Analysis of the transfer function for layered piezoelectric ultrasonic sensors
NASA Astrophysics Data System (ADS)
Gutiérrrez-Reyes, E.; García-Segundo, C.; García-Valenzuela, A.; Reyes-Ramírez, B.; Gutiérrez-Juárez, G.; Guadarrama-Santana, A.
2017-06-01
We model theoretically the voltage response to an acoustic pulse of a multilayer system forming a low noise capacitive sensor including a Polyvinylidene Fluoride piezoelectric film. First we model a generic piezoelectric detector consisting of a piezoelectric film between two metallic electrodes that are the responsible to convert the acoustic signal into a voltage signal. Then we calculate the pressure-to-voltage transfer function for a N-layer piezo-electric capacitor detector, allowing to study the effects of the electrode and protective layers thickness in typical layered piezoelectric sensors. The derived transfer function, when multiplied by the Fourier transform of the incident acoustic pulse, gives the voltage electric response in the frequency domain. An important concern regarding the transfer function is that it may have zeros at specific frequencies, and thus inverting the voltage Fourier transform of the pulse to recover the pressure signal in the time domain is not always, in principle, possible. Our formulas can be used to predict the existence and locations of such zeroes. We illustrate the use of the transfer function by predicting the electric signal generated at a multilayer piezoelectric sensor to an ultrasonic pulse generated photoacoustically by a laser pulse at a three media system with impedance mismatch. This theoretical calculations are compared with our own experimental measurements.
Analysis and calculation of lightning-induced voltages in aircraft electrical circuits
NASA Technical Reports Server (NTRS)
Plumer, J. A.
1974-01-01
Techniques to calculate the transfer functions relating lightning-induced voltages in aircraft electrical circuits to aircraft physical characteristics and lightning current parameters are discussed. The analytical work was carried out concurrently with an experimental program of measurements of lightning-induced voltages in the electrical circuits of an F89-J aircraft. A computer program, ETCAL, developed earlier to calculate resistive and inductive transfer functions is refined to account for skin effect, providing results more valid over a wider range of lightning waveshapes than formerly possible. A computer program, WING, is derived to calculate the resistive and inductive transfer functions between a basic aircraft wing and a circuit conductor inside it. Good agreement is obtained between transfer inductances calculated by WING and those reduced from measured data by ETCAL. This computer program shows promise of expansion to permit eventual calculation of potential lightning-induced voltages in electrical circuits of complete aircraft in the design stage.
Bateman, J; Proctor, M; Buchnev, O; Podoliak, N; D'Alessandro, G; Kaczmarek, M
2014-07-01
The voltage transfer function is a rapid and visually effective method to determine the electrical response of liquid crystal (LC) systems using optical measurements. This method relies on crosspolarized intensity measurements as a function of the frequency and amplitude of the voltage applied to the device. Coupled with a mathematical model of the device it can be used to determine the device time constants and electrical properties. We validate the method using photorefractive LC cells and determine the main time constants and the voltage dropped across the layers using a simple nonlinear filter model.
Voltage and frequency dependence of prestin-associated charge transfer
Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.
2009-01-01
Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917
Dynamic Range Enhancement of High-Speed Electrical Signal Data via Non-Linear Compression
NASA Technical Reports Server (NTRS)
Laun, Matthew C. (Inventor)
2016-01-01
Systems and methods for high-speed compression of dynamic electrical signal waveforms to extend the measuring capabilities of conventional measuring devices such as oscilloscopes and high-speed data acquisition systems are discussed. Transfer function components and algorithmic transfer functions can be used to accurately measure signals that are within the frequency bandwidth but beyond the voltage range and voltage resolution capabilities of the measuring device.
Cloverleaf microgyroscope with electrostatic alignment and tuning
NASA Technical Reports Server (NTRS)
Challoner, A. Dorian (Inventor); Gutierrez, Roman C. (Inventor); Tang, Tony K. (Inventor)
2007-01-01
A micro-gyroscope (10) having closed loop output operation by a control voltage (V.sub.ty), that is demodulated by a drive axis (x-axis) signal V.sub.thx of the sense electrodes (S1, S2), providing Coriolis torque rebalance to prevent displacement of the micro-gyroscope (10) on the output axis (y-axis) V.sub.thy.about.0. Closed loop drive axis torque, V.sub.tx maintains a constant drive axis amplitude signal, V.sub.thx. The present invention provides independent alignment and tuning of the micro-gyroscope by using separate electrodes and electrostatic bias voltages to adjust alignment and tuning. A quadrature amplitude signal, or cross-axis transfer function peak amplitude is used to detect misalignment that is corrected to zero by an electrostatic bias voltage adjustment. The cross-axis transfer function is either V.sub.thy/V.sub.ty or V.sub.tnx/V.sub.tx. A quadrature signal noise level, or difference in natural frequencies estimated from measurements of the transfer functions is used to detect residual mistuning, that is corrected to zero by a second electrostatic bias voltage adjustment.
Transfer of Kv3.1 voltage sensor features to the isolated Ci-VSP voltage-sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Knöpfel, Thomas
2012-08-22
Membrane proteins that respond to changes in transmembrane voltage are critical in regulating the function of living cells. The voltage-sensing domains (VSDs) of voltage-gated ion channels are extensively studied to elucidate voltage-sensing mechanisms, and yet many aspects of their structure-function relationship remain elusive. Here, we transplanted homologous amino acid motifs from the tetrameric voltage-activated potassium channel Kv3.1 to the monomeric VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP) to explore which portions of Kv3.1 subunits depend on the tetrameric structure of Kv channels and which properties of Kv3.1 can be transferred to the monomeric Ci-VSP scaffold. By attaching fluorescent proteins to these chimeric VSDs, we obtained an optical readout to establish membrane trafficking and kinetics of voltage-dependent structural rearrangements. We found that motifs extending from 10 to roughly 100 amino acids can be readily transplanted from Kv3.1 into Ci-VSP to form engineered VSDs that efficiently incorporate into the plasma membrane and sense voltage. Some of the functional features of these engineered VSDs are reminiscent of Kv3.1 channels, indicating that these properties do not require interactions between Kv subunits or between the voltage sensing and the pore domains of Kv channels. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Analysis of spacecraft battery charger systems
NASA Astrophysics Data System (ADS)
Kim, Seong J.; Cho, Bo H.
In spacecraft battery charger systems, switching regulators are widely used for bus voltage regulation, charge current regulation, and peak power tracking. Small-signal dynamic characteristics of the battery charging subsystem of direct energy transfer (DET) and peak power tracking (PPT) systems are analyzed to facilitate design of the control loop for optimum performance and stability. Control loop designs of the charger in various modes of operation are discussed. Analyses are verified through simulations. It is shown that when the charger operates in the bus voltage regulation mode, the control-to-voltage transfer function has a negative DC gain and two LHP zeros in both the DET and PPT systems. The control-to-inductor current transfer function also has a negative DC gain and a RHP zero. Thus, in the current-mode control, the current loop can no longer be used to stabilize the system. When the system operates in the charge current regulation mode, the charger operates with a fixed duty cycle which is determined by the regulated bus voltage and the battery voltage. Without an input filter, the converter becomes a first-order system. When the peak power tracker is inactive, the operating point of the solar array output moves to the voltage source region. Thus, the solar array behaves as a stiff voltage source to a constant power load.
Gate Tuning of Förster Resonance Energy Transfer in a Graphene - Quantum Dot FET Photo-Detector.
Li, Ruifeng; Schneider, Lorenz Maximilian; Heimbrodt, Wolfram; Wu, Huizhen; Koch, Martin; Rahimi-Iman, Arash
2016-06-20
Graphene photo-detectors functionalized by colloidal quantum dots (cQDs) have been demonstrated to show effective photo-detection. Although the transfer of charge carriers or energy from the cQDs to graphene is not sufficiently understood, it is clear that the mechanism and efficiency of the transfer depends on the morphology of the interface between cQDs and graphene, which is determined by the shell of the cQDs in combination with its ligands. Here, we present a study of a graphene field-effect transistor (FET), which is functionalized by long-ligand CdSe/ZnS core/shell cQDs. Time-resolved photo-luminescence from the cQDs as a function of the applied gate voltage has been investigated in order to probe transfer dynamics in this system. Thereby, a clear modification of the photo-luminescence lifetime has been observed, indicating a change of the decay channels. Furthermore, we provide responsivities under a Förster-like energy transfer model as a function of the gate voltage in support of our findings. The model shows that by applying a back-gate voltage to the photo-detector, the absorption can be tuned with respect to the photo-luminescence of the cQDs. This leads to a tunable energy transfer rate across the interface of the photo-detector, which offers an opportunity to optimize the photo-detection.
Rankin, Richard; Kotter, Dale
1994-01-01
An optical voltage reference for providing an alternative to a battery source. The optical reference apparatus provides a temperature stable, high precision, isolated voltage reference through the use of optical isolation techniques to eliminate current and impedance coupling errors. Pulse rate frequency modulation is employed to eliminate errors in the optical transmission link while phase-lock feedback is employed to stabilize the frequency to voltage transfer function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vargas, Asticio; Center for Optics and Photonics, Universidad de Concepción, Casilla 4016, Concepción; Mar Sánchez-López, María del
Multiple-beam Fabry-Perot (FP) interferences occur in liquid crystal retarders (LCR) devoid of an antireflective coating. In this work, a highly accurate method to obtain the spectral retardance of such devices is presented. On the basis of a simple model of the LCR that includes FP effects and by using a voltage transfer function, we show how the FP features in the transmission spectrum can be used to accurately retrieve the ordinary and extraordinary spectral phase delays, and the voltage dependence of the latter. As a consequence, the modulation characteristics of the device are fully determined with high accuracy by meansmore » of a few off-state physical parameters which are wavelength-dependent, and a single voltage transfer function that is valid within the spectral range of characterization.« less
Rankin, R.; Kotter, D.
1994-04-26
An optical voltage reference for providing an alternative to a battery source is described. The optical reference apparatus provides a temperature stable, high precision, isolated voltage reference through the use of optical isolation techniques to eliminate current and impedance coupling errors. Pulse rate frequency modulation is employed to eliminate errors in the optical transmission link while phase-lock feedback is employed to stabilize the frequency to voltage transfer function. 2 figures.
Generation of constant-amplitude radio-frequency sweeps at a tunnel junction for spin resonance STM
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paul, William; Lutz, Christopher P.; Heinrich, Andreas J.
2016-07-15
We describe the measurement and successful compensation of the radio-frequency transfer function of a scanning tunneling microscope over a wide frequency range (15.5–35.5 GHz) and with high dynamic range (>50 dB). The precise compensation of cabling resonances and attenuations is critical for the production of constant-voltage frequency sweeps for electric-field driven electron spin resonance (ESR) experiments. We also demonstrate that a well-calibrated tunnel junction voltage is necessary to avoid spurious ESR peaks that can arise due to a non-flat transfer function.
Sensing of metal-transfer mode for process control of GMAW (gas metal arc welding)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carlson, N.M.; Johnson, J.A.; Smartt, H.B.
1989-01-01
One of the requirements of a sensing system for feedback control of gas metal arc welding (GMAW) is the capability to determine the metal-transfer mode. Because the operating boundary for the desired transfer mode, expressed as a function of mass input and heat input, may vary due to conditions beyond the control of the system, a means of detecting the transfer mode during welding is necessary. A series of sensing experiments was performed during which the ultrasonic emissions, audio emissions, welding current fluctuations and welding voltage fluctuations were recorded as a function of the transfer mode. In addition, high speedmore » movies (5000 frames/s) of the droplet formation and detachment were taken synchronously with the sensing data. An LED mounted in the camera was used to mark the film at the beginning and end of the data acquisition period. A second LED was pulsed at a 1 kHz rate and the pulses recorded on film and with the sensor data. Thus events recorded on the film can be correlated with the sensor data. Data acquired during globular transfer, spray transfer, and stiff spray or streaming transfer were observed to correlate with droplet detachment and arc shorting. The audio, current, and voltage data can be used to discriminate among these different transfer modes. However, the current and voltage data are also dependent on the characteristic of the welding power supply. 5 refs., 3 figs., 1 tab.« less
Detection of metal-transfer mode in GMAW
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, J.A.; Carlson, N.M.; Smartt, H.B.
1989-01-01
One of the requirements of a sensing system for feedback control of gas metal arc welding (GMAW) is the capability to detect information about the metal-transfer mode. Because the operating boundary for the desired transfer mode, expressed as a function of mass input and heat input, may vary due to conditions beyond the control of the system, a means of determining the transfer mode during welding is necessary. A series of sensing experiments is performed during which the ultrasonic emissions, audio emissions, welding current fluctuations, and welding voltage fluctuations are recorded as a function of the transfer mode. In addition,more » high speed movies (5000 frame/s) of the droplet formation and detachment are taken synchronously with the sensing data. An LED mounted in the camera is used to work the film at the beginning and end of the data acquisition period. A second LED is pulsed at a 1 kHz rate and the pulses are recorded on film and with the sensor data. Thus events observed on the film can be correlated with the sensor data. Data acquired during globular transfer, spray transfer, and stiff spray or streaming transfer are observed to correlate with droplet detachment and arc shorting. The audio, current, and voltage data can be used to discriminate among these different transfer modes. However, the current and voltage data are also dependent on the characteristics of the welding power supply. 4 refs., 5 figs.« less
Measurement and modeling of transfer functions for lightning coupling into the Sago mine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, Marvin E.; Higgins, Matthew B.
2007-04-01
This report documents measurements and analytical modeling of electromagnetic transfer functions to quantify the ability of cloud-to-ground lightning strokes (including horizontal arc-channel components) to couple electromagnetic energy into the Sago mine located near Buckhannon, WV. Two coupling mechanisms were measured: direct and indirect drive. These transfer functions are then used to predict electric fields within the mine and induced voltages on conductors that were left abandoned in the sealed area of the Sago mine.
The role of optoelectronic feedback on Franz-Keldysh voltage modulation of transistor lasers
NASA Astrophysics Data System (ADS)
Chang, Chi-Hsiang; Chang, Shu-Wei; Wu, Chao-Hsin
2016-03-01
Possessing both the high-speed characteristics of heterojunction bipolar transistors (HBTs) and enhanced radiative recombination of quantum wells (QWs), the light-emitting transistor (LET) which operates in the regime of spontaneous emissions has achieved up to 4.3 GHz modulation bandwidth. A 40 Gbit/s transmission rate can be even achieved using transistor laser (TL). The transistor laser provides not only the current modulation but also direct voltage-controlled modulation scheme of optical signals via Franz-Keldysh (FK) photon-assisted tunneling effect. In this work, the effect of FK absorption on the voltage modulation of TLs is investigated. In order to analyze the dynamics and optical responses of voltage modulation in TLs, the conventional rate equations relevant to diode lasers (DLs) are first modified to include the FK effect intuitively. The theoretical results of direct-current (DC) and small-signal alternating-current (AC) characteristics of optical responses are both investigated. While the DC characteristics look physical, the intrinsic optical response of TLs under the FK voltage modulation shows an AC enhancement with a 20 dB peak, which however is not observed in experiment. A complete model composed of the intrinsic optical transfer function and an electrical transfer function fed back by optical responses is proposed to explain the behaviors of voltage modulation in TLs. The abnormal AC peak disappears through this optoelectronic feedback. With the electrical response along with FK-included photon-carrier rate equations taken into account, the complete voltage-controlled optical modulation response of TLs is demonstrated.
NASA Technical Reports Server (NTRS)
Wong, R. C.; Owen, H. A., Jr.; Wilson, T. G.
1981-01-01
Small-signal models are derived for the power stage of the voltage step-up (boost) and the current step-up (buck) converters. The modeling covers operation in both the continuous-mmf mode and the discontinuous-mmf mode. The power stage in the regulated current step-up converter on board the Dynamics Explorer Satellite is used as an example to illustrate the procedures in obtaining the small-signal functions characterizing a regulated converter.
Mapping of voltage sensor positions in resting and inactivated mammalian sodium channels by LRET
Kubota, Tomoya; Durek, Thomas; Dang, Bobo; Finol-Urdaneta, Rocio K.; Craik, David J.; Kent, Stephen B. H.; French, Robert J.; Bezanilla, Francisco; Correa, Ana M.
2017-01-01
Voltage-gated sodium channels (Navs) play crucial roles in excitable cells. Although vertebrate Nav function has been extensively studied, the detailed structural basis for voltage-dependent gating mechanisms remain obscure. We have assessed the structural changes of the Nav voltage sensor domain using lanthanide-based resonance energy transfer (LRET) between the rat skeletal muscle voltage-gated sodium channel (Nav1.4) and fluorescently labeled Nav1.4-targeting toxins. We generated donor constructs with genetically encoded lanthanide-binding tags (LBTs) inserted at the extracellular end of the S4 segment of each domain (with a single LBT per construct). Three different Bodipy-labeled, Nav1.4-targeting toxins were synthesized as acceptors: β-scorpion toxin (Ts1)-Bodipy, KIIIA-Bodipy, and GIIIA-Bodipy analogs. Functional Nav-LBT channels expressed in Xenopus oocytes were voltage-clamped, and distinct LRET signals were obtained in the resting and slow inactivated states. Intramolecular distances computed from the LRET signals define a geometrical map of Nav1.4 with the bound toxins, and reveal voltage-dependent structural changes related to channel gating. PMID:28202723
Mapping of voltage sensor positions in resting and inactivated mammalian sodium channels by LRET.
Kubota, Tomoya; Durek, Thomas; Dang, Bobo; Finol-Urdaneta, Rocio K; Craik, David J; Kent, Stephen B H; French, Robert J; Bezanilla, Francisco; Correa, Ana M
2017-03-07
Voltage-gated sodium channels (Navs) play crucial roles in excitable cells. Although vertebrate Nav function has been extensively studied, the detailed structural basis for voltage-dependent gating mechanisms remain obscure. We have assessed the structural changes of the Nav voltage sensor domain using lanthanide-based resonance energy transfer (LRET) between the rat skeletal muscle voltage-gated sodium channel (Nav1.4) and fluorescently labeled Nav1.4-targeting toxins. We generated donor constructs with genetically encoded lanthanide-binding tags (LBTs) inserted at the extracellular end of the S4 segment of each domain (with a single LBT per construct). Three different Bodipy-labeled, Nav1.4-targeting toxins were synthesized as acceptors: β-scorpion toxin (Ts1)-Bodipy, KIIIA-Bodipy, and GIIIA-Bodipy analogs. Functional Nav-LBT channels expressed in Xenopus oocytes were voltage-clamped, and distinct LRET signals were obtained in the resting and slow inactivated states. Intramolecular distances computed from the LRET signals define a geometrical map of Nav1.4 with the bound toxins, and reveal voltage-dependent structural changes related to channel gating.
Cryogenic temperature dependence of the voltage transfer characteristics of CMOS inverters
NASA Astrophysics Data System (ADS)
Deen, M. J.
1988-08-01
The voltage transfer characteristics of CMOS inverters have been studied in detail as a function of temperature between 77 and 300 K and supply voltages between 2 and 20 V. The logic levels, maximum gain, unity gain points, noise margins and other parameters, such as ( VH - VL), all showed a marked improvement as the temperature was lowered. In particular, for one inverter with a supply of 5 V, the maximum gain increased from 57 to 105, ( VIH - VIL) decreased from 0.50 to 0.28 V and ( VH - VL) increased from 4.46 to 4.75 V on decreasing the temperature from 300 to 77 K. For all the inverters, these and other parameters showed a smooth monotonic improvement as the temperature was lowered. These and the other results obtained can be qualitatively explained as due to an increase in the absolute values in the threshold voltages of the PMOS and NMOS transistors and to an increase in the carrier mobility as the temperature was lowered.
Small signal measurement of Sc 2O 3 AlGaN/GaN moshemts
NASA Astrophysics Data System (ADS)
Luo, B.; Mehandru, R.; Kang, B. S.; Kim, J.; Ren, F.; Gila, B. P.; Onstine, A. H.; Abernathy, C. R.; Pearton, S. J.; Gotthold, D.; Birkhahn, R.; Peres, B.; Fitch, R.; Gillespie, J. K.; Jenkins, T.; Sewell, J.; Via, D.; Crespo, A.
2004-02-01
The rf performance of 1 × 200 μm 2 AlGaN/GaN MOS-HEMTs with Sc 2O 3 used as both the gate dielectric and as a surface passivation layer is reported. A maximum fT of ˜11 GHz and fMAX of 19 GHz were obtained. The equivalent device parameters were extracted by fitting this data to obtain the transconductance, drain resistance, drain-source resistance, transfer time and gate-drain and gate-source capacitance as a function of gate voltage. The transfer time is in the order 0.5-1 ps and decreases with increasing gate voltage.
Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM
2009-11-03
A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.
Comparison of control structures for a bidirectional high-frequency dc-dc converter
NASA Astrophysics Data System (ADS)
Himmelstoss, Felix A.; Kolar, Johann W.; Zach, Franz C.
1989-08-01
A system for dc-dc power conversion based on a buck-boost converter topology is presented. It makes power flow in both directions possible. The possibility of bidirectional power flow is useful for certain applications, such as uninterruptable power supplies. Starting from a structural diagram the transfer function of the system is derived. The controller for the converter is then designed. It is made up of a simple voltage controller, a voltage controller with an inner loop current controller (cascade control) and with two kinds of state space control. The transfer functions of the different system parts are derived and dimensioning guidelines for the controller sections are presented. The closed loop behavior of the bidirectional converter for the different control structures is analyzed based on simulation using duty cycle averaging. Bodediagrams and step responses are shown.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Ben; He, Feng; Ouyang, Jiting, E-mail: jtouyang@bit.edu.cn
2015-12-15
Simulation work is very important for understanding the formation of self-organized discharge patterns. Previous works have witnessed different models derived from other systems for simulation of discharge pattern, but most of these models are complicated and time-consuming. In this paper, we introduce a convenient phenomenological dynamic model based on the basic dynamic process of glow discharge and the voltage transfer curve (VTC) to study the dielectric barrier glow discharge (DBGD) pattern. VTC is an important characteristic of DBGD, which plots the change of wall voltage after a discharge as a function of the initial total gap voltage. In the modeling,more » the combined effect of the discharge conditions is included in VTC, and the activation-inhibition effect is expressed by a spatial interaction term. Besides, the model reduces the dimensionality of the system by just considering the integration effect of current flow. All these greatly facilitate the construction of this model. Numerical simulations turn out to be in good accordance with our previous fluid modeling and experimental result.« less
The isotopic effects of electron transfer: An explanation for Fe isotope fractionation in nature
NASA Astrophysics Data System (ADS)
Kavner, Abby; Bonet, François; Shahar, Anat; Simon, Justin; Young, Edward
2005-06-01
Isotope fractionation of electroplated Fe was measured as a function of applied electrochemical potential. As plating voltage was varied from -0.9 V to 2.0 V, the isotopic signature of the electroplated iron became depleted in heavy Fe, with δ 56Fe values (relative to IRMM-14) ranging from -0.18(±0.02) to -2.290(±0.006) ‰, and corresponding δ 57Fe values of -0.247(±0.014) and -3.354(±0.019) ‰. This study demonstrates that there is a voltage-dependent isotope fractionation associated with the reduction of iron. We show that Marcus's theory for the kinetics of electron transfer can be extended to include the isotope effects of electron transfer, and that the extended theory accounts for the voltage dependence of Fe isotope fractionation. The magnitude of the electrochemically-induced fractionation is similar to that of Fe reduction by certain bacteria, suggesting that similar electrochemical processes may be responsible for biogeochemical Fe isotope effects. Charge transfer is a fundamental physicochemical process involving Fe as well as other transition metals with multiple isotopes. Partitioning of isotopes among elements with varying redox states holds promise as a tool in a wide range of the Earth and environmental sciences, biology, and industry.
Modeling Current Transfer from PV Modules Based on Meteorological Data
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hacke, Peter; Smith, Ryan; Kurtz, Sarah
2016-11-21
Current transferred from the active cell circuit to ground in modules undergoing potential-induced degradation (PID) stress is analyzed with respect to meteorological data. Duration and coulombs transferred as a function of whether the module is wet (from dew or rain) or the extent of uncondensed surface humidity are quantified based on meteorological indicators. With this, functions predicting the mode and rate of coulomb transfer are developed for use in estimating the relative PID stress associated with temperature, moisture, and system voltage in any climate. Current transfer in a framed crystalline silicon module is relatively high when there is no condensedmore » water on the module, whereas current transfer in a thin-film module held by edge clips is not, and displays a greater fraction of coulombs transferred when wet compared to the framed module in the natural environment.« less
Analysis, design, and control of a transcutaneous power regulator for artificial hearts.
Qianhong Chen; Siu Chung Wong; Tse, C K; Xinbo Ruan
2009-02-01
Based on a generic transcutaneous transformer model, a remote power supply using a resonant topology for use in artificial hearts is analyzed and designed for easy controllability and high efficiency. The primary and secondary windings of the transcutaneous transformer are positioned outside and inside the human body, respectively. In such a transformer, the alignment and gap may change with external positioning. As a result, the coupling coefficient of the transcutaneous transformer is also varying, and so are the two large leakage inductances and the mutual inductance. Resonant-tank circuits with varying resonant-frequency are formed from the transformer inductors and external capacitors. For a given range of coupling coefficients, an operating frequency corresponding to a particular coupling coefficient can be found, for which the voltage transfer function is insensitive to load. Prior works have used frequency modulation to regulate the output voltage under varying load and transformer coupling. The use of frequency modulation may require a wide control frequency range which may extend well above the load insensitive frequency. In this paper, study of the input-to-output voltage transfer function is carried out, and a control method is proposed to lock the switching frequency at just above the load insensitive frequency for optimized efficiency at heavy loads. Specifically, operation at above resonant of the resonant circuits is maintained under varying coupling-coefficient. Using a digital-phase-lock-loop (PLL), zero-voltage switching is achieved in a full-bridge converter which is also programmed to provide output voltage regulation via pulsewidth modulation (PWM). A prototype transcutaneous power regulator is built and found to to perform excellently with high efficiency and tight regulation under variations of the alignment or gap of the transcutaneous transformer, load and input voltage.
NASA Astrophysics Data System (ADS)
Bagherzadeh-Nobari, S.; Hosseini-Istadeh, K.; Kalantarinejad, R.; Elahi, S. M.; Shokri, A. A.
2018-03-01
Our aim is to study theoretically, the sensitivity of a hydrogen sulfide gas sensor, with regard to electrical conductance behavior. Our senor consists of a semiconductor single-wall carbon nanotube (SWCNT), functionalized with palladium nanoclusters, sandwiched between two gold electrodes. Initially, we have computed the optimized structure of the sensor, via molecular dynamic simulations. Then by using non-equilibrium Green's function method, combined with density functional theory, the electronic and transport properties of the sensor were calculated, and compared before and after adsorption of H2S gas, at different bias voltages. The highest sensitivity is achieved at 40 mV bias voltage. In this bias voltage, H2S gas adsorption causes a significant decrease of current, because as a result of charge transfer from the CNT and palladium nanoclusters, to H2S gas, majority carriers (electrons) decrease. The results show that CNT decorated with palladium nanoclusters can be a promising candidate in gas-sensorics.
Enhancement of Spin-transfer torque switching via resonant tunneling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chatterji, Niladri; Tulapurkar, Ashwin A.; Muralidharan, Bhaskaran
We propose the use of resonant tunneling as a route to enhance the spin-transfer torque switching characteristics of magnetic tunnel junctions. The proposed device structure is a resonant tunneling magnetic tunnel junction based on a MgO-semiconductor heterostructure sandwiched between a fixed magnet and a free magnet. Using the non-equilibrium Green's function formalism coupled self consistently with the Landau-Lifshitz-Gilbert-Slonczewski equation, we demonstrate enhanced tunnel magneto-resistance characteristics as well as lower switching voltages in comparison with traditional trilayer devices. Two device designs based on MgO based heterostructures are presented, where the physics of resonant tunneling leads to an enhanced spin transfer torquemore » thereby reducing the critical switching voltage by up to 44%. It is envisioned that the proof-of-concept presented here may lead to practical device designs via rigorous materials and interface studies.« less
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Quench dynamics in superconducting nanojunctions: Metastability and dynamical Yang-Lee zeros
NASA Astrophysics Data System (ADS)
Souto, R. Seoane; Martín-Rodero, A.; Yeyati, A. Levy
2017-10-01
We study the charge transfer dynamics following the formation of a phase or voltage biased superconducting nanojunction using a full counting statistics analysis. We demonstrate that the evolution of the zeros of the generating function allows one to identify the population of different many body states much in the same way as the accumulation of Yang-Lee zeros of the partition function in equilibrium statistical mechanics is connected to phase transitions. We give an exact expression connecting the dynamical zeros to the charge transfer cumulants and discuss when an approximation based on "dominant" zeros is valid. We show that, for generic values of the parameters, the system gets trapped into a metastable state characterized by a nonequilibrium population of the many body states which is dependent on the initial conditions. We study in particular the effect of the switching rates in the dynamics showing that, in contrast to intuition, the deviation from thermal equilibrium increases for the slower rates. In the voltage biased case the steady state is reached independent of the initial conditions. Our method allows us to obtain accurate results for the steady state current and noise in quantitative agreement with steady state methods developed to describe the multiple Andreev reflections regime. Finally, we discuss the system dynamics after a sudden voltage drop showing the possibility of tuning the many body states population by an appropriate choice of the initial voltage, providing a feasible experimental way to access the quench dynamics and control the state of the system.
Sensor Authentication: Embedded Processor Code
DOE Office of Scientific and Technical Information (OSTI.GOV)
Svoboda, John
2012-09-25
Described is the c code running on the embedded Microchip 32bit PIC32MX575F256H located on the INL developed noise analysis circuit board. The code performs the following functions: Controls the noise analysis circuit board preamplifier voltage gains of 1, 10, 100, 000 Initializes the analog to digital conversion hardware, input channel selection, Fast Fourier Transform (FFT) function, USB communications interface, and internal memory allocations Initiates high resolution 4096 point 200 kHz data acquisition Computes complex 2048 point FFT and FFT magnitude. Services Host command set Transfers raw data to Host Transfers FFT result to host Communication error checking
An improved push-pull voltage fed converter using a tapped output-filter inductor
NASA Technical Reports Server (NTRS)
Wester, G. W.
1983-01-01
A new concept of using a tapped output-filter inductor and an auxiliary commutating diode to reduce the likelihood of transformer core saturation in a push-pull, voltage-fed converter is presented. The linearized circuit model and transfer functions are derived with a hybrid approach using both state-space and circuit averaging. Operation of the new converter - including parasitic effects - is discussed, and a design equation for inductor tap ratio is established. It is predicted and experimentally confirmed that the new converter has more symmetrical transformer core operation, and the potential exits for lower transistor turnon current and reduced transistor voltage stress. These benefits reduce switching loss and enhance transistor reliability.
NASA Astrophysics Data System (ADS)
Ileana, Ioan; Risteiu, Mircea; Marc, Gheorghe
2016-12-01
This paper is a part of our research dedicated to high power LED lamps designing. The boost-up selected technology wants to meet driver producers' tendency in the frame of efficiency and disturbances constrains. In our work we used modeling and simulation tools for implementing scenarios of the driver work when some controlling functions are executed (output voltage/ current versus input voltage and fixed switching frequency, input and output electric power transfer versus switching frequency, transient inductor voltage analysis, and transient out capacitor analysis). Some electrical and thermal stress conditions are also analyzed. Based on these aspects, a high reliable power LED driver has been designed.
NASA Astrophysics Data System (ADS)
Zoka, Yoshifumi; Yorino, Naoto; Kawano, Koki; Suenari, Hiroyasu
This paper proposes a fast computation method for Available Transfer Capability (ATC) with respect to thermal and voltage magnitude limits. In the paper, ATC is formulated as an optimization problem. In order to obtain the efficiency for the N-1 outage contingency calculations, linear sensitivity methods are applied for screening and ranking all contingency selections with respect to the thermal and voltage magnitude limits margin to identify the severest case. In addition, homotopy functions are used for the generator QV constrains to reduce the maximum error of the linear estimation. Then, the Primal-Dual Interior Point Method (PDIPM) is used to solve the optimization problem for the severest case only, in which the solutions of ATC can be obtained efficiently. The effectiveness of the proposed method is demonstrated through IEEE 30, 57, 118-bus systems.
Robust Electrical Transfer System (RETS) for Solar Array Drive Mechanism SlipRing Assembly
NASA Astrophysics Data System (ADS)
Bommottet, Daniel; Bossoney, Luc; Schnyder, Ralph; Howling, Alan; Hollenstein, Christoph
2013-09-01
Demands for robust and reliable power transmission systems for sliprings for SADM (Solar Array Drive Mechanism) are increasing steadily. As a consequence, it is required to know their performances regarding the voltage breakdown limit.An understanding of the overall shape of the breakdown voltage versus pressure curve is established, based on experimental measurements of DC (Direct Current) gas breakdown in complex geometries compared with a numerical simulation model.In addition a detailed study was made of the functional behaviour of an entire wing of satellite in a like- operational mode, comprising the solar cells, the power transmission lines, the SRA (SlipRing Assembly), the power S3R (Sequential Serial/shunt Switching Regulators) and the satellite load to simulate the electrical power consumption.A test bench able to measure automatically the: a)breakdown voltage versus pressure curve and b)the functional switching performances, was developed and validated.
A Transfer Voltage Simulation Method for Generator Step Up Transformers
NASA Astrophysics Data System (ADS)
Funabashi, Toshihisa; Sugimoto, Toshirou; Ueda, Toshiaki; Ametani, Akihiro
It has been found from measurements for 13 sets of GSU transformers that a transfer voltage of a generator step-up (GSU) transformer involves one dominant oscillation frequency. The frequency can be estimated from the inductance and capacitance values of the GSU transformer low-voltage-side. This observation has led to a new method for simulating a GSU transformer transfer voltage. The method is based on the EMTP TRANSFORMER model, but stray capacitances are added. The leakage inductance and the magnetizing resistance are modified using approximate curves for their frequency characteristics determined from the measured results. The new method is validated in comparison with the measured results.
NASA Astrophysics Data System (ADS)
Christensen, David B.; Basaeri, Hamid; Roundy, Shad
2017-12-01
In acoustic power transfer systems, a receiver is displaced from a transmitter by an axial depth, a lateral offset (alignment), and a rotation angle (orientation). In systems where the receiver’s position is not fixed, such as a receiver implanted in biological tissue, slight variations in depth, orientation, or alignment can cause significant variations in the received voltage and power. To address this concern, this paper presents a computationally efficient technique to model the effects of depth, orientation, and alignment via ray tracing (DOART) on received voltage and power in acoustic power transfer systems. DOART combines transducer circuit equivalent models, a modified version of Huygens principle, and ray tracing to simulate pressure wave propagation and reflection between a transmitter and a receiver in a homogeneous medium. A reflected grid method is introduced to calculate propagation distances, reflection coefficients, and initial vectors between a point on the transmitter and a point on the receiver for an arbitrary number of reflections. DOART convergence and simulation time per data point is discussed as a function of the number of reflections and elements chosen. Finally, experimental data is compared to DOART simulation data in terms of magnitude and shape of the received voltage signal.
NASA Astrophysics Data System (ADS)
Zhang, Yulong; Yang, Shihai; Gu, Bozhong
2016-10-01
This paper puts forward a electronic fault diagnose method focusing on large-diameter astronomical telescope's armature winding, and ascertains if it is the resistance or inductance which is out of order. When it comes to armature winding's electronic fault, give the angular position a step signal, and compare the outputs of five models of normal, larger-resistance, smaller-resistance, larger-inductance and smaller-inductance, so we can position the fault. Firstly, we ascertain the transfer function of the angular position to the armature voltage, to analysis the output of armature voltage when the angular position's input is step signal. Secondly, ascertain the different armature currents' characteristics after armature voltage pass through different armature models. Finally, basing on the characteristics, we design two strategies of resistance and inductance separately. The author use MATLAB/Simulink function to model and emulate with the hardware parameters of the 2.5m-caliber telescope, which China and France developed cooperatively for Russia. Meanwhile, the author add a white noise disturbance to the armature voltage, the result shows its feasibility under a certain sized disturbance.
Gating Charge Calculations by Computational Electrophysiology Simulations.
Machtens, Jan-Philipp; Briones, Rodolfo; Alleva, Claudia; de Groot, Bert L; Fahlke, Christoph
2017-04-11
Electrical cell signaling requires adjustment of ion channel, receptor, or transporter function in response to changes in membrane potential. For the majority of such membrane proteins, the molecular details of voltage sensing remain insufficiently understood. Here, we present a molecular dynamics simulation-based method to determine the underlying charge movement across the membrane-the gating charge-by measuring electrical capacitor properties of membrane-embedded proteins. We illustrate the approach by calculating the charge transfer upon membrane insertion of the HIV gp41 fusion peptide, and validate the method on two prototypical voltage-dependent proteins, the Kv1.2 K + channel and the voltage sensor of the Ciona intestinalis voltage-sensitive phosphatase, against experimental data. We then use the gating charge analysis to study how the T1 domain modifies voltage sensing in Kv1.2 channels and to investigate the voltage dependence of the initial binding of two Na + ions in Na + -coupled glutamate transporters. Our simulation approach quantifies various mechanisms of voltage sensing, enables direct comparison with experiments, and supports mechanistic interpretation of voltage sensitivity by fractional amino acid contributions. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Mishima, Eriko; Sato, Yoko; Nanatani, Kei; Hoshi, Naomi; Lee, Jong-Kook; Schiller, Nina; von Heijne, Gunnar; Sakaguchi, Masao; Uozumi, Nobuyuki
2016-12-01
Voltage-dependent K + (K V ) channels control K + permeability in response to shifts in the membrane potential. Voltage sensing in K V channels is mediated by the positively charged transmembrane domain S4. The best-characterized K V channel, KvAP, lacks the distinct hydrophilic region corresponding to the S3-S4 extracellular loop that is found in other K + channels. In the present study, we evaluated the topogenic properties of the transmembrane regions within the voltage-sensing domain in KvAP. S3 had low membrane insertion activity, whereas S4 possessed a unique type-I signal anchor (SA-I) function, which enabled it to insert into the membrane by itself. S4 was also found to function as a stop-transfer signal for retention in the membrane. The length and structural nature of the extracellular S3-S4 loop affected the membrane insertion of S3 and S4, suggesting that S3 membrane insertion was dependent on S4. Replacement of charged residues within the transmembrane regions with residues of opposite charge revealed that Asp 72 in S2 and Glu 93 in S3 contributed to membrane insertion of S3 and S4, and increased the stability of S4 in the membrane. These results indicate that the SA-I function of S4, unique among K + channels studied to date, promotes the insertion of S3 into the membrane, and that the charged residues essential for voltage sensing contribute to the membrane-insertion of the voltage sensor domain in KvAP. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Magnetic field dependence of spin torque switching in nanoscale magnetic tunnel junctions
NASA Astrophysics Data System (ADS)
Yang, Liu; Rowlands, Graham; Katine, Jordan; Langer, Juergen; Krivorotov, Ilya
2012-02-01
Magnetic random access memory based on spin transfer torque effect in nanoscale magnetic tunnel junctions (STT-RAM) is emerging as a promising candidate for embedded and stand-alone computer memory. An important performance parameter of STT-RAM is stability of its free magnetic layer against thermal fluctuations. Measurements of the free layer switching probability as a function of sub-critical voltage at zero effective magnetic field (read disturb rate or RDR measurements) have been proposed as a method for quantitative evaluation of the free layer thermal stability at zero voltage. In this presentation, we report RDR measurement as a function of external magnetic field, which provide a test of the RDR method self-consistency and reliability.
Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli
NASA Astrophysics Data System (ADS)
Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.
2015-12-01
Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.
NASA Astrophysics Data System (ADS)
Samba, R.; Herrmann, T.; Zeck, G.
2015-02-01
Objective. The aim of this study was to compare two different microelectrode materials—the conductive polymer composite poly-3,4-ethylenedioxythiophene (PEDOT)-carbon nanotube(CNT) and titanium nitride (TiN)—at activating spikes in retinal ganglion cells in whole mount rat retina through stimulation of the local retinal network. Stimulation efficacy of the microelectrodes was analyzed by comparing voltage, current and transferred charge at stimulation threshold. Approach. Retinal ganglion cell spikes were recorded by a central electrode (30 μm diameter) in the planar grid of an electrode array. Extracellular stimulation (monophasic, cathodic, 0.1-1.0 ms) of the retinal network was performed using constant voltage pulses applied to the eight surrounding electrodes. The stimulation electrodes were equally spaced on the four sides of a square (400 × 400 μm). Threshold voltage was determined as the pulse amplitude required to evoke network-mediated ganglion cell spiking in a defined post stimulus time window in 50% of identical stimulus repetitions. For the two electrode materials threshold voltage, transferred charge at threshold, maximum current and the residual current at the end of the pulse were compared. Main results. Stimulation of retinal interneurons using PEDOT-CNT electrodes is achieved with lower stimulation voltage and requires lower charge transfer as compared to TiN. The key parameter for effective stimulation is a constant current over at least 0.5 ms, which is obtained by PEDOT-CNT electrodes at lower stimulation voltage due to its faradaic charge transfer mechanism. Significance. In neuroprosthetic implants, PEDOT-CNT may allow for smaller electrodes, effective stimulation in a safe voltage regime and lower energy-consumption. Our study also indicates, that the charge transferred at threshold or the charge injection capacity per se does not determine stimulation efficacy.
Structural Mechanism of Voltage-Dependent Gating in an Isolated Voltage-Sensing Domain
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos; Hulse, Raymond E.; Roux, Benoit; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-01-01
SUMMARY The transduction of transmembrane electric fields into protein motion plays an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSD) carry out these functions through reorientations of S4 helix with discrete gating charges. Here, crystal structures of the VSD from Ci-VSP were determined in both, active (Up) and resting (Down) conformations. The S4 undergoes a ~5 Å displacement along its main axis accompanied by a ~60o rotation, consistent with the helix-screw gating mechanism. This movement is stabilized by a change in countercharge partners in helices S1 and S3, generating an estimated net charge transfer of ~1 eo. Gating charges move relative to a “hydrophobic gasket” that electrically divides intra and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent cellular activities. PMID:24487958
NASA Astrophysics Data System (ADS)
Meyer, Toni; Körner, Christian; Vandewal, Koen; Leo, Karl
2018-04-01
In two terminal tandem solar cells, the current density - voltage (jV) characteristic of the individual subcells is typically not directly measurable, but often required for a rigorous device characterization. In this work, we reconstruct the jV-characteristic of organic solar cells from measurements of the external quantum efficiency under applied bias voltages and illumination. We show that it is necessary to perform a bias irradiance variation at each voltage and subsequently conduct a mathematical correction of the differential to the absolute external quantum efficiency to obtain an accurate jV-characteristic. Furthermore, we show that measuring the external quantum efficiency as a function of voltage for a single bias irradiance of 0.36 AM1.5g equivalent sun provides a good approximation of the photocurrent density over voltage curve. The method is tested on a selection of efficient, common single-junctions. The obtained conclusions can easily be transferred to multi-junction devices with serially connected subcells.
Response of pMOS dosemeters on gamma-ray irradiation during its re-use.
Pejovic, Milic M; Pejovic, Momcilo M; Jaksic, Aleksandar B
2013-08-01
Response of pMOS dosemeters during two successive irradiations with gamma-ray irradiation to a dose of 35 Gy and annealing at room and elevated temperature has been studied. The response was followed on the basis of threshold voltage shift, determined from transfer characteristics, as a function of absorbed dose or annealing time. It was shown that the threshold voltage shifts during first and second irradiation for the gate bias during irradiation of 5 and 2.5 V insignificantly differ although complete fading was not achieved after the first cycle of annealing. In order to analyse the defects formed in oxide and at the interface during irradiation and annealing, which are responsible for threshold voltage shift, midgap and charge-pumping techniques were used. It was shown that during first irradiation and annealing a dominant influence to threshold voltage shift is made by fixed oxide traps, while at the beginning of the second annealing cycle, threshold voltage shift is a consequence of both fixed oxide traps and slow switching traps.
Contact Force Compensated Thermal Stimulators for Holistic Haptic Interfaces.
Sim, Jai Kyoung; Cho, Young-Ho
2016-05-01
We present a contact force compensated thermal stimulator that can provide a consistent tempera- ture sensation on the human skin independent of the contact force between the thermal stimulator and the skin. Previous passive thermal stimulators were not capable of providing a consistent tem- perature on the human skin even when using identical heat source voltage due to an inconsistency of the heat conduction, which changes due to the force-dependent thermal contact resistance. We propose a force-based feedback method that monitors the contact force and controls the heat source voltage according to this contact force, thus providing consistent temperature on the skin. We composed a heat circuit model equivalent to the skin heat-transfer rate as it is changed by the contact forces; we obtained the optimal voltage condition for the constant skin heat-transfer rate independent of the contact force using a numerical estimation simulation tool. Then, in the experiment, we heated real human skin at the obtained heat source voltage condition, and investigated the skin heat transfer-rate by measuring the skin temperature at various times at different levels of contact force. In the numerical estimation results, the skin heat-transfer rate for the contact forces showed a linear profile in the contact force range of 1-3 N; from this profile we obtained the voltage equation for heat source control. In the experimental study, we adjusted the heat source voltage according to the contact force based on the obtained equation. As a result, without the heat source voltage control for the contact forces, the coefficients of variation (CV) of the skin heat-transfer rate in the contact force range of 1-3 N was found to be 11.9%. On the other hand, with the heat source voltage control for the contact forces, the CV of the skin heat-transfer rate in the contact force range of 1-3 N was found to be barely 2.0%, which indicate an 83.2% improvement in consistency compared to the skin heat-transfer rate without the heat source voltage control. The present technique provides a consistent temperature sensation on the human skin independent of the body movement environment; therefore, it has high potential for use in holistic haptic interfaces that have thermal displays.
NASA Astrophysics Data System (ADS)
Sakamoto, Yuri; Uemura, Kohei; Ikuta, Takashi; Maehashi, Kenzo
2018-04-01
We have succeeded in fabricating a hydrogen gas sensor based on palladium-modified graphene field-effect transistors (FETs). The negative-voltage shift in the transfer characteristics was observed with exposure to hydrogen gas, which was explained by the change in work function. The hydrogen concentration dependence of the voltage shift was investigated using graphene FETs with palladium deposited by three different evaporation processes. The results indicate that the hydrogen detection sensitivity of the palladium-modified graphene FETs is strongly dependent on the palladium configuration. Therefore, the palladium-modified graphene FET is a candidate for breath analysis.
Adamatzky, Andrew
2014-08-01
In experimental laboratory studies we evaluate a possibility of making electrical wires from living plants. In scoping experiments we use lettuce seedlings as a prototype model of a plant wire. We approximate an electrical potential transfer function by applying direct current voltage to the lettuce seedlings and recording output voltage. We analyse oscillation frequencies of the output potential and assess noise immunity of the plant wires. Our findings will be used in future designs of self-growing wetware circuits and devices, and integration of plant-based electronic components into future and emergent bio-hybrid systems. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Xia, Guangqing; Han, Yajie; Chen, Liuwei; Wei, Yanming; Yu, Yang; Chen, Maolin
2018-06-01
The interaction between the solar wind plasma and the bias voltage of long tethers is the basic mechanism of the electric sail thruster. The momentum transfer process between the solar wind plasma and electric tethers was investigated using a 2D full particle PIC method. The coupled electric field distribution and deflected ion trajectory under different bias voltages were compared, and the influence of bias voltage on momentum transfer process was analyzed. The results show that the high potential of the bias voltage of long tethers will slow down, stagnate, reflect and deflect a large number of ions, so that ion cavities are formed in the vicinity of the tether, and the ions will transmit the axial momentum to the sail tethers to produce the thrust. Compared to the singe tether, double tethers show a better thrust performance.
Bertoluzzi, Luca; Bisquert, Juan
2017-01-05
The optimization of solar energy conversion devices relies on their accurate and nondestructive characterization. The small voltage perturbation techniques of impedance spectroscopy (IS) have proven to be very powerful to identify the main charge storage modes and charge transfer processes that control device operation. Here we establish the general connection between IS and light modulated techniques such as intensity modulated photocurrent (IMPS) and photovoltage spectroscopies (IMVS) for a general system that converts light to energy. We subsequently show how these techniques are related to the steady-state photocurrent and photovoltage and the external quantum efficiency. Finally, we express the IMPS and IMVS transfer functions in terms of the capacitive and resistive features of a general equivalent circuit of IS for the case of a photoanode used for solar fuel production. We critically discuss how much knowledge can be extracted from the combined use of those three techniques.
NASA Astrophysics Data System (ADS)
Velev, Julian P.; Merodio, Pablo; Pollack, Cesar; Kalitsov, Alan; Chshiev, Mairbek; Kioussis, Nicholas
2017-12-01
Using model calculations, we demonstrate a very high level of control of the spin-transfer torque (STT) by electric field in multiferroic tunnel junctions with composite dielectric/ferroelectric barriers. We find that, for particular device parameters, toggling the polarization direction can switch the voltage-induced part of STT between a finite value and a value close to zero, i.e. quench and release the torque. Additionally, we demonstrate that under certain conditions the zero-voltage STT, i.e. the interlayer exchange coupling, can switch sign with polarization reversal, which is equivalent to reversing the magnetic ground state of the tunnel junction. This bias- and polarization-tunability of the STT could be exploited to engineer novel functionalities such as softening/hardening of the bit or increasing the signal-to-noise ratio in magnetic sensors, which can have important implications for magnetic random access memories or for combined memory and logic devices.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xantheas, S. S.
2016-12-01
The structure and properties of the aqueous proton is of fundamental interest in many areas of chemistry and biology. Acids and bases are molecules that are able to transfer (donate / accept) a proton according to Brønsted and Lowry, a process that was further explained by Lewis in terms of changes in their electronic structure in an attempt to offer a generalization of the Arrhenius theory. Simple proton transfers or the ones coupled to an electron transfer determine speciation, valence and reactivity in aqueous media and explain electrochemical processes, while voltage-gated proton channels have severe implications to the function ofmore » a number of tissues and species.« less
NASA Astrophysics Data System (ADS)
Wang, Yucheng; Zhang, Yuming; Liu, Yintao; Pang, Tiqiang; Hu, Ziyang; Zhu, Yuejin; Luan, Suzhen; Jia, Renxu
2017-11-01
Two types of perovskite (with and without doping of PCBM) based metal-oxide-semiconductor (MOS) gate-controlled devices were fabricated and characterized. The study of the interfacial characteristics and charge transfer mechanisms by doping of PCBM were analyzed by material and electrical measurements. Doping of PCBM does not affect the size and crystallinity of perovskite films, but has an impact on carrier extraction in perovskite MOS devices. The electrical hysteresis observed in capacitance-voltage and current-voltage measurements can be alleviated by doping of PCBM. Experimental results demonstrate that extremely low trap densities are found for the perovskite device without doping, while the doped sample leads to higher density of interface state. Three mechanisms including Ohm’s law, trap-filled-limit (TFL) emission, and child’s law were used to analyze possible charge transfer mechanisms. Ohm’s law mechanism is well suitable for charge transfer of both the perovskite MOS devices under light condition at large voltage, while TFL emission well addresses the behavior of charge transfer under dark at small voltage. This change of charge transfer mechanism is attributed to the impact of the ion drift within perovskites.
Kouno, Takuya; Kuga, Noriyuki; Enzaki, Masahiro; Yamashita, Yuuki; Kitazato, Yumiko; Shimotabira, Haruhiko; Jinnouchi, Takashi; Kusuhara, Kazuo; Kawamura, Shinji
2015-04-01
The aim of this study was to reduce the exposed dose of radiotherapy treatment planning computed tomography (CT) by using low tube voltage technique. We used tube voltages of 80 kV, 100 kV, and 120 kV, respectively. First, we evaluated exposure dose with CT dose index (CTDI) for each voltage. Second, we compared image quality indexes such as modulation transfer function (MTF), noise power spectrum (NPS), and contrast to noise ratio (CNR) of phantom images with each voltage. Third, CT to electron density tables were measured in three voltages and monitor unit value was calculated along with clinical cases. Finally, CT surface exposed dose of chest skin was measured by thermoluminescent dosimeter (TLD). In image evaluation MTF and NPS were approximately equal; CNR slightly decreased, 2.0% for 100 kV. We performed check radiation dose accuracy for each tube voltage with each model phantom. As a result, the difference of MU value was not accepted. Finally, compared with 120 kV, CTDIvol and TLD value showed markedly decreased radiation dose, 60% for 80 kV and 30% for 100 kV. Using a technique with low tube voltages, especially 100 kV, is useful in radiotherapy treatment planning to obtain 20% dose reduction without compromising 120 kV image quality.
NASA Astrophysics Data System (ADS)
Seo, Satoshi; Shitagaki, Satoko; Ohsawa, Nobuharu; Inoue, Hideko; Suzuki, Kunihiko; Nowatari, Hiromi; Yamazaki, Shunpei
2014-04-01
A novel approach to enhance the power efficiency of an organic light-emitting diode (OLED) by employing energy transfer from an exciplex to a phosphorescent emitter is reported. It was found that excitation energy of an exciplex formed between an electron-transporting material with a π-deficient quinoxaline moiety and a hole-transporting material with aromatic amine structure can be effectively transferred to a phosphorescent iridium complex in an emission layer of a phosphorescent OLED. Moreover, such an exciplex formation increases quantum efficiency and reduces drive voltage. A highly efficient, low-voltage, and long-life OLED based on this energy transfer is also demonstrated. This OLED device exhibited extremely high external quantum efficiency of 31% even without any attempt to enhance light outcoupling and also achieved a low drive voltage of 2.8 V and a long lifetime of approximately 1,000,000 h at a luminance of 1,000 cd/m2.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Kulkarni, Rishikesh U; Yin, Hang; Pourmandi, Narges; James, Feroz; Adil, Maroof M; Schaffer, David V; Wang, Yi; Miller, Evan W
2017-02-17
Voltage imaging with fluorescent dyes offers promise for interrogating the complex roles of membrane potential in coordinating the activity of neurons in the brain. Yet, low sensitivity often limits the broad applicability of optical voltage indicators. In this paper, we use molecular dynamics (MD) simulations to guide the design of new, ultrasensitive fluorescent voltage indicators that use photoinduced electron transfer (PeT) as a voltage-sensing switch. MD simulations predict an approximately 16% increase in voltage sensitivity resulting purely from improved alignment of dye with the membrane. We confirm this theoretical finding by synthesizing 9 new voltage-sensitive (VoltageFluor, or VF) dyes and establishing that all of them display the expected improvement of approximately 19%. This synergistic outworking of theory and experiment enabled computational and theoretical estimation of VF dye orientation in lipid bilayers and has yielded the most sensitive PeT-based VF dye to date. We use this new voltage indicator to monitor voltage spikes in neurons from rat hippocampus and human pluripotent-stem-cell-derived dopaminergic neurons.
Frequency comb generation in a silicon ring resonator modulator.
Demirtzioglou, Iosif; Lacava, Cosimo; Bottrill, Kyle R H; Thomson, David J; Reed, Graham T; Richardson, David J; Petropoulos, Periklis
2018-01-22
We report on the generation of an optical comb of highly uniform in power frequency lines (variation less than 0.7 dB) using a silicon ring resonator modulator. A characterization involving the measurement of the complex transfer function of the ring is presented and five frequency tones with a 10-GHz spacing are produced using a dual-frequency electrical input at 10 and 20 GHz. A comb shape comparison is conducted for different modulator bias voltages, indicating optimum operation at a small forward-bias voltage. A time-domain measurement confirmed that the comb signal was highly coherent, forming 20.3-ps-long pulses.
NASA Technical Reports Server (NTRS)
Aslam, Shahid; Jones, Hollis H.
2011-01-01
Care must always be taken when performing noise measurements on high-Tc superconducting materials to ensure that the results are not from the measurement system itself. One situation likely to occur is with low noise transformers. One of the least understood devices, it provides voltage gain for low impedance inputs (< 100 ), e.g., YBaCuO and GdBaCuO thin films, with comparatively lower noise levels than other devices for instance field effect and bipolar junction transistors. An essential point made in this paper is that because of the complex relationships between the transformer ports, input impedance variance alters the transformer s transfer function in particular, the low frequency cutoff shift. The transfer of external and intrinsic transformer noise to the output along with optimization and precautions are treated; all the while, we will cohesively connect the transfer function shift, the load impedance, and the actual noise at the transformer output.
Inductance parameter design based seamless transfer strategy for three-phase converter in microgrid
NASA Astrophysics Data System (ADS)
Zhao, Guopeng; Zhou, Xinwei; Jiang, Chao; Lu, Yi; Wang, Yanjie
2018-06-01
During the operation of microgrid, especially when the unplanned islanding occurs, the voltage of the point of common coupling (PCC) needs to be maintained within a certain range, otherwise it would affect the operation of loads in microgrid. This paper proposes a seamless transfer strategy based on the inductance parameter design for three-phase converter in microgrid, which considers both the fundamental component of voltage on the inductance and the ripple current in the inductance. In grid-connected mode, the PCC voltage is supported by the grid. When the unplanned islanding occurs, the PCC voltage is affected by the output voltage of converter and the voltage on the inductance. According to the single phase equivalent circuit, analyzing the phasor diagram of voltage and current vector, considering the prescribed range of PCC voltage and satisfying the requirement of the magnitude of ripple current, the inductance parameter is designed. At last, the simulation result shows that the designed inductance can ensure the PCC voltage does not exceed the prescribed range and restrain the ripple current.
Linking results of key and supplementary comparisons of AC/DC voltage transfer references
NASA Astrophysics Data System (ADS)
Velychko, Oleh
2018-04-01
A regional key comparison (KC) COOMET.EM-K6.a and a supplementary comparison (SC) COOMET.EM-S1 of AC/DC voltage transfer references were conducted between participating laboratories from the Eurasian region. Measurements were made over the period 2004-2014. The results showed good agreement between all but one of the participating laboratories. The proposed procedure of linking results of key and SCs of regional metrology organization of AC/DC voltage transfer references is presented. Linking results is realized for COOMET.EM-K6.a and CCEM-K6.a KCs, and for COOMET.EM-K6.a KC and COOMET.EM-S1 SC.
Margin and sensitivity methods for security analysis of electric power systems
NASA Astrophysics Data System (ADS)
Greene, Scott L.
Reliable operation of large scale electric power networks requires that system voltages and currents stay within design limits. Operation beyond those limits can lead to equipment failures and blackouts. Security margins measure the amount by which system loads or power transfers can change before a security violation, such as an overloaded transmission line, is encountered. This thesis shows how to efficiently compute security margins defined by limiting events and instabilities, and the sensitivity of those margins with respect to assumptions, system parameters, operating policy, and transactions. Security margins to voltage collapse blackouts, oscillatory instability, generator limits, voltage constraints and line overloads are considered. The usefulness of computing the sensitivities of these margins with respect to interarea transfers, loading parameters, generator dispatch, transmission line parameters, and VAR support is established for networks as large as 1500 buses. The sensitivity formulas presented apply to a range of power system models. Conventional sensitivity formulas such as line distribution factors, outage distribution factors, participation factors and penalty factors are shown to be special cases of the general sensitivity formulas derived in this thesis. The sensitivity formulas readily accommodate sparse matrix techniques. Margin sensitivity methods are shown to work effectively for avoiding voltage collapse blackouts caused by either saddle node bifurcation of equilibria or immediate instability due to generator reactive power limits. Extremely fast contingency analysis for voltage collapse can be implemented with margin sensitivity based rankings. Interarea transfer can be limited by voltage limits, line limits, or voltage stability. The sensitivity formulas presented in this thesis apply to security margins defined by any limit criteria. A method to compute transfer margins by directly locating intermediate events reduces the total number of loadflow iterations required by each margin computation and provides sensitivity information at minimal additional cost. Estimates of the effect of simultaneous transfers on the transfer margins agree well with the exact computations for a network model derived from a portion of the U.S grid. The accuracy of the estimates over a useful range of conditions and the ease of obtaining the estimates suggest that the sensitivity computations will be of practical value.
Intrinsic non-radiative voltage losses in fullerene-based organic solar cells
NASA Astrophysics Data System (ADS)
Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Fan, Yeli; Tropiano, Manuel; McGarry, Kathryn A.; Zeika, Olaf; Riede, Moritz K.; Douglas, Christopher J.; Barlow, Stephen; Marder, Seth R.; Neher, Dieter; Spoltore, Donato; Vandewal, Koen
2017-06-01
Organic solar cells demonstrate external quantum efficiencies and fill factors approaching those of conventional photovoltaic technologies. However, as compared with the optical gap of the absorber materials, their open-circuit voltage is much lower, largely due to the presence of significant non-radiative recombination. Here, we study a large data set of published and new material combinations and find that non-radiative voltage losses decrease with increasing charge-transfer-state energies. This observation is explained by considering non-radiative charge-transfer-state decay as electron transfer in the Marcus inverted regime, being facilitated by a common skeletal molecular vibrational mode. Our results suggest an intrinsic link between non-radiative voltage losses and electron-vibration coupling, indicating that these losses are unavoidable. Accordingly, the theoretical upper limit for the power conversion efficiency of single-junction organic solar cells would be reduced to about 25.5% and the optimal optical gap increases to 1.45-1.65 eV, that is, 0.2-0.3 eV higher than for technologies with minimized non-radiative voltage losses.
NASA Astrophysics Data System (ADS)
Imai, Shigeru; Ito, Masato
2018-06-01
In this paper, anomalous single-electron transfer in common-gate quadruple-dot turnstile devices with asymmetric junction capacitances is revealed. That is, the islands have the same total number of excess electrons at high and low gate voltages of the swing that transfers a single electron. In another situation, two electrons enter the islands from the source and two electrons leave the islands for the source and drain during a gate voltage swing cycle. First, stability diagrams of the turnstile devices are presented. Then, sequences of single-electron tunneling events by gate voltage swings are investigated, which demonstrate the above-mentioned anomalous single-electron transfer between the source and the drain. The anomalous single-electron transfer can be understood by regarding the four islands as “three virtual islands and a virtual source or drain electrode of a virtual triple-dot device”. The anomalous behaviors of the four islands are explained by the normal behavior of the virtual islands transferring a single electron and the behavior of the virtual electrode.
Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel.
Wang, Jia-Zeng; Wang, Rui-Zhen
2018-02-01
Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.
Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel
NASA Astrophysics Data System (ADS)
Wang, Jia-Zeng; Wang, Rui-Zhen
2018-02-01
Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.
An analytical model for bio-electronic organic field-effect transistor sensors
NASA Astrophysics Data System (ADS)
Macchia, Eleonora; Giordano, Francesco; Magliulo, Maria; Palazzo, Gerardo; Torsi, Luisa
2013-09-01
A model for the electrical characteristics of Functional-Bio-Interlayer Organic Field-Effect Transistors (FBI-OFETs) electronic sensors is here proposed. Specifically, the output current-voltage characteristics of a streptavidin (SA) embedding FBI-OFET are modeled by means of the analytical equations of an enhancement mode p-channel OFET modified according to an ad hoc designed equivalent circuit that is also independently simulated with pspice. An excellent agreement between the model and the experimental current-voltage output characteristics has been found upon exposure to 5 nM of biotin. A good agreement is also found with the SA OFET parameters graphically extracted from the device transfer I-V curves.
Solar panel acceptance testing using a pulsed solar simulator
NASA Technical Reports Server (NTRS)
Hershey, T. L.
1977-01-01
Utilizing specific parameters as area of an individual cell, number in series and parallel, and established coefficient of current and voltage temperature dependence, a solar array irradiated with one solar constant at AMO and at ambient temperature can be characterized by a current-voltage curve for different intensities, temperatures, and even different configurations. Calibration techniques include: uniformity in area, depth and time, absolute and transfer irradiance standards, dynamic and functional check out procedures. Typical data are given for individual cell (2x2 cm) to complete flat solar array (5x5 feet) with 2660 cells and on cylindrical test items with up to 10,000 cells. The time and energy saving of such testing techniques are emphasized.
Non-Invasive Evaluation of Cephalic Blood Flow in the +Gz Environment
1988-09-25
and the center frequency, COQ , is set by R3 and C1. The transfer function for this BPF is given by: K co„s/Q H(s)=-^ eq.5 S + S(OQ/Q -I- CO...0 where 0 = 20,1.4 < K < 8.6, COQ = 613.2 x 103 rad/s (97.6 kHz), Vout = output voltage, Vin = input voltage, and bandwidth = 7 kHz. To choose the...values of R1 - R4 and C1, these factors were first normalized: COQ = 1 rad/s, C1 = 1F, and R4 = lil. Then R1 = Q/K, R2 = Q, and R3 = 1i^. To denor
Frequency Response of Graphene Electrolyte-Gated Field-Effect Transistors
McVay, Elaine; Palacios, Tomás
2018-01-01
This work develops the first frequency-dependent small-signal model for graphene electrolyte-gated field-effect transistors (EGFETs). Graphene EGFETs are microfabricated to measure intrinsic voltage gain, frequency response, and to develop a frequency-dependent small-signal model. The transfer function of the graphene EGFET small-signal model is found to contain a unique pole due to a resistive element, which stems from electrolyte gating. Intrinsic voltage gain, cutoff frequency, and transition frequency for the microfabricated graphene EGFETs are approximately 3.1 V/V, 1.9 kHz, and 6.9 kHz, respectively. This work marks a critical step in the development of high-speed chemical and biological sensors using graphene EGFETs. PMID:29414868
Towards nanoprinting with metals on graphene.
Melinte, G; Moldovan, S; Hirlimann, C; Liu, X; Bégin-Colin, S; Bégin, D; Banhart, F; Pham-Huu, C; Ersen, O
2015-08-28
Graphene and carbon nanotubes are envisaged as suitable materials for the fabrication of the new generation of nanoelectronics. The controlled patterning of such nanostructures with metal nanoparticles is conditioned by the transfer between a recipient and the surface to pattern. Electromigration under the impact of an applied voltage stands at the base of printing discrete digits at the nanoscale. Here we report the use of carbon nanotubes as nanoreservoirs for iron nanoparticles transfer on few-layer graphene. An initial Joule-induced annealing is required to ensure the control of the mass transfer with the nanotube acting as a 'pen' for the writing process. By applying a voltage, the tube filled with metal nanoparticles can deposit metal on the surface of the graphene sheet at precise locations. The reverse transfer of nanoparticles from the graphene surface to the nanotube when changing the voltage polarity opens the way for error corrections.
Towards nanoprinting with metals on graphene
NASA Astrophysics Data System (ADS)
Melinte, G.; Moldovan, S.; Hirlimann, C.; Liu, X.; Bégin-Colin, S.; Bégin, D.; Banhart, F.; Pham-Huu, C.; Ersen, O.
2015-08-01
Graphene and carbon nanotubes are envisaged as suitable materials for the fabrication of the new generation of nanoelectronics. The controlled patterning of such nanostructures with metal nanoparticles is conditioned by the transfer between a recipient and the surface to pattern. Electromigration under the impact of an applied voltage stands at the base of printing discrete digits at the nanoscale. Here we report the use of carbon nanotubes as nanoreservoirs for iron nanoparticles transfer on few-layer graphene. An initial Joule-induced annealing is required to ensure the control of the mass transfer with the nanotube acting as a `pen' for the writing process. By applying a voltage, the tube filled with metal nanoparticles can deposit metal on the surface of the graphene sheet at precise locations. The reverse transfer of nanoparticles from the graphene surface to the nanotube when changing the voltage polarity opens the way for error corrections.
NASA Astrophysics Data System (ADS)
Khoshkbar Sadigh, Arash
Part I: Dynamic Voltage Restorer In the present power grids, voltage sags are recognized as a serious threat and a frequently occurring power-quality problem and have costly consequence such as sensitive loads tripping and production loss. Consequently, the demand for high power quality and voltage stability becomes a pressing issue. Dynamic voltage restorer (DVR), as a custom power device, is more effective and direct solutions for "restoring" the quality of voltage at its load-side terminals when the quality of voltage at its source-side terminals is disturbed. In the first part of this thesis, a DVR configuration with no need of bulky dc link capacitor or energy storage is proposed. This fact causes to reduce the size of the DVR and increase the reliability of the circuit. In addition, the proposed DVR topology is based on high-frequency isolation transformer resulting in the size reduction of transformer. The proposed DVR circuit, which is suitable for both low- and medium-voltage applications, is based on dc-ac converters connected in series to split the main dc link between the inputs of dc-ac converters. This feature makes it possible to use modular dc-ac converters and utilize low-voltage components in these converters whenever it is required to use DVR in medium-voltage application. The proposed configuration is tested under different conditions of load power factor and grid voltage harmonic. It has been shown that proposed DVR can compensate the voltage sag effectively and protect the sensitive loads. Following the proposition of the DVR topology, a fundamental voltage amplitude detection method which is applicable in both single/three-phase systems for DVR applications is proposed. The advantages of proposed method include application in distorted power grid with no need of any low-pass filter, precise and reliable detection, simple computation and implementation without using a phased locked loop and lookup table. The proposed method has been verified by simulation and experimental tests under various conditions considering all possible cases such as different amounts of voltage sag depth (VSD), different amounts of point-on-wave (POW) at which voltage sag occurs, harmonic distortion, line frequency variation, and phase jump (PJ). Furthermore, the ripple amount of fundamental voltage amplitude calculated by the proposed method and its error is analyzed considering the line frequency variation together with harmonic distortion. The best and worst detection time of proposed method were measured 1ms and 8.8ms, respectively. Finally, the proposed method has been compared with other voltage sag detection methods available in literature. Part 2: Power System Modeling for Renewable Energy Integration: As power distribution systems are evolving into more complex networks, electrical engineers have to rely on software tools to perform circuit analysis. There are dozens of powerful software tools available in the market to perform the power system studies. Although their main functions are similar, there are differences in features and formatting structures to suit specific applications. This creates challenges for transferring power system circuit models data (PSCMD) between different software and rebuilding the same circuit in the second software environment. The objective of this part of thesis is to develop a Unified Platform (UP) to facilitate transferring PSCMD among different software packages and relieve the challenges of the circuit model conversion process. UP uses a commonly available spreadsheet file with a defined format, for any home software to write data to and for any destination software to read data from, via a script-based application called PSCMD transfer application. The main considerations in developing the UP are to minimize manual intervention and import a one-line diagram into the destination software or export it from the source software, with all details to allow load flow, short circuit and other analyses. In this study, ETAP, OpenDSS, and GridLab-D are considered, and PSCMD transfer applications written in MATLAB have been developed for each of these to read the circuit model data provided in the UP spreadsheet. In order to test the developed PSCMD transfer applications, circuit model data of a test circuit and a power distribution circuit from Southern California Edison (SCE) - a utility company - both built in CYME, were exported into the spreadsheet file according to the UP format. Thereafter, circuit model data were imported successfully from the spreadsheet files into above mentioned software using the PSCMD transfer applications developed for each software. After the SCE studied circuit is transferred into OpenDSS software using the proposed UP scheme and developed application, it has been studied to investigate the impacts of large-scale solar energy penetration. The main challenge of solar energy integration into power grid is its intermittency (i.e., discontinuity of output power) nature due to cloud shading of photovoltaic panels which depends on weather conditions. In order to conduct this study, OpenDSS time-series simulation feature, which is required due to intermittency of solar energy, is utilized. In this study, the impacts of intermittency of solar energy penetration, especially high-variability points, on voltage fluctuation and operation of capacitor bank and voltage regulator is provided. In addition, the necessity to interpolate and resample unequally spaced time-series measurement data and convert them to equally spaced time-series data as well as the effect of resampling time-interval on the amount of error is discussed. Two applications are developed in Matlab to do interpolation and resampling as well as to calculate the amount of error for different resampling time-intervals to figure out the suitable resampling time-interval. Furthermore, an approach based on cumulative distribution, regarding the length for lines/cables types and the power rating for loads, is presented to prioritize which loads, lines and cables the meters should be installed at to have the most effect on model validation.
Supramolecular core-shell nanoparticles for photoconductive device applications
NASA Astrophysics Data System (ADS)
Cheng, Chih-Chia; Chen, Jem-Kun; Shieh, Yeong-Tarng; Lee, Duu-Jong
2016-08-01
We report a breakthrough discovery involving supramolecular-based strategies to construct novel core-shell heterojunction nanoparticles with hydrophilic adenine-functionalized polythiophene (PAT) as the core and hydrophobic phenyl-C61-butyric acid methyl ester (PCBM) as the shell, which enables the conception of new functional supramolecular assemblies for constructing functional nanomaterials for applications in optoelectronic devices. The generated nanoparticles exhibit uniform spherical shape, well-controlled tuning of particle size with narrow size distributions, and excellent electrochemical stability in solution and the solid state owing to highly efficient energy transfer from PAT to PCBM. When the PAT/PCBM nanoparticles were fabricated into a photoconducting layer in an electronic device, the resulting device showed excellent electric conduction characteristics, including an electrically-tunable voltage-controlled switch, and high short-circuit current and open-circuit voltage. These observations demonstrate how the self-assembly of PAT/PCBM into specific nanostructures may help to promote efficient charge generation and transport processes, suggesting potential for a wide variety of applications as a promising candidate material for bulk heterojunction polymer devices.
1993-01-01
A contact interaction is proposed to exist between the voltage sensor of the transverse tubular membrane of skeletal muscle and the calcium release channel of the sarcoplasmic reticulum. This interaction is given a quantitative formulation inspired in the Monod, Wyman, and Changeux model of allosteric transitions in hemoglobin (Monod, J., J. Wyman, and J.-P. Changeux. 1965. Journal of Molecular Biology. 12:88- 118), and analogous to one proposed by Marks and Jones for voltage- dependent Ca channels (Marks, T. N., and S. W. Jones. 1992. Journal of General Physiology. 99:367-390). The allosteric protein is the calcium release channel, a homotetramer, with two accessible states, closed and open. The kinetics and equilibrium of this transition are modulated by voltage sensors (dihydropyridine receptors) pictured as four units per release channel, each undergoing independent voltage-driven transitions between two states (resting and activating). For each voltage sensor that moves to the activating state, the tendency of the channel to open increases by an equal (large) factor. The equilibrium and kinetic equations of the model are solved and shown to reproduce well a number of experimentally measured relationships including: charge movement (Q) vs. voltage, open probability of the release channel (Po) vs. voltage, the transfer function relationship Po vs. Q, and the kinetics of charge movement, release activation, and deactivation. The main consequence of the assumption of allosteric coupling is that primary effects on the release channel are transmitted backward to the voltage sensor and give secondary effects. Thus, the model reproduces well the effects of perchlorate, described in the two previous articles, under the assumption that the primary effect is to increase the intrinsic tendency of the release channel to open, with no direct effects on the voltage sensor. This modification of the open-closed equilibrium of the release channel causes a shift in the equilibrium dependency of charge movement with voltage. The paradoxical slowing of charge movement by perchlorate also results from reciprocal effects of the channel on the allosterically coupled voltage sensors. The observations of the previous articles plus the simulations in this article constitute functional evidence of allosteric transmission. PMID:8245819
A frequency-sensing readout using piezoelectric sensors for sensing of physiological signals.
Buxi, Dilpreet; Redouté, Jean-Michel; Yuce, Mehmet Rasit
2014-01-01
Together with a charge or voltage amplifier, piezoelectric sensors are commonly used to pick up physiological vibrations from the body. As an alternative to chopper or auto-zero amplifiers, frequency sensing is known in literature to provide advantages of noise immunity, interfacing to digital readout systems as well as tunable range of sensing. A frequency-sensing readout circuit for sensing low voltage signals from piezoelectric sensors is successfully developed and tested in this work. The output voltage of a piezoelectric sensor is fed to a varactor, which is part of an Colpitts LC oscillator. The oscillation frequency is converted into a voltage using a phase locked loop. The circuit is compared to a reference design in terms of linearity, noise and transfer function. The readout has a input-referred noise voltage of 2.24μV/√Hz and consumes 15 mA at 5V supply. Arterial pulse wave signals and the cardiac vibrations from the chest are measured from one subject to show the proof of concept of the proposed readout. The results of this work are intended to contribute towards alternative low noise analog front end designs for piezoelectric sensors.
Power system voltage stability and agent based distribution automation in smart grid
NASA Astrophysics Data System (ADS)
Nguyen, Cuong Phuc
2011-12-01
Our interconnected electric power system is presently facing many challenges that it was not originally designed and engineered to handle. The increased inter-area power transfers, aging infrastructure, and old technologies, have caused many problems including voltage instability, widespread blackouts, slow control response, among others. These problems have created an urgent need to transform the present electric power system to a highly stable, reliable, efficient, and self-healing electric power system of the future, which has been termed "smart grid". This dissertation begins with an investigation of voltage stability in bulk transmission networks. A new continuation power flow tool for studying the impacts of generator merit order based dispatch on inter-area transfer capability and static voltage stability is presented. The load demands are represented by lumped load models on the transmission system. While this representation is acceptable in traditional power system analysis, it may not be valid in the future smart grid where the distribution system will be integrated with intelligent and quick control capabilities to mitigate voltage problems before they propagate into the entire system. Therefore, before analyzing the operation of the whole smart grid, it is important to understand the distribution system first. The second part of this dissertation presents a new platform for studying and testing emerging technologies in advanced Distribution Automation (DA) within smart grids. Due to the key benefits over the traditional centralized approach, namely flexible deployment, scalability, and avoidance of single-point-of-failure, a new distributed approach is employed to design and develop all elements of the platform. A multi-agent system (MAS), which has the three key characteristics of autonomy, local view, and decentralization, is selected to implement the advanced DA functions. The intelligent agents utilize a communication network for cooperation and negotiation. Communication latency is modeled using a user-defined probability density function. Failure-tolerant communication strategies are developed for agent communications. Major elements of advanced DA are developed in a completely distributed way and successfully tested for several IEEE standard systems, including: Fault Detection, Location, Isolation, and Service Restoration (FLISR); Coordination of Distributed Energy Storage Systems (DES); Distributed Power Flow (DPF); Volt-VAR Control (VVC); and Loss Reduction (LR).
Simson, Päivo; Jepihhina, Natalja; Laasmaa, Martin; Peterson, Pearu; Birkedal, Rikke; Vendelin, Marko
2016-08-01
Adequate intracellular energy transfer is crucial for proper cardiac function. In energy starved failing hearts, partial restoration of energy transfer can rescue mechanical performance. There are two types of diffusion obstacles that interfere with energy transfer from mitochondria to ATPases: mitochondrial outer membrane (MOM) with voltage-dependent anion channel (VDAC) permeable to small hydrophilic molecules and cytoplasmatic diffusion barriers grouping ATP-producers and -consumers. So far, there is no method developed to clearly distinguish the contributions of cytoplasmatic barriers and MOM to the overall diffusion restriction. Furthermore, the number of open VDACs in vivo remains unknown. The aim of this work was to establish the partitioning of intracellular diffusion obstacles in cardiomyocytes. We studied the response of mitochondrial oxidative phosphorylation of permeabilized rat cardiomyocytes to changes in extracellular ADP by recording 3D image stacks of NADH autofluorescence. Using cell-specific mathematical models, we determined the permeability of MOM and cytoplasmatic barriers. We found that only ~2% of VDACs are accessible to cytosolic ADP and cytoplasmatic diffusion barriers reduce the apparent diffusion coefficient by 6-10×. In cardiomyocytes, diffusion barriers in the cytoplasm and by the MOM restrict ADP/ATP diffusion to similar extents suggesting a major role of both barriers in energy transfer and other intracellular processes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bartynski, Andrew N; Gruber, Mark; Das, Saptaparna; Rangan, Sylvie; Mollinger, Sonya; Trinh, Cong; Bradforth, Stephen E; Vandewal, Koen; Salleo, Alberto; Bartynski, Robert A; Bruetting, Wolfgang; Thompson, Mark E
2015-04-29
Low open-circuit voltages significantly limit the power conversion efficiency of organic photovoltaic devices. Typical strategies to enhance the open-circuit voltage involve tuning the HOMO and LUMO positions of the donor (D) and acceptor (A), respectively, to increase the interfacial energy gap or to tailor the donor or acceptor structure at the D/A interface. Here, we present an alternative approach to improve the open-circuit voltage through the use of a zinc chlorodipyrrin, ZCl [bis(dodecachloro-5-mesityldipyrrinato)zinc], as an acceptor, which undergoes symmetry-breaking charge transfer (CT) at the donor/acceptor interface. DBP/ZCl cells exhibit open-circuit voltages of 1.33 V compared to 0.88 V for analogous tetraphenyldibenzoperyflanthrene (DBP)/C60-based devices. Charge transfer state energies measured by Fourier-transform photocurrent spectroscopy and electroluminescence show that C60 forms a CT state of 1.45 ± 0.05 eV in a DBP/C60-based organic photovoltaic device, while ZCl as acceptor gives a CT state energy of 1.70 ± 0.05 eV in the corresponding device structure. In the ZCl device this results in an energetic loss between E(CT) and qV(OC) of 0.37 eV, substantially less than the 0.6 eV typically observed for organic systems and equal to the recombination losses seen in high-efficiency Si and GaAs devices. The substantial increase in open-circuit voltage and reduction in recombination losses for devices utilizing ZCl demonstrate the great promise of symmetry-breaking charge transfer in organic photovoltaic devices.
Electrical Transfer Function and Poling Mechanisms for Nonlinear Optical Polymer Modulators
NASA Technical Reports Server (NTRS)
Watson, Michael Dale
2004-01-01
Electro-Optic Polymers hold great promise in increased electro-optic coefficients as compared to their inorganic corollaries. Many researchers have focused on quantum chemistry to describe how the dipoles respond to temperature and electric fields. Much work has also been done for single layer films to confirm these results. For optical applications, waveguide structures are utilized to guide the optical waves in 3 layer stacks. Electrode poling is the only practical poling method for these structures. This research takes an electrical engineering approach to develop poling models and electrical and optical transfer functions of the waveguide structure. The key aspect of the poling model is the large boundary charge density deposited during the poling process. The boundary charge density also has a large effect on the electrical transfer function which is used to explain the transient response of the system. These models are experimentally verified. Exploratory experiment design is used to study poling parameters including time, temperature, and voltage. These studies verify the poling conditions for CLDX/APC and CLDZ/APEC guest host electro optic polymer films in waveguide stacks predicted by the theoretical developments.
Infrared Sensor Readout Design
1975-11-01
Line Replaceable Unit LT Level Translator MRT Minimum Resolvable Temperature MTF Modulation Transfer Function PC Printed Circuit SCCCD Surface...reduced, not only will the aliased noise increase, but signal aliasing will also start to occur. Atlbe display level this means that sharp edges could...converted from a quantity ol charge to a voltage- level shift by the action ol the precharge pulse that presets the potential on the output diode node to
NASA Technical Reports Server (NTRS)
Moore, J. H.
1973-01-01
A model was developed for the switching radiometer utilizing a continuous method of calibration. Sources of system degradation were identified and include losses and voltage standing wave ratios in front of the receiver input. After computing the three modes of operation, expressions were developed for the normalized radiometer output, the minimum detectable signal (normalized RMS temperature fluctuation), sensitivity, and accuracy correction factors).
Electric power distribution and load transfer system
NASA Technical Reports Server (NTRS)
Bradford, Michael P. (Inventor); Parkinson, Gerald W. (Inventor); Grant, Ross M. (Inventor)
1987-01-01
A power distribution system includes a plurality of power sources and load transfer units including transistors and diodes connected in series and leading to a common power output, each of the transistors being controller switchable subject to voltage levels of the respective input and output sides of said transistors, and the voltage and current level of said common power output. The system is part of an interconnection scheme in which all but one of the power sources is connected to a single load transfer unit, enabling the survival of at least a single power source with the failure of one of the load transfer units.
Electric power distribution and load transfer system
NASA Technical Reports Server (NTRS)
Bradford, Michael P. (Inventor); Parkinson, Gerald W. (Inventor); Grant, Ross M. (Inventor)
1989-01-01
A power distribution system includes a plurality of power sources and load transfer units including transistors and diodes connected in series and leading to a common power output, each of the transistors being controller switchable subject to voltage levels of the respective input and output sides of said transistors, and the voltage and current level of said common power output. The system is part of an interconnection scheme in which all but one of the power sources is connected to a single load transfer unit, enabling the survival of at least a single power source with the failure of one of the load transfer units.
Zhang, Liang; Zhu, Xun; Kashima, Hiroyuki; Li, Jun; Ye, Ding-Ding; Liao, Qiang; Regan, John M
2015-03-01
Two identical microbial fuel cells (MFCs) with a floating air-cathode were operated under either buffered (MFC-B) or bufferless (MFC-BL) conditions to investigate anolyte recirculation effects on enhancing proton transfer. With an external resistance of 50 Ω and recirculation rate of 1.0 ml/min, MFC-BL had a 27% lower voltage (9.7% lower maximal power density) but a 64% higher Coulombic efficiency (CE) than MFC-B. MFC-B had a decreased voltage output, batch time, and CE with increasing recirculation rate resulting from more oxygen transfer into the anode. However, increasing the recirculation rate within a low range significantly enhanced proton transfer in MFC-BL, resulting in a higher voltage output, a longer batch time, and a higher CE. A further increase in recirculation rate decreased the batch time and CE of MFC-BL due to excess oxygen transfer into anode outweighing the proton-transfer benefits. The unbuffered MFC had an optimal recirculation rate of 0.35 ml/min. Copyright © 2014 Elsevier Ltd. All rights reserved.
Effect of voltage waveform on dielectric barrier discharge ozone production efficiency
NASA Astrophysics Data System (ADS)
Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.
2012-03-01
Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.
Hybrid electric vehicle power management system
Bissontz, Jay E.
2015-08-25
Level voltage levels/states of charge are maintained among a plurality of high voltage DC electrical storage devices/traction battery packs that are arrayed in series to support operation of a hybrid electric vehicle drive train. Each high voltage DC electrical storage device supports a high voltage power bus, to which at least one controllable load is connected, and at least a first lower voltage level electrical distribution system. The rate of power transfer from the high voltage DC electrical storage devices to the at least first lower voltage electrical distribution system is controlled by DC-DC converters.
Membrane Potential Controls the Efficacy of Catecholamine-induced β1-Adrenoceptor Activity*
Birk, Alexandra; Rinne, Andreas; Bünemann, Moritz
2015-01-01
G protein-coupled receptors (GPCRs) are membrane-located proteins and, therefore, are exposed to changes in membrane potential (VM) in excitable tissues. These changes have been shown to alter receptor activation of certain Gi-and Gq-coupled GPCRs. By means of a combination of whole-cell patch-clamp and Förster resonance energy transfer (FRET) in single cells, we demonstrate that the activation of the Gs-coupled β1-adrenoreceptor (β1-AR) by the catecholamines isoprenaline (Iso) and adrenaline (Adr) is regulated by VM. This voltage-dependence is also transmitted to G protein and arrestin 3 signaling. Voltage-dependence of β2-AR activation, however, was weak compared with β1-AR voltage-dependence. Drug efficacy is a major target of β1-AR voltage-dependence as depolarization attenuated receptor activation, even under saturating concentrations of agonists, with significantly faster kinetics than the deactivation upon agonist withdrawal. Also the efficacy of the endogenous full agonist adrenaline was reduced by depolarization. This is a unique finding since reports of natural full agonists at other voltage-dependent GPCRs only show alterations in affinity during depolarization. Based on a Boltzmann function fit to the relationship of VM and receptor-arrestin 3 interaction we determined the voltage-dependence with highest sensitivity in the physiological range of membrane potential. Our data suggest that under physiological conditions voltage regulates the activity of agonist-occupied β1-adrenoceptors on a very fast time scale. PMID:26408198
Battery voltage-balancing applications of disk-type radial mode Pb(Zr • Ti)O3 ceramic resonator
NASA Astrophysics Data System (ADS)
Thenathayalan, Daniel; Lee, Chun-gu; Park, Joung-hu
2017-10-01
In this paper, we propose a novel technique to build a charge-balancing circuit for series-connected battery strings using various kinds of disk-type ceramic Pb(Zr • Ti)O3 piezoelectric resonators (PRs). The use of PRs replaces the whole external battery voltage-balancer circuit, which consists mainly of a bulky magnetic element. The proposed technique is validated using different ceramic PRs and the results are analyzed in terms of their physical properties. A series-connected battery string with a voltage rating of 61.5 V is set as a hardware prototype under test, then the power transfer efficiency of the system is measured at different imbalance voltages. The performance of the proposed battery voltage-balancer circuit employed with a PR is also validated through hardware implementation. Furthermore, the temperature distribution image of the PR is obtained to compare power transfer efficiency and thermal stress under different operating conditions. The test results show that the battery voltage-balancer circuit can be successfully implemented using PRs with the maximum power conversion efficiency of over 96% for energy storage systems.
ARC and Melting Efficiency of Plasma ARC Welds
NASA Technical Reports Server (NTRS)
McClure, J. C.; Nunes, A. C.; Evans, D. M.
1999-01-01
A series of partial penetration Variable Polarity Plasma Arc welds were made at equal power but various combinations of current and voltage on 2219 Aluminum. Arc efficiency was measured calorimetrically and ranged between 48% and 66% for the conditions of the welds. Arc efficiency depends in different ways on voltage and current. The voltage effect dominates. Raising voltage while reducing current increases arc efficiency. Longer, higher voltage arcs are thought to transfer a greater portion of arc power to the workpiece through shield gas convection. Melting efficiency depends upon weld pool shape as well as arc efficiency. Increased current increases the melting efficiency as it increases the depth to width ratio of the weld pool. Increased plasma gas flow does the same thing. Higher currents are thought to raise arc pressure and depress liquid at the bottom of the weld pool. More arc power then transfers to the workpiece through increasing plasma gas convection. If the power is held constant, the reduced voltage lowers the arc efficiency, while the pool shape change increases the melting efficiency,
NASA Technical Reports Server (NTRS)
Mumaw, Susan J. (Inventor); Evers, Jeffrey (Inventor); Craig, Calvin L., Jr. (Inventor); Walker, Stuart D. (Inventor)
2001-01-01
The invention is a circuit and method of limiting the charging current voltage from a power supply net work applied to an individual cell of a plurality of cells making up a battery being charged in series. It is particularly designed for use with batteries that can be damaged by overcharging, such as Lithium-ion type batteries. In detail. the method includes the following steps: 1) sensing the actual voltage level of the individual cell; 2) comparing the actual voltage level of the individual cell with a reference value and providing an error signal representative thereof; and 3) by-passing the charging current around individual cell necessary to keep the individual cell voltage level generally equal a specific voltage level while continuing to charge the remaining cells. Preferably this is accomplished by by-passing the charging current around the individual cell if said actual voltage level is above the specific voltage level and allowing the charging current to the individual cell if the actual voltage level is equal or less than the specific voltage level. In the step of bypassing the charging current, the by-passed current is transferred at a proper voltage level to the power supply. The by-pass circuit a voltage comparison circuit is used to compare the actual voltage level of the individual cell with a reference value and to provide an error signal representative thereof. A third circuit, designed to be responsive to the error signal, is provided for maintaining the individual cell voltage level generally equal to the specific voltage level. Circuitry is provided in the third circuit for bypassing charging current around the individual cell if the actual voltage level is above the specific voltage level and transfers the excess charging current to the power supply net work. The circuitry also allows charging of the individual cell if the actual voltage level is equal or less than the specific voltage level.
Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung
2017-10-01
Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mechanism of Electromechanical Coupling in Voltage-Gated Potassium Channels
Blunck, Rikard; Batulan, Zarah
2012-01-01
Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium, or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv) undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt, and vertical displacement in order to bring 3–4e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy, and molecular dynamics simulations. Evidently, the S4–S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i) an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii) insight as to how the voltage sensor and pore domain influence one another; and (iii) theoretical predictions on the movement of the cytosolic face of the Kv channels during gating. PMID:22988442
Oscillatory bistability of real-space transfer in semiconductor heterostructures
NASA Astrophysics Data System (ADS)
Do˙ttling, R.; Scho˙ll, E.
1992-01-01
Charge transport parallel to the layers of a modulation-doped GaAs/AlxGa1-xAs heterostructure is studied theoretically. The heating of electrons by the applied electric field leads to real-space transfer of electrons from the GaAs into the adjacent AlxGa1-xAs layer. For sufficiently large dc bias, spontaneous periodic 100-GHz current oscillations, and bistability and hysteretic switching transitions between oscillatory and stationary states are predicted. We present a detailed investigation of complex bifurcation scenarios as a function of the bias voltage U0 and the load resistance RL. For large RL subcritical Hopf bifurcations and global bifurcations of limit cycles are displayed.
Haddad, Georges A.
2011-01-01
The voltage sensors of voltage-gated ion channels undergo a conformational change upon depolarization of the membrane that leads to pore opening. This conformational change can be measured as gating currents and is thought to be transferred to the pore domain via an annealing of the covalent link between voltage sensor and pore (S4-S5 linker) and the C terminus of the pore domain (S6). Upon prolonged depolarizations, the voltage dependence of the charge movement shifts to more hyperpolarized potentials. This mode shift had been linked to C-type inactivation but has recently been suggested to be caused by a relaxation of the voltage sensor itself. In this study, we identified two ShakerIR mutations in the S4-S5 linker (I384N) and S6 (F484G) that, when mutated, completely uncouple voltage sensor movement from pore opening. Using these mutants, we show that the pore transfers energy onto the voltage sensor and that uncoupling the pore from the voltage sensor leads the voltage sensors to be activated at more negative potentials. This uncoupling also eliminates the mode shift occurring during prolonged depolarizations, indicating that the pore influences entry into the mode shift. Using voltage-clamp fluorometry, we identified that the slow conformational change of the S4 previously correlated with the mode shift disappears when uncoupling the pore. The effects can be explained by a mechanical load that is imposed upon the voltage sensors by the pore domain and allosterically modulates its conformation. Mode shift is caused by the stabilization of the open state but leads to a conformational change in the voltage sensor. PMID:21518834
Modeling single event induced crosstalk in nanometer technologies
NASA Astrophysics Data System (ADS)
Boorla, Vijay K.
Radiation effects become more important in combinational logic circuits with newer technologies. When a high energetic particle strikes at the sensitive region within the combinational logic circuit a voltage pulse called Single Event Transient is created. Recently, researchers reported Single Event Crosstalk because of increasing coupling effects. In this work, the closed form expression for SE crosstalk noise is formulated for the first time. For all calculations, 4-pi model is used in this work. The crosstalk model uses a reduced transfer function between aggressor coupling node and victim node to reduce information loss. Aggressor coupling node waveform is obtained and then applied to transfer function between the coupling node and the victim output to obtain victim noise voltage. This work includes both effect of passive aggressor loading on victim and victim loading on aggressor by considering resistive shielding effect. Noise peak expressions derived in this work show very good results in comparison to HSPICE results. Results show that average error for noise peak is 3.794% while allowing for very fast analysis. Once the SE crosstalk noise is calculated, one can hire mitigation techniques such as driver sizing. A standard DTMOS technique along with sizing is proposed in this work to mitigate SE crosstalk. This combined approach can saves in some areas compared to driver sizing alone. Key Words: Crosstalk Noise, Closed Form Modeling, Standard DTMOS
NASA Astrophysics Data System (ADS)
Yuan, Shifei; Jiang, Lei; Yin, Chengliang; Wu, Hongjie; Zhang, Xi
2017-06-01
The electrochemistry-based battery model can provide physics-meaningful knowledge about the lithium-ion battery system with extensive computation burdens. To motivate the development of reduced order battery model, three major contributions have been made throughout this paper: (1) the transfer function type of simplified electrochemical model is proposed to address the current-voltage relationship with Padé approximation method and modified boundary conditions for electrolyte diffusion equations. The model performance has been verified under pulse charge/discharge and dynamic stress test (DST) profiles with the standard derivation less than 0.021 V and the runtime 50 times faster. (2) the parametric relationship between the equivalent circuit model and simplified electrochemical model has been established, which will enhance the comprehension level of two models with more in-depth physical significance and provide new methods for electrochemical model parameter estimation. (3) four simplified electrochemical model parameters: equivalent resistance Req, effective diffusion coefficient in electrolyte phase Deeff, electrolyte phase volume fraction ε and open circuit voltage (OCV), have been identified by the recursive least square (RLS) algorithm with the modified DST profiles under 45, 25 and 0 °C. The simulation results indicate that the proposed model coupled with RLS algorithm can achieve high accuracy for electrochemical parameter identification in dynamic scenarios.
Na-ion batteries based on the inorganic BN nanocluster anodes: DFT studies.
Nejati, K; Hosseinian, A; Bekhradnia, A; Vessally, E; Edjlali, L
2017-06-01
It has been recently indicated that the Li-ion batteries may be replaced by Na-ion batteries because of their low safety, high cost, and low-temperature performance, and lack of the Li mineral reserves. Here, using density functional theory calculations, we studied the potential application of B 12 N 12 nanoclusters as anode in Na-ion batteries. Our calculations indicate that the adsorption energy of Na + and Na are about -23.4 and -1.4kcal/mol, respectively, and the pristine BN cage to improve suffers from a low cell voltage (∼0.92V) as an anode in Na-ion batteries. We presented a strategy to increase the cell voltage and performance of Na-ion batteries. We showed that encapsulation of different halides (X=F - , Cl - , or Br - ) into BN cage significantly increases the cell voltage. By increasing the atomic number of X, the Gibbs free energy change of cell becomes more negative and the cell voltage is increased up to 3.93V. The results are discussed based on the structural, energetic, frontier molecular orbital, charge transfer and electronic properties and compared with the performance of other nanostructured anodes. Copyright © 2017 Elsevier Inc. All rights reserved.
Heat transport in electrically aligned multiwalled carbon nanotubes dispersed in water
NASA Astrophysics Data System (ADS)
Cervantes-Alvarez, F.; Macias, J. D.; Alvarado-Gil, J. J.
2018-02-01
A modified Ångström method was used to determine the thermal diffusivity and thermal conductivity of aqueous dispersions of multiwalled carbon nanotubes as a function of their weight fraction concentration and in the presence of an externally applied electric field. Measurements were performed in planar samples, with a fixed thickness of 3.18 mm applying an AC voltage in the range from 0 to 70~V_RMS and for concentrations of carbon nanotubes from 0 to 2 wf%. It is shown that this field induces the formation of clusters followed by their alignment along the electric field, which can favor heat transfer in that direction. Heat transfer measurements show two regimes, in the first one under 0.5 wf%, voltages lower than 30~V_RMS are not strong enough to induce the adequate order of the carbon nanostructures, and as a consequence, thermal diffusivity of the dispersion remains close to the thermal diffusivity of water. In contrast for higher concentrations (above 1.5 wf%), 10~V_RMS are enough to get a good alignment. Above such thresholds of concentrations and voltages, thermal diffusivity and conductivity increase, when the electric field is increased, in such a way that for an applied voltage of 20~V_RMS and for a concentration of 1.5 wf%, an increase of 49% of the thermal conductivity was obtained. It is also shown that this approach exhibits limits, due to the fact that the electric-field induced structure, can act as a heating element at high electric field intensities and carbon nanotubes concentrations, which can induce convection and evaporation of the liquid matrix.
Topologically protected charge transfer along the edge of a chiral p -wave superconductor
NASA Astrophysics Data System (ADS)
Gnezdilov, N. V.; van Heck, B.; Diez, M.; Hutasoit, Jimmy A.; Beenakker, C. W. J.
2015-09-01
The Majorana fermions propagating along the edge of a topological superconductor with px+i py pairing deliver a shot noise power of 1/2 ×e2/h per eV of voltage bias. We calculate the full counting statistics of the transferred charge and find that it becomes trinomial in the low-temperature limit, distinct from the binomial statistics of charge-e transfer in a single-mode nanowire or charge-2 e transfer through a normal-superconductor interface. All even-order correlators of current fluctuations have a universal quantized value, insensitive to disorder and decoherence. These electrical signatures are experimentally accessible, because they persist for temperatures and voltages large compared to the Thouless energy.
76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop
Federal Register 2010, 2011, 2012, 2013, 2014
2011-11-15
... and the capability of existing and emerging software to improve coordination and optimization of transfer capability across the Bulk-Power System from a reliability and economic perspective. The agenda...
Absolute calibration technique for broadband ultrasonic transducers
NASA Technical Reports Server (NTRS)
Yost, William T. (Inventor); Cantrell, John H. (Inventor)
1994-01-01
Calibrating an ultrasonic transducer can be performed with a reduced number of calculations and testing. A wide-band pulser is connected to an ultrasonic transducer under test to generate ultrasonic waves in a liquid. A single frequency is transmitted to the electrostatic acoustic transducer (ESAT) and the voltage change produced is monitored. Then a broadband ultrasonic pulse is generated by the ultrasonic transducer and received by the ESAT. The output of the ESAT is amplified and input to a digitized oscilloscope for fast Fourier transform. The resulting plot is normalized with the monitored signal from the single frequency pulse. The plot is then corrected for characteristics of the membrane and diffraction effects. The transfer function of the final plot is determined. The transfer function gives the final sensitivity of the ultrasonic transducer as a function of frequency. The advantage of the system is the speed of calibrating the transducer by a reduced number of measurements and removal of the membrane and diffraction effects.
Addressable inverter matrix for process and device characterization
NASA Technical Reports Server (NTRS)
Buehler, M. G.; Sayah, H. R.
1985-01-01
The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.
NASA Astrophysics Data System (ADS)
Munira, Kamaram; Pandey, Sumeet C.; Kula, Witold; Sandhu, Gurtej S.
2016-11-01
Voltage-controlled magnetic anisotropy (VCMA) effect has attracted a significant amount of attention in recent years because of its low cell power consumption during the anisotropy modulation of a thin ferromagnetic film. However, the applied voltage or electric field alone is not enough to completely and reliably reverse the magnetization of the free layer of a magnetic random access memory (MRAM) cell from anti-parallel to parallel configuration or vice versa. An additional symmetry-breaking mechanism needs to be employed to ensure the deterministic writing process. Combinations of voltage-controlled magnetic anisotropy together with spin-transfer torque (STT) and with an applied magnetic field (Happ) were evaluated for switching reliability, time taken to switch with low error rate, and energy consumption during the switching process. In order to get a low write error rate in the MRAM cell with VCMA switching mechanism, a spin-transfer torque current or an applied magnetic field comparable to the critical current and field of the free layer is necessary. In the hybrid processes, the VCMA effect lowers the duration during which the higher power hungry secondary mechanism is in place. Therefore, the total energy consumed during the hybrid writing processes, VCMA + STT or VCMA + Happ, is less than the energy consumed during pure spin-transfer torque or applied magnetic field switching.
NASA Astrophysics Data System (ADS)
Pipa, A. V.; Koskulics, J.; Brandenburg, R.; Hoder, T.
2012-11-01
The concept of the simplest equivalent circuit for a dielectric barrier discharge (DBD) is critically reviewed. It is shown that the approach is consistent with experimental data measured either in large-scale sinusoidal-voltage driven or miniature pulse-voltage driven DBDs. An expression for the charge transferred through the gas gap q(t) is obtained with an accurate account for the displacement current and the values of DBD reactor capacitance. This enables (i) the significant reduction of experimental error in the determination of q(t) in pulsed DBDs, (ii) the verification of the classical electrical theory of ozonizers about maximal transferred charge qmax, and (iii) the development of a graphical method for the determination of qmax from charge-voltage characteristics (Q-V plots, often referred as Lissajous figures) measured under pulsed excitation. The method of graphical presentation of qmax is demonstrated with an example of a Q-V plot measured under pulsed excitation. The relations between the discharge current jR(t), the transferred charge q(t), and the measurable parameters are presented in new forms, which enable the qualitative interpretation of the measured current and voltage waveforms without the knowledge about the value of the dielectric barrier capacitance Cd. Whereas for quantitative evaluation of electrical measurements, the accurate estimation of the Cd is important.
Effect of pole zero location on system dynamics of boost converter for micro grid
NASA Astrophysics Data System (ADS)
Lavanya, A.; Vijayakumar, K.; Navamani, J. D.; Jayaseelan, N.
2018-04-01
Green clean energy like photo voltaic, wind energy, fuel cell can be brought together by microgrid.For low voltage sources like photovoltaic cell boost converter is very much essential. This paper explores the dynamic analysis of boost converter in a continuous conduction mode (CCM). The transient performance and stability analysis is carried out in this paper using time domain analysis and frequency domain analysis techniques. Boost converter is simulated using both PSIM and MATLAB software. Furthermore, state space model obtained and the transfer function is derived. The converter behaviour when a step input is applied is analyzed and stability of the converter is analyzed from bode plot frequency for open loop. Effect of the locations of poles and zeros in the transfer function of boost converter and how the performance parameters are affected is discussed in this paper. Closed loop performance with PI controller is also analyzed for boost converter.
Stability phase diagram of a perpendicular magnetic tunnel junction in noncollinear geometry
NASA Astrophysics Data System (ADS)
Strelkov, N.; Timopheev, A.; Sousa, R. C.; Chshiev, M.; Buda-Prejbeanu, L. D.; Dieny, B.
2017-05-01
Experimental measurements performed on MgO-based perpendicular magnetic tunnel junctions show a strong dependence of the stability voltage-field diagrams as a function of the direction of the magnetic field with respect to the plane of the sample. When the magnetic field is applied in-plane, systematic nonlinear phase boundaries are observed for various lateral sizes. The simulation results based on the phenomenological Landau-Lifshitz-Gilbert equation including the in-plane and out-of-plane spin transfer torques are consistent with the measurements if a second-order anisotropy contribution is considered. Furthermore, performing the stability analysis in linear approximation allowed us to analytically extract the critical switching voltage at zero temperature in the presence of an in-plane field. This study indicates that in the noncollinear geometry investigations are suitable to detect the presence of the second-order term in the anisotropy. Such higher order anisotropy term can yield an easy-cone anisotropy which reduces the thermal stability factor but allows for more reproducible spin transfer torque switching due to a reduced stochasticity of the switching. As a result, the energy per write event decreases much faster than the thermal stability factor as the second-order anisotropy becomes more negative. Easy-cone anisotropy can be useful for fast-switching spin transfer torque magnetic random access memories provided the thermal stability can be maintained above the required value for a given memory specification.
Charge transport in vertically aligned, self-assembled peptide nanotube junctions.
Mizrahi, Mordechay; Zakrassov, Alexander; Lerner-Yardeni, Jenny; Ashkenasy, Nurit
2012-01-21
The self-assembly propensity of peptides has been extensively utilized in recent years for the formation of supramolecular nanostructures. In particular, the self-assembly of peptides into fibrils and nanotubes makes them promising building blocks for electronic and electro-optic applications. However, the mechanisms of charge transfer in these wire-like structures, especially in ambient conditions, are not yet fully understood. We describe here a layer-by-layer deposition methodology of short self-assembled cyclic peptide nanotubes, which results in vertically oriented nanotubes on gold substrates. Using this novel deposition methodology, we have fabricated molecular junctions with a conductive atomic force microscopy tip as a second electrode. Studies of the junctions' current-voltage characteristics as a function of the nanotube length revealed an efficient charge transfer in these supramolecular structures, with a low current attenuation constant of 0.1 Å(-1), which indicate that electron transfer is dominated by hopping. Moreover, the threshold voltage to field-emission dominated transport was found to increase with peptide length in a manner that depends on the nature of the contact with the electrodes. The flexibility in the design of the peptide monomers and the ability to control their sequential order over the nanotube by means of the layer-by-layer assembly process, which is demonstrated in this work, can be used to engineer the electronic properties of self-assembled peptide nanotubes toward device applications.
Applying analog integrated circuits for HERO protection
NASA Technical Reports Server (NTRS)
Willis, Kenneth E.; Blachowski, Thomas J.
1994-01-01
One of the most efficient methods for protecting electro-explosive devices (EED's) from HERO and ESD is to shield the EED in a conducting shell (Faraday cage). Electrical energy is transferred to the bridge by means of a magnetic coupling which passes through a portion of the conducting shell that is made from a magnetically permeable but electrically conducting material. This technique was perfected by ML Aviation, a U.K. company, in the early 80's, and was called a Radio Frequency Attenuation Connector (RFAC). It is now in wide use in the U.K. Previously, the disadvantage of RFAC over more conventional methods was its relatively high cost, largely driven by a thick film hybrid circuit used to switch the primary of the transformer. Recently, through a licensing agreement, this technology has been transferred to the U.S. and significant cost reductions and performance improvements have been achieved by the introduction of analog integrated circuits. An integrated circuit performs the following functions: (1) Chops the DC input to a signal suitable for driving the primary of the transformer; (2) Verifies the input voltage is above a threshold; (3) Verifies the input voltage is valid for a pre set time before enabling the device; (4) Provides thermal protection of the circuit; and (5) Provides an external input for independent logic level enabling of the power transfer mechanism. This paper describes the new RFAC product and its applications.
Heat transfer in GTA welding arcs
NASA Astrophysics Data System (ADS)
Huft, Nathan J.
Heat transfer characteristics of Gas Tungsten Arc Welding (GTAW) arcs with arc currents of 50 to 125 A and arc lengths of 3 to 11 mm were measured experimentally through wet calorimetry. The data collected were used to calculate how much heat reported to the cathode and anode and how much was lost from the arc column. A Visual Basic for Applications (VBA) macro was written to further analyze the data and account for Joule heating within the electrodes and radiation and convection losses from the arc, providing a detailed account of how heat was generated and dissipated within the system. These values were then used to calculate arc efficiencies, arc column voltages, and anode and cathode fall voltages. Trends were noted for variances in the arc column voltage, power dissipated from the arc column, and the total power dissipated by the system with changing arc length. Trends for variances in the anode and cathode fall voltages, total power dissipated, Joule heating within the torches and electrodes with changing arc current were also noted. In addition, the power distribution between the anode and cathode for each combination of arc length and arc current was examined. Keywords: Gas Tungsten Arc Welding, GTAW, anode fall, cathode fall, heat transfer, wet calorimetry
Study of a control strategy for grid side converter in doubly- fed wind power system
NASA Astrophysics Data System (ADS)
Zhu, D. J.; Tan, Z. L.; Yuan, F.; Wang, Q. Y.; Ding, M.
2016-08-01
The grid side converter is an important part of the excitation system of doubly-fed asynchronous generator used in wind power system. As a three-phase voltage source PWM converter, it can not only transfer slip power in the form of active power, but also adjust the reactive power of the grid. This paper proposed a control approach for improving its performance. In this control approach, the dc voltage is regulated by a sliding mode variable structure control scheme and current by a variable structure controller based on the input output linearization. The theoretical bases of the sliding mode variable structure control were introduced, and the stability proof was presented. Switching function of the system has been deduced, sliding mode voltage controller model has been established, and the output of the outer voltage loop is the instruction of the inner current loop. Affine nonlinear model of two input two output equations on d-q axis for current has been established its meeting conditions of exact linearization were proved. In order to improve the anti-jamming capability of the system, a variable structure control was added in the current controller, the control law was deduced. The dual-loop control with sliding mode control in outer voltage loop and linearization variable structure control in inner current loop was proposed. Simulation results demonstrate the effectiveness of the proposed control strategy even during the dc reference voltage and system load variation.
Models for electromagnetic coupling of lightning onto multiconductor cables in underground cavities
NASA Astrophysics Data System (ADS)
Higgins, Matthew Benjamin
This dissertation documents the measurements, analytical modeling, and numerical modeling of electromagnetic transfer functions to quantify the ability of cloud-to-ground lightning strokes (including horizontal arc-channel components) to couple electromagnetic energy onto multiconductor cables in an underground cavity. Measurements were performed at the Sago coal mine located near Buckhannon, WV. These transfer functions, coupled with mathematical representations of lightning strokes, are then used to predict electric fields within the mine and induced voltages on a cable that was left abandoned in the sealed area of the Sago mine. If voltages reached high enough levels, electrical arcing could have occurred from the abandoned cable. Electrical arcing is known to be an effective ignition source for explosive gas mixtures. Two coupling mechanisms were measured: direct and indirect drive. Direct coupling results from the injection or induction of lightning current onto metallic conductors such as the conveyors, rails, trolley communications cable, and AC power shields that connect from the outside of the mine to locations deep within the mine. Indirect coupling results from electromagnetic field propagation through the earth as a result of a cloud-to-ground lightning stroke or a long, low-altitude horizontal current channel from a cloud-to-ground stroke. Unlike direct coupling, indirect coupling does not require metallic conductors in a continuous path from the surface to areas internal to the mine. Results from the indirect coupling measurements and analysis are of great concern. The field measurements, modeling, and analysis indicate that significant energy can be coupled directly into the sealed area of the mine. Due to the relatively low frequency content of lightning (< 100 kHz), electromagnetic energy can readily propagate through hundreds of feet of earth. Indirect transfer function measurements compare extremely well with analytical and computational models developed for the Sago site which take into account measured soil properties.
Larsen, T; Doll, J C; Loizeau, F; Hosseini, N; Peng, A W; Fantner, G; Ricci, A J; Pruitt, B L
2017-01-01
Electrothermal actuators have many advantages compared to other actuators used in Micro-Electro-Mechanical Systems (MEMS). They are simple to design, easy to fabricate and provide large displacements at low voltages. Low voltages enable less stringent passivation requirements for operation in liquid. Despite these advantages, thermal actuation is typically limited to a few kHz bandwidth when using step inputs due to its intrinsic thermal time constant. However, the use of pre-shaped input signals offers a route for reducing the rise time of these actuators by orders of magnitude. We started with an electrothermally actuated cantilever having an initial 10-90% rise time of 85 μs in air and 234 μs in water for a standard open-loop step input. We experimentally characterized the linearity and frequency response of the cantilever when operated in air and water, allowing us to obtain transfer functions for the two cases. We used these transfer functions, along with functions describing desired reduced rise-time system responses, to numerically simulate the required input signals. Using these pre-shaped input signals, we improved the open-loop 10-90% rise time from 85 μs to 3 μs in air and from 234 μs to 5 μs in water, an improvement by a factor of 28 and 47, respectively. Using this simple control strategy for MEMS electrothermal actuators makes them an attractive alternative to other high speed micromechanical actuators such as piezoelectric stacks or electrostatic comb structures which are more complex to design, fabricate, or operate.
Tutorial on X-ray photon counting detector characterization.
Ren, Liqiang; Zheng, Bin; Liu, Hong
2018-01-01
Recent advances in photon counting detection technology have led to significant research interest in X-ray imaging. As a tutorial level review, this paper covers a wide range of aspects related to X-ray photon counting detector characterization. The tutorial begins with a detailed description of the working principle and operating modes of a pixelated X-ray photon counting detector with basic architecture and detection mechanism. Currently available methods and techniques for charactering major aspects including energy response, noise floor, energy resolution, count rate performance (detector efficiency), and charge sharing effect of photon counting detectors are comprehensively reviewed. Other characterization aspects such as point spread function (PSF), line spread function (LSF), contrast transfer function (CTF), modulation transfer function (MTF), noise power spectrum (NPS), detective quantum efficiency (DQE), bias voltage, radiation damage, and polarization effect are also remarked. A cadmium telluride (CdTe) pixelated photon counting detector is employed for part of the characterization demonstration and the results are presented. This review can serve as a tutorial for X-ray imaging researchers and investigators to understand, operate, characterize, and optimize photon counting detectors for a variety of applications.
A wireless magnetic resonance energy transfer system for micro implantable medical sensors.
Li, Xiuhan; Zhang, Hanru; Peng, Fei; Li, Yang; Yang, Tianyang; Wang, Bo; Fang, Dongming
2012-01-01
Based on the magnetic resonance coupling principle, in this paper a wireless energy transfer system is designed and implemented for the power supply of micro-implantable medical sensors. The entire system is composed of the in vitro part, including the energy transmitting circuit and resonant transmitter coils, and in vivo part, including the micro resonant receiver coils and signal shaping chip which includes the rectifier module and LDO voltage regulator module. Transmitter and receiver coils are wound by Litz wire, and the diameter of the receiver coils is just 1.9 cm. The energy transfer efficiency of the four-coil system is greatly improved compared to the conventional two-coil system. When the distance between the transmitter coils and the receiver coils is 1.5 cm, the transfer efficiency is 85% at the frequency of 742 kHz. The power transfer efficiency can be optimized by adding magnetic enhanced resonators. The receiving voltage signal is converted to a stable output voltage of 3.3 V and a current of 10 mA at the distance of 2 cm. In addition, the output current varies with changes in the distance. The whole implanted part is packaged with PDMS of excellent biocompatibility and the volume of it is about 1 cm(3).
A method for computing ion energy distributions for multifrequency capacitive discharges
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Alan C. F.; Lieberman, M. A.; Verboncoeur, J. P.
2007-03-01
The ion energy distribution (IED) at a surface is an important parameter for processing in multiple radio frequency driven capacitive discharges. An analytical model is developed for the IED in a low pressure discharge based on a linear transfer function that relates the time-varying sheath voltage to the time-varying ion energy response at the surface. This model is in good agreement with particle-in-cell simulations over a wide range of single, dual, and triple frequency driven capacitive discharge excitations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suhendi, Endi; Syariati, Rifki; Noor, Fatimah A.
We modeled a tunneling current in a p-n junction based on armchair graphene nanoribbons (AGNRs) by using an Airy function approach (AFA) and a transfer matrix method (TMM). We used β-type AGNRs, in which its band gap energy and electron effective mass depends on its width as given by the extended Huckel theory. It was shown that the tunneling currents evaluated by employing the AFA are the same as those obtained under the TMM. Moreover, the calculated tunneling current was proportional to the voltage bias and inversely with temperature.
Equilibrium fluctuation relations for voltage coupling in membrane proteins.
Kim, Ilsoo; Warshel, Arieh
2015-11-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free energy barrier that follow the trend of the equilibrium fluctuation relation and the Marcus theory of electron transfer. These energetics also allow for a direct estimation of the voltage dependence of channel activation (Q-V curve), offering a quantitative rationale for a correlation between the voltage dependence parabolas and the Q-V curve, upon site-directed mutagenesis or drug binding. Taken together, by introducing the voltage coupling as the energy gap reaction coordinate, our framework brings new perspectives to the thermodynamic models of voltage activation in voltage-sensitive membrane proteins, offering an a framework for a better understating of the structure-function correlations of voltage gating in ion channels as well as electrogenic phenomena in ion pumps and transporters. Significantly, this formulation also provides a powerful bridge between the CG model of voltage coupling and the conventional macroscopic treatments. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chinthavali, Madhu Sudhan; Wang, Zhiqiang
This paper presents a detailed parametric sensitivity analysis for a wireless power transfer (WPT) system in electric vehicle application. Specifically, several key parameters for sensitivity analysis of a series-parallel (SP) WPT system are derived first based on analytical modeling approach, which includes the equivalent input impedance, active / reactive power, and DC voltage gain. Based on the derivation, the impact of primary side compensation capacitance, coupling coefficient, transformer leakage inductance, and different load conditions on the DC voltage gain curve and power curve are studied and analyzed. It is shown that the desired power can be achieved by just changingmore » frequency or voltage depending on the design value of coupling coefficient. However, in some cases both have to be modified in order to achieve the required power transfer.« less
Analysis of a Van de Graaff Generator for EMP Direct Current Survivability Testing
2013-03-01
voltage source, VS , equals the voltage load, VL, as shown in the schematic of Figure 12. When impedance is matched, maximum power is transferred...maximum power is 42 transmitted, and VS =VL. The voltage drops shown in Table 7 are from the skin effect at frequencies above 1 MHz, as well... voltage . 46 3.1.6 Response to CVR Location The purpose of these experiments was to find the best cable and connector attachment that would
Traceable calibration and demonstration of a portable dynamic force transfer standard
NASA Astrophysics Data System (ADS)
Vlajic, Nicholas; Chijioke, Ako
2017-08-01
In general, the dynamic sensitivity of a force transducer depends upon the mechanical system in which it is used. This dependence serves as motivation to develop a dynamic force transfer standard, which can be used to calibrate an application transducer in situ. In this work, we SI-traceably calibrate a hand-held force transducer, namely an impact hammer, by using a mass suspended from a thin line which is cut to produce a known dynamic force in the form of a step function. We show that this instrument is a promising candidate as a transfer standard, since its dynamic response has small variance between different users. This calibrated transfer standard is then used to calibrate a secondary force transducer in an example application setting. The combined standard uncertainty (k = 2) in the calibration of the transfer standard was determined to be 2.1% or less, up to a bandwidth of 5 kHz. The combined standard uncertainty (k = 2) in the performed transfer calibration was less than 4%, up to 3 kHz. An advantage of the transfer calibration framework presented here, is that the transfer standard can be used to transfer SI-traceable calibrations without the use of any SI-traceable voltage metrology instrumentation.
Specifics of Pulsed Arc Welding Power Supply Performance Based On A Transistor Switch
NASA Astrophysics Data System (ADS)
Krampit, N. Yu; Kust, T. S.; Krampit, M. A.
2016-08-01
Specifics of designing a pulsed arc welding power supply device are presented in the paper. Electronic components for managing large current was analyzed. Strengths and shortcomings of power supply circuits based on thyristor, bipolar transistor and MOSFET are outlined. As a base unit for pulsed arc welding was chosen MOSFET transistor, which is easy to manage. Measures to protect a transistor are given. As for the transistor control device is a microcontroller Arduino which has a low cost and adequate performance of the work. Bead transfer principle is to change the voltage on the arc in the formation of beads on the wire end. Microcontroller controls transistor when the arc voltage reaches the threshold voltage. Thus there is a separation and transfer of beads without splashing. Control strategies tested on a real device and presented. The error in the operation of the device is less than 25 us, it can be used controlling drop transfer at high frequencies (up to 1300 Hz).
Analysis and application of two-current-source circuit as a signal conditioner for resistive sensors
NASA Astrophysics Data System (ADS)
Idzkowski, Adam; Gołębiowski, Jerzy; Walendziuk, Wojciech
2017-05-01
The article presents the analysis of metrological properties of a two-current-source supplied circuit. It includes such data as precise and simplified equations for two circuit output voltages in the function of relative resistance increments of sensors. Moreover, graphs showing nonlinearity coefficients of both output voltages for two resistance increments varying widely are presented. Graphs of transfer resistances, depending on relative increments of sensors resistance were also created. The article also contains a description of bridge-based circuit realization with the use of a computer and a data acquisition (DAQ) card. Laboratory measurement of the difference and sum of relative resistance increments of two resistance decade boxes were carried out indirectly with the use of the created measurement system. Measurement errors were calculated and included in the article, as well.
NASA Astrophysics Data System (ADS)
Zhang, Yiming; Zhao, Zhengming; Chen, Kainan; Fan, Jun
2017-05-01
Wireless Power Transfer (WPT) has been the research focus and applied in many fields. Normally power is transferred wirelessly to charge the battery, which requires specific load characteristics. The load characteristics are essential for the design and operation of the WPT system. This paper investigates the load characteristics of the WPT system with different resonant types and resonator numbers. It is found that in a WPT system with series or LCL resonance under a constant voltage source, the load characteristic is determined by the number of inductors. Even number of inductors results in a constant current characteristic and odd number constant voltage characteristic. Calculations, simulations, and experiments verify the analysis.
A High Voltage Ratio and Low Ripple Interleaved DC-DC Converter for Fuel Cell Applications
Chang, Long-Yi; Chao, Kuei-Hsiang; Chang, Tsang-Chih
2012-01-01
This paper proposes a high voltage ratio and low ripple interleaved boost DC-DC converter, which can be used to reduce the output voltage ripple. This converter transfers the low DC voltage of fuel cell to high DC voltage in DC link. The structure of the converter is parallel with two voltage-doubler boost converters by interleaving their output voltages to reduce the voltage ripple ratio. Besides, it can lower the current stress for the switches and inductors in the system. First, the PSIM software was used to establish a proton exchange membrane fuel cell and a converter circuit model. The simulated and measured results of the fuel cell output characteristic curve are made to verify the correctness of the established simulation model. In addition, some experimental results are made to validate the effectiveness in improving output voltage ripple of the proposed high voltage ratio interleaved boost DC-DC converters. PMID:23365536
A high voltage ratio and low ripple interleaved DC-DC converter for fuel cell applications.
Chang, Long-Yi; Chao, Kuei-Hsiang; Chang, Tsang-Chih
2012-01-01
This paper proposes a high voltage ratio and low ripple interleaved boost DC-DC converter, which can be used to reduce the output voltage ripple. This converter transfers the low DC voltage of fuel cell to high DC voltage in DC link. The structure of the converter is parallel with two voltage-doubler boost converters by interleaving their output voltages to reduce the voltage ripple ratio. Besides, it can lower the current stress for the switches and inductors in the system. First, the PSIM software was used to establish a proton exchange membrane fuel cell and a converter circuit model. The simulated and measured results of the fuel cell output characteristic curve are made to verify the correctness of the established simulation model. In addition, some experimental results are made to validate the effectiveness in improving output voltage ripple of the proposed high voltage ratio interleaved boost DC-DC converters.
NASA Astrophysics Data System (ADS)
Zhang, Xi; Lu, Jinling; Yuan, Shifei; Yang, Jun; Zhou, Xuan
2017-03-01
This paper proposes a novel parameter identification method for the lithium-ion (Li-ion) battery equivalent circuit model (ECM) considering the electrochemical properties. An improved pseudo two-dimension (P2D) model is established on basis of partial differential equations (PDEs), since the electrolyte potential is simplified from the nonlinear to linear expression while terminal voltage can be divided into the electrolyte potential, open circuit voltage (OCV), overpotential of electrodes, internal resistance drop, and so on. The model order reduction process is implemented by the simplification of the PDEs using the Laplace transform, inverse Laplace transform, Pade approximation, etc. A unified second order transfer function between cell voltage and current is obtained for the comparability with that of ECM. The final objective is to obtain the relationship between the ECM resistances/capacitances and electrochemical parameters such that in various conditions, ECM precision could be improved regarding integration of battery interior properties for further applications, e.g., SOC estimation. Finally simulation and experimental results prove the correctness and validity of the proposed methodology.
Sulas, Dana B.; Yao, Kai; Intemann, Jeremy J.; ...
2015-09-12
Using an analysis based on Marcus theory, we characterize losses in open-circuit voltage (V OC) due to changes in charge-transfer state energy, electronic coupling, and spatial density of charge-transfer states in a series of polymer/fullerene solar cells. Here, we use a series of indacenodithiophene polymers and their selenium-substituted analogs as electron donor materials and fullerenes as the acceptors. By combining device measurements and spectroscopic studies (including subgap photocurrent, electroluminescence, and, importantly, time-resolved photoluminescence of the charge-transfer state) we are able to isolate the values for electronic coupling and the density of charge-transfer states (NCT), rather than the more commonly measuredmore » product of these values. We find values for NCT that are surprisingly large (~4.5 × 10 21–6.2 × 10 22 cm -3), and we find that a significant increase in N CT upon selenium substitution in donor polymers correlates with lower VOC for bulk heterojunction photovoltaic devices. The increase in N CT upon selenium substitution is also consistent with nanoscale morphological characterization. Using transmission electron microscopy, selected area electron diffraction, and grazing incidence wide-angle X-ray scattering, we find evidence of more intermixed polymer and fullerene domains in the selenophene blends, which have higher densities of polymer/fullerene interfacial charge-transfer states. Our results provide an important step toward understanding the spatial nature of charge-transfer states and their effect on the open-circuit voltage of polymer/fullerene solar cells« less
NASA Astrophysics Data System (ADS)
Liang, Sang-Zi; Chen, Gugang; Harutyunyan, Avetik R.; Sofo, Jorge O.
2014-09-01
In carbon nanotube and graphene gas sensing, the measured conductance change after the sensor is exposed to target molecules has been traditionally attributed to carrier density change due to charge transfer between the sample and the adsorbed molecule. However, this explanation has many problems when it is applied to graphene: The increased amount of Coulomb impurities should lead to decrease in carrier mobility which was not observed in many experiments, carrier density is controlled by the gate voltage in the experimental setup, and there are inconsistencies in the energetics of the charge transfer. In this paper we explore an alternative mechanism. Charged functional groups and dipolar molecules on the surface of graphene may counteract the effect of charged impurities on the substrate. Because scattering of electrons with these charged impurities has been shown to be the limiting factor in graphene conductivity, this leads to significant changes in the transport behavior. A model for the conductivity is established using the random phase approximation dielectric function of graphene and the first-order Born approximation for scattering. The model predicts optimal magnitudes for the charge and dipole moment which maximally screen a given charged impurity. The dipole screening is shown to be generally weaker than the charge screening although the former becomes more effective with higher gate voltage away from the charge neutrality point. The model also predicts that with increasing amount of adsorbates, the charge impurities eventually become saturated and additional adsorption always lead to decreasing conductivity.
Low-voltage electron microscopy of polymer and organic molecular thin films.
Drummy, Lawrence F; Yang, Junyan; Martin, David C
2004-06-01
We have demonstrated the capabilities of a novel low-voltage electron microscope (LVEM) for imaging polymer and organic molecular thin films. The LVEM can operate in transmission electron microscopy, scanning transmission electron microscopy, scanning electron microscopy, and electron diffraction modes. The microscope operates at a nominal accelerating voltage of 5 kV and fits on a tabletop. A detailed discussion of the electron-sample interaction processes is presented, and the mean free path for total electron scattering was calculated to be 15 nm for organic samples at 5 kV. The total end point dose for the destruction of crystallinity at 5 kV was estimated at 5 x 10(-4) and 3.5 x 10(-2) C/cm2 for polyethylene and pentacene, respectively. These values are significantly lower than those measured at voltages greater than 100 kV. A defocus series of colloidal gold particles allowed us to estimate the experimental contrast transfer function of the microscope. Images taken of several organic materials have shown high contrast for low atomic number elements and a resolution of 2.5 nm. The materials studied here include thin films of the organic semiconductor pentacene, triblock copolymer films, single-molecule dendrimers, electrospun polymer fibers and gold nanoparticles. Copyright 2004 Elsevier B.V.
Display nonlinearity in digital image processing for visual communications
NASA Astrophysics Data System (ADS)
Peli, Eli
1992-11-01
The luminance emitted from a cathode ray tube (CRT) display is a nonlinear function (the gamma function) of the input video signal voltage. In most analog video systems, compensation for this nonlinear transfer function is implemented in the camera amplifiers. When CRT displays are used to present psychophysical stimuli in vision research, the specific display nonlinearity usually is measured and accounted for to ensure that the luminance of each pixel in the synthetic image property represents the intended value. However, when using digital image processing, the linear analog-to-digital converters store a digital image that is nonlinearly related to the displayed or recorded image. The effect of this nonlinear transformation on a variety of image-processing applications used in visual communications is described.
Display nonlinearity in digital image processing for visual communications
NASA Astrophysics Data System (ADS)
Peli, Eli
1991-11-01
The luminance emitted from a cathode ray tube, (CRT) display is a nonlinear function (the gamma function) of the input video signal voltage. In most analog video systems, compensation for this nonlinear transfer function is implemented in the camera amplifiers. When CRT displays are used to present psychophysical stimuli in vision research, the specific display nonlinearity usually is measured and accounted for to ensure that the luminance of each pixel in the synthetic image properly represents the intended value. However, when using digital image processing, the linear analog-to-digital converters store a digital image that is nonlinearly related to the displayed or recorded image. This paper describes the effect of this nonlinear transformation on a variety of image-processing applications used in visual communications.
Transfer impedances of balanced shielded cables
NASA Astrophysics Data System (ADS)
Hardiguian, M.
1982-07-01
The transfer impedance concept is extended to balanced shielded cables, e.g., shielded pairs and twinax in which the actual voltage developed at the load, between the two wires of a pair is emphasized. This parameter can be computed by a separate knowledge of the shield, and the shield-to-pair coupling (i.e., the pair unbalance ratio). Thus, a unique parameter called shield coupling evolves which relates directly the shield current to the differential output voltage. Conditions of cable pair and harness shielding and the impact of grounding at one or both ends are discussed.
DBD tranformerless power supplies: impact of the parasitic capacitances on the power transfer.
NASA Astrophysics Data System (ADS)
Diop, M. A.; Belinger, A.; Piquet, H.
2017-04-01
A new transformerless power supply for DBD application is presented here. The power supply is built with 10kV SiC MOSFET. This high voltage switches allow holding the high voltage required by the DBD. An analytical study of the converter’s operation is presented to deduce the power transmitted to the DBD. A comparison between the experimental and theoretical electrical waveforms is shown. The experimental waveforms are particularly affected by all the parasitic capacitances. When all the switches are in OFF state, oscillations cause over-voltages across the switches. An analysis of the effect of each capacitance is presented and demonstrates that the parasitic capacitances of the switches and of the inductance play a key role in the actual power transfer.
Analysis and Control of Pulse-Width Modulated AC to DC Voltage Source Converters.
NASA Astrophysics Data System (ADS)
Wu, Rusong
The pulse width modulated AC to DC voltage source converter is comprehensively analyzed in the thesis. A general mathematical model of the converter is first established, which is discontinuous, time-variant and non-linear. The following three techniques are used to obtain closed form solutions: Fourier analysis, transformation of reference frame and small signal linearization. Three models, namely, a steady-state DC model, a low frequency small signal AC model and a high frequency model, are consequently developed. Finally, three solution sets, namely, the steady-state solution, various dynamic transfer functions and the high frequency harmonic components, are obtained from the three models. Two control strategies, the Phase and Amplitude Control (PAC) and a new proposed strategy, Predicted Current Control with a Fixed Switching Frequency (PCFF), are investigated. Based on the transfer functions derived from the above mentioned analysis, regulators for a closed-loop control are designed. A prototype circuit is built to experimentally verify the theoretical predictions. The analysis and experimental results show that both strategies produce nearly sinusoidal line current with unity power factor on the utility side in both rectifying and regenerating operations and concurrently provide a regulated DC output voltage on the load side. However the proposed PCFF control has a faster and improved dynamic response over the PAC control. Moreover it is also easier to be implemented. Therefore, the PCFF control is preferable to the PAC control. As an example of application, a configuration of variable DC supply under PCFF control is proposed. The quasi-optimal dynamic response obtained shows that the PWM AC to DC converter lays the foundation for building a four-quadrant, fast-dynamic system, and the PCFF control is an effective strategy for improving dynamic performances not only as applied to the AC to DC converter, but also as applied to the DC to DC chopper or other circuits.
The Calibration of dc Voltage Standards at NIST
Field, Bruce F.
1990-01-01
This document describes the procedures used at NIST to calibrate dc voltage standards in terms of the NIST volt. Three calibration services are offered by the Electricity Division: Regular Calibration Service (RCS) of client standard cells at NIST; the Volt Transfer Program (VTP) a process to determine the difference between the NIST volt and the volt as maintained by a group of standard cells in a client laboratory; and the calibration of client solid-state dc voltage standards at NIST. The operational procedures used to compare these voltage standards to NIST voltage standards and to maintain the NIST volt via the ac Josephson effect are discussed. PMID:28179777
NASA Astrophysics Data System (ADS)
Lin, Gong-Ru
2002-12-01
We develop a delay-line-free and frequency traceable electro-optic sampling oscilloscope by use of a digital phase-locked loop phase shifter (PLL-PS) controlled delay-time-tunable gain-switched laser diode (GSLD). The home-made voltage-controllable PLL-PS exhibits a linear transfer function with ultra-wide phase shifting range of ±350° and tuning error of <±5%, which benefits the advantages of frequency tracking to free-running signals with suppressed timing-jitter. The maximum delay-time of PLL-PS controlled GSLD is up to 1.95 periods by changing the controlling voltage ( VREF) from -3.5 to 3.5 V, which corresponds to 3.9 ns at repetition frequency of 500 MHz. The tuning responsivity and resolution are about 0.56 ns/V and 0.15˜0.2 ps, respectively. The maximum delay-time switching bandwidth of 100 Hz is determined under the control of a saw-tooth modulated VREF function. The waveform sampling of microwave PECL signals generated from a free-running digital frequency divider is performed with acceptable measuring deviation.
Mapping the droplet transfer modes for an ER100S-1 GMAW electrode
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heald, P.R.; Madigan, R.B.; Siewert, T.A.
1994-02-01
Welds were made with a 1.2-mm-diameter AWS ER100S-1 electrode using Ar-2% O[sub 2] shielding gas to map the effects of contact-tube-to-work distance (13, 19 and 25 mm), current, voltage, and wire feed rate on metal transfer. The droplet transfer modes were identified for each map by both the sound of the arc and images from a laser back-lit high-speed video system. The modes were correlated to digital records of the voltage and current fluctuations. The maps contain detailed information on the spray transfer mode, including the boundaries of drop spray, streaming spray and rotating spray modes. The metal transfer modemore » boundaries shifted with an increase in contact-tube-to-work distance. Increasing the contact-tube-to-work distance from 13 to 19 mm resulted in a 15 mm/s increase in the wire feet rate for the globular-to-drop-spray transition.« less
The interaction of spacecraft high voltage power systems with the space plasma environment
NASA Technical Reports Server (NTRS)
Domitz, S.; Grier, N. T.
1974-01-01
The development of spacecraft with electrical loads that require high voltage power is discussed. The high voltage solar array has been considered for supplying d.c. power directly to high voltage loads such as ion thrusters and communication tubes without intermediate power processing. Space power stations for transferring solar power to earth are being studied in the 40 kilovolt, multikilowatt regime. Analytical and experimental studies have determined that with the advent of high voltage power, new problems will arise through the interaction of the high voltage surfaces with the charged particle environment of space. The interactive environment has been identified and duplicated to some extent in simulation facilities at NASA-Lewis Research Center and at several contractor locations.
Centrifugal photovoltaic and photogalvanic effects driven by structured light
Wätzel, J.; Berakdar, J.
2016-01-01
Much efforts are devoted to material structuring in a quest to enhance the photovoltaic effect. We show that structuring light in a way it transfers orbital angular momentum to semiconductor-based rings results in a steady charge accumulation at the outer boundaries that can be utilized for the generation of an open circuit voltage or a photogalvanic (bulk photovoltaic) type current. This effect which stems both from structuring light and matter confinement potentials, can be magnified even at fixed moderate intensities, by increasing the orbital angular momentum of light which strengthens the effective centrifugal potential that repels the charge outwards. Based on a full numerical time propagation of the carriers wave functions in the presence of light pulses we demonstrate how the charge buildup leads to a useable voltage or directed photocurrent whose amplitudes and directions are controllable by the light pulse parameters. PMID:26900105
Input-output Transfer Function Analysis of a Photometer Circuit Based on an Operational Amplifier.
Hernandez, Wilmar
2008-01-09
In this paper an input-output transfer function analysis based on the frequencyresponse of a photometer circuit based on operational amplifier (op amp) is carried out. Opamps are universally used in monitoring photodetectors and there are a variety of amplifierconnections for this purpose. However, the electronic circuits that are usually used to carryout the signal treatment in photometer circuits introduce some limitations in theperformance of the photometers that influence the selection of the op amps and otherelectronic devices. For example, the bandwidth, slew-rate, noise, input impedance and gain,among other characteristics of the op amp, are often the performance limiting factors ofphotometer circuits. For this reason, in this paper a comparative analysis between twophotodiode amplifier circuits is carried out. One circuit is based on a conventional currentto-voltage converter connection and the other circuit is based on a robust current-to-voltageconverter connection. The results are satisfactory and show that the photodiode amplifierperformance can be improved by using robust control techniques.
An In-Rush Current Suppression Technique for the Solid-State Transfer Switch System
NASA Astrophysics Data System (ADS)
Cheng, Po-Tai; Chen, Yu-Hsing
More and more utility companies provide dual power feeders as a premier service of high power quality and reliability. To take advantage of this, the solid-state transfer switch (STS) is adopted to protect the sensitive load against the voltage sag. However, the fast transfer process may cause in-rush current on the load-side transformer due to the resulting DC-offset in its magnetic flux as the load-transfer is completed. The in-rush current can reach 2∼6 p.u. and it may trigger the over-current protections on the power feeder. This paper develops a flux estimation scheme and a thyristor gating scheme based on the impulse commutation bridge STS (ICBSTS) to minimize the DC-offset on the magnetic flux. By sensing the line voltages of both feeders, the flux estimator can predict the peak transient flux linkage at the moment of load-transfer and evaluate a suitable moment for the transfer to minimize the in-rush current. Laboratory test results are presented to validate the performance of the proposed system.
Spin current and spin transfer torque in ferromagnet/superconductor spin valves
NASA Astrophysics Data System (ADS)
Moen, Evan; Valls, Oriol T.
2018-05-01
Using fully self-consistent methods, we study spin transport in fabricable spin valve systems consisting of two magnetic layers, a superconducting layer, and a spacer normal layer between the ferromagnets. Our methods ensure that the proper relations between spin current gradients and spin transfer torques are satisfied. We present results as a function of geometrical parameters, interfacial barrier values, misalignment angle between the ferromagnets, and bias voltage. Our main results are for the spin current and spin accumulation as functions of position within the spin valve structure. We see precession of the spin current about the exchange fields within the ferromagnets, and penetration of the spin current into the superconductor for biases greater than the critical bias, defined in the text. The spin accumulation exhibits oscillating behavior in the normal metal, with a strong dependence on the physical parameters both as to the structure and formation of the peaks. We also study the bias dependence of the spatially averaged spin transfer torque and spin accumulation. We examine the critical-bias effect of these quantities, and their dependence on the physical parameters. Our results are predictive of the outcome of future experiments, as they take into account imperfect interfaces and a realistic geometry.
NASA Astrophysics Data System (ADS)
Amerikheirabadi, Fatemeh
Organic Donor-Acceptor complexes form the main component of the organic photovoltaic devices (OPVs). The open circuit voltage of OPVs is directly related to the charge transfer excited state energies of these complexes. Currently a large number of different molecular complexes are being tested for their efficiency in photovoltaic devices. In this work, density functional theory as implemented in the NRLMOL code is used to investigate the electronic structure and related properties of these donor-acceptor complexes. The charge transfer excitation energies are calculated using the perturbative delta self-consistent field method recently developed in our group as the standard time dependent density functional approaches fail to accurately provide them. The model photovoltaics systems analyzed are as follows: Sc3N C 80--ZnTPP, Y3 N C80-- ZnTPP and Sc3 N C80-- ZnPc. In addition, a thorough analysis of the isolated donor and acceptor molecules is also provided. The studied acceptors are chosen from a class of fullerenes named trimetallic nitride endohedral fullerenes. These molecules have shown to possess advantages as acceptors such as long lifetimes of the charge-separated states.
Grafting voltage and pharmacological sensitivity in potassium channels.
Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing
2016-08-01
A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.
Kraujalis, Tadas; Maciunas, Kestutis
2017-01-01
We combined the Hodgkin–Huxley equations and a 36-state model of gap junction channel gating to simulate electrical signal transfer through electrical synapses. Differently from most previous studies, our model can account for dynamic modulation of junctional conductance during the spread of electrical signal between coupled neurons. The model of electrical synapse is based on electrical properties of the gap junction channel encompassing two fast and two slow gates triggered by the transjunctional voltage. We quantified the influence of a difference in input resistances of electrically coupled neurons and instantaneous conductance–voltage rectification of gap junctions on an asymmetry of cell-to-cell signaling. We demonstrated that such asymmetry strongly depends on junctional conductance and can lead to the unidirectional transfer of action potentials. The simulation results also revealed that voltage spikes, which develop between neighboring cells during the spread of action potentials, can induce a rapid decay of junctional conductance, thus demonstrating spiking activity-dependent short-term plasticity of electrical synapses. This conclusion was supported by experimental data obtained in HeLa cells transfected with connexin45, which is among connexin isoforms expressed in neurons. Moreover, the model allowed us to replicate the kinetics of junctional conductance under different levels of intracellular concentration of free magnesium ([Mg2+]i), which was experimentally recorded in cells expressing connexin36, a major neuronal connexin. We demonstrated that such [Mg2+]i-dependent long-term plasticity of the electrical synapse can be adequately reproduced through the changes of slow gate parameters of the 36-state model. This suggests that some types of chemical modulation of gap junctions can be executed through the underlying mechanisms of voltage gating. Overall, the developed model accounts for direction-dependent asymmetry, as well as for short- and long-term plasticity of electrical synapses. Our modeling results demonstrate that such complex behavior of the electrical synapse is important in shaping the response of coupled neurons. PMID:28384220
Design of a Matrix Transducer for Three-Dimensional Second Harmonic Transesophageal Echocardiography
NASA Astrophysics Data System (ADS)
Blaak, Sandra; van Neer, Paul L. M. J.; Prins, Christian; Bosch, Johan G.; Lancée, Charles T.; van der Steen, Antonius F. W.; de Jong, Nico
Three-dimensional (3D) echocardiography visualizes the 3D anatomy and function of the heart. For 3D imaging an ultrasound matrix of several thousands of elements is required. To connect the matrix to an external imaging system, smart signal processing with integrated circuitry in the tip of the TEE probe is required for channel reduction. To separate the low voltage integrated receive circuitry from the high voltages required for transmission, our design features a separate transmit and receive subarray. In this study we focus on the transmit subarray. A 3D model of an individual element was developed using the finite element method (FEM). The model was validated by laser interferometer and acoustic measurements. Measurement and simulations matched well. The maximum transmit transfer was 3 nm/V at 2.4 MHz for both the FEM simulation of an element in air and the laser interferometer measurement. The FEM simulation of an element in water resulted in a maximum transfer of 43 kPa/V at 2.3 MHz and the acoustic measurement in 55 kPa/V at 2.5 MHz. The maximum pressure is ~1 MPa/120Vpp, which is sufficient pressure for second harmonic imaging. The proposed design of the transmit subarray is suitable for its role in a 3D 2H TEE probe.
Impedance based time-domain modeling of lithium-ion batteries: Part I
NASA Astrophysics Data System (ADS)
Gantenbein, Sophia; Weiss, Michael; Ivers-Tiffée, Ellen
2018-03-01
This paper presents a novel lithium-ion cell model, which simulates the current voltage characteristic as a function of state of charge (0%-100%) and temperature (0-30 °C). It predicts the cell voltage at each operating point by calculating the total overvoltage from the individual contributions of (i) the ohmic loss η0, (ii) the charge transfer loss of the cathode ηCT,C, (iii) the charge transfer loss and the solid electrolyte interface loss of the anode ηSEI/CT,A, and (iv) the solid state and electrolyte diffusion loss ηDiff,A/C/E. This approach is based on a physically meaningful equivalent circuit model, which is parametrized by electrochemical impedance spectroscopy and time domain measurements, covering a wide frequency range from MHz to μHz. The model is exemplarily parametrized to a commercial, high-power 350 mAh graphite/LiNiCoAlO2-LiCoO2 pouch cell and validated by continuous discharge and charge curves at varying temperature. For the first time, the physical background of the model allows the operator to draw conclusions about the performance-limiting factor at various operating conditions. Not only can the model help to choose application-optimized cell characteristics, but it can also support the battery management system when taking corrective actions during operation.
Agarwal, Bishu; González-Méndez, Ramón; Lanza, Matteo; Sulzer, Philipp; Märk, Tilmann D; Thomas, Neil; Mayhew, Chris A
2014-09-18
We have investigated the reactions of NO(+), H3O(+), O2(+), and Kr(+) with picric acid (2,4,6 trinitrophenol, C6H3N3O7, PiA) using a time-of-flight mass spectrometer with a switchable reagent ion source. NO(+) forms a simple adduct ion PiA·NO(+), while H3O(+) reacts with PiA via nondissociative proton transfer to form PiAH(+). In contrast, both O2(+) and Kr(+) react with PiA by nondissociative charge transfer to produce PiA(+). For Kr(+), we also observe dissociation of PiA, producing NO2(+) with a branching percentage of approximately 40%. For the reagent ions H3O(+) and O2(+) (and operating the drift tube with normal laboratory air), we find that the intensities of the PiAH(+) and PiA(+) ions both exhibit a peak at a given drift-tube voltage (which is humidity dependent). This unusual behavior implies a peak in the detection sensitivity of PiA as a function of the drift-tube voltage (and hence E/N). Aided by electronic-structure calculations and our previous studies of trinitrotoluene and trinitrobenzene, we provide a possible explanation for the observed peak in the detection sensitivity of PiA.
SHORT COMMUNICATION: Transportable Zener-diode Voltage Standard
NASA Astrophysics Data System (ADS)
Karpov, O. V.; Shulga, V. M.; Shakirzyanova, F. R.; Sarandi, A. E.
1994-01-01
Five transportable Zener-diode dc voltage standards have been developed, fabricated and investigated at the NPO VNIIFTRI. The standards were designed to transfer the unit of electromotive force (emf) from Josephson reference standards to measuring instruments. Following the results of these investigations, standard N 02 has been used for intercomparison of the Russian Josephson reference standards.
Deflection amplifier for image dissectors
NASA Technical Reports Server (NTRS)
Salomon, P. M.
1977-01-01
Balanced symmetrical y-axis amplifier uses zener-diode level shifting to interface operational amplifiers to high voltage bipolar output stages. Nominal voltage transfer characteristic is 40 differential output volts per input volt; bandwidth, between -3-dB points, is approximately 8 kHz; loop gain is nominally 89 dB with closed loop gain of 26 dB.
Method for the measurement of media player use
NASA Astrophysics Data System (ADS)
Webb, Graham
There has been ongoing concern that prolonged use of MP3 players can lead to noise-induced hearing loss. Acoustic exposure is the product of intensity and duration of exposure. Previous work has utilised measurements of maximum headphone output and output during listening tests to determine acoustic intensity; whilst duration of use is currently assessed with questionnaires and interviews. The subjective nature of these latter methods has led to a wide variation in figures for device use, restricting the scope of media player risk assessment. A need was therefore identified for an improved method of acquiring data of users' listening habits. This need was addressed with the design of a new data-logging device that discretely measures voltage output from the media player, whilst in use. A calibration method is proposed to implement the headphone transfer function into the data-logger, to relate output voltage to exposed pressure. It is proposed that the headphone transfer function is measured using an acoustic manikin, representative of the population of interest. The real ear measurement is put forward as an appropriate tool for validating results gained using this approach. A data-logger was designed and a proof of concept has been demonstrated in a software program written for this purpose. The proposed method has the advantages that an objective measurement can be made of the user's natural listening habits, over a long period of time, with a resolution comparable to personal acoustic dosimetry. A number of practical steps are required to further this work before data can be collected. A software graphic equaliser was used to implement the transfer function, but the chosen filter topology gave an unsatisfactory response, an investigation is required for further work. The device requires migration to hardware and the experimental calibration and validation of the system are also required. The worldwide population of MP3 player users is in the region of hundreds of millions of people. The relationship between user and device is becoming closer and portable music technology is becoming ubiquitous, permitting extended listening durations. There is therefore a strong need to continue this field of research, to increase understanding of the risks of this aspect of recreational noise.
Magistretti, Jacopo; Castelli, Loretta; Forti, Lia; D'Angelo, Egidio
2006-01-01
Cerebellar neurones show complex and differentiated mechanisms of action potential generation that have been proposed to depend on peculiar properties of their voltage-dependent Na+ currents. In this study we analysed voltage-dependent Na+ currents of rat cerebellar granule cells (GCs) by performing whole-cell, patch-clamp experiments in acute rat cerebellar slices. A transient Na+ current (INaT) was always present and had the properties of a typical fast-activating/inactivating Na+ current. In addition to INaT, robust persistent (INaP) and resurgent (INaR) Na+ currents were observed. INaP peaked at ∼−40 mV, showed half-maximal activation at ∼−55 mV, and its maximal amplitude was about 1.5% of that of INaT. INaR was elicited by repolarizing pulses applied following step depolarizations able to activate/inactivate INaT, and showed voltage- and time-dependent activation and voltage-dependent decay kinetics. The conductance underlying INaR showed a bell-shaped voltage dependence, with peak at −35 mV. A significant correlation was found between GC INaR and INaT peak amplitudes; however, GCs expressing INaT of similar size showed marked variability in terms of INaR amplitude, and in a fraction of cells INaR was undetectable. INaT, INaP and INaR could be accounted for by a 13-state kinetic scheme comprising closed, open, inactivated and blocked states. Current-clamp experiments carried out to identify possible functional correlates of INaP and/or INaR revealed that in GCs single action potentials were followed by depolarizing afterpotentials (DAPs). In a majority of cells, DAPs showed properties consistent with INaR playing a role in their generation. Computer modelling showed that INaR promotes DAP generation and enhances high-frequency firing, whereas INaP boosts near-threshold firing activity. Our findings suggest that special properties of voltage-dependent Na+ currents provides GCs with mechanisms suitable for shaping activity patterns, with potentially important consequences for cerebellar information transfer and computation. PMID:16527854
Multi-hundred kilowatt roll ring assembly
NASA Technical Reports Server (NTRS)
Jacobson, Peter E.
1985-01-01
A program was completed to develop an evaluation unit of a high power rotary transfer device for potential application in a space environment. This device was configured around a Roll Ring concept which performs the same function as a slip ring/brush assembly with a rolling instead of sliding interface. An eight circuit Evaluation Unit (EU) and a portable Test Fixture (TF) were designed and fabricated. The EU was designed to transfer currents to 200 amperes at a potential of as high as 500 volts for an ultimate 100 kW/circuit transfer capability. The EU was evaluated in vacuum at dc transfer currents of 50 to 200 amperes at voltages to 10 volts and at 500 volts at 2 amperes. Power transfer to levels of 2 kW through each of the eight circuits was completed. Power transfer in vacuum at levels and efficiencies not previously achieved was demonstrated. The terminal-to-terminal resistance was measured to be greater than 0.42 milliohms which translates to an efficiency at 100 kW of 99.98 percent. The EU and TF have been delivered to the Lewis Research Center and are being prepared tor testing at increased power levels and for life testing, which will include both dc and ac power.
NASA Astrophysics Data System (ADS)
Fotoohi, Somayeh; Haji-Nasiri, Saeed
2018-04-01
Spin-dependent electronic transport properties of single 3d transition metal (TM) atoms doped α-armchair graphyne nanoribbons (α-AGyNR) are investigated by non-equilibrium Green's function (NEGF) method combined with density functional theory (DFT). It is found that all of the impurity atoms considered in this study (Fe, Co, Ni) prefer to occupy the sp-hybridized C atom site in α-AGyNR, and the obtained structures remain planar. The results show that highly localized impurity states are appeared around the Fermi level which correspond to the 3d orbitals of TM atoms, as can be derived from the projected density of states (PDOS). Moreover, Fe, Co, and Ni doped α-AGyNRs exhibit magnetic properties due to the strong spin splitting property of the energy levels. Also for each case, the calculated current-voltage characteristic per super-cell shows that the spin degeneracy in the system is obviously broken and the current becomes strongly spin dependent. Furthermore, a high spin-filtering effect around 90% is found under the certain bias voltages in Ni doped α-AGyNR. Additionally, the structure with Ni impurity reveals transfer characteristic that is suitable for designing a spin current switch. Our findings provide a high possibility to design the next generation spin nanodevices with novel functionalities.
Goffeau, Jacques R.
1979-01-01
An improved Up-and-Down Chopper Circuit is provided which is useful for voltage regulation in a bi-directional DC power system. In the down mode, power is switched from a DC power source to a lower voltage energy storing load while in the up mode stored energy in the load is transferred to the higher voltage source. The system uses Darlington transistor switches in a conventional connection. The improvement relates to circuit additions to eliminate the effects of inter-electrode capacitance inherent with this Darlington transistor switching arrangement.
A system for the automated data-acquisition of fast transient signals in excitable membranes.
Bustamante, J O
1988-01-01
This paper provides a description of a system for the acquisition of fast transient currents flowing across excitable membranes. The front end of the system consists of a CAMAC crate with plug-in modules. The modules provide control of CAMAC operations, analog to digital conversion, electronic memory storage and timing of events. The signals are transferred under direct memory access to an IBM PC microcomputer through a special-purpose interface. Voltage levels from a digital to analog board in the microcomputer are passed through multiplexers to produce the desired voltage pulse patterns to elicit the transmembrane currents. The dead time between consecutive excitatory voltage pulses is limited only by the computer data bus and the software characteristics. The dead time between data transfers can be reduced to the order of milliseconds, which is sufficient for most experiments with transmembrane ionic currents.
Available Transfer Capability Determination Using Hybrid Evolutionary Algorithm
NASA Astrophysics Data System (ADS)
Jirapong, Peeraool; Ongsakul, Weerakorn
2008-10-01
This paper proposes a new hybrid evolutionary algorithm (HEA) based on evolutionary programming (EP), tabu search (TS), and simulated annealing (SA) to determine the available transfer capability (ATC) of power transactions between different control areas in deregulated power systems. The optimal power flow (OPF)-based ATC determination is used to evaluate the feasible maximum ATC value within real and reactive power generation limits, line thermal limits, voltage limits, and voltage and angle stability limits. The HEA approach simultaneously searches for real power generations except slack bus in a source area, real power loads in a sink area, and generation bus voltages to solve the OPF-based ATC problem. Test results on the modified IEEE 24-bus reliability test system (RTS) indicate that ATC determination by the HEA could enhance ATC far more than those from EP, TS, hybrid TS/SA, and improved EP (IEP) algorithms, leading to an efficient utilization of the existing transmission system.
The Architecture Design of Detection and Calibration System for High-voltage Electrical Equipment
NASA Astrophysics Data System (ADS)
Ma, Y.; Lin, Y.; Yang, Y.; Gu, Ch; Yang, F.; Zou, L. D.
2018-01-01
With the construction of Material Quality Inspection Center of Shandong electric power company, Electric Power Research Institute takes on more jobs on quality analysis and laboratory calibration for high-voltage electrical equipment, and informationization construction becomes urgent. In the paper we design a consolidated system, which implements the electronic management and online automation process for material sampling, test apparatus detection and field test. In the three jobs we use QR code scanning, online Word editing and electronic signature. These techniques simplify the complex process of warehouse management and testing report transferring, and largely reduce the manual procedure. The construction of the standardized detection information platform realizes the integrated management of high-voltage electrical equipment from their networking, running to periodic detection. According to system operation evaluation, the speed of transferring report is doubled, and querying data is also easier and faster.
NASA Astrophysics Data System (ADS)
Reisgen, Uwe; Schleser, Markus; Mokrov, Oleg; Zabirov, Alexander
2011-06-01
A two dimensional transient numerical analysis and computational module for simulation of electrical and thermal characteristics during electrode melting and metal transfer involved in Gas-Metal-Arc-Welding (GMAW) processes is presented. Solution of non-linear transient heat transfer equation is carried out using a control volume finite difference technique. The computational module also includes controlling and regulation algorithms of industrial welding power sources. The simulation results are the current and voltage waveforms, mean voltage drops at different parts of circuit, total electric power, cathode, anode and arc powers and arc length. We describe application of the model for normal process (constant voltage) and for pulsed processes with U/I and I/I-modulation modes. The comparisons with experimental waveforms of current and voltage show that the model predicts current, voltage and electric power with a high accuracy. The model is used in simulation package SimWeld for calculation of heat flux into the work-piece and the weld seam formation. From the calculated heat flux and weld pool sizes, an equivalent volumetric heat source according to Goldak model, can be generated. The method was implemented and investigated with the simulation software SimWeld developed by the ISF at RWTH Aachen University.
Magnetic tunnel junction based spintronic logic devices
NASA Astrophysics Data System (ADS)
Lyle, Andrew Paul
The International Technology Roadmap for Semiconductors (ITRS) predicts that complimentary metal oxide semiconductor (CMOS) based technologies will hit their last generation on or near the 16 nm node, which we expect to reach by the year 2025. Thus future advances in computational power will not be realized from ever-shrinking device sizes, but rather by 'outside the box' designs and new physics, including molecular or DNA based computation, organics, magnonics, or spintronic. This dissertation investigates magnetic logic devices for post-CMOS computation. Three different architectures were studied, each relying on a different magnetic mechanism to compute logic functions. Each design has it benefits and challenges that must be overcome. This dissertation focuses on pushing each design from the drawing board to a realistic logic technology. The first logic architecture is based on electrically connected magnetic tunnel junctions (MTJs) that allow direct communication between elements without intermediate sensing amplifiers. Two and three input logic gates, which consist of two and three MTJs connected in parallel, respectively were fabricated and are compared. The direct communication is realized by electrically connecting the output in series with the input and applying voltage across the series connections. The logic gates rely on the fact that a change in resistance at the input modulates the voltage that is needed to supply the critical current for spin transfer torque switching the output. The change in resistance at the input resulted in a voltage margin of 50--200 mV and 250--300 mV for the closest input states for the three and two input designs, respectively. The two input logic gate realizes the AND, NAND, NOR, and OR logic functions. The three input logic function realizes the Majority, AND, NAND, NOR, and OR logic operations. The second logic architecture utilizes magnetostatically coupled nanomagnets to compute logic functions, which is the basis of Magnetic Quantum Cellular Automata (MQCA). MQCA has the potential to be thousands of times more energy efficient than CMOS technology. While interesting, these systems are academic unless they can be interfaced into current technologies. This dissertation pushed past a major hurdle by experimentally demonstrating a spintronic input/output (I/O) interface for the magnetostatically coupled nanomagnets by incorporating MTJs. This spintronic interface allows individual nanomagnets to be programmed using spin transfer torque and read using magneto resistance structure. Additionally the spintronic interface allows statistical data on the reliability of the magnetic coupling utilized for data propagation to be easily measured. The integration of spintronics and MQCA for an electrical interface to achieve a magnetic logic device with low power creates a competitive post-CMOS logic device. The final logic architecture that was studied used MTJs to compute logic functions and magnetic domain walls to communicate between gates. Simulations were used to optimize the design of this architecture. Spin transfer torque was used to compute logic function at each MTJ gate and was used to drive the domain walls. The design demonstrated that multiple nanochannels could be connected to each MTJ to realize fan-out from the logic gates. As a result this logic scheme eliminates the need for intermediate reads and conversions to pass information from one logic gate to another.
Research and Construction of DC Energy Measurement Traceability Technology
NASA Astrophysics Data System (ADS)
Zhi, Wang; Maotao, Yang; Jing, Yang
2018-02-01
With the implementation of energy saving and emission reduction policies, DC energy metering has been widely used in many fields. In view of the lack of a DC energy measurementtraceability system, in combination with the process of downward measurement transfer in relation to the DC charger-based field calibration technology and DC energy meter and shunt calibration technologies, the paper proposed DC fast charging, high DC, small DC voltage output and measuring technologies, and built a time-based plan by converting high DC voltage into low voltage and high current into low current and then into low voltage, leaving DC energy traceable to national standards in terms of voltage, current and time and thus filling in the gap in DC energy measurement traceability.
Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan
High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio andmore » good memory retention.« less
Process techniques of charge transfer time reduction for high speed CMOS image sensors
NASA Astrophysics Data System (ADS)
Zhongxiang, Cao; Quanliang, Li; Ye, Han; Qi, Qin; Peng, Feng; Liyuan, Liu; Nanjian, Wu
2014-11-01
This paper proposes pixel process techniques to reduce the charge transfer time in high speed CMOS image sensors. These techniques increase the lateral conductivity of the photo-generated carriers in a pinned photodiode (PPD) and the voltage difference between the PPD and the floating diffusion (FD) node by controlling and optimizing the N doping concentration in the PPD and the threshold voltage of the reset transistor, respectively. The techniques shorten the charge transfer time from the PPD diode to the FD node effectively. The proposed process techniques do not need extra masks and do not cause harm to the fill factor. A sub array of 32 × 64 pixels was designed and implemented in the 0.18 μm CIS process with five implantation conditions splitting the N region in the PPD. The simulation and measured results demonstrate that the charge transfer time can be decreased by using the proposed techniques. Comparing the charge transfer time of the pixel with the different implantation conditions of the N region, the charge transfer time of 0.32 μs is achieved and 31% of image lag was reduced by using the proposed process techniques.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anzanel, P.; Kouteynikoff, P.
1985-02-01
This Part II presents theorical and experimental work about interference generated by lightning strokes in a telecommunication coaxial circuit enclosed inside a composite earthwire for overhead transmission lines. Sinusoidal steady state and surge measurements of the composite earthwire susceptibility to interference (transfer impedance) have been carried out. Induced voltages have been calculated using an original double sampling FFT method whose validity has been checked by measurements on a test line. Finally, it is shown how the cable design can be improved and maximum induced voltage values are given.
R1 in the Shaker S4 occupies the gating charge transfer center in the resting state
Lin, Meng-chin A.; Hsieh, Jui-Yi; Mock, Allan F.
2011-01-01
During voltage-dependent activation in Shaker channels, four arginine residues in the S4 segment (R1–R4) cross the transmembrane electric field. It has been proposed that R1–R4 movement is facilitated by a “gating charge transfer center” comprising a phenylalanine (F290) in S2 plus two acidic residues, one each in S2 and S3. According to this proposal, R1 occupies the charge transfer center in the resting state, defined as the conformation in which S4 is maximally retracted toward the cytoplasm. However, other evidence suggests that R1 is located extracellular to the charge transfer center, near I287 in S2, in the resting state. To investigate the resting position of R1, we mutated I287 to histidine (I287H), paired it with histidine mutations of key voltage sensor residues, and determined the effect of extracellular Zn2+ on channel activity. In I287H+R1H, Zn2+ generated a slow component of activation with a maximum amplitude (Aslow,max) of ∼56%, indicating that only a fraction of voltage sensors can bind Zn2+ at a holding potential of −80 mV. Aslow,max decreased after applying either depolarizing or hyperpolarizing prepulses from −80 mV. The decline of Aslow,max after negative prepulses indicates that R1 moves inward to abolish ion binding, going beyond the point where reorientation of the I287H and R1H side chains would reestablish a binding site. These data support the proposal that R1 occupies the charge transfer center upon hyperpolarization. Consistent with this, pairing I287H with A359H in the S3–S4 loop generated a Zn2+-binding site. At saturating concentrations, Aslow,max reached 100%, indicating that Zn2+ traps the I287H+A359H voltage sensor in an absorbing conformation. Transferring I287H+A359H into a mutant background that stabilizes the resting state significantly enhanced Zn2+ binding at −80 mV. Our results strongly support the conclusion that R1 occupies the gating charge transfer center in the resting conformation. PMID:21788609
Dual side control for inductive power transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Hunter; Sealy, Kylee; Gilchrist, Aaron
An apparatus for dual side control includes a measurement module that measures a voltage and a current of an IPT system. The voltage includes an output voltage and/or an input voltage and the current includes an output current and/or an input current. The output voltage and the output current are measured at an output of the IPT system and the input voltage and the input current measured at an input of the IPT system. The apparatus includes a max efficiency module that determines a maximum efficiency for the IPT system. The max efficiency module uses parameters of the IPT systemmore » to iterate to a maximum efficiency. The apparatus includes an adjustment module that adjusts one or more parameters in the IPT system consistent with the maximum efficiency calculated by the max efficiency module.« less
Current-voltage characteristics and transition voltage spectroscopy of individual redox proteins.
Artés, Juan M; López-Martínez, Montserrat; Giraudet, Arnaud; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau
2012-12-19
Understanding how molecular conductance depends on voltage is essential for characterizing molecular electronics devices. We reproducibly measured current-voltage characteristics of individual redox-active proteins by scanning tunneling microscopy under potentiostatic control in both tunneling and wired configurations. From these results, transition voltage spectroscopy (TVS) data for individual redox molecules can be calculated and analyzed statistically, adding a new dimension to conductance measurements. The transition voltage (TV) is discussed in terms of the two-step electron transfer (ET) mechanism. Azurin displays the lowest TV measured to date (0.4 V), consistent with the previously reported distance decay factor. This low TV may be advantageous for fabricating and operating molecular electronic devices for different applications. Our measurements show that TVS is a helpful tool for single-molecule ET measurements and suggest a mechanism for gating of ET between partner redox proteins.
Kertesz, Vilmos; Van Berkel, Gary J.
2016-07-12
A system for sampling a surface includes a surface sampling probe comprising a solvent liquid supply conduit and a distal end, and a sample collector for suspending a sample collection liquid adjacent to the distal end of the probe. A first electrode provides a first voltage to solvent liquid at the distal end of the probe. The first voltage produces a field sufficient to generate electrospray plume at the distal end of the probe. A second electrode provides a second voltage and is positioned to produce a plume-directing field sufficient to direct the electrospray droplets and ions to the suspended sample collection liquid. The second voltage is less than the first voltage in absolute value. A voltage supply system supplies the voltages to the first electrode and the second electrode. The first electrode can apply the first voltage directly to the solvent liquid. A method for sampling for a surface is also disclosed.
Origins of low energy-transfer efficiency between patterned GaN quantum well and CdSe quantum dots
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Xingsheng, E-mail: xsxu@semi.ac.cn
For hybrid light emitting devices (LEDs) consisting of GaN quantum wells and colloidal quantum dots, it is necessary to explore the physical mechanisms causing decreases in the quantum efficiencies and the energy transfer efficiency between a GaN quantum well and CdSe quantum dots. This study investigated the electro-luminescence for a hybrid LED consisting of colloidal quantum dots and a GaN quantum well patterned with photonic crystals. It was found that both the quantum efficiency of colloidal quantum dots on a GaN quantum well and the energy transfer efficiency between the patterned GaN quantum well and the colloidal quantum dots decreasedmore » with increases in the driving voltage or the driving time. Under high driving voltages, the decreases in the quantum efficiency of the colloidal quantum dots and the energy transfer efficiency can be attributed to Auger recombination, while those decreases under long driving time are due to photo-bleaching and Auger recombination.« less
Park, JungEun; Oh, HyunJu; Hong, SoGun; Kim, MinJung; Kim, GeonA; Koo, OkJae; Kang, SungKeun; Jang, Goo; Lee, ByeongChun
2011-03-01
As shown by the birth of the first cloned dog 'Snuppy', a protocol to produce viable cloned dogs has been reported. In order to evaluate optimum fusion conditions for improving dog cloning efficiency, in vivo matured oocytes were reconstructed with adult somatic cells from a female Pekingese using different fusion conditions. Fusion with needle vs chamber methods, and with low vs high pulse strength was compared by evaluating fusion rate and in vivo development of canine cloned embryos. The fusion rates in the high voltage groups were significantly higher than in the low voltage groups regardless of fusion method (83.5 vs 66.1% for the needle fusion method, 67.4 vs 37.9% for the fusion chamber method). After embryo transfer, one each pregnancy was detected after using the needle fusion method with high and low voltage and in the chamber fusion method with high voltage, whereas no pregnancy was detected using the chamber method with low voltage. However, only the pregnancy from the needle fusion method with high voltage was maintained to term and one healthy puppy was delivered. The results of the present study demonstrated that two DC pulses of 3.8 to 4.0 kV/cm for 15 μsec using the needle fusion method were the most effective method for the production of cloned dogs under the conditions of this experiment. Copyright © 2011 Elsevier Inc. All rights reserved.
Cyclic voltammetric and spectroscopic studies of SOCl2 solutions
NASA Astrophysics Data System (ADS)
Venkatasetty, H. V.
1980-11-01
Cyclic voltammetric data on thionyl chloride (SOCl2) is presented as a function of SOCl2 concentration and scan rate in different aprotic organic solvents such as dimethyl-sulfite (DMSI), dimethylformamide (DMF), and acetonitrile (ACN) with lithium aluminum chloride and tetrabutylammonium hexafluorophosphate as supporting electrolytes. Using the diagnostic criteria of Nicholson and Shain (1964), the data are treated showing plots of current function vs voltage sweep rate which are consistent with an irreversible charge transfer followed by a chemical reaction. It is suggested that this type of chemical process occurring in a lithium-thionyl chloride battery might be important in regards to safety problems. Other experiments use constant potential electrolysis and ultraviolet spectroscopy of solutions of SOCl2 in acetonitrile with 0.1M tetrabutylammonium hexafluorophosphate.
Imaging of Brain Slices with a Genetically Encoded Voltage Indicator.
Quicke, Peter; Barnes, Samuel J; Knöpfel, Thomas
2017-01-01
Functional fluorescence microscopy of brain slices using voltage sensitive fluorescent proteins (VSFPs) allows large scale electrophysiological monitoring of neuronal excitation and inhibition. We describe the equipment and techniques needed to successfully record functional responses optical voltage signals from cells expressing a voltage indicator such as VSFP Butterfly 1.2. We also discuss the advantages of voltage imaging and the challenges it presents.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred
2016-01-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857
An analog silicon retina with multichip configuration.
Kameda, Seiji; Yagi, Tetsuya
2006-01-01
The neuromorphic silicon retina is a novel analog very large scale integrated circuit that emulates the structure and the function of the retinal neuronal circuit. We fabricated a neuromorphic silicon retina, in which sample/hold circuits were embedded to generate fluctuation-suppressed outputs in the previous study [1]. The applications of this silicon retina, however, are limited because of a low spatial resolution and computational variability. In this paper, we have fabricated a multichip silicon retina in which the functional network circuits are divided into two chips: the photoreceptor network chip (P chip) and the horizontal cell network chip (H chip). The output images of the P chip are transferred to the H chip with analog voltages through the line-parallel transfer bus. The sample/hold circuits embedded in the P and H chips compensate for the pattern noise generated on the circuits, including the analog communication pathway. Using the multichip silicon retina together with an off-chip differential amplifier, spatial filtering of the image with an odd- and an even-symmetric orientation selective receptive fields was carried out in real time. The analog data transfer method in the present multichip silicon retina is useful to design analog neuromorphic multichip systems that mimic the hierarchical structure of neuronal networks in the visual system.
Phased Array Excitations For Efficient Near Field Wireless Power Transmission
2016-09-01
relating to the improvement of wireless - power transfer (WPT) in the near field. Improvement to power reception in the near field requires that...improvement of wireless - power transfer (WPT) in the near field. Improvement to power reception in the near field requires that excitation correction methods...transverse electromagnetic TM transverse magnetic UAV unmanned aerial vehicles VSWR voltage standing wave ratio WPT wireless power transfer XML
Nanowire NMOS Logic Inverter Characterization.
Hashim, Yasir
2016-06-01
This study is the first to demonstrate characteristics optimization of nanowire N-Channel Metal Oxide Semiconductor (NW-MOS) logic inverter. Noise margins and inflection voltage of transfer characteristics are used as limiting factors in this optimization. A computer-based model used to produce static characteristics of NW-NMOS logic inverter. In this research two circuit configuration of NW-NMOS inverter was studied, in first NW-NMOS circuit, the noise margin for (low input-high output) condition was very low. For second NMOS circuit gives excellent noise margins, and results indicate that optimization depends on applied voltage to the inverter. Increasing gate to source voltage with (2/1) nanowires ratio results better noise margins. Increasing of applied DC load transistor voltage tends to increasing in decreasing noise margins; decreasing this voltage will improve noise margins significantly.
Current-voltage characteristics in organic field-effect transistors. Effect of interface dipoles
NASA Astrophysics Data System (ADS)
Sworakowski, Juliusz
2015-07-01
The role of polar molecules present at dielectric/semiconductor interfaces of organic field-effect transistors (OFETs) has been assessed employing the electrostatic model put forward in a recently published paper (Sworakowski et al., 2014). The interface dipoles create dipolar traps in the surface region of the semiconductor, their depths decreasing with the distance from the interface. This feature results in appearance of mobility gradients in the direction perpendicular to the dielectric/semiconductor interface, manifesting themselves in modification of the shapes of current-voltage characteristics. The effect may account for differences in carrier mobilities determined from the same experimental data using methods scanning different ranges of channel thicknesses (e.g., transconductances vs. transfer characteristics), differences between turn-on voltages and threshold voltages, and gate voltage dependence of mobility.
Voltage-induced ferromagnetic resonance in magnetic tunnel junctions.
Zhu, Jian; Katine, J A; Rowlands, Graham E; Chen, Yu-Jin; Duan, Zheng; Alzate, Juan G; Upadhyaya, Pramey; Langer, Juergen; Amiri, Pedram Khalili; Wang, Kang L; Krivorotov, Ilya N
2012-05-11
We demonstrate excitation of ferromagnetic resonance in CoFeB/MgO/CoFeB magnetic tunnel junctions (MTJs) by the combined action of voltage-controlled magnetic anisotropy (VCMA) and spin transfer torque (ST). Our measurements reveal that GHz-frequency VCMA torque and ST in low-resistance MTJs have similar magnitudes, and thus that both torques are equally important for understanding high-frequency voltage-driven magnetization dynamics in MTJs. As an example, we show that VCMA can increase the sensitivity of an MTJ-based microwave signal detector to the sensitivity level of semiconductor Schottky diodes.
Static Characteristics of the Ferroelectric Transistor Inverter
NASA Technical Reports Server (NTRS)
Mitchell, Cody; Laws, crystal; MacLeond, Todd C.; Ho, Fat D.
2010-01-01
The inverter is one of the most fundamental building blocks of digital logic, and it can be used as the foundation for understanding more complex logic gates and circuits. This paper presents the characteristics of an inverter circuit using a ferroelectric field-effect transistor. The voltage transfer characteristics are analyzed with respect to varying parameters such as supply voltage, input voltage, and load resistance. The effects of the ferroelectric layer between the gate and semiconductor are examined, and comparisons are made between the inverters using ferroelectric transistors and those using traditional MOSFETs.
Pulse power applications of silicon diodes in EML capacitive pulsers
NASA Astrophysics Data System (ADS)
Dethlefsen, Rolf; McNab, Ian; Dobbie, Clyde; Bernhardt, Tom; Puterbaugh, Robert; Levine, Frank; Coradeschi, Tom; Rinaldi, Vito
1993-01-01
Crowbar diodes are used for increasing the energy transfer from capacitive pulse forming networks. They also prevent voltage reversal on the energy storage capacitors. 52 mm diameter diodes with a 5 kV reverse blocking voltage, rated 40 kA were successfully used for the 32 MJ SSG rail gun. An uprated diode with increased current capability and a 15 kV reverse blocking voltage has been developed. Transient thermal analysis has predicted the current ratings for different pulse length. Analysis verification is obtained from destructive testing.
Voltage collapse in complex power grids
Simpson-Porco, John W.; Dörfler, Florian; Bullo, Francesco
2016-01-01
A large-scale power grid's ability to transfer energy from producers to consumers is constrained by both the network structure and the nonlinear physics of power flow. Violations of these constraints have been observed to result in voltage collapse blackouts, where nodal voltages slowly decline before precipitously falling. However, methods to test for voltage collapse are dominantly simulation-based, offering little theoretical insight into how grid structure influences stability margins. For a simplified power flow model, here we derive a closed-form condition under which a power network is safe from voltage collapse. The condition combines the complex structure of the network with the reactive power demands of loads to produce a node-by-node measure of grid stress, a prediction of the largest nodal voltage deviation, and an estimate of the distance to collapse. We extensively test our predictions on large-scale systems, highlighting how our condition can be leveraged to increase grid stability margins. PMID:26887284
Flow-induced voltage generation in non-ionic liquids over monolayer graphene
NASA Astrophysics Data System (ADS)
Ho Lee, Seung; Jung, Yousung; Kim, Soohyun; Han, Chang-Soo
2013-02-01
To clarify the origin of the flow-induced voltage generation in graphene, we prepared a new experimental device whose electrodes were aligned perpendicular to the flow with a non-ionic liquid. We found that significant voltage in our device was generated with increasing flow velocity, thereby confirming that voltage was due to an intrinsic interaction between graphene and the flowing liquid. To understand the mechanism of the observed flow-induced voltage generation, we systematically varied several important experimental parameters: flow velocity, electrode alignment, liquid polarity, and liquid viscosity. Based on these measurements, we suggest that polarity of the fluid is a significant factor in determining the extent of the voltage generated, and the major mechanism can be attributed to instantaneous potential differences induced in the graphene due to an interaction with polar liquids and to the momentum transferred from the flowing liquid to the graphene.
High Voltage, Low Inductance Hydrogen Thyratron Study Program.
1981-01-01
E-E Electrode Spacing Ef Cathode Heater Voltage egy Peak Forward Grid Voltage epy Peak Forward Anode Voltage epx Peak Inverse Anode Voltage Eres... electrodes . ........... 68 30 Marx generator used for sample testing. ........... 68 31 Waveforms showing sample holdoff and sample breakdown 73 32...capability (a function of gas pressure and electrode spacing) could be related to its current rise time capability (a function of gas pressure and inductance
Transferrable monolithic III-nitride photonic circuit for multifunctional optoelectronics
NASA Astrophysics Data System (ADS)
Shi, Zheng; Gao, Xumin; Yuan, Jialei; Zhang, Shuai; Jiang, Yan; Zhang, Fenghua; Jiang, Yuan; Zhu, Hongbo; Wang, Yongjin
2017-12-01
A monolithic III-nitride photonic circuit with integrated functionalities was implemented by integrating multiple components with different functions into a single chip. In particular, the III-nitride-on-silicon platform is used as it integrates a transmitter, a waveguide, and a receiver into a suspended III-nitride membrane via a wafer-level procedure. Here, a 0.8-mm-diameter suspended device architecture is directly transferred from silicon to a foreign substrate by mechanically breaking the support beams. The transferred InGaN/GaN multiple-quantum-well diode (MQW-diode) exhibits a turn-on voltage of 2.8 V with a dominant electroluminescence peak at 453 nm. The transmitter and receiver share an identical InGaN/GaN MQW structure, and the integrated photonic circuit inherently works for on-chip power monitoring and in-plane visible light communication. The wire-bonded monolithic photonic circuit on glass experimentally demonstrates in-plane data transmission at 120 Mb/s, paving the way for diverse applications in intelligent displays, in-plane light communication, flexible optical sensors, and wearable III-nitride optoelectronics.
Transfer characteristics of the hair cell's afferent synapse
NASA Astrophysics Data System (ADS)
Keen, Erica C.; Hudspeth, A. J.
2006-04-01
The sense of hearing depends on fast, finely graded neurotransmission at the ribbon synapses connecting hair cells to afferent nerve fibers. The processing that occurs at this first chemical synapse in the auditory pathway determines the quality and extent of the information conveyed to the central nervous system. Knowledge of the synapse's input-output function is therefore essential for understanding how auditory stimuli are encoded. To investigate the transfer function at the hair cell's synapse, we developed a preparation of the bullfrog's amphibian papilla. In the portion of this receptor organ representing stimuli of 400-800 Hz, each afferent nerve fiber forms several synaptic terminals onto one to three hair cells. By performing simultaneous voltage-clamp recordings from presynaptic hair cells and postsynaptic afferent fibers, we established that the rate of evoked vesicle release, as determined from the average postsynaptic current, depends linearly on the amplitude of the presynaptic Ca2+ current. This result implies that, for receptor potentials in the physiological range, the hair cell's synapse transmits information with high fidelity. auditory system | exocytosis | glutamate | ribbon synapse | synaptic vesicle
Functional diversity of potassium channel voltage-sensing domains.
Islas, León D
2016-01-01
Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology.
Functional diversity of potassium channel voltage-sensing domains
Islas, León D.
2016-01-01
Abstract Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology. PMID:26794852
A novel wireless power and data transmission AC to DC converter for an implantable device.
Liu, Jhao-Yan; Tang, Kea-Tiong
2013-01-01
This article presents a novel AC to DC converter implemented by standard CMOS technology, applied for wireless power transmission. This circuit combines the functions of the rectifier and DC to DC converter, rather than using the rectifier to convert AC to DC and then supplying the required voltage with regulator as in the transitional method. This modification can reduce the power consumption and the area of the circuit. This circuit also transfers the loading condition back to the external circuit by the load shift keying(LSK), determining if the input power is not enough or excessive, which increases the efficiency of the total system. The AC to DC converter is fabricated with the TSMC 90nm CMOS process. The circuit area is 0.071mm(2). The circuit can produce a 1V DC voltage with maximum output current of 10mA from an AC input ranging from 1.5V to 2V, at 1MHz to 10MHz.
Deng, Wanyuan; Gao, Ke; Yan, Jun; Liang, Quanbin; Xie, Yuan; He, Zhicai; Wu, Hongbin; Peng, Xiaobin; Cao, Yong
2018-03-07
In this study, we demonstrate that remarkably reduced open-circuit voltage in highly efficient organic solar cells (OSCs) from a blend of phenyl-C 61 -butyric acid methyl ester and a recently developed conjugated small molecule (DPPEZnP-THD) upon solvent vapor annealing (SVA) is due to two independent sources: increased radiative recombination and increased nonradiative recombination. Through the measurements of electroluminescence due to the emission of the charge-transfer state and photovoltaic external quantum efficiency measurement, we can quantify that the open-circuit voltage losses in a device with SVA due to the radiative recombination and nonradiative recombination are 0.23 and 0.31 V, respectively, which are 0.04 and 0.07 V higher than those of the as-cast device. Despite of the reduced open-circuit voltage, the device with SVA exhibited enhanced dissociation of charge-transfer excitons, leading to an improved short-circuit current density and a remarkable power conversion efficiency (PCE) of 9.41%, one of the best for solution-processed OSCs based on small-molecule donor materials. Our study also clearly shows that removing the nonradiative recombination pathways and/or suppressing energetic disorder in the active layer would result in more long-lived charge carriers and enhanced open-circuit voltage, which are prerequisites for further improving the PCE.
Addressable inverter matrix for process and device characterization
NASA Technical Reports Server (NTRS)
Buehler, M. G.; Sayah, H. R.
1985-01-01
The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold vltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.
Stamp transferred suspended graphene mechanical resonators for radio frequency electrical readout.
Song, Xuefeng; Oksanen, Mika; Sillanpää, Mika A; Craighead, H G; Parpia, J M; Hakonen, Pertti J
2012-01-11
We present a simple micromanipulation technique to transfer suspended graphene flakes onto any substrate and to assemble them with small localized gates into mechanical resonators. The mechanical motion of the graphene is detected using an electrical, radio frequency (RF) reflection readout scheme where the time-varying graphene capacitor reflects a RF carrier at f = 5-6 GHz producing modulation sidebands at f ± f(m). A mechanical resonance frequency up to f(m) = 178 MHz is demonstrated. We find both hardening/softening Duffing effects on different samples and obtain a critical amplitude of ~40 pm for the onset of nonlinearity in graphene mechanical resonators. Measurements of the quality factor of the mechanical resonance as a function of dc bias voltage V(dc) indicates that dissipation due to motion-induced displacement currents in graphene electrode is important at high frequencies and large V(dc). © 2011 American Chemical Society
Spin transfer driven resonant expulsion of a magnetic vortex core for efficient rf detector
NASA Astrophysics Data System (ADS)
Menshawy, S.; Jenkins, A. S.; Merazzo, K. J.; Vila, L.; Ferreira, R.; Cyrille, M.-C.; Ebels, U.; Bortolotti, P.; Kermorvant, J.; Cros, V.
2017-05-01
Spin transfer magnetization dynamics have led to considerable advances in Spintronics, including opportunities for new nanoscale radiofrequency devices. Among the new functionalities is the radiofrequency (rf) detection using the spin diode rectification effect in spin torque nano-oscillators (STNOs). In this study, we focus on a new phenomenon, the resonant expulsion of a magnetic vortex in STNOs. This effect is observed when the excitation vortex radius, due to spin torques associated to rf currents, becomes larger than the actual radius of the STNO. This vortex expulsion is leading to a sharp variation of the voltage at the resonant frequency. Here we show that the detected frequency can be tuned by different parameters; furthermore, a simultaneous detection of different rf signals can be achieved by real time measurements with several STNOs having different diameters. This result constitutes a first proof-of-principle towards the development of a new kind of nanoscale rf threshold detector.
Improvement of Ohmic contacts on Ga 2O 3 through use of ITO-interlayers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carey, Patrick H.; Yang, Jiancheng; Ren, Fan
In this work, the use of ITO interlayers between Ga 2O 3 and Ti/Au metallization is shown to produce Ohmic contacts after annealing in the range of 500–600 °C. Without the ITO, similar anneals do not lead to linear current–voltage characteristics. Transmission line measurements were used to extract the specific contact resistance of the Au/Ti/ITO/Ga 2O 3 stacks as a function of annealing temperature. Sheet, specific contact, and transfer resistances all decreased sharply from as-deposited values with annealing. The minimum transfer resistance and specific contact resistance of 0.60 Ω mm and 6.3 × 10 -5 Ω cm 2 were achievedmore » after 600 °C annealing, respectively. Lastly, the conduction band offset between ITO and Ga 2O 3 is 0.32 eV and is consistent with the improved electron transport across the heterointerface.« less
Electrical Resistivity of Wire Arc Sprayed Zn and Cu Coatings for In-Mold-Metal-Spraying
NASA Astrophysics Data System (ADS)
Bobzin, K.; Öte, M.; Knoch, M. A.; Liao, X.; Hopmann, Ch; Ochotta, P.
2018-06-01
Electrical functionalities can be integrated into plastic parts by integrating thermally sprayed metal coatings into the non-conductive base material. Thermally sprayed conducting tracks for power and signal transmission are one example. In this case, the electrical resistance or resistivity of the coatings should be investigated. Therefore, the electrical resistivity of wire arc sprayed Zn and Cu coatings has been investigated. In case of Zn coatings, spray distance, gas pressure and wire diameter could be identified as significant influencing parameters on the electrical resistivity. In contrast, process gas, gas pressure and voltage do have a significant influence on the electrical resistivity of Cu coatings. Through the use of the In-Mold-Metal-Spraying method (IMMS), thermal degradation can be avoided by transferring thermally sprayed coating from a mold insert onto the plastic part. Therefore, the influence of the transfer process on the electrical resistance of the coatings has also been investigated.
Electric field control of spin transfer torque in multiferroic tunnel junctions
NASA Astrophysics Data System (ADS)
Useinov, Artur; Kalitsov, Alan; Velev, Julian; Kioussis, Nicholas
2014-03-01
Based on model calculations we predict that the spin transfer torque (STT) in magnetic tunnel junctions with ferroelectric barriers can be strongly influenced by the saturated polarization of the barrier. The STT in such multiferroic tunnel junctions is calculated within the non-equilibrium Keldysh formalism generalized for non-collinear transport and implemented in the framework of a single-band tight-binding (TB) model. We calculate the bias dependence of both the in-plane (T∥) and out-of-plane (T⊥) components of STT as a function of the ferroelectric polarization (P) in the barrier. We find that the components of STT strongly depend on both the magnitude and the direction of the polarization. In particular switching of the polarization direction can dramatically alter the value of the STT and can even lead to a change of sign of T∥ and the voltage-induced part of T⊥. The effect is proportional to the magnitude of the polarization.
Fortier, Pierre A; Bray, Chelsea
2013-04-16
Previous studies revealed mechanisms of dendritic inputs leading to action potential initiation at the axon initial segment and backpropagation into the dendritic tree. This interest has recently expanded toward the communication between different parts of the dendritic tree which could preprocess information before reaching the soma. This study tested for effects of asymmetric voltage attenuation between different sites in the dendritic tree on summation of synaptic inputs and action potential initiation using the NEURON simulation environment. Passive responses due to the electrical equivalent circuit of the three-dimensional neuron architecture with leak channels were examined first, followed by the responses after adding voltage-gated channels and finally synaptic noise. Asymmetric attenuation of voltage, which is a function of asymmetric input resistance, was seen between all pairs of dendritic sites but the transfer voltages (voltage recorded at the opposite site from stimulation among a pair of dendritic sites) were equal and also summed linearly with local voltage responses during simultaneous stimulation of both sites. In neurons with voltage-gated channels, we reproduced the observations where a brief stimulus to the proximal ascending dendritic branch of a pyramidal cell triggers a local action potential but a long stimulus triggers a somal action potential. Combined stimulation of a pair of sites in this proximal dendrite did not alter this pattern. The attraction of the action potential onset toward the soma with a long stimulus in the absence of noise was due to the higher density of voltage-gated sodium channels at the axon initial segment. This attraction was, however, negligible at the most remote distal dendritic sites and was replaced by an effect due to high input resistance. Action potential onset occurred at the dendritic site of higher input resistance among a pair of remote dendritic sites, irrespective of which of these two sites received the synaptic input. Exploration of the parameter space showed how the gradient of voltage-gated channel densities and input resistances along a dendrite could draw the action potential onset away from the stimulation site. The attraction of action potential onset toward the higher density of voltage-gated channels in the soma during stimulation of the proximal dendrite was, however, reduced after the addition of synaptic noise. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.
Small Patch Antennas for UWB Wireless Body Area Network
NASA Astrophysics Data System (ADS)
Klemm, M.; Tröster, G.
This paper presents the transient characteristics of an aperture-stacked patch antenna (ASPA) and its miniaturized version. These antennas were designed for ultra-wideband (UWB) body area network (BAN) applications, to operate within the 3 to 6 GHz frequency band. The APSA with large ground plane size has a planar dimensions 70 × 70 mm2, the smaller version has dimensions 32 × 26 mm2. The latest yields 85% reduction of the antenna surface. Time- and frequency-domain characteristics of these antennas were calculated in a transmission mode (Tx) and also in a complete, two-antenna (Tx-Rx) system. We have used 3 different waveforms to drive the antenna: gaussian pulse (duration-250 ps), monocycle pulse (duration-300 ps) and defined wavelet (duration-650 ps). The received pulses have very similar shapes (fidelity >90%), but they differ in the voltage amplitudes. Results show that the highest received voltage (best transmission efficiency) is achieved for the pulse with the closest spectrum to the antenna's transfer function characteristic. In order to disclose the effects of the human body proximity, two body models were built and full-wave FDTD method was employed to carry out the simulations. Significant changes of the UWB antenna performance when close to the body were identified. The most important effects are the seriously decreased radiation efficiency (16 to 34%) and different (from that in a free space) shape of the antenna transfer function. The first one can have the impact on low power implementations of UWB wearable radios; the second one discloses possible influence on the UWB systems design (especially for template receivers). The impact of the human body on antenna characteristics was identified to be a key factor in UWB body-worn antenna design.
Empirical transfer functions for stations in the Central California seismological network
Bakun, W.H.; Dratler, Jay
1976-01-01
A sequence of calibration signals composed of a station identification code, a transient from the release of the seismometer mass at rest from a known displacement from the equilibrium position, and a transient from a known step in voltage to the amplifier input are generated by the automatic daily calibration system (ADCS) now operational in the U.S. Geological Survey central California seismographic network. Documentation of a sequence of interactive programs to compute, from the calibration data, the complex transfer functions for the seismographic system (ground motion through digitizer) the electronics (amplifier through digitizer), and the seismometer alone are presented. The analysis utilizes the Fourier transform technique originally suggested by Espinosa et al (1962). Section I is a general description of seismographic calibration. Section II contrasts the 'Fourier transform' and the 'least-squares' techniques for analyzing transient calibration signals. Theoretical consideration for the Fourier transform technique used here are described in Section III. Section IV is a detailed description of the sequence of calibration signals generated by the ADCS. Section V is a brief 'cookbook description' of the calibration programs; Section VI contains a detailed sample program execution. Section VII suggests the uses of the resultant empirical transfer functions. Supplemental interactive programs by which smooth response functions, suitable for reducing seismic data to ground motion, are also documented in Section VII. Appendices A and B contain complete listings of the Fortran source Codes while Appendix C is an update containing preliminary results obtained from an analysis of some of the calibration signals from stations in the seismographic network near Oroville, California.
NASA Astrophysics Data System (ADS)
Pejović, Milić M.; Milosavljević, Čedomir S.; Pejović, Momčilo M.
2003-06-01
This article describes an electrical system aimed at measuring and data acquisition of breakdown voltages of vacuum and gas-filled tubes. The measurements were performed using a nitrogen-filled tube at 4 mbar pressure. Based on the measured breakdown voltage data as a function of the applied voltage increase rate, a static breakdown voltage is estimated for the applied voltage gradient ranging from 0.1 to 1 V s-1 and from 1 to 10 V s-1. The histograms of breakdown voltages versus applied voltage increase rates from 0.1 and 0.5 V s-1 are approximated by the probability density functions using a fitting procedure.
NASA Astrophysics Data System (ADS)
Meiler, M.; Andre, D.; Schmid, O.; Hofer, E. P.
Intelligent energy management is a cost-effective key path to realize efficient automotive drive trains [R. O'Hayre, S.W. Cha, W. Colella, F.B. Prinz. Fuel Cell Fundamentals, John Wiley & Sons, Hoboken, 2006]. To develop operating strategy in fuel cell drive trains, precise and computational efficient models of all system components, especially the fuel cell stack, are needed. Should these models further be used in diagnostic or control applications, then some major requirements must be fulfilled. First, the model must predict the mean fuel cell voltage very precisely in all possible operating conditions, even during transients. The model output should be as smooth as possible to support best efficient optimization strategies of the complete system. At least, the model must be computational efficient. For most applications, a difference between real fuel cell voltage and model output of less than 10 mV and 1000 calculations per second will be sufficient. In general, empirical models based on system identification offer a better accuracy and consume less calculation resources than detailed models derived from theoretical considerations [J. Larminie, A. Dicks. Fuel Cell Systems Explained, John Wiley & Sons, West Sussex, 2003]. In this contribution, the dynamic behaviour of the mean cell voltage of a polymer-electrolyte-membrane fuel cell (PEMFC) stack due to variations in humidity of cell's reactant gases is investigated. The validity of the overall model structure, a so-called general Hammerstein model (or Uryson model), was introduced recently in [M. Meiler, O. Schmid, M. Schudy, E.P. Hofer. Dynamic fuel cell stack model for real-time simulation based on system identification, J. Power Sources 176 (2007) 523-528]. Fuel cell mean voltage is calculated as the sum of a stationary and a dynamic voltage component. The stationary component of cell voltage is represented by a lookup-table and the dynamic voltage by a parallel placed, nonlinear transfer function. A suitable experimental setup to apply fast variations of gas humidity is introduced and is used to investigate a 10 cell PEMFC stack under various operation conditions. Using methods like stepwise multiple-regression a good mathematical description with reduced free parameters is achieved.
Fast charge separation in a non-fullerene organic solar cell with a small driving force
NASA Astrophysics Data System (ADS)
Liu, Jing; Chen, Shangshang; Qian, Deping; Gautam, Bhoj; Yang, Guofang; Zhao, Jingbo; Bergqvist, Jonas; Zhang, Fengling; Ma, Wei; Ade, Harald; Inganäs, Olle; Gundogdu, Kenan; Gao, Feng; Yan, He
2016-07-01
Fast and efficient charge separation is essential to achieve high power conversion efficiency in organic solar cells (OSCs). In state-of-the-art OSCs, this is usually achieved by a significant driving force, defined as the offset between the bandgap (Egap) of the donor/acceptor materials and the energy of the charge transfer (CT) state (ECT), which is typically greater than 0.3 eV. The large driving force causes a relatively large voltage loss that hinders performance. Here, we report non-fullerene OSCs that exhibit ultrafast and efficient charge separation despite a negligible driving force, as ECT is nearly identical to Egap. Moreover, the small driving force is found to have minimal detrimental effects on charge transfer dynamics of the OSCs. We demonstrate a non-fullerene OSC with 9.5% efficiency and nearly 90% internal quantum efficiency despite a low voltage loss of 0.61 V. This creates a path towards highly efficient OSCs with a low voltage loss.
A ZnO nanowire-based photo-inverter with pulse-induced fast recovery.
Raza, Syed Raza Ali; Lee, Young Tack; Hosseini Shokouh, Seyed Hossein; Ha, Ryong; Choi, Heon-Jin; Im, Seongil
2013-11-21
We demonstrate a fast response photo-inverter comprised of one transparent gated ZnO nanowire field-effect transistor (FET) and one opaque FET respectively as the driver and load. Under ultraviolet (UV) light the transfer curve of the transparent gate FET shifts to the negative side and so does the voltage transfer curve (VTC) of the inverter. After termination of UV exposure the recovery of photo-induced current takes a long time in general. This persistent photoconductivity (PPC) is due to hole trapping on the surface of ZnO NWs. Here, we used a positive voltage short pulse after UV exposure, for the first time resolving the PPC issue in nanowire-based photo-detectors by accumulating electrons at the ZnO/dielectric interface. We found that a pulse duration as small as 200 ns was sufficient to reach a full recovery to the dark state from the UV induced state, realizing a fast UV detector with a voltage output.
Tsutsui, Hidekazu; Jinno, Yuka; Tomita, Akiko; Niino, Yusuke; Yamada, Yoshiyuki; Mikoshiba, Katsuhiko; Miyawaki, Atsushi; Okamura, Yasushi
2013-09-15
One of the most awaited techniques in modern physiology is the sensitive detection of spatiotemporal electrical activity in a complex network of excitable cells. The use of genetically encoded voltage probes has been expected to enable such analysis. However, in spite of recent progress, existing probes still suffer from low signal amplitude and/or kinetics too slow to detect fast electrical activity. Here, we have developed an improved voltage probe named Mermaid2, which is based on the voltage-sensor domain of the voltage-sensing phosphatase from Ciona intestinalis and Förster energy transfer between a pair of fluorescent proteins. In mammalian cells, Mermaid2 permits ratiometric readouts of fractional changes of more than 50% over a physiologically relevant voltage range with fast kinetics, and it was used to follow a train of action potentials at frequencies of up to 150 Hz. Mermaid2 was also able to detect single action potentials and subthreshold voltage responses in hippocampal neurons in vitro, in addition to cortical electrical activity evoked by sound stimuli in single trials in living mice.
A low power on-chip class-E power amplifier for remotely powered implantable sensor systems
NASA Astrophysics Data System (ADS)
Ture, Kerim; Kilinc, Enver G.; Dehollain, Catherine
2015-06-01
This paper presents a low power fully integrated class-E power amplifier and its integration with remotely powered sensor system. The class-E power amplifier is suitable solution for low-power applications due to its high power efficiency. However, the required high inductance values which make the on-chip integration of the power amplifier difficult. The designed power amplifier is fully integrated in the remotely powered sensor system and fabricated in 0.18 μm CMOS process. The power is transferred to the implantable sensor system at 13.56 MHz by using an inductively coupled remote powering link. The induced AC voltage on the implant coil is converted into a DC voltage by a passive full-wave rectifier. A voltage regulator is used to suppress the ripples and create a clean and stable 1.8 V supply voltage for the sensor and communication blocks. The data collected from the sensors is transmitted by on-off keying modulated low-power transmitter at 1.2 GHz frequency. The transmitter is composed of a LC tank oscillator and a fully on-chip class-E power amplifier. An additional output network is used for the power amplifier which makes the integration of the power amplifier fully on-chip. The integrated power amplifier with 0.2 V supply voltage has a drain efficiency of 31.5% at -10 dBm output power for 50 Ω load. The measurement results verify the functionality of the power amplifier and the remotely powered implantable sensor system. The data communication is also verified by using a commercial 50 Ω chip antenna and has 600 kbps data rate at 1 m communication distance.
Aberration control in adaptive optics: a numerical study of arbitrarily deformable liquid lenses.
Lima, N C; Mishra, K; Mugele, F
2017-03-20
By means of numerical simulations, using a computational fluid dynamics software together with an optical ray tracing analysis platform, we show that we can tune various optical aberrations by electrically manipulating the shape of liquid lenses using one hundred individually addressable electrodes. To demonstrate the flexibility of our design, we define electrode patterns based on specific Zernike modes and show that aspherical, cylindrical and decentered shapes of liquid lenses can be produced. Using different voltages, we evaluate the tuning range of spherical aberration (Z11), astigmatism (Z5 and Z6) and coma (Z7), while a hydrostatic pressure is applied to control the average curvature of a microlens with a diameter of 1mm. Upon activating all electrodes simultaneously spherical aberrations of 0.15 waves at a pressure of 30Pa can be suppressed almost completely for the highest voltages applied. For astigmatic and comatic patterns, the values of Z5, Z6 and Z7 increase monotonically with the voltage reaching values up to 0.06, 0.06 and 0.2 waves, respectively. Spot diagrams, wavefront maps and modulation transfer function are reported to quantify the optical performance of each lens. Crosstalk and independence of tunability are discussed in the context of possible applications of the approach for general wavefront shaping.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Shiba, Kenji; Nukaya, Masayuki; Tsuji, Toshio; Koshiji, Kohji
2008-01-01
This paper reports on the current density and specific absorption rate (SAR) analysis of biological tissue surrounding an air-core transcutaneous transformer for an artificial heart. The electromagnetic field in the biological tissue is analyzed by the transmission line modeling method, and the current density and SAR as a function of frequency, output voltage, output power, and coil dimension are calculated. The biological tissue of the model has three layers including the skin, fat, and muscle. The results of simulation analysis show SARs to be very small at any given transmission conditions, about 2-14 mW/kg, compared to the basic restrictions of the International Commission on nonionizing radiation protection (ICNIRP; 2 W/kg), while the current density divided by the ICNIRP's basic restrictions gets smaller as the frequency rises and the output voltage falls. It is possible to transfer energy below the ICNIRP's basic restrictions when the frequency is over 250 kHz and the output voltage is under 24 V. Also, the parts of the biological tissue that maximized the current density differ by frequencies; in the low frequency is muscle and in the high frequency is skin. The boundary is in the vicinity of the frequency 600-1000 kHz.
High Voltage Testing. Volume 2. Specifications and Test Procedures
1982-08-01
the greatest impact on the initial assumption and criteria developed in the published criteria documents include: dielectric withstanding voltage...3382-75 Measurement of Energy and Integrated Charge Transfer Due to Partial Discharges (Corona) Using Bridge Techniques. ASTM-D 3426 - Dielectric... Energy (NEMA Publication No. WC 7-1971). NEMA Publication No. 109 - AIEE-EEI-NEMA Standard Basic Insulation Level. 092-57 - Method of Test for Flash and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Z. D.; Wang, J.; Department of Chemistry, SUNY Stony Brook, New York 11794
We established a theoretical framework in terms of the curl flux, population landscape, and coherence for non-equilibrium quantum systems at steady state, through exploring the energy and charge transport in molecular processes. The curl quantum flux plays the key role in determining transport properties and the system reaches equilibrium when flux vanishes. The novel curl quantum flux reflects the degree of non-equilibriumness and the time-irreversibility. We found an analytical expression for the quantum flux and its relationship to the environmental pumping (non-equilibriumness quantified by the voltage away from the equilibrium) and the quantum tunneling. Furthermore, we investigated another quantum signature,more » the coherence, quantitatively measured by the non-zero off diagonal element of the density matrix. Populations of states give the probabilities of individual states and therefore quantify the population landscape. Both curl flux and coherence depend on steady state population landscape. Besides the environment-assistance which can give dramatic enhancement of coherence and quantum flux with high voltage at a fixed tunneling strength, the quantum flux is promoted by the coherence in the regime of small tunneling while reduced by the coherence in the regime of large tunneling, due to the non-monotonic relationship between the coherence and tunneling. This is in contrast to the previously found linear relationship. For the systems coupled to bosonic (photonic and phononic) reservoirs the flux is significantly promoted at large voltage while for fermionic (electronic) reservoirs the flux reaches a saturation after a significant enhancement at large voltage due to the Pauli exclusion principle. In view of the system as a quantum heat engine, we studied the non-equilibrium thermodynamics and established the analytical connections of curl quantum flux to the transport quantities such as energy (charge) transfer efficiency, chemical reaction efficiency, energy dissipation, heat and electric currents observed in the experiments. We observed a perfect transfer efficiency in chemical reactions at high voltage (chemical potential difference). Our theoretical predicted behavior of the electric current with respect to the voltage is in good agreements with the recent experiments on electron transfer in single molecules.« less
Voltage-Driven Magnetization Switching and Spin Pumping in Weyl Semimetals
NASA Astrophysics Data System (ADS)
Kurebayashi, Daichi; Nomura, Kentaro
2016-10-01
We demonstrate electrical magnetization switching and spin pumping in magnetically doped Weyl semimetals. The Weyl semimetal is a three-dimensional gapless topological material, known to have nontrivial coupling between the charge and the magnetization due to the chiral anomaly. By solving the Landau-Lifshitz-Gilbert equation for a multilayer structure of a Weyl semimetal, an insulator and a metal while taking the charge-magnetization coupling into account, magnetization dynamics is analyzed. It is shown that the magnetization dynamics can be driven by the electric voltage. Consequently, switching of the magnetization with a pulsed electric voltage can be achieved, as well as precession motion with an applied oscillating electric voltage. The effect requires only a short voltage pulse and may therefore be energetically favorable for us in spintronics devices compared to conventional spin-transfer torque switching.
van der Waals Heterostructures with High Accuracy Rotational Alignment.
Kim, Kyounghwan; Yankowitz, Matthew; Fallahazad, Babak; Kang, Sangwoo; Movva, Hema C P; Huang, Shengqiang; Larentis, Stefano; Corbet, Chris M; Taniguchi, Takashi; Watanabe, Kenji; Banerjee, Sanjay K; LeRoy, Brian J; Tutuc, Emanuel
2016-03-09
We describe the realization of van der Waals (vdW) heterostructures with accurate rotational alignment of individual layer crystal axes. We illustrate the approach by demonstrating a Bernal-stacked bilayer graphene formed using successive transfers of monolayer graphene flakes. The Raman spectra of this artificial bilayer graphene possess a wide 2D band, which is best fit by four Lorentzians, consistent with Bernal stacking. Scanning tunneling microscopy reveals no moiré pattern on the artificial bilayer graphene, and tunneling spectroscopy as a function of gate voltage reveals a constant density of states, also in agreement with Bernal stacking. In addition, electron transport probed in dual-gated samples reveals a band gap opening as a function of transverse electric field. To illustrate the applicability of this technique to realize vdW heterostructuctures in which the functionality is critically dependent on rotational alignment, we demonstrate resonant tunneling double bilayer graphene heterostructures separated by hexagonal boron-nitride dielectric.
Alfinito, Eleonora; Reggiani, Lino
2016-10-01
Current-voltage characteristics of metal-protein-metal structures made of proteorhodopsin and bacteriorhodopsin are modeled by using a percolation-like approach. Starting from the tertiary structure pertaining to the single protein, an analogous resistance network is created. Charge transfer inside the network is described as a sequential tunneling mechanism and the current is calculated for each value of the given voltage. The theory is validated with available experiments, in dark and light. The role of the tertiary structure of the single protein and of the mechanisms responsible for the photo-activity is discussed.
NASA Astrophysics Data System (ADS)
Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin
2018-04-01
This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.
Experimental verification of Space Platform battery discharger design optimization
NASA Astrophysics Data System (ADS)
Sable, Dan M.; Deuty, Scott; Lee, Fred C.; Cho, Bo H.
The detailed design of two candidate topologies for the Space Platform battery discharger, a four module boost converter (FMBC) and a voltage-fed push-pull autotransformer (VFPPAT), is presented. Each has unique problems. The FMBC requires careful design and analysis in order to obtain good dynamic performance. This is due to the presence of a right-half-plane (RHP) zero in the control-to-output transfer function. The VFPPAT presents a challenging power stage design in order to yield high efficiency and light component weight. The authors describe the design of each of these converters and compare their efficiency, weight, and dynamic characteristics.
Experimental verification of Space Platform battery discharger design optimization
NASA Technical Reports Server (NTRS)
Sable, Dan M.; Deuty, Scott; Lee, Fred C.; Cho, Bo H.
1991-01-01
The detailed design of two candidate topologies for the Space Platform battery discharger, a four module boost converter (FMBC) and a voltage-fed push-pull autotransformer (VFPPAT), is presented. Each has unique problems. The FMBC requires careful design and analysis in order to obtain good dynamic performance. This is due to the presence of a right-half-plane (RHP) zero in the control-to-output transfer function. The VFPPAT presents a challenging power stage design in order to yield high efficiency and light component weight. The authors describe the design of each of these converters and compare their efficiency, weight, and dynamic characteristics.
Neural coding using telegraphic switching of magnetic tunnel junction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suh, Dong Ik; Bae, Gi Yoon; Oh, Heong Sik
2015-05-07
In this work, we present a synaptic transmission representing neural coding with spike trains by using a magnetic tunnel junction (MTJ). Telegraphic switching generates an artificial neural signal with both the applied magnetic field and the spin-transfer torque that act as conflicting inputs for modulating the number of spikes in spike trains. The spiking probability is observed to be weighted with modulation between 27.6% and 99.8% by varying the amplitude of the voltage input or the external magnetic field. With a combination of the reverse coding scheme and the synaptic characteristic of MTJ, an artificial function for the synaptic transmissionmore » is achieved.« less
NASA Astrophysics Data System (ADS)
Feizabadi, Mina; Ajloo, Davood; Soleymanpour, Ahmad; Faridnouri, Hassan
2018-05-01
Electrochemical characterization of functionalized carbon nanotubes (f-CNT) including carboxyl (CNT-COOH), amine (CNT-NH2) and hydroxyl (CNT-OH) functional groups were studied using differential pulse voltammetry (DPV). The current-voltage (I-V) curves were obtained from each system and the effect of f-CNT on redox interaction of horseradish peroxidase (HRP) immobilized on the electrode surface was investigated. The non-equilibrium Green's function (NEGF) combined with density functional theory (DFT) were used to study the transport properties of f-CNT. Additionally, the effect of the number of functional groups on transport properties of CNT, I-V characteristics, electronic transmission coefficients and spatial distribution of f-CNTs have been calculated and analyzed. The results showed that the carboxyl derivative has larger transmission coefficients and current value than other f-CNTs. Then, the effect of functional groups on the electron transport in heme group of HRP is discussed. Finally, the effect of a covalent bond between active site amino acids and amine functional group of CNT was investigated and discussed.
A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme
NASA Astrophysics Data System (ADS)
Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol
2018-02-01
We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.
Molecular control of pentacene/ZnO photoinduced charge transfer
NASA Astrophysics Data System (ADS)
Spalenka, Josef W.; Paoprasert, Peerasak; Franking, Ryan; Hamers, Robert J.; Gopalan, Padma; Evans, Paul G.
2011-03-01
Photoinduced charge transfer modifies the device properties of illuminated pentacene field effect transistors (FETs) incorporating ZnO quantum dots at the gate insulator/pentacene interface. The transferred charge is trapped on electronic states associated with the ZnO quantum dots, with a steady state population approximately proportional to the rate of organic-inorganic charge transfer. Trapped charge shifts the threshold voltage of the FETs, providing the means to evaluate the rate of organic/inorganic charge transfer and the effects of interface modification. Monolayers of the wide-gap alkane stearic acid and the conjugated oligomer terthiophene attached to the ZnO suppress or permit charge transfer, respectively.
Portable precision dc voltage-current transfer standard for electrometer calibration
Landis, G.; Godwin, M.
1982-01-01
A circuit design is presented for an instrument providing a highly stable and fully adjustable voltage and current in the range of 0-1.999 V or 0-199.9 mV and 10-11-10-15 A. This instrument is used to verify the calibration and performance of dc and vibrating reed electrometers and chart recorders on mass spectrometers of the USGS Isotope Laboratories in Denver.
Origin of Non-Radiative Voltage Losses in Fullerene-Based Organic Solar Cells
NASA Astrophysics Data System (ADS)
Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Neher, Dieter; Spoltore, Donato; Vandewal, Koen
The open-circuit voltage of organic solar cells (OSCs) is low as compared to the optical gap of the absorber molecules, indicating high energy losses per absorbed photon. These voltage losses arise only partly due to necessity of an electron transfer event to dissociate the excitons. A large part of these voltage losses is due to recombination of photo-generated charge carriers, including inevitable radiative recombination. In this work, we study the non-radiative recombination losses and we find that they increase when the energy difference between charge transfer (CT) state and ground state decreases. This behavior is in agreement with the \\x9Denergy gap law for non-radiative transition\\x9D, which implies that internal conversion from CT state to ground state is facilitated by skeletal molecular vibrations. This intrinsic loss mechanism, which until now has not been thoroughly considered for OSCs, is different in its nature as compared to the commonly considered inorganic photovoltaic loss mechanisms of defect, surface, and Auger recombination. As a consequence, the theoretical upper limit for the power conversion efficiency of a single junction OSC reduces by 25% as compared to the Shockley-Queisser limit for an optimal optical gap of the main absorber between (1.45-1.65) eV.
Effect of Copper and Silicon on Al-5%Zn Alloy as a Candidate Low Voltage Sacrificial Anode
NASA Astrophysics Data System (ADS)
Pratesa, Yudha; Ferdian, Deni; Togina, Inez
2017-05-01
One common method used for corrosion protection is a sacrificial anode. Sacrificial anodes that usually employed in the marine environment are an aluminum alloy sacrificial anode, especially Al-Zn-In. However, the electronegativity of these alloys can cause corrosion overprotection and stress cracking (SCC) on a high-strength steel. Therefore, there is a development of the sacrificial anode aluminum low voltage to reduce the risk of overprotection. The addition of alloying elements such as Cu, Si, and Ge will minimize the possibility of overprotection. This study was conducted to analyze the effect of silicon and copper addition in Al-5Zn. The experiment started from casting the sacrificial anode aluminum uses electrical resistance furnace in a graphite crucible in 800°C. The results alloy was analyzed using Optical emission spectroscopy (OES), Differential scanning calorimetry, electrochemical impedance spectroscopy, and metallography. Aluminum alloy with the addition of a copper alloy is the most suitable and efficient to serve as a low-voltage sacrificial anode aluminum. Charge transfer resistivity of copper is smaller than silicon which indicates that the charge transfer between the metal and the electrolyte is easier t to occur. Also, the current potential values in coupling with steel are also in the criteria range of low-voltage aluminum sacrificial anodes.
NASA Astrophysics Data System (ADS)
Niroumand, Amir M.; Homayouni, Hooman; DeVaal, Jake; Golnaraghi, Farid; Kjeang, Erik
2016-08-01
This paper describes a diagnostic tool for in-situ characterization of the rate and distribution of hydrogen transfer leaks in Polymer Electrolyte Membrane (PEM) fuel cell stacks. The method is based on reducing the air flow rate from a high to low value at a fixed current, while maintaining an anode overpressure. At high air flow rates, the reduction in air flow results in lower oxygen concentration in the cathode and therefore reduction in cell voltages. Once the air flow rate in each cell reaches a low value at which the cell oxygen-starves, the voltage of the corresponding cell drops to zero. However, oxygen starvation results from two processes: 1) the electrochemical oxygen reduction reaction which produces current; and 2) the chemical reaction between oxygen and the crossed over hydrogen. In this work, a diagnostic technique has been developed that accounts for the effect of the electrochemical reaction on cell voltage to identify the hydrogen leak rate and number of leaky cells in a fuel cell stack. This technique is suitable for leak characterization during fuel cell operation, as it only requires stack air flow and voltage measurements, which are readily available in an operational fuel cell system.
Resonant-Type Smooth Impact Drive Mechanism Actuator Operating at Lower Input Voltages
NASA Astrophysics Data System (ADS)
Morita, Takeshi; Nishimura, Takuma; Yoshida, Ryuichi; Hosaka, Hiroshi
2013-07-01
We report on the design and fabrication of a resonant-type smooth impact drive mechanism (SIDM) actuator based on a multilayered piezoelectric ceramic transducer. Conventional SIDMs use off-resonant sawtooth-shaped displacement in developing stick-slip motion of a slider, but require large input voltages for high-speed operation. In contrast, in resonant-type SIDMs, a quasi-sawtooth-shaped displacement is obtained by combining two resonant vibrational modes. This driving principle enables low input voltage operations. In combining the modes, their frequency ratio must be 1:2. To design and optimize the stator transducer to generate sawtooth-shaped displacements, a transfer matrix method was adopted. With a preload of 270 mN, the no-load speed was 40 mm/s under a driving voltage of 1.6 V (peak to peak). This input voltage was one-sixth that of previous SIDMs for the same performance. Concurrently, heat generation was significantly reduced because dielectric losses were suppressed under the lower input voltage operation.
Allosteric substrate switching in a voltage-sensing lipid phosphatase.
Grimm, Sasha S; Isacoff, Ehud Y
2016-04-01
Allostery provides a critical control over enzyme activity, biasing the catalytic site between inactive and active states. We found that the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP), which modifies phosphoinositide signaling lipids (PIPs), has not one but two sequential active states with distinct substrate specificities, whose occupancy is allosterically controlled by sequential conformations of the voltage-sensing domain (VSD). Using fast fluorescence resonance energy transfer (FRET) reporters of PIPs to monitor enzyme activity and voltage-clamp fluorometry to monitor conformational changes in the VSD, we found that Ci-VSP switches from inactive to a PIP3-preferring active state when the VSD undergoes an initial voltage-sensing motion and then into a second PIP2-preferring active state when the VSD activates fully. This two-step allosteric control over a dual-specificity enzyme enables voltage to shape PIP concentrations in time, and provides a mechanism for the complex modulation of PIP-regulated ion channels, transporters, cell motility, endocytosis and exocytosis.
Methods of computing steady-state voltage stability margins of power systems
Chow, Joe Hong; Ghiocel, Scott Gordon
2018-03-20
In steady-state voltage stability analysis, as load increases toward a maximum, conventional Newton-Raphson power flow Jacobian matrix becomes increasingly ill-conditioned so power flow fails to converge before reaching maximum loading. A method to directly eliminate this singularity reformulates the power flow problem by introducing an AQ bus with specified bus angle and reactive power consumption of a load bus. For steady-state voltage stability analysis, the angle separation between the swing bus and AQ bus can be varied to control power transfer to the load, rather than specifying the load power itself. For an AQ bus, the power flow formulation is only made up of a reactive power equation, thus reducing the size of the Jacobian matrix by one. This reduced Jacobian matrix is nonsingular at the critical voltage point, eliminating a major difficulty in voltage stability analysis for power system operations.
Control voltage and power fluctuations when connecting wind farms
NASA Astrophysics Data System (ADS)
Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana
2015-12-01
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.
Role of AlGaN/GaN interface traps on negative threshold voltage shift in AlGaN/GaN HEMT
NASA Astrophysics Data System (ADS)
Malik, Amit; Sharma, Chandan; Laishram, Robert; Bag, Rajesh Kumar; Rawal, Dipendra Singh; Vinayak, Seema; Sharma, Rajesh Kumar
2018-04-01
This article reports negative shift in the threshold-voltage in AlGaN/GaN high electron mobility transistor (HEMT) with application of reverse gate bias stress. The device is biased in strong pinch-off and low drain to source voltage condition for a fixed time duration (reverse gate bias stress), followed by measurement of transfer characteristics. Negative threshold voltage shift after application of reverse gate bias stress indicates the presence of more carriers in channel as compared to the unstressed condition. We propose the presence of AlGaN/GaN interface states to be the reason of negative threshold voltage shift, and developed a process to electrically characterize AlGaN/GaN interface states. We verified the results with Technology Computer Aided Design (TCAD) ATLAS simulation and got a good match with experimental measurements.
Park, Jung Tae; Chi, Won Seok; Jeon, Harim; Kim, Jong Hak
2014-03-07
TiO2 nanoparticles are surface-modified via atom transfer radical polymerization (ATRP) with a hydrophilic poly(oxyethylene)methacrylate (POEM), which can coordinate to the Ag precursor, i.e. silver trifluoromethanesulfonate (AgCF3SO3). Following the reduction of Ag ions, a Nb2O5 doping process and calcination at 450 °C, bi-functional Nb-doped TiO2/Ag ternary nanostructures are generated. The resulting nanostructures are characterized by energy-filtering transmission electron microscopy (EF-TEM), X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), and UV-visible spectroscopy. The dye-sensitized solar cell (DSSC) based on the Nb-doped TiO2/Ag nanostructure photoanode with a polymerized ionic liquid (PIL) as the solid polymer electrolyte shows an overall energy conversion efficiency (η) of 6.9%, which is much higher than those of neat TiO2 (4.7%) and Nb-doped TiO2 (5.4%). The enhancement of η is mostly due to the increase of current density, attributed to the improved electron transfer properties including electron injection, collection, and plasmonic effects without the negative effects of charge recombination or problems with corrosion. These properties are supported by intensity modulated photocurrent/voltage spectroscopy (IMPS/IMVS) and incident photon-to-electron conversion efficiency (IPCE) measurements.
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
Ding, Ziqian; Abbas, Gamal; Assender, Hazel E; Morrison, John J; Yeates, Stephen G; Patchett, Eifion R; Taylor, D Martin
2014-09-10
We report a systemic study of the stability of organic thin film transistors (OTFTs) both in storage and under operation. Apart from a thin polystyrene buffer layer spin-coated onto the gate dielectric, the constituent parts of the OTFTs were all prepared by vacuum evaporation. The OTFTs are based on the semiconducting small molecule dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT) deposited onto the surface of a polystyrene-buffered in situ polymerized diacrylate gate insulator. Over a period of 9 months, no degradation of the hole mobility occurred in devices stored either in the dark in dry air or in uncontrolled air and normal laboratory fluorescent lighting conditions. In the latter case, rather than decreasing, the mobility actually increased almost 2-fold to 1.5 cm(2)/(V · s). The devices also showed good stability during repeat on/off cycles in the dark in dry air. Exposure to oxygen and light during the on/off cycles led to a positive shift of the transfer curves due to electron trapping when the DNTT was biased into depletion by the application of positive gate voltage. When operated in accumulation, negative gate voltage under the same conditions, the transfer curves were stable. When voltage cycling in moist air in the dark, the transfer curves shifted to negative voltages, thought to be due to the generation of hole traps either in the semiconductor or its interface with the dielectric layer. When subjected to gate bias stress in dry air in the dark for at least 144 h, the device characteristics remained stable.
Boundary layer charge dynamics in ionic liquid-ionic polymer transducers
NASA Astrophysics Data System (ADS)
Davidson, Jacob D.; Goulbourne, N. C.
2011-01-01
Ionic polymer transducers (IPTs), also known as ionic polymer-metal composites, are soft sensors and actuators which operate through a coupling of microscale chemical, electrical, and mechanical interactions. The use of an ionic liquid as solvent for an IPT has been shown to dramatically increase transducer lifetime in free-air use, while also allowing for higher applied voltages without electrolysis. In this work, we apply Nernst-Planck/Poisson theory to model charge transport in an ionic liquid IPT by considering a certain fraction of the ionic liquid ions as mobile charge carriers, a phenomenon which is unique to ionic liquid IPTs compared to their water-based counterparts. Numerical simulations are performed using the finite element method to examine how the introduction of another pair of mobile ions affects boundary layer charge dynamics, concentration, and charge density distributions in the electric double layer, and the overall charge transferred and current response of the IPT. Due to interactions with the Nafion ionomer, not all of the ionic liquid ions will function as mobile charge carriers; only a certain fraction will exist as "free" ions. The presence of mobile ionic liquid ions in the transducer will increase the overall charge transferred when a voltage is applied, and cause the current in the transducer to decay more slowly. The additional mobile ions also cause the ionic concentration profiles to exhibit a nonlinear dynamic response, characterized by nonmonotonic ionic concentration profiles in space and time. Although the presence of mobile ionic liquid ions increases the overall amount of charge transferred, this additional charge transfer occurs in a somewhat symmetric manner. Therefore, the additional charge transferred due to the ionic liquid ions does not greatly increase the net bending moment of the transducer; in fact, it is possible that ionic liquid ion movement actually decreases the observed bending response. This suggests that an optimal electromechanical conversion efficiency for bending actuation is achieved by using an ionic liquid where only a relatively small fraction of the ionic liquid ions exist as free ions. Conversely, if it is desired to increase the overall amount of charge transferred, an ionic liquid with a large fraction of free ions should be used. These theoretical considerations are found to be in good qualitative agreement with recent experimental results.
Byers, John A
2004-05-30
Heating of chromatographic columns, transfer lines, and other devices is often required in neuroscience research. For example, volatile compounds passing through a capillary column of a gas chromatograph (GC) can be split, with half exiting the instrument through a heated transfer line to an insect antenna or olfactory sensillum for electroantennographic detector (GC-EAD) recordings. The heated transfer line is used to prevent condensation of various chemicals in the capillary that would otherwise occur at room temperature. Construction of such a transfer line heater is described using (80/20%) nickel-chromium heating wire wrapped in a helical coil and powered by a 120/220 V ac rheostat. Algorithms were developed in a computer program to estimate the voltage at which a rheostat should be set to obtain the desired heater temperature for a specific coil. The coil attributes (radius, width, number of loops, or length of each loop) are input by the user, as well as AWG size of heating wire and desired heater temperature. The program calculates total length of wire in the helix, resistance of the wire, amperage used, and the voltage to set the rheostat. A discussion of semiochemical isolation methods using the GC-EAD and bioassays is presented.
First principle study of transport properties of a graphene nano structure
NASA Astrophysics Data System (ADS)
Kumar, Naveen; Sharma, Munish; Sharma, Jyoti Dhar; Ahluwalia, P. K.
2013-06-01
The first principle quantum transport calculations have been performed for graphene using Tran SIESTA which calculates transport properties using nonequilibrium Green's function method in conjunction with density-functional theory. Transmission functions, electron density of states and current-voltage characteristic have been calculated for a graphene nano structure using graphene electrodes. Transmission function, density of states and projected density of states show a discrete band structure which varies with applied voltage. The value of current is very low for applied voltage between 0.0 V to 5.0 V and lies in the range of pico ampere. In the V-I characteristic current shows non-linear fluctuating pattern with increase in voltage.
2017-07-01
work , the guideline document (1) provides a basis for identifying high voltage design risks, (2) defines areas of concern as a function of environment ... work , the guideline document 1) provides a basis for identifying high voltage design risks, 2) defines areas of concern as a function of environment ...pressures (y-axis - breakdown voltage [volts-peak]) As an example of the impact of the aerospace environment , consider the calculation of the safe
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya
The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less
Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...
2016-08-09
The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less
Low noise charge ramp electrometer
Morgan, John P.; Piper, Thomas C.
1992-01-01
An electrometer capable of measuring small currents without the use of a feedback resistor which tends to contribute a large noise factor to the measured data. The electrometer eliminates the feedback resistor through the use of a feedback capacitor located across the electrometer amplifier. The signal from the electrometer amplifier is transferred to a electrometer buffer amplifier which serves to transfer the signal to several receptors. If the electrometer amplifier is approaching saturation, the buffer amplifier signals a reset discriminator which energizes a coil whose magnetic field closes a magnetic relay switch which in turn resets or zeros the feedback capacitor. In turn, a reset complete discriminator restarts the measurement process when the electrometer amplifier approaches its initial condition. The buffer amplifier also transmits the voltage signal from the electrometer amplifier to a voltage-to-frequency converter. The signals from the voltage-to-frequency converter are counted over a fixed period of time and the information is relayed to a data processor. The timing and sequencing of the small current measuring system is under the control of a sequence control logic unit.
Low noise charge ramp electrometer
Morgan, J.P.; Piper, T.C.
1992-10-06
An electrometer capable of measuring small currents without the use of a feedback resistor which tends to contribute a large noise factor to the measured data. The electrometer eliminates the feedback resistor through the use of a feedback capacitor located across the electrometer amplifier. The signal from the electrometer amplifier is transferred to a electrometer buffer amplifier which serves to transfer the signal to several receptors. If the electrometer amplifier is approaching saturation, the buffer amplifier signals a reset discriminator which energizes a coil whose magnetic field closes a magnetic relay switch which in turn resets or zeros the feedback capacitor. In turn, a reset complete discriminator restarts the measurement process when the electrometer amplifier approaches its initial condition. The buffer amplifier also transmits the voltage signal from the electrometer amplifier to a voltage-to-frequency converter. The signals from the voltage-to-frequency converter are counted over a fixed period of time and the information is relayed to a data processor. The timing and sequencing of the small current measuring system is under the control of a sequence control logic unit. 2 figs.
Volume and Mass Estimation of Three-Phase High Power Transformers for Space Applications
NASA Technical Reports Server (NTRS)
Kimnach, Greg L.
2004-01-01
Spacecraft historically have had sub-1kW(sub e), electrical requirements for GN&C, science, and communications: Galileo at 600W(sub e), and Cassini at 900W(sub e), for example. Because most missions have had the same order of magnitude power requirements, the Power Distribution Systems (PDS) use existing, space-qualified technology and are DC. As science payload and mission duration requirements increase, however, the required electrical power increases. Subsequently, this requires a change from a passive energy conversion (solar arrays and batteries) to dynamic (alternator, solar dynamic, etc.), because dynamic conversion has higher thermal and conversion efficiencies, has higher power densities, and scales more readily to higher power levels. Furthermore, increased power requirements and physical distribution lengths are best served with high-voltage, multi-phase AC to maintain distribution efficiency and minimize voltage drops. The generated AC-voltage must be stepped-up (or down) to interface with various subsystems or electrical hardware. Part of the trade-space design for AC distribution systems is volume and mass estimation of high-power transformers. The volume and mass are functions of the power rating, operating frequency, the ambient and allowable temperature rise, the types and amount of heat transfer available, the core material and shape, the required flux density in a core, the maximum current density, etc. McLyman has tabulated the performance of a number of transformers cores and derived a "cookbook" methodology to determine the volume of transformers, whereas Schawrze had derived an empirical method to estimate the mass of single-phase transformers. Based on the work of McLyman and Schwarze, it is the intent herein to derive an empirical solution to the volume and mass estimation of three-phase, laminated EI-core power transformers, having radiated and conducted heat transfer mechanisms available. Estimation of the mounting hardware, connectors, etc. is not included.
The CARIBU EBIS control and synchronization system
NASA Astrophysics Data System (ADS)
Dickerson, Clayton; Peters, Christopher
2015-01-01
The Californium Rare Isotope Breeder Upgrade (CARIBU) Electron Beam Ion Source (EBIS) charge breeder has been built and tested. The bases of the CARIBU EBIS electrical system are four voltage platforms on which both DC and pulsed high voltage outputs are controlled. The high voltage output pulses are created with either a combination of a function generator and a high voltage amplifier, or two high voltage DC power supplies and a high voltage solid state switch. Proper synchronization of the pulsed voltages, fundamental to optimizing the charge breeding performance, is achieved with triggering from a digital delay pulse generator. The control system is based on National Instruments realtime controllers and LabVIEW software implementing Functional Global Variables (FGV) to store and access instrument parameters. Fiber optic converters enable network communication and triggering across the platforms.
Transfer printing of thermoreversible ion gels for flexible electronics.
Lee, Keun Hyung; Zhang, Sipei; Gu, Yuanyan; Lodge, Timothy P; Frisbie, C Daniel
2013-10-09
Thermally assisted transfer printing was employed to pattern thin films of high capacitance ion gels on polyimide, poly(ethylene terephthalate), and SiO2 substrates. The ion gels consisted of 20 wt % block copolymer poly(styrene-b-ethylene oxide-b-styrene and 80 wt % ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethyl sulfonyl)amide. Patterning resolution was on the order of 10 μm. Importantly, ion gels containing the block polymer with short PS end blocks (3.4 kg/mol) could be transfer-printed because of thermoreversible gelation that enabled intimate gel-substrate contact at 100 °C, while gels with long PS blocks (11 kg/mol) were not printable at the same temperature due to poor wetting contact between the gel and substrates. By using printed ion gels as high-capacitance gate insulators, electrolyte-gated thin-film transistors were fabricated that operated at low voltages (<1 V) with high on/off current ratios (∼10(5)). Statistical analysis of carrier mobility, turn-on voltage, and on/off ratio for an array of printed transistors demonstrated the excellent reproducibility of the printing technique. The results show that transfer printing is an attractive route to pattern high-capacitance ion gels for flexible thin-film devices.
NASA Astrophysics Data System (ADS)
Oubram, O.; Navarro, O.; Guzmán, E. J.; Rodríguez-Vargas, I.
2018-01-01
Electron transport in a silicene structure, composed of a pair of magnetic gates, is studied in a ferromagnetic and antiferromagnetic configuration. The transport properties are investigated for asymmetrical external effects like an electrostatic potential, a magnetic field and for asymmetrical geometric structure. This theoretical study, has been done using the matrix transfer method to calculate the transmission, the conductance for parallel and antiparallel magnetic alignment and the tunneling magnetoresistance (TMR). In Particular, we have found that the transmission, conductance and magnetoresistance oscillate as a function of the width of barriers. It is also found that a best control and high values of TMR spectrum are achieved by an asymmetrical application of the contact voltage. Besides, we have shown that the TMR is enhanced several orders of magnitude by the combined asymmetrical magnetization effect with an adequate applied electrostatic potential. Whereby, the asymmetrical external effects play an important role to improve TMR than symmetrical ones. Finally, the giant TMR can be flexibly modulated by incident energy and a specific asymmetrical application of control voltage. These results could be useful to design filters and digital nanodevices.
Problems encountered in fluctuating flame temperature measurements by thermocouple.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Donaldson, A. Burl; Lucero, Ralph E.; Gill, Walter
2008-11-01
Some thermocouple experiments were carried out in order to obtain sensitivity of thermocouple readings to fluctuations in flames and to determine if the average thermocouple reading was representative of the local volume temperature for fluctuating flames. The thermocouples considered were an exposed junction thermocouple and a fully sheathed thermocouple with comparable time constants. Either the voltage signal or indicated temperature for each test was recorded at sampling rates between 300-4,096 Hz. The trace was then plotted with respect to time or sample number so that time variation in voltage or temperature could be visualized and the average indicated temperature couldmore » be determined. For experiments where high sampling rates were used, the signal was analyzed using Fast Fourier Transforms (FFT) to determine the frequencies present in the thermocouple signal. This provided a basic observable as to whether or not the probe was able to follow flame oscillations. To enhance oscillations, for some experiments, the flame was forced. An analysis based on thermocouple time constant, coupled with the transfer function for a sinusoidal input was tested against the experimental results.« less
Problems Encountered in Fluctuating Flame Temperature Measurements by Thermocouple
Yilmaz, Nadir; Gill, Walt; Donaldson, A. Burl; Lucero, Ralph E.
2008-01-01
Some thermocouple experiments were carried out in order to obtain sensitivity of thermocouple readings to fluctuations in flames and to determine if the average thermocouple reading was representative of the local volume temperature for fluctuating flames. The thermocouples considered were an exposed junction thermocouple and a fully sheathed thermocouple with comparable time constants. Either the voltage signal or indicated temperature for each test was recorded at sampling rates between 300-4,096 Hz. The trace was then plotted with respect to time or sample number so that time variation in voltage or temperature could be visualized and the average indicated temperature could be determined. For experiments where high sampling rates were used, the signal was analyzed using Fast Fourier Transforms (FFT) to determine the frequencies present in the thermocouple signal. This provided a basic observable as to whether or not the probe was able to follow flame oscillations. To enhance oscillations, for some experiments, the flame was forced. An analysis based on thermocouple time constant, coupled with the transfer function for a sinusoidal input was tested against the experimental results. PMID:27873964
Problems Encountered in Fluctuating Flame Temperature Measurements by Thermocouple.
Yilmaz, Nadir; Gill, Walt; Donaldson, A Burl; Lucero, Ralph E
2008-12-04
Some thermocouple experiments were carried out in order to obtain sensitivity of thermocouple readings to fluctuations in flames and to determine if the average thermocouple reading was representative of the local volume temperature for fluctuating flames. The thermocouples considered were an exposed junction thermocouple and a fully sheathed thermocouple with comparable time constants. Either the voltage signal or indicated temperature for each test was recorded at sampling rates between 300-4,096 Hz. The trace was then plotted with respect to time or sample number so that time variation in voltage or temperature could be visualized and the average indicated temperature could be determined. For experiments where high sampling rates were used, the signal was analyzed using Fast Fourier Transforms (FFT) to determine the frequencies present in the thermocouple signal. This provided a basic observable as to whether or not the probe was able to follow flame oscillations. To enhance oscillations, for some experiments, the flame was forced. An analysis based on thermocouple time constant, coupled with the transfer function for a sinusoidal input was tested against the experimental results.
An Autonomous Satellite Time Synchronization System Using Remotely Disciplined VC-OCXOs.
Gu, Xiaobo; Chang, Qing; Glennon, Eamonn P; Xu, Baoda; Dempseter, Andrew G; Wang, Dun; Wu, Jiapeng
2015-07-23
An autonomous remote clock control system is proposed to provide time synchronization and frequency syntonization for satellite to satellite or ground to satellite time transfer, with the system comprising on-board voltage controlled oven controlled crystal oscillators (VC-OCXOs) that are disciplined to a remote master atomic clock or oscillator. The synchronization loop aims to provide autonomous operation over extended periods, be widely applicable to a variety of scenarios and robust. A new architecture comprising the use of frequency division duplex (FDD), synchronous time division (STDD) duplex and code division multiple access (CDMA) with a centralized topology is employed. This new design utilizes dual one-way ranging methods to precisely measure the clock error, adopts least square (LS) methods to predict the clock error and employs a third-order phase lock loop (PLL) to generate the voltage control signal. A general functional model for this system is proposed and the error sources and delays that affect the time synchronization are discussed. Related algorithms for estimating and correcting these errors are also proposed. The performance of the proposed system is simulated and guidance for selecting the clock is provided.
Ab initio modeling of steady-state and time-dependent charge transport in hole-only α-NPD devices
NASA Astrophysics Data System (ADS)
Liu, Feilong; Massé, Andrea; Friederich, Pascal; Symalla, Franz; Nitsche, Robert; Wenzel, Wolfgang; Coehoorn, Reinder; Bobbert, Peter A.
2016-12-01
We present an ab initio modeling study of steady-state and time-dependent charge transport in hole-only devices of the amorphous molecular semiconductor α-NPD [N ,N'-Di(1 -naphthyl)-N ,N'-diphenyl-(1 ,1'-biphenyl)-4 ,4'-diamine] . The study is based on the microscopic information obtained from atomistic simulations of the morphology and density functional theory calculations of the molecular hole energies, reorganization energies, and transfer integrals. Using stochastic approaches, the microscopic information obtained in simulation boxes at a length scale of ˜10 nm is expanded and employed in one-dimensional (1D) and three-dimensional (3D) master-equation modeling of the charge transport at the device scale of ˜100 nm. Without any fit parameter, predicted current density-voltage and impedance spectroscopy data obtained with the 3D modeling are in very good agreement with measured data on devices with different α-NPD layer thicknesses in a wide range of temperatures, bias voltages, and frequencies. Similarly good results are obtained with the computationally much more efficient 1D modeling after optimizing a hopping prefactor.
He, Yangyong; Cai, Zeying; Shao, Jian; Xu, Li; She, Limin; Zheng, Yue; Zhong, Dingyong
2018-05-03
The self-assembly behavior of quaterrylene (QR) molecules on Ag(111) surfaces has been investigated by scanning tunneling microscopy (STM) and density functional theory (DFT) calculations. It is found that the QR molecules are highly mobile on the Ag(111) surface at 78 K. No ordered assembled structure is formed on the surface with a sub-monolayer coverage up to 0.8 monolayer due to the intermolecular repulsive interactions, whereas ordered molecular structures are observed at one monolayer coverage. According to our DFT calculations, charge transfer occurs between the substrate and the adsorbed QR molecule. As a result, out-of-plane dipoles appear at the interface, which are ascribed to the repulsive dipole-dipole interactions between the QR molecules. Furthermore, due to the planar geometry, the QR molecules exhibit relatively low diffusion barriers on Ag(111). By applying a voltage pulse between the tunneling gap, immobilization and aggregation of QR molecules take place, resulting in the formation of a triangle-shaped trimer. Our work demonstrates the ability of manipulating intermolecular repulsive and attractive interactions at the single molecular level.
Kedem, Nir; Kulbak, Michael; Brenner, Thomas M; Hodes, Gary; Cahen, David
2017-02-22
Using several metals with different work functions as solar cell back contact we identify majority carrier type inversion in methylammonium lead bromide (MAPbBr3, without intentional doping) as the basis for the formation of a p-n junction. MAPbBr 3 films deposited on TiO 2 are slightly n-type, whereas in a full device they are strongly p-type. The charge transfer between the metal electrode and the halide perovskite (HaP) film is shown to determine the dominant charge carrier type of the HaP and, thus, also of the final cells. Usage of Pt, Au and Pb as metal electrodes shows the effects of metal work function on minority carrier diffusion length and majority carrier concentration in the HaP, as well as on built-in voltage, band bending, and open circuit voltage (V OC ) within a solar cell. V OC > 1.5 V is demonstrated. The higher the metal WF, the higher the carrier concentration induced in the HaP, as indicated by a narrower space charge region and a smaller minority carrier diffusion length. From the analysis of bias-dependent electron beam-induced currents, the HaP carrier concentrations are estimated to be ∼ 1 × 10 17 cm -3 with Au and 2-3 × 10 18 cm -3 with Pt. A model in which type-inversion stretches across the entire film width implies formation of the p-n junction away from the interface, near the back-contact metal electrode. This work highlights the importance of the contact metal on device performance in that contact engineering can also serve to control the carrier concentration in HaP.
Rusanen, Juha; Frolov, Roman; Weckström, Matti; Kinoshita, Michiyo; Arikawa, Kentaro
2018-04-30
Lamina monopolar cells (LMCs) are the first-order visual interneurons of insects and crustacea, primarily involved in achromatic vision. Here we investigated morphological and electrophysiological properties of LMCs in the butterfly Papilio xuthus Using intracellular recording coupled with dye injection, we found two types of LMCs. Cells with roundish terminals near the distal surface of the medulla demonstrating no or small depolarizing spikes were classified as L1/2. LMCs with elongated terminals deep in the medulla that showed prominent spiking were classified as L3/4. The majority of LMCs of both types had broad spectral sensitivities, peaking between 480 and 570 nm. Depending on the experimental conditions, spikes varied from small to action potential-like events, with their amplitudes and rates decreasing as stimulus brightness increased. When the eye was stimulated with naturalistic contrast-modulated time series, spikes were reliably triggered by high-contrast components of the stimulus. Spike-triggered average functions showed that spikes emphasize rapid membrane depolarizations. Our results suggest that spikes are mediated by voltage-activated Na + channels, which are mainly inactivated at rest. Strong local minima in the coherence functions of spiking LMCs indicate that the depolarizing conductance contributes to the amplification of graded responses even when detectable spikes are not evoked. We propose that the information transfer strategies of spiking LMCs change with light intensity. In dim light, both graded voltage signals and large spikes are used together without mutual interference, due to separate transmission bandwidths. In bright light, signals are non-linearly amplified by the depolarizing conductance in the absence of detectable spikes. © 2018. Published by The Company of Biologists Ltd.
2015-01-01
The voltage sensor domain (VSD) of voltage-gated cation (e.g., Na+, K+) channels central to neurological signal transmission can function as a distinct module. When linked to an otherwise voltage-insensitive, ion-selective membrane pore, the VSD imparts voltage sensitivity to the channel. Proteins homologous with the VSD have recently been found to function themselves as voltage-gated proton channels or to impart voltage sensitivity to enzymes. Determining the conformational changes associated with voltage gating in the VSD itself in the absence of a pore domain thereby gains importance. We report the direct measurement of changes in the scattering-length density (SLD) profile of the VSD protein, vectorially oriented within a reconstituted phospholipid bilayer membrane, as a function of the transmembrane electric potential by time-resolved X-ray and neutron interferometry. The changes in the experimental SLD profiles for both polarizing and depolarizing potentials with respect to zero potential were found to extend over the entire length of the isolated VSD’s profile structure. The characteristics of the changes observed were in qualitative agreement with molecular dynamics simulations of a related membrane system, suggesting an initial interpretation of these changes in terms of the VSD’s atomic-level 3-D structure. PMID:24697545
Kcna1-mutant rats dominantly display myokymia, neuromyotonia and spontaneous epileptic seizures.
Ishida, Saeko; Sakamoto, Yu; Nishio, Takeshi; Baulac, Stéphanie; Kuwamura, Mitsuru; Ohno, Yukihiro; Takizawa, Akiko; Kaneko, Shuji; Serikawa, Tadao; Mashimo, Tomoji
2012-01-30
Mutations in the KCNA1 gene, which encodes for the α subunit of the voltage-gated potassium channel Kv1.1, cause episodic ataxia type 1 (EA1). EA1 is a dominant human neurological disorder characterized by variable phenotypes of brief episodes of ataxia, myokymia, neuromyotonia, and associated epilepsy. Animal models for EA1 include Kcna1-deficient mice, which recessively display severe seizures and die prematurely, and V408A-knock-in mice, which dominantly exhibit stress-induced loss of motor coordination. In the present study, we have identified an N-ethyl-N-nitrosourea-mutagenized rat, named autosomal dominant myokymia and seizures (ADMS), with a missense mutation (S309T) in the voltage-sensor domain, S4, of the Kcna1 gene. ADMS rats dominantly exhibited myokymia, neuromyotonia and generalized tonic-clonic seizures. They also showed cold stress-induced tremor, neuromyotonia, and motor incoordination. Expression studies of homomeric and heteromeric Kv1.1 channels in HEK cells and Xenopus oocytes, showed that, although S309T channels are transferred to the cell membrane surface, they remained non-functional in terms of their biophysical properties, suggesting a dominant-negative effect of the S309T mutation on potassium channel function. ADMS rats provide a new model, distinct from previously reported mouse models, for studying the diverse functions of Kv1.1 in vivo, as well as for understanding the pathology of EA1. Copyright © 2011 Elsevier B.V. All rights reserved.
Feng, Guo-Hua; Liu, Jun-Hao
2013-02-01
This paper proposes a tunable-focus liquid lens implemented with a simple cylindrical container structure and liquid as the lens material. The cylindrical container was constructed using a Pb [Zr(0.52)Ti(0.48)]O(3) (PZT) ring transducer and a polydimethylsiloxane membrane that was attached to a flat side of the transducer. The free surface of the liquid in the cylindrical container can be driven as a static-like convex lens with different curvatures because the higher-order harmonic resonance of the PZT transducer was electrically controlled. Based on a capillary-force-dominant design, the activated liquid lens maintained surface curvature in an arbitrary orientation without a gravitational effect. Profiles of the liquid lenses were characterized with the driving voltages of the transducer ranging from 12 to 60 V peak-to-peak (Vpp) at a resonant frequency of 460 kHz. The temperature effects on the lenses caused by the continuous operation of the transducer were measured. Images showed the various curvatures of the lenses with a range of actuation voltages. A change in focal length of eight times (5.72 to 46.03 cm) was demonstrated within the 10 Vpp variation of the driving voltage. For the characterized liquid lenses, the distortion was less than 2%, and the modulation transfer function reached 63 line pairs per mm (lp/mm) using ZEMAX analysis.
Improved Signal Chains for Readout of CMOS Imagers
NASA Technical Reports Server (NTRS)
Pain, Bedabrata; Hancock, Bruce; Cunningham, Thomas
2009-01-01
An improved generic design has been devised for implementing signal chains involved in readout from complementary metal oxide/semiconductor (CMOS) image sensors and for other readout integrated circuits (ICs) that perform equivalent functions. The design applies to any such IC in which output signal charges from the pixels in a given row are transferred simultaneously into sampling capacitors at the bottoms of the columns, then voltages representing individual pixel charges are read out in sequence by sequentially turning on column-selecting field-effect transistors (FETs) in synchronism with source-follower- or operational-amplifier-based amplifier circuits. The improved design affords the best features of prior source-follower-and operational- amplifier-based designs while overcoming the major limitations of those designs. The limitations can be summarized as follows: a) For a source-follower-based signal chain, the ohmic voltage drop associated with DC bias current flowing through the column-selection FET causes unacceptable voltage offset, nonlinearity, and reduced small-signal gain. b) For an operational-amplifier-based signal chain, the required bias current and the output noise increase superlinearly with size of the pixel array because of a corresponding increase in the effective capacitance of the row bus used to couple the sampled column charges to the operational amplifier. The effect of the bus capacitance is to simultaneously slow down the readout circuit and increase noise through the Miller effect.
Rathi, Servin; Lee, Inyeal; Lim, Dongsuk; Wang, Jianwei; Ochiai, Yuichi; Aoki, Nobuyuki; Watanabe, Kenji; Taniguchi, Takashi; Lee, Gwan-Hyoung; Yu, Young-Jun; Kim, Philip; Kim, Gil-Ho
2015-08-12
Lateral and vertical two-dimensional heterostructure devices, in particular graphene-MoS2, have attracted profound interest as they offer additional functionalities over normal two-dimensional devices. Here, we have carried out electrical and optical characterization of graphene-MoS2 heterostructure. The few-layer MoS2 devices with metal electrode at one end and monolayer graphene electrode at the other end show nonlinearity in drain current with drain voltage sweep due to asymmetrical Schottky barrier height at the contacts and can be modulated with an external gate field. The doping effect of MoS2 on graphene was observed as double Dirac points in the transfer characteristics of the graphene field-effect transistor (FET) with a few-layer MoS2 overlapping the middle part of the channel, whereas the underlapping of graphene have negligible effect on MoS2 FET characteristics, which showed typical n-type behavior. The heterostructure also exhibits a strongest optical response for 520 nm wavelength, which decreases with higher wavelengths. Another distinct feature observed in the heterostructure is the peak in the photocurrent around zero gate voltage. This peak is distinguished from conventional MoS2 FETs, which show a continuous increase in photocurrent with back-gate voltage. These results offer significant insight and further enhance the understanding of the graphene-MoS2 heterostructure.
Resonant Rectifier ICs for Piezoelectric Energy Harvesting Using Low-Voltage Drop Diode Equivalents
Din, Amad Ud; Chandrathna, Seneke Chamith; Lee, Jong-Wook
2017-01-01
Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power used for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power transfer efficiency of 68.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding efficiency of 78.4%. Using the proposed bias-flip technique, the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier. PMID:28422085
Resonant Rectifier ICs for Piezoelectric Energy Harvesting Using Low-Voltage Drop Diode Equivalents.
Din, Amad Ud; Chandrathna, Seneke Chamith; Lee, Jong-Wook
2017-04-19
Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power used for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power P OUT of 564 μW and a rectifier output voltage V RECT of 3.36 V with a power transfer efficiency of 68.1%. Under self-power conditions, the rectifier using MDDE delivers a P OUT of 288 μW and a V RECT of 2.4 V with a corresponding efficiency of 78.4%. Using the proposed bias-flip technique, the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.
Okuda, Hiroko; Yonezawa, Yasushige; Takano, Yu; Okamura, Yasushi; Fujiwara, Yuichiro
2016-01-01
The voltage-gated H+ channel (Hv) is a voltage sensor domain-like protein consisting of four transmembrane segments (S1–S4). The native Hv structure is a homodimer, with the two channel subunits functioning cooperatively. Here we show that the two voltage sensor S4 helices within the dimer directly cooperate via a π-stacking interaction between Trp residues at the middle of each segment. Scanning mutagenesis showed that Trp situated around the original position provides the slow gating kinetics characteristic of the dimer's cooperativity. Analyses of the Trp mutation on the dimeric and monomeric channel backgrounds and analyses with tandem channel constructs suggested that the two Trp residues within the dimer are functionally coupled during Hv deactivation but are less so during activation. Molecular dynamics simulation also showed direct π-stacking of the two Trp residues. These results provide new insight into the cooperative function of voltage-gated channels, where adjacent voltage sensor helices make direct physical contact and work as a single unit according to the gating process. PMID:26755722
NASA Technical Reports Server (NTRS)
Perotti, Jose M. (Inventor); Mata, Carlos T. (Inventor); Santiago, Josephine B. (Inventor); Vokrot, Peter (Inventor); Zavala, Carlos E. (Inventor); Burns, Bradley M. (Inventor)
2010-01-01
Self-Validating Thermocouple (SVT) Systems capable of detecting sensor probe open circuits, short circuits, and unnoticeable faults such as a probe debonding and probe degradation are useful in the measurement of temperatures. SVT Systems provide such capabilities by incorporating a heating or excitation element into the measuring junction of the thermocouple. By heating the measuring junction and observing the decay time for the detected DC voltage signal, it is possible to indicate whether the thermocouple is bonded or debonded. A change in the thermal transfer function of the thermocouple system causes a change in the rise and decay times of the thermocouple output. Incorporation of the excitation element does not interfere with normal thermocouple operation, thus further allowing traditional validation procedures as well.
Modeling and Analysis of Geoelectric Fields: Extended Solar Shield
NASA Astrophysics Data System (ADS)
Ngwira, C. M.; Pulkkinen, A. A.
2016-12-01
In the NASA Applied Sciences Program Solar Shield project, an unprecedented first-principles-based system to forecast geomagnetically induced current (GIC) in high-voltage power transmission systems was developed. Rapid progress in the field of numerical physics-based space environment modeling has led to major developments over the past few years. In this study modeling and analysis of induced geoelectric fields is discussed. Specifically, we focus on the successful incorporation of 3-D EM transfer functions in the modeling of E-fields, and on the analysis of near real-time simulation outputs used in the Solar Shield forecast system. The extended Solar Shield is a collaborative project between DHS, NASA, NOAA, CUA and EPRI.
NASA Astrophysics Data System (ADS)
Wang, Zhao; Knights, Andrew P.
2017-02-01
We describe a direct experimental method to determine the effective driving voltage (Vpp) applied to a silicon photonic modulator possessing an impedance mismatch between the unterminated capacitive load and input source. This method thus permits subsequent estimation of the power consumption of an imperfectly terminated device as well as a deduction of load impedance for optimization of termination design. The capacitive load in this paper is a silicon micro-ring modulator with an integrated p-n junction acting as a phase shifter. The RF reflection under high-speed drive is directly determined from observation of the eye-diagram following measurement of the power transfer function for various junction bias.
Design of an electrostatic phase shifting device for biological transmission electron microscopy.
Koeck, Philip J B
2018-04-01
I suggest an electrostatic phase plate designed to broaden the contrast transfer function of a transmission electron microscope operated close to Scherzer defocus primarily in the low resolution direction. At higher defocus the low frequency behavior is equal to that close to Scherzer defocus, but CTF-correction becomes necessary to extend image interpretation to higher resolution. One simple realization of the phase plate consists of two ring shaped electrodes symmetrically surrounding the central beam. Since no physical components come into contact with the central beam and charge on the electrodes is controlled by an external voltage supply, problems with uncontrolled charging are expected to be reduced. Copyright © 2018 Elsevier B.V. All rights reserved.
Rocket Propulsion 21 Steering Committee Meeting (RP21) NASA In-Space Propulsion Update
NASA Technical Reports Server (NTRS)
Klem, Mark
2015-01-01
In-house Support of NEXT-C Contract Status Thruster NEXT Long Duration Test post-test destructive evaluation in progress Findings will be used to verify service life models identify potential design improvements Cathode heater fabrication initiated for cyclic life testing Thruster operating algorithm definition verification initiated to provide operating procedures for mission users High voltage propellant isolator life test voluntarily terminated after successfully operating 51,200 h Power processor unit (PPU) Replaced all problematic stacked multilayer ceramic dual inline pin capacitors within PPU Test bed Rebuilt installed discharge power supply primary power board Completed full functional performance characterization Final test report in progress Transferred PPU Testbed to contractor to support prototype design effort.
Optimal Design of a Resonance-Based Voltage Boosting Rectifier for Wireless Power Transmission.
Lim, Jaemyung; Lee, Byunghun; Ghovanloo, Maysam
2018-02-01
This paper presents the design procedure for a new multi-cycle resonance-based voltage boosting rectifier (MCRR) capable of delivering a desired amount of power to the load (PDL) at a designated high voltage (HV) through a loosely-coupled inductive link. This is achieved by shorting the receiver (Rx) LC-tank for several cycles to harvest and accumulate the wireless energy in the RX inductor before boosting the voltage by breaking the loop and transferring the energy to the load in a quarter cycle. By optimizing the geometries of the transmitter (Tx) and Rx coils and the number of cycles, N , for energy harvesting, through an iterative design procedure, the MCRR can achieve the highest PDL under a given set of design constraints. Governing equations in the MCRR operation are derived to identify key specifications and the design guidelines. Using an exemplary set of specs, the optimized MCRR was able to generate 20.9 V DC across a 100 kΩ load from a 1.8 V p , 6.78 MHz sinusoid input in the ISM-band at a Tx/Rx coil separation of 1.3 cm, power transfer efficiency (PTE) of 2.2%, and N = 9 cycles. At the same coil distance and loading, coils optimized for a conventional half-wave rectifier (CHWR) were able to reach only 13.6 V DC from the same source.
Bidirectional buck boost converter
Esser, Albert Andreas Maria
1998-03-31
A bidirectional buck boost converter and method of operating the same allows regulation of power flow between first and second voltage sources in which the voltage level at each source is subject to change and power flow is independent of relative voltage levels. In one embodiment, the converter is designed for hard switching while another embodiment implements soft switching of the switching devices. In both embodiments, first and second switching devices are serially coupled between a relatively positive terminal and a relatively negative terminal of a first voltage source with third and fourth switching devices serially coupled between a relatively positive terminal and a relatively negative terminal of a second voltage source. A free-wheeling diode is coupled, respectively, in parallel opposition with respective ones of the switching devices. An inductor is coupled between a junction of the first and second switching devices and a junction of the third and fourth switching devices. Gating pulses supplied by a gating circuit selectively enable operation of the switching devices for transferring power between the voltage sources. In the second embodiment, each switching device is shunted by a capacitor and the switching devices are operated when voltage across the device is substantially zero.
Bidirectional buck boost converter
Esser, A.A.M.
1998-03-31
A bidirectional buck boost converter and method of operating the same allows regulation of power flow between first and second voltage sources in which the voltage level at each source is subject to change and power flow is independent of relative voltage levels. In one embodiment, the converter is designed for hard switching while another embodiment implements soft switching of the switching devices. In both embodiments, first and second switching devices are serially coupled between a relatively positive terminal and a relatively negative terminal of a first voltage source with third and fourth switching devices serially coupled between a relatively positive terminal and a relatively negative terminal of a second voltage source. A free-wheeling diode is coupled, respectively, in parallel opposition with respective ones of the switching devices. An inductor is coupled between a junction of the first and second switching devices and a junction of the third and fourth switching devices. Gating pulses supplied by a gating circuit selectively enable operation of the switching devices for transferring power between the voltage sources. In the second embodiment, each switching device is shunted by a capacitor and the switching devices are operated when voltage across the device is substantially zero. 20 figs.
Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge
NASA Astrophysics Data System (ADS)
Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.
2014-11-01
The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.
The CARIBU EBIS control and synchronization system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dickerson, Clayton, E-mail: cdickerson@anl.gov; Peters, Christopher, E-mail: cdickerson@anl.gov
2015-01-09
The Californium Rare Isotope Breeder Upgrade (CARIBU) Electron Beam Ion Source (EBIS) charge breeder has been built and tested. The bases of the CARIBU EBIS electrical system are four voltage platforms on which both DC and pulsed high voltage outputs are controlled. The high voltage output pulses are created with either a combination of a function generator and a high voltage amplifier, or two high voltage DC power supplies and a high voltage solid state switch. Proper synchronization of the pulsed voltages, fundamental to optimizing the charge breeding performance, is achieved with triggering from a digital delay pulse generator. Themore » control system is based on National Instruments realtime controllers and LabVIEW software implementing Functional Global Variables (FGV) to store and access instrument parameters. Fiber optic converters enable network communication and triggering across the platforms.« less
Schmidt, Daniel; MacKinnon, Roderick
2008-12-09
Voltage-dependent K(+) (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K(+) channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane.
Schmidt, Daniel; MacKinnon, Roderick
2008-01-01
Voltage-dependent K+ (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K+ channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane. PMID:19050073
Compact microwave ion source for industrial applications.
Cho, Yong-Sub; Kim, Dae-Il; Kim, Han-Sung; Seol, Kyung-Tae; Kwon, Hyeok-Jung; Hong, In-Seok
2012-02-01
A 2.45 GHz microwave ion source for ion implanters has many good properties for industrial application, such as easy maintenance and long lifetime, and it should be compact for budget and space. But, it has a dc current supply for the solenoid and a rf generator for plasma generation. Usually, they are located on high voltage platform because they are electrically connected with beam extraction power supply. Using permanent magnet solenoid and multi-layer dc break, high voltage deck and high voltage isolation transformer can be eliminated, and the dose rate on targets can be controlled by pulse duty control with semiconductor high voltage switch. Because the beam optics does not change, beam transfer components, such as focusing elements and beam shutter, can be eliminated. It has shown the good performances in budget and space for industrial applications of ion beams.
Voltage stress effects on microcircuit accelerated life test failure rates
NASA Technical Reports Server (NTRS)
Johnson, G. M.
1976-01-01
The applicability of Arrhenius and Eyring reaction rate models for describing microcircuit aging characteristics as a function of junction temperature and applied voltage was evaluated. The results of a matrix of accelerated life tests with a single metal oxide semiconductor microcircuit operated at six different combinations of temperature and voltage were used to evaluate the models. A total of 450 devices from two different lots were tested at ambient temperatures between 200 C and 250 C and applied voltages between 5 Vdc and 15 Vdc. A statistical analysis of the surface related failure data resulted in bimodal failure distributions comprising two lognormal distributions; a 'freak' distribution observed early in time, and a 'main' distribution observed later in time. The Arrhenius model was shown to provide a good description of device aging as a function of temperature at a fixed voltage. The Eyring model also appeared to provide a reasonable description of main distribution device aging as a function of temperature and voltage. Circuit diagrams are shown.
Liu, Ping; Chen, Bojun; Wang, Zhao-Wen
2014-01-01
Slo2 channels are prominent K+ channels in mammalian neurons but their physiological functions are not well understood. Here we investigate physiological functions and regulation of the C. elegans homologue SLO-2 in motor neurons through electrophysiological analyses of wild-type and mutant worms. We find that SLO-2 is the primary K+ channel conducting delayed outward current in cholinergic motor neurons, and one of two K+ channels with this function in GABAergic motor neurons. Loss-of-function mutation of slo-2 increases the duration and charge transfer rate of spontaneous postsynaptic current bursts at the neuromuscular junction, which are physiological signals used by motor neurons to control muscle cells, without altering postsynaptic receptor sensitivity. SLO-2 activity in motor neurons depends on Ca2+ entry through EGL-19, an L-type voltage-gated Ca2+ channel (CaV1), but not on other proteins implicated in either Ca2+ entry or intracellular Ca2+ release. Thus, SLO-2 is functionally coupled with CaV1 and regulates neurotransmitter release. PMID:25300429
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hacke, Peter; Spataru, Sergiu; Terwilliger, Kent
2015-06-14
An acceleration model based on the Peck equation was applied to power performance of crystalline silicon cell modules as a function of time and of temperature and humidity, the two main environmental stress factors that promote potential-induced degradation. This model was derived from module power degradation data obtained semi-continuously and statistically by in-situ dark current-voltage measurements in an environmental chamber. The modeling enables prediction of degradation rates and times as functions of temperature and humidity. Power degradation could be modeled linearly as a function of time to the second power; additionally, we found that coulombs transferred from the active cellmore » circuit to ground during the stress test is approximately linear with time. Therefore, the power loss could be linearized as a function of coulombs squared. With this result, we observed that when the module face was completely grounded with a condensed phase conductor, leakage current exceeded the anticipated corresponding degradation rate relative to the other tests performed in damp heat.« less
Task 4 completion report for 40 Kilowatt grid connected modification contract
NASA Technical Reports Server (NTRS)
Vogt, J. H.
1983-01-01
Startup, operation in grid connect mode, shutdown from grid connects, operation in isolated mode, shutdown from isolated mode, steady state operation, mode transfers, and voltage disconnects are addressed.
Transferred substrate heterojunction bipolar transistors for submillimeter wave applications
NASA Technical Reports Server (NTRS)
Fung, A.; Samoska, L.; Siegel, P.; Rodwell, M.; Urteaga, M.; Paidi, V.
2003-01-01
We present ongoing work towards the development of submillimeter wave transistors with goals of realizing advanced high frequency amplifiers, voltage controlled oscillators, active multipliers, and traditional high-speed digital circuits.
Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco
2013-01-23
Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.
Control voltage and power fluctuations when connecting wind farms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com
2015-12-23
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid.more » FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.« less
Solar bus regulator and battery charger for IMP's H, I, and J
NASA Technical Reports Server (NTRS)
Paulkovich, J.
1972-01-01
Interplanetary Monitoring Probe (IMP) spacecrafts H, I, and J utilize a direct energy transfer (DET) type of power system operating from a solar array source. A shunt type of regulator prevents the bus voltage from exceeding a preset voltage level. The power system utilizes a single differential amplifier with dual outputs to control the battery charge/shunt regulator and the discharge regulator. A two-voltage level, current limited, series charger and a current sensor control battery state of charge of the silver-cadmium battery pack. Premature termination of the battery charge is prevented by a power available gate that also initiates charge current to the battery upon availability of excess power.
High-Performance WSe2 Complementary Metal Oxide Semiconductor Technology and Integrated Circuits.
Yu, Lili; Zubair, Ahmad; Santos, Elton J G; Zhang, Xu; Lin, Yuxuan; Zhang, Yuhao; Palacios, Tomás
2015-08-12
Because of their extraordinary structural and electrical properties, two-dimensional materials are currently being pursued for applications such as thin-film transistors and integrated circuit. One of the main challenges that still needs to be overcome for these applications is the fabrication of air-stable transistors with industry-compatible complementary metal oxide semiconductor (CMOS) technology. In this work, we experimentally demonstrate a novel high performance air-stable WSe2 CMOS technology with almost ideal voltage transfer characteristic, full logic swing and high noise margin with different supply voltages. More importantly, the inverter shows large voltage gain (∼38) and small static power (picowatts), paving the way for low power electronic system in 2D materials.
Near-field radiative heat transfer between graphene-covered hyperbolic metamaterials
NASA Astrophysics Data System (ADS)
Hong, Xiao-Juan; Li, Jian-Wen; Wang, Tong-Biao; Zhang, De-Jian; Liu, Wen-Xing; Liao, Qing-Hua; Yu, Tian-Bao; Liu, Nian-Hua
2018-04-01
We propose the use of graphene-covered silicon carbide (SiC) nanowire arrays (NWAs) for theoretical studies of near-field radiative heat transfer. The SiC NWAs exhibit a hyperbolic characteristic at an appropriately selected filling-volume fraction. The surface plasmon supported by graphene and the hyperbolic modes supported by SiC NWAs significantly affect radiative heat transfer. The heat-transfer coefficient (HTC) between the proposed structures is larger than that between SiC NWAs. We also find that the chemical potential of graphene plays an important role in modulating the HTC. The tunability of chemical potential through gate voltage enables flexible control of heat transfer using the graphene-covered SiC NWAs.
NASA Technical Reports Server (NTRS)
Ferrell, S., Jr.; Lahr, N.
1970-01-01
Simulator verifies proper operation of a battery cell voltage-monitoring device. It also contains variable ac voltage to ascertain that a battery scanner will perform its function at all possible ac voltages.
Nickel-Hydrogen Battery Fault Clearing at Low State of Charge
NASA Technical Reports Server (NTRS)
Lurie, C.
1997-01-01
Fault clearing currents were achieved and maintained at discharge rates from C/2 to C/3 at high and low states of charge. The fault clearing plateau voltage is strong function of: discharge current, and voltage-prior-to-the-fault-clearing-event and a weak function of state of charge. Voltage performance, for the range of conditions reported, is summarized.
Efficiency estimation method of three-wired AC to DC line transfer
NASA Astrophysics Data System (ADS)
Solovev, S. V.; Bardanov, A. I.
2018-05-01
The development of power semiconductor converters technology expands the scope of their application to medium voltage distribution networks (6-35 kV). Particularly rectifiers and inverters of appropriate power capacity complement the topology of such voltage level networks with the DC links and lines. The article presents a coefficient that allows taking into account the increase of transmission line capacity depending on the parameters of it. The application of the coefficient is presented by the example of transfer three-wired AC line to DC in various methods. Dependences of the change in the capacity from the load power factor of the line and the reactive component of the resistance of the transmission line are obtained. Conclusions are drawn about the most efficient ways of converting a three-wired AC line to direct current.
Simulation study of a new inverse-pinch high Coulomb transfer switch
NASA Technical Reports Server (NTRS)
Choi, S. H.
1984-01-01
A simulation study of a simplified model of a high coulomb transfer switch is performed. The switch operates in an inverse pinch geometry formed by an all metal chamber, which greatly reduces hot spot formations on the electrode surfaces. Advantages of the switch over the conventional switches are longer useful life, higher current capability and lower inductance, which improves the characteristics required for a high repetition rate switch. The simulation determines the design parameters by analytical computations and comparison with the experimentally measured risetime, current handling capability, electrode damage, and hold-off voltages. The parameters of initial switch design can be determined for the anticipated switch performance. Results are in agreement with the experiment results. Although the model is simplified, the switch characteristics such as risetime, current handling capability, electrode damages, and hold-off voltages are accurately determined.
Ko, Sangwon; Hoke, Eric T; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D; Brédas, Jean-Luc; Salleo, Alberto; Bao, Zhenan
2012-03-21
Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone--due to an increase in the polymer ionization potential--while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2':5',2''-terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C(71)-butyric acid methyl ester (PC(71)BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current.
Yunoki, Takakazu; Takimoto, Koichi; Kita, Kaori; Funahashi, Yasuhito; Takahashi, Ryosuke; Matsuyoshi, Hiroko; Naito, Seiji; Yoshimura, Naoki
2014-11-15
Little is known about electrophysiological differences of A-type transient K(+) (KA) currents in nociceptive afferent neurons that innervate somatic and visceral tissues. Staining with isolectin B4 (IB4)-FITC classifies L6-S1 dorsal root ganglion (DRG) neurons into three populations with distinct staining intensities: negative to weak, moderate, and intense fluorescence signals. All IB4 intensely stained cells are negative for a fluorescent dye, Fast Blue (FB), injected into the bladder wall, whereas a fraction of somatic neurons labeled by FB, injected to the external urethral dermis, is intensely stained with IB4. In whole-cell, patch-clamp recordings, phrixotoxin 2 (PaTx2), a voltage-gated K(+) (Kv)4 channel blocker, exhibits voltage-independent inhibition of the KA current in IB4 intensely stained cells but not the one in bladder-innervating cells. The toxin also shows voltage-independent inhibition of heterologously expressed Kv4.1 current, whereas its inhibition of Kv4.2 and Kv4.3 currents is voltage dependent. The swapping of four amino acids at the carboxyl portion of the S3 region between Kv4.1 and Kv4.2 transfers this characteristic. RT-PCRs detected Kv4.1 and the long isoform of Kv4.3 mRNAs without significant Kv4.2 mRNA in L6-S1 DRGs. Kv4.1 and Kv4.3 mRNA levels were higher in laser-captured, IB4-stained neurons than in bladder afferent neurons. These results indicate that PaTx2 acts differently on channels in the Kv4 family and that Kv4.1 and possibly Kv4.3 subunits functionally participate in the formation of KA channels in a subpopulation of somatic C-fiber neurons but not in visceral C-fiber neurons innervating the bladder. Copyright © 2014 the American Physiological Society.
Yunoki, Takakazu; Takimoto, Koichi; Kita, Kaori; Funahashi, Yasuhito; Takahashi, Ryosuke; Matsuyoshi, Hiroko; Naito, Seiji
2014-01-01
Little is known about electrophysiological differences of A-type transient K+ (KA) currents in nociceptive afferent neurons that innervate somatic and visceral tissues. Staining with isolectin B4 (IB4)-FITC classifies L6-S1 dorsal root ganglion (DRG) neurons into three populations with distinct staining intensities: negative to weak, moderate, and intense fluorescence signals. All IB4 intensely stained cells are negative for a fluorescent dye, Fast Blue (FB), injected into the bladder wall, whereas a fraction of somatic neurons labeled by FB, injected to the external urethral dermis, is intensely stained with IB4. In whole-cell, patch-clamp recordings, phrixotoxin 2 (PaTx2), a voltage-gated K+ (Kv)4 channel blocker, exhibits voltage-independent inhibition of the KA current in IB4 intensely stained cells but not the one in bladder-innervating cells. The toxin also shows voltage-independent inhibition of heterologously expressed Kv4.1 current, whereas its inhibition of Kv4.2 and Kv4.3 currents is voltage dependent. The swapping of four amino acids at the carboxyl portion of the S3 region between Kv4.1 and Kv4.2 transfers this characteristic. RT-PCRs detected Kv4.1 and the long isoform of Kv4.3 mRNAs without significant Kv4.2 mRNA in L6-S1 DRGs. Kv4.1 and Kv4.3 mRNA levels were higher in laser-captured, IB4-stained neurons than in bladder afferent neurons. These results indicate that PaTx2 acts differently on channels in the Kv4 family and that Kv4.1 and possibly Kv4.3 subunits functionally participate in the formation of KA channels in a subpopulation of somatic C-fiber neurons but not in visceral C-fiber neurons innervating the bladder. PMID:25143545
Song, Yong-Ha; Ahn, Sang-Joon Kenny; Kim, Min-Wu; Lee, Jeong-Oen; Hwang, Chi-Sun; Pi, Jae-Eun; Ko, Seung-Deok; Choi, Kwang-Wook; Park, Sang-Hee Ko; Yoon, Jun-Bo
2015-03-25
A hybrid complementary logic inverter consisting of a microelectromechanical system switch as a promising alternative for the p-type oxide thin film transistor (TFT) and an n-type oxide TFT is presented for ultralow power integrated circuits. These heterogeneous microdevices are monolithically integrated. The resulting logic device shows a distinctive voltage transfer characteristic curve, very low static leakage, zero-short circuit current, and exceedingly high voltage gain. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fabrication of Porous Carbon-based Nanostructure for Energy Storage and Transfer Applications
2014-06-09
in the voltage range of 3.0 to 0.005 V (versus Li/Li+). Cyclic voltammetry (CV) was performed on a computer controlled MacPile II unit (Biological...performed at current density of 37mAg–1, voltage: 3.0-0.005V vs. Li/Li+. Cyclic voltammetry was performed at a scan rate of 58 µs/V. Red plots...pseudocapacitve storage behaviour of the electrode.19 The Li storage mechanism of both electrodes can also be studied carefully by slow scanning cyclic
Quality factor concept in piezoceramic transformer performance description.
Mezheritsky, Alex V
2006-02-01
A new general approach based on the quality factor concept to piezoceramic transformer (PT) performance description is proposed. The system's quality factor, material elastic anisotropy, and coupling factors of the input and output sections of an electrically excited and electrically loaded PT fully characterize its resonance and near-resonance behavior. The PT efficiency, transformation ratio, and input and output power were analytically analyzed and simulated as functions of the load and frequency for the simplest classical Langevin-type and Rosen-type PT designs. A new formulation of the electrical input impedance allows one to separate the power consumed by PT from the power transferred into the load. The system's PT quality factor takes into account losses in each PT "input-output-load" functional components. The loading process is changing PT input electrical impedance on the way that under loading the minimum series impedance is increasing and the maximum parallel impedance is decreasing coincidentally. The quality-factors ratio, between the states of fully loaded and nonloaded PT, is one of the best measures of PTs dynamic performance--practically, the lower the ratio is, the better PT efficiency. A simple and effective method for the loaded PT quality factor determination is proposed. As was found, a piezoceramic with low piezoelectric anisotropy is required to provide maximum PT efficiency and higher corresponding voltage gain. Limitations on the PT output voltage and power, caused by nonlinear effects in piezoceramics, were established.
Structural dynamics of the cell nucleus
Wiegert, Simon; Bading, Hilmar
2011-01-01
Neuronal morphology plays an essential role in signal processing in the brain. Individual neurons can undergo use-dependent changes in their shape and connectivity, which affects how intracellular processes are regulated and how signals are transferred from one cell to another in a neuronal network. Calcium is one of the most important intracellular second messengers regulating cellular morphologies and functions. In neurons, intracellular calcium levels are controlled by ion channels in the plasma membrane such as NMDA receptors (NMDARs), voltage-gated calcium channels (VGCCs) and certain α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) as well as by calcium exchange pathways between the cytosol and internal calcium stores including the endoplasmic reticulum and mitochondria. Synaptic activity and the subsequent opening of ligand and/or voltage-gated calcium channels can initiate cytosolic calcium transients which propagate towards the cell soma and enter the nucleus via its nuclear pore complexes (NPCs) embedded in the nuclear envelope. We recently described the discovery that in hippocampal neurons the morphology of the nucleus affects the calcium dynamics within the nucleus. Here we propose that nuclear infoldings determine whether a nucleus functions as an integrator or detector of oscillating calcium signals. We outline possible ties between nuclear mophology and transcriptional activity and discuss the importance of extending the approach to whole cell calcium signal modeling in order to understand synapse-to-nucleus communication in healthy and dysfunctional neurons. PMID:21738832
NASA Astrophysics Data System (ADS)
Emah, Joseph B.; George, Nyakno J.; Akpan, Usenobong B.
2017-08-01
The low-cost patterning of poly(3,4-ethylenedioxythiophene) poly(4-styrenesulfonate) (PEDOT:PSS) interfacial layers inserted between indium tin oxide and poly(3-hexylthiophene-2,5-diyl):[6,6]-phenyl-C61-butyric acid ester blends leads to an improvement in organic photovoltaics (OPV) device performance. Significantly, improvements in all device parameters, including the open-circuit voltage, are achieved. The nanoimprinted devices improved further as the pattern period and imprinting depth was reduced from 727 nm and 42 nm to 340 nm and 10 nm, respectively. A residue of poly(dimethylsiloxane) (PDMS) is found on the interfacial PEDOT:PSS film following patterning and can be used to explain the increase in OPV performance. Ultraviolet photoelectron spectroscopy measurements of the PEDOT:PSS interfacial layer demonstrated a reduction of the work function of 0.4 eV following nanoimprinting which may originate from chemical modification of the PDMS residue or interfacial dipole formation supported by x-ray photoelectron spectroscopy analysis. Ultimately, we have demonstrated a 39% improvement in OPV device performance via a simple low-cost modification of the anode interfacial layer. This improvement can be assigned to two effects resulting from a PDMS residue on the PEDOT:PSS surface: (1) the reduction of the anode work function which in turn decreases the hole extraction barrier, and (2) the reduction of electron transfer from the highest occupied molecular orbital of PCBM to the anode.
Creation of smart composites using an embroidery machine
NASA Astrophysics Data System (ADS)
Torii, Nobuhiro; Oka, Kosuke; Ikeda, Tadashige
2016-04-01
A smart composite with functional fibers and reinforcement fibers optimally placed with an embroidery machine was created. Fiber orientation affects mechanical properties of composite laminates significantly. Accordingly, if the fibers can be placed along a desired curved path, fiber reinforced plastic (FRP) structures can be designed more lightly and more sophisticatedly. To this end a tailored fiber placement method using the embroidery machine have been studied. To add functions to the FRP structures, shape memory alloy (SMA) wires were placed as functional fibers. First, for a certain purpose the paths of the reinforcement fibers and the SMA wires were simultaneously optimized in analysis. Next, the reinforcement fibers and tubes with the SMA wires were placed on fabrics by using the embroidery machine and this fabric was impregnated with resin by using the vacuum assisted resin transfer molding method. This smart composite was activated by applying voltage to the SMA wires. Fundamental properties of the smart composite were examined and the feasibility of the proposed creation method was shown.
NASA Astrophysics Data System (ADS)
Zhang, Jian; Li, Tingyu
2017-09-01
Solar cells sensitized by polypyridyl Ru(II) complexes exhibit relatively high efficiency, however those photo-sensitizers did not absorb the photons in the far-red and near-infrared region. At present, squaraine dyes have received considerable attention as their attractively intrinsic red light absorption and unusual high molar extinction coefficient. Here we applied density functional theory and time dependent density functional theory to investigate the properties of electronically excited states of four squaraine dyes and their complexes with fullerene C70. The influences of different functionals, basis sets and solvent effects are evaluated. To understand the photophysical properties, the investigations are basing on a classification method which splits the squaraine dyes and their complexes with fullerene C70 into two units to characterize the intramolecular density distribution. We present the signatures of their electronically excited states which are characterized as local excitation or charge-transfer excitation. The relationship between open-circuit voltage and the number of intramolecular hydrogen bonds in squaraine dyes are discussed.
Quasi-2D Liquid State at Metal-Organic Interface and Adsorption State Manipulation
NASA Astrophysics Data System (ADS)
Mehdizadeh, Masih
The metal/organic interface between noble metal close-packed (111) surfaces and organic semiconducting molecules is studied using Scanning tunneling microscopy and Photoelectron Spectroscopy, supplemented by first principles density functional theory calculations and Markov Chain Monte Carlo simulations. Copper Phthalocyanine molecules were shown to have dual adsorption states: a liquid state where intermolecular interactions were shown to be repulsive in nature and largely due to entropic effects, and a disordered immobilized state triggered by annealing or applying a tip-sample bias larger than a certain temperature or voltage respectively where intermolecular forces were demonstrated to be attractive. A methodology for altering molecular orientation on the aforementioned surfaces is also proposed through introduction of a Fullerene C60 buffer layer. Density functional theory calculations demonstrate orientation-switching of Copper Phthalocyanine molecules based on the amount of charges transferred to/from the substrate to the C60-CuPc layers; suggesting existence of critical substrate work functions that cause reorientation.
Electron transport in NH3/NO2 sensed buckled antimonene
NASA Astrophysics Data System (ADS)
Srivastava, Anurag; Khan, Md. Shahzad; Ahuja, Rajeev
2018-04-01
The structural and electronic properties of buckled antimonene have been analysed using density functional theory based ab-initio approach. Geometrical parameters in terms of bond length and bond angle are found close to the single ruffle mono-layer of rhombohedral antimony. Inter-frontier orbital analyses suggest localization of lone pair electrons at each atomic centre. Phonon dispersion along with high symmetry point of Brillouin zone does not signify any soft mode. With an electronic band gap of 1.8eV, the quasi-2D nano-surface has been further explored for NH3/NO2 molecules sensing and qualities of interaction between NH3/NO2 gas and antimonene scrutinized in terms of electronic charges transfer. A current-voltage characteristic has also been analysed, using Non Equilibrium Green's function (NEGF), for antimonene, in presence of incoming NH3/NO2 molecules.
Zhao, Hong-Quan; Kasai, Seiya; Shiratori, Yuta; Hashizume, Tamotsu
2009-06-17
A two-bit arithmetic logic unit (ALU) was successfully fabricated on a GaAs-based regular nanowire network with hexagonal topology. This fundamental building block of central processing units can be implemented on a regular nanowire network structure with simple circuit architecture based on graphical representation of logic functions using a binary decision diagram and topology control of the graph. The four-instruction ALU was designed by integrating subgraphs representing each instruction, and the circuitry was implemented by transferring the logical graph structure to a GaAs-based nanowire network formed by electron beam lithography and wet chemical etching. A path switching function was implemented in nodes by Schottky wrap gate control of nanowires. The fabricated circuit integrating 32 node devices exhibits the correct output waveforms at room temperature allowing for threshold voltage variation.
NASA Astrophysics Data System (ADS)
Itoh, Eiji; Sakai, Shota; Fukuda, Katsutoshi
2018-03-01
We studied the effects of a hole buffer layer [molybdenum oxide (MoO3) and natural copper oxide layer] and a low-temperature-processed electron buffer layer on the performance of inverted bulk-heterojunction organic solar cells in a device consisting of indium-tin oxide (ITO)/poly(ethylene imine) (PEI)/titanium oxide nanosheet (TiO-NS)/poly(3-hexylthiopnehe) (P3HT):phenyl-C61-butyric acid methylester (PCBM)/oxide/anode (Ag or Cu). The insertion of ultrathin TiO-NS (˜1 nm) and oxide hole buffer layers improved the open circuit voltage V OC, fill factor, and rectification properties owing to the effective hole blocking and electron transport properties of ultrathin TiO-NS, and to the enhanced work function difference between TiO-NS and the oxide hole buffer layer. The insertion of the TiO-NS contributed to the reduction in the potential barrier at the ITO/PEI/TiO-NS/active layer interface for electrons, and the insertion of the oxide hole buffer layer contributed to the reduction in the potential barrier for holes. The marked increase in the capacitance under positive biasing in the capacitance-voltage characteristics revealed that the combination of TiO-NS and MoO3 buffer layers contributes to the selective transport of electrons and holes, and blocks counter carriers at the active layer/oxide interface. The natural oxide layer of the copper electrode also acts as a hole buffer layer owing to the increase in the work function of the Cu surface in the inverted cells. The performance of the cell with evaporated MoO3 and Cu layers that were transfer-printed to the active layer was almost comparable to that of the cell with MoO3 and Ag layers directly evaporated onto the active layer. We also demonstrated comparable device performance in the cell with all-printed MoO3 and low-temperature-processed silver nanoparticles as an anode.
NASA Astrophysics Data System (ADS)
E, Lotfi; H, Rezania; B, Arghavaninia; M, Yarmohammadi
2016-07-01
We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength.
Splice connector with internal heat transfer jacket
Silva, Frank A.; Mayer, Robert W.
1977-01-01
A heat transfer jacket is placed over the terminal portions of the conductors of a pair of high voltage cables which are connected in a splice connection wherein a housing surrounds the connected conductor portions, the heat transfer jacket extending longitudinally between the confronting ends of a pair of adaptor sleeves placed upon the insulation of the cables to engage and locate the adaptor sleeves relative to one another, and laterally between the conductors and the housing to provide a path of relatively high thermal conductivity between the connected conductor portions and the housing.
Metal transfer and V-I transients in GMAW of aluminium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pandey, S.; Rao, U.R.K.; Aghakhani, M.
1996-12-31
The mode of metal transfer in arc welding significantly affects the positional weldability; particularly the overhead welding, the chemical composition and properties of weld metal, metallurgy of weld metal, weld pool stability, arc stability, spatter losses, and weld bead geometry. The mode of metal transfer is affected mainly by the type of the arc, welding current, electrode polarity, arc voltage, contact tube to plate distance (CTPD)/Stand-off, type and flow rate of the shielding gas, torch angle and alloying elements in GMAW of aluminium and its alloys.
Shields for protecting cables from the effects of electromagnetic noise and interference
NASA Astrophysics Data System (ADS)
Hoeft, L. O.; Hofstra, J. S.; Karaskiewicz, R. J.; Torres, B. W.
1988-12-01
The intrinsic electromagnetic property of a cable or connector shield is its surface transfer impedance. This is the ratio of the longitudinal open circuit voltage measured on one side of the shield (normally the inside) to the axial current on the other side (normally the outside). In cases where a high electric field is present at the surface of the shield, the transfer admittance or charge transfer elastance is also important. Measurements of typical cables, connectors, backshells and cable terminations are presented and explained in terms of simple models.
Morton, Russell A; Valenzuela, C Fernando
2016-02-15
Developmental ethanol exposure damages the hippocampus, a brain region involved in learning and memory. Alterations in synaptic transmission and plasticity may play a role in this effect of ethanol. We previously reported that acute and repeated exposure to ethanol during the third trimester-equivalent inhibits long-term potentiation of GABAA receptor-dependent synaptic currents in CA3 pyramidal neurons through a mechanism that depends on retrograde release of brain-derived neurotrophic factor driven by activation of voltage-gated Ca(2+) channels (Zucca and Valenzuela, 2010). We found evidence indicating that voltage-gated Ca(2+) channels are inhibited in the presence of ethanol, an effect that may play a role in its mechanism of action. Here, we further investigated the acute effect of ethanol on the function of voltage-gated Ca(2+) channels in CA3 pyramidal neurons using Ca(2+) imaging techniques. These experiments revealed that acute ethanol exposure inhibits voltage-gated Ca(2+) channels both in somatic and proximal dendritic compartments. To investigate the long-term consequences of ethanol on voltage-gated Ca(2+) channels, we used patch-clamp electrophysiological techniques to assess the function of L-type voltage-gated Ca(2+) channels during and following ten days of vapor ethanol exposure. During ethanol withdrawal periods, the function of these channels was not significantly affected by vapor chamber exposure. Taken together with our previous findings, our results suggest that 3(rd) trimester-equivalent ethanol exposure transiently inhibits L-type voltage-gated Ca(2+) channel function in CA3 pyramidal neurons and that compensatory mechanisms restore their function during ethanol withdrawal. Transient inhibition of these channels by ethanol may be, in part, responsible for the hippocampal abnormalities associated with developmental exposure to this agent. Copyright © 2015 Elsevier B.V. All rights reserved.
Du, Jian-Hua; Zeng, Yi; Pan, Leng; Zhang, Ren-Cheng
2017-01-01
The characteristics of a series direct current (DC) arc-fault including both electrical and thermal parameters were investigated based on an arc-fault simulator to provide references for multi-parameter electrical fire detection method. Tests on arc fault behavior with three different initial circuit voltages, resistances and arc gaps were conducted, respectively. The influences of circuit conditions on arc dynamic image, voltage, current or power were interpreted. Also, the temperature rises of electrode surface and ambient air were studied. The results showed that, first, significant variations of arc structure and light emitting were observed under different conditions. A thin outer burning layer of vapor generated from electrodes with orange light was found due to the extremely high arc temperature. Second, with the increasing electrode gap in discharging, the arc power was shown to have a non monotonic relationship with arc length for constant initial circuit voltage and resistance. Finally, the temperature rises of electrode surface caused by heat transfer from arc were found to be not sensitive with increasing arc length due to special heat transfer mechanism. In addition, temperature of ambient air showed a large gradient in radial direction of arc. PMID:28797055
Electric Field-aided Selective Activation for Indium-Gallium-Zinc-Oxide Thin Film Transistors.
Lee, Heesoo; Chang, Ki Soo; Tak, Young Jun; Jung, Tae Soo; Park, Jeong Woo; Kim, Won-Gi; Chung, Jusung; Jeong, Chan Bae; Kim, Hyun Jae
2016-10-11
A new technique is proposed for the activation of low temperature amorphous InGaZnO thin film transistor (a-IGZO TFT) backplanes through application of a bias voltage and annealing at 130 °C simultaneously. In this 'electrical activation', the effects of annealing under bias are selectively focused in the channel region. Therefore, electrical activation can be an effective method for lower backplane processing temperatures from 280 °C to 130 °C. Devices fabricated with this method exhibit equivalent electrical properties to those of conventionally-fabricated samples. These results are analyzed electrically and thermodynamically using infrared microthermography. Various bias voltages are applied to the gate, source, and drain electrodes while samples are annealed at 130 °C for 1 hour. Without conventional high temperature annealing or electrical activation, current-voltage curves do not show transfer characteristics. However, electrically activated a-IGZO TFTs show superior electrical characteristics, comparable to the reference TFTs annealed at 280 °C for 1 hour. This effect is a result of the lower activation energy, and efficient transfer of electrical and thermal energy to a-IGZO TFTs. With this approach, superior low-temperature a-IGZO TFTs are fabricated successfully.
Flexible piezoelectric nanogenerators based on a transferred ZnO nanorod/Si micro-pillar array
NASA Astrophysics Data System (ADS)
Baek, Seong-Ho; Park, Il-Kyu
2017-03-01
Flexible piezoelectric nanogenerators (PNGs) based on a composite of ZnO nanorods (NRs) and an array of Si micro-pillars (MPs) are demonstrated by a transfer process. The flexible composite structure was fabricated by hydrothermal growth of ZnO NRs on an electrochemically etched Si MP array with various lengths followed by mechanically delaminating the Si MP arrays from the Si substrate after embedding them in a polydimethylsiloxane matrix. Because the Si MP arrays act as a supporter to connect the ZnO NRs electrically and mechanically, verified by capacitance measurement, the output voltage from the flexible PNGs increased systematically with the increased density ZnO NRs depending on the length of the Si MPs. The flexible PNGs showed 3.2 times higher output voltage with a small change in current with increasing Si MP length from 5 to 20 μm. The enhancement of the output voltage is due to the increased number of series-connected ZnO NRs and the beneficial effect of a ZnO NR/Si MP heterojunction on reducing free charge screening effects. The flexible PNGs can be attached on fingers as a wearable electrical power source or motion sensor.
Du, Jian-Hua; Tu, Ran; Zeng, Yi; Pan, Leng; Zhang, Ren-Cheng
2017-01-01
The characteristics of a series direct current (DC) arc-fault including both electrical and thermal parameters were investigated based on an arc-fault simulator to provide references for multi-parameter electrical fire detection method. Tests on arc fault behavior with three different initial circuit voltages, resistances and arc gaps were conducted, respectively. The influences of circuit conditions on arc dynamic image, voltage, current or power were interpreted. Also, the temperature rises of electrode surface and ambient air were studied. The results showed that, first, significant variations of arc structure and light emitting were observed under different conditions. A thin outer burning layer of vapor generated from electrodes with orange light was found due to the extremely high arc temperature. Second, with the increasing electrode gap in discharging, the arc power was shown to have a non monotonic relationship with arc length for constant initial circuit voltage and resistance. Finally, the temperature rises of electrode surface caused by heat transfer from arc were found to be not sensitive with increasing arc length due to special heat transfer mechanism. In addition, temperature of ambient air showed a large gradient in radial direction of arc.
Modeling of a Metal-Ferroelectric-Semiconductor Field-Effect Transistor NAND Gate
NASA Technical Reports Server (NTRS)
Phillips, Thomas A.; MacLeod, Todd C.; Ho, Fat Duen
2005-01-01
Considerable research has been performed by several organizations in the use of the Metal- Ferroelectric-Semiconductor Field-Effect Transistors (MFSFET) in memory circuits. However, research has been limited in expanding the use of the MFSFET to other electronic circuits. This research project investigates the modeling of a NAND gate constructed from MFSFETs. The NAND gate is one of the fundamental building blocks of digital electronic circuits. The first step in forming a NAND gate is to develop an inverter circuit. The inverter circuit was modeled similar to a standard CMOS inverter. A n-channel MFSFET with positive polarization was used for the n-channel transistor, and a n-channel MFSFET with negative polarization was used for the p-channel transistor. The MFSFETs were simulated by using a previously developed current model which utilized a partitioned ferroelectric layer. The inverter voltage transfer curve was obtained over a standard input of zero to five volts. Then a 2-input NAND gate was modeled similar to the inverter circuit. Voltage transfer curves were obtained for the NAND gate for various configurations of input voltages. The resultant data shows that it is feasible to construct a NAND gate with MFSFET transistors.
DiFranco, Marino; Capote, Joana; Quiñonez, Marbella; Vergara, Julio L
2007-12-01
Two hybrid voltage-sensing systems based on fluorescence resonance energy transfer (FRET) were used to record membrane potential changes in the transverse tubular system (TTS) and surface membranes of adult mice skeletal muscle fibers. Farnesylated EGFP or ECFP (EGFP-F and ECFP-F) were used as immobile FRET donors, and either non-fluorescent (dipicrylamine [DPA]) or fluorescent (oxonol dye DiBAC(4)(5)) lipophilic anions were used as mobile energy acceptors. Flexor digitorum brevis (FDB) muscles were transfected by in vivo electroporation with pEGFP-F and pECFP-F. Farnesylated fluorescent proteins were efficiently expressed in the TTS and surface membranes. Voltage-dependent optical signals resulting from resonance energy transfer from fluorescent proteins to DPA were named QRET transients, to distinguish them from FRET transients recorded using DiBAC(4)(5). The peak DeltaF/F of QRET transients elicited by action potential stimulation is twice larger in fibers expressing ECFP-F as those with EGFP-F (7.1% vs. 3.6%). These data provide a unique experimental demonstration of the importance of the spectral overlap in FRET. The voltage sensitivity of QRET and FRET signals was demonstrated to correspond to the voltage-dependent translocation of the charged acceptors, which manifest as nonlinear components in current records. For DPA, both electrical and QRET data were predicted by radial cable model simulations in which the maximal time constant of charge translocation was 0.6 ms. FRET signals recorded in response to action potentials in fibers stained with DiBAC(4)(5) exhibit DeltaF/F amplitudes as large as 28%, but their rising phase was slower than those of QRET signals. Model simulations require a time constant for charge translocation of 1.6 ms in order to predict current and FRET data. Our results provide the basis for the potential use of lipophilic ions as tools to test for fast voltage-dependent conformational changes of membrane proteins in the TTS.
NASA Astrophysics Data System (ADS)
Sauvé, Alexandre; Montier, Ludovic
2016-12-01
Context: Bolometers are high sensitivity detector commonly used in Infrared astronomy. The HFI instrument of the Planck satellite makes extensive use of them, but after the satellite launch two electronic related problems revealed critical. First an unexpected excess response of detectors at low optical excitation frequency for ν < 1 Hz, and secondly the Analog To digital Converter (ADC) component had been insufficiently characterized on-ground. These two problems require an exquisite knowledge of detector response. However bolometers have highly nonlinear characteristics, coming from their electrical and thermal coupling making them very difficult to model. Goal: We present a method to build the analytical transfer function in frequency domain which describe the voltage response of an Alternative Current (AC) biased bolometer to optical excitation, based on the standard bolometer model. This model is built using the setup of the Planck/HFI instrument and offers the major improvement of being based on a physical model rather than the currently in use had-hoc model based on Direct Current (DC) bolometer theory. Method: The analytical transfer function expression will be presented in matrix form. For this purpose, we build linearized versions of the bolometer electro thermal equilibrium. A custom description of signals in frequency is used to solve the problem with linear algebra. The model performances is validated using time domain simulations. Results: The provided expression is suitable for calibration and data processing. It can also be used to provide constraints for fitting optical transfer function using real data from steady state electronic response and optical response. The accurate description of electronic response can also be used to improve the ADC nonlinearity correction for quickly varying optical signals.
Rezazadeh, Maryam; Yamini, Yadollah; Seidi, Shahram; Arjomandi-Behzad, Leila
2014-01-10
In the present work, the effect of application of voltage steps on extraction efficiency of pulsed electromembrane extraction (PEME) was investigated for the first time. The effects of voltage variations including initial and final voltages, number of steps between the initial and final voltages as well as their time durations were studied on the extraction efficiencies of three different classes of analytes. These classes include amitriptyline (AMI) and nortriptyline (NOR) as more hydrophobic analytes, diclofenac (DIC) and mefenamic acid (MEF) as acidic drugs and salbutamol (SB) and terbutaline (TB) as hydrophilic compounds. It was anticipated that the application of high voltages is not necessary at the beginning of the extraction, since large amounts of target analytes exist around the supported liquid membrane (SLM)/sample solution interface. So, they could be easily transferred into the acceptor phase utilizing lower voltages. Results showed that the benefits of voltage-step PEME (VS-PEME) are more obvious in systems with low electrical resistance (regarding the SLM composition). Efficiencies of VS-PEME for extraction of AMI and NOR (96% and 89% for AMI and NOR, respectively) were comparable with those achieved from applying a constant voltage (95% for AMI and 83% for NOR). However, recoveries from the VS-PEME of DIC and MEF (53% and 44% for DIC and MEF, respectively) were significantly higher than those from the application of a constant voltage (33% for DIC and 31% for MEF). Also, recoveries obtained from the VS-PEME for SB and TB were approximately 3 orders of magnitude greater than those from a constant voltage. Moreover, it was demonstrated that in all cases analytes could effectively be extracted at the beginning of extraction by applying low voltages. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Rahmawati, Sitti; Agnesstacia
2014-03-01
This research analyzes the factors that affect the work of the battery from the star fruit extract and the cactus extract. The value voltage and current generated are measure the work of the battery. Voltage measurement based on the electrode distance function, and electrode surface area. Voltage as a surface area electrode function and electrode distance function determined the current density and the voltage generated. From the experimental results obtained that the battery voltage is large enough, it is about 1.8 V for the extract of star fruit, and 1.7 V for the extract of cactus, which means that the juice extract from star fruit and the juice extract of cactus can become an alternative as battery replacement. The measurements with different electrode surface area on the star fruit and cactus extract which has the depth of the electrode 0.5 cm to 4 cm causes a decrease in the electric current generated from 12.5 mA to 1.0 mA, but obtained the same voltage.
High-voltage pulsed generator for dynamic fragmentation of rocks
NASA Astrophysics Data System (ADS)
Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
High-voltage pulsed generator for dynamic fragmentation of rocks.
Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
Medvedev, Igor G
2011-11-07
A theory of electrochemical behavior of small metal nanoparticles (NPs) which is governed both by the charging effect and the effect of the solvent reorganization on the dynamic of the electron transfer (ET) is considered under ambient conditions. The exact expression for the rate constant of ET from an electrode to NP which is valid for all values of the reorganization free energy E(r), bias voltage, and overpotential is obtained in the non-adiabatic limit. The tunnel current/overpotential relations are studied and calculated for different values of the bias voltage and E(r). The effect of E(r) on the full width at half maximum of the charging peaks is investigated at different values of the bias voltage. The differential conductance/bias voltage and the tunnel current/bias voltage dependencies are also studied and calculated. It is shown that, at room temperature, the pronounced Coulomb blockade oscillations in the differential conductance/bias voltage curves and the noticeable Coulomb staircase in the tunnel current/bias voltage relations are observed only at rather small values of E(r) in the case of the strongly asymmetric tunneling contacts.
An RF-induced voltage sensor for investigating pacemaker safety in MRI.
Barbier, Thérèse; Piumatti, Roberto; Hecker, Bertrand; Odille, Freddy; Felblinger, Jacques; Pasquier, Cédric
2014-12-01
Magnetic resonance imaging (MRI) is inadvisable for patients with pacemakers, as radiofrequency (RF) voltages induced in the pacemaker leads may cause the device to malfunction. Our goal is to develop a sensor to measure such RF-induced voltages during MRI safety tests. A sensor was designed (16.6 cm(2)) for measuring voltages at the connection between the pacemaker lead and its case. The induced voltage is demodulated, digitized, and transferred by optical fibres. The sensor was calibrated on the bench using RF pulses of known amplitude and duration. Then the sensor was tested during MRI scanning at 1.5 T in a saline gel filled phantom. Bench tests showed measurement errors below 5% with a (-40 V; +40 V) range, a precision of 0.06 V, and a temporal resolution of 24.2 μs. In MRI tests, variability in the measured voltages was below 3.7% for 996 measurements with different sensors and RF exposure. Coupling between the sensor and the MRI electromagnetic environment was estimated with a second sensor connected and was below 6.2%. For a typical clinical MRI sequence, voltages around ten Vp were detected. We have built an accurate and reproducible tool for measuring RF-induced voltages in pacemaker leads during MR safety investigations. The sensor might also be used with other conducting cables including those used for electrocardiography and neurostimulation.
Statistical characterization of voltage-biased SQUIDs with weakly damped junctions
NASA Astrophysics Data System (ADS)
Liu, Chao; Zhang, Yi; Mück, Michael; Zhang, Shulin; Krause, Hans-Joachim; Braginski, Alex I.; Zhang, Guofeng; Wang, Yongliang; Kong, Xiangyan; Xie, Xiaoming; Offenhäusser, Andreas; Jiang, Mianheng
2013-06-01
Recently, it has been shown that voltage-biased readout of SQUIDs with weakly damped junctions (large Stewart-McCumber parameter βc, due to high shunt resistance) is useful for suppression of preamplifier noise. We experimentally studied the characteristics of 53 planar niobium-SQUID magnetometers with junction shunt resistors RJ nominally of 30 Ω fabricated on 5 × 5 mm2 chips. The field-to-flux transfer coefficient ∂B/∂Φ of the magnetometers was 1.5 nT/Φ0, with a SQUID loop inductance Ls of about 350 pH. The distributions of important SQUID parameters, such as the current swing Iswing, the dynamic resistance Rd, and the flux-to-voltage transfer coefficient ∂V/∂Φ, are given. Nearly all the SQUIDs could be stably operated in the voltage bias mode and their ∂V/∂Φ reached a large mean value of 380 μV/Φ0. In this case, the SQUIDs can be read out directly by a commercial operational amplifier without any additional means to suppress preamplifier noise. The mean flux noise of the SQUIDs was found to be 4.5 μΦ0 Hz-1/2, corresponding to a field resolution of 7 fT Hz-1/2. To demonstrate the applicability of these SQUIDs in the direct readout scheme, a simple four-channel SQUID gradiometer system was set up to perform magnetocardiography and magnetoencephalography measurements in a magnetically shielded room.
Heat transfer in an evaporation-condensation system in simulated weightlessness conditions
NASA Astrophysics Data System (ADS)
Bologa, M. K.; Grosu, F. P.; Kozhevnikov, I. V.; Motorin, O. V.; Polikarpov, A. A.
2017-10-01
The process of heat transfer in an evaporation-condensation system (ECS) at circulation of dielectric liquid in a closed thermoelectrohydrodynamic (TEHD) loop consisting of an evaporator, a condenser and electrohydrodynamic (EHD) pump for pumping of heat carrier, is considered. Previously, the authors studied the dependence of heat transfer on the angle of rotation of TEHD loop in a vertical plane. The report contains the results of studies of heat transfer at electrohydrodynamic pumping of the heat carrier (8% solution of acetone in Freon 113) in the condenser area by means of EHD pump of “cone-cone” type. All elements of the ECS are arranged in a horizontal plane and the heat transfer from the heater to the condenser without EHD pumping is impossible. A pulsating heat carrier flow mode, depending on the heat input and the voltage applied to the pump, takes place at EHD pumping. As the input power is decreasing the frequency of the coolant pulsations as well as the departure diameter and number of vapour bubbles are also decreasing. At some critical heat input the pulsations disappear and the transition from turbulent mode to the laminar one takes place causing the decrease of the heat transfer coefficient. The increase of the pumping flow rate by raising the voltage applied to the EHD pump, results in a partial suppression of boiling. The maximum intensification of heat transfer is reached at pulsation frequency of 1.25 Hz. The maximum heat flow from the heater was 4.2·104 W/m2. Graphical representation and the physical interpretation of the results, which reflect the essence of the process, are given.
Oxidative Modulation of Voltage-Gated Potassium Channels
Sahoo, Nirakar; Hoshi, Toshinori
2014-01-01
Abstract Significance: Voltage-gated K+ channels are a large family of K+-selective ion channel protein complexes that open on membrane depolarization. These K+ channels are expressed in diverse tissues and their function is vital for numerous physiological processes, in particular of neurons and muscle cells. Potentially reversible oxidative regulation of voltage-gated K+ channels by reactive species such as reactive oxygen species (ROS) represents a contributing mechanism of normal cellular plasticity and may play important roles in diverse pathologies including neurodegenerative diseases. Recent Advances: Studies using various protocols of oxidative modification, site-directed mutagenesis, and structural and kinetic modeling provide a broader phenomenology and emerging mechanistic insights. Critical Issues: Physicochemical mechanisms of the functional consequences of oxidative modifications of voltage-gated K+ channels are only beginning to be revealed. In vivo documentation of oxidative modifications of specific amino-acid residues of various voltage-gated K+ channel proteins, including the target specificity issue, is largely absent. Future Directions: High-resolution chemical and proteomic analysis of ion channel proteins with respect to oxidative modification combined with ongoing studies on channel structure and function will provide a better understanding of how the function of voltage-gated K+ channels is tuned by ROS and the corresponding reducing enzymes to meet cellular needs. Antioxid. Redox Signal. 21, 933–952. PMID:24040918
Piezoelectric energy harvester interface with real-time MPPT
NASA Astrophysics Data System (ADS)
Elliott, A. D. T.; Mitcheson, P. D.
2014-11-01
Power of resonant piezoelectric harvesters can be severely limited if the damping force cannot be dynamically altered as the mechanical excitation level changes. The singlesupply pre-biasing (SSPB) technique enables the Coulomb damping force to be set by a single voltage and so by varying that voltage, real-time adaptation to variations in the mechanical force can be implemented. Similarly the conduction angle of a diode bridge rectifier circuit can be altered by changing the biasing voltage applied. This paper presents a method of achieving this by altering the amount of energy transferred from the pre-biasing capacitor used in SSPB and the diode bridge rectifier to a storage battery via a buck converter. The control system was implemented on a FPGA and consumed 50 μW.
NASA Astrophysics Data System (ADS)
Mori, Tatsuo; Miyachi, Kiyokazu; Kichimi, Tomoaki; Mizutani, Teruyoshi
1994-12-01
The organic electoluminescent diode (LED) with squarylium (Sq) dye-doped Alq3 changes color upon application of voltage (current). The luminescent color from the organic LED changes from red (electroluminescence (EL) of Sq dye) at low voltage to light green (EL of Alq3) at high voltage. We studied the EL efficiency and EL spectrum of organic Sq-doped Alq3 LED with various doping positions in the emission layer. Consequentially, it was clarified that Sq doping near TPD considerably reduced the EL efficiency. The EL mechanism of the organic LED was concluded to be associated with the energy transfer from the excited Alq3 to the guest dye and hole trapping of the guest dye in Alq3.
NASA Astrophysics Data System (ADS)
Khound, Sagarika; Sarma, Ranjit
2018-01-01
We have reported here on the design, processing and dielectric properties of pentacene-based organic thin film transitors (OTFTs) with a bilayer gate dilectrics of crosslinked PVA/Nd2O3 which enables low-voltage organic thin film operations. The dielectric characteristics of PVA/Nd2O3 bilayer films are studied by capacitance-voltage ( C- V) and current-voltage ( I- V) curves in the metal-insulator-metal (MIM) structure. We have analysed the output electrical responses and transfer characteristics of the OTFT devices to determine their performance of OTFT parameters. The mobility of 0.94 cm2/Vs, the threshold voltage of - 2.8 V, the current on-off ratio of 6.2 × 105, the subthreshold slope of 0.61 V/decade are evaluated. Low leakage current of the device is observed from current density-electric field ( J- E) curve. The structure and the morphology of the device are studied using X-ray diffraction (XRD) and atomic force microscope (AFM), respectively. The study demonstrates an effective way to realize low-voltage, high-performance OTFTs at low cost.
NASA Technical Reports Server (NTRS)
Won, C. C.
1993-01-01
This work describes a modeling and design method whereby a piezoelectric system is formulated by two sets of second-order equations, one for the mechanical system, and the other for the electrical system, coupled through the piezoelectric effect. The solution to this electromechanical coupled system gives a physical interpretation of the piezoelectric effect as a piezoelectric transformer that is a part of the piezoelectric system, which transfers the applied mechanical force into a force-controlled current source, and short circuit mechanical compliance into capacitance. It also transfers the voltage source into a voltage-controlled relative velocity input, and free motional capacitance into mechanical compliance. The formulation and interpretation simplify the modeling of smart structures and lead to physical insight that aids the designer. Due to its physical realization, the smart structural system can be unconditional stable and effectively control responses. This new concept has been demonstrated in three numerical examples for a simple piezoelectric system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Varade, Vaibhav, E-mail: vaibhav.tvarade@gmail.com; Jagtap, Amardeep M.; Koteswara Rao, K. S. R.
2015-06-07
Temperature and photo-dependent current–voltage characteristics are investigated in thin film devices of a hybrid-composite comprising of organic semiconductor poly(3,4-ethylenedioxythiophene):polystyrenesulfonate (PEDOT:PSS) and cadmium telluride quantum dots (CdTe QDs). A detailed study of the charge injection mechanism in ITO/PEDOT:PSS-CdTe QDs/Al device exhibits a transition from direct tunneling to Fowler–Nordheim tunneling with increasing electric field due to formation of high barrier at the QD interface. In addition, the hybrid-composite exhibits a huge photoluminescence quenching compared to aboriginal CdTe QDs and high increment in photoconductivity (∼ 400%), which is attributed to the charge transfer phenomena. The effective barrier height (Φ{sub B} ≈ 0.68 eV) ismore » estimated from the transition voltage and the possible origin of its variation with temperature and photo-illumination is discussed.« less
NASA Astrophysics Data System (ADS)
Wong, Man Hoi; Takeyama, Akinori; Makino, Takahiro; Ohshima, Takeshi; Sasaki, Kohei; Kuramata, Akito; Yamakoshi, Shigenobu; Higashiwaki, Masataka
2018-01-01
The effects of ionizing radiation on β-Ga2O3 metal-oxide-semiconductor field-effect transistors (MOSFETs) were investigated. A gamma-ray tolerance as high as 1.6 MGy(SiO2) was demonstrated for the bulk Ga2O3 channel by virtue of weak radiation effects on the MOSFETs' output current and threshold voltage. The MOSFETs remained functional with insignificant hysteresis in their transfer characteristics after exposure to the maximum cumulative dose. Despite the intrinsic radiation hardness of Ga2O3, radiation-induced gate leakage and drain current dispersion ascribed respectively to dielectric damage and interface charge trapping were found to limit the overall radiation hardness of these devices.
NASA Astrophysics Data System (ADS)
Wang, Xue-yan; Bao, Jun; Li, Lu; Cui, Shao-li; Du, Xiao-qing
2017-10-01
The flexible electrodes based on CVD-graphene/ AgNWs hybrid transparent films were prepared by the vacuum filtration and substrate transferring method, and several performances of the films including sheet resistance, optical transmittance, work function, surface roughness and flexibility were further researched. The results suggested that the hybrid films which were obtained by vacuum filtration and substrate transferring method have the advantages such as uniform distribution of AgNWs, high work function, low roughness and small sheet resistance and good flexibility. The sheet resistance of the hybrid films would decrease with the increasing of the concentration of AgNWs, while the surface roughness would increase and the optical transmittance at 550nm of the films decrease linearly. Organic light emitting devices (OLED) devices based on CVD-graphene/AgNWs hybrid films were fabricated, and characteristics of voltage-current density, luminance, current efficiency were tested. It's found that CVD-graphene/AgNWs hybrid films were better than CVD-graphene films when they were used as anodes for organic light emitting devices. It can be seen that CVD-graphene/AgNWs hybrid transparent films have great potential in applications of flexible electrodes, and are of great significance for promoting the development of organic light emitting devices.
Fingerprinted circuits and methods of making and identifying the same
NASA Technical Reports Server (NTRS)
Ferguson, Michael Ian (Inventor)
2011-01-01
A circuit having a fingerprint for identification of a particular instantiation of the circuit is disclosed. The circuit may include a plurality of digital circuits or gates. Each of the digital circuits or gates is responsive to a configuration voltage applied to its analog input for controlling whether or not the digital circuit or gate performs its intended digital function and each of the digital circuits or gates transitioning between its functional state and its at least one other state when the configuration voltage equals a boundary voltage. The boundary voltage varies between different instantiations of the circuit for a majority of the digital circuits or gates and these differing boundary voltages serving to identify (or fingerprint) different instantiations of the same circuit.
Fingerprinted circuits and methods of making and identifying the same
NASA Technical Reports Server (NTRS)
Ferguson, Michael Ian (Inventor)
2012-01-01
A circuit having a fingerprint for identification of a particular instantiation of the circuit is disclosed. The circuit may include a plurality of digital circuits or gates. Each of the digital circuits or gates is responsive to a configuration voltage applied to its analog input for controlling whether or not the digital circuit or gate performs its intended digital function and each of the digital circuits or gates transitioning between its functional state and its at least one other state when the configuration voltage equals a boundary voltage. The boundary voltage varies between different instantiations of the circuit for a majority of the digital circuits or gates and these differing boundary voltages serving to identify (or fingerprint) different instantiations of the same circuit.
Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.
Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin
2013-08-06
Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.
Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.
Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C
2018-05-07
Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.
Enhanced Response Time of Electrowetting Lenses with Shaped Input Voltage Functions.
Supekar, Omkar D; Zohrabi, Mo; Gopinath, Juliet T; Bright, Victor M
2017-05-16
Adaptive optical lenses based on the electrowetting principle are being rapidly implemented in many applications, such as microscopy, remote sensing, displays, and optical communication. To characterize the response of these electrowetting lenses, the dependence upon direct current (DC) driving voltage functions was investigated in a low-viscosity liquid system. Cylindrical lenses with inner diameters of 2.45 and 3.95 mm were used to characterize the dynamic behavior of the liquids under DC voltage electrowetting actuation. With the increase of the rise time of the input exponential driving voltage, the originally underdamped system response can be damped, enabling a smooth response from the lens. We experimentally determined the optimal rise times for the fastest response from the lenses. We have also performed numerical simulations of the lens actuation with input exponential driving voltage to understand the variation in the dynamics of the liquid-liquid interface with various input rise times. We further enhanced the response time of the devices by shaping the input voltage function with multiple exponential rise times. For the 3.95 mm inner diameter lens, we achieved a response time improvement of 29% when compared to the fastest response obtained using single-exponential driving voltage. The technique shows great promise for applications that require fast response times.
NASA Technical Reports Server (NTRS)
Yang, Eui-Hyeok; Shcheglov, Kirill
2002-01-01
Future concepts of ultra large space telescopes include segmented silicon mirrors and inflatable polymer mirrors. Primary mirrors for these systems cannot meet optical surface figure requirements and are likely to generate over several microns of wavefront errors. In order to correct for these large wavefront errors, high stroke optical quality deformable mirrors are required. JPL has recently developed a new technology for transferring an entire wafer-level mirror membrane from one substrate to another. A thin membrane, 100 mm in diameter, has been successfully transferred without using adhesives or polymers. The measured peak-to-valley surface error of a transferred and patterned membrane (1 mm x 1 mm x 0.016 mm) is only 9 nm. The mirror element actuation principle is based on a piezoelectric unimorph. A voltage applied to the piezoelectric layer induces stress in the longitudinal direction causing the film to deform and pull on the mirror connected to it. The advantage of this approach is that the small longitudinal strains obtainable from a piezoelectric material at modest voltages are thus translated into large vertical displacements. Modeling is performed for a unimorph membrane consisting of clamped rectangular membrane with a PZT layer with variable dimensions. The membrane transfer technology is combined with the piezoelectric bimorph actuator concept to constitute a compact deformable mirror device with a large stroke actuation of a continuous mirror membrane, resulting in a compact A0 systems for use in ultra large space telescopes.
Ha, Phuc Thi; Moon, Hyunsoo; Kim, Byung Hong; Ng, How Yong; Chang, In Seop
2010-03-15
An alternative method for determining the charge transfer resistance and double-layer capacitance of microbial fuel cells (MFCs), easily implemented without a potentiostat, was developed. A dynamic model with two parameters, the charge transfer resistance and double-layer capacitance of electrodes, was derived from a linear differential equation to depict the current generation with respect to activation overvoltage. This model was then used to fit the transient cell voltage response to the current step change during the continuous operation of a flat-plate type MFC fed with acetate. Variations of the charge transfer resistance and the capacitance value with respect to the MFC design conditions (biocatalyst existence and electrode area) and operating parameters (acetate concentration and buffer strength in the catholyte) were then determined to elucidate the validity of the proposed method. This model was able to describe the dynamic behavior of the MFC during current change in the activation loss region; having an R(2) value of over 0.99 in most tests. Variations of the charge transfer resistance value (thousands of Omega) according to the change of the design factors and operational factors were well-correlated with the corresponding MFC performances. However, though the capacitance values (approximately 0.02 F) reflected the expected trend according to the electrode area change and catalyst property, they did not show significant variation with changes in either the acetate concentration or buffer strength. (c) 2009 Elsevier B.V. All rights reserved.
Robust low-bias negative differential resistance in graphene superlattices
NASA Astrophysics Data System (ADS)
Sattari-Esfahlan, S. M.; Fouladi-Oskuei, J.; Shojaei, S.
2017-06-01
In this work, we present a detailed theoretical study on the low bias current-voltage (I-V) characteristic of biased planar graphene superlattice (PGSL), provided by a heterostructured substrate and a series of grounded metallic planes placed over a graphene sheet, which induce a periodically modulated Dirac gap and Fermi velocity barrier, respectively. We investigate the effect of PGSL parameters on the I-V characteristic and the appearance of multipeak negative differential resistance (NDR) in the proposed device within the Landauer-Buttiker formalism and adopted transfer matrix method. Moreover‚ we propose a novel venue to control the NDR in PGSL with Fermi velocity barrier. Different regimes of NDR have been recognized, based on the PGSL parameters and external bias. From this viewpoint‚ we obtain multipeak NDR through miniband aligning in PGSL. The maximum pick to valley ratio (PVR) up to 167 obtained for ~{{\\upsilon}c} , the Fermi velocity correlation (ratio of Fermi velocity in barrier and well region), is 1.9 at bias voltages between 70-130 mV. Our findings have good agreement with experiments and can be considered in designing multi-valued memory‚ functional circuit, low power and high-speed nanoelectronic device applications.
An Autonomous Satellite Time Synchronization System Using Remotely Disciplined VC-OCXOs
Gu, Xiaobo; Chang, Qing; Glennon, Eamonn P.; Xu, Baoda; Dempseter, Andrew G.; Wang, Dun; Wu, Jiapeng
2015-01-01
An autonomous remote clock control system is proposed to provide time synchronization and frequency syntonization for satellite to satellite or ground to satellite time transfer, with the system comprising on-board voltage controlled oven controlled crystal oscillators (VC-OCXOs) that are disciplined to a remote master atomic clock or oscillator. The synchronization loop aims to provide autonomous operation over extended periods, be widely applicable to a variety of scenarios and robust. A new architecture comprising the use of frequency division duplex (FDD), synchronous time division (STDD) duplex and code division multiple access (CDMA) with a centralized topology is employed. This new design utilizes dual one-way ranging methods to precisely measure the clock error, adopts least square (LS) methods to predict the clock error and employs a third-order phase lock loop (PLL) to generate the voltage control signal. A general functional model for this system is proposed and the error sources and delays that affect the time synchronization are discussed. Related algorithms for estimating and correcting these errors are also proposed. The performance of the proposed system is simulated and guidance for selecting the clock is provided. PMID:26213929
Yachnev, Igor L; Plakhova, Vera B; Podzorova, Svetlana A; Shelykh, Tatiana N; Rogachevsky, Ilya V; Krylov, Boris V
2012-01-01
Effects of infrared (IR) radiation generated by a low-power CO2-laser on the membrane of cultured dissociated nociceptive neurons of newborn rat spinal ganglia were investigated using the whole-cell patch-clamp method. Low-power IR radiation diminished the voltage sensitivity of activation gating machinery of slow sodium channels (Na(v)1.8). Ouabain known to block both transducer and pumping functions of Na+,K+-ATPase eliminated IR irradiation effects. The molecular mechanism of interaction of CO2-laser radiation with sensory membrane was proposed. The primary event of this interaction is the process of energy absorption by ATP molecules. The transfer of vibrational energy from Na+,K+- ATPase-bound and vibrationally excited ATP molecules to Na+,K+-ATPase activates this enzyme and converts it into a signal transducer. This effect leads to a decrease in the voltage sensitivity of Na(v)1.8 channels. The effect of IR-radiation was elucidated by the combined application of a very sensitive patch-clamp method and an optical facility with a controlled CO2-laser. As a result, the mechanism of interaction of non-thermal low-power IR radiation with the nociceptive neuron membrane is suggested.
Lee, Seok-Yong; Banerjee, Anirban; MacKinnon, Roderick
2009-03-03
Voltage-dependent K(+) (Kv) channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors), which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
NASA Astrophysics Data System (ADS)
Wu, H.; Zhou, L.; Xu, T.; Fang, W. L.; He, W. G.; Liu, H. M.
2017-11-01
In order to improve the situation of voltage violation caused by the grid-connection of photovoltaic (PV) system in a distribution network, a bi-level programming model is proposed for battery energy storage system (BESS) deployment. The objective function of inner level programming is to minimize voltage violation, with the power of PV and BESS as the variables. The objective function of outer level programming is to minimize the comprehensive function originated from inner layer programming and all the BESS operating parameters, with the capacity and rated power of BESS as the variables. The differential evolution (DE) algorithm is applied to solve the model. Based on distribution network operation scenarios with photovoltaic generation under multiple alternative output modes, the simulation results of IEEE 33-bus system prove that the deployment strategy of BESS proposed in this paper is well adapted to voltage violation regulation invariable distribution network operation scenarios. It contributes to regulating voltage violation in distribution network, as well as to improve the utilization of PV systems.
Upsets in Erased Floating Gate Cells With High-Energy Protons
Gerardin, S.; Bagatin, M.; Paccagnella, A.; ...
2017-01-01
We discuss upsets in erased floating gate cells, due to large threshold voltage shifts, using statistical distributions collected on a large number of memory cells. The spread in the neutral threshold voltage appears to be too low to quantitatively explain the experimental observations in terms of simple charge loss, at least in SLC devices. The possibility that memories exposed to high energy protons and heavy ions exhibit negative charge transfer between programmed and erased cells is investigated, although the analysis does not provide conclusive support to this hypothesis.
Analysis of the instability underlying electrostatic suppression of the Leidenfrost state
NASA Astrophysics Data System (ADS)
Shahriari, Arjang; Das, Soumik; Bahadur, Vaibhav; Bonnecaze, Roger T.
2017-03-01
A liquid droplet on a hot solid can generate enough vapor to prevent its contact on the surface and reduce the rate of heat transfer, the so-called Leidenfrost effect. We show theoretically and experimentally that for a sufficiently high electrostatic potential on the droplet, the formation of the vapor layer is suppressed. The interplay of the destabilizing electrostatic force and stabilizing capillary force and evaporation determines the minimum or threshold voltage to suppress the Leidenfrost effect. Linear stability theory accurately predicts threshold voltages for different size droplets and varying temperatures.
Improving Ionic Conductivity and Lithium-Ion Transference Number in Lithium-Ion Battery Separators.
Zahn, Raphael; Lagadec, Marie Francine; Hess, Michael; Wood, Vanessa
2016-12-07
The microstructure of lithium-ion battery separators plays an important role in separator performance; however, here we show that a geometrical analysis falls short in predicting the lithium-ion transport in the electrolyte-filled pore space. By systematically modifying the surface chemistry of a commercial polyethylene separator while keeping its microstructure unchanged, we demonstrate that surface chemistry, which alters separator-electrolyte interactions, influences ionic conductivity and lithium-ion transference number. Changes in separator surface chemistry, particularly those that increase lithium-ion transference numbers can reduce voltage drops across the separator and improve C-rate capability.
Charge-Transfer-Induced p-Type Channel in MoS2 Flake Field Effect Transistors.
Min, Sung-Wook; Yoon, Minho; Yang, Sung Jin; Ko, Kyeong Rok; Im, Seongil
2018-01-31
The two-dimensional transition-metal dichalcogenide semiconductor MoS 2 has received extensive attention for decades because of its outstanding electrical and mechanical properties for next-generation devices. One weakness of MoS 2 , however, is that it shows only n-type conduction, revealing its limitations for homogeneous PN diodes and complementary inverters. Here, we introduce a charge-transfer method to modify the conduction property of MoS 2 from n- to p-type. We initially deposited an n-type InGaZnO (IGZO) film on top of the MoS 2 flake so that electron charges might be transferred from MoS 2 to IGZO during air ambient annealing. As a result, electron charges were depleted in MoS 2 . Such charge depletion lowered the MoS 2 Fermi level, which makes hole conduction favorable in MoS 2 when optimum source/drain electrodes with a high work function are selected. Our IGZO-supported MoS 2 flake field effect transistors (FETs) clearly display channel-type conversion from n- to p-channel in this way. Under short- and long-annealing conditions, n- and p-channel MoS 2 FETs are achieved, respectively, and a low-voltage complementary inverter is demonstrated using both channels in a single MoS 2 flake.
A model for heat and mass input control in GMAW
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smartt, H.B.; Einerson, C.J.
1993-05-01
This work describes derivation of a control model for electrode melting and heat and mass transfer from the electrode to the work piece in gas metal arc welding (GMAW). Specifically, a model is developed which allows electrode speed and welding speed to be calculated for given values of voltage and torch-to-base metal distance, as a function of the desired heat and mass input to the weldment. Heat input is given on a per unit weld length basis, and mass input is given in terms of transverse cross-sectional area added to the weld bead (termed reinforcement). The relationship to prior workmore » is discussed. The model was demonstrated using a computer-controlled welding machine and a proportional-integral (PI) controller receiving input from a digital filter. The difference between model-calculated welding current and measured current is used as controller feedback. The model is calibrated for use with carbon steel welding wire and base plate with Ar-CO[sub 2] shielding gas. Although the system is intended for application during spray transfer of molten metal from the electrode to the weld pool, satisfactory performance is also achieved during globular and streaming transfer. Data are presented showing steady-state and transient performance, as well as resistance to external disturbances.« less
Resonant Spin-Transfer-Torque Nano-Oscillators
NASA Astrophysics Data System (ADS)
Sharma, Abhishek; Tulapurkar, Ashwin A.; Muralidharan, Bhaskaran
2017-12-01
Spin-transfer-torque nano-oscillators are potential candidates for replacing the traditional inductor-based voltage-controlled oscillators in modern communication devices. Typical oscillator designs are based on trilayer magnetic tunnel junctions, which have the disadvantages of low power outputs and poor conversion efficiencies. We theoretically propose using resonant spin filtering in pentalayer magnetic tunnel junctions as a possible route to alleviate these issues and present viable device designs geared toward a high microwave output power and an efficient conversion of the dc input power. We attribute these robust qualities to the resulting nontrivial spin-current profiles and the ultrahigh tunnel magnetoresistance, both of which arise from resonant spin filtering. The device designs are based on the nonequilibrium Green's-function spin-transport formalism self-consistently coupled with the stochastic Landau-Lifshitz-Gilbert-Slonczewski equation and Poisson's equation. We demonstrate that the proposed structures facilitate oscillator designs featuring a large enhancement in microwave power of around 1150% and an efficiency enhancement of over 1100% compared to typical trilayer designs. We rationalize the optimum operating regions via an analysis of the dynamic and static device resistances. We also demonstrate the robustness of our structures against device design fluctuations and elastic dephasing. This work sets the stage for pentalyer spin-transfer-torque nano-oscillator device designs that ameliorate major issues associated with typical trilayer designs.
Electrodialytic matrix isolation for metal cations.
Ohira, Shin-Ichi; Hiroyama, Yuri; Nakamura, Koretaka; Koda, Takumi; Dasgupta, Purnendu K; Toda, Kei
2015-01-01
Electrodialytic ion transfer was studied as a matrix isolation tool for heavy metal determinations. An ion transfer device (ITD) was used for the transfer of heavy metal cations. Under optimized flow rates applied voltage and receptor composition, heavy metal ions were quantitatively transferred at concentrations spanning µg L(-1) to mg L(-1). As long as the sample pH was acidic, there was no significant sample pH effect on the transfer efficiencies. Significant salt concentrations (>1 mM NaCl), however, decreased the transfer efficiency. This could be ameliorated (up to 5 mM NaCl) by transient instead of continuous sample introduction. The device was applied to the determination of Fe, Cu and Zn in equine and bovine serum; the reproducibility was better than conventional digestion method. Copyright © 2014 Elsevier B.V. All rights reserved.
Lee, Chi-Yuan; Chan, Pin-Cheng; Lee, Chung-Ju
2010-01-01
Temperature, voltage and fuel flow distribution all contribute considerably to fuel cell performance. Conventional methods cannot accurately determine parameter changes inside a fuel cell. This investigation developed flexible and multi-functional micro sensors on a 40 μm-thick stainless steel foil substrate by using micro-electro-mechanical systems (MEMS) and embedded them in a proton exchange membrane fuel cell (PEMFC) to measure the temperature, voltage and flow. Users can monitor and control in situ the temperature, voltage and fuel flow distribution in the cell. Thereby, both fuel cell performance and lifetime can be increased.
Qiu, Jingjing; Hajibabaei, Hamed; Nellist, Michael R.; ...
2017-08-17
Electrocatalysts improve the efficiency of light-absorbing semiconductor photoanodes driving the oxygen evolution reaction, but the precise function(s) of the electrocatalysts remains unclear. We directly measure, for the first time, the interface carrier transport properties of a prototypical visible-light-absorbing semiconductor, α-Fe 2O 3, in contact with one of the fastest known water oxidation catalysts, Ni 0.8Fe 0.2O x, by directly measuring/controlling the current and/or voltage at the Ni 0.8Fe 0.2O x catalyst layer using a second working electrode. The measurements demonstrate that the majority of photogenerated holes in α-Fe 2O 3 directly transfer to the catalyst film over a wide rangemore » of conditions and that the Ni 0.8Fe 0.2O x is oxidized by photoholes to an operating potential sufficient to drive water oxidation at rates that match the photocurrent generated by the α-Fe 2O 3. The Ni 0.8Fe 0.2O x therefore acts as both a hole-collecting contact and a catalyst for the photoelectrochemical water oxidation process. Separate measurements show that the illuminated junction photovoltage across the α-Fe 2O 3|Ni 0.8Fe 0.2O x interface is significantly decreased by the oxidation of Ni 2+ to Ni 3+ and the associated increase in the Ni 0.8Fe 0.2O x electrical conductivity. Finally, in sum, the results illustrate the underlying operative charge-transfer and photovoltage generation mechanisms of catalyzed photoelectrodes, thus guiding their continued improvement.« less
NASA Astrophysics Data System (ADS)
Liu, Wei; He, Jianhong; Guo, Huazhong; Gao, Jie
2018-04-01
We report experiments on the dynamic response of an interacting mesoscopic capacitor consisting of a quantum dot with two confined spin-split levels of the lowest Landau level. In high magnetic fields, states inside the dot are regulated by a mixture of Coulomb interaction and Landau-level quantization, and electrons distribute on two spatially separated regions. Quantum point contact voltage and magnetic field are employed to manipulate the number and distribution of electrons inside the quantum dot. We find that the periodicity of the electrochemical capacitance oscillations is dominated by the charging energy, and their amplitudes, due to internal charge transfer and strong internal capacitive coupling, show rich variations of modulations. Magnetocapacitance displays a sawtoothlike manner and may differ in tooth directions for different voltages, which, we demonstrate, result from a sawtoothlike electrochemical potential change induced by internal charge transfer and field-sensitive electrostatic potential. We further build a charge stability diagram, which, together with all other capacitance properties, is consistently interpreted in terms of a double-dot model. The demonstrated technique is of interest as a tool for fast and sensitive charge state readout of a double-quantum-dot qubit in the gigahertz frequency quantum electronics.
A Theoretical Investigation of the Charge Transfer System TCNQ-F4 and Alpha-Sexithiophene
NASA Astrophysics Data System (ADS)
Braun, Kai-Felix
2005-03-01
The electronic and geometrical structures of the charge-transfer system of alpha-sexihiophene and tetrafluorotetracyanoquinodimethane are calculated self-consistently from first principles. By means of density functional theory (DFT) methods several configurations of the free molecules are calculated within LDA and B3LYP employing a plane wave basis and different atomic orbital sets. The combined system exhibits preferential binding of the center of the TCNQ-F4 on top of a c-c bond of the sexithiophene, thereby the central configuration having the lowest energy. As opposed to the periodic arrangement in a crystal of the related system dimethylquaterthiophene and TCNQ-F4, the free system exhibits a strong interaction going along with a substantial polarization of both molecules. For comparison with scanning tunneling spectroscopy results, the molecules were adsorbed in a parallel geometry on a Au(111) slab. To take into account the voltage applied to the STM tip the system was finally calculated within an electric field. This work is financially supported by the US-DOE grant no. DE-FG02-02ER46012.
Liu, Yanpeng; Jung, Eun; Wang, Yu; Zheng, Yi; Park, Eun Ji; Cho, Sung Min; Loh, Kian Ping
2014-03-12
An air-stable transparent conductive film with "quasi-freestanding" graphene supported on horizontal single walled carbon nanotubes (SWCNTs) arrays is fabricated. The sheet resistance of graphene films stacked via layer-by-layer transfer (LBL) on quartz, and modified by 1-Pyrenebutyric acid N-hydroxysuccinimide ester (PBASE), is reduced from 273 Ω/sq to about 76 Ω/sq. The electrical properties are stable to heat treatment (up to 200 ºC) and ambient exposure. Organic light-emitting diodes (OLEDs) constructed of this carbon anode (T ≈ 89.13% at 550 nm) exhibit ≈88% power efficiency of OLEDs fabricated on an ITO anode (low turn on voltage ≈3.1 eV, high luminance up to ≈29 490 cd/m(2) , current efficiency ≈14.7 cd/A). Most importantly, the entire graphene-on-SWCNT hybrid electrodes can be transferred onto plastic (PET) forming a highly-flexible OLED device, which continues to function without degradation in performance at bending angles >60°. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Exciton size and binding energy limitations in one-dimensional organic materials.
Kraner, S; Scholz, R; Plasser, F; Koerner, C; Leo, K
2015-12-28
In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent density functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.
Koryta, I; Kozlov, Iu N; Gofmanova, A; Khalil, V; Vanysek, P
1983-11-01
A new electroanalytical method of voltamperometry at the interface of two immiscible electrolyte solutions (ITIES) is based on electrochemical polarization of a liquid/liquid interface. The resulting current voltage characteristics completely resemble those obtained with metallic electrodes. The charge transfer processes are either the direct ion transfer across the ITIES or the transfer facilitated by macrocyclic ionophores. Determination of tetracycline antibiotics is based on the direct transfer of the cationic forms of these substances in acid media. Determination of valinomycin, nonactin and monensin acting as ion carriers is connected with the facilitated alkali metal ion transfer. In general, antibiotic concentrations higher than 0.02-0.05 mmol/l can be determined with this method. Monensin can also be determined in the extracts of Streptomyces cinnamonensis.
NASA Astrophysics Data System (ADS)
Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui; Liu, Qinghui; Tan, Mingrui; Zhou, Qiang; Zhang, Hanzhuang
2016-12-01
The role of ZnS shell on the photo-physical properties within CuInS2/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS2 and CuInS2/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.
Nakagawa, Hiroyuki; Kitagawa, Shinya; Araki, Shuki; Ohtani, Hajime
2006-02-01
Several alkyl benzenes are separated by pressurized flow-driven capillary electrochromatography using a temperature-controlled capillary column packed with octadecyl siloxane-modified silica gel, and the effect of applied voltage on the retention is investigated. The van't Hoff plot shows good linearity at the column temperature between 305 and 330 K under applications from -6 to +6 kV. The applied voltage causes a relatively large variation in the enthalpy and the entropy of transfer of the solute from the mobile phase to the stationary phase (> 20%). However, the direction of variation in the enthalpy is almost opposite to that in the entropy, both of which might compensate each other. Therefore, the retention factor is not significantly varied (< 4%) by the application of voltage.
Electric Field-aided Selective Activation for Indium-Gallium-Zinc-Oxide Thin Film Transistors
NASA Astrophysics Data System (ADS)
Lee, Heesoo; Chang, Ki Soo; Tak, Young Jun; Jung, Tae Soo; Park, Jeong Woo; Kim, Won-Gi; Chung, Jusung; Jeong, Chan Bae; Kim, Hyun Jae
2016-10-01
A new technique is proposed for the activation of low temperature amorphous InGaZnO thin film transistor (a-IGZO TFT) backplanes through application of a bias voltage and annealing at 130 °C simultaneously. In this ‘electrical activation’, the effects of annealing under bias are selectively focused in the channel region. Therefore, electrical activation can be an effective method for lower backplane processing temperatures from 280 °C to 130 °C. Devices fabricated with this method exhibit equivalent electrical properties to those of conventionally-fabricated samples. These results are analyzed electrically and thermodynamically using infrared microthermography. Various bias voltages are applied to the gate, source, and drain electrodes while samples are annealed at 130 °C for 1 hour. Without conventional high temperature annealing or electrical activation, current-voltage curves do not show transfer characteristics. However, electrically activated a-IGZO TFTs show superior electrical characteristics, comparable to the reference TFTs annealed at 280 °C for 1 hour. This effect is a result of the lower activation energy, and efficient transfer of electrical and thermal energy to a-IGZO TFTs. With this approach, superior low-temperature a-IGZO TFTs are fabricated successfully.
Electric Field-aided Selective Activation for Indium-Gallium-Zinc-Oxide Thin Film Transistors
Lee, Heesoo; Chang, Ki Soo; Tak, Young Jun; Jung, Tae Soo; Park, Jeong Woo; Kim, Won-Gi; Chung, Jusung; Jeong, Chan Bae; Kim, Hyun Jae
2016-01-01
A new technique is proposed for the activation of low temperature amorphous InGaZnO thin film transistor (a-IGZO TFT) backplanes through application of a bias voltage and annealing at 130 °C simultaneously. In this ‘electrical activation’, the effects of annealing under bias are selectively focused in the channel region. Therefore, electrical activation can be an effective method for lower backplane processing temperatures from 280 °C to 130 °C. Devices fabricated with this method exhibit equivalent electrical properties to those of conventionally-fabricated samples. These results are analyzed electrically and thermodynamically using infrared microthermography. Various bias voltages are applied to the gate, source, and drain electrodes while samples are annealed at 130 °C for 1 hour. Without conventional high temperature annealing or electrical activation, current-voltage curves do not show transfer characteristics. However, electrically activated a-IGZO TFTs show superior electrical characteristics, comparable to the reference TFTs annealed at 280 °C for 1 hour. This effect is a result of the lower activation energy, and efficient transfer of electrical and thermal energy to a-IGZO TFTs. With this approach, superior low-temperature a-IGZO TFTs are fabricated successfully. PMID:27725695
NASA Astrophysics Data System (ADS)
Sun, Xu; Gu, Yousong; Wang, Xueqiang
2012-08-01
One dimensional ZnO NWs with different diameters and lengths have been investigated using density functional theory (DFT) and Maximally Localized Wannier Functions (MLWFs). It is found that ZnO NWs are direct band gap semiconductors and there exist a turn on voltage for observable current. ZnO nanowires with different diameters and lengths show distinctive turn-on voltage thresholds in I-V characteristics curves. The diameters of ZnO NWs are greatly influent the transport properties of ZnO NWs. For the ZnO NW with large diameter that has more states and higher transmission coefficients leads to narrow band gap and low turn on voltage. In the case of thinner diameters, the length of ZnO NW can effects the electron tunneling and longer supercell lead to higher turn on voltage.
Developing Fast Fluorescent Protein Voltage Sensors by Optimizing FRET Interactions
Sung, Uhna; Sepehri-Rad, Masoud; Piao, Hong Hua; Jin, Lei; Hughes, Thomas; Cohen, Lawrence B.; Baker, Bradley J.
2015-01-01
FRET (Förster Resonance Energy Transfer)-based protein voltage sensors can be useful for monitoring neuronal activity in vivo because the ratio of signals between the donor and acceptor pair reduces common sources of noise such as heart beat artifacts. We improved the performance of FRET based genetically encoded Fluorescent Protein (FP) voltage sensors by optimizing the location of donor and acceptor FPs flanking the voltage sensitive domain of the Ciona intestinalis voltage sensitive phosphatase. First, we created 39 different “Nabi1” constructs by positioning the donor FP, UKG, at 8 different locations downstream of the voltage-sensing domain and the acceptor FP, mKO, at 6 positions upstream. Several of these combinations resulted in large voltage dependent signals and relatively fast kinetics. Nabi1 probes responded with signal size up to 11% ΔF/F for a 100 mV depolarization and fast response time constants both for signal activation (~2 ms) and signal decay (~3 ms). We improved expression in neuronal cells by replacing the mKO and UKG FRET pair with Clover (donor FP) and mRuby2 (acceptor FP) to create Nabi2 probes. Nabi2 probes also had large signals and relatively fast time constants in HEK293 cells. In primary neuronal culture, a Nabi2 probe was able to differentiate individual action potentials at 45 Hz. PMID:26587834
Method for exciting inductive-resistive loads with high and controllable direct current
Hill, Jr., Homer M.
1976-01-01
Apparatus and method for transmitting dc power to a load circuit by applying a dc voltage from a standard waveform synthesizer to duration modulate a bipolar rectangular wave generator. As the amplitude of the dc voltage increases, the widths of the rectangular wave generator output pulses increase, and as the amplitude of the dc voltage decreases, the widths of the rectangular wave generator output pulses decrease. Thus, the waveform synthesizer selectively changes the durations of the rectangular wave generator bipolar output pulses so as to produce a rectangular wave ac carrier that is duration modulated in accordance with and in direct proportion to the voltage amplitude from the synthesizer. Thereupon, by transferring the carrier to the load circuit through an amplifier and a rectifier, the load current also corresponds directly to the voltage amplitude from the synthesizer. To this end, the rectified wave at less than 100% duty factor, amounts to a doubled frequency direct voltage pulse train for applying a direct current to the load, while the current ripple is minimized by a high L/R in the load circuit. In one embodiment, a power transmitting power amplifier means having a dc power supply is matched to the load circuit through a transformer for current magnification without sacrificing load current duration capability, while negative voltage and current feedback are provided in order to insure good output fidelity.
Tunable negative differential resistance in planar graphene superlattice resonant tunneling diode
NASA Astrophysics Data System (ADS)
Sattari-Esfahlan, S. M.; Fouladi-Oskuei, J.; Shojaei, S.
2017-04-01
Here, we study the negative differential resistance (NDR) of Dirac electrons in biased planar graphene superlattice (PGSL) and investigate the transport characteristics by adopted transfer matrix method within Landauer-Buttiker formalism. Our model device is based on one-dimensional Kronig-Penney type electrostatic potential in monolayer graphene deposited on a substrate, where the bias voltage is applied by two electrodes in the left and right. At Low bias voltages, we found that NDR appears due to breaking of minibands to Wannier-Stark ladders (WSLs). At the critical bias voltage, delocalization appeared by WS states leads to tunneling peak current in current-voltage (I-V) characteristics. With increasing bias voltage, crossing of rungs from various WSL results in multi-peak NDR. The results demonstrate that the structure parameters like barrier/well thickness and barrier height have remarkable effect on I-V characteristics of PGSL. In addition, Dirac gap enhances peak to valley (PVR) value due to suppressing Klein tunneling. Our results show that the tunable PVR in PGSL resonant tunneling diode can be achievable by structure parameters engineering. NDR at ultra-low bias voltages, such as 100 mV, with giant PVR of 20 is obtained. In our device, the multiple same NDR peaks with ultra-low bias voltage provide promising prospect for multi-valued memories and the low power nanoelectronic tunneling devices.
Fuel Cell/Electrochemical Cell Voltage Monitor
NASA Technical Reports Server (NTRS)
Vasquez, Arturo
2012-01-01
A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.
NASA Astrophysics Data System (ADS)
Shah, Jyoti; Ahmad, Saood; Chaujar, Rishu; Puri, Nitin K.; Negi, P. S.; Kotnala, R. K.
2017-12-01
In our recent studies inverse spin Hall voltage (ISHE) was investigated by ferromagnetic resonance (FMR) using bilayer FeSi3%/Pt thin film prepared by pulsed laser deposition (PLD) technique. In ISHE measurement microwave signal was applied on FeSi3% film along with DC magnetic field. Higher magnetization value along the film-plane was measured by magnetic hysteresis (M-H) loop. Presence of magnetic anisotropy has been obtained by M-H loop which showed easy direction of magnetization when applied magnetic field is parallel to the film plane. The main result of this study is that FMR induced inverse spin Hall voltage 12.6 μV at 1.0 GHz was obtained across Pt layer. Magnetic exchange field at bilayer interface responsible for field torque was measured 6 × 1014 Ω-1 m-2 by spin Hall magnetoresistance. The damping torque and spin Hall angle have been evaluated as 0.084 and 0.071 respectively. Presence of Si atom in FeSi3% inhomogenize the magnetic exchange field among accumulated spins at bilayer interface and feebly influenced by spin torque of FeSi3% layer. Weak field torque suppresses the spin pumping to Pt layer thus low value of inverse spin Hall voltage is obtained. This study provides an excellent opportunity to investigate spin transfer torque effect, thus motivating a more intensive experimental effort for its utilization at maximum potential. The improvement in spin transfer torque may be useful in spin valve, spin battery and spin transistor application.
Queisser, Gillian; Wiegert, Simon; Bading, Hilmar
2011-01-01
Neuronal morphology plays an essential role in signal processing in the brain. Individual neurons can undergo use-dependent changes in their shape and connectivity, which affects how intracellular processes are regulated and how signals are transferred from one cell to another in a neuronal network. Calcium is one of the most important intracellular second messengers regulating cellular morphologies and functions. In neurons, intracellular calcium levels are controlled by ion channels in the plasma membrane such as NMDA receptors (NMDARs), voltage-gated calcium channels (VGCCs) and certain α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) as well as by calcium exchange pathways between the cytosol and internal calcium stores including the endoplasmic reticulum and mitochondria. Synaptic activity and the subsequent opening of ligand and/or voltage-gated calcium channels can initiate cytosolic calcium transients which propagate towards the cell soma and enter the nucleus via its nuclear pore complexes (NPCs) embedded in the nuclear envelope. We recently described the discovery that in hippocampal neurons the morphology of the nucleus affects the calcium dynamics within the nucleus. Here we propose that nuclear infoldings determine whether a nucleus functions as an integrator or detector of oscillating calcium signals. We outline possible ties between nuclear mophology and transcriptional activity and discuss the importance of extending the approach to whole cell calcium signal modeling in order to understand synapse-to-nucleus communication in healthy and dysfunctional neurons.
Redox regulation of neuronal voltage-gated calcium channels.
Todorovic, Slobodan M; Jevtovic-Todorovic, Vesna
2014-08-20
Voltage-gated calcium channels are ubiquitously expressed in neurons and are key regulators of cellular excitability and synaptic transmitter release. There is accumulating evidence that multiple subtypes of voltage-gated calcium channels may be regulated by oxidation and reduction. However, the redox mechanisms involved in the regulation of channel function are not well understood. Several studies have established that both T-type and high-voltage-activated subtypes of voltage-gated calcium channel can be redox-regulated. This article reviews different mechanisms that can be involved in redox regulation of calcium channel function and their implication in neuronal function, particularly in pain pathways and thalamic oscillation. A current critical issue in the field is to decipher precise mechanisms of calcium channel modulation via redox reactions. In this review we discuss covalent post-translational modification via oxidation of cysteine molecules and chelation of trace metals, and reactions involving nitric oxide-related molecules and free radicals. Improved understanding of the roles of redox-based reactions in regulation of voltage-gated calcium channels may lead to improved understanding of novel redox mechanisms in physiological and pathological processes. Identification of redox mechanisms and sites on voltage-gated calcium channel may allow development of novel and specific ion channel therapies for unmet medical needs. Thus, it may be possible to regulate the redox state of these channels in treatment of pathological process such as epilepsy and neuropathic pain.
Burr, Melvin J.
1990-01-30
An arc voltage simulator for an arc welder permits the welder response to a variation in arc voltage to be standardized. The simulator uses a linear potentiometer connected to the electrode to provide a simulated arc voltage at the electrode that changes as a function of electrode position.
Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.
Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco
2013-11-01
Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.
NASA Astrophysics Data System (ADS)
Uda, M. N. A.; Hasfalina, C. M.; Samsuzana, A. A.; Faridah, S.; Rafidah A., R.; Hashim, U.; Ariffin, Shahrul A. B.; Gopinath, Subash C. B.
2017-03-01
Cucumber Mosaic Virus (CMV) is a most dangerous pathogen among the cucurbit plant which it striking cucumbers, zucchinis, squashes, watermelons but it also striking to non-cucurbit such as peppers, tobaccos, celeries, beans and tomatoes. Symptoms shown by this virus when they starting to strike are very significant and at the end can kill the hosts they infected. In order to detect these viruses, biosensor such as screen-printed carbon electrode (SPCE) is developed and fixes a set potential voltage is defined using Chronoamperometry (CM) immunosensor technique. For short introduction, CM is a process which is a constant applied potential voltage between the working and reference electrode is maintained in order to create an electrons transfer for the oxidation or reduction species taking place at the surface of working electrode is measured and in this manuscript, complete details about measurement were used to finding the stable set potential voltages will be pointed out.
Component technology for space power systems
NASA Technical Reports Server (NTRS)
Finke, R. C.
1982-01-01
Progress made by NASA toward implementation of equipment for the conversion, management, and distribution of voltage power in space applications are reviewed. Work has been carried forward on components such as bipolar transistors, deep impurity semiconductors, conductors, dielectrics, magnetic devices, and rotary power transfer. Specific programs for the high voltage systems have included research on lightweight, low-cost conductors featuring graphite fibers containing electron donor materials for wires and cables with reduced mass and the conductivity of copper. Attention has also been given p-n junction technology for high-speed, high-current, high-voltage materials and diamond-like dielectric films which are hard, have high dielectric strength, and can operate up to 300 C. A transistor has been fabricated with a voltage of 1200 V at 100 A, with a gain of 10 and a 0.5 microsec rise/fall time. A 25 kW transformer has also been built which performs at 20 kHz with an efficiency of 99.2%.
Performance characteristics of nanocrystalline diamond vacuum field emission transistor array
NASA Astrophysics Data System (ADS)
Hsu, S. H.; Kang, W. P.; Davidson, J. L.; Huang, J. H.; Kerns, D. V.
2012-06-01
Nitrogen-incorporated nanocrystalline diamond (ND) vacuum field emission transistor (VFET) with self-aligned gate is fabricated by mold transfer microfabrication technique in conjunction with chemical vapor deposition (CVD) of nanocrystalline diamond on emitter cavity patterned on silicon-on-insulator (SOI) substrate. The fabricated ND-VFET demonstrates gate-controlled emission current with good signal amplification characteristics. The dc characteristics of the ND-VFET show well-defined cutoff, linear, and saturation regions with low gate turn-on voltage, high anode current, negligible gate intercepted current, and large dc voltage gain. The ac performance of the ND-VFET is measured, and the experimental data are analyzed using a modified small signal circuit model. The experimental results obtained for the ac voltage gain are found to agree with the theoretical model. A higher ac voltage gain is attainable by using a better test setup to eliminate the associated parasitic capacitances. The paper reveals the amplifier characteristics of the ND-VFET for potential applications in vacuum microelectronics.
Performance characteristics of nanocrystalline diamond vacuum field emission transistor array
NASA Astrophysics Data System (ADS)
Hsu, S. H.; Kang, W. P.; Davidson, J. L.; Huang, J. H.; Kerns, D. V.
2012-05-01
Nitrogen-incorporated nanocrystalline diamond (ND) vacuum field emission transistor (VFET) with self-aligned gate is fabricated by mold transfer microfabrication technique in conjunction with chemical vapor deposition (CVD) of nanocrystalline diamond on emitter cavity patterned on silicon-on-insulator (SOI) substrate. The fabricated ND-VFET demonstrates gate-controlled emission current with good signal amplification characteristics. The dc characteristics of the ND-VFET show well-defined cutoff, linear, and saturation regions with low gate turn-on voltage, high anode current, negligible gate intercepted current, and large dc voltage gain. The ac performance of the ND-VFET is measured, and the experimental data are analyzed using a modified small signal circuit model. The experimental results obtained for the ac voltage gain are found to agree with the theoretical model. A higher ac voltage gain is attainable by using a better test setup to eliminate the associated parasitic capacitances. The paper reveals the amplifier characteristics of the ND-VFET for potential applications in vacuum microelectronics.
Mechanisms of pyrethroid insecticide-induced stimulation of calcium influx in neocortical neurons
Pyrethroid insecticides bind to voltage-gated sodium channels (VGSCs) and modify their gating kinetics, thereby disrupting neuronal function. Pyrethroids have also been reported to alter the function of other channel types, including activation of voltage-gated Ca2+ calcium chann...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-28
... Maintenance; Protection and Control; and Voltage and Reactive AGENCY: Federal Energy Regulatory Commission..., Connections, and Maintenance; Protection and Control; and Voltage and Reactive, Notice of Proposed Rulemaking... regional definitions for Functionally Equivalent Protection System, Functionally Equivalent Remedial Action...
NASA Astrophysics Data System (ADS)
Luo, Li-Chuan; Bao, De-Chun; Yu, Wu-Qi; Zhang, Zhao-Hua; Ren, Tian-Ling
2016-01-01
It is meaningful to research the Triboelectric Nanogenerators (TENG), which can create electricity anywhere and anytime. There are many researches on the structures and materials of TENG to explain the phenomenon that the maximum voltage is stable and the current is increasing. The output voltage of the TENG is high about 180-400 V, and the output current is small about 39 μA, which the electronic devices directly integration of TENG with Li-ion batteries will result in huge energy loss due to the ultrahigh TENG impedance. A novel interface circuit with the high-voltage buck regulator for TENG is introduced firstly in this paper. The interface circuit can transfer the output signal of the TENG into the signal fit to a lithium ion battery. Through the circuit of the buck regulator, the average output voltage is about 4.0 V and the average output current is about 1.12 mA. Further, the reliability and availability for the lithium ion battery and the circuit are discussed. The interface circuit is simulated using the Cadence software and verified through PCB experiment. The buck regulator can achieve 75% efficiency for the High-Voltage TENG. This will lead to a research hot and industrialization applications.
A Photostable Silicon Rhodamine Platform for Optical Voltage Sensing
Huang, Yi-Lin; Walker, Alison S.; Miller, Evan W.
2015-01-01
This paper describes the design and synthesis of a photostable, far-red to near-infrared (NIR) platform for optical voltage sensing. We developed a new, sulfonated silicon rhodamine fluorophore and integrated it with a phenylenevinylene molecular wire to create a Berkeley Red Sensor of Transmembrane potential, or BeRST 1 (“burst”). BeRST 1 is the first member of a class of farred to NIR voltage sensitive dyes that make use of a photoinduced electron transfer (PeT) trigger for optical interrogation of membrane voltage. We show that BeRST 1 displays bright, membrane-localized fluorescence in living cells, high photostability, and excellent voltage sensitivity in neurons. Depolarization of the plasma membrane results in rapid fluorescence increases (24% ΔF/F per 100 mV). BeRST 1 can be used in conjunction with fluorescent stains for organelles, Ca2+ indicators, and voltage-sensitive fluorescent proteins. In addition, the red-shifted spectral profile of BeRST 1, relative to commonly employed optogenetic actuators like ChannelRhodopsin2 (ChR2), which require blue light, enables optical electrophysiology in neurons. The high speed, sensitivity, photostability and long-wavelength fluorescence profiles of BeRST 1 make it a useful platform for the non-invasive, optical dissection of neuronal activity. PMID:26237573
Huie, Matthew M; DiLeo, Roberta A; Marschilok, Amy C; Takeuchi, Kenneth J; Takeuchi, Esther S
2015-06-10
Batteries are multicomponent systems where the theoretical voltage and stoichiometric electron transfer are defined by the electrochemically active anode and cathode materials. While the electrolyte may not be considered in stoichiometric electron-transfer calculations, it can be a critical factor determining the deliverable energy content of a battery, depending also on the use conditions. The development of ionic liquid (IL)-based electrolytes has been a research area of recent reports by other researchers, due, in part, to opportunities for an expanded high-voltage operating window and improved safety through the reduction of flammable solvent content. The study reported here encompasses a systematic investigation of the physical properties of IL-based hybrid electrolytes including quantitative characterization of the electrolyte-separator interface via contact-angle measurements. An inverse trend in the conductivity and wetting properties was observed for a series of IL-based electrolyte candidates. Test-cell measurements were undertaken to evaluate the electrolyte performance in the presence of functioning anode and cathode materials, where several promising IL-based hybrid electrolytes with performance comparable to that of conventional carbonate electrolytes were identified. The study revealed that the contact angle influenced the performance more significantly than the conductivity because the cells containing IL-tetrafluoroborate-based electrolytes with higher conductivity but poorer wetting showed significantly decreased performance relative to the cells containing IL-bis(trifluoromethanesulfonyl)imide electrolytes with lower conductivity but improved wetting properties. This work contributes to the development of new IL battery-based electrolyte systems with the potential to improve the deliverable energy content as well as safety of lithium-ion battery systems.
NASA Astrophysics Data System (ADS)
Wiedenmann, Jonas; Liebhaber, Eva; Kübert, Johannes; Bocquillon, Erwann; Burset, Pablo; Ames, Christopher; Buhmann, Hartmut; Klapwijk, Teun M.; Molenkamp, Laurens W.
2017-10-01
The proximity-induced superconducting state in the three-dimensional topological insulator HgTe has been studied using electronic transport of a normal metal-superconducting point contact as a spectroscopic tool (Andreev point-contact spectroscopy). By analyzing the conductance as a function of voltage for various temperatures, magnetic fields, and gate voltages, we find evidence, in equilibrium, for an induced order parameter in HgTe of 70 µeV and a niobium order parameter of 1.1 meV. To understand the full conductance curve as a function of applied voltage we suggest a non-equilibrium-driven transformation of the quantum transport process where the relevant scattering region and equilibrium reservoirs change with voltage. This change implies that the spectroscopy probes the superconducting correlations at different positions in the sample, depending on the bias voltage.
Voltage control in pulsed system by predict-ahead control
Payne, Anthony N.; Watson, James A.; Sampayan, Stephen E.
1994-01-01
A method and apparatus for predict-ahead pulse-to-pulse voltage control in a pulsed power supply system is disclosed. A DC power supply network is coupled to a resonant charging network via a first switch. The resonant charging network is coupled at a node to a storage capacitor. An output load is coupled to the storage capacitor via a second switch. A de-Q-ing network is coupled to the resonant charging network via a third switch. The trigger for the third switch is a derived function of the initial voltage of the power supply network, the initial voltage of the storage capacitor, and the present voltage of the storage capacitor. A first trigger closes the first switch and charges the capacitor. The third trigger is asserted according to the derived function to close the third switch. When the third switch is closed, the first switch opens and voltage on the node is regulated. The second trigger may be thereafter asserted to discharge the capacitor into the output load.
Voltage control in pulsed system by predict-ahead control
Payne, A.N.; Watson, J.A.; Sampayan, S.E.
1994-09-13
A method and apparatus for predict-ahead pulse-to-pulse voltage control in a pulsed power supply system is disclosed. A DC power supply network is coupled to a resonant charging network via a first switch. The resonant charging network is coupled at a node to a storage capacitor. An output load is coupled to the storage capacitor via a second switch. A de-Q-ing network is coupled to the resonant charging network via a third switch. The trigger for the third switch is a derived function of the initial voltage of the power supply network, the initial voltage of the storage capacitor, and the present voltage of the storage capacitor. A first trigger closes the first switch and charges the capacitor. The third trigger is asserted according to the derived function to close the third switch. When the third switch is closed, the first switch opens and voltage on the node is regulated. The second trigger may be thereafter asserted to discharge the capacitor into the output load. 4 figs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
López-Téllez, J. M., E-mail: jmlopez@comunidad.unam.mx; Bruce, N. C.
2014-03-15
We present a method for using liquid-crystal variable retarders (LCVR’s) with continually varying voltage to measure the Stokes vector of a light beam. The LCVR's are usually employed with fixed retardance values due to the nonlinear voltage-retardance behavior that they show. The nonlinear voltage-retardance relationship is first measured and then a linear fit of the known retardance terms to the detected signal is performed. We use known waveplates (half-wave and quarter-wave) as devices to provide controlled polarization states to the Stokes polarimeter and we use the measured Stokes parameters as functions of the orientation of the axes of the waveplatesmore » as an indication of the quality of the polarimeter. Results are compared to a Fourier analysis method that does not take into account the nonlinear voltage-retardance relationship and also to a Fourier analysis method that uses experimental voltage values to give a linear retardance function with time. Also, we present results of simulations for comparison.« less
Lee, Chi-Yuan; Chan, Pin-Cheng; Lee, Chung-Ju
2010-01-01
Temperature, voltage and fuel flow distribution all contribute considerably to fuel cell performance. Conventional methods cannot accurately determine parameter changes inside a fuel cell. This investigation developed flexible and multi-functional micro sensors on a 40 μm-thick stainless steel foil substrate by using micro-electro-mechanical systems (MEMS) and embedded them in a proton exchange membrane fuel cell (PEMFC) to measure the temperature, voltage and flow. Users can monitor and control in situ the temperature, voltage and fuel flow distribution in the cell. Thereby, both fuel cell performance and lifetime can be increased. PMID:22163545
ERIC Educational Resources Information Center
Poitras, Adrian W., Ed.
1973-01-01
The following items are discussed: Digital Counters and Readout Devices, Automatic Burette Outfits, Noise Exposure System, Helium-Cadmium Laser, New pH Buffers and Flip-Top Dispenser, Voltage Calibrator Transfer Standard, Photomicrographic Stereo Zoom Microscope, Portable pH Meter, Micromanipulators, The Snuffer, Electronic Top-Loading Balances,…
Threading the biophysics of mammalian Slo1 channels onto structures of an invertebrate Slo1 channel
2017-01-01
For those interested in the machinery of ion channel gating, the Ca2+ and voltage-activated BK K+ channel provides a compelling topic for investigation, by virtue of its dual allosteric regulation by both voltage and intracellular Ca2+ and because its large-single channel conductance facilitates detailed kinetic analysis. Over the years, biophysical analyses have illuminated details of the allosteric regulation of BK channels and revealed insights into the mechanism of BK gating, e.g., inner cavity size and accessibility and voltage sensor-pore coupling. Now the publication of two structures of an Aplysia californica BK channel—one liganded and one metal free—promises to reinvigorate functional studies and interpretation of biophysical results. The new structures confirm some of the previous functional inferences but also suggest new perspectives regarding cooperativity between Ca2+-binding sites and the relationship between voltage- and Ca2+-dependent gating. Here we consider the extent to which the two structures explain previous functional data on pore-domain properties, voltage-sensor motions, and divalent cation binding and activation of the channel. PMID:29025867
Metabolism and transfer of choline in hamster small intestine
Flower, R. J.; Pollitt, R. J.; Sanford, P. A.; Smyth, D. H.
1972-01-01
1. The transfer and metabolism of choline was studied with sacs of everted intestine of hamster. 2. Approximately half the choline transferred from the mucosal fluid may be metabolized. High voltage electrophoresis, paper chromatography and ion exchange chromatography have been used to identify this meta bolite as betaine. 3. The concentration of choline and betaine together accumulating in the gut wall and serosal fluid are greater than that of choline present initially in the mucosal fluid indicating some kind of specific mechanism for choline transport. 4. A detailed analysis of choline transfer suggests that the movement of choline cannot be accounted for by simple diffusion. The concentration of choline accumulating in the gut wall and serosal fluid, the inhibitory effects of hemicholinium-3 and α-methylglucoside on choline transfer, and the insensitivity of betaine transfer to hemicholinium-3 suggest a specific active transport process for choline independent of active betaine transport. PMID:5085340
Microgrid Restraining Strategy Based on Improved DC Grid Connected DFIG Torque Ripple
NASA Astrophysics Data System (ADS)
Fei, Xia; Yang, Zhixiong; Zongze, Xia
2017-05-01
Aiming to the voltage of the stator side is generated by the modulation of the SSC in the improved topology, especially under the circumstance with the asymmTeric fault of stator side, DFIG’s electromagnTeic torque, amplifies ripple of grid-connected power for the grid side. The novel control mTehod suitable to stator side converter and rotor side converter based on reduced-order resonant controller (RORC) is proposed in this thesis, DFIG’s torque and output power performance are improved. Under the RORC control conditions the transfer functions of stator current and torque control system are established, the amplitude characteristic and the system stability of RORC control are analysed. The simulation results in Matlab/Simulink verify the correctness and validity of the proposed mTehod.
Design and test hardware for a solar array switching unit
NASA Technical Reports Server (NTRS)
Patil, A. R.; Cho, B. H.; Sable, D.; Lee, F. C.
1992-01-01
This paper describes the control of a pulse width modulated (PWM) type sequential shunt switching unit (SSU) for spacecraft applications. It is found that the solar cell output capacitance has a significant impact on SSU design. Shorting of this cell capacitance by the PWM switch causes input current surges. These surges are minimized by the use of a series filter inductor. The system with a filter is analyzed for ripple and the control to output-voltage transfer function. Stable closed loop design considerations are discussed. The results are supported by modeling and measurements of loop gain and of closed-loop bus impedance on test hardware for NASA's 120 V Earth Observation System (EOS). The analysis and modeling are also applicable to NASA's 160 V Space Station power system.
NASA Astrophysics Data System (ADS)
Nasser Eddine, Achraf; Huard, Benoît; Gabano, Jean-Denis; Poinot, Thierry
2018-06-01
This paper deals with the initialization of a non linear identification algorithm used to accurately estimate the physical parameters of Lithium-ion battery. A Randles electric equivalent circuit is used to describe the internal impedance of the battery. The diffusion phenomenon related to this modeling is presented using a fractional order method. The battery model is thus reformulated into a transfer function which can be identified through Levenberg-Marquardt algorithm to ensure the algorithm's convergence to the physical parameters. An initialization method is proposed in this paper by taking into account previously acquired information about the static and dynamic system behavior. The method is validated using noisy voltage response, while precision of the final identification results is evaluated using Monte-Carlo method.
Nonlinear piezoelectric devices for broadband air-flow energy harvesting
NASA Astrophysics Data System (ADS)
Bai, Y.; Havránek, Z.; Tofel, P.; Meggs, C.; Hughes, H.; Button, T. W.
2015-11-01
This paper presents preliminary work on an investigation of a nonlinear air-flow energy harvester integrating magnets and a piezoelectric cantilever array. Two individual piezoelectric cantilevers with the structure of free-standing multi-layer thick-films have been fabricated and assembled with a free-spinning fan. The cantilevers were attached with different tip masses thereby achieving separated resonant frequencies. Also, permanent magnets were fixed onto the blades of the fan as well as the tips of the cantilevers, in order to create nonlinear coupling and transfer fluidic movement into mechanical oscillation. The device has been tested in a wind tunnel. Bifurcations in the spectra of the blade rotation speed of the fan as a function of output voltage have been observed, and a bandwidth (blade rotation speed range) widening effect has been achieved.
A study of the transmission characteristics of suppressor nozzles
NASA Technical Reports Server (NTRS)
Ahuja, K. K.; Salikuddin, M.; Burrin, R. H.; Plumbee, H. E., Jr.
1980-01-01
The internal noise radiation characteristics for a single stream 12 lobe 24 tube suppressor nozzle, and for a dual stream 36 chute suppressor nozzle were investigated. An equivalent single round conical nozzle and an equivalent coannular nozzle system were also tested to provide a reference for the two suppressors. The technique utilized a high voltage spark discharge as a noise source within the test duct which permitted separation of the incident, reflected and transmitted signals in the time domain. These signals were then Fourier transformed to obtain the nozzle transmission coefficient and the power transfer function. These transmission parameters for the 12 lobe, 24 tube suppressor nozzle and the reference conical nozzle are presented as a function of jet Mach number, duct Mach number polar angle and temperature. Effects of simulated forward flight are also considered for this nozzle. For the dual stream, 36 chute suppressor, the transmission parameters are presented as a function of velocity ratios and temperature ratios. Possible data for the equivalent coaxial nozzle is also presented. Jet noise suppression by these nozzles is also discussed.
Phosphatidic acid modulation of Kv channel voltage sensor function.
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-10-06
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid.
Improving Advanced Inverter Control Convergence in Distribution Power Flow
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nagarajan, Adarsh; Palmintier, Bryan; Ding, Fei
Simulation of modern distribution system powerflow increasingly requires capturing the impact of advanced PV inverter voltage regulation on powerflow. With Volt/var control, the inverter adjusts its reactive power flow as a function of the point of common coupling (PCC) voltage. Similarly, Volt/watt control curtails active power production as a function of PCC voltage. However, with larger systems and higher penetrations of PV, this active/reactive power flow itself can cause significant changes to the PCC voltage potentially introducing oscillations that slow the convergence of system simulations. Improper treatment of these advanced inverter functions could potentially lead to incorrect results. This papermore » explores a simple approach to speed such convergence by blending in the previous iteration's reactive power estimate to dampen these oscillations. Results with a single large (5MW) PV system and with multiple 500kW advanced inverters show dramatic improvements using this approach.« less
Han, Su-Ting; Zhou, Ye; Yang, Qing Dan; Zhou, Li; Huang, Long-Biao; Yan, Yan; Lee, Chun-Sing; Roy, Vellaisamy A L
2014-02-25
Tunable memory characteristics are used in multioperational mode circuits where memory cells with various functionalities are needed in one combined device. It is always a challenge to obtain control over threshold voltage for multimode operation. On this regard, we use a strategy of shifting the work function of reduced graphene oxide (rGO) in a controlled manner through doping gold chloride (AuCl3) and obtained a gradient increase of rGO work function. By inserting doped rGO as floating gate, a controlled threshold voltage (Vth) shift has been achieved in both p- and n-type low voltage flexible memory devices with large memory window (up to 4 times for p-type and 8 times for n-type memory devices) in comparison with pristine rGO floating gate memory devices. By proper energy band engineering, we demonstrated a flexible floating gate memory device with larger memory window and controlled threshold voltage shifts.
High-performance blue phosphorescent OLEDs using energy transfer from exciplex.
Seino, Yuki; Sasabe, Hisahiro; Pu, Yong-Jin; Kido, Junji
2014-03-12
An efficient energy transfer from an exciplex between a sulfone and an arylamine derivatives to a blue phosphorescent emitter enables OLED performances among the best, of over 50 lm W(-1) at 100 cd m(-2) . The formation of the exciplex realizes a barrier-free hole-electron recombination pathway, thereby leading to high OLED performances with an extremely low driving voltage of 2.9 V at 100 cd m(-2) . © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Electric power processing, distribution, management and energy storage
NASA Astrophysics Data System (ADS)
Giudici, R. J.
1980-07-01
Power distribution subsystems are required for three elements of the SPS program: (1) orbiting satellite, (2) ground rectenna, and (3) Electric Orbiting Transfer Vehicle (EOTV). Power distribution subsystems receive electrical power from the energy conversion subsystem and provide the power busses rotary power transfer devices, switchgear, power processing, energy storage, and power management required to deliver control, high voltage plasma interactions, electric thruster interactions, and spacecraft charging of the SPS and the EOTV are also included as part of the power distribution subsystem design.
Electric power processing, distribution, management and energy storage
NASA Technical Reports Server (NTRS)
Giudici, R. J.
1980-01-01
Power distribution subsystems are required for three elements of the SPS program: (1) orbiting satellite, (2) ground rectenna, and (3) Electric Orbiting Transfer Vehicle (EOTV). Power distribution subsystems receive electrical power from the energy conversion subsystem and provide the power busses rotary power transfer devices, switchgear, power processing, energy storage, and power management required to deliver control, high voltage plasma interactions, electric thruster interactions, and spacecraft charging of the SPS and the EOTV are also included as part of the power distribution subsystem design.
Graphene fixed-end beam arrays based on mechanical exfoliation
NASA Astrophysics Data System (ADS)
Li, Peng; You, Zheng; Haugstad, Greg; Cui, Tianhong
2011-06-01
A low-cost mechanical exfoliation method is presented to transfer graphite to graphene for free-standing beam arrays. Nickel film or photoresist is used to peel off and transfer patterned single-layer or multilayer graphene onto substrates with macroscopic continuity. Free-standing graphene beam arrays are fabricated on both silicon and polymer substrates. Their mechanical properties are studied by atomic force microscopy. Finally, a graphene based radio frequency switch is demonstrated, with its pull-in voltage and graphene-silicon junction investigated.
Efficient transformer for electromagnetic waves
Miller, R.B.
A transformer structure for efficient transfer of electromagnetic energy from a transmission line to an unmatched load provides voltage multiplication and current division by a predetermined constant. Impedance levels are transformed by the square of that constant. The structure includes a wave splitter, connected to an input transmission device and to a plurality of output transmission devices. The output transmission devices are effectively connected in parallel to the input transmission device. The output transmission devices are effectively series connected to provide energy to a load. The transformer structure is particularly effective in increasing efficiency of energy transfer through an inverting convolute structure by capturing and transferring energy losses from the inverter to the load.
Fully synthetic taped insulation cables
Forsyth, E.B.; Muller, A.C.
1983-07-15
The present invention is a cable which, although constructed from inexpensive polyolefin tapes and using typical impregnating oils, furnishes high voltage capability up to 765 kV, and has such excellent dielectric characteristics and heat transfer properties that it is capable of operation at capacities equal to or higher than presently available cables at a given voltage. This is accomplished by using polyethylene, polybutene or polypropylene insulating tape which has been specially processed to attain properties which are not generally found in these materials, but are required for their use in impregnated electrical cables. Chief among these properties is compatibility with impregnating oil.
Electron tunnelling through single azurin molecules can be on/off switched by voltage pulses
NASA Astrophysics Data System (ADS)
Baldacchini, Chiara; Kumar, Vivek; Bizzarri, Anna Rita; Cannistraro, Salvatore
2015-05-01
Redox metalloproteins are emerging as promising candidates for future bio-optoelectronic and nano-biomemory devices, and the control of their electron transfer properties through external signals is still a crucial task. Here, we show that a reversible on/off switching of the electron current tunnelling through a single protein can be achieved in azurin protein molecules adsorbed on gold surfaces, by applying appropriate voltage pulses through a scanning tunnelling microscope tip. The observed changes in the hybrid system tunnelling properties are discussed in terms of long-sustained charging of the protein milieu.
Hybrid circuit achieves pulse regeneration with low power drain
NASA Technical Reports Server (NTRS)
Cancro, C. A.
1965-01-01
Hybrid tunnel diode-transistor circuit provides a solid-state, low power drain pulse regenerator, frequency limiter, or gated oscillator. When the feedback voltage exceeds the input voltage, the circuit functions as a pulse normalizer or a frequency limiter. If the circuit is direct coupled, it functions as a gated oscillator.
Spin-Dependent Processes Measured without a Permanent Magnet.
Fontanesi, Claudio; Capua, Eyal; Paltiel, Yossi; Waldeck, David H; Naaman, Ron
2018-05-07
A novel Hall circuit design that can be incorporated into a working electrode, which is used to probe spin-selective charge transfer and charge displacement processes, is reviewed herein. The general design of a Hall circuit based on a semiconductor heterostructure, which forms a shallow 2D electron gas and is used as an electrode, is described. Three different types of spin-selective processes have been studied with this device in the past: i) photoinduced charge exchange between quantum dots and the working electrode through chiral molecules is associated with spin polarization that creates a local magnetization and generates a Hall voltage; ii) charge polarization of chiral molecules by an applied voltage is accompanied by a spin polarization that generates a Hall voltage; and iii) cyclic voltammetry (current-voltage) measurements of electrochemical redox reactions that can be spin-analyzed by the Hall circuit to provide a third dimension (spin) in addition to the well-known current and voltage dimensions. The three studies reviewed open new doors into understanding both the spin current and the charge current in electronic materials and electrochemical processes. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
100kW Energy Transfer Multiplexer Power Converter Prototype Development Project
DOE Office of Scientific and Technical Information (OSTI.GOV)
S. Merrill Skeist; Richard H.; Anthony G.P. Marini
2006-03-21
Project Final Report for "100kW Energy Transfer Multiplexer Power Converter Prototype Development Project" prepared under DOE grant number DE-FG36-03GO13138. This project relates to the further development and prototype construction/evaluation for the Energy Transfer Multiplexer (ETM) power converter topology concept. The ETM uses a series resonant link to transfer energy from any phase of a multiphase input to any phase of a multiphase output, converting any input voltage and frequency to any output voltage and frequency. The basic form of the ETM converter consists of an eight (8)-switch matrix (six phase power switches and two ground power switches) and a seriesmore » L-C resonant circuit. Electronic control of the switches allows energy to be transferred in the proper amount from any phase to any other phase. Depending upon the final circuit application, the switches may be either SCRs or IGBTs. The inherent characteristics of the ETM converter include the following: Power processing in either direction (bidirectional); Large voltage gain without the need of low frequency magnetics; High efficiency independent of output load and frequency; Wide bandwidth with fast transient response and; Operation as a current source. The ETM is able to synthesize true sinusoidal waveforms with low harmonic distortions. For a low power PM wind generation system, the ETM has the following characteristics and advantages: It provides voltage gain without the need of low frequency magnetics (DC inductors) and; It has constant high efficiency independent of the load. The ETM converter can be implemented into a PM wind power system with smaller size, reduced weight and lower cost. As a result of our analyses, the ETM offers wind power generation technology for the reduction of the cost and size as well as the increase in performance of low power, low wind speed power generation. This project is the further theoretical/analytical exploration of the ETM converter concept in relationship to PM wind power generator applications in the 100kW and under power range. The theoretical/analytical and bench scale work focuses on simplifying the basic ETM converter topology (in terms of parts count and complexity) for the specific application of the low power PM system. The project goals and objectives were for Spellman HV will develop a 100kW prototype ETM power converter based on paralleled lower ratings converters. The proposed configuration of this prototype is a 100kW rated converter comprised of four (4) 34kW rated modules connected in parallel (the fourth converter is included to demonstrate N+1 fault tolerance). This approach is more viable as there is lower technological risk involved in developing a 34kW-rated converter than a single 100kW unit. The modular system approach should have a lower deployment and service cost over a single unit system, because of the economics of scale (smaller units at a higher volume means lower manufacturing cost) and because of improved serviceability (a non-redundant power system with one failed module will still operate at a lower power level). There is also the added benefit that greater commercial application and acceptance should be achieved by having a modular system available in which fault tolerance (N+1 or 2N) is a feature. This modular approach would allow the output power to be increased by adding more paralleled converters. Thus, the maximum output power of the overall power system is a function of the interconnection medium (the hot swap connection subsystem), rather than the ratings of a single module. The project was implemented with Spellman HV acting as the program management and production assembly and test facility; The Baker Company acting as a technical consultant and resource when required; and dtm Associates acting as the design/development resource for the hardware development of the 100kW ETM converter prototype.« less
NASA Astrophysics Data System (ADS)
Al-Asbahi, Bandar Ali
2017-10-01
Energy transfer between poly (9,9'-di-n-octylfluorenyl-2,7-diyl) (PFO) as a donor in presence of TiO2 nanoparticles (NPs) and Fluorol 7GA as an acceptor with different weight ratios has been investigated by steady-state emission measurements. Based on the absorption and fluorescence measurements, the energy transfer properties, such as quenching rate constant (kSV), energy transfer rate constant (kET), quantum yield (ϕDA), and lifetime (τDA), of the donor in the presence of the acceptor, energy transfer probability (PDA), energy transfer efficiency (η), energy transfer time (τET), and critical distance of the energy transfer (Ro) were calculated. Förster-type energy transfer between the excited donor and ground-state acceptor molecules was the dominant mechanism responsible for the energy transfer as evidenced by large values of kSV, kET, and Ro. Moreover, these composite materials were employed as an emissive layer in organic light-emitting diodes (OLEDs). Additionally, the optoelectronic properties of OLEDs were investigated in terms of current density-voltage characteristics and electroluminescence spectra.
Electrochemical Performance of Glucose/Oxygen Biofuel Cells Based on Carbon Nanostructures.
Koo, Min-Hye; Das, Gautam; Yoon, Hyon Hee
2016-03-01
The electrochemical performance of glucose/oxygen biofuel cells based on carbon nanostructures was investigated in the present study. Different types of carbon nanomaterials, including multi-walled carbon nanotubes (MWCNT), functionalized MWCNT (f-MWCNT), carbon nanofibers (CNF), and functionalized CNF (f-CNF) were examined for electrode fabrications. The anode for glucose/oxygen biofuel cells were prepared by sequential coating of carbon nanomaterials, charge transfer complex (CTC), glucose oxidase (GOx) and nafion membrane. The anode was then integrated with a bilirubin oxidase-immobilized cathode for the biofuel cell test. It was found that the electrochemical performance of the enzyme electrodes was remarkably enhanced by the amalgamation of carbon nanomaterials with the CTC. The biofuel cell with anode comprising of f-CNF and the cathode with MWCNT exhibited the best electrochemical performance with a maximum power density of 210 μW/cm2 at a cell voltage of 0.44 V for 20 mM glucose concentration, which is comparable with the best power density value reported earlier.
Designing Light Beam Transmittance Measuring Tool Using a Laser Pointer
NASA Astrophysics Data System (ADS)
Nuroso, H.; Kurniawan, W.; Marwoto, P.
2016-08-01
A simple instrument used for measuring light beam transmittance percentage made of window film has been developed. The instrument uses a laser pointer of 405 nm and 650 nm ±10% as a light source. Its accuracy approaches 80%. Transmittance data was found by comparing the light beam before and after passing the window film. The light intensity measuring unit was deleted by splitting the light source into two beams through a beam splitter. The light beam was changed into resistance by a NORP12 LDR sensor designed at a circuit of voltage divider rule of Khirchoff's laws. This conversion system will produce light beam intensity received by the sensor to become an equal voltage. This voltage will, then, be presented on the computer screen in the form of a real time graph via a 2.0 USB data transfer.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Molecular basis of ancestral vertebrate electroreception
Bellono, Nicholas W.; Leitch, Duncan B.; Julius, David
2017-01-01
Elasmobranch fishes, including sharks, rays, and skates, use specialized electrosensory organs called Ampullae of Lorenzini to detect extremely small changes in environmental electric fields. Electrosensory cells within these ampullae are able to discriminate and respond to minute changes in environmental voltage gradients through an as-yet unknown mechanism. Here we show that the voltage-gated calcium channel CaV1.3 and big conductance calcium-activated potassium (BK) channel are preferentially expressed by electrosensory cells in little skate (Leucoraja erinacea) and functionally couple to mediate electrosensory cell membrane voltage oscillations, which are important in the detection of specific, weak electrical signals. Both channels exhibit unique properties compared with their mammalian orthologues to support electrosensory functions: structural adaptations in CaV1.3 mediate a low voltage threshold for activation, while alterations in BK support specifically tuned voltage oscillations. These findings reveal a molecular basis of electroreception and demonstrate how discrete evolutionary changes in ion channel structure facilitate sensory adaptation. PMID:28264196
Photovoltaic effect in organic polymer-iodine complex
NASA Technical Reports Server (NTRS)
Hermann, A. M.; Rembaum, A.
1967-01-01
Certain charge transfer complexes formed from organic polymers and iodine generate appreciable voltages at relatively low impedances upon exposure to light. These films show promise in applications requiring chemically and electrically stable films as detectors of optical radiation and as energy converters in photovoltaic cells.
Ban, Xinxin; Sun, Kaiyong; Sun, Yueming; Huang, Bin; Jiang, Wei
2016-01-27
A benzimidazole/phosphine oxide hybrid 1,3,5-tris(1-(4-(diphenylphosphoryl)phenyl)-1H-benzo[d]imidazol-2-yl)benzene (TPOB) was newly designed and synthesized as the electron-transporting component to form an exciplex-type host with the conventional hole-transporting material tris(4-carbazoyl-9-ylphenyl)amine (TCTA). Because of the enhanced triplet energy and electron affinity of TPOB, the energy leakage from exciplex-state to the constituting molecule was eliminated. Using energy transfer from exciplex-state, solution-processed blue phosphorescent organic light-emitting diodes (PHOLEDs) achieved an extremely low turn-on voltage of 2.8 V and impressively high power efficiency of 22 lm W(-1). In addition, the efficiency roll-off was very small even at luminance up to 10 000 cd m(-2), which suggested the balanced charge transfer in the emission layer. This study demonstrated that molecular modulation was an effective way to develop efficient exciplex-type host for high performanced PHOLEDs.
NASA Astrophysics Data System (ADS)
Lankevich, Vladimir; Bittner, Eric
In organic photovoltaic devices (OPVs), initially bound electron and hole can take many different paths to dissociate and become free charge carriers. This leads to the increase in their density of states and therefore increase in the entropy of the system. Accurate description of the energy barriers that charges have to overcome, therefore requires calculation of the free energy. Free energy of an OPV is directly related to its open-circuit voltage and depends only on few important parameters such as average life-time of a charge-transfer state, average energy of the charge-transfer state and energetic disorder in the system. We extend these ideas to the quantum mechanical simulations of the dissociation in the lattice modeled bulk-heterojunction system. We observe average excitonic and free energies that agree with theoretical predictions and the number of experimental results from previous studies. We study effects of the energy disorder and importance of the dimensionality and morphology in materials such as polymer-fullerene blends.
NASA Astrophysics Data System (ADS)
Su, Wei-Jhih; Chang, Hsuan-Chen; Honda, Shin-ichi; Lin, Pao-Hung; Huang, Ying-Sheng; Lee, Kuei-Yi
2017-08-01
Chemical doping with hetero-atoms is an effective method used to change the characteristics of materials. Nitrogen doping technology plays a critical role in regulating the electronic properties of graphene. Nitrogen plasma treatment was used in this work to dope nitrogen atoms to modulate multilayer graphene electrical properties. The measured I-V multilayer graphene-base field-effect transistor characteristics (GFETs) showed a V-shaped transfer curve with the hole and electron region separated from the measured current-voltage (I-V) minimum. GFETs fabricated with multilayer graphene from chemical vapor deposition (CVD) exhibited p-type behavior because of oxygen adsorption. After using different nitrogen plasma treatment times, the minimum in I-V characteristic shifted into the negative gate voltage region with increased nitrogen concentration and the GFET channel became an n-type semiconductor. GFETs could be easily fabricated using this method with potential for various applications. The GFET transfer characteristics could be tuned precisely by adjusting the nitrogen plasma treatment time.
Zou, Yunlong; Holmes, Russell J
2015-08-26
In order to further improve the performance of organic photovoltaic cells (OPVs), it is essential to better understand the factors that limit the open-circuit voltage (VOC). Previous work has sought to correlate the value of VOC in donor-acceptor (D-A) OPVs to the interface energy level offset (EDA). In this work, measurements of electroluminescence are used to extract the charge transfer (CT) state energy for multiple small molecule D-A pairings. The CT state as measured from electroluminescence is found to show better correlation to the maximum VOC than EDA. The difference between EDA and the CT state energy is attributed to the Coulombic binding energy of the CT state. This correlation is demonstrated explicitly by inserting an insulating spacer layer between the donor and acceptor materials, reducing the binding energy of the CT state and increasing the measured VOC. These results demonstrate a direct correlation between maximum VOC and CT state energy.
King, Robert Dean; DeDoncker, Rik Wivina Anna Adelson
1998-01-01
A method and apparatus for load leveling of a battery in an electrical power system includes a power regulator coupled to transfer power between a load and a DC link, a battery coupled to the DC link through a first DC-to-DC converter and an auxiliary passive energy storage device coupled to the DC link through a second DC-to-DC converter. The battery is coupled to the passive energy storage device through a unidirectional conducting device whereby the battery can supply power to the DC link through each of the first and second converters when battery voltage exceeds voltage on the passive storage device. When the load comprises a motor capable of operating in a regenerative mode, the converters are adapted for transferring power to the battery and passive storage device. In this form, resistance can be coupled in circuit with the second DC-to-DC converter to dissipate excess regenerative power.
King, R.D.; DeDoncker, R.W.A.A.
1998-01-20
A method and apparatus for load leveling of a battery in an electrical power system includes a power regulator coupled to transfer power between a load and a DC link, a battery coupled to the DC link through a first DC-to-DC converter and an auxiliary passive energy storage device coupled to the DC link through a second DC-to-DC converter. The battery is coupled to the passive energy storage device through a unidirectional conducting device whereby the battery can supply power to the DC link through each of the first and second converters when battery voltage exceeds voltage on the passive storage device. When the load comprises a motor capable of operating in a regenerative mode, the converters are adapted for transferring power to the battery and passive storage device. In this form, resistance can be coupled in circuit with the second DC-to-DC converter to dissipate excess regenerative power. 8 figs.
NASA Astrophysics Data System (ADS)
Sirotkin, N. A.; Titov, V. A.
2018-04-01
An atmospheric-pressure dc discharge in air ( i = 10-50 mA) with metal and liquid electrolyte electrodes was studied experimentally. An aqueous solution of sodium chloride (0.5 mol/L) was used as the cathode or anode. The electric field strength in the plasma and the cathode (anode) voltage drops were obtained from the measured dependences of the discharge voltage on the electrode gap length. The gas temperature was deduced from the spectral distribution of nitrogen emission in the band N2( C 3Π u → B 3Π g , 0-2). The time dependences of the temperatures of the liquid electrolyte electrodes during the discharge and in its afterglow, as well as the evaporation rate of the solution, were determined experimentally. The contributions of ion bombardment and heat flux from the plasma to the heating of the liquid electrode and transfer of solvent (water) into the gas phase are discussed using the experimental data obtained.
Hybrid switch for resonant power converters
Lai, Jih-Sheng; Yu, Wensong
2014-09-09
A hybrid switch comprising two semiconductor switches connected in parallel but having different voltage drop characteristics as a function of current facilitates attainment of zero voltage switching and reduces conduction losses to complement reduction of switching losses achieved through zero voltage switching in power converters such as high-current inverters.
NASA Astrophysics Data System (ADS)
Soreng, Bineeta; Behera, Pradyumna; Pradhan, Raseswari
2017-08-01
This paper presents model of a grid-integrated photovoltaic array with Maximum Power Point Tracker (MPPT) and voltage oriented controller. The MPPT of the PV array is usually an essential part of PV system as MPPT helps the operating point of the solar array to align its maximum power point. In this model, the MPPT along with a DC-DC converter lets a PV generator to produce continuous power, despite of the measurement conditions. The neutral-point-clamped converter (NPC) with a boost converter raises the voltage from the panels to the DC-link. An LCL-filter smoothens the current ripple caused by the PWM modulation of the grid-side inverter. In addition to the MPPT, the system has two more two controllers, such as voltage controller and a current controller. The voltage control has a PI controller to regulate the PV voltage to optimal level by controlling the amount of current injected into the boost stage. Here, the grid-side converter transfers the power from the DC-link into the grid and maintains the DC-link voltage. Three-phase PV inverters are used for off-grid or designed to create utility frequency AC. The PV system can be connected in series or parallel to get the desired output power. To justify the working of this model, the grid-integrated PV system has been designed in MATLAB/PLECS. The simulation shows the P-V curve of implemented PV Array consisting 4 X 20 modules, reactive, real power, grid voltage and current.
Voltage-induced swelling and deswelling of weak polybase brushes.
Weir, Michael P; Heriot, Sasha Y; Martin, Simon J; Parnell, Andrew J; Holt, Stephen A; Webster, John R P; Jones, Richard A L
2011-09-06
We have investigated a novel method of remotely switching the conformation of a weak polybase brush using an applied voltage. Surface-grafted polyelectrolyte brushes exhibit rich responsive behavior and show great promise as "smart surfaces", but existing switching methods involve physically or chemically changing the solution in contact with the brush. In this study, high grafting density poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) brushes were grown from silicon surfaces using atom transfer radical polymerization. Optical ellipsometry and neutron reflectivity were used to measure changes in the profiles of the brushes in response to DC voltages applied between the brush substrate and a parallel electrode some distance away in the surrounding liquid (water or D(2)O). Positive voltages were shown to cause swelling, while negative voltages in some cases caused deswelling. Neutron reflectometry experiments were carried out on the INTER reflectometer (ISIS, Rutherford Appleton Laboratory, UK) allowing time-resolved measurements of polymer brush structure. The PDMAEMA brushes were shown to have a polymer volume fraction profile described by a Gaussian-terminated parabola both in the equilibrium and in the partially swollen states. At very high positive voltages (in this study, positive bias means positive voltage to the brush-bearing substrate), the brush chains were shown to be stretched to an extent comparable to their contour length, before being physically removed from the interface. Voltage-induced swelling was shown to exhibit a wider range of brush swelling states in comparison to pH switching, with the additional advantages that the stimulus is remotely controlled and may be fully automated. © 2011 American Chemical Society
Redox Regulation of Neuronal Voltage-Gated Calcium Channels
Jevtovic-Todorovic, Vesna
2014-01-01
Abstract Significance: Voltage-gated calcium channels are ubiquitously expressed in neurons and are key regulators of cellular excitability and synaptic transmitter release. There is accumulating evidence that multiple subtypes of voltage-gated calcium channels may be regulated by oxidation and reduction. However, the redox mechanisms involved in the regulation of channel function are not well understood. Recent Advances: Several studies have established that both T-type and high-voltage-activated subtypes of voltage-gated calcium channel can be redox-regulated. This article reviews different mechanisms that can be involved in redox regulation of calcium channel function and their implication in neuronal function, particularly in pain pathways and thalamic oscillation. Critical Issues: A current critical issue in the field is to decipher precise mechanisms of calcium channel modulation via redox reactions. In this review we discuss covalent post-translational modification via oxidation of cysteine molecules and chelation of trace metals, and reactions involving nitric oxide-related molecules and free radicals. Improved understanding of the roles of redox-based reactions in regulation of voltage-gated calcium channels may lead to improved understanding of novel redox mechanisms in physiological and pathological processes. Future Directions: Identification of redox mechanisms and sites on voltage-gated calcium channel may allow development of novel and specific ion channel therapies for unmet medical needs. Thus, it may be possible to regulate the redox state of these channels in treatment of pathological process such as epilepsy and neuropathic pain. Antioxid. Redox Signal. 21, 880–891. PMID:24161125
A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.
Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S
2016-03-01
Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.
Energy harvesting from arterial blood pressure for powering embedded brain sensors
NASA Astrophysics Data System (ADS)
Nanda, Aditya; Karami, M. Amin
2016-04-01
This paper investigates energy harvesting from arterial blood pressure via the piezoelectric effect by using a novel streaked cylinder geometry for the purpose of powering embedded micro-sensors in the brain. Initially, we look at the energy harvested by a piezoelectric cylinder placed inside an artery acted upon by blood pressure. Such an arrangement would be tantamount to constructing a stent out of piezoelectric materials. A stent is a cylinder placed in veins and arteries to prevent obstruction in blood flow. The governing equations of a conductor coated piezoelectric cylinder are obtained using Hamilton's principle. Pressure acting in arteries is radially directed and this is used to simplify the modal analysis and obtain the transfer function relating pressure to the induced voltage across the surface of the harvester. The power harvested by the cylindrical harvester is obtained for different shunt resistances. Radially directed pressure occurs elsewhere and we also look at harvesting energy from oil flow in pipelines. Although the energy harvested by the cylindrical energy harvester is significant at resonance, the natural frequency of the system is found to be very high. To decrease the natural frequency, we propose a novel streaked stent design by cutting it along the length, transforming it to a curved plate and decreasing the natural frequency. The governing equations corresponding to the new geometry are derived using Hamilton's principle and modal analysis is used to obtain the transfer function.
Room-temperature current blockade in atomically defined single-cluster junctions
NASA Astrophysics Data System (ADS)
Lovat, Giacomo; Choi, Bonnie; Paley, Daniel W.; Steigerwald, Michael L.; Venkataraman, Latha; Roy, Xavier
2017-11-01
Fabricating nanoscopic devices capable of manipulating and processing single units of charge is an essential step towards creating functional devices where quantum effects dominate transport characteristics. The archetypal single-electron transistor comprises a small conducting or semiconducting island separated from two metallic reservoirs by insulating barriers. By enabling the transfer of a well-defined number of charge carriers between the island and the reservoirs, such a device may enable discrete single-electron operations. Here, we describe a single-molecule junction comprising a redox-active, atomically precise cobalt chalcogenide cluster wired between two nanoscopic electrodes. We observe current blockade at room temperature in thousands of single-cluster junctions. Below a threshold voltage, charge transfer across the junction is suppressed. The device is turned on when the temporary occupation of the core states by a transiting carrier is energetically enabled, resulting in a sequential tunnelling process and an increase in current by a factor of ∼600. We perform in situ and ex situ cyclic voltammetry as well as density functional theory calculations to unveil a two-step process mediated by an orbital localized on the core of the cluster in which charge carriers reside before tunnelling to the collector reservoir. As the bias window of the junction is opened wide enough to include one of the cluster frontier orbitals, the current blockade is lifted and charge carriers can tunnel sequentially across the junction.
Hainsworth, Atticus H; Randall, Andrew D; Stefani, Alessandro
2005-01-01
Voltage-sensitive Ca(2+) channels (VSCC) play a central role in an extensive array of physiological processes. Their importance in cellular function arises from their ability both to sense membrane voltage and to conduct Ca(2+) ions, two facets that couple membrane excitability to a key intracellular second messenger. Through this relationship, activation of VSCCs is tightly coupled to the gamut of cellular functions dependent on intracellular Ca(2+), including muscle contraction, energy metabolism, gene expression, and exocytotic/endocytotic cycling.
Tveito, Aslak; Lines, Glenn T; Edwards, Andrew G; McCulloch, Andrew
2016-07-01
Markov models are ubiquitously used to represent the function of single ion channels. However, solving the inverse problem to construct a Markov model of single channel dynamics from bilayer or patch-clamp recordings remains challenging, particularly for channels involving complex gating processes. Methods for solving the inverse problem are generally based on data from voltage clamp measurements. Here, we describe an alternative approach to this problem based on measurements of voltage traces. The voltage traces define probability density functions of the functional states of an ion channel. These probability density functions can also be computed by solving a deterministic system of partial differential equations. The inversion is based on tuning the rates of the Markov models used in the deterministic system of partial differential equations such that the solution mimics the properties of the probability density function gathered from (pseudo) experimental data as well as possible. The optimization is done by defining a cost function to measure the difference between the deterministic solution and the solution based on experimental data. By evoking the properties of this function, it is possible to infer whether the rates of the Markov model are identifiable by our method. We present applications to Markov model well-known from the literature. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Roy, Sharani; Mujica, Vladimiro; Ratner, Mark A
2013-08-21
The scanning tunneling microscope (STM) is a fascinating tool used to perform chemical processes at the single-molecule level, including bond formation, bond breaking, and even chemical reactions. Hahn and Ho [J. Chem. Phys. 123, 214702 (2005)] performed controlled rotations and dissociations of single O2 molecules chemisorbed on the Ag(110) surface at precise bias voltages using STM. These threshold voltages were dependent on the direction of the bias voltage and the initial orientation of the chemisorbed molecule. They also observed an interesting voltage-direction-dependent and orientation-dependent pathway selectivity suggestive of mode-selective chemistry at molecular junctions, such that in one case the molecule underwent direct dissociation, whereas in the other case it underwent rotation-mediated dissociation. We present a detailed, first-principles-based theoretical study to investigate the mechanism of the tunneling-induced O2 dynamics, including the origin of the observed threshold voltages, the pathway dependence, and the rate of O2 dissociation. Results show a direct correspondence between the observed threshold voltage for a process and the activation energy for that process. The pathway selectivity arises from a competition between the voltage-modified barrier heights for rotation and dissociation, and the coupling strength of the tunneling electrons to the rotational and vibrational modes of the adsorbed molecule. Finally, we explore the "dipole" and "resonance" mechanisms of inelastic electron tunneling to elucidate the energy transfer between the tunneling electrons and chemisorbed O2.
NASA Astrophysics Data System (ADS)
Bae, Jinho; Kim, Hyoung Woo; Kang, In Ho; Yang, Gwangseok; Kim, Jihyun
2018-03-01
We have demonstrated a β-Ga2O3 metal-semiconductor field-effect transistor (MESFET) with a high off-state breakdown voltage (344 V), based on a quasi-two-dimensional β-Ga2O3 field-plated with hexagonal boron nitride (h-BN). Both the β-Ga2O3 and h-BN were mechanically exfoliated from their respective crystal substrates, followed by dry-transfer onto a SiO2/Si substrate for integration into a high breakdown voltage quasi-two-dimensional β-Ga2O3 MESFETs. N-type conducting behavior was observed in the fabricated β-Ga2O3 MESFETs, along with a high on/off current ratio (>106) and excellent current saturation. A three-terminal off-state breakdown voltage of 344 V was obtained, with a threshold voltage of -7.3 V and a subthreshold swing of 84.6 mV/dec. The distribution of electric fields in the quasi-two-dimensional β-Ga2O3 MESFETs was simulated to analyze the role of the dielectric h-BN field plate in improving the off-state breakdown voltage. The stability of the field-plated β-Ga2O3 MESFET in air was confirmed after storing the MESFET in ambient air for one month. Our results pave the way for unlocking the full potential of β-Ga2O3 for use in a high-power nano-device with an ultrahigh breakdown voltage.
Sensing charges of the Ciona intestinalis voltage-sensing phosphatase
Frezza, Ludivine; Sandtner, Walter
2013-01-01
Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing. PMID:24127524
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ding, Fei; Nagarajan, Adarsh; Baggu, Murali
This paper evaluated the impact of smart inverter Volt-VAR function on voltage reduction energy saving and power quality in electric power distribution systems. A methodology to implement the voltage reduction optimization was developed by controlling the substation LTC and capacitor banks, and having smart inverters participate through their autonomous Volt-VAR control. In addition, a power quality scoring methodology was proposed and utilized to quantify the effect on power distribution system power quality. All of these methodologies were applied to a utility distribution system model to evaluate the voltage reduction energy saving and power quality under various PV penetrations and smartmore » inverter densities.« less
NASA Technical Reports Server (NTRS)
Parker, C. D.
1975-01-01
The Pioneer 10/11 meteoroid detection equipment (MDE) pressure cells were tested at liquid nitrogen (LN2) and liquid helium (LHe) temperatures with the excitation voltage controlled as a parameter. The cells failed by firing because of pressurizing gas condensation as the temperature was lowered from LN2 to LHe temperature and when raised from LHe temperature. A study was conducted to determine cell pressure as a function of temperature, and cell failure was estimated as a function of temperature and excitation voltage. The electronic system was also studied, and a profile of primary spacecraft voltage (nominally 28 Vdc) and temperature corresponding to electronic system failure was determined experimentally.
NASA Astrophysics Data System (ADS)
Sai Chaithanya, M.; Thakur, Somil; Sonu, Kumar; Das, Bhaskar
2017-11-01
A microbial fuel cell (MFC) consists of a cathode and anode; micro-organisms transfer electrons acquired from the degradation of organic matter in the substrate to anode; and thereby to cathode; by using an external circuit to generate electricity. In the present study, a single chamber single electrode microbial fuel cell has been fabricated to generate electricity from the sludge of the sewage treatment plant at two different ambient temperature range of 25 ± 4°C and 32 ± 4°C under aerobic condition. No work has been done yet by using the single electrode in any MFC system; it is hypothesized that single electrode submerged partially in substrate and rest to atmosphere can function as both cathode and anode. The maximum voltage obtained was about 2890 mV after 80 (hrs) at temperature range of 25 ± 4°C, with surface power density of 1108.29 mW/m2. When the ambient temperature was 32 ± 4°C, maximum voltage obtained was 1652 mV after 40 (hrs.) surface power density reduced to 865.57 mW/m2. When amount of substrate was decreased for certain area of electrode at 25 ± 4°C range, electricity generation decreased and it also shortened the time to reach peak voltage. On the other hand, when the ambient temperature was increased to 32 ± 4°C, the maximum potential energy generated was less than that of previous experiment at 25 ± 4°C for the same substrate Also the time to reach peak voltage decreased to 40 hrs. When comparing with other single chamber single electrode MFC, the present model is generating more electricity that any MFC using sewage sludge as substrate except platinum electrode, which is much costlier that electrode used in the present study.
Turabekova, Malakhat A.; Rasulev, Bakhtiyor F.; Levkovich, Mikhail G.; Abdullaev, Nasrulla D.; Leszczynski, Jerzy
2015-01-01
Early pharmacological studies of Aconitum and Delphinium sp. alkaloids suggested that these neurotoxins act at site 2 of voltage-gated Na+ channel and allosterically modulate its function. Understanding structural requirements for these compounds to exhibit binding activity at voltage-gated Na+ channel has been important in various fields. This paper reports quantum-chemical studies and quantitative structure-activity relationships (QSARs) based on a total of 65 natural alkaloids from two plant species, which includes both blockers and openers of sodium ion channel. A series of 18 antagonist alkaloids (9 blockers and 9 openers) have been studied using AM1 and DFT computational methods in order to reveal their structure-activity (structure-toxicity) relationship at electronic level. An examination of frontier orbitals obtained for ground and protonated forms of the compounds revealed that HOMOs and LUMOs were mainly represented by nitrogen atom and benzyl/benzoylester orbitals with –OH and –OCOCH3 contributions. The results obtained from this research have confirmed the experimental findings suggesting that neurotoxins acting at type 2 receptor site of voltage-dependent sodium channel are activators and blockers with common structural features and differ only in efficacy. The energetic tendency of HOMO-LUMO energy gap can probably distinguish activators and blockers that have been observed. Genetic Algorithm with Multiple Linear Regression Analysis (GA-MLRA) technique was also applied for the generation of two-descriptor QSAR models for the set of 65 blockers. Additionally to the computational studies, the HOMO-LUMO gap descriptor in each obtained QSAR model has confirmed the crucial role of charge transfer in receptor-ligand interactions. A number of other descriptors such as logP, IBEG, nNH2, nHDon, nCO have been selected as complementary ones to LUMO and their role in activity alteration has also been discussed. PMID:18201930
An Integrated Multilevel Converter with Sigma Delta Control for LED Lighting
NASA Astrophysics Data System (ADS)
Gerber, Daniel L.
High brightness LEDs have become a mainstream lighting technology due to their efficiency, life span, and environmental benefits. As such, the lighting industry values LED drivers with low cost, small form factor, and long life span. Additional specifications that define a high quality LED driver are high efficiency, high power factor, wide-range dimming, minimal flicker, and a galvanically isolated output. The flyback LED driver is a popular topology that satisfies all these specifications, but it requires a bulky and costly flyback transformer. In addition, its passive methods for cancelling AC power ripple require electrolytic capacitors, which have been known to have life span issues. This dissertation details the design, construction, and verification of a novel LED driver that satisfies all the specifications. In addition, it does not require a flyback transformer or electrolytic capacitors, thus marking an improvement over the flyback driver on size, cost, and life span. This dissertation presents an integrated circuit (IC) LED driver, which features a pair of generalized multilevel converters that are controlled via sigma-delta modulation. The first is a multilevel rectifier responsible for power factor correction (PFC) and dimming. The PFC rectifier employs a second order sigma-delta loop to precisely control the input current harmonics and amplitude. The second is a bidirectional multilevel inverter used to cancel AC power ripple from the DC bus. This ripple-cancellation module transfers energy to and from a storage capacitor. It uses a first order sigma-delta loop with a preprogrammed waveform to swing the storage capacitor voltage. The system also contains an output stage that powers the LEDs with DC and provides for galvanic isolation. The output stage consists of an H-bridge stack that connects to the output through a small toroid transformer. The IC LED driver was simulated and prototyped on an ABCD silicon test chip. Testing and verification indicates functional performance for all the modules in the LED driver. The driver exhibits moderate efficiency at half voltage. Although the part was only testable to half voltage, loss models predict that its efficiency would be much higher at full voltage. The driver also meets specifications on the line current harmonics and ripple cancellation. This dissertation introduces multilevel circuit techniques to the IC and LED research space. The prototype's functional performance indicates that integrated multilevel converters are a viable topology for lighting and other similar applications.
Abdul Aziz,, Siti Aishah; Mohd Saparudin, Abdul Khaliq; Harun, Ahmad Zaky
2013-01-01
Background: Different target-filter combinations in computed radiography have different impacts on the dose and image quality in digital radiography. This study aims to evaluate the mean glandular dose (MGD) and modulation transfer function (MTF) of various target-filter combinations by investigating the signal intensities of X-ray beams. Methods: General Electric (GE) Senographe DMR Plus mammography unit was used for MGD and MTF evaluation. The measured MGD was compared with the dose reference level (DRL), whereas the MTF was evaluated using ImageJ 1.46o software. A modified Mammography Accreditation Phantom RMI 156 was exposed using different target-filter combinations of molybdenum-molybdenum (Mo-Mo), molybdenum-rhodium (Mo-Rh) and rhodium-rhodium (Rh-Rh) at two different tube voltages, 26 kV and 32 kV with 50 mAs. Results: In the MGD evaluations, all target-filters gave an MGD value of < 1.5 mGy. The one-way ANOVA test showed a highly significant interaction between the MGD and the kilovoltage and target-filter material used (26 kV: F (2,12) = 49,234, P = 0.001;32 kV: F (2,12) = 89,972, P = 0.001). A Tukey post-hoc test revealed that the MGD for 26 kV and 32 kV was highly affected by the target-filter combinations. The test of homogeneity of variances indicates that the MGD varies significantly for 26 kV and 32 kV images (0.045 and 0.030 (P < 0.05), respectively). However, the one-way ANOVA for the MTF shows that no significant difference exists between the target-filter combinations used with 26 kV and 32 kV images either in parallel or perpendicular to the chest wall side F (2,189) = 0.26, P > 0.05). Conclusion: Higher tube voltage and atomic number target-filter yield higher MGD values. However, the MTF is independent of the X-ray energy and the type of target-filter combinations used. PMID:23966821
NASA Astrophysics Data System (ADS)
Sukhomlinov, V.; Mustafaev, A.; Timofeev, N.
2018-04-01
Previously developed methods based on the single-sided probe technique are altered and applied to measure the anisotropic angular spread and narrow energy distribution functions of charged particle (electron and ion) beams. The conventional method is not suitable for some configurations, such as low-voltage beam discharges, electron beams accelerated in near-wall and near-electrode layers, and vacuum electron beam sources. To determine the range of applicability of the proposed method, simple algebraic relationships between the charged particle energies and their angular distribution are obtained. The method is verified for the case of the collisionless mode of a low-voltage He beam discharge, where the traditional method for finding the electron distribution function with the help of a Legendre polynomial expansion is not applicable. This leads to the development of a physical model of the formation of the electron distribution function in a collisionless low-voltage He beam discharge. The results of a numerical calculation based on Monte Carlo simulations are in good agreement with the experimental data obtained using the new method.
Delemotte, Lucie; Klein, Michael L.; Tarek, Mounir
2012-01-01
Since their discovery in the 1950s, the structure and function of voltage-gated cation channels (VGCC) has been largely understood thanks to results stemming from electrophysiology, pharmacology, spectroscopy, and structural biology. Over the past decade, computational methods such as molecular dynamics (MD) simulations have also contributed, providing molecular level information that can be tested against experimental results, thereby allowing the validation of the models and protocols. Importantly, MD can shed light on elements of VGCC function that cannot be easily accessed through “classical” experiments. Here, we review the results of recent MD simulations addressing key questions that pertain to the function and modulation of the VGCC’s voltage-sensor domain (VSD) highlighting: (1) the movement of the S4-helix basic residues during channel activation, articulating how the electrical driving force acts upon them; (2) the nature of the VSD intermediate states on transitioning between open and closed states of the VGCC; and (3) the molecular level effects on the VSD arising from mutations of specific S4 positively charged residues involved in certain genetic diseases. PMID:22654756
A high-voltage pulse transformer with a modular ferrite core
NASA Astrophysics Data System (ADS)
Liu, Z.; Winands, G. J. J.; Yan, K.; Pemen, A. J. M.; Van Heesch, E. J. M.
2008-01-01
A high ratio (winding ratio of 1:80) pulse transformer with a modular ferrite core was developed for a repetitive resonant charging system. The magnetic core is constructed from 68 small blocks of ferrites, glued together by epoxy resin. This allows a high degree of freedom in choosing core shape and size. Critical issues related to this modular design are the size tolerance of the individual ferrite blocks, the unavoidable air gap between the blocks, and the saturation of the core. To evaluate the swing of the flux density inside the core during the charging process, an equivalent circuit model was introduced. It was found that when a transformer is used in a resonant charging circuit, the minimal required volume of the magnetic material to keep the core unsaturated depends on the coupling coefficient of the transformer and is independent of the number of turns of the primary winding. Along the flux path, 17 small air gaps are present due to the inevitable joints between the ferrite blocks. The total air gap distance is about 0.67mm. The primary and secondary windings have 16 turns and 1280 turns, respectively, and the actually obtained ratio is about 1:75.4. A coupling coefficient of 99.6% was obtained. Experimental results are in good agreement with the model, and the modular ferrite core works well. Using this transformer, the high-voltage capacitors can be charged up to more than 70kV from a low-voltage capacitor with an initial charging voltage of about 965V. With 26.9J energy transfer, the increased flux density inside the core was about 0.23T, and the core remains unsaturated. The energy transfer efficiency from the primary to the secondary was around 92%.
A comprehensive approach to reactive power scheduling in restructured power systems
NASA Astrophysics Data System (ADS)
Shukla, Meera
Financial constraints, regulatory pressure, and need for more economical power transfers have increased the loading of interconnected transmission systems. As a consequence, power systems have been operated close to their maximum power transfer capability limits, making the system more vulnerable to voltage instability events. The problem of voltage collapse characterized by a severe local voltage depression is generally believed to be associated with inadequate VAr support at key buses. The goal of reactive power planning is to maintain a high level of voltage security, through installation of properly sized and located reactive sources and their optimal scheduling. In case of vertically-operated power systems, the reactive requirement of the system is normally satisfied by using all of its reactive sources. But in case of different scenarios of restructured power systems, one may consider a fixed amount of exchange of reactive power through tie lines. Reviewed literature suggests a need for optimal scheduling of reactive power generation for fixed inter area reactive power exchange. The present work proposed a novel approach for reactive power source placement and a novel approach for its scheduling. The VAr source placement technique was based on the property of system connectivity. This is followed by development of optimal reactive power dispatch formulation which facilitated fixed inter area tie line reactive power exchange. This formulation used a Line Flow-Based (LFB) model of power flow analysis. The formulation determined the generation schedule for fixed inter area tie line reactive power exchange. Different operating scenarios were studied to analyze the impact of VAr management approach for vertically operated and restructured power systems. The system loadability, losses, generation and the cost of generation were the performance measures to study the impact of VAr management strategy. The novel approach was demonstrated on IEEE 30 bus system.
NASA Astrophysics Data System (ADS)
Kattke, K. J.; Braun, R. J.
2011-08-01
A novel, highly integrated tubular SOFC system intended for small-scale power is characterized through a series of sensitivity analyses and parametric studies using a previously developed high-fidelity simulation tool. The high-fidelity tubular SOFC system modeling tool is utilized to simulate system-wide performance and capture the thermofluidic coupling between system components. Stack performance prediction is based on 66 anode-supported tubular cells individually evaluated with a 1-D electrochemical cell model coupled to a 3-D computational fluid dynamics model of the cell surroundings. Radiation is the dominate stack cooling mechanism accounting for 66-92% of total heat loss at the outer surface of all cells at baseline conditions. An average temperature difference of nearly 125 °C provides a large driving force for radiation heat transfer from the stack to the cylindrical enclosure surrounding the tube bundle. Consequently, cell power and voltage disparities within the stack are largely a function of the radiation view factor from an individual tube to the surrounding stack can wall. The cells which are connected in electrical series, vary in power from 7.6 to 10.8 W (with a standard deviation, σ = 1.2 W) and cell voltage varies from 0.52 to 0.73 V (with σ = 81 mV) at the simulation baseline conditions. It is observed that high cell voltage and power outputs directly correspond to tubular cells with the smallest radiation view factor to the enclosure wall, and vice versa for tubes exhibiting low performance. Results also reveal effective control variables and operating strategies along with an improved understanding of the effect that design modifications have on system performance. By decreasing the air flowrate into the system by 10%, the stack can wall temperature increases by about 6% which increases the minimum cell voltage to 0.62 V and reduces deviations in cell power and voltage by 31%. A low baseline fuel utilization is increased by decreasing the fuel flowrate and by increasing the stack current demand. Simulation results reveal fuel flow as a poor control variable because excessive tail-gas combustor temperatures limit fuel flow to below 110% of the baseline flowrate. Additionally, system efficiency becomes inversely proportional to fuel utilization over the practical fuel flow range. Stack current is found to be an effective control variable in this type of system because system efficiency becomes directly proportional to fuel utilization. Further, the integrated system acts to dampen temperature spikes when fuel utilization is altered by varying current demand. Radiation remains the dominate heat transfer mechanism within the stack even if stack surfaces are polished lowering emissivities to 0.2. Furthermore, the sensitivity studies point to an optimal system insulation thickness that balances the overall system volume and total conductive heat loss.
Precision linear ramp function generator
Jatko, W.B.; McNeilly, D.R.; Thacker, L.H.
1984-08-01
A ramp function generator is provided which produces a precise linear ramp function which is repeatable and highly stable. A derivative feedback loop is used to stabilize the output of an integrator in the forward loop and control the ramp rate. The ramp may be started from a selected baseline voltage level and the desired ramp rate is selected by applying an appropriate constant voltage to the input of the integrator.
The Structural Basis of IKs Ion-Channel Activation: Mechanistic Insights from Molecular Simulations.
Ramasubramanian, Smiruthi; Rudy, Yoram
2018-06-05
Relating ion channel (iCh) structural dynamics to physiological function remains a challenge. Current experimental and computational techniques have limited ability to explore this relationship in atomistic detail over physiological timescales. A framework associating iCh structure to function is necessary for elucidating normal and disease mechanisms. We formulated a modeling schema that overcomes the limitations of current methods through applications of artificial intelligence machine learning. Using this approach, we studied molecular processes that underlie human IKs voltage-mediated gating. IKs malfunction underlies many debilitating and life-threatening diseases. Molecular components of IKs that underlie its electrophysiological function include KCNQ1 (a pore-forming tetramer) and KCNE1 (an auxiliary subunit). Simulations, using the IKs structure-function model, reproduced experimentally recorded saturation of gating-charge displacement at positive membrane voltages, two-step voltage sensor (VS) movement shown by fluorescence, iCh gating statistics, and current-voltage relationship. Mechanistic insights include the following: 1) pore energy profile determines iCh subconductance; 2) the entire protein structure, not limited to the pore, contributes to pore energy and channel subconductance; 3) interactions with KCNE1 result in two distinct VS movements, causing gating-charge saturation at positive membrane voltages and current activation delay; and 4) flexible coupling between VS and pore permits pore opening at lower VS positions, resulting in sequential gating. The new modeling approach is applicable to atomistic scale studies of other proteins on timescales of physiological function. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Ligand-induced dependence of charge transfer in nanotube–quantum dot heterostructures
Wang, Lei; Han, Jinkyu; Sundahl, Bryan; ...
2016-07-01
As a model system to probe ligand-dependent charge transfer in complex composite heterostructures, we fabricated double-walled carbon nanotube (DWNT) – CdSe quantum dot (QD) composites. Whereas the average diameter of the QDs probed was kept fixed at ~4.1 nm and the nanotubes analyzed were similarly oxidatively processed, by contrast, the ligands used to mediate the covalent attachment between the QDs and DWNTs were systematically varied to include p-phenylenediamine (PPD), 2-aminoethanethiol (AET), and 4-aminothiophenol (ATP). Herein, we have put forth a unique compilation of complementary data from experiment and theory, including results from transmission electron microscopy (TEM), near-edge X-ray absorption finemore » structure (NEXAFS) spectroscopy, Raman spectroscopy, electrical transport measurements, and theoretical modeling studies, in order to fundamentally assess the nature of the charge transfer between CdSe QDs and DWNTs, as a function of the structure of various, intervening bridging ligand molecules. Specifically, we correlated evidence of charge transfer as manifested by changes and shifts associated with NEXAFS intensities, Raman peak positions, and threshold voltages both before and after CdSe QD deposition onto the underlying DWNT surface. Importantly, for the first time ever in these types of nanoscale composite systems, we have sought to use theoretical modeling to justify and account for our experimental results. Finally, our overall data suggest that (i) QD coverage density on the DWNTs varies, based upon the different ligand pendant groups used and that (ii) the presence of a π-conjugated carbon framework within the ligands themselves and the electron affinity of the pendant groups collectively play important roles in the resulting charge transfer from QDs to the underlying CNTs.« less
A new low voltage level-shifted FVF current mirror with enhanced bandwidth and output resistance
NASA Astrophysics Data System (ADS)
Aggarwal, Bhawna; Gupta, Maneesha; Gupta, Anil Kumar; Sangal, Ankur
2016-10-01
This paper proposes a new high-performance level-shifted flipped voltage follower (LSFVF) based low-voltage current mirror (CM). The proposed CM utilises the low-supply voltage and low-input resistance characteristics of a flipped voltage follower (FVF) CM. In the proposed CM, level-shifting configuration is used to obtain a wide operating current range and resistive compensation technique is employed to increase the operating bandwidth. The peaking in frequency response is reduced by using an additional large MOSFET. Moreover, a very high output resistance (in GΩ range) along with low-current transfer error is achieved through super-cascode configuration for a wide current range (0-440 µA). Small signal analysis is carried out to show the improvements achieved at each step. The proposed CM is simulated by Mentor Graphics Eldospice in TSMC 0.18 µm CMOS, BSIM3 and Level 53 technology. In the proposed CM, a bandwidth of 6.1799 GHz, 1% settling time of 0.719 ns, input and output resistances of 21.43 Ω and 1.14 GΩ, respectively, are obtained with a single supply voltage of 1 V. The layout of the proposed CM has been designed and post-layout simulation results have been shown. The post-layout simulation results for Monte Carlo and temperature analysis have also been included to show the reliability of the CM against the variations in process parameters and temperature changes.
Chang, Shu-Jui; Chang, Po-Chun; Lin, Wen-Chin; Lo, Shao-Hua; Chang, Liang-Chun; Lee, Shang-Fan; Tseng, Yuan-Chieh
2017-03-23
Using x-ray magnetic spectroscopy with in-situ electrical characterizations, we investigated the effects of external voltage on the spin-electronic and transport properties at the interface of a Fe/ZnO device. Layer-, element-, and spin-resolved information of the device was obtained by cross-tuning of the x-ray mode and photon energy, when voltage was applied. At the early stage of the operation, the device exhibited a low-resistance state featuring robust Fe-O bonds. However, the Fe-O bonds were broken with increasing voltage. Breaking of the Fe-O bonds caused the formation of oxygen vacancies and resulted in a high-resistance state. Such interface reconstruction was coupled to a charge-transfer effect via Fe-O hybridization, which suppressed/enhanced the magnetization/coercivity of Fe electronically. Nevertheless, the interface became stabilized with the metallic phase if the device was continuously polarized. During this stage, the spin-polarization of Fe was enhanced whereas the coercivity was lowered by voltage, but changes of both characteristics were reversible. This stage is desirable for spintronic device applications, owing to a different voltage-induced electronic transition compared to the first stage. The study enabled a straightforward detection of the spin-electronic state at the ferromagnet-semiconductor interface in relation to the transport and reversal properties during operation process of the device.
Modular apparatus for electrostatic actuation of common atomic force microscope cantilevers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Long, Christian J., E-mail: christian.long@nist.gov; Maryland Nanocenter, University of Maryland, College Park, Maryland 20742; Cannara, Rachel J.
2015-07-15
Piezoelectric actuation of atomic force microscope (AFM) cantilevers often suffers from spurious mechanical resonances in the loop between the signal driving the cantilever and the actual tip motion. These spurious resonances can reduce the accuracy of AFM measurements and in some cases completely obscure the cantilever response. To address these limitations, we developed a specialized AFM cantilever holder for electrostatic actuation of AFM cantilevers. The holder contains electrical contacts for the AFM cantilever chip, as well as an electrode (or electrodes) that may be precisely positioned with respect to the back of the cantilever. By controlling the voltages on themore » AFM cantilever and the actuation electrode(s), an electrostatic force is applied directly to the cantilever, providing a near-ideal transfer function from drive signal to tip motion. We demonstrate both static and dynamic actuations, achieved through the application of direct current and alternating current voltage schemes, respectively. As an example application, we explore contact resonance atomic force microscopy, which is a technique for measuring the mechanical properties of surfaces on the sub-micron length scale. Using multiple electrodes, we also show that the torsional resonances of the AFM cantilever may be excited electrostatically, opening the door for advanced dynamic lateral force measurements with improved accuracy and precision.« less
NASA Astrophysics Data System (ADS)
Xiangjie, Zhao; Cangli, Liu; Jiazhu, Duan; Dayong, Zhang; Yongquan, Luo
2015-01-01
Optically addressed conventional nematic liquid crystal spatial light modulator has attracted wide research interests. But the slow response speed limited its further application. In this paper, polymer network liquid crystal (PNLC) was proposed to replace the conventional nematic liquid crystal to enhance the response time to the order of submillisecond. The maximum light scattering of the employed PNLC was suppressed to be less than 2% at 1.064 μm by optimizing polymerization conditions and selecting large viscosity liquid crystal as solvent. The occurrence of phase ripple phenomenon due to electron diffusion and drift in photoconductor was found to deteriorate the phase modulation effect of the optical addressed PNLC phase modulator. The wavelength effect and AC voltage frequency effect on the on state dynamic response of phase change was investigated by experimental methods. These effects were interpreted by electron diffusion and drift theory based on the assumption that free electron was inhomogeneously distributed in accordance with the writing beam intensity distribution along the incident direction. The experimental results indicated that the phase ripple could be suppressed by optimizing the wavelength of the writing beam and the driving AC voltage frequency when varying the writing beam intensity to generate phase change in 2π range. The modulation transfer function was also measured.
E-beam-pumped semiconductor lasers
NASA Astrophysics Data System (ADS)
Rice, Robert R.; Shanley, James F.; Ruggieri, Neil F.
1995-04-01
The collapse of the Soviet Union opened many areas of laser technology to the West. E-beam- pumped semiconductor lasers (EBSL) were pursued for 25 years in several Soviet Institutes. Thin single crystal screens of II-VI alloys (ZnxCd1-xSe, CdSxSe1-x) were incorporated in laser CRTs to produce scanned visible laser beams at average powers greater than 10 W. Resolutions of 2500 lines were demonstrated. MDA-W is conducting a program for ARPA/ESTO to assess EBSL technology for high brightness, high resolution RGB laser projection application. Transfer of II-VI crystal growth and screen processing technology is underway, and initial results will be reported. Various techniques (cathodoluminescence, one- and two-photon laser pumping, etc.) have been used to assess material quality and screen processing damage. High voltage (75 kV) video electronics were procured in the U.S. to operate test EBSL tubes. Laser performance was documented as a function of screen temperature, beam voltage and current. The beam divergence, spectrum, efficiency and other characteristics of the laser output are being measured. An evaluation of the effect of laser operating conditions upon the degradation rate is being carried out by a design-of-experiments method. An initial assessment of the projected image quality will be performed.
Duan, Yu-Ai; Geng, Yun; Li, Hai-Bin; Jin, Jun-Ling; Wu, Yong; Su, Zhong-Min
2013-07-15
To seek for high-performance small molecule donor materials used in heterojunction solar cell, six acceptor-donor-acceptor small molecules based on naphtho[2,3-b:6,7-b']dithiophene (NDT) units with different acceptor units were designed and characterized using density functional theory and time-dependent density functional theory. Their geometries, electronic structures, photophysical, and charge transport properties have been scrutinized comparing with the reported donor material NDT(TDPP)2 (TDPP = thiophene-capped diketopyrrolopyrrole). The open circuit voltage (V(oc)), energetic driving force(ΔE(L-L)), and exciton binding energy (E(b)) were also provided to give an elementary understanding on their cell performance. The results reveal that the frontier molecular orbitals of 3-7 match well with the acceptor material PC61 BM, and compounds 3-5 were found to exhibit the comparable performances to 1 and show promising potential in organic solar cells. In particular, comparing with 1, system 7 with naphthobisthiadiazole acceptor unit displays broader absorption spectrum, higher V(oc), lower E(b), and similar carrier mobility. An in-depth insight into the nature of the involved excited states based on transition density matrix and charge density difference indicates that all S1 states are mainly intramolecular charge transfer states with the charge transfer from central NDT unit to bilateral acceptor units, and also imply that the exciton of 7 can be dissociated easily due to its large extent of the charge transfer. In a word, 7 maybe superior to 1 and may act as a promising donor candidate for organic solar cell. Copyright © 2013 Wiley Periodicals, Inc.
Tokita, Yuichi; Shimura, Jusuke; Nakajima, Hiroshi; Goto, Yoshio; Watanabe, Yoshihito
2008-04-16
Photoinduced electron transfer (ET) in zinc-substituted cytochrome c (Zn-cyt c) has been utilized in many studies on the long-range ET in protein. Attempting to understand its ET mechanism in terms of electronic structure of the molecule, we have calculated an all-electron wave function for the ground-state of Zn-cyt c on the basis of density functional theory (DFT). The four molecular orbitals (MOs) responsible for excitation by UV-vis light (Gouterman's 4-orbitals) are assigned on the basis of the excited states of chromophore model for Zn-porphine complex calculated with the time-dependent DFT method. ET rates between each Gouterman's 4-orbitals and other MOs were estimated using Fermi's golden rule. It appeared that the two occupied MOs of the 4-orbitals show exclusively higher ET rate from/to particular MOs that localize on outermost amino acid residues (Lys 7 or Asn 54), respectively, whereas ET rates involving the two unoccupied MOs of the 4-orbitals are much slower. These results imply that the intramolecular ET in photoexcited Zn-cyt c is governed by the hole transfer through occupied MOs. The couplings of MOs between zinc porphyrin core and specific amino acid residues on the protein surface have been demonstrated in Zn-cyt c immobilized on an Au electrode via carboxylic acid group-terminated self-assembled monolayer. The Zn-cyt c-modified electrode showed photocurrents responsible for photoillumination. The action spectrum of the photocurrent was identical with the absorption spectrum of Zn-cyt c, indicating photoinduced electron conduction via occupied MOs. The voltage dependence of the photocurrent appeared to be linear and bidirectional like a photoconductor, which strongly supports the intramolecular ET mechanism in Zn-cyt c proposed on the basis of the theoretical calculations.
NASA Astrophysics Data System (ADS)
Nie, Wanyi; Gupta, Gautam; Crone, Brian; Wang, Hsing-Lin; Mohite, Aditya; MPA-11 Material synthesis and integrated device Team; MPA-chemistry Team
2014-03-01
The performance of donor (D) /acceptor (A) structure based organic electronic devices, such as solar cell, light emitting devices etc., relays on the charge transfer process at the interface dramatically. In organic solar cell, the photo-induced electron-hole pair is tightly bonded and will form a charge transfer (CT) state at the D/A interface after dissociation. There is a large chance for them to recombine through CT state and thus is a major loss that limit the overall performance. Here, we report three different strategies that allow us to completely suppress the exciplex (or charge transfer state) recombination between any D/A system. We observe that the photocurrent increases by 300% and the power conversion efficiency increases by 4-5 times simply by inserting a spacer layer in the form of an a) insulator b) Oliogomer or using a c) heavy atom at the donor-acceptor interface in a P3HT/C60 bilayer device. By using those different functional mono layers, we successfully suppressed the exciplex recombination in evidence of increased photocurrent and open circuit voltage. Moreover, these strategies are applicable universally to any donor-acceptor interface. And we demonstrated such strategies in a bulk-heterojunction device which improved the power conversion efficiency from 3.5% up to 4.6%.
Development of Multi-Functional Voltage Restore System
NASA Astrophysics Data System (ADS)
Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki
Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.
Study of metal transfer in CO2 laser+GMAW-P hybrid welding using argon-helium mixtures
NASA Astrophysics Data System (ADS)
Zhang, Wang; Hua, Xueming; Liao, Wei; Li, Fang; Wang, Min
2014-03-01
The metal transfer in CO2 Laser+GMAW-P hybrid welding by using argon-helium mixtures was investigated and the effect of the laser on the mental transfer is discussed. A 650 nm laser, in conjunction with the shadow graph technique, is used to observe the metal transfer process. In order to analyze the heat input to the droplet and the droplet internal current line distribution. An optical emission spectroscopy system was employed to estimate default parameter and optimized plasma temperature, electron number densities distribution. The results indicate that the CO2 plasma plume have a significant impact to the electrode melting, droplet formation, detachment, impingement onto the workpiece and weld morphology. Since the current distribution direction flow changes to the keyhole, to obtain a metal transfer mode of one droplet per pulse, the welding parameters should be adjusted to a higher pulse time (TP) and a lower voltage.
Creating and optimizing interfaces for electric-field and photon-induced charge transfer.
Park, Byoungnam; Whitham, Kevin; Cho, Jiung; Reichmanis, Elsa
2012-11-27
We create and optimize a structurally well-defined electron donor-acceptor planar heterojunction interface in which electric-field and/or photon-induced charge transfer occurs. Electric-field-induced charge transfer in the dark and exciton dissociation at a pentacene/PCBM interface were probed by in situ thickness-dependent threshold voltage shift measurements in field-effect transistor devices during the formation of the interface. Electric-field-induced charge transfer at the interface in the dark is correlated with development of the pentacene accumulation layer close to PCBM, that is, including interface area, and dielectric relaxation time in PCBM. Further, we demonstrate an in situ test structure that allows probing of both exciton diffusion length and charge transport properties, crucial for optimizing optoelectronic devices. Competition between the optical absorption length and the exciton diffusion length in pentacene governs exciton dissociation at the interface. Charge transfer mechanisms in the dark and under illumination are detailed.
NASA Astrophysics Data System (ADS)
Seo, Satoshi; Shitagaki, Satoko; Ohsawa, Nobuharu; Inoue, Hideko; Suzuki, Kunihiko; Nowatari, Hiromi; Takahashi, Tatsuyoshi; Hamada, Takao; Watabe, Takeyoshi; Yamada, Yui; Mitsumori, Satomi
2016-09-01
This study investigates an organic light-emitting diode (OLED) utilizing energy transfer from an excited complex (exciplex) comprising donor and acceptor molecules to a phosphorescent dopant. An exciplex has a very small energy gap between the lowest singlet and triplet excited states (S1 and T1). Thus, both S1 and T1 energies of the exciplex can be directly transferred to the T1 of the phosphorescent dopant by adjusting the emission energy of the exciplex to the absorption-edge energy of the dopant. Such an exciplex‒triplet energy transfer (ExTET) achieves high efficiency at low drive voltage because the electrical excitation energy of the exciplex approximates the T1 energy of the dopant. Furthermore, the efficiency of the reverse intersystem crossing (RISC) of the exciplex does not affect the external quantum efficiency (EQE) of the ExTET OLED. The RISC of the exciplex is inhibited when the T1 energy of either donor or acceptor molecules is close to or lower than that of the exciplex itself. Even in this case, however, the ExTET OLED maintains its high efficiency because the T1 energy of each component of the exciplex or the T1 energy of the exciplex itself can be transferred to the dopant. We also varied the emission colors of ExTET OLEDs from sky-blue to red by introducing various phosphorescent dopants. These devices achieved high EQEs (≍30%), low drive voltages (≍3 V), and extremely long lifetimes (e.g., 1 million hours for the orange OLED) at a luminance of 1,000 cd/m2.
NASA Astrophysics Data System (ADS)
Huang, Tao; Zou, Yanhui; Lv, Jianhong; Yang, Jinchun; Tao, Li; Zhou, Jianfei
2017-09-01
Human body under high-voltage AC transmission lines will produce a certain induced voltage due to the electrostatic induction. When the human body contacts with some grounded objects, the charges transfer from the body to the ground and produce contact current which may cause transient electric shock. Using CDEGS and ATP/EMTP, the paper proposes a method for quantitatively calculating the transient electric shock characteristics. It calculates the human body voltage, discharge current and discharge energy under certain 500kV compact-type transmission lines and predicts the corresponding human feelings. The results show that the average root value of discharge current is less than 10mA when the human body is under the 500kV compact-type transmission lines and the human body is overall safe if the transmission lines satisfy the relevant design specifications. It concludes that the electric field strength above the ground should be limited to 4kV/m through the residential area for the purpose of reducing the electromagnetic impact.
NASA Astrophysics Data System (ADS)
Ataei, Milad; Robert, Christian; Boegli, Alexis; Farine, Pierre-André
2015-10-01
This paper describes a detailed design procedure for an efficient thermal body energy harvesting integrated power converter. The procedure is based on the examination of power loss and power transfer in a converter for a self-powered medical device. The efficiency limit for the system is derived and the converter is optimized for the worst case scenario. All optimum system parameters are calculated respecting the transducer constraints and the application form factor. Circuit blocks including pulse generators are implemented based on the system specifications and optimized converter working frequency. At this working condition, it has been demonstrated that the wide area capacitor of the voltage doubler, which provides high voltage switch gating, can be eliminated at the expense of wider switches. With this method, measurements show that 54% efficiency is achieved for just a 20 mV transducer output voltage and 30% of the chip area is saved. The entire electronic board can fit in one EEG or ECG electrode, and the electronic system can convert the electrode to an active electrode.
NASA Astrophysics Data System (ADS)
Chou, Kuan-Yu; Hsu, Nai-Wen; Su, Yi-Hsin; Chou, Chung-Tao; Chiu, Po-Yuan; Chuang, Yen; Li, Jiun-Yun
2018-02-01
We investigate DC characteristics of a two-dimensional electron gas (2DEG) in an undoped Si/SiGe heterostructure and its temperature dependence. An insulated-gate field-effect transistor was fabricated, and transfer characteristics were measured at 4 K-300 K. At low temperatures (T < 45 K), source electrons are injected into the buried 2DEG channel first and drain current increases with the gate voltage. By increasing the gate voltage further, the current saturates followed by a negative transconductance observed, which can be attributed to electron tunneling from the buried channel to the surface channel. Finally, the drain current is saturated again at large gate biases due to parallel conduction of buried and surface channels. By increasing the temperature, an abrupt increase in threshold voltage is observed at T ˜ 45 K and it is speculated that negatively charged impurities at the Al2O3/Si interface are responsible for the threshold voltage shift. At T > 45 K, the current saturation and negative transconductance disappear and the device acts as a normal transistor.
Fabrication and Characteristics of Pentacene/Vanadium Pentoxide Field-Effect Transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minagawa, M.; Nakai, K.; Baba, A.
2011-12-23
Organic field-effect transistors (OFETs) were fabricated using pentacene thin layer, and the effects of inserted Lewis-acid thin layers on electrical properties were investigated. The OFETs have active layers of pentacene and vanadium pentoxide (V{sub 2}O{sub 5}) as a Lewis-acid layer. Typical source-drain current (I{sub DS}) vs. source-drain voltage (V{sub DS}) curves were observed under negative gate voltages (V{sub G}S) application, and the shift of the threshold voltage for FET driving (V{sub t}) to positive side was also observed by V{sub 2}O{sub 5} layer insertion, that is, -2.5 V for device with V{sub 2}O{sub 5} layer and -5.7 V for devicemore » without V{sub 2}O{sub 5} layer. It was thought that charge transfer (CT) complexes which were formed at the interface between pentacene and V{sub 2}O{sub 5} layer were dissociated by the applied gate voltage, and the generated holes seem to contribute to drain current and the apparent V{sub t} improvement.« less
NASA Astrophysics Data System (ADS)
Xu, Pengfei; Zhang, Bo; Wang, Zezhong; Chen, Shuiming; He, Jinliang
2017-12-01
By synchronous measurement of corona current and the water droplet deformation process on a conductor surface, different types of corona discharge are visualized when AC voltage is applied on a line-ground electrode system. The corona characteristics are closely related to the applied voltage and water supply rate. With the increase of AC voltage, the positive Taylor cone discharge firstly appears and then disappears, replaced by the dripping and crashing discharge. Furthermore, the number of pulses in each pulse train increases with the increase of applied voltage. The mechanism of the transfer from the positive Taylor cone discharge to the dripping and crashing discharge is found to be related to the oscillation process of the water droplet. The water supply rate also has a great influence on the characteristics of corona currents. The number of positive pulse trains increases linearly when the water supply rate gets larger, leading to a higher audible noise and radio interference level from the AC corona, which is quite different from that of the DC corona. The difference between the AC and DC coronas under rainfall conditions is analyzed finally.
NASA Astrophysics Data System (ADS)
Lee, Kimoon; Kim, Yong-Hoon; Kim, Jiwan; Oh, Min Suk
2018-05-01
We report on the transparent and flexible enhancement-load inverters which consist of zinc tin oxide (ZTO) thin film transistors (TFTs) fabricated at low process temperature. To control the electrical characteristics of oxide TFTs by oxygen vacancies, we applied low-pressure oxygen rapid thermal annealing (RTA) process to our devices. When we annealed the ZTO TFTs in oxygen ambient of 2 Torr, they showed better electrical characteristics than those of the devices annealed in the air ambient of 760 Torr. To realize oxide thin film transistor and simple inverter circuits on flexible substrate, we annealed the devices in O2 of 2 Torr at 150° C and could achieve the decent electrical properties. When we used transparent conductive oxide electrodes such as indium zinc oxide (IZO) and indium tin oxide (ITO), our transparent and flexible inverter showed the total transmittance of 68% in the visible range and the voltage gain of 5. And the transition voltage in voltage transfer curve was located well within the range of operation voltage.
Electrical properties of nano-resistors made from the Zr-doped HfO2 high-k dielectric film
NASA Astrophysics Data System (ADS)
Zhang, Shumao; Kuo, Yue
2018-03-01
Electrical properties of nano-sized resistors made from the breakdown of the metal-oxide-semiconductor capacitor composed of the amorphous high-k gate dielectric have been investigated under different stress voltages and temperatures. The effective resistance of nano-resistors in the device was estimated from the I-V curve in the high voltage range. It decreased with the increase of the number of resistors. The resistance showed complicated temperature dependence, i.e. it neither behaves like a conductor nor a semiconductor. In the low voltage operation range, the charge transfer was controlled by the Schottky barrier at the nano-resistor/Si interface. The barrier height decreased with the increase of stress voltage, which was probably caused by the change of the nano-resistor composition. Separately, it was observed that the barrier height was dependent on the temperature, which was probably due to the dynamic nano-resistor formation process and the inhomogeneous barrier height distribution. The unique electrical characteristics of this new type of nano-resistors are important for many electronic and optoelectronic applications.
NASA Technical Reports Server (NTRS)
Frederick, Martin E. (Inventor); Jermakian, Joel (Inventor)
1991-01-01
A method and an apparatus is provided for efficiently controlling the power output of a solar cell array string or a plurality of solar cell array strings to achieve a maximum amount of output power from the strings under varying conditions of use. Maximum power output from a solar array string is achieved through control of a pulse width modulated DC/DC buck converter which transfers power from a solar array to a load or battery bus. The input voltage from the solar array to the converter is controlled by a pulse width modulation duty cycle, which in turn is controlled by a differential signal controller. By periodically adjusting the control voltage up or down by a small amount and comparing the power on the load or bus with that generated at different voltage values a maximum power output voltage may be obtained. The system is totally modular and additional solar array strings may be added to the system simply by adding converter boards to the system and changing some constants in the controller's control routines.
Probing α-3(10) transitions in a voltage-sensing S4 helix.
Kubota, Tomoya; Lacroix, Jérôme J; Bezanilla, Francisco; Correa, Ana M
2014-09-02
The S4 helix of voltage sensor domains (VSDs) transfers its gating charges across the membrane electrical field in response to changes of the membrane potential. Recent studies suggest that this process may occur via the helical conversion of the entire S4 between α and 310 conformations. Here, using LRET and FRET, we tested this hypothesis by measuring dynamic changes in the transmembrane length of S4 from engineered VSDs expressed in Xenopus oocytes. Our results suggest that the native S4 from the Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP) does not exhibit extended and long-lived 310 conformations and remains mostly α-helical. Although the S4 of NavAb displays a fully extended 310 conformation in x-ray structures, its transplantation in the Ci-VSP VSD scaffold yielded similar results as the native Ci-VSP S4. Taken together, our study does not support the presence of long-lived extended α-to-310 helical conversions of the S4 in Ci-VSP associated with voltage activation. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.
Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L
2016-02-25
Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.
Unfolding of a temperature-sensitive domain controls voltage-gated channel activation
Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A.; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S.; Minor, Daniel L.
2016-01-01
Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNaV) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNaV CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNaV CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNaV voltage dependencies, and demonstrate that a discrete domain can encode the temperature dependent response of a channel. PMID:26919429
Phosphatidic acid modulation of Kv channel voltage sensor function
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-01-01
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. DOI: http://dx.doi.org/10.7554/eLife.04366.001 PMID:25285449
Brachial artery protected by wrapped latissimus dorsi muscle flap in high voltage electrical injury
Gencel, E.; Eser, C.; Kokacya, O.; Kesiktas, E.; Yavuz, M.
2016-01-01
Summary High voltage electrical injury can disrupt the vascular system and lead to extremity amputations. It is important to protect main vessels from progressive burn necrosis in order to salvage a limb. The brachial artery should be totally isolated from the burned area by a muscle flap to prevent vessel disruption. In this study, we report the use of a wrap-around latissimus dorsi muscle flap to protect a skeletonized brachial artery in a high voltage electrical injury in order to salvage the upper extremity and restore function. The flap wrapped around the exposed brachial artery segment and luminal status of the artery was assessed using magnetic resonance angiography. No vascular intervention was required. The flap survived completely with good elbow function. Extremity amputation was not encountered. This method using a latissimus dorsi flap allows the surgeon to protect the main upper extremity artery and reconstruct arm defects, which contributes to restoring arm function in high voltage electrical injury. PMID:28149236
High frequency x-ray generator basics.
Sobol, Wlad T
2002-02-01
The purpose of this paper is to present basic functional principles of high frequency x-ray generators. The emphasis is put on physical concepts that determine the engineering solutions to the problem of efficient generation and control of high voltage power required to drive the x-ray tube. The physics of magnetically coupled circuits is discussed first, as a background for the discussion of engineering issues related to high-frequency power transformer design. Attention is paid to physical processes that influence such factors as size, efficiency, and reliability of a high voltage power transformer. The basic electrical circuit of a high frequency generator is analyzed next, with focus on functional principles. This section investigates the role and function of basic components, such as power supply, inverter, and voltage doubler. Essential electronic circuits of generator control are then examined, including regulation of voltage, current and timing of electrical power delivery to the x-ray tube. Finally, issues related to efficient feedback control, including basic design of the AEC circuitry are reviewed.
Lee, Chi-Yuan; Fan, Wei-Yuan; Chang, Chih-Ping
2011-01-01
In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS). These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC) and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it.
Lee, Chi-Yuan; Fan, Wei-Yuan; Chang, Chih-Ping
2011-01-01
In this investigation, micro voltage, temperature and humidity sensors were fabricated and integrated for the first time on a stainless steel foil using micro-electro-mechanical systems (MEMS). These flexible multi-functional micro sensors have the advantages of high temperature resistance, flexibility, smallness, high sensitivity and precision of location. They were embedded in a proton exchange membrane fuel cell (PEMFC) and used to simultaneously measure variations in the inner voltage, temperature and humidity. The accuracy and reproducibility of the calibrated results obtained using the proposed micro sensors is excellent. The experimental results indicate that, at high current density and 100%RH or 75%RH, the relative humidity midstream and downstream saturates due to severe flooding. The performance of the PEM fuel cell can be stabilized using home-made flexible multi-functional micro sensors by the in-situ monitoring of local voltage, temperature and humidity distributions within it. PMID:22319361
Brachial artery protected by wrapped latissimus dorsi muscle flap in high voltage electrical injury.
Gencel, E; Eser, C; Kokacya, O; Kesiktas, E; Yavuz, M
2016-06-30
High voltage electrical injury can disrupt the vascular system and lead to extremity amputations. It is important to protect main vessels from progressive burn necrosis in order to salvage a limb. The brachial artery should be totally isolated from the burned area by a muscle flap to prevent vessel disruption. In this study, we report the use of a wrap-around latissimus dorsi muscle flap to protect a skeletonized brachial artery in a high voltage electrical injury in order to salvage the upper extremity and restore function. The flap wrapped around the exposed brachial artery segment and luminal status of the artery was assessed using magnetic resonance angiography. No vascular intervention was required. The flap survived completely with good elbow function. Extremity amputation was not encountered. This method using a latissimus dorsi flap allows the surgeon to protect the main upper extremity artery and reconstruct arm defects, which contributes to restoring arm function in high voltage electrical injury.
40 CFR 761.40 - Marking requirements.
Code of Federal Regulations, 2012 CFR
2012-07-01
... illustrated in Figure 1 is referred to as ML throughout this subpart. (1) PCB Containers; (2) PCB Transformers...) Equipment containing a PCB Transformer or a PCB Large High Voltage Capacitor at the time of manufacture, at... this section); (8) Heat transfer systems (other than PCB Transformers) using PCBs (See also paragraph...
40 CFR 761.40 - Marking requirements.
Code of Federal Regulations, 2010 CFR
2010-07-01
... illustrated in Figure 1 is referred to as ML throughout this subpart. (1) PCB Containers; (2) PCB Transformers...) Equipment containing a PCB Transformer or a PCB Large High Voltage Capacitor at the time of manufacture, at... this section); (8) Heat transfer systems (other than PCB Transformers) using PCBs (See also paragraph...
40 CFR 761.40 - Marking requirements.
Code of Federal Regulations, 2013 CFR
2013-07-01
... illustrated in Figure 1 is referred to as ML throughout this subpart. (1) PCB Containers; (2) PCB Transformers...) Equipment containing a PCB Transformer or a PCB Large High Voltage Capacitor at the time of manufacture, at... this section); (8) Heat transfer systems (other than PCB Transformers) using PCBs (See also paragraph...
40 CFR 761.40 - Marking requirements.
Code of Federal Regulations, 2011 CFR
2011-07-01
... illustrated in Figure 1 is referred to as ML throughout this subpart. (1) PCB Containers; (2) PCB Transformers...) Equipment containing a PCB Transformer or a PCB Large High Voltage Capacitor at the time of manufacture, at... this section); (8) Heat transfer systems (other than PCB Transformers) using PCBs (See also paragraph...
40 CFR 761.40 - Marking requirements.
Code of Federal Regulations, 2014 CFR
2014-07-01
... illustrated in Figure 1 is referred to as ML throughout this subpart. (1) PCB Containers; (2) PCB Transformers...) Equipment containing a PCB Transformer or a PCB Large High Voltage Capacitor at the time of manufacture, at... this section); (8) Heat transfer systems (other than PCB Transformers) using PCBs (See also paragraph...
Optimal line drop compensation parameters under multi-operating conditions
NASA Astrophysics Data System (ADS)
Wan, Yuan; Li, Hang; Wang, Kai; He, Zhe
2017-01-01
Line Drop Compensation (LDC) is a main function of Reactive Current Compensation (RCC) which is developed to improve voltage stability. While LDC has benefit to voltage, it may deteriorate the small-disturbance rotor angle stability of power system. In present paper, an intelligent algorithm which is combined by Genetic Algorithm (GA) and Backpropagation Neural Network (BPNN) is proposed to optimize parameters of LDC. The objective function proposed in present paper takes consideration of voltage deviation and power system oscillation minimal damping ratio under multi-operating conditions. A simulation based on middle area of Jiangxi province power system is used to demonstrate the intelligent algorithm. The optimization result shows that coordinate optimized parameters can meet the multioperating conditions requirement and improve voltage stability as much as possible while guaranteeing enough damping ratio.
Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing
NASA Technical Reports Server (NTRS)
Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.
2013-01-01
Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the voltage offsets were measured as a function of initial voltage, and these data were fitwith a linear function that was constrained to pass through the origin. The best fit solution had a correlation coefficient of R=0.85 and a slope of approximately -0.0228 volts/volt. The voltage offset when normalizedis demonstrated to be constant -2.28% for both positive and negative polarities over nearly 3 orders ofbaseline voltage magnitude. From this, the voltage-force coefficient is derived to be -0.34 ppm/N. Thiscorrelates well to a first-order parallel plate capacitor model that assumes constant area, and smalldeformation such that the polymer may be mechanically modeled by a spring that obeys Hookes law. Thissimple model predicts that the coefficient of proportionality is a function of Youngs modulus E= 0.8 GPaand surface area of the insulator, theoretically -1EA= -0.31 ppm/N. The outcome of this work is animproved insulator made from ultra-high molecular weight (UHMW) polyethylene and other approachestoward the minimization of and compensation for these experimental artifacts.
Watt, D.A.
1956-07-01
A current transfer system is described for transferring current between a rotating member and a co-axial stationary member. The particular area of application for the invention is in connection with homopolar generators where a low voltage and high current are generated. The current tramsfer system of the invention comprises a rotor member and a co-axial stator member wherein one of the members is shaped to provide a circumferential surface concave in section and the other member is shaped to have a peripheral portion in close proximity to the surface, whereby a liquid metal can be stably supported between the two members when they are moving relative to one another to establish an electrical conducting path between the members.
Research Update: Spin transfer torques in permalloy on monolayer MoS 2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Wei; Sklenar, Joseph; Hsu, Bo
2016-03-01
We observe current induced spin transfer torque resonance in permalloy (Py) grown on monolayer MoS2. By passing rf current through the Py/MoS2 bilayer, field-like and damping-like torques are induced which excite the ferromagnetic resonance of Py. The signals are detected via a homodyne voltage from anisotropic magnetoresistance of Py. In comparison to other bilayer systems with strong spin-orbit torques, the monolayer MoS2 cannot provide bulk spin Hall effects and thus indicates the purely interfacial nature of the spin transfer torques. Therefore our results indicate the potential of two-dimensional transition-metal dichalcogenide for the use of interfacial spin-orbitronics applications.
Exploring the Use of the LT3480 (RH3480) Circuit as Low-Power, Low-Voltage Solar Array Regulator
NASA Astrophysics Data System (ADS)
Garrigos, A.; Lizan, J. L.; Blanes, J. M.; Gutierrez, R.
2014-08-01
With the advent of PoL technology, several commercial integrated switching regulators already have their space- qualified versions. Apart of PoL and secondary supply applications, other functions can be explored using those integrated circuits. In this work, the Solar Array Regulator function is analyzed using the commercial LT3480 circuit, which has the space counterpart (RH3480) commercialized by MSK and named MSK5058RH and later MSK5031 (but not rad-hard). Input voltage regulation, taper charge, protection functions and module parallelization are studied and verified experimentally in a low-voltage, low-power MPPT battery bus configuration. Potential users of this approach are micro and nano-satellites power systems.
IGZO TFT-based circuit with tunable threshold voltage by laser annealing
NASA Astrophysics Data System (ADS)
Huang, Xiaoming; Yu, Guang; Wu, Chenfei
2017-11-01
In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.
A CMOS Humidity Sensor for Passive RFID Sensing Applications
Deng, Fangming; He, Yigang; Zhang, Chaolong; Feng, Wei
2014-01-01
This paper presents a low-cost low-power CMOS humidity sensor for passive RFID sensing applications. The humidity sensing element is implemented in standard CMOS technology without any further post-processing, which results in low fabrication costs. The interface of this humidity sensor employs a PLL-based architecture transferring sensor signal processing from the voltage domain to the frequency domain. Therefore this architecture allows the use of a fully digital circuit, which can operate on ultra-low supply voltage and thus achieves low-power consumption. The proposed humidity sensor has been fabricated in the TSMC 0.18 μm CMOS process. The measurements show this humidity sensor exhibits excellent linearity and stability within the relative humidity range. The sensor interface circuit consumes only 1.05 μW at 0.5 V supply voltage and reduces it at least by an order of magnitude compared to previous designs. PMID:24841250
A CMOS humidity sensor for passive RFID sensing applications.
Deng, Fangming; He, Yigang; Zhang, Chaolong; Feng, Wei
2014-05-16
This paper presents a low-cost low-power CMOS humidity sensor for passive RFID sensing applications. The humidity sensing element is implemented in standard CMOS technology without any further post-processing, which results in low fabrication costs. The interface of this humidity sensor employs a PLL-based architecture transferring sensor signal processing from the voltage domain to the frequency domain. Therefore this architecture allows the use of a fully digital circuit, which can operate on ultra-low supply voltage and thus achieves low-power consumption. The proposed humidity sensor has been fabricated in the TSMC 0.18 μm CMOS process. The measurements show this humidity sensor exhibits excellent linearity and stability within the relative humidity range. The sensor interface circuit consumes only 1.05 µW at 0.5 V supply voltage and reduces it at least by an order of magnitude compared to previous designs.
Electrical properties of fullerenol C60(OH)10/Au interface
NASA Astrophysics Data System (ADS)
Sakaino, Masamichi; Sun, Yong; Morimoto, Fumio
2014-01-01
Electrical properties of the C60(OH)10/Au contact have been studied by measuring its current-voltage characteristics in the temperature range of 300-500 K. The Schottky barrier of the C60(OH)10/Au contact was confirmed to be 0.70±0.02 eV from Arrhenius plots of the current-voltage characteristics measured at various bias voltages as well as various preparation conditions of the C60(OH)10 material. Significant effect of the applied electric field on the barrier height has not been observed in the range of 0.1-2.0 MVm-1. The effects of both the charge transfer from C60 cage to OH groups and the crystallinity of the C60(OH)10 material on the Schottky barrier were discussed on the basis of x-ray photoemission spectroscopy and x-ray diffraction analyses.
Distributed control system for parallel-connected DC boost converters
Goldsmith, Steven
2017-08-15
The disclosed invention is a distributed control system for operating a DC bus fed by disparate DC power sources that service a known or unknown load. The voltage sources vary in v-i characteristics and have time-varying, maximum supply capacities. Each source is connected to the bus via a boost converter, which may have different dynamic characteristics and power transfer capacities, but are controlled through PWM. The invention tracks the time-varying power sources and apportions their power contribution while maintaining the DC bus voltage within the specifications. A central digital controller solves the steady-state system for the optimal duty cycle settings that achieve a desired power supply apportionment scheme for a known or predictable DC load. A distributed networked control system is derived from the central system that utilizes communications among controllers to compute a shared estimate of the unknown time-varying load through shared bus current measurements and bus voltage measurements.
NASA Astrophysics Data System (ADS)
Chen, Jianhui; Chen, Bingbing; Shen, Yanjiao; Guo, Jianxin; Liu, Baoting; Dai, Xiuhong; Xu, Ying; Mai, Yaohua
2017-11-01
A hysteresis loop of minority carrier lifetime vs voltage is found in polystyrenesulfonate (PSS)/Si organic-inorganic hybrid heterojunctions, implying an interfacial memory effect. Capacitance-voltage and conductance-voltage hysteresis loops are observed and reveal a memory window. A switchable interface state, which can be controlled by charge transfer based on an electrochemical oxidation/deoxidation process, is suggested to be responsible for this hysteresis effect. We perform first-principle total-energy calculations on the influence of external electric fields and electrons or holes, which are injected into interface states on the adsorption energy of PSS on Si. It is demonstrated that the dependence of the interface adsorption energy difference on the electric field is the origin of this two-state switching. These results offer a concept of organic-inorganic hybrid interface memory being optically or electrically readable, low-cost, and compatible with the flexible organic electronics.
Control of power to an inductively heated part
Adkins, Douglas R.; Frost, Charles A.; Kahle, Philip M.; Kelley, J. Bruce; Stanton, Suzanne L.
1997-01-01
A process for induction hardening a part to a desired depth with an AC signal applied to the part from a closely coupled induction coil includes measuring the voltage of the AC signal at the coil and the current passing through the coil; and controlling the depth of hardening of the part from the measured voltage and current. The control system determines parameters of the part that are functions of applied voltage and current to the induction coil, and uses a neural network to control the application of the AC signal based on the detected functions for each part.
Control of power to an inductively heated part
Adkins, D.R.; Frost, C.A.; Kahle, P.M.; Kelley, J.B.; Stanton, S.L.
1997-05-20
A process for induction hardening a part to a desired depth with an AC signal applied to the part from a closely coupled induction coil includes measuring the voltage of the AC signal at the coil and the current passing through the coil; and controlling the depth of hardening of the part from the measured voltage and current. The control system determines parameters of the part that are functions of applied voltage and current to the induction coil, and uses a neural network to control the application of the AC signal based on the detected functions for each part. 6 figs.
Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang
2016-01-01
Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation, emphasizing that VSPs can cleave the 3-phosphate of PI(3,4,5)P3. PMID:27222577
NASA Astrophysics Data System (ADS)
Chen, R. M.; Diggins, Z. J.; Mahatme, N. N.; Wang, L.; Zhang, E. X.; Chen, Y. P.; Zhang, H.; Liu, Y. N.; Narasimham, B.; Witulski, A. F.; Bhuva, B. L.; Fleetwood, D. M.
2017-08-01
The single-event sensitivity of bulk 40-nm sequential circuits is investigated as a function of temperature and supply voltage. An overall increase in SEU cross section versus temperature is observed at relatively high supply voltages. However, at low supply voltages, there is a threshold temperature beyond which the SEU cross section decreases with further increases in temperature. Single-event transient induced errors in flip-flops also increase versus temperature at relatively high supply voltages and are more sensitive to temperature variation than those caused by single-event upsets.
Methylmercury (CH3Hg+) alters the function of voltage-gated Na+ and Ca2+ channels in neuronal preparations following acute, in vitro, exposure. Because the developing nervous system is particularly sensitive to CH3Hg+ neurotoxicity, effects on voltage-gated Na+ (INa) and Ca2+ (IC...
Clock jitter generator with picoseconds resolution
NASA Astrophysics Data System (ADS)
Jovanović, Goran; Stojčev, Mile; Nikolić, Tatjana
2013-06-01
The clock is one of the most critical signals in any synchronous system. As CMOS technology has scaled, supply voltages have dropped chip power consumption has increased and the effects of jitter due to clock frequency increase have become critical and jitter budget has become tighter. This article describes design and development of low-cost mixed-signal programmable jitter generator with high resolution. The digital technique is used for coarse-grain and an analogue technique for fine-grain clock phase shifting. Its structure allows injection of various random and deterministic jitter components in a controllable and programmable fashion. Each jitter component can be switched on or off. The jitter generator can be used in jitter tolerance test and jitter transfer function measurement of high-speed synchronous digital circuits. At operating system clock frequency of 220 MHz, a jitter with 4 ps resolution can be injected.
From "seahorse" to "molecular Recording"
NASA Astrophysics Data System (ADS)
Gao, Hong-Jun
2002-08-01
We will first present unique dendritic "seahorse" patterns observed when we study structural features in functional C60-TCNQ complex thin films, and their formation mechanism. Then we report a new process for ultrahigh density, erasable data storage, based on the molecular electrical bistability of an organic charge transfer complex, 3-nitrobenzal malononitrile and 1,4-phenylenediamine (NBMN-pDA). Switched by a voltage pulse from a scanning tunneling microscope (STM), we demonstrate a data density exceeding 1013 bits/cm2. The experiment results and theoretical ab initio calculations show the writing and erasing mechanism to be a conductance transition of the organic compound due to a structural change from crystalline to noncrystalline. The ultimate bit density appears limited only by the size of the organic complex, less than 1 nm in our case, corresponding to 1014 bits/cm2.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Puri, Nidhi; Department of Physics, Faculty of Natural Sciences, Jamia Millia Islamia, New Delhi 110025; Niazi, Asad
2014-10-13
We report the fabrication of a single-walled carbon nanotube (SWNT) based ultrasensitive label-free chemiresistive biosensor for the detection of human cardiac biomarker, myoglobin (Ag-cMb). Poly(pyrrole-co-pyrrolepropylic acid) with pendant carboxyl groups was electrochemically deposited on electrophoretically aligned SWNT channel, as a conducting linker, for biomolecular immobilization of highly specific cardiac myoglobin antibody. The device was characterized by scanning electron microscopy, source-drain current-voltage (I-V), and charge-transfer characteristic studies. The device exhibited a linear response with a change in conductance in SWNT channel towards the target, Ag-cMb, over the concentration range of 1.0 to 1000 ng ml{sup −1} with a sensitivity of ∼118% per decademore » with high specificity.« less