value of magnetic permeability in the microwave range.
High-Frequency Response and Voltage Noise in Magnetic Nanocomposites
NASA Astrophysics Data System (ADS)
Buznikov, N. A.; Iakubov, I. T.; Rakhmanov, A. L.; Kugel, K. I.; Sboychakov, A. O.
2010-12-01
We study the noise spectra and high-frequency permeability of inhomogeneous magnetic materials consisting of single-domain magnetic nanoparticles embedded into an insulating matrix. Possible mechanisms of 1/f voltage noise in phase-separated manganites is analyzed. The material is modelled by a system of small ferromagnetic metallic droplets (magnetic polarons or ferrons) in insulating antiferromagnetic or paramagnetic matrix. The electron transport is related to tunnelling of charge carriers between droplets. One of the sources of the 1/f noise in such a system stems from fluctuations of the number of droplets with extra electron. In the case of strong magnetic anisotropy, the 1/f noise can arise also due to the fluctuations of the magnetic moments of ferrons. The high frequency magnetic permeability of nanocomposite film with magnetic particles in insulating non-magnetic matrix is studied in detail. The case of strong magnetic dipole interaction and strong magnetic anisotropy of ferromagnetic granules is considered. The composite is modelled by a cubic regular array of ferromagnetic particles. The high-frequency permeability tensor components are found as a functions of frequency, temperature, ferromagnetic phase content, and magnetic anisotropy. The results demonstrate that magnetic dipole interaction leads to a shift of the resonance frequencies towards higher values, and nanocomposite film could have rather high value of magnetic permeability in the microwave range.
A magnetic phase-transition graphene transistor with tunable spin polarization
NASA Astrophysics Data System (ADS)
Vancsó, Péter; Hagymási, Imre; Tapasztó, Levente
2017-06-01
Graphene nanoribbons (GNRs) have been proposed as potential building blocks for field effect transistor (FET) devices due to their quantum confinement bandgap. Here, we propose a novel GNR device concept, enabling the control of both charge and spin signals, integrated within the simplest three-terminal device configuration. In a conventional FET device, a gate electrode is employed to tune the Fermi level of the system in and out of a static bandgap. By contrast, in the switching mechanism proposed here, the applied gate voltage can dynamically open and close an interaction gap, with only a minor shift of the Fermi level. Furthermore, the strong interplay of the band structure and edge spin configuration in zigzag ribbons enables such transistors to carry spin polarized current without employing an external magnetic field or ferromagnetic contacts. Using an experimentally validated theoretical model, we show that such transistors can switch at low voltages and high speed, and the spin polarization of the current can be tuned from 0% to 50% by using the same back gate electrode. Furthermore, such devices are expected to be robust against edge irregularities and can operate at room temperature. Controlling both charge and spin signal within the simplest FET device configuration could open up new routes in data processing with graphene based devices.
Polyimide encapsulated lithium-rich cathode material for high voltage lithium-ion battery.
Zhang, Jie; Lu, Qingwen; Fang, Jianhua; Wang, Jiulin; Yang, Jun; NuLi, Yanna
2014-10-22
Lithium-rich materials represented by xLi2MnO3·(1 - x)LiMO2 (M = Mn, Co, Ni) are attractive cathode materials for lithium-ion battery due to their high specific energy and low cost. However, some drawbacks of these materials such as poor cycle and rate capability remain to be addressed before applications. In this study, a thin polyimide (PI) layer is coated on the surface of Li1.2Ni0.13Mn0.54Co0.13O2 (LNMCO) by a polyamic acid (PAA) precursor with subsequently thermal imidization process. X-ray diffraction (XRD), scanning electron microscopy (SEM), and high-resolution transmission electron microscopy (HR-TEM) results confirm the successful formation of a PI layer (∼3 nm) on the surface of LNMCO without destruction of its main structure. X-ray photoelectron spectroscopy (XPS) spectra show a slight shift of the Mn valence state from Mn(IV) to Mn(III) in the PI-LNMCO treated at 450 °C, elucidating that charge transfer takes place between the PI layer and LNMCO surface. Electrochemical performances of LNMCO including cyclic stability and rate capability are evidently improved by coating a PI nanolayer, which effectively separates the cathode material from the electrolyte and stabilizes their interface at high voltage.
Voltage dips at the terminals of wind power installations
NASA Astrophysics Data System (ADS)
Bollen, Math H. J.; Olguin, Gabriel; Martins, Marcia
2005-07-01
This article gives an overview of the kind of voltage dips that can be expected at the terminals of a wind power installation. The overview is based on the study of those dips at the terminals of industrial installations and provides a guideline for the testing of wind power installations against voltage dips. For voltage dips due to faults, a classification into different types is presented. Five types appear at the terminals of sensitive equipment and thus have to be included when testing the wind power installation against disturbances coming from the grid. A distinction is made between installations connected at transmission level and those connected at distribution level. For the latter the phase angle jump has to be considered. Dips due to other causes (motor, transformer and capacitor switching) are briefly discussed as well as the voltage recovery after a dip. Finally some thoughts are presented on the way in which voltage tolerance requirements should be part of the design process for wind power installations. Copyright
A comparative study of charge movement in rat and frog skeletal muscle fibres.
Hollingworth, S; Marshall, M W
1981-12-01
1. The middle of the fibre voltage--clamp technique (Adrian & Marshall, 1977), modified where necessary for electrically short muscle fibres, has been used to measure non-linear charge movements in mammalian fast twitch (rat extensor digitorum longus), mammalian slow twitch (rat soleus) and frog (sartorius) muscles. 2. The maximum amount of charge moved in mammalian fast twitch muscle at 2 degrees C in hypertonic solution, was 3--5 times greater than in slow twitch muscle. The voltage distribution of fast twitch charge was 10--15 mV more positive when compared to slow twitch. 3. In both mammalian muscle types hypertonic Ringer solution negatively shifted the voltage distribution of charge some 6 mV. The steepness of charge moved around mechanical threshold was unaffected by hypertonicity. 4. The amount of charge in frog sartorius fibres at 2 degrees C in hypertonic solution was about half of that in rat fast twitch muscle; the voltage distribution of the frog charge was similar to rat soleus muscle. 5. Warming between 2 and 15 degrees C had no effect on either the amount of steady-state distribution of charge in mammalian or frog muscles. 6. At 2 degrees C, the kinetics of charge movement in fast and slow twitch mammalian muscles were similar and 2--3 times faster than frog muscle at the same temperature. In fast and slow mammalian fibres at 2 degrees C similar times were taken to shift the same fractions of the total amount of charge. The Q10 of charge movement kinetics was between 1.2 and 2.0 in the three muscles studied.
Rodgers, EW; Krenz, W-D; Baro, DJ
2012-01-01
Neuromodulatory effects can vary with their mode of transmission. Phasic release produces local and transient increases in dopamine (DA) up to micromolar concentrations. Additionally, since DA is released from open synapses and reuptake mechanisms are not nearby, tonic nanomolar DA exists in the extracellular space. Do phasic and tonic transmissions similarly regulate voltage dependent ionic conductances in a given neuron? It was previously shown that DA could immediately alter the transient potassium current (IA) of identified neurons in the stomatogastric ganglion (STG) of the spiny lobster, Panulirus interruptus. Here we show that DA can also persistently alter IA, and that DA’s immediate and persistent effects oppose one another. The lateral pyloric neuron (LP) exclusively expresses type 1 DA receptors (D1Rs). Micromolar DA produces immediate depolarizing shifts in the voltage dependence of LP IA, whereas tonic nanomolar DA produces a persistent increase in LP IA maximal conductance (Gmax) through a translation dependent mechanism involving target of rapamycin (TOR). The pyloric dilator neuron (PD) exclusively expresses type 2 DA receptors (D2Rs). Micromolar DA produces an immediate hyperpolarizing shift in PD IA voltage dependence of activation, whereas tonic DA persistently decreases PD IA Gmax through a translation dependent mechanism not involving TOR. The persistent effects on IA Gmax do not depend on LP or PD activity. These data suggest a role for tonic modulators in the regulation of voltage gated ion channel number; and furthermore, that dopaminergic systems may be organized to limit the amount of change they can impose on a circuit. PMID:21917788
Using Passive Two-Port Networks to Study the Forced Vibrations of Piezoceramic Transducers
NASA Astrophysics Data System (ADS)
Karlash, V. L.
2017-09-01
A generalization and subsequent development of experimental techniques, including methods of studying the phase-frequency relations between the measured components of admittance and instantaneous power are considered. The conditions of electric loading where electric currents, voltages, or instantaneous powers of constant amplitude in the piezoresonators are specified are numerically modeled. It is particularly established that the advanced Mason circuit with additional switch allows acquiring much more data on the forced vibrations of piezoceramic transducers than the classical circuit. The measured (at an arbitrary frequency) voltage drop across the piezoelement, its pull-up resistor, and at the input of the measuring circuit allow determining, with high accuracy, the current, conductivity, impedance, instantaneous power, and phase shifts when the amplitudes of electric current and voltage are given.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Taewoong; Seong, Tae-Yeon; School of Materials Science and Engineering, Korea University, Seoul 136-713
Efficiency droop is a phenomenon in which the efficiency of a light-emitting diode (LED) decreases with the increase in current density. To analyze efficiency droop, direct experimental observations on the energy conversion occurring inside the LED is required. Here, we present the measured voltage profiles on the cross section of an operating LED and analyze them with the cross-sectional temperature profiles obtained in a previous study under the same operation conditions. The measured voltage profiles suggest that with increases in the injection current density, electron depletion shifts from the multi-quantum well through an electron blocking layer to the p-GaN region.more » This is because electron leakage increases with increases in current density.« less
Acidic pH modulation of Na+ channels in trigeminal mesencephalic nucleus neurons.
Kang, In-Sik; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung
2016-12-07
Cell bodies of trigeminal mesencephalic nucleus (Vmes) neurons are located within the central nervous system, and therefore, peripheral as well as central acidosis can modulate the excitability of Vmes neurons. Here, we report the effect of acidic pH on voltage-gated Na channels in acutely isolated rat Vmes neurons using a conventional whole-cell patch clamp technique. Acidic pH (pH 6.0) slightly but significantly shifted both the activation and steady-state fast inactivation relationships toward depolarized potentials. However, acidic pH (pH 6.0) had a minor effect on the inactivation kinetics of voltage-gated Na channels. Less sensitivity of voltage-gated Na channels to acidic pH may allow Vmes neurons to transduce the precise proprioceptive information even under acidic pH conditions.
Artificial phosphorylation sites modulate the activity of a voltage-gated potassium channel
NASA Astrophysics Data System (ADS)
Ariyaratne, Amila; Zocchi, Giovanni
2015-03-01
The KvAP potassium channel is representative of a family of voltage-gated ion channels where the membrane potential is sensed by a transmembrane helix containing several positively charged arginines. Previous work by Wang and Zocchi [A. Wang and G. Zocchi, PLoS ONE 6, e18598 (2011), 10.1371/journal.pone.0018598] showed how a negatively charged polyelectrolyte attached in proximity to the voltage sensing element can bias the opening probability of the channel. Here we introduce three phosphorylation sites at the same location and show that the response curve of the channel shifts by about 20 mV upon phosphorylation, while other characteristics such as the single-channel conductance are unaffected. In summary, we construct an artificial phosphorylation site which confers allosteric regulation to the channel.
Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D
2018-01-01
Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p<0.0001). IIR of >0.74 corresponded to bipolar voltage <0.5 mV. A total of 1554 PBP-mapping points were matched to the nearest FAM-point. In an adjusted mixed-effects model, log-FAM bipolar voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, p<0.0001). At low-voltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Faraday-Shielded dc Stark-Shift-Free Optical Lattice Clock
NASA Astrophysics Data System (ADS)
Beloy, K.; Zhang, X.; McGrew, W. F.; Hinkley, N.; Yoon, T. H.; Nicolodi, D.; Fasano, R. J.; Schäffer, S. A.; Brown, R. C.; Ludlow, A. D.
2018-05-01
We demonstrate the absence of a dc Stark shift in an ytterbium optical lattice clock. Stray electric fields are suppressed through the introduction of an in-vacuum Faraday shield. Still, the effectiveness of the shielding must be experimentally assessed. Such diagnostics are accomplished by applying high voltage to six electrodes, which are grounded in normal operation to form part of the Faraday shield. Our measurements place a constraint on the dc Stark shift at the 10-20 level, in units of the clock frequency. Moreover, we discuss a potential source of error in strategies to precisely measure or cancel nonzero dc Stark shifts, attributed to field gradients coupled with the finite spatial extent of the lattice-trapped atoms. With this consideration, we find that Faraday shielding, complemented with experimental validation, provides both a practically appealing and effective solution to the problem of dc Stark shifts in optical lattice clocks.
Faraday-Shielded dc Stark-Shift-Free Optical Lattice Clock.
Beloy, K; Zhang, X; McGrew, W F; Hinkley, N; Yoon, T H; Nicolodi, D; Fasano, R J; Schäffer, S A; Brown, R C; Ludlow, A D
2018-05-04
We demonstrate the absence of a dc Stark shift in an ytterbium optical lattice clock. Stray electric fields are suppressed through the introduction of an in-vacuum Faraday shield. Still, the effectiveness of the shielding must be experimentally assessed. Such diagnostics are accomplished by applying high voltage to six electrodes, which are grounded in normal operation to form part of the Faraday shield. Our measurements place a constraint on the dc Stark shift at the 10^{-20} level, in units of the clock frequency. Moreover, we discuss a potential source of error in strategies to precisely measure or cancel nonzero dc Stark shifts, attributed to field gradients coupled with the finite spatial extent of the lattice-trapped atoms. With this consideration, we find that Faraday shielding, complemented with experimental validation, provides both a practically appealing and effective solution to the problem of dc Stark shifts in optical lattice clocks.
Auxiliary quasi-resonant dc tank electrical power converter
Peng, Fang Z.
2006-10-24
An auxiliary quasi-resonant dc tank (AQRDCT) power converter with fast current charging, voltage balancing (or charging), and voltage clamping circuits is provided for achieving soft-switched power conversion. The present invention is an improvement of the invention taught in U.S. Pat. No. 6,111,770, herein incorporated by reference. The present invention provides faster current charging to the resonant inductor, thus minimizing delay time of the pulse width modulation (PWM) due to the soft-switching process. The new AQRDCT converter includes three tank capacitors or power supplies to achieve the faster current charging and minimize the soft-switching time delay. The new AQRDCT converter further includes a voltage balancing circuit to charge and discharge the three tank capacitors so that additional isolated power supplies from the utility line are not needed. A voltage clamping circuit is also included for clamping voltage surge due to the reverse recovery of diodes.
Optimized MPPT algorithm for boost converters taking into account the environmental variables
NASA Astrophysics Data System (ADS)
Petit, Pierre; Sawicki, Jean-Paul; Saint-Eve, Frédéric; Maufay, Fabrice; Aillerie, Michel
2016-07-01
This paper presents a study on the specific behavior of the Boost DC-DC converters generally used for powering conversion of PV panels connected to a HVDC (High Voltage Direct Current) Bus. It follows some works pointing out that converter MPPT (Maximum Power Point Tracker) is severely perturbed by output voltage variations due to physical dependency of parameters as the input voltage, the output voltage and the duty cycle of the PWM switching control of the MPPT. As a direct consequence many converters connected together on a same load perturb each other because of the output voltage variations induced by fluctuations on the HVDC bus essentially due to a not insignificant bus impedance. In this paper we show that it is possible to include an internal computed variable in charge to compensate local and external variations to take into account the environment variables.
Investigation of interface property in Al/SiO2/ n-SiC structure with thin gate oxide by illumination
NASA Astrophysics Data System (ADS)
Chang, P. K.; Hwu, J. G.
2017-04-01
The reverse tunneling current of Al/SiO2/ n-SiC structure employing thin gate oxide is introduced to examine the interface property by illumination. The gate current at negative bias decreases under blue LED illumination, yet increases under UV lamp illumination. Light-induced electrons captured by interface states may be emitted after the light sources are off, leading to the recovery of gate currents. Based on transient characteristics of gate current, the extracted trap level is close to the light energy for blue LED, indicating that electron capture induced by lighting may result in the reduction of gate current. Furthermore, bidirectional C- V measurements exhibit a positive voltage shift caused by electron trapping under blue LED illumination, while a negative voltage shift is observed under UV lamp illumination. Distinct trapping and detrapping behaviors can be observed from variations in I- V and C- V curves utilizing different light sources for 4H-SiC MOS capacitors with thin insulators.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiazadeh, Asal; Universidade do Algarve, FCT, 8000-139 Faro; Gomes, Henrique L.
The impact of a parylene top-coating layer on the illumination and bias stress instabilities of indium-gallium-zinc oxide thin-film transistors (TFTs) is presented and discussed. The parylene coating substantially reduces the threshold voltage shift caused by continuous application of a gate bias and light exposure. The operational stability improves by 75%, and the light induced instability is reduced by 35%. The operational stability is quantified by fitting the threshold voltage shift with a stretched exponential model. Storage time as long as 7 months does not cause any measurable degradation on the electrical performance. It is proposed that parylene plays not onlymore » the role of an encapsulation layer but also of a defect passivation on the top semiconductor surface. It is also reported that depletion-mode TFTs are less sensitive to light induced instabilities. This is attributed to a defect neutralization process in the presence of free electrons.« less
NASA Astrophysics Data System (ADS)
Miller, Tristan; Smallwood, Chris; Zhang, Wentao; Eisaki, Hiroshi; Lee, Dung-Hai; Lanzara, Alessandra
2015-03-01
Time- and Angle-resolved photoemission spectroscopy (tr-ARPES) has been used to directly measure the dynamics of many different properties of high-temperature superconductors, including the quasiparticle relaxation, cooper pair recombination, and many-body interactions. There have also been several intriguing results on several materials showing how laser pulses can manipulate their chemical potential on ultrafast timescales, and it's been suggested that these effects could find applications in optoelectronic devices. Studies on GaAs have also found that laser pulses may induce a surface voltage effect. Here, we extend these studies for the first time to a Bi2212 sample in the superconducting state, and disentangle the shift in chemical potential from surface voltage effects. This work was supported by Berkeley Lab's program on Quantum Materials, funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Materials Sciences and Engineering Division, under Contract No. DE-AC02-05CH11231.
Electrostatic shape-shifting ion optics
Dahl, David A.; Scott, Jill R.; Appelhans, Anthony D.
2006-05-02
Electrostatic shape-shifting ion optics includes an outer electrode that defines an interior region between first and second opposed open ends. A first inner electrode is positioned within the interior region of the outer electrode at about the first open end. A second inner electrode is positioned within the interior region of the outer electrode at about the second open end. A first end cap electrode is positioned at about a first open end of the first inner electrode so that the first end cap electrode substantially encloses the first open end of the first inner electrode. A second end cap electrode is positioned at about a second open end of the second inner electrode so that the second end cap electrode substantially encloses the second open end of the second inner electrode. A voltage source operatively connected to each of the electrodes applies voltage functions to each of the electrodes to produce an electric field within an interior space enclosed by the electrodes.
Phosphatidic acid modulation of Kv channel voltage sensor function
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-01-01
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. DOI: http://dx.doi.org/10.7554/eLife.04366.001 PMID:25285449
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B; Mayor, Marcel
2005-06-21
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic pi -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical pi-systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode.
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-01-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208
Electron emission controller with pulsed heating of filament
NASA Astrophysics Data System (ADS)
Durakiewicz, Tomasz
1996-11-01
A novel circuit has been invented for the versatile and safe stabilization of the electron emission current (Ie) produced by a hot filament in mass spectrometers or in ionization gauges. The voltage signal, which is directly proportional to Ie, is provided to the inverting input of a comparator, whereas the noninverting input is connected to the reference voltage. In addition to the commonly used negative feedback loop, a positive feedback loop was introduced by siting a resistor between the noninverting input and the output of the comparator, which results in a pulsation of the filament voltage. The pulses are rectangular, so that the power dissipated by the transistor in the filament power supply circuit is radically reduced. To refine the switching action of the transistor, the output of the comparator is connected through a capacitor to the transistor gate. A concise discussion of the phase shift between Ie, the filament temperature Tf, and the filament voltage Vf, including time constants for different modes of power dissipation, is included.
Electrokinetic Response of Charge-Selective Nanostructured Polymeric Membranes
NASA Astrophysics Data System (ADS)
Schiffbauer, Jarrod; Li, Diya; Gao, Feng; Phillip, William; Chang, Hsueh-Chia
2017-11-01
Nanostructured polymeric membranes, with a tunable pore size and ease of surface molecular functionalization, are a promising material for separations, filtration, and sensing applications. Recently, such membranes have been fabricated wherein the ion selectivity is imparted by self-assembled functional groups through a two-step process. Amine groups are used to provide a positive surface charge and acid groups are used to yield a negative charge. The membranes can be fabricated as either singly-charged or patterned/mosaic membranes, where there are alternating regions of amine- lined or acid-lined pores. We demonstrate that such membranes, in addition to having many features in common with other charge selective membranes (i.e. AMX or Nafion), display a unique single-membrane rectification behavior. This is due to the asymmetric distribution of charged functional groups during the fabrication process. We demonstrate this rectification effect using both dc current-voltage characteristics as well as dc-biased electrical impedance spectroscopy. Furthermore, surface charge changes due to dc concentration polarization and generation of localized pH shifts are monitored using electrical impedance spectroscopy. (formerly at University of Notre Dame).
Voltage Sag due to Pollution Induced Flashover Across Ceramic Insulator Strings
NASA Astrophysics Data System (ADS)
Reddy B, Subba; Goswami, Arup Kumar
2017-11-01
Voltage sag or voltage dips are significant to industrial reliability. There is a necessity to characterize the feeder level power quality (PQ) and the PQ performance among various utility companies. Contamination/pollution induced flashover is the ultimate consequence of the creeping discharges across the insulator strings which induce voltage sag. These have a severe threat on the safe and reliable operation of power systems. In the present work an attempt has been made to experimentally investigate the occurrence of voltage sag/dips during pollution induced flashovers. Results show significant dip/sag in the voltage magnitude during the flashover process.
Combating the Reliability Challenge of GPU Register File at Low Supply Voltage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Jingweijia; Song, Shuaiwen; Yan, Kaige
Supply voltage reduction is an effective approach to significantly reduce GPU energy consumption. As the largest on-chip storage structure, the GPU register file becomes the reliability hotspot that prevents further supply voltage reduction below the safe limit (Vmin) due to process variation effects. This work addresses the reliability challenge of the GPU register file at low supply voltages, which is an essential first step for aggressive supply voltage reduction of the entire GPU chip. We propose GR-Guard, an architectural solution that leverages long register dead time to enable reliable operations from unreliable register file at low voltages.
Contribution of Sialic Acid to the Voltage Dependence of Sodium Channel Gating
Bennett, Eric; Urcan, Mary S.; Tinkle, Sally S.; Koszowski, Adam G.; Levinson, Simon R.
1997-01-01
A potential role for sialic acid in the voltage-dependent gating of rat skeletal muscle sodium channels (rSkM1) was investigated using Chinese hamster ovary (CHO) cells stably transfected with rSkM1. Changes in the voltage dependence of channel gating were observed after enzymatic (neuraminidase) removal of sialic acid from cells expressing rSkM1 and through the expression of rSkM1 in a sialylation-deficient cell line (lec2). The steady-state half-activation voltages (Va) of channels under each condition of reduced sialylation were ∼10 mV more depolarized than control channels. The voltage dependence of the time constants of channel activation and inactivation were also shifted in the same direction and by a similar magnitude. In addition, recombinant deletion of likely glycosylation sites from the rSkM1 sequence resulted in mutant channels that gated at voltages up to 10 mV more positive than wild-type channels. Thus three independent means of reducing channel sialylation show very similar effects on the voltage dependence of channel gating. Finally, steady-state activation voltages for channels subjected to reduced sialylation conditions were much less sensitive to the effects of external calcium than those measured under control conditions, indicating that sialic acid directly contributes to the negative surface potential. These results are consistent with an electrostatic mechanism by which external, negatively charged sialic acid residues on rSkM1 alter the electric field sensed by channel gating elements. PMID:9089440
Brauchi, Sebastian; Orio, Patricio; Latorre, Ramon
2004-01-01
The cold and menthol receptor, TRPM8, also designated CMR1, is a member of the transient receptor potential (TRP) family of excitatory ion channels. TRPM8 is a channel activated by cold temperatures, voltage, and menthol. In this study, we characterize the cold- and voltage-induced activation of TRPM8 channel in an attempt to identify the temperature- and voltage-dependent components involved in channel activation. Under equilibrium conditions, decreasing temperature has two effects. (i) It shifts the normalized conductance vs. voltage curves toward the left, along the voltage axis. This effect indicates that the degree of order is higher when the channel is in the open configuration. (ii) It increases the maximum channel open probability, suggesting that temperature affects both voltage-dependent and -independent pathways. In the temperature range between 18°C and 25°C, large changes in enthalpy (ΔH = -112 kcal/mol) and entropy (ΔS = -384 cal/mol K) accompany the activation process. The Q10 calculated in the same temperature range is 24. This thermodynamic analysis strongly suggests that the process of opening involves large conformational changes of the channel-forming protein. Therefore, the highly temperature-dependent transition between open and closed configurations is possible because enthalpy and entropy are both large and compensate each other. Our data also demonstrate that temperature and voltage interact allosterically to enhance channel opening. PMID:15492228
NASA Astrophysics Data System (ADS)
Bhowmik, R. N.; Vijayasri, G.
2015-06-01
We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
NASA Astrophysics Data System (ADS)
Yang, Jianwen; Liao, Po-Yung; Chang, Ting-Chang; Chen, Bo-Wei; Huang, Hui-Chun; Su, Wan-Ching; Chiang, Hsiao-Cheng; Zhang, Qun
2017-04-01
Amorphous InGaZnO thin film transistors (a-IGZO TFTs) with an etching-stop layer (ESL) exhibit an anomalous negative shift of threshold voltage (Vth) under positive bias temperature stress. TFTs with wider and shorter channels show a clear hump phenomenon, resulting from the existence of both main channels and parasitic channels. The electrons trapped in the gate insulator are responsible for the positive shift in the main channel characteristics. The electrons trapped near the IGZO edges and the holes injected into the ESL layer above InGaZnO (IGZO) jointly determine the shift of the parasitic TFT performance.
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Correa, A M; Bezanilla, F; Latorre, R
1992-01-01
The gating kinetics of batrachotoxin-modified Na+ channels were studied in outside-out patches of axolemma from the squid giant axon by means of the cut-open axon technique. Single channel kinetics were characterized at different membrane voltages and temperatures. The probability of channel opening (Po) as a function of voltage was well described by a Boltzmann distribution with an equivalent number of gating particles of 3.58. The voltage at which the channel was open 50% of the time was a function of [Na+] and temperature. A decrease in the internal [Na+] induced a shift to the right of the Po vs. V curve, suggesting the presence of an integral negative fixed charge near the activation gate. An increase in temperature decreased Po, indicating a stabilization of the closed configuration of the channel and also a decrease in entropy upon channel opening. Probability density analysis of dwell times in the closed and open states of the channel at 0 degrees C revealed the presence of three closed and three open states. The slowest open kinetic component constituted only a small fraction of the total number of transitions and became negligible at voltages greater than -65 mV. Adjacent interval analysis showed that there is no correlation in the duration of successive open and closed events. Consistent with this analysis, maximum likelihood estimation of the rate constants for nine different single-channel models produced a preferred model (model 1) having a linear sequence of closed states and two open states emerging from the last closed state. The effect of temperature on the rate constants of model 1 was studied. An increase in temperature increased all rate constants; the shift in Po would be the result of an increase in the closing rates predominant over the change in the opening rates. The temperature study also provided the basis for building an energy diagram for the transitions between channel states. PMID:1318096
Píriz, Nazira; Brum, Gustavo; Pizarro, Gonzalo
2006-01-01
In voltage clamped frog skeletal muscle fibres 0.2 mM tetracaine strongly suppresses Ca(2+) release. After this treatment Ca(2+) release flux lacks its characteristic initial peak and the remaining steady component is strongly reduced when compared with the control condition. We studied the effect of two agonists of Ca(2+) release on these tetracaine treated fibres. 8 mM ClO(4)(-) added after tetracaine potentiated release flux from 0.11 +/- 0.03 mM s(-1) to 0.34 +/- 0.07 mM s(-1) (n = 6) although without recovery of the peak at any test voltage. The voltage dependence of the increased release was shifted towards more negative potentials (approximately -10 mV). The effects of ClO(4)(-) on charge movement under these conditions showed the previously described characteristic changes consisting in a left shift of its voltage dependence (approximately -9 mV) together with a slower kinetics, both at the ON and OFF transients. Caffeine at 0.5 mM in the presence of the same concentration of tetracaine failed to potentiate release flux independently of the test voltage applied. When the cut ends of the fibre were exposed to a 10 mM BAPTA intracellular solution, in the absence of tetracaine, the peak was progressively abolished. Under these conditions caffeine potentiated release restoring the peak (from 0.63 +/- 0.12 mM s(-1) to 1.82 +/- 0.23 mM s(-1)) with no effect on charge movement. Taken together the present results suggest that tetracaine is blocking a Ca(2+) sensitive component of release flux. It is speculated that the suppressed release includes a component that is dependent on Ca(2+) and mainly mediated by the activation of the beta ryanodine receptors (the RyR3 equivalent isoform). These receptors are located parajunctionally in the frog and are not interacting with the dihydropyridine receptor.
Magnetic Compensation for Second-Order Doppler Shift in LITS
NASA Technical Reports Server (NTRS)
Burt, Eric; Tjoelker, Robert
2008-01-01
The uncertainty in the frequency of a linear-ion-trap frequency standard (LITS) can be reduced substantially by use of a very small magnetic inhomogeneity tailored to compensate for the residual second-order Doppler shift. An effect associated with the relativistic time dilatation, one cause of the second-order Doppler shift, is ion motion that is attributable to the trapping radio-frequency (RF)electromagnetic field used to trap ions. The second-order Doppler shift is reduced by using a multi-pole trap; however it is still the largest source of systematic frequency shift in the latest generation of LITSs, which are among the most stable clocks in the world. The present compensation scheme reduces the frequency instability of the affected LITS to about a tenth of its previous value. The basic principles of prior generation LITSs were discussed in several prior NASA Tech Briefs articles. Below are recapitulated only those items of basic information necessary to place the present development in context. A LITS includes a microwave local oscillator, the frequency of which is stabilized by comparison with the frequency of the ground state hyperfine transition of 199Hg+ ions. The comparison involves a combination of optical and microwave excitation and interrogation of the ions in a linear ion trap in the presence of a nominally uniform magnetic field. In the current version of the LITS, there are two connected traps (see figure): (1) a quadrupole trap wherein the optical excitation and measurement take place and (2) a 12-pole trap (denoted the resonance trap), wherein the microwave interrogation takes place. The ions are initially loaded into the quadrupole trap and are thereafter shuttled between the two traps. Shuttling ions into the resonance trap allows sensitive microwave interrogation to take place well away from loading interference. The axial magnetic field for the resonance trap is generated by an electric current in a finely wound wire coil surrounded by magnetic shields. In the quadrupole and 12-pole traps, the potentials are produced by RF voltages applied to even numbers (4 and 12, respectively) of parallel rods equally spaced around a circle. The polarity of the voltage on each rod is opposite that of the voltage on the adjacent rod. As a result, the amplitude of the RF trapping field is zero along the centerline and increases, with radius, to a maximum value near the rods.
Standardized UXO Technology Demonstration Site, Scoring Record No. 928
2011-03-01
magnetic permittivity (possibly complex and frequency dependent), ω is radian frequency, Vrx is the voltage at the receiver coil, txn̂ and rxn̂ are the...voltage induced in the receiver coil Vrx due to the induced target dipole moment m is related to magnetic field uxoH at the target due to a
A Photostable Silicon Rhodamine Platform for Optical Voltage Sensing
Huang, Yi-Lin; Walker, Alison S.; Miller, Evan W.
2015-01-01
This paper describes the design and synthesis of a photostable, far-red to near-infrared (NIR) platform for optical voltage sensing. We developed a new, sulfonated silicon rhodamine fluorophore and integrated it with a phenylenevinylene molecular wire to create a Berkeley Red Sensor of Transmembrane potential, or BeRST 1 (“burst”). BeRST 1 is the first member of a class of farred to NIR voltage sensitive dyes that make use of a photoinduced electron transfer (PeT) trigger for optical interrogation of membrane voltage. We show that BeRST 1 displays bright, membrane-localized fluorescence in living cells, high photostability, and excellent voltage sensitivity in neurons. Depolarization of the plasma membrane results in rapid fluorescence increases (24% ΔF/F per 100 mV). BeRST 1 can be used in conjunction with fluorescent stains for organelles, Ca2+ indicators, and voltage-sensitive fluorescent proteins. In addition, the red-shifted spectral profile of BeRST 1, relative to commonly employed optogenetic actuators like ChannelRhodopsin2 (ChR2), which require blue light, enables optical electrophysiology in neurons. The high speed, sensitivity, photostability and long-wavelength fluorescence profiles of BeRST 1 make it a useful platform for the non-invasive, optical dissection of neuronal activity. PMID:26237573
Electron Tunneling in Junctions Doped with Semiconductors and Metals.
NASA Astrophysics Data System (ADS)
Bell, Lloyd Douglas, II
In this study, tunnel junctions incorporating thin layers of semiconductors and metals have been analyzed. Inelastic electron tunneling spectroscopy (IETS) was employed to yield high-resolution vibrational spectra of surface species deposited at the oxide-M_2 interface of M_1-M_1O _{rm x}-M _2 tunneling samples. Analysis was also performed on the elastic component of the tunneling current, yielding information on the tunnel barrier shape. The samples in this research exhibit a wide range of behavior. The IETS for Si, SiO_2, and Ge doped samples show direct evidence of SiH _{rm x} and GeH_ {rm x} formation. The particular species formed is shown to depend on the form of the evaporated dopant. Samples were also made with organic dopants deposited over the evaporated dopants. Many such samples show marked effects of the evaporated dopants on the inelastic peak intensities of the organic dopants. These alterations are correlated with the changed reactivity of the oxide surface coupled with a change in the OH dipole layer density on the oxide. Thicker organic dopant layers cause large changes in the elastic tunneling barrier due to OH layer alterations or the low barrier attributes of the evaporated dopant. In the cases of the thicker layers an extra current-carrying mechanism is shown to be contributing. Electron ejection from charge traps is proposed as an explanation for this extra current. The trend of barrier shape with dopant thickness is examined. Many of these dopants also produce a voltage-induced shift in the barrier shape which is stable at low temperature but relaxes at high temperature. This effect is similar to that produced by certain organic dopants and is explained by metastable bond formation between the surface OH and dopant. Other dopants, such as Al, Mg, and Fe, produce different effects. These dopants cause large I-V nonlinearity at low voltages. This nonlinearity is modeled as a giant zero-bias anomaly (ZBA) and fits are presented which show good agreement with theory. For some samples, poor fits result due to additional nonlinearity at higher voltages. This is explained in terms of a barrier lowering due to disruption of the OH layer or the small bandgap of the dopant.
A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme
NASA Astrophysics Data System (ADS)
Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol
2018-02-01
We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.
DiFrancesco, D; Ohba, M; Ojeda, C
1979-12-01
1. The apparent reversal potential (Erev) of the pace-maker current (iK2) is found to depend on the experimental protocol used for its measurement. Evidence is presented showing that depolarizing (hyperpolarizing) pulses given before a test hyperpolarization used to determine Erev, shift Erev to more negative (positive) values. These shifts are opposite to those expected if the only effect of pre-pulses were to change the concentration of potassium in extracellular clefts ([K]c) via accumulation and depletion processes. 2. This effect is shown to be due to the fact that Erev is dependent on s0, the degree of activation of iK2 at the start of the test hyperpolarization. 3. When a suitable protocol is used, depletion of cleft K can be demonstrated to take place during a large hyperpolarization. Changes in the level of [K]c induced by pre-pulses must therefore also affect the Erev determination. 4. A simplified three-compartment model has been used to investigate how K accumulation and depletion can affect the time course of iK2, with particular reference to the problem of Erev determination. Computed examples show that the model is able to reproduce the main features of the time course of iK2 recorded near its reversal potential and the changes induced by pre-pulses on Erev measuremnet. By contrast, simulation on a linear cable model rules out the possibility that such results are due to voltage non-uniformity. 5. The three-compartment model predicts that the measured value of Erev differs from EK2 for two reasons: (1) when the recorded current trace is flat iK2 is still outward and decaying, and (2) the K equilibrium potential shifts to more negative values while the test hyperpolarization is applied. 6. The finding that Erev is directly affected by changes in s at the beginning of the test pulse is discussed in relation to the action of agents (such as Ca2+, H+, salicylate, adrenaline and ouabain) which are found to shift both the s00 curve and Erev.
Resistive and Ferroelectric-Domain Switching in Multiferroic BiFeO3 Films
NASA Astrophysics Data System (ADS)
Ramirez, J. G.; Arango, I. C.; Gomez, M. F.; Dominguez, C.; Sulekar, S.; Cardona, A.; Trastoy, J.; Nino, J. C.; Schuller, I. K.; Gomez, M. E.
Resistive switching (RS) in oxides has attracted much attention due to its potential application for nonvolatile memory and neuromorphic computing devices. Here we study the voltage-induced RS mechanisms in metal/multiferroic/semiconductor (Au/BiFeO3/Nb:SrTiO3) thin film vertical devices. We found switching with RON and ROFF ratios as big as 0.16 at voltages starting at +/- 2V. Further voltage increase produced an intensification of the RS effects, until dielectric breakdown was reached. Interestingly, the voltage at which the RS effect appears coincides with the coercive voltage of the ferroelectric polarization in similar BiFeO3 films, as measured by piezoelectric force microscopy. This suggests that the primary RS mechanism is the ferroelectric switching. Impedance spectroscopy measurements show filamentary contributions after ferroelectric saturation, possible due to voltage-induced movement of charge defects across the device and therefore suggesting an additional RS mechanism. Work supported by: Univalle CI 7999; FAPA at Uniandes; Colciencias 120471250659 and 120424054303. J.T. acknowledges the support from the Fundación Areces (Spain); AFOSR and DoD for a Vannevar Bush Fellowship.
New ion trap for atomic frequency standard applications
NASA Technical Reports Server (NTRS)
Prestage, J. D.; Dick, G. J.; Maleki, L.
1989-01-01
A novel linear ion trap that permits storage of a large number of ions with reduced susceptibility to the second-order Doppler effect caused by the radio frequency (RF) confining fields has been designed and built. This new trap should store about 20 times the number of ions a conventional RF trap stores with no corresponding increase in second-order Doppler shift from the confining field. In addition, the sensitivity of this shift to trapping parameters, i.e., RF voltage, RF frequency, and trap size, is greatly reduced.
Electro-optic-waveguide frequency translator in LiNbO(3) fabricated by proton exchange.
Wong, K K; De La Rue, R M; Wright, S
1982-11-01
An optical waveguide phase modulator has been fabricated on X-cut LiNbO(3) by using proton exchange in benzoic acid. The phase modulator was operated as a serrodyne optical-frequency translator with shifted-signal to imagesignal discrimination of 52 dB for a 4-MHz frequency shift. The amplitude of the sawtooth driving signal was 10 V peak to peak. Application of a de bias voltage of either polarity was found to cause a substantial reduction in transmitted-light intensity.
Modeling Proton Irradiation in AlGaN/GaN HEMTs: Understanding the Increase of Critical Voltage
NASA Astrophysics Data System (ADS)
Patrick, Erin; Law, Mark E.; Liu, Lu; Cuervo, Camilo Velez; Xi, Yuyin; Ren, Fan; Pearton, Stephen J.
2013-12-01
A combination of TRIM and FLOODS models the effect of radiation damage on AlGaN/GaN HEMTs. While excellent fits are obtained for threshold voltage shift, the models do not fully explain the increased reliability observed experimentally. In short, the addition of negatively-charged traps in the GaN buffer layer does not significantly change the electric field at the gate edges at radiation fluence levels seen in this study. We propose that negative trapped charge at the nitride/AlGaN interface actually produces the virtual-gate effect that results in decreasing the magnitude of the electric field at the gate edges and thus the increase in critical voltage. Simulation results including nitride interface charge show significant changes in electric field profiles while the I-V device characteristics do not change.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, H. X.; Zhang, T.; Wang, R. X.
A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfO{sub x} film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfO{sub x} matrix. Pt/Ni-NCs embedded HfO{sub x}/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 10{sup 12} electrons/cm{sup 2}, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 10{sup 4} cycles and excellent retention performance of 10{sup 5} s, fulfilling themore » requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.« less
Lo, Shun Qiang; Koh, Dawn X. P.; Sng, Judy C. G.; Augustine, George J.
2015-01-01
Abstract. We describe an experimental approach that uses light to both control and detect neuronal activity in mouse barrel cortex slices: blue light patterned by a digital micromirror array system allowed us to photostimulate specific layers and columns, while a red-shifted voltage-sensitive dye was used to map out large-scale circuit activity. We demonstrate that such all-optical mapping can interrogate various circuits in somatosensory cortex by sequentially activating different layers and columns. Further, mapping in slices from whisker-deprived mice demonstrated that chronic sensory deprivation did not significantly alter feedforward inhibition driven by layer 5 pyramidal neurons. Further development of voltage-sensitive optical probes should allow this all-optical mapping approach to become an important and high-throughput tool for mapping circuit interactions in the brain. PMID:26158003
Charge storage and tunneling mechanism of Ni nanocrystals embedded HfOx film
NASA Astrophysics Data System (ADS)
Zhu, H. X.; Zhang, T.; Wang, R. X.; Zhang, Y. Y.; Li, L. T.; Qiu, X. Y.
2016-05-01
A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfOx film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfOx matrix. Pt/Ni-NCs embedded HfOx/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 1012 electrons/cm2, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 104 cycles and excellent retention performance of 105 s, fulfilling the requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.
Yashchenok, Alexey M; Gorin, Dmitry A; Badylevich, Mikhail; Serdobintsev, Alexey A; Bedard, Matthieu; Fedorenko, Yanina G; Khomutov, Gennady B; Grigoriev, Dmitri O; Möhwald, Helmuth
2010-09-21
Optical and electrical properties of polyelectrolyte/iron oxide nanocomposite planar films on silicon substrates were investigated for different amount of iron oxide nanoparticles incorporated in the films. The nanocomposite assemblies prepared by the layer-by-layer assembly technique were characterized by ellipsometry, atomic force microscopy, and secondary ion mass-spectrometry. Absorption spectra of the films reveal a shift of the optical absorption edge to higher energy when the number of deposited layers decreases. Capacitance-voltage and current-voltage measurements were applied to study the electrical properties of metal-oxide-semiconductor structures prepared by thermal evaporation of gold electrodes on nanocomposite films. The capacitance-voltage measurements show that the dielectric constant of the film increases with the number of deposited layers and the fixed charge and the trapped charge densities have a negative sign.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Oniki, Yusuke; Koumo, Hideo; Iwazaki, Yoshitaka; Ueno, Tomo
2010-01-01
The relation between germanium monoxide (GeO) desorption and either improvement or deterioration in electrical characteristics of metal∕GeO2∕Ge capacitors fabricated by thermal oxidation has been investigated. In the metal∕GeO2∕Ge stack, two processes of GeO desorption at different sites and at different temperatures were observed by thermal desorption spectroscopy measurements. The electrical characteristics of as-oxidized metal∕GeO2∕Ge capacitors shows a large flat-band voltage shift and minority carrier generation due to the GeO desorption from the GeO2∕Ge interface during oxidation of Ge substrates. On the other hand, the electrical properties were drastically improved by a postmetallization annealing at low temperature resulting in a metal catalyzed GeO desorption from the top interface. PMID:20644659
Tuning charge and correlation effects for a single molecule on a graphene device
Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; ...
2016-11-25
The ability to understand and control the electronic properties of individual molecules in a device environment is crucial for developing future technologies at the nanometre scale and below. Achieving this, however, requires the creation of three-terminal devices that allow single molecules to be both gated and imaged at the atomic scale. We have accomplished this by integrating a graphene field effect transistor with a scanning tunnelling microscope, thus allowing gate-controlled charging and spectroscopic interrogation of individual tetrafluoro-tetracyanoquinodimethane molecules. We observe a non-rigid shift in the molecule’s lowest unoccupied molecular orbital energy (relative to the Dirac point) as a function ofmore » gate voltage due to graphene polarization effects. Our results show that electron–electron interactions play an important role in how molecular energy levels align to the graphene Dirac point, and may significantly influence charge transport through individual molecules incorporated in graphene-based nanodevices.« less
Biosensors based on DNA-Functionalized Graphene
NASA Astrophysics Data System (ADS)
Vishnubhotla, Ramya; Ping, Jinglei; Vrudhula, Amey; Johnson, A. T. Charlie
Since its discovery, graphene has been used for sensing applications due to its outstanding electrical properties and biocompatibility. Here, we demonstrate the capabilities of field effect transistors (FETs) based on CVD-grown graphene functionalized with commercially obtained DNA oligomers and aptamers for detection of various biomolecular targets (e.g., complementary DNA and small molecule drug targets). Graphene FETs were created with a scalable photolithography process that produces arrays consisting of 50-100 FETs with a layout suitable for multiplexed detection of four molecular targets. FETs were characterized via AFM to confirm the presence of the aptamer. From the measured electrical characteristics, it was determined that binding of molecular targets by the DNA chemical recognition element led to a reproducible, concentration-dependent shift in the Dirac voltage. This biosensor class is potentially suitable for applications in drug detection. This work is funded by NIH through the Center for AIDS Research at the University of Pennsylvania.
Ahn, Cheol Hyoun; Lee, Ju Ho; Lee, Jeong Yong; Cho, Hyung Koun
2014-12-01
Binary ZnO active layers possessing a polycrystalline structure were deposited with various argon/oxygen flow ratios at 250 degrees C via sputtering. Then ZnO thin-film-transistors (TFTs) were fabricated without additional thermal treatments. As the oxygen content increased during the deposition, the preferred orientation along the (0002) was weakened and the rotation of the grains increased, and furthermore, less conducting films were observed. On the other hand, the reduced oxygen flow rate induced the formation of amorphous-like transition layers during the initial growth due to a high growth rate and high energetic bombardment of the adatoms. As a result, the amorphous phases at the gate dielectric/channel interface were responsible for the formation of a hump shape in the subthreshold region of the TFT transfer curve. In addition, the relationship between the crystal properties and the shift in the threshold voltage was experimentally confirmed by a hysteresis test.
Restorative effect of oxygen annealing on device performance in HfIZO thin-film transistors
NASA Astrophysics Data System (ADS)
Ha, Tae-Jun
2015-03-01
Metal-oxide based thin-film transistors (oxide-TFTs) are very promising for use in next generation electronics such as transparent displays requiring high switching and driving performance. In this study, we demonstrate an optimized process to secure excellent device performance with a favorable shift of the threshold voltage toward 0V in amorphous hafnium-indium-zinc-oxide (a-HfIZO) TFTs by using post-treatment with oxygen annealing. This enhancement results from the improved interfacial characteristics between gate dielectric and semiconductor layers due to the reduction in the density of interfacial states related to oxygen vacancies afforded by oxygen annealing. The device statistics confirm the improvement in the device-to-device and run-to-run uniformity. We also report on the photo-induced stability in such oxide-TFTs against long-term UV irradiation, which is significant for transparent displays.
Microsecond-range optical shutter for unpolarized light with chiral nematic liquid crystal
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohammadimasoudi, Mohammad, E-mail: Mohammad.Mohammadimasoudi@elis.ugent.be; Neyts, Kristiaan; Beeckman, Jeroen
2015-04-15
A fast electro-optic shutter is fabricated and demonstrated. The device works independently of the polarization state of the incoming light beam. Modulation between 3% transmission and 60% transmission is obtained within a wavelength range of 50 nm with a response time of 20 μs. The device consists of two partly polymerized chiral nematic liquid crystal layers separated by a half wave plate. The transmission modulation is due to a 50 nm wavelength shift of the photonic band gap of the chiral liquid crystal realized by applying an electric field over a mixture of photo-polymerized LC and non-reactive nematic LC containingmore » a chiral dopant. The shutter features high reflectivity in the photonic band gap. We investigate the influence of the amplitude of the applied voltage on the width and the depth of the reflection band.« less
Lee, Sunwoo; Chung, Keum Jee; Park, In-Sung; Ahn, Jinho
2009-12-01
We report the characteristics of the organic field effect transistor (OFET) after electrical and time stress. Aluminum oxide (Al2O3) was used as a gate dielectric layer. The surface of the gate oxide layer was treated with hydrogen (H2) and nitrogen (N2) mixed gas to minimize the dangling bond at the interface layer of gate oxide. According to the two stress parameters of electrical and time stress, threshold voltage shift was observed. In particular, the mobility and subthreshold swing of OFET were significantly decreased due to hole carrier localization and degradation of the channel layer between gate oxide and pentacene by electrical stress. Electrical stress is a more critical factor in the degradation of mobility than time stress caused by H2O and O2 in the air.
Transverse thermoelectric effect in La{sub 0.67}Sr{sub 0.33}MnO{sub 3}|SrRuO{sub 3} superlattices
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shiomi, Y.; Spin Quantum Rectification Project, ERATO, Japan Science and Technology Agency, Aoba-ku, Sendai 980-8577; Handa, Y.
2015-06-08
Transverse thermoelectric effects in response to an out-of-plane heat current have been studied in an external magnetic field for ferromagnetic superlattices consisting of La{sub 0.67}Sr{sub 0.33}MnO{sub 3} and SrRuO{sub 3} layers. The superlattices were fabricated on SrTiO{sub 3} substrates by pulsed laser deposition. We found that the sign of the transverse thermoelectric voltage for the superlattices is opposite to that for La{sub 0.67}Sr{sub 0.33}MnO{sub 3} and SrRuO{sub 3} single layers at 200 K, implying an important role of spin Seebeck effects inside the superlattices. At 10 K, the magnetothermoelectric curves shift from the zero field due to an antiferromagnetic coupling between layersmore » in the superlattices.« less
NASA Astrophysics Data System (ADS)
Kim, S.; Russell, M.; Henry, M.; Kim, S. S.; Naik, R. R.; Voevodin, A. A.; Jang, S. S.; Tsukruk, V. V.; Fedorov, A. G.
2015-09-01
We report on the first demonstration of controllable carbon doping of graphene to engineer local electronic properties of a graphene conduction channel using focused electron beam induced deposition (FEBID). Electrical measurements indicate that an ``n-p-n'' junction on graphene conduction channel is formed by partial carbon deposition near the source and drain metal contacts by low energy (<50 eV) secondary electrons due to inelastic collisions of long range backscattered primary electrons generated from a low dose of high energy (25 keV) electron beam (1 × 1018 e- per cm2). Detailed AFM imaging provides direct evidence of the new mechanism responsible for dynamic evolution of the locally varying graphene doping. The FEBID carbon atoms, which are physisorbed and weakly bound to graphene, diffuse towards the middle of graphene conduction channel due to their surface chemical potential gradient, resulting in negative shift of Dirac voltage. Increasing a primary electron dose to 1 × 1019 e- per cm2 results in a significant increase of carbon deposition, such that it covers the entire graphene conduction channel at high surface density, leading to n-doping of graphene channel. Collectively, these findings establish a unique capability of FEBID technique to dynamically modulate the doping state of graphene, thus enabling a new route to resist-free, ``direct-write'' functional patterning of graphene-based electronic devices with potential for on-demand re-configurability.We report on the first demonstration of controllable carbon doping of graphene to engineer local electronic properties of a graphene conduction channel using focused electron beam induced deposition (FEBID). Electrical measurements indicate that an ``n-p-n'' junction on graphene conduction channel is formed by partial carbon deposition near the source and drain metal contacts by low energy (<50 eV) secondary electrons due to inelastic collisions of long range backscattered primary electrons generated from a low dose of high energy (25 keV) electron beam (1 × 1018 e- per cm2). Detailed AFM imaging provides direct evidence of the new mechanism responsible for dynamic evolution of the locally varying graphene doping. The FEBID carbon atoms, which are physisorbed and weakly bound to graphene, diffuse towards the middle of graphene conduction channel due to their surface chemical potential gradient, resulting in negative shift of Dirac voltage. Increasing a primary electron dose to 1 × 1019 e- per cm2 results in a significant increase of carbon deposition, such that it covers the entire graphene conduction channel at high surface density, leading to n-doping of graphene channel. Collectively, these findings establish a unique capability of FEBID technique to dynamically modulate the doping state of graphene, thus enabling a new route to resist-free, ``direct-write'' functional patterning of graphene-based electronic devices with potential for on-demand re-configurability. Electronic supplementary information (ESI) available: Optimization of a PMMA-mediated wet transfer method of graphene, transfer characteristics of all the channels, raw data of drain-source current measured by sweeping a backgate voltage and an AFM topography image and cross-sectional profiles of Fig. 4 and the corresponding electrical measurement along with an estimation of carbon diffusion coefficient. See DOI: 10.1039/c5nr04063a
In situ NMR spectroscopy of supercapacitors: insight into the charge storage mechanism.
Wang, Hao; Forse, Alexander C; Griffin, John M; Trease, Nicole M; Trognko, Lorie; Taberna, Pierre-Louis; Simon, Patrice; Grey, Clare P
2013-12-18
Electrochemical capacitors, commonly known as supercapacitors, are important energy storage devices with high power capabilities and long cycle lives. Here we report the development and application of in situ nuclear magnetic resonance (NMR) methodologies to study changes at the electrode-electrolyte interface in working devices as they charge and discharge. For a supercapacitor comprising activated carbon electrodes and an organic electrolyte, NMR experiments carried out at different charge states allow quantification of the number of charge storing species and show that there are at least two distinct charge storage regimes. At cell voltages below 0.75 V, electrolyte anions are increasingly desorbed from the carbon micropores at the negative electrode, while at the positive electrode there is little change in the number of anions that are adsorbed as the voltage is increased. However, above a cell voltage of 0.75 V, dramatic increases in the amount of adsorbed anions in the positive electrode are observed while anions continue to be desorbed at the negative electrode. NMR experiments with simultaneous cyclic voltammetry show that supercapacitor charging causes marked changes to the local environments of charge storing species, with periodic changes of their chemical shift observed. NMR calculations on a model carbon fragment show that the addition and removal of electrons from a delocalized system should lead to considerable increases in the nucleus-independent chemical shift of nearby species, in agreement with our experimental observations.
In Situ NMR Spectroscopy of Supercapacitors: Insight into the Charge Storage Mechanism
2013-01-01
Electrochemical capacitors, commonly known as supercapacitors, are important energy storage devices with high power capabilities and long cycle lives. Here we report the development and application of in situ nuclear magnetic resonance (NMR) methodologies to study changes at the electrode–electrolyte interface in working devices as they charge and discharge. For a supercapacitor comprising activated carbon electrodes and an organic electrolyte, NMR experiments carried out at different charge states allow quantification of the number of charge storing species and show that there are at least two distinct charge storage regimes. At cell voltages below 0.75 V, electrolyte anions are increasingly desorbed from the carbon micropores at the negative electrode, while at the positive electrode there is little change in the number of anions that are adsorbed as the voltage is increased. However, above a cell voltage of 0.75 V, dramatic increases in the amount of adsorbed anions in the positive electrode are observed while anions continue to be desorbed at the negative electrode. NMR experiments with simultaneous cyclic voltammetry show that supercapacitor charging causes marked changes to the local environments of charge storing species, with periodic changes of their chemical shift observed. NMR calculations on a model carbon fragment show that the addition and removal of electrons from a delocalized system should lead to considerable increases in the nucleus-independent chemical shift of nearby species, in agreement with our experimental observations. PMID:24274637
NASA Astrophysics Data System (ADS)
Wong, Hon Fai; Ng, Sheung Mei; Cheng, Wang Fai; Liu, Yukuai; Chen, Xinxin; von Nordheim, Danny; Mak, Chee Leung; Dai, Jiyan; Ploss, Bernd; Leung, Chi Wah
2017-12-01
We investigated the tunability of the transport and magnetic properties in 7.5 nm La0.7Sr0.3MnO3 (LSMO) epitaxial films in a field effect geometry with the ferroelectric copolymer P(VDF-TrFE) as the gate insulator. Two different switching behaviors were observed upon application of gate voltages with either high or low magnitudes. The application of single voltage pulses of alternating polarity with an amplitude high enough to switch the remanent polarization of the ferroelectric copolymer led to a 15% change of the resistance of the LSMO channel at temperature 300 K (but less than 1% change at 20 K). A minimal shift of the peak in the resistance-temperature plot was observed, implying that the Curie temperature TC of the manganite layer is not changed. Alternatively, the application of a chain of low voltage pulses was found to shift TC by more than 16 K, and a change of the channel resistance by a 45% was obtained. We attribute this effect to the field-assisted injection and removal of oxygen vacancies in the LSMO layer, which can occur across the thickness of the oxide film. By controlling the oxygen migration, the low-field switching route offers a simple method for modulating the electric and magnetic properties of manganite films.
Ionic currents and charge movements in organ-cultured rat skeletal muscle.
Hollingworth, S; Marshall, M W; Robson, E
1984-12-01
The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.
Lu, Jing; Tu, Xinglong; Yin, Guilin; Wang, Hui; He, Dannong
2017-11-09
In this work, a spot laser modulated resistance switching (RS) effect is firstly observed on n-type Mn-doped ZnO/SiO 2 /Si structure by growing n-type Mn-doped ZnO film on Si wafer covered with a 1.2 nm native SiO 2 , which has a resistivity in the range of 50-80 Ω∙cm. The I-V curve obtained in dark condition evidences the structure a rectifying junction, which is further confirmed by placing external bias. Compared to the resistance state modulated by electric field only in dark (without illumination), the switching voltage driving the resistance state of the structure from one state to the other, shows clear shift under a spot laser illumination. Remarkably, the switching voltage shift shows a dual dependence on the illumination position and power of the spot laser. We ascribe this dual dependence to the electric filed produced by the redistribution of photo-generated carriers, which enhance the internal barrier of the hetero-junction. A complete theoretical analysis based on junction current and diffusion equation is presented. The dependence of the switching voltage on spot laser illumination makes the n-type Mn-doped ZnO/SiO 2 /Si structure sensitive to light, which thus allows for the integration of an extra functionality in the ZnO-based photoelectric device.
Yang, Jingsong; Xiao, Lifen; He, Wei; Fan, Jiangwei; Chen, Zhongxue; Ai, Xinping; Yang, Hanxi; Cao, Yuliang
2016-07-27
The effect of the cutoff voltages on the working voltage decay and cyclability of the lithium-rich manganese-based layered cathode (LRMO) was investigated by electrochemical measurements, electrochemical impedance spectroscopy, ex situ X-ray diffraction, transmission electron microscopy, and energy dispersive spectroscopy line scan technologies. It was found that both lower (2.0 V) and upper (4.8 V) cutoff voltages cause severe voltage decay with cycling due to formation of the spinel phase and migration of the transition metals inside the particles. Appropriate cutoff voltage between 2.8 and 4.4 V can effectively inhibit structural variation as the electrode demonstrates 92% capacity retention and indiscernible working voltage decay over 430 cycles. The results also show that phase transformation not only on high charge voltage but also on low discharge voltage should be addressed to obtain highly stable LRMO materials.
Beyl, Stanislav; Depil, Katrin; Hohaus, Annette; Stary-Weinzinger, Anna; Linder, Tobias; Timin, Eugen; Hering, Steffen
2012-10-01
Voltage sensors trigger the closed-open transitions in the pore of voltage-gated ion channels. To probe the transmission of voltage sensor signalling to the channel pore of Ca(V)1.2, we investigated how elimination of positive charges in the S4 segments (charged residues were replaced by neutral glutamine) modulates gating perturbations induced by mutations in pore-lining S6 segments. Neutralisation of all positively charged residues in IIS4 produced a functional channel (IIS4(N)), while replacement of the charged residues in IS4, IIIS4 and IVS4 segments resulted in nonfunctional channels. The IIS4(N) channel displayed activation kinetics similar to wild type. Mutations in a highly conserved structure motif on S6 segments ("GAGA ring": G432W in IS6, A780T in IIS6, G1193T in IIIS6 and A1503G in IVS6) induce strong left-shifted activation curves and decelerated channel deactivation kinetics. When IIS4(N) was combined with these mutations, the activation curves were shifted back towards wild type and current kinetics were accelerated. In contrast, 12 other mutations adjacent to the GAGA ring in IS6-IVS6, which also affect activation gating, were not rescued by IIS4(N). Thus, the rescue of gating distortions in segments IS6-IVS6 by IIS4(N) is highly position-specific. Thermodynamic cycle analysis supports the hypothesis that IIS4 is energetically coupled with the distantly located GAGA residues. We speculate that conformational changes caused by neutralisation of IIS4 are not restricted to domain II (IIS6) but are transmitted to gating structures in domains I, III and IV via the GAGA ring.
Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício
2015-02-01
This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.
Sundt, Danielle; Gamper, Nikita
2015-01-01
Unmyelinated C-fibers are a major type of sensory neurons conveying pain information. Action potential conduction is regulated by the bifurcation (T-junction) of sensory neuron axons within the dorsal root ganglia (DRG). Understanding how C-fiber signaling is influenced by the morphology of the T-junction and the local expression of ion channels is important for understanding pain signaling. In this study we used biophysical computer modeling to investigate the influence of axon morphology within the DRG and various membrane conductances on the reliability of spike propagation. As expected, calculated input impedance and the amplitude of propagating action potentials were both lowest at the T-junction. Propagation reliability for single spikes was highly sensitive to the diameter of the stem axon and the density of voltage-gated Na+ channels. A model containing only fast voltage-gated Na+ and delayed-rectifier K+ channels conducted trains of spikes up to frequencies of 110 Hz. The addition of slowly activating KCNQ channels (i.e., KV7 or M-channels) to the model reduced the following frequency to 30 Hz. Hyperpolarization produced by addition of a much slower conductance, such as a Ca2+-dependent K+ current, was needed to reduce the following frequency to 6 Hz. Attenuation of driving force due to ion accumulation or hyperpolarization produced by a Na+-K+ pump had no effect on following frequency but could influence the reliability of spike propagation mutually with the voltage shift generated by a Ca2+-dependent K+ current. These simulations suggest how specific ion channels within the DRG may contribute toward therapeutic treatments for chronic pain. PMID:26334005
29 CFR 1926.952 - Mechanical equipment.
Code of Federal Regulations, 2014 CFR
2014-07-01
... of each shift during which the equipment is to be used to determine that the brakes and operating systems are in proper working condition. (3) No employer shall use any motor vehicle equipment having an... certified for work on the proper voltage, mechanical equipment shall not be operated closer to any energized...
29 CFR 1926.952 - Mechanical equipment.
Code of Federal Regulations, 2013 CFR
2013-07-01
... of each shift during which the equipment is to be used to determine that the brakes and operating systems are in proper working condition. (3) No employer shall use any motor vehicle equipment having an... certified for work on the proper voltage, mechanical equipment shall not be operated closer to any energized...
Miniature Piezoelectric Macro-Mass Balance
NASA Technical Reports Server (NTRS)
Sherrit, Stewart; Trebi-Ollennu, Ashitey; Bonitz, Robert G.; Bar-Cohen, Yoseph
2010-01-01
Mass balances usually use a strain gauge that requires an impedance measurement and is susceptible to noise and thermal drift. A piezoelectric balance can be used to measure mass directly by monitoring the voltage developed across the piezoelectric balance, which is linear with weight or it can be used in resonance to produce a frequency change proportional to the mass change (see figure). The piezoelectric actuator/balance is swept in frequency through its fundamental resonance. If a small mass is added to the balance, the resonance frequency shifts down in proportion to the mass. By monitoring the frequency shift, the mass can be determined. This design allows for two independent measurements of mass. Additionally, more than one sample can be verified because this invention allows for each sample to be transported away from the measuring device upon completion of the measurement, if required. A piezoelectric actuator, or many piezoelectric actuators, was placed between the collection plate of the sampling system and the support structure. As the sample mass is added to the plate, the piezoelectrics are stressed, causing them to produce a voltage that is proportional to the mass and acceleration. In addition, a change in mass delta m produces a change in the resonance frequency with delta f proportional to delta m. In a microgravity environment, the spacecraft could be accelerated to produce a force on the piezoelectric actuator that would produce a voltage proportional to the mass and acceleration. Alternatively, the acceleration could be used to force the mass on the plate, and the inertial effects of the mass on the plate would produce a shift in the resonance frequency with the change in frequency related to the mass change. Three prototypes of the mass balance mechanism were developed. These macro-mass balances each consist of a solid base and an APA 60 Cedrat flextensional piezoelectric actuator supporting a measuring plate. A similar structure with 3 APA 120 Cedrat flextensional piezoelectric actuators spaced equidistantly at 120 degrees supporting the plate and a softer macro balance with an APA 150 actuator/sensor were developed. These flextensional actuators were chosen because they increase the sensitivity of the actuator to stress, allow the piezoelectric to be pre-stressed, and the piezoelectric element is a stacked multilayer actuator, which has a considerably lower input impedance than a monolithic element that allows for common instruments (e.g., input impedance of 10 megohms) to measure the voltage without rapidly discharging the charge/voltage on the piezoelectric actuator.
Langille, Megan M.; Desai, Jay
2015-01-01
Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition. PMID:26019428
Langille, Megan M; Desai, Jay
2015-01-01
Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.
Röhr, Jason A; Moia, Davide; Haque, Saif A; Kirchartz, Thomas; Nelson, Jenny
2018-03-14
Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.
NASA Astrophysics Data System (ADS)
Röhr, Jason A.; Moia, Davide; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny
2018-03-01
Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.
Design, Growth, and Characterization of Mid Infrared and Terahertz Detectors Based on Nanostructures
NASA Astrophysics Data System (ADS)
Choi, Jae Kyu
In the first part of the dissertation, I present the design, growth, and characterization a multi-color quantum well infrared photodetecor (QWIP). The QWIP is based on GaAs/Al0.2Ga0.8As coupled double-quantum-well structure with asymmetric doping of the wells. The asymmetry resulted into a new property of the detector -- voltage tunability of the QWIP multicolor spectrum. Three major mechanisms contributing into the photoresponse were analyzed: 1) electron energy level shifting due to the quantum-confined Stark effect, 2) tunneling process at the triangular tip of barrier, which is known Fowler-Nordheim effect, and 3) thermoactivation processes. The experimental and theoretical results are in good agreement with the simulation results using Matlab and nextnano3 software. The QWIP structure was grown by the solid source molecular beam epitaxy, and was experimentally characterized by performing current-voltage characteristics and spectral photoresponse measurement. The effective voltage tunability and switchability of spectral photoresponse were demonstrated in the spectral range between 7.5 ˜ 11.1 mum. The low noise QWIP operation (at the dark current as low as 3 ?10-3 A/cm2) was demonstrated up to 60 K. The results are promising for development of accurate remote temperature sensing. In the second part, we present the results on design, fabrication, and characterization of a hot-electron bolometer based on low mobility 2-D electron gas (2-DEG) in an AlGaN/GaN heterostructure. The characterization of the hot-electron bolometer (HEB) demonstrated that we could simultaneously achieve the following conditions required for successful operation of 2-DEG HEB: 1) strong coupling to incident THz radiation due to strong Drude absorption; 2) significant THz heating of 2-DEG due to the small value of the electron heat capacity: and 3) high responsivity due to the strong temperature dependence of 2-DEG resistance. We identified THz response from our HEBs as a bolometric effect through modulation dependent photoresponse measurement. Low contact resistance achieved in our devices ensures that THz radiation couples primarily to the 2-DEG. Due to a small electron momentum relaxation time, the real part of the 2-DEG sensor impedance is ˜ 50-100 Ohm, which provides good impedance matching between sensors and antennas. For effective THz coupling to 2-DEG, a variety of THz planar antennas have been designed, tested, and optimized. The room temperature responsivity of our devices reaches ˜0.04 A/W at 2.55 THz along with a noise equivalent power of ˜5 nW/Hz1/2. Finally, prospects for high performance of HEBs by improving the design of the sensor and THz coupling to 2DEG design are proposed.
System and method for quench protection of a superconductor
Huang, Xianrui; Sivasubramaniam, Kiruba Haran; Bray, James William; Ryan, David Thomas
2008-03-11
A system and method for protecting a superconductor from a quench condition. A quench protection system is provided to protect the superconductor from damage due to a quench condition. The quench protection system comprises a voltage detector operable to detect voltage across the superconductor. The system also comprises a frequency filter coupled to the voltage detector. The frequency filter is operable to couple voltage signals to a control circuit that are representative of a rise in superconductor voltage caused by a quench condition and to block voltage signals that are not. The system is operable to detect whether a quench condition exists in the superconductor based on the voltage signal received via the frequency filter and to initiate a protective action in response.
NASA Astrophysics Data System (ADS)
Kanazawa, Seiji; Enokizono, Masato; Shibakita, Toshihide; Umehara, Eiji; Toshimitsu, Jun; Ninomiya, Shinji; Taniguchi, Hideki; Abe, Yukari
In recent years, inverter drive machines such as a hybrid vehicle and an electric vehicle are operated under high voltage pulse with high repetition rate. In this case, inverter surge is generated and affected the machine operation. Especially, the enameled wire of a motor is deteriorated due to the partial discharge (PD) and finally breakdown of the wire will occur. In order to investigate a PD on a resistant enameled wire, characteristics of PD in the twisted pair sample under bipolar repetitive impulse voltages are investigated experimentally. The relationship between the applied voltage and discharge current was measured at PD inception and extinction, and we estimated the repetitive PD inception and extinction voltages experimentally. The corresponding optical emission of the discharge was also observed by using an ICCD camera. Furthermore, ozone concentration due to the discharge was measured during the life-time test of the resistant enameled wires from a working environmental point of view.
In-Source Reduction of Disulfide-Bonded Peptides Monitored by Ion Mobility Mass Spectrometry
NASA Astrophysics Data System (ADS)
Stocks, Bradley B.; Melanson, Jeremy E.
2018-02-01
Many peptides with antimicrobial activity and/or therapeutic potential contain disulfide bonds as a means to enhance stability, and their quantitation is often performed using electrospray ionization mass spectrometry (ESI-MS). Disulfides can be reduced during ESI under commonly used instrument conditions, which has the potential to hinder accurate peptide quantitation. We demonstrate that this in-source reduction (ISR) is predominantly observed for peptides infused from acidic solutions and subjected to elevated ESI voltages (3-4 kV). ISR is readily apparent in the mass spectrum of oxytocin—a small, single disulfide-containing peptide. However, subtle m/z shifts due to partial ISR of highly charged (z ≥ 3) peptides with multiple disulfide linkages may proceed unnoticed. Ion mobility (IM)-MS separates ions on the basis of charge and shape in the gas phase, and using insulin as a model system, we show that IM-MS arrival time distributions (ATDs) are particularly sensitive to partial ISR of large peptides. Isotope modeling allows for the relative quantitation of disulfide-intact and partially reduced states of the mobility-separated peptide conformers. Interestingly, hepcidin peptides ionized from acidic solutions at elevated ESI voltages undergo gas-phase compaction, ostensibly due to partial disulfide ISR. Our IM-MS results lead us to propose that residual acid is the likely cause of disparate ATDs recently measured for hepcidin from different suppliers [Anal. Bioanal. Chem. 409, 2559-2567 (2017)]. Overall, our results demonstrate the utility of IM-MS to detect partial ISR of disulfide-bonded peptides and reinforce the notion that peptide/protein measurements should be carried out using minimally activating instrument conditions. [Figure not available: see fulltext.
Mondal, Arobendo; Kaupp, Martin
2018-04-05
A novel protocol to compute and analyze NMR chemical shifts for extended paramagnetic solids, accounting comprehensively for Fermi-contact (FC), pseudocontact (PC), and orbital shifts, is reported and applied to the important lithium ion battery cathode materials LiFePO 4 and LiCoPO 4 . Using an EPR-parameter-based ansatz, the approach combines periodic (hybrid) DFT computation of hyperfine and orbital-shielding tensors with an incremental cluster model for g- and zero-field-splitting (ZFS) D-tensors. The cluster model allows the use of advanced multireference wave function methods (such as CASSCF or NEVPT2). Application of this protocol shows that the 7 Li shifts in the high-voltage cathode material LiCoPO 4 are dominated by spin-orbit-induced PC contributions, in contrast with previous assumptions, fundamentally changing interpretations of the shifts in terms of covalency. PC contributions are smaller for the 7 Li shifts of the related LiFePO 4 , where FC and orbital shifts dominate. The 31 P shifts of both materials finally are almost pure FC shifts. Nevertheless, large ZFS contributions can give rise to non-Curie temperature dependences for both 7 Li and 31 P shifts.
Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo
2012-10-16
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.
Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo
2013-01-01
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304
Threshold voltage control in TmSiO/HfO2 high-k/metal gate MOSFETs
NASA Astrophysics Data System (ADS)
Dentoni Litta, E.; Hellström, P.-E.; Östling, M.
2015-06-01
High-k interfacial layers have been proposed as a way to extend the scalability of Hf-based high-k/metal gate CMOS technology, which is currently limited by strong degradations in threshold voltage control, channel mobility and device reliability when the chemical oxide (SiOx) interfacial layer is scaled below 0.4 nm. We have previously demonstrated that thulium silicate (TmSiO) is a promising candidate as a high-k interfacial layer, providing competitive advantages in terms of EOT scalability and channel mobility. In this work, the effect of the TmSiO interfacial layer on threshold voltage control is evaluated, showing that the TmSiO/HfO2 dielectric stack is compatible with threshold voltage control techniques commonly used with SiOx/HfO2 stacks. Specifically, we show that the flatband voltage can be set in the range -1 V to +0.5 V by the choice of gate metal and that the effective workfunction of the stack is properly controlled by the metal workfunction in a gate-last process flow. Compatibility with a gate-first approach is also demonstrated, showing that integration of La2O3 and Al2O3 capping layers can induce a flatband voltage shift of at least 150 mV. Finally, the effect of the annealing conditions on flatband voltage is investigated, finding that the duration of the final forming gas anneal can be used as a further process knob to tune the threshold voltage. The evaluation performed on MOS capacitors is confirmed by the fabrication of TmSiO/HfO2/TiN MOSFETs achieving near-symmetric threshold voltages at sub-nm EOT.
REXUS 16 Low Gravity Experiment
NASA Astrophysics Data System (ADS)
Manoliu, L.; Ciuca, I.; Lupu, E. S.; Ciobanu, I.; Cherciu, C.; Soare, C.; Murensan, C.; Dragomir, D.; Chitu, C.; Nachila, C.
2015-09-01
The REXUS/BEXUS is a programme realized under a bilateral agency agreement between the German Aerospace Centre (DLR) and the Swedish National Space Board (SNSB) (Source: www.rexusbexus.net) . Within this programme, the experiment proposed by LOW Gravity was given the opportunity to fly on board of REXUS 16 from Kiruna, Sweden, in May 2014. Since space settlements are within our reach and material processing in reduced gravity is a key requirement, we aim to improve this field by investigating the melting and welding processes taking place in milligravity on board of a sounding rocket. Our main objective is to analyze the surface deformation and physical properties of titanium and acid core solder alloys welded/melted under miligravity conditions with a 25W LASER diode. The main components of our experiment are the metal samples, the LASER diode and the control electronics. The metal samples are placed in front of an optical system and are shifted during approximately 120 seconds of milligravity. The optical system is connected via an optic fiber to the LASER diode. The electronics consists of two custom-made boards: the mainboard which is connected to the REXUS interface and controls the LASER diode and the sample shifting and the logboard which has an SD card to log all experiment data (sample position, experiment acceleration and rotation rate, pressure and temperature, battery voltage and LASER diode status). During the flight, due to unexpected vibration levels, the fiber optics was damaged at T+70 and the experiment could not fulfill its main objective. A GoPro camera mounted inside the experiment box recorded the experiment operation. Valuable information regarding temperature and battery voltage was also sent remotely to our Ground Station. This data enabled us to perform a thorough failure analysis. Parallel readings of these parameters taken by other experiments and by the REXUS Service Module corroborate our data and increase the accuracy of our analysis. The hypothesis for the failure is presented along with the lessons learnt.
Sensitivity-Enhanced CMOS Phase Luminometry System Using Xerogel-Based Sensors.
Lei Yao; Khan, R; Chodavarapu, V P; Tripathi, V S; Bright, F V
2009-10-01
We present the design and implementation of a phase luminometry sensor system with improved and tunable detection sensitivity achieved using a complementary metal-oxide semiconductor (CMOS) integrated circuit. We use sol-gel derived xerogel thin films as an immobilization media to house oxygen (O2) responsive luminescent molecules. The sensor operates on the principal of phase luminometry wherein a sinusoidal modulation signal is used to excite the luminophores encapsulated in the porous xerogel films and the corresponding phase shift of the emission signals is monitored. The phase shift is directly related to excited state lifetimes of the luminophores which in turn are related to the concentration of the target analyte species present in the vicinity of the luminophores. The CMOS IC, which consists of a 16 times 16 high-gain phototransistor array, current-to-voltage converter, amplifier and tunable phase shift detector, consumes an average power of 14 mW with 5-V power supply operating at a 38-kHz modulation frequency. The output of the IC is a dc voltage that corresponds to the detected luminescence phase shift with respect to the excitation signal. As a prototype, we demonstrate an oxygen sensor system by encapsulating the luminophore tris(4,7-diphenyl-1,10-phenanthroline)ruthenium(II) within the xerogel matrices. The sensor system showed a fast response on the order of few seconds and we obtained a detection sensitivity of 118 mV per 1% change in O2 concentration. The system demonstrates a novel concept to tune and improve the detection sensitivity for specific concentrations of the target analyte in many biomedical monitoring applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Tian-Li, E-mail: Tian-Li.Wu@imec.be; Groeseneken, Guido; Department of Electrical Engineering, KU Leuven, Leuven
2015-08-31
In this paper, three electrical techniques (frequency dependent conductance analysis, AC transconductance (AC-g{sub m}), and positive gate bias stress) were used to evaluate three different gate dielectrics (Plasma-Enhanced Atomic Layer Deposition Si{sub 3}N{sub 4}, Rapid Thermal Chemical Vapor Deposition Si{sub 3}N{sub 4}, and Atomic Layer Deposition (ALD) Al{sub 2}O{sub 3}) for AlGaN/GaN Metal-Insulator-Semiconductor High-Electron-Mobility Transistors. From these measurements, the interface state density (D{sub it}), the amount of border traps, and the threshold voltage (V{sub TH}) shift during a positive gate bias stress can be obtained. The results show that the V{sub TH} shift during a positive gate bias stress ismore » highly correlated to not only interface states but also border traps in the dielectric. A physical model is proposed describing that electrons can be trapped by both interface states and border traps. Therefore, in order to minimize the V{sub TH} shift during a positive gate bias stress, the gate dielectric needs to have a lower interface state density and less border traps. However, the results also show that the commonly used frequency dependent conductance analysis technique to extract D{sub it} needs to be cautiously used since the resulting value might be influenced by the border traps and, vice versa, i.e., the g{sub m} dispersion commonly attributed to border traps might be influenced by interface states.« less
Santos-Sacchi, Joseph; Song, Lei
2014-04-11
The outer hair cell is electromotile, its membrane motor identified as the protein SLC26a5 (prestin). An area motor model, based on two-state Boltzmann statistics, was developed about two decades ago and derives from the observation that outer hair cell surface area is voltage-dependent. Indeed, aside from the nonlinear capacitance imparted by the voltage sensor charge movement of prestin, linear capacitance (Clin) also displays voltage dependence as motors move between expanded and compact states. Naturally, motor surface area changes alter membrane capacitance. Unit linear motor capacitance fluctuation (δCsa) is on the order of 140 zeptofarads. A recent three-state model of prestin provides an alternative view, suggesting that voltage-dependent linear capacitance changes are not real but only apparent because the two component Boltzmann functions shift their midpoint voltages (Vh) in opposite directions during treatment with salicylate, a known competitor of required chloride binding. We show here using manipulations of nonlinear capacitance with both salicylate and chloride that an enhanced area motor model, including augmented δCsa by salicylate, can accurately account for our novel findings. We also show that although the three-state model implicitly avoids measuring voltage-dependent motor capacitance, it registers δCsa effects as a byproduct of its assessment of Clin, which increases during salicylate treatment as motors are locked in the expanded state. The area motor model, in contrast, captures the characteristics of the voltage dependence of δCsa, leading to a better understanding of prestin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G.
2015-06-15
We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling.more » The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.« less
Circuits and methods for impedance determination using active measurement cancelation
Jamison, David K.
2016-12-13
A delta signal and opposite delta signal are generated such that a sum of the two signals is substantially zero. The delta signal is applied across a first set of electrochemical cells. The opposite delta signal is applied across a second set of electrochemical cells series connected to the first set. A first held voltage is established as the voltage across the first set. A second held voltage is established as the voltage across the second set. A first delta signal is added to the first held voltage and applied to the first set. A second delta signal is added to the second held voltage and applied to the second set. The current responses due to the added delta voltages travel only into the set associated with its delta voltage. The delta voltages and the current responses are used to calculate the impedances of their associated cells.
Surface functionalized Cu2Zn1- x Cd x SnS4 quinternary alloyed nanostructure for DNA sensing
NASA Astrophysics Data System (ADS)
Ibraheam, A. S.; Al-Douri, Y.; Voon, C. H.; Foo, K. L.; Azizah, N.; Gopinath, S. C. B.; Ameri, M.; Ibrahim, Sattar S.
2017-03-01
A sensing plate of extended Cu2Zn1- x Cd x SnS4 quinternary alloy nanostructures, fabricated on an oxidized silicon substrate by the sol-gel method, is reported in this paper. The fabricated device was characterized and analyzed via field emission-scanning electron microscopy, X-ray diffraction (XRD), and photoluminescence (PL). The XRD peaks shifted towards the lower angle side alongside increasing concentration of cadmium. The average diameter of the Cu2Zn1- x Cd x SnS4 quinternary alloy nanostructures falls between 21.55 and 43.12 nm, while the shift of the PL bandgap was from 1.81 eV ( x = 0) to 1.72 eV ( x = 1). The resulting Cu2Zn1- x Cd x SnS4 quinternary alloy nanostructures components were functionalized with oligonucleotides probe DNA molecules and interacted with the target, exhibiting good sensing capabilities due to its large surface-to-volume ratio. The fabrication, immobilization, and hybridization processes were analyzed via representative current-voltage ( I- V) plots. Its electrical profile shows that the device is capable to distinguish biomolecules. Its high performance was evident from the linear relationship between the probe DNA from cervical cancer and the target DNA, showing its applicability for medical applications.
NASA Astrophysics Data System (ADS)
Otsuka, Takako; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2017-11-01
By using the charge modulated reflectance (CMR) imaging technique, charge distribution in the pentacene organic field-effect transistor (OFET) with a ferroelectric gate insulator [P(VDF-TrFE)] was investigated in terms of polarization reversal of the P(VDF-TrFE) layer. We studied the polarization reversal process and the carrier spreading process in the OFET channel. The I-V measurement showed a hysteresis behavior caused by the spontaneous polarization of P(VDF-TrFE), but the hysteresis I-V curve changes depending on the applied drain bias, possibly due to the gradual shift of the polarization reversal position in the OFET channel. CMR imaging visualized the gradual shift of the polarization reversal position and showed that the electrostatic field formed by the polarization of P(VDF-TrFE) contributes to hole and electron injection into the pentacene layer and the carrier distribution is significantly dependent on the direction of the polarization. The polarization reversal position in the channel region is governed by the electrostatic potential, and it happens where the potential reaches the coercive voltage of P(VDF-TrFE). The transmission line model developed on the basis of the Maxwell-Wagner effect element analysis well accounts for this polarization reversal process in the OFET channel.
NASA Astrophysics Data System (ADS)
Priya Darshini, B.; Ranjit, M.; Babu, V. Ramesh
2018-04-01
In this paper different Multicarrier PWM (MCPWM) techniques are proposed for dual inverter fed open end induction motor (IM) drive to achieve multilevel operation. To generate the switching pulses for the dual inverter sinusoidal modulating signal is compared with multi carrier signals. A common mode voltage (CMV) has been analyzed in the proposed open end winding induction motor drive. All the proposed techniques mitigate the CMV along with the harmonic distortion in the phase voltage. To authenticate the proposed work several simulation techniques have been carried out using MATLAB/SIMULINK and the corresponding results are presented and compared.
Tsuda, Sachiko; Kee, Michelle Z.L.; Cunha, Catarina; Kim, Jinsook; Yan, Ping; Loew, Leslie M.; Augustine, George J.
2013-01-01
Recent advances in our understanding of brain function have come from using light to either control or image neuronal activity. Here we describe an approach that combines both techniques: a micromirror array is used to photostimulate populations of presynaptic neurons expressing channelrhodopsin-2, while a red-shifted voltage-sensitive dye allows optical detection of resulting postsynaptic activity. Such technology allowed us to control the activity of cerebellar interneurons while simultaneously recording inhibitory responses in multiple Purkinje neurons, their postsynaptic targets. This approach should substantially accelerate our understanding of information processing by populations of neurons within brain circuits. PMID:23254260
Synchronization algorithm for three-phase voltages of an inverter and a grid
NASA Astrophysics Data System (ADS)
Nos, O. V.
2017-07-01
This paper presents the results of designing a joint phase-locked loop for adjusting the phase shifts (speed) and Euclidean norm of three-phase voltages of an inverter to the same grid parameters. The design can be used, in particular, to match the potentials of two parallel-connected power sources for the fundamental harmonic at the moments of switching the stator windings of an induction AC motor from a converter to a centralized power-supply system and back. Technical implementation of the developed synchronization algorithm will significantly reduce the inductance of the current-balancing reactor and exclude emergency operation modes in the electric motor power circuit.
NASA Astrophysics Data System (ADS)
Wang, Q.; Song, Z. T.; Liu, W. L.; Lin, C. L.; Wang, T. H.
2004-05-01
Monolayer-isolated silver (Ag) nanodots with the average diameter down to 7 nm are synthesized on Al 2O 3/Si substrate by vacuum electron-beam evaporation followed by annealing at 400 °C in N 2 ambient. Metal-insulator-silicon (MIS) structures with Ag nanodots embedded in Al 2O 3 gate dielectric are fabricated. Clear electron storage effect with the flatband voltage shift of 1.3 eV is observed through capacitance-conductance and conductance-voltage measurements. Our results demonstrate the feasibility of applying Ag nanodots for nanocrystal floating-gate memory devices.
Piacentino, V; Dipla, K; Gaughan, J P; Houser, S R
2000-03-15
1. Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. 2. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3',5'-monophosphate (cAMP) in the pipette or in the presence of the beta-adrenergic agonist isoproterenol (isoprenaline; ISO). 3. The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. 4. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (VŁ = -57.8 +/- 0.49 mV). 5. ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. 6. The voltage-contraction relationship in 200 microM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. 7. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis.
Sun, Qian-Quan; Dale, Nicholas
1998-01-01
In whole-cell patch clamp recordings made from non-sensory neurons acutely isolated from the spinal cord of Xenopus (stage 40–42) larvae, two forms of inhibition of the high voltage-activated (HVA) Ca2+ currents were produced by 5-HT. One was voltage dependent and associated with both slowing of the activation kinetics and shifting of the voltage dependence of the HVA currents. This inhibition was relieved by strong depolarizing prepulses. A second form of inhibition was neither associated with slowing of the activation kinetics nor relieved by depolarizing prepulses and was thus voltage independent. In all neurons examined, 5-HT (1 μM) reversibly reduced 34 ± 1.6 % (n = 102) of the HVA Ca2+ currents. In about 40 % of neurons, the inhibition was totally voltage independent. In another 5 %, the inhibition was totally voltage dependent. In the remaining neurons, inhibition was only partially (by around 40 %) relieved by a large depolarizing prepulse, suggesting that in these, the inhibition consisted of both voltage-dependent and -independent components. By using selective channel blockers, we found that 5-HT acted on both N- and P/Q-type channels. However, whereas the inhibition of P/Q-type currents was only voltage independent, the inhibition of N-type currents had both voltage-dependent and -independent components. The effects of 5-HT on HVA Ca2+ currents were mediated by 5-HT1A and 5-HT1D receptors. The 5-HT1A receptors not only preferentially caused voltage-independent inhibition, but did so by acting mainly on the ω-agatoxin-IVA-sensitive Ca2+ channels. In contrast, the 5-HT1D receptor produced both voltage-dependent and -independent inhibition and was preferentially coupled to ω-conotoxin-GVIA sensitive channels. This complexity of modulation may allow fine tuning of transmitter release and calcium signalling in the spinal circuitry of Xenopus larvae. PMID:9625870
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuesta, A.J.; Bump, D.D.
1980-01-01
Lithium cells have become the primary power source for cardiac pacemakers due to their reliability and longevity at low current drain rates. A lithium-cupric sulfide cell was developed which makes maximum use of the shape of a pacemaker's battery compartment. The cell has a stable voltage throughout 90% of its lifetime. It then drops to a second stable voltage before depletion. The voltage drop creates a small decrease in pacemaker rate, which alerts the physician to replace the pacemaker. No loss of capacity due to self-discharge as been seen to date, and cells have proven to be safe under extrememore » conditions. 2 refs.« less