NASA Astrophysics Data System (ADS)
Miyaji, Kousuke; Yajima, Ryoji; Hatanaka, Teruyoshi; Takahashi, Mitsue; Sakai, Shigeki; Takeuchi, Ken
Initialize and weak-program erasing scheme is proposed to achieve high-performance and high-reliability Ferroelectric (Fe-) NAND flash solid-state drive (SSD). Bit-by-bit erase VTH control is achieved by the proposed erasing scheme and history effects in Fe-NAND is also suppressed. History effects change the future erase VTH shift characteristics by the past program voltage. The proposed erasing scheme decreases VTH shift variation due to history effects from ±40% to ±2% and the erase VTH distribution width is reduced from over 0.4V to 0.045V. As a result, the read and VPASS disturbance decrease by 42% and 37%, respectively. The proposed erasing scheme is immune to VTH variations and voltage stress. The proposed erasing scheme also suppresses the power and bandwidth degradation of SSD.
NASA Astrophysics Data System (ADS)
Lükens, G.; Yacoub, H.; Kalisch, H.; Vescan, A.
2016-05-01
The interface charge density between the gate dielectric and an AlGaN/GaN heterostructure has a significant impact on the absolute value and stability of the threshold voltage Vth of metal-insulator-semiconductor (MIS) heterostructure field effect transistor. It is shown that a dry-etching step (as typically necessary for normally off devices engineered by gate-recessing) before the Al2O3 gate dielectric deposition introduces a high positive interface charge density. Its origin is most likely donor-type trap states shifting Vth to large negative values, which is detrimental for normally off devices. We investigate the influence of oxygen plasma annealing techniques of the dry-etched AlGaN/GaN surface by capacitance-voltage measurements and demonstrate that the positive interface charge density can be effectively compensated. Furthermore, only a low Vth hysteresis is observable making this approach suitable for threshold voltage engineering. Analysis of the electrostatics in the investigated MIS structures reveals that the maximum Vth shift to positive voltages achievable is fundamentally limited by the onset of accumulation of holes at the dielectric/barrier interface. In the case of the Al2O3/Al0.26Ga0.74N/GaN material system, this maximum threshold voltage shift is limited to 2.3 V.
NASA Astrophysics Data System (ADS)
Han, Chang-Wook; Han, Min-Koo; Choi, Nack-Bong; Kim, Chang-Dong; Kim, Ki-Yong; Chung, In-Jae
2007-07-01
Hydrogenated amorphous silicon (a-Si:H) thin-film transistors (TFTs) were fabricated on a flexible stainless-steel (SS) substrate. The stability of the a-Si:H TFT is a key issue for active matrix organic light-emitting diodes (AMOLEDs). The drain current decreases because of the threshold voltage shift (Δ VTH) during OLED driving. A negative voltage at a floated gate can be induced by a negative substrate bias through a capacitor between the substrate and the gate electrode without additional circuits. The negative voltage biased at the SS substrate can recover Δ VTH and reduced drain current of the driving TFT. The VTH of the TFT increased by 2.3 V under a gate bias of +15 V and a drain bias of +15 V at 65 °C applied for 3,500 s. The VTH decreased by -2.3 V and the drain current recovered 97% of its initial value under a substrate bias of -23 V at 65 °C applied for 3,500 s.
NASA Astrophysics Data System (ADS)
Kwon, Dae Woong; Kim, Jang Hyun; Chang, Ji Soo; Kim, Sang Wan; Sun, Min-Chul; Kim, Garam; Kim, Hyun Woo; Park, Jae Chul; Song, Ihun; Kim, Chang Jung; Jung, U. In; Park, Byung-Gook
2010-11-01
A comprehensive study is done regarding stabilities under simultaneous stress of light and dc-bias in amorphous hafnium-indium-zinc-oxide thin film transistors. The positive threshold voltage (Vth) shift is observed after negative gate bias and light stress, and it is completely different from widely accepted phenomenon which explains that negative-bias stress results in Vth shift in the left direction by bias-induced hole-trapping. Gate current measurement is performed to explain the unusual positive Vth shift under simultaneous application of light and negative gate bias. As a result, it is clearly found that the positive Vth shift is derived from electron injection from gate electrode to gate insulator.
Origin of positive fixed charge at insulator/AlGaN interfaces and its control by AlGaN composition
NASA Astrophysics Data System (ADS)
Matys, M.; Stoklas, R.; Blaho, M.; Adamowicz, B.
2017-06-01
The key feature for the precise tuning of Vth in GaN-based metal-insulator-semiconductor (MIS) high electron mobility transistors is the control of the positive fixed charge (Qf) at the insulator/III-N interfaces, whose amount is often comparable to the negative surface polarization charge ( Qp o l -). In order to clarify the origin of Qf, we carried out a comprehensive capacitance-voltage (C-V) characterization of SiO2/AlxGa1-xN/GaN and SiN/AlxGa1-xN/GaN structures with Al composition (x) varying from 0.15 to 0.4. For both types of structures, we observed a significant Vth shift in C-V curves towards the positive gate voltage with increasing x. On the contrary, the Schottky gate structures exhibited Vth shift towards the more negative biases. From the numerical simulations of C-V curves using the Poisson's equation supported by the analytical calculations of Vth, we showed that the Vth shift in the examined MIS structures is due to a significant decrease in the positive Qf with rising x. Finally, we examined this result with respect to various hypotheses developed in the literature to explain the origin of the positive Qf at insulator/III-N interfaces.
NASA Astrophysics Data System (ADS)
Xu, Wangying; Dai, Mingzhi; Liang, Lingyan; Liu, Zhimin; Sun, Xilian; Wan, Qing; Cao, Hongtao
2012-05-01
InZnO thin-film transistors using high-κ Ta2O5 gate dielectric are presented and analysed. The large capacitance coupling effect of amorphous Ta2O5 results in fabricated devices with good electrical properties. However, an anomalous negative threshold voltage (Vth) shift under positive bias stress is observed. It is suggested that electron detrapping from the high-κ Ta2O5 dielectric to the gate electrode is responsible for this Vth shift, which is supported both by the logarithmical dependence of the Vth change on the duration of the bias stress and device simulation extracted trapped charges involved.
Effect of Fluorine Diffusion on Amorphous-InGaZnO-Based Thin-Film Transistors.
Jiang, Jingxin; Furuta, Mamoru
2018-08-01
This study investigated the effect of fluorine (F) diffusion from a fluorinated siliconnitride passivation layer (SiNX:F-Pa) into amorphous-InGaZnO-based thin-film transistors (a-IGZO TFTs). The results of thermal desorption spectroscopy and secondary ion mass spectrometry revealed that F was introduced into the SiOX etch-stopper layer (SiOX-ES) during the deposition of a SiNX:F-Pa, and did not originate from desorption of Si-F bonds; and that long annealing times enhanced F diffusion from the SiOX-ES layer to the a-IGZO channel. Improvements to the performance and threshold-voltage (Vth) negative shift of IGZO TFTs were achieved when annealing time increased from 1 h to 3 h; and capacitance-voltage results indicated that F acted as a shallow donor near the source side in a-IGZO and induced the negative Vth shift. In addition, it was found that when IGZO TFTs with SiNX:F-Pa were annealed 4 h, a low-resistance region was formed at the backchannel of the TFT, leading to a drastic negative Vth shift.
IGZO TFT-based circuit with tunable threshold voltage by laser annealing
NASA Astrophysics Data System (ADS)
Huang, Xiaoming; Yu, Guang; Wu, Chenfei
2017-11-01
In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.
NASA Astrophysics Data System (ADS)
Tsai, Jyun-Yu; Chang, Ting-Chang; Lo, Wen-Hung; Ho, Szu-Han; Chen, Ching-En; Chen, Hua-Mao; Tseng, Tseung-Yuen; Tai, Ya-Hsiang; Cheng, Osbert; Huang, Cheng-Tung
2013-09-01
This work investigates the channel hot carrier (CHC) effect in HfO2/Ti1-xNx p-channel metal oxide semiconductor field effect transistors (p-MOSFETs). Generally, the subthreshold swing (S.S.) should increase during CHC stress (CHCS), since interface states will be generated near the drain side under high electric field due to drain voltage (Vd). However, our experimental data indicate that S.S. has no evident change under CHCS, but threshold voltage (Vth) shifts positively. This result can be attributed to hot carrier injected into high-k dielectric near the drain side. Meanwhile, it is surprising that such Vth degradation is not observed in the saturation region during stress. Therefore, drain-induced-barrier-lowering (DIBL) as a result of CHC-induced electron trapping is proposed to explain the different Vth behaviors in the linear and saturation regions. Additionally, the influence of different nitrogen concentrations in HfO2/Ti1-xNx p-MOSFETs on CHCS is also investigated in this work. Since nitrogen diffuses to SiO2/Si interface induced pre-Nit occurring to degrades channel mobility during the annealing process, a device with more nitrogen shows slightly less impact ionization, leading to insignificant charge trapping-induced DIBL behavior.
NASA Astrophysics Data System (ADS)
Mativenga, Mallory; Kang, Dong Han; Lee, Ung Gi; Jang, Jin
2012-09-01
Bias instability of top-gate amorphous-indium-gallium-zinc-oxide thin-film transistors with source- and drain-offsets is reported. Positive and negative gate bias-stress (VG_STRESS) respectively induce reversible negative threshold-voltage shift (ΔVTH) and reduction in on-current. Migration of positive charges towards the offsets lowers the local resistance of the offsets, resulting in the abnormal negative ΔVTH under positive VG_STRESS. The reduction in on-current under negative VG_STRESS is due to increase in resistance of the offsets when positive charges migrate away from the offsets. Appropriate drain and source bias-stresses applied simultaneously with VG_STRESS either suppress or enhance the instability, verifying lateral ion migration to be the instability mechanism.
Effect of gate bias sweep rate on the threshold voltage of in-plane gate nanowire transistor
NASA Astrophysics Data System (ADS)
Liu, H. X.; Li, J.; Tan, R. R.
2018-01-01
In2O3 nanowire electric-double-layer (EDL) transistors with in-plane gate gated by SiO2 solid-electrolyte are fabricated on transparent glass substrates. The gate voltage sweep rates can effectively modulate the threshold voltage (Vth) of nanowire device. Both depletion mode and enhancement mode are realized, and the Vth shift of the nanowire transistors is estimated to be 0.73V (without light). This phenomenon is due to increased adsorption of oxygen on the nanowire surface by the slower gate voltage sweep rates. Adsorbed oxygens capture electrons and cause a surface of nanowire channel was depleted. The operation voltage of transistor was 1.0 V, because the EDL gate dielectric can lead to high gate dielectric capacitance. These transparent in-plane gate nanowire transistors are promising for “see-through” nanoscale sensors.
NASA Astrophysics Data System (ADS)
Kunii, M.; Iino, H.; Hanna, J.
2017-06-01
Bias-stress effects in solution-processed, 2-decyl-7-phenyl-[1]benzothieno[3,2-b][1]benzothiophene (Ph-BTBT-10) field effect transistors (FETs) are studied under negative and positive direct current bias. The bottom gate, bottom contact polycrystalline Ph-BTBT-10 FET with a hybrid gate dielectric of polystyrene and SiO2 shows high field effect mobility as well as a steep subthreshold slope when fabricated with a highly ordered smectic E liquid crystalline (SmE) film as a precursor. Negative gate bias-stress causes negative threshold voltage shift (ΔVth) for Ph-BTBT-10 FET in ambient air, but ΔVth rapidly decreases as the gate bias decreases and approaches to near zero when the gate bias goes down to 9 V in amplitude. In contrast, positive gate bias-stress causes negligible ΔVth even with a relatively high bias voltage. These results conclude that Ph-BTBT-10 FET has excellent bias-stress stability in ambient air in the range of low to moderate operating voltages.
NASA Astrophysics Data System (ADS)
Wang, Wenwu; Akiyama, Koji; Mizubayashi, Wataru; Nabatame, Toshihide; Ota, Hiroyuki; Toriumi, Akira
2009-03-01
We systematically studied what effect Al diffusion from high-k dielectrics had on the flatband voltage (Vfb) of Al-incorporated high-k gate stacks. An anomalous positive shift fin Vfb with the decreasing equivalent oxide thickness (EOT) of high-k gate stacks is reported. As the SiO2 interfacial layer is aggressively thinned in Al-incorporated HfxAl1-xOy gate stacks with a metal-gate electrode, the Vfb first lies on the well known linear Vfb-EOT plot and deviates toward the positive-voltage direction (Vfb roll-up), followed by shifting toward negative voltage (Vfb roll-off). We demonstrated that the Vfb roll-up behavior remarkably decreases the threshold voltage (Vth) of p-type metal-oxide-semiconductor field-effect transistors (p-MOSFETs), and does not cause severe degradation in the characteristics of hole mobility. The Vfb roll-up behavior, which is independent of gate materials but strongly dependent on high-k dielectrics, was ascribed to variations in fixed charges near the SiO2/Si interface, which are caused by Al diffusion from HfxAl1-xOy through SiO2 to the SiO2/Si interface. These results indicate that anomalous positive shift in Vfb, i.e., Vfb roll-up, should be taken into consideration in quantitatively adjusting Vfb in thin EOT regions and that it could be used to further tune Vth in p-MOSFETs.
NASA Astrophysics Data System (ADS)
Jeon, Jae Kwon; Um, Jae Gwang; Lee, Suhui; Jang, Jin
2017-12-01
We report two-step annealing, high temperature and sequent low temperature, for amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistor (TFT) to improve its stability and device performance. The annealing is carried out at 300 oC in N2 ambient for 1 h (1st step annealing) and then at 250 oC in vacuum for 10 h (2nd step annealing). It is found that the threshold voltage (VTH) changes from 0.4 V to -2.0 V by the 1st step annealing and to +0.6 V by 2nd step annealing. The mobility changes from 18 cm2V-1s-1 to 25 cm2V-1s-1 by 1st step and decreases to 20 cm2V-1s-1 by 2nd step annealing. The VTH shift by positive bias temperature stress (PBTS) is 3.7 V for the as-prepared TFT, and 1.7 V for the 1st step annealed TFT, and 1.3 V for the 2nd step annealed TFT. The XPS (X-ray photoelectron spectroscopy) depth analysis indicates that the reduction in O-H bonds at the top interface (SiO2/a-IGZO) by 2nd step annealing appears, which is related to the positive VTH shift and smaller VTH shift by PBTS.
Effect of 30 MeV Li3+ ion and 8 MeV electron irradiation on N-channel MOSFETs
NASA Astrophysics Data System (ADS)
Prakash, A. P. G.; Ganesh, K. C. P.; Nagesha, Y. N.; Umakanth, D.; Arora, S. K.; Siddappa, K.
The effect of 30 MeV Li3+ ion and 8 MeV electron irradiation on the threshold voltage (V-TH), the voltage shift due to interface trapped charge (DeltaV(Nit)), the voltage shift due to oxide trapped charge (DeltaV(Not)), the density of interface trapped charge (DeltaN(it)), the density of oxide trapped charge (DeltaN(ot) ) and the drain saturation current (I-D Sat) were studied as a function of fluence. Considerable increase in DeltaN(it) and DeltaN(ot) , and decrease in V-TH and I-D Sat were observed in both types of irradiation. The observed difference in the properties of Li3+ ion and electron irradiated MOSFETs are interpreted on the basis of energy loss process associated with the type of radiation. The study showed that the 30 MeV Li3+ ion irradiation produce more damage when compared to the 8 MeV electron irradiation because of the higher electronic energy loss value. High temperature annealing studies showed that trapped charge generated during ion and electron irradiation was annealed out at 500 degreesC.
NASA Astrophysics Data System (ADS)
Djezzar, Boualem; Tahi, Hakim; Benabdelmoumene, Abdelmadjid; Chenouf, Amel; Kribes, Youcef
2012-11-01
In this paper, we present a new method, named on the fly oxide trap (OTFOT), to extract the bias temperature instability (BTI) in MOS transistors. The OTFOT method is based on charge pumping technique (CP) at low and high frequencies. We emphasize on the theoretical-based concept, giving a clear insight on the easy-use of the OTFOT methodology and demonstrating its viability to characterize the negative BTI (NBTI). Using alternatively high and low frequencies, OTFOT method separates the interface-traps (ΔNit) and border-trap (ΔNbt) (switching oxide-trap) densities independently and also their contributions to the threshold voltage shift (ΔVth), without needing additional methods. The experimental results, from two experimental scenarios, showing the extraction of NBTI-induced shifts caused by interface- and oxide-trap increases are also presented. In the first scenario, all stresses are performed on the same transistor. It exhibits an artifact value of exponent n. In the second scenario, each voltage stress is applied only on one transistor. Its results show an average n of 0.16, 0.05, and 0.11 for NBTI-induced ΔNit, ΔNbt, ΔVth, respectively. Therefore, OTFOT method can contribute to further understand the behavior of the NBTI degradation, especially through the threshold voltage shift components such as ΔVit and ΔVot caused by interface-trap and border-trap, respectively.
Visible-light-induced instability in amorphous metal-oxide based TFTs for transparent electronics
NASA Astrophysics Data System (ADS)
Ha, Tae-Jun
2014-10-01
We investigate the origin of visible-light-induced instability in amorphous metal-oxide based thin film transistors (oxide-TFTs) for transparent electronics by exploring the shift in threshold voltage (Vth). A large hysteresis window in amorphous indium-gallium-zinc-oxide (a-IGZO) TFTs possessing large optical band-gap (≈3 eV) was observed in a visible-light illuminated condition whereas no hysteresis window was shown in a dark measuring condition. We also report the instability caused by photo irradiation and prolonged gate bias stress in oxide-TFTs. Larger Vth shift was observed after photo-induced stress combined with a negative gate bias than the sum of that after only illumination stress and only negative gate bias stress. Such results can be explained by trapped charges at the interface of semiconductor/dielectric and/or in the gate dielectric which play a role in a screen effect on the electric field applied by gate voltage, for which we propose that the localized-states-assisted transitions by visible-light absorption can be responsible.
Park, Ji Hoon; Lee, Young Tack; Lee, Hee Sung; Lee, Jun Young; Lee, Kimoon; Lee, Gyu Baek; Han, Jiwon; Kim, Tae Woong; Im, Seongil
2013-03-13
The stabilities of a blending type organic thin-film transistor with phase-separated TIPS-pentacene channel layer were characterized under the conditions of negative-bias-stress (NBS) and positive-bias-stress (PBS). During NBS, threshold voltage (Vth) shifts noticeably. NBS-imposed devices revealed interfacial trap density-of-states (DOS) at 1.56 and 1.66 eV, whereas initial device showed the DOS at only 1.56 eV, as measured by photoexcited charge-collection spectroscopy (PECCS) method. Possible origin of this newly created defect is related to ester group in PMMA, which induces some hole traps at the TIPS-pentacene/i-PMMA interface. PBS-imposed device showed little Vth shift but visible off-current increase as "back-channel" effect, which is attributed to the water molecules trapped on the TFT surface.
NASA Astrophysics Data System (ADS)
Kamei, Masayuki; Takao, Yoshinori; Eriguchi, Koji; Ono, Kouichi
2014-01-01
We clarified in this study how plasma-induced charging damage (PCD) affects the so-called “random telegraph noise (RTN)” — a principal concern in designing ultimately scaled large-scale integrated circuits (LSIs). Metal-oxide-semiconductor field-effect transistors (MOSFETs) with SiO2 and high-k gate dielectric were exposed to an inductively coupled plasma (ICP) with Ar gas. Drain current vs gate voltage (Ids-Vg) characteristics were obtained before and after the ICP plasma exposure for the same device. Then, the time evolution of Ids fluctuation defined as Ids/μIds was measured, where μIds is the mean Ids. This value corresponds to an RTN feature, and RTN was obtained under various gate voltages (Vg) by a customized measurement technique. We focused on the statistical distribution width of (Ids/μIds), δ(Ids/μIds), in order to clarify the effects of PCD on RTN. δ(Ids/μIds) was increased by PCD for both MOSFETs with the SiO2 and high-k gate dielectrics, suggesting that RTN can be used as a measure of PCD, i.e., a distribution width increase directly indicates the presence of PCD. The dependence of δ(Ids/μIds) on the overdrive voltage Vg-Vth, where Vth is the threshold voltage, was investigated by the present technique. It was confirmed that δ(Ids/μIds) increased with a decrease in the overdrive voltage for MOSFETs with the SiO2 and high-k gate dielectrics. The presence of created carrier trap sites with PCD was characterized by the time constants for carrier capture and emission. The threshold voltage shift (ΔVth) induced by PCD was also evaluated and compared with the RTN change, to correlate the RTN increase with ΔVth induced by PCD. Although the estimated time constants exhibited complex behaviors due to the nature of trap sites created by PCD, δ(Ids/μIds) showed a straightforward tendency in accordance with the amount of PCD. These findings provide an in-depth understanding of plasma-induced RTN characteristic changes in future MOSFETs.
Poly-Si TFTs integrated gate driver circuit with charge-sharing structure
NASA Astrophysics Data System (ADS)
Chen, Meng; Lei, Jiefeng; Huang, Shengxiang; Liao, Congwei; Deng, Lianwen
2017-06-01
A p-type low-temperature poly-Si thin film transistors (LTPS TFTs) integrated gate driver using 2 non-overlapped clocks is proposed. This gate driver features charge-sharing structure to turn off buffer TFT and suppresses voltage feed-through effects. It is analyzed that the conventional gate driver suffers from waveform distortions due to voltage uncertainty of internal nodes for the initial period. The proposed charge-sharing structure also helps to suppress the unexpected pulses during the initialization phases. The proposed gate driver shows a simple circuit, as only 6 TFTs and 1 capacitor are used for single-stage, and the buffer TFT is used for both pulling-down and pulling-up of output electrode. Feasibility of the proposed gate driver is proven through detailed analyses. Investigations show that voltage bootrapping can be maintained once the bootrapping capacitance is larger than 0.8 pF, and pulse of gate driver outputs can be reduced to 5 μs. The proposed gate driver can still function properly with positive {V}{TH} shift within 0.4 V and negative {V}{TH} shift within -1.2 V and it is robust and promising for high-resolution display. Project supported by the Science and Technology Project of Hunan Province, China (No. 2015JC3401)
Han, Su-Ting; Zhou, Ye; Yang, Qing Dan; Zhou, Li; Huang, Long-Biao; Yan, Yan; Lee, Chun-Sing; Roy, Vellaisamy A L
2014-02-25
Tunable memory characteristics are used in multioperational mode circuits where memory cells with various functionalities are needed in one combined device. It is always a challenge to obtain control over threshold voltage for multimode operation. On this regard, we use a strategy of shifting the work function of reduced graphene oxide (rGO) in a controlled manner through doping gold chloride (AuCl3) and obtained a gradient increase of rGO work function. By inserting doped rGO as floating gate, a controlled threshold voltage (Vth) shift has been achieved in both p- and n-type low voltage flexible memory devices with large memory window (up to 4 times for p-type and 8 times for n-type memory devices) in comparison with pristine rGO floating gate memory devices. By proper energy band engineering, we demonstrated a flexible floating gate memory device with larger memory window and controlled threshold voltage shifts.
The influence of visible light on transparent zinc tin oxide thin film transistors
NASA Astrophysics Data System (ADS)
Görrn, P.; Lehnhardt, M.; Riedl, T.; Kowalsky, W.
2007-11-01
The characteristics of transparent zinc tin oxide thin film transistors (TTFTs) upon illumination with visible light are reported. Generally, a reversible decrease of threshold voltage Vth, saturation field effect mobility μsat, and an increase of the off current are found. The time scale of the recovery in the dark is governed by the persistent photoconductivity in the semiconductor. Devices with tuned [Zn]:[Sn] ratio show a shift of Vth of less 2V upon illumination at 5mW/cm2 (brightness >30000cd/m2) throughout the visible spectrum. These results demonstrate TTFTs which are candidates as pixel drivers in transparent active-matrix organic light emitting diode displays.
NASA Astrophysics Data System (ADS)
Uedono, A.; Inumiya, S.; Matsuki, T.; Aoyama, T.; Nara, Y.; Ishibashi, S.; Ohdaira, T.; Suzuki, R.; Miyazaki, S.; Yamada, K.
2007-09-01
Vacancy-fluorine complexes in metal-oxide semiconductors (MOS) with high-k gate dielectrics were studied using a positron annihilation technique. F+ ions were implanted into Si substrates before the deposition of gate dielectrics (HfSiON). The shift of threshold voltage (Vth) in MOS capacitors and an increase in Fermi level position below the HfSiON/Si interface were observed after F+ implantation. Doppler broadening spectra of the annihilation radiation and positron lifetimes were measured before and after HfSiON fabrication processes. From a comparison between Doppler broadening spectra and those obtained by first-principles calculation, the major defect species in Si substrates after annealing treatment (1050 °C, 5 s) was identified as vacancy-fluorine complexes (V3F2). The origin of the Vth shift in the MOS capacitors was attributed to V3F2 located in channel regions.
NASA Astrophysics Data System (ADS)
Yun, Ho-Jin; Kim, Young-Su; Jeong, Kwang-Seok; Kim, Yu-Mi; Yang, Seung-dong; Lee, Hi-Deok; Lee, Ga-Won
2014-01-01
In this study, we fabricated dual-gate zinc oxide thin film transistors (ZnO TFTs) without additional processes and analyzed their stability characteristics under a negative gate bias stress (NBS) by comparison with conventional bottom-gate structures. The dual-gate device shows superior electrical parameters, such as subthreshold swing (SS) and on/off current ratio. NBS of VGS = -20 V with VDS = 0 was applied, resulting in a negative threshold voltage (Vth) shift. After applying stress for 1000 s, the Vth shift is 0.60 V in a dual-gate ZnO TFT, while the Vth shift is 2.52 V in a bottom-gate ZnO TFT. The stress immunity of the dual-gate device is caused by the change in field distribution in the ZnO channel by adding another gate as the technology computer aided design (TCAD) simulation shows. Additionally, in flicker noise analysis, a lower noise level with a different mechanism is observed in the dual-gate structure. This can be explained by the top side of the ZnO film having a larger crystal and fewer grain boundaries than the bottom side, which is revealed by the enhanced SS and XRD results. Therefore, the improved stability of the dual-gate ZnO TFT is greatly related to the E-field cancellation effect and crystal quality of the ZnO film.
Field-Induced Disorder and Carrier Localization in Molecular Organic Transistors
NASA Astrophysics Data System (ADS)
Ando, M.; Minakata, T.; Duffy, C.; Sirringhaus, H.
2009-06-01
We propose a "field-induced polymorphous disorder" model to explain bias-stress instability in molecular organic thin-film transistors, based on the experimental results showing the strong correlation between the micro-structural change in semiconductor layer composed of penrtacene molecules and the threshold voltage (Vth) shift due to electron trapping in a reversible manner under the successive bias-stress, thermal annealing, and light irradiation.
King, M. P.; Wu, X.; Eller, Manfred; ...
2016-12-07
Here, total ionizing dose results are provided, showing the effects of different threshold adjust implant processes and irradiation bias conditions of 14-nm FinFETs. Minimal radiation-induced threshold voltage shift across a variety of transistor types is observed. Off-state leakage current of nMOSFET transistors exhibits a strong gate bias dependence, indicating electrostatic gate control of the sub-fin region and the corresponding parasitic conduction path are the largest concern for radiation hardness in FinFET technology. The high-Vth transistors exhibit the best irradiation performance across all bias conditions, showing a reasonably small change in off-state leakage current and Vth, while the low-Vth transistors exhibitmore » a larger change in off-state leakage current. The “worst-case” bias condition during irradiation for both pull-down and pass-gate nMOSFETs in static random access memory is determined to be the on-state (Vgs = Vdd). We find the nMOSFET pull-down and pass-gate transistors of the SRAM bit-cell show less radiation-induced degradation due to transistor geometry and channel doping differences than the low-Vth transistor. Near-threshold operation is presented as a methodology for reducing radiation-induced increases in off-state device leakage current. In a 14-nm FinFET technology, the modeling indicates devices with high channel stop doping show the most robust response to TID allowing stable operation of ring oscillators and the SRAM bit-cell with minimal shift in critical operating characteristics.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
King, M. P.; Wu, X.; Eller, Manfred
Here, total ionizing dose results are provided, showing the effects of different threshold adjust implant processes and irradiation bias conditions of 14-nm FinFETs. Minimal radiation-induced threshold voltage shift across a variety of transistor types is observed. Off-state leakage current of nMOSFET transistors exhibits a strong gate bias dependence, indicating electrostatic gate control of the sub-fin region and the corresponding parasitic conduction path are the largest concern for radiation hardness in FinFET technology. The high-Vth transistors exhibit the best irradiation performance across all bias conditions, showing a reasonably small change in off-state leakage current and Vth, while the low-Vth transistors exhibitmore » a larger change in off-state leakage current. The “worst-case” bias condition during irradiation for both pull-down and pass-gate nMOSFETs in static random access memory is determined to be the on-state (Vgs = Vdd). We find the nMOSFET pull-down and pass-gate transistors of the SRAM bit-cell show less radiation-induced degradation due to transistor geometry and channel doping differences than the low-Vth transistor. Near-threshold operation is presented as a methodology for reducing radiation-induced increases in off-state device leakage current. In a 14-nm FinFET technology, the modeling indicates devices with high channel stop doping show the most robust response to TID allowing stable operation of ring oscillators and the SRAM bit-cell with minimal shift in critical operating characteristics.« less
Piezoelectric MEMS switch to activate event-driven wireless sensor nodes
NASA Astrophysics Data System (ADS)
Nogami, H.; Kobayashi, T.; Okada, H.; Makimoto, N.; Maeda, R.; Itoh, T.
2013-09-01
We have developed piezoelectric microelectromechanical systems (MEMS) switches and applied them to ultra-low power wireless sensor nodes, to monitor the health condition of chickens. The piezoelectric switches have ‘S’-shaped piezoelectric cantilevers with a proof mass. Since the resonant frequency of the piezoelectric switches is around 24 Hz, we have utilized their superharmonic resonance to detect chicken movements as low as 5-15 Hz. When the vibration frequency is 4, 6 and 12 Hz, the piezoelectric switches vibrate at 0.5 m s-2 and generate 3-5 mV output voltages with superharmonic resonance. In order to detect such small piezoelectric output voltages, we employ comparator circuits that can be driven at low voltages, which can set the threshold voltage (Vth) from 1 to 31 mV with a 1 mV increment. When we set Vth at 4 mV, the output voltages of the piezoelectric MEMS switches vibrate below 15 Hz with amplitudes above 0.3 m s-2 and turn on the comparator circuits. Similarly, by setting Vth at 5 mV, the output voltages turn on the comparator circuits with vibrations above 0.4 m s-2. Furthermore, setting Vth at 10 mV causes vibrations above 0.5 m s-2 that turn on the comparator circuits. These results suggest that we can select small or fast chicken movements to utilize piezoelectric MEMS switches with comparator circuits.
Suppression of threshold voltage variability in MOSFETs by adjustment of ion implantation parameters
NASA Astrophysics Data System (ADS)
Park, Jae Hyun; Chang, Tae-sig; Kim, Minsuk; Woo, Sola; Kim, Sangsig
2018-01-01
In this study, we investigate threshold voltage (VTH) variability of metal-oxide-semiconductor field-effect transistors induced by random dopant fluctuation (RDF). Our simulation work demonstrates not only the influence of the implantation parameters such as its dose, tilt angle, energy, and rotation angle on the RDF-induced VTH variability, but also the solution to reduce the effect of this variability. By adjusting the ion implantation parameters, the 3σ (VTH) is reduced from 43.8 mV to 28.9 mV. This 34% reduction is significant, considering that our technique is very cost effective and facilitates easy fabrication, increasing availability.
NASA Astrophysics Data System (ADS)
Yang, Jianwen; Liao, Po-Yung; Chang, Ting-Chang; Chen, Bo-Wei; Huang, Hui-Chun; Su, Wan-Ching; Chiang, Hsiao-Cheng; Zhang, Qun
2017-04-01
Amorphous InGaZnO thin film transistors (a-IGZO TFTs) with an etching-stop layer (ESL) exhibit an anomalous negative shift of threshold voltage (Vth) under positive bias temperature stress. TFTs with wider and shorter channels show a clear hump phenomenon, resulting from the existence of both main channels and parasitic channels. The electrons trapped in the gate insulator are responsible for the positive shift in the main channel characteristics. The electrons trapped near the IGZO edges and the holes injected into the ESL layer above InGaZnO (IGZO) jointly determine the shift of the parasitic TFT performance.
Review of mixer design for low voltage - low power applications
NASA Astrophysics Data System (ADS)
Nurulain, D.; Musa, F. A. S.; Isa, M. Mohamad; Ahmad, N.; Kasjoo, S. R.
2017-09-01
A mixer is used in almost all radio frequency (RF) or microwave systems for frequency translation. Nowadays, the increase market demand encouraged the industry to deliver circuit designs to create proficient and convenient equipment with very low power (LP) consumption and low voltage (LV) supply in both digital and analogue circuits. This paper focused on different Complementary Metal Oxide Semiconductor (CMOS) design topologies for LV and LP mixer design. Floating Gate Metal Oxide Semiconductor (FGMOS) is an alternative technology to replace CMOS due to their high ability for LV and LP applications. FGMOS only required a few transistors per gate and can have a shift in threshold voltage (VTH) to increase the LP and LV performances as compared to CMOS, which makes an attractive option to replace CMOS.
NASA Astrophysics Data System (ADS)
Zaidi, Z. H.; Lee, K. B.; Roberts, J. W.; Guiney, I.; Qian, H.; Jiang, S.; Cheong, J. S.; Li, P.; Wallis, D. J.; Humphreys, C. J.; Chalker, P. R.; Houston, P. A.
2018-05-01
In a bid to understand the commonly observed hysteresis in the threshold voltage (VTH) in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors during forward gate bias stress, we have analyzed a series of measurements on devices with no surface treatment and with two different plasma treatments before the in-situ Al2O3 deposition. The observed changes between samples were quasi-equilibrium VTH, forward bias related VTH hysteresis, and electrical response to reverse bias stress. To explain these effects, a disorder induced gap state model, combined with a discrete level donor, at the dielectric/semiconductor interface was employed. Technology Computer-Aided Design modeling demonstrated the possible differences in the interface state distributions that could give a consistent explanation for the observations.
NASA Astrophysics Data System (ADS)
Alsaqqa, Ali; Kilcoyne, Colin; Singh, Sujay; Horrocks, Gregory; Marley, Peter; Banerjee, Sarbajit; Sambandamurthy, G.
Vanadium dioxide (VO2) is a strongly correlated material that exhibits a sharp thermally driven metal-insulator transition at Tc ~ 340 K. The transition can also be triggered by a DC voltage in the insulating phase with a threshold (Vth) behavior. The mechanisms behind these transitions are hotly discussed and resistance noise spectroscopy is a suitable tool to delineate different transport mechanisms in correlated systems. We present results from a systematic study of the low frequency (1 mHz < f < 10 Hz) noise behavior in VO2 nanobeams across the thermally and electrically driven transitions. In the thermal transition, the power spectral density (PSD) of the resistance noise is unchanged as we approach Tc from 300 K and an abrupt drop in the magnitude is seen above Tc and it remains unchanged till 400 K. However, the noise behavior in the electrically driven case is distinctly different: as the voltage is ramped from zero, the PSD gradually increases by an order of magnitude before reaching Vth and an abrupt increase is seen at Vth. The noise magnitude decreases above Vth, approaching the V = 0 value. The individual roles of percolation, Joule heating and signatures of correlated behavior will be discussed. This work is supported by NSF DMR 0847324.
A reliable ground bounce noise reduction technique for nanoscale CMOS circuits
NASA Astrophysics Data System (ADS)
Sharma, Vijay Kumar; Pattanaik, Manisha
2015-11-01
Power gating is the most effective method to reduce the standby leakage power by adding header/footer high-VTH sleep transistors between actual and virtual power/ground rails. When a power gating circuit transitions from sleep mode to active mode, a large instantaneous charge current flows through the sleep transistors. Ground bounce noise (GBN) is the high voltage fluctuation on real ground rail during sleep mode to active mode transitions of power gating circuits. GBN disturbs the logic states of internal nodes of circuits. A novel and reliable power gating structure is proposed in this article to reduce the problem of GBN. The proposed structure contains low-VTH transistors in place of high-VTH footer. The proposed power gating structure not only reduces the GBN but also improves other performance metrics. A large mitigation of leakage power in both modes eliminates the need of high-VTH transistors. A comprehensive and comparative evaluation of proposed technique is presented in this article for a chain of 5-CMOS inverters. The simulation results are compared to other well-known GBN reduction circuit techniques at 22 nm predictive technology model (PTM) bulk CMOS model using HSPICE tool. Robustness against process, voltage and temperature (PVT) variations is estimated through Monte-Carlo simulations.
An All Oxide-Based Imperceptible Thin-Film Transistor with Humidity Sensing Properties
Kim, Kyung Su; Ahn, Cheol Hyoun; Kang, Won Jun; Cho, Sung Woon; Jung, Sung Hyeon; Yoon, Dae Ho; Cho, Hyung Koun
2017-01-01
We have examined the effects of oxygen content and thickness in sputtered InSnO (ITO) electrodes, especially for the application of imperceptible amorphous-InGaZnO (a-IGZO) thin-film transistors (TFTs) in humidity sensors. The imperceptible a-IGZO TFT with 50-nm ITO electrodes deposited at Ar:O2 = 29:0.3 exhibited good electrical performances with Vth of −0.23 V, SS of 0.34 V/dec, µFE of 7.86 cm2/V∙s, on/off ratio of 8.8 × 107, and has no degradation for bending stress up to a 3.5-mm curvature. The imperceptible oxide TFT sensors showed the highest sensitivity for the low and wide gate bias of −1~2 V under a wide range of relative humidity (40–90%) at drain voltage 1 V, resulting in low power consumption by the sensors. Exposure to water vapor led to a negative shift in the threshold voltage (or current enhancement), and an increase in relative humidity induced continuous threshold voltage shift. In particular, compared to conventional resistor-type sensors, the imperceptible oxide TFT sensors exhibited extremely high sensitivity from a current amplification of >103. PMID:28772888
Investigation of Short Channel Effects on Device Performance for 60nm NMOS Transistor
NASA Astrophysics Data System (ADS)
Chinnappan, U.; Sanudin, R.
2017-08-01
In the aggressively scaled complementary metal oxide semiconductor (CMOS) devices, shallower p-n junctions and low sheet resistances are essential for short-channel effect (SCE) control and high device performance. The SCE are attributed to two physical phenomena that are the limitation imposed on electron drift characteristics in channel and the modification of the threshold voltage (Vth) due to the shortening channel length. The decrement of Vth with decrement in gate length is a well-known attribute in SCE known as “threshold voltage roll-off’. In this research, the Technology Computer Aided Design (TCAD) was used to model the SCE phenomenon effect on 60nm n-type metal oxide semiconductor (NMOS) transistor. There are three parameters being investigated, which are the oxide thickness (Tox), gate length (L), acceptor concentration (Na). The simulation data were used to visualise the effect of SCE on the 60nm NMOS transistor. Simulation data suggest that all three parameters have significant effect on Vth, and hence on the transistor performance. It is concluded that there is a trade-off among these three parameters to obtain an optimized transistor performance.
NASA Astrophysics Data System (ADS)
Takeda, Yasunori; Yoshimura, Yudai; Adib, Faiz Adi Ezarudin Bin; Kumaki, Daisuke; Fukuda, Kenjiro; Tokito, Shizuo
2015-04-01
Organic reset-set (RS) flip-flop logic circuits based on pseudo-CMOS inverters have been fabricated using full solution processing at a relatively low process temperatures of 150 °C or less. The work function for printed silver electrodes was increased from 4.7 to 5.4 eV through surface modification with a self-assembled monolayer (SAM) material. A bottom-gate, bottom-contact organic thin-film transistor (OTFT) device using a solution-processable small-molecular semiconductor material exhibited field-effect mobility of 0.40 cm2 V-1 s-1 in the saturation region and a threshold voltage (VTH) of -2.4 V in ambient air operation conditions. In order to reduce the variations in mobility and VTH, we designed a circuit with six transistors arranged in parallel, in order to average out their electrical characteristics. As a result, we have succeeded in reducing these variations without changing the absolute values of the mobility and VTH. The fabricated RS flip-flop circuits were functioned well and exhibited short delay times of 3.5 ms at a supply voltage of 20 V.
Wiegand, U K; Zhdanov, A; Stammwitz, E; Crozier, I; Claessens, R J; Meier, J; Bos, R J; Bode, F; Potratz, J
1999-06-01
The aim of this multicenter study was to investigate the performance of a new cardiac pacemaker lead with a titanium nitride cathode coated with a copolymer membrane. In particular, the electrophysiological effect of steroid dissolved in this ion-exchange membrane was evaluated by randomized comparison. Ninety-five patients were randomized either to the 1450 T (n = 51) or the 1451 T ventricular lead (n = 45) and received telemeteral VVI(R) pacemakers with identical diagnostic features. Both leads were bipolar, were passively affixed, and had a porous titanium nitride tip with a surface area of 3.5 mm2. The only difference between the two electrodes was 13 micrograms of dexamethasone added to the 1450 Ts membrane coating. Voltage thresholds (VTH) at pulse durations of 0.25, 0.37, and 0.5 ms, lead impedance, and sensing thresholds were measured at discharge, 2 weeks, 1 month, 3 months, and 6 months after implantation. Mean amplitude and the slew rate from three telemetered intracardiac electrograms, chronaxie-rheobase product, and minimum energy consumption were calculated. After a 6-month follow-up, mean voltage thresholds of 0.65 +/- 0.20 V and 0.63 +/- 0.34 were achieved for the 1450 T lead and 1451 T lead, respectively. As a result, a VTH < 1.0 V was obtained in all patients with 1450 T electrodes and in 97.7% of patients with 1451 T leads after 6 months follow-up. In both electrodes, stable VTH was reached 2 weeks after implantation, and no transient rise in threshold was observed. No differences were observed between the steroid and the nonsteroid group in respect to VTH, chronaxie-rheobase product, minimum energy consumption, and potential amplitude and slew rate. In conclusion, safe and efficient pacing at low pulse amplitudes were achieved with both leads. The tip design, independently of the steroid additive, prevented any energy-consuming increases in the voltage threshold.
GaN HEMTs with p-GaN gate: field- and time-dependent degradation
NASA Astrophysics Data System (ADS)
Meneghesso, G.; Meneghini, M.; Rossetto, I.; Canato, E.; Bartholomeus, J.; De Santi, C.; Trivellin, N.; Zanoni, E.
2017-02-01
GaN-HEMTs with p-GaN gate have recently demonstrated to be excellent normally-off devices for application in power conversion systems, thanks to the high and robust threshold voltage (VTH>1 V), the high breakdown voltage, and the low dynamic Ron increase. For this reason, studying the stability and reliability of these devices under high stress conditions is of high importance. This paper reports on our most recent results on the field- and time-dependent degradation of GaN-HEMTs with p-GaN gate submitted to stress with positive gate bias. Based on combined step-stress experiments, constant voltage stress and electroluminescence testing we demonstrated that: (i) when submitted to high/positive gate stress, the transistors may show a negative threshold voltage shift, that is ascribed to the injection of holes from the gate metal towards the p-GaN/AlGaN interface; (ii) in a step-stress experiment, the analyzed commercial devices fail at gate voltages higher than 9-10 V, due to the extremely high electric field over the p-GaN/AlGaN stack; (iii) constant voltage stress tests indicate that the failure is also time-dependent and Weibull distributed. The several processes that can explain the time-dependent failure are discussed in the following.
Study of the enhancement-mode AlGaN/GaN high electron mobility transistor with split floating gates
NASA Astrophysics Data System (ADS)
Wang, Hui; Wang, Ning; Jiang, Ling-Li; Zhao, Hai-Yue; Lin, Xin-Peng; Yu, Hong-Yu
2017-11-01
In this work, the charge storage based split floating gates (FGs) enhancement mode (E-mode) AlGaN/GaN high electron mobility transistors (HEMTs) are studied. The simulation results reveal that under certain density of two dimensional electron gas, the variation tendency of the threshold voltage (Vth) with the variation of the blocking dielectric thickness depends on the FG charge density. It is found that when the length sum and isolating spacing sum of the FGs both remain unchanged, the Vth shall decrease with the increasing FGs number but maintaining the device as E-mode. It is also reported that for the FGs HEMT, the failure of a FG will lead to the decrease of Vth as well as the increase of drain current, and the failure probability can be improved significantly with the increase of FGs number.
Threshold Voltage Instability in A-Si:H TFTS and the Implications for Flexible Displays and Circuits
2008-12-01
and negative gate voltages with and without elevated drain voltages for FDC TFTs. Extending techniques used to localize hot electron degradation...in MOSFETs, experiments in our lab have localized the degradation of a-Si:H to the gate dielectric/a-Si:H channel interface [Shringarpure, et al...saturation, increased drain source current measured with the source and drain reversed indicates localization of ΔVth to the gate dielectric/amorphous
NASA Astrophysics Data System (ADS)
Suko, Ayaka; Jia, JunJun; Nakamura, Shin-ichi; Kawashima, Emi; Utsuno, Futoshi; Yano, Koki; Shigesato, Yuzo
2016-03-01
Amorphous indium-gallium-zinc oxide (a-IGZO) films were deposited by DC magnetron sputtering and post-annealed in air at 300-1000 °C for 1 h to investigate the crystallization behavior in detail. X-ray diffraction, electron beam diffraction, and high-resolution electron microscopy revealed that the IGZO films showed an amorphous structure after post-annealing at 300 °C. At 600 °C, the films started to crystallize from the surface with c-axis preferred orientation. At 700-1000 °C, the films totally crystallized into polycrystalline structures, wherein the grains showed c-axis preferred orientation close to the surface and random orientation inside the films. The current-gate voltage (Id-Vg) characteristics of the IGZO thin-film transistor (TFT) showed that the threshold voltage (Vth) and subthreshold swing decreased markedly after the post-annealing at 300 °C. The TFT using the totally crystallized films also showed the decrease in Vth, whereas the field-effect mobility decreased considerably.
NASA Astrophysics Data System (ADS)
Hwang, Ah Young; Kim, Sang Tae; Ji, Hyuk; Shin, Yeonwoo; Jeong, Jae Kyeong
2016-04-01
Transition tantalum induced crystallization of amorphous zinc tin oxide (a-ZTO) was observed at low temperature annealing of 300 °C. Thin-film transistors (TFTs) with an a-ZTO channel layer exhibited a reasonable field-effect mobility of 12.4 cm2/V s, subthreshold swing (SS) of 0.39 V/decade, threshold voltage (VTH) of 1.5 V, and ION/OFF ratio of ˜107. A significant improvement in the field-effect mobility (up to ˜33.5 cm2/V s) was achieved for crystallized ZTO TFTs: this improvement was accomplished without compromising the SS, VTH, or ION/OFF ratio due to the presence of a highly ordered microstructure.
NASA Astrophysics Data System (ADS)
Jeon, Dae-Young; Park, So Jeong; Mouis, Mireille; Barraud, Sylvain; Kim, Gyu-Tae; Ghibaudo, Gérard
2013-11-01
A new and simple method for the extraction of electrical parameters in junctionless transistors (JLTs) is presented. The bulk channel mobility (μbulk) and flat-band voltage (Vfb) were successfully extracted from the new method, based on a linear dependence between the inverse of transconductance squared (1/gm2) vs gate voltage in the partially depleted operation regime (Vth < Vg < Vfb). The validity of the new method is also proved by 2D numerical simulation and newly defined Maserjian's-like function for gm of JLT devices.
Effects of co-dopants on the microstructure and electroluminescence of ZnS:Mn thin film phosphors
NASA Astrophysics Data System (ADS)
Zhai, Qing
The objective of this study is to investigate the effects of the co-dopants of KCl and Ga2S3 and post-deposition annealing on the microstructure and electroluminescence (EL) properties of ZnS:Mn thin film phosphors. ZnS:Mn thin films are deposited by radio frequency (RF) magnetron sputtering from ZnS and Mn targets onto pre-deposited indium tin oxide (ITO) and aluminum titanium oxide (ATO) layers on Corning 7059 glass. Argon at 20mTorr is the sputtering ambient. The substrates are held at 180°C during deposition. Co-dopants are thermally evaporated after the ZnS:Mn films, and diffused into the ZnS:Mn films by ex situ annealing between 600°C and 800°C for 5 minutes in a nitrogen ambient. Brightness versus the applied voltage, luminous efficiency, and photoluminescence (PL) are used to characterize the EL devices. The figures of merit are the threshold voltage Vth, at which luminescence is first detected, B40 and eta40, the brightness and efficiency at 40V above the threshold voltage, respectively. In the as-deposited ZnS:Mn phosphor, the microstructure is heavily defected with two different grain morphologies: a roughly 100nm layer of equiaxed fine grains at the insulator/phosphor interface and columnar grains with an average diameter of 89nm in the rest of the film. The EL properties of as-deposited films are poor, with a Vth of 125V, B40 of 48.7nits, and a eta40 of 0.2275lm/W. Annealing at 700°C for 5 minutes raises B40 to 99.6nits and eta40 to 0.4463lm/W, with little change in Vth. In KCl doped ZnS:Mn samples, after 5 minutes of annealing at 700°C, SIMS indicates a uniform distribution of K and a complete diffusion of Cl throughout the phosphor. KCl co-doping enhances grain growth by improving dislocation motion, and the columnar grain size increases from 132nm to 187nm. EL properties are improved, with a B40 of 252nits and eta 40 of 0.9879lm/W. A slight increase in Vth is observed. In ZnS:Mn samples with Ga2S3, the grain growth is less than that in undoped ZnS:Mn. Energy dispersive spectrometry (EDS) data show Ga segregation to grain boundaries and triple points. Decreases of 40V in Vth and 10nits in B40 are observed from ZnS:Mn,Ga 2S3 samples annealed at 800°C. It is postulated that Ga2S3 creates a range of shallow donor states at the interface close to the conduction band, which causes lower threshold voltages and "leaky" turn-on properties. The low EL brightness is attributed to the low threshold voltage. The lack of reduction of the defects in the microstructure of ZnS:Mn,Ga2S3 during anneal is another reason for the poor EL properties. When samples are doped with Ga2S3 first followed by KCl, much better EL properties are observed than from samples doped with KCl first followed by Ga2S3 (B40 of 120nits versus 64.2nits). (Abstract shortened by UMI.)
NASA Astrophysics Data System (ADS)
Matys, M.; Kaneki, S.; Nishiguchi, K.; Adamowicz, B.; Hashizume, T.
2017-12-01
We proposed that the disorder induced gap states (DIGS) can be responsible for the threshold voltage (Vth) instability in Al2O3/AlGaN/GaN metal-oxide-semiconductor high-electron-mobility transistors. In order to verify this hypothesis, we performed the theoretical calculations of the capacitance voltage (C-V) curves for the Al2O3/AlGaN/GaN structures using the DIGS model and compared them with measured ones. We found that the experimental C-V curves with a complex hysteresis behavior varied with the maximum forward bias and the sweeping rate can be well reproduced theoretically by assuming a particular distribution in energy and space of the DIGS continuum near the Al2O3/AlGaN interface, i.e., a U-shaped energy density distribution and exponential depth decay from the interface into Al2O3 layer (up to 4 nm), as well as suitable DIGS capture cross sections (the order of magnitude of 10-15 cm2). Finally, we showed that the DIGS model can also explain the negative bias induced threshold voltage instability. We believe that these results should be critical for the successful development of the passivation techniques, which allows to minimize the Vth instability related effects.
NASA Astrophysics Data System (ADS)
Choe, Byeong-In; Park, Byung-Gook; Lee, Jong-Ho
2013-06-01
The program disturbance characteristic in the three-dimensional (3D) stack NAND flash was analyzed for the first time in terms of string select line (SSL) threshold voltage (Vth) and p-type body doping profile. From the edge word line (W/L) program disturbance, we can observe the boosted channel potential loss as a function of SSL Vth and body doping profile for SSL device. According to simulation work, a high Vth of the SSL device is required to suppress channel leakage during programming. When the body doping of the SSL device is high in the channel, there is a large band bending near the gate edge of the SSL adjacent to the edge W/L cell of boosted cell strings, which generates significantly electron-hole pairs. The generated electrons decreases the boosted channel potential, resulting in increase of program disturbance of the inhibit strings. Through optimization of the body doping profile of the SSL device, both channel leakage and the program disturbance are successfully suppressed for a highly reliable 3D stack NAND flash memory cell operation.
Fabrication and Characteristics of High Mobility InSnZnO Thin Film Transistors.
Choi, Pyungho; Lee, Junki; Park, Hyoungsun; Baek, Dohyun; Lee, Jaehyeong; Yi, Junsin; Kim, Sangsoo; Choi, Byoungdeog
2016-05-01
In this paper, we describe the fabrication of thin film transistors (TFTs) with amorphous indium-tin-zinc-oxide (ITZO) as the active material. A transparent ITZO channel layer was formed under an optimized oxygen partial pressure (OPP (%) = O2/(Ar + O2)) and subsequent annealing process. The electrical properties exhibited by this device include field-effect mobility (μ(eff)), sub-threshold swing (SS), and on/off current ratio (I(ON/OFF)) values of 28.97 cm2/V x s, 0.2 V/decade, and 2.64 x 10(7), respectively. The average transmittance values for each OPP condition in the visible range were greater than 80%. The positive gate bias stress resulted in a positive threshold voltage (V(th)) shift in the transfer curves and degraded the parameters μ(eff) and SS. These phenomena originated from electron trapping from the ITZO channel layer into the oxide/ITZO interface trap sites.
Bak, Jun Yong; Kang, Youngho; Yang, Shinhyuk; Ryu, Ho-Jun; Hwang, Chi-Sun; Han, Seungwu; Yoon, Sung-Min
2015-01-01
Top-gate structured thin film transistors (TFTs) using In-Ga-Zn-O (IGZO) and In-Ga-O (IGO) channel compositions were investigated to reveal a feasible origin for degradation phenomenon under drain bias stress (DBS). DBS-driven instability in terms of VTH shift, deviation of the SS value, and increase in the on-state current were detected only for the IGZO-TFT, in contrast to the IGO-TFT, which did not demonstrate VTH shift. These behaviors were visually confirmed via nanoscale transmission electron microscopy and energy-dispersive x-ray spectroscopy observations. To understand the degradation mechanism, we performed ab initio molecular dynamic simulations on the liquid phases of IGZO and IGO. The diffusivities of Ga and In atoms were enhanced in IGZO, confirming the degradation mechanism to be increased atomic diffusion. PMID:25601183
Bak, Jun Yong; Kang, Youngho; Yang, Shinhyuk; Ryu, Ho-Jun; Hwang, Chi-Sun; Han, Seungwu; Yoon, Sung-Min
2015-01-20
Top-gate structured thin film transistors (TFTs) using In-Ga-Zn-O (IGZO) and In-Ga-O (IGO) channel compositions were investigated to reveal a feasible origin for degradation phenomenon under drain bias stress (DBS). DBS-driven instability in terms of V(TH) shift, deviation of the SS value, and increase in the on-state current were detected only for the IGZO-TFT, in contrast to the IGO-TFT, which did not demonstrate V(TH) shift. These behaviors were visually confirmed via nanoscale transmission electron microscopy and energy-dispersive x-ray spectroscopy observations. To understand the degradation mechanism, we performed ab initio molecular dynamic simulations on the liquid phases of IGZO and IGO. The diffusivities of Ga and In atoms were enhanced in IGZO, confirming the degradation mechanism to be increased atomic diffusion.
NASA Astrophysics Data System (ADS)
Sun, Jia; Wan, Qing; Lu, Aixia; Jiang, Jie
2009-11-01
Battery drivable low-voltage SnO2-based paper thin-film transistors with a near-zero threshold voltage (Vth=0.06 V) gated by microporous SiO2 dielectric with electric-double-layer (EDL) effect are fabricated at room temperature. The operating voltage is found to be as low as 1.5 V due to the huge gate specific capacitance (1.34 μF/cm2 at 40 Hz) related to EDL formation. The subthreshold gate voltage swing and current on/off ratio is found to be 82 mV/decade and 2.0×105, respectively. The electron field-effect mobility is estimated to be 47.3 cm2/V s based on the measured gate specific capacitance at 40 Hz.
NASA Astrophysics Data System (ADS)
Fan, Ching-Lin; Lin, Yu-Sheng; Liu, Yan-Wei
A new pixel design and driving method for active matrix organic light emitting diode (AMOLED) displays that use low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs) with a voltage programming method are proposed and verified using the SPICE simulator. We had employed an appropriate TFT model in SPICE simulation to demonstrate the performance of the pixel circuit. The OLED anode voltage variation error rates are below 0.35% under driving TFT threshold voltage deviation (Δ Vth =± 0.33V). The OLED current non-uniformity caused by the OLED threshold voltage degradation (Δ VTO =+0.33V) is significantly reduced (below 6%). The simulation results show that the pixel design can improve the display image non-uniformity by compensating for the threshold voltage deviation in the driving TFT and the OLED threshold voltage degradation at the same time.
NASA Astrophysics Data System (ADS)
Ching-Lin Fan,; Yi-Yan Lin,; Jyu-Yu Chang,; Bo-Jhang Sun,; Yan-Wei Liu,
2010-06-01
This study presents one novel compensation pixel design and driving method for active matrix organic light-emitting diode (AMOLED) displays that use low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs) with a voltage feed-back method and the simulation results are proposed and verified by SPICE simulator. The measurement and simulation of LTPS TFT characteristics demonstrate the good fitting result. The proposed circuit consists of four TFTs and two capacitors with an additional signal line. The error rates of OLED anode voltage variation are below 0.3% under the threshold voltage deviation of driving TFT (Δ VTH = ± 0.33 V). The simulation results show that the pixel design can improve the display image non-uniformity by compensating the threshold voltage deviation of driving TFT and the degradation of OLED threshold voltage at the same time.
NASA Astrophysics Data System (ADS)
Fan, Ching-Lin; Lin, Yi-Yan; Chang, Jyu-Yu; Sun, Bo-Jhang; Liu, Yan-Wei
2010-06-01
This study presents one novel compensation pixel design and driving method for active matrix organic light-emitting diode (AMOLED) displays that use low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs) with a voltage feed-back method and the simulation results are proposed and verified by SPICE simulator. The measurement and simulation of LTPS TFT characteristics demonstrate the good fitting result. The proposed circuit consists of four TFTs and two capacitors with an additional signal line. The error rates of OLED anode voltage variation are below 0.3% under the threshold voltage deviation of driving TFT (ΔVTH = ±0.33 V). The simulation results show that the pixel design can improve the display image non-uniformity by compensating the threshold voltage deviation of driving TFT and the degradation of OLED threshold voltage at the same time.
Analysis of proton irradiated n- and p-type strained FinFETs at low temperatures down to 100 K
NASA Astrophysics Data System (ADS)
Vicentis Caparroz, Luis Felipe; Mendes Bordallo, Caio Cesar; Martino, Joao Antonio; Simoen, Eddy; Claeys, Cor; Ghedini Der Agopian, Paula
2018-06-01
This paper studies the main low temperature electrical parameters of SOI n- and p-type FinFETs, standard and strained devices, submitted to proton irradiation. The study covers the range from room temperature down to 100 K, focusing on the threshold voltage (VTH), subthreshold swing (SS), the Early voltage VEA, transistor efficiency and the intrinsic gain voltage (AV) for 3 different channel widths. The p-channel devices showed a greater immunity to radiation than the n-channel ones, when considering the basic parameters thanks to the back conduction turn-off tendency, while from the analog parameters point of view, both transistor types presented a similar response to proton radiation at strong inversion.
Middle Electrode in a Vertical Transistor Structure Using an Sn Layer by Thermal Evaporation
NASA Astrophysics Data System (ADS)
Nogueira, Gabriel Leonardo; da Silva Ozório, Maiza; da Silva, Marcelo Marques; Morais, Rogério Miranda; Alves, Neri
2018-05-01
We report a process for performing the middle electrode for a vertical field effect transistor (VOFET) by the evaporation of a tin (Sn) layer. Bare aluminum oxide (Al2O3), obtained by anodization, and Al2O3 covered with a polymethylmethacrylate (PMMA) layer were used as the gate dielectric. We measured the electrical resistance of Sn while the evaporation was carried out to find the best condition to prepare the middle electrode, that is, good lateral conduction associated with openings that give permeability to the electric field in a vertical direction. This process showed that 55 nm Sn thick is suitable for use in a VOFET, being easier to achieve optimal thickness when the Sn is evaporated onto PMMA than onto bare Al2O3. The addition of a PMMA layer on the Al2O3 surface modifies the morphology of the Sn layer, resulting in a lowering of the threshold voltage. The values of threshold voltage and electric field, VTH = - 8 V and ETH = 354.5 MV/m respectively, were calculated using an Al2O3 film 20 nm thick covered with a 14 nm PMMA layer as gate dielectric, while for bare Al2O3 these values were VTH = - 10 V and ETH = 500 MV/m.
NASA Astrophysics Data System (ADS)
Singh, Subhash; Mohapatra, Y. N.
2016-07-01
There is a growing need to understand mechanisms of photoresponse in devices based on organic semiconductor thin films and interfaces. The phenomenon of persistent photocurrent (PPC) has been systematically investigated in solution processed TIPS-Pentacene based organic thin film transistors (OTFTs) as an important example of an organic semiconductor material system. With increasing light intensity from dark to 385 mW/cm2, there is a significant shift in threshold voltage (VTh) while the filed-effect mobility remains unchanged. The OTFT shows large photoresponse under white light illumination due to exponential tail states with characteristic energy parameter of 86 meV. The photo-induced current is observed to persist even for several hours after turning the light off. To investigate the origin of PPC, its quenching mechanism is investigated by a variety of methods involving a combination of gate bias, illumination and temperature. We show that a coherent model of trap-charge induced carrier concentration is able to account for the quenching behavior. Analysis of isothermal transients using time-analyzed transient spectroscopy shows that the emission rates are activated and are also field enhanced due to Poole-Frankel effect. The results shed light on the nature, origin, and energetic distribution of the traps controlling PPC in solution processed organic semiconductors and their interfaces.
Critical factors to achieve low voltage- and capacitance-based organic field-effect transistors.
Jang, Mi; Park, Ji Hoon; Im, Seongil; Kim, Se Hyun; Yang, Hoichang
2014-01-15
Hydrophobic organo-compatible but low-capacitance dielectrics (10.5 nFcm(-2) ), polystyrene-grafted SiO2 could induce surface-mediated large crystal grains of face-to-face stacked triethylsilylethynyl anthradithiophene (TES-ADT), producing more efficient charge-carrier transport, in comparison to μm-sized pentacene crystals containing a face-to-edge packing. Low-voltage operating TES-ADT OFETs showed good device performance (μFET ≈ 1.3 cm(2) V(-1) s(-1) , Vth ≈ 0.5 V, SS ≈ 0.2 V), as well as excellent device reliability. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chen, Min-Cheng; Chen, Hao-Yu; Lin, Chia-Yi; Chien, Chao-Hsin; Hsieh, Tsung-Fan; Horng, Jim-Tong; Qiu, Jian-Tai; Huang, Chien-Chao; Ho, Chia-Hua; Yang, Fu-Liang
2012-01-01
This paper reports a versatile nano-sensor technology using “top-down” poly-silicon nanowire field-effect transistors (FETs) in the conventional Complementary Metal-Oxide Semiconductor (CMOS)-compatible semiconductor process. The nanowire manufacturing technique reduced nanowire width scaling to 50 nm without use of extra lithography equipment, and exhibited superior device uniformity. These n type polysilicon nanowire FETs have positive pH sensitivity (100 mV/pH) and sensitive deoxyribonucleic acid (DNA) detection ability (100 pM) at normal system operation voltages. Specially designed oxide-nitride-oxide buried oxide nanowire realizes an electrically Vth-adjustable sensor to compensate device variation. These nanowire FETs also enable non-volatile memory application for a large and steady Vth adjustment window (>2 V Programming/Erasing window). The CMOS-compatible manufacturing technique of polysilicon nanowire FETs offers a possible solution for commercial System-on-Chip biosensor application, which enables portable physiology monitoring and in situ recording. PMID:22666012
Way-Scaling to Reduce Power of Cache with Delay Variation
NASA Astrophysics Data System (ADS)
Goudarzi, Maziar; Matsumura, Tadayuki; Ishihara, Tohru
The share of leakage in cache power consumption increases with technology scaling. Choosing a higher threshold voltage (Vth) and/or gate-oxide thickness (Tox) for cache transistors improves leakage, but impacts cell delay. We show that due to uncorrelated random within-die delay variation, only some (not all) of cells actually violate the cache delay after the above change. We propose to add a spare cache way to replace delay-violating cache-lines separately in each cache-set. By SPICE and gate-level simulations in a commercial 90nm process, we show that choosing higher Vth, Tox and adding one spare way to a 4-way 16KB cache reduces leakage power by 42%, which depending on the share of leakage in total cache power, gives up to 22.59% and 41.37% reduction of total energy respectively in L1 instruction- and L2 unified-cache with a negligible delay penalty, but without sacrificing cache capacity or timing-yield.
Everaerts, Ken; Zeng, Li; Hennek, Jonathan W; Camacho, Diana I; Jariwala, Deep; Bedzyk, Michael J; Hersam, Mark C; Marks, Tobin J
2013-11-27
Solution-processed amorphous oxide semiconductors (AOSs) are emerging as important electronic materials for displays and transparent electronics. We report here on the fabrication, microstructure, and performance characteristics of inkjet-printed, low-temperature combustion-processed, amorphous indium gallium zinc oxide (a-IGZO) thin-film transistors (TFTs) grown on solution-processed hafnia self-assembled nanodielectrics (Hf-SANDs). TFT performance for devices processed below 300 °C includes >4× enhancement in electron mobility (μFE) on Hf-SAND versus SiO2 or ALD-HfO2 gate dielectrics, while other metrics such as subthreshold swing (SS), current on:off ratio (ION:IOFF), threshold voltage (Vth), and gate leakage current (Ig) are unchanged or enhanced. Thus, low voltage IGZO/SAND TFT operation (<2 V) is possible with ION:IOFF = 10(7), SS = 125 mV/dec, near-zero Vth, and large electron mobility, μFE(avg) = 20.6 ± 4.3 cm(2) V(-1) s(-1), μFE(max) = 50 cm(2) V(-1) s(-1). Furthermore, X-ray diffraction analysis indicates that the 300 °C IGZO combustion processing leaves the underlying Hf-SAND microstructure and capacitance intact. This work establishes the compatibility and advantages of all-solution, low-temperature fabrication of inkjet-printed, combustion-derived high-mobility IGZO TFTs integrated with self-assembled hybrid organic-inorganic nanodielectrics.
A study on the temperature dependence of the threshold switching characteristics of Ge2Sb2Te5
NASA Astrophysics Data System (ADS)
Lee, Suyoun; Jeong, Doo Seok; Jeong, Jeung-hyun; Zhe, Wu; Park, Young-Wook; Ahn, Hyung-Woo; Cheong, Byung-ki
2010-01-01
We investigated the temperature dependence of the threshold switching characteristics of a memory-type chalcogenide material, Ge2Sb2Te5. We found that the threshold voltage (Vth) decreased linearly with temperature, implying the existence of a critical conductivity of Ge2Sb2Te5 for its threshold switching. In addition, we investigated the effect of bias voltage and temperature on the delay time (tdel) of the threshold switching of Ge2Sb2Te5 and described the measured relationship by an analytic expression which we derived based on a physical model where thermally activated hopping is a dominant transport mechanism in the material.
Subramanian, Sowmya; Aschenbach, Konrad H; Evangelista, Jennifer P; Najjar, Mohamed Badaoui; Song, Wenxia; Gomez, Romel D
2012-02-15
An electronic platform to detect very small amounts of genomic DNA from bacteria without the need for PCR amplification and molecular labeling is described. The system uses carbon nanotube field-effect transistor (FET) arrays whose electrical properties are affected by minute electrical charges localized on their active regions. Two pathogenic strains of E. coli are used to evaluate the detection properties of the transistor arrays. Described herein are the results for detection of synthetic oligomers, unpurified and highly purified genomic DNA at various concentrations and their comparison against non-specific binding. In particular, the capture of genomic DNA of E. coli O157:H7 by a specific oligonucleotide probe coated onto the transistor array results in a significant shift in the threshold (gate-source) voltage (V(th)). By contrast the signal under the same procedure using a different strain, E. coli O45 that is non-complementary to the probe remained nearly constant. This work highlights the detection sensitivity and efficacy of this biosensor without stringent requirement for DNA sample preparation. Copyright © 2011 Elsevier B.V. All rights reserved.
Application of Semiconductor Devices in Computer Technique.
1960-10-14
large number of circuits v&th point-contact triod.es are used in practice f’^J" - £"i? 7° Yfe shall consider below only sojae of 7 «. -X... la a number of devices, for example in adders and registersj for the control and for connection with other circuits it is necessary to pick up... la discontin tied the voltage on the collector remains the saaaes fox’ some tiae and passing through •’the has© and collector is the space
Disturb-Free Three-Dimensional Vertical Floating Gate NAND with Separated-Sidewall Control Gate
NASA Astrophysics Data System (ADS)
Seo, Moon-Sik; Endoh, Tetsuo
2012-02-01
Recently, the three-dimensional (3D) vertical floating gate (FG) type NAND cell arrays with the sidewall control gate (SCG) structure are receiving attention to overcome the reliability issues of charge trap (CT) type 3D NAND. In order to achieve the multilevel cell (MLC) operation for lower bit cost in 3D NAND, it is important to eliminate reliability issues, such as the Vth distribution with interference and disturbance problems and Vth shift with retention issues. In this paper, we intensively investigated the disturbance problems of the 3D vertical FG type NAND cell with separated-sidewall control gate (S-SCG) structure for the reliable MLC operation. Above all, we successfully demonstrate the fully suppressed disturbance problems, such as indirect programming of the unselected cells, hot electron injection of the edge cells and direct influence to the neighboring passing cells, by using the S-SCG with 30 nm pillar size.
Modeling and simulation of floating gate nanocrystal FET devices and circuits
NASA Astrophysics Data System (ADS)
Hasaneen, El-Sayed A. M.
The nonvolatile memory market has been growing very fast during the last decade, especially for mobile communication systems. The Semiconductor Industry Association International Technology Roadmap for Semiconductors states that the difficult challenge for nonvolatile semiconductor memories is to achieve reliable, low power, low voltage performance and high-speed write/erase. This can be achieved by aggressive scaling of the nonvolatile memory cells. Unfortunately, scaling down of conventional nonvolatile memory will further degrade the retention time due to the charge loss between the floating gate and drain/source contacts and substrate which makes conventional nonvolatile memory unattractive. Using nanocrystals as charge storage sites reduces dramatically the charge leakage through oxide defects and drain/source contacts. Floating gate nanocrystal nonvolatile memory, FG-NCNVM, is a candidate for future memory because it is advantageous in terms of high-speed write/erase, small size, good scalability, low-voltage, low-power applications, and the capability to store multiple bits per cell. Many studies regarding FG-NCNVMs have been published. Most of them have dealt with fabrication improvements of the devices and device characterizations. Due to the promising FG-NCNVM applications in integrated circuits, there is a need for circuit a simulation model to simulate the electrical characteristics of the floating gate devices. In this thesis, a FG-NCNVM circuit simulation model has been proposed. It is based on the SPICE BSIM simulation model. This model simulates the cell behavior during normal operation. Model validation results have been presented. The SPICE model shows good agreement with experimental results. Current-voltage characteristics, transconductance and unity gain frequency (fT) have been studied showing the effect of the threshold voltage shift (DeltaVth) due to nanocrystal charge on the device characteristics. The threshold voltage shift due to nanocrystal charge has a strong effect on the memory characteristics. Also, the programming operation of the memory cell has been investigated. The tunneling rate from quantum well channel to quantum dot (nanocrystal) gate is calculated. The calculations include various memory parameters, wavefunctions, and energies of quantum well channel and quantum dot gate. The use of floating gate nanocrystal memory as a transistor with a programmable threshold voltage has been demonstrated. The incorporation of FG-NCFETs to design programmable integrated circuit building blocks has been discussed. This includes the design of programmable current and voltage reference circuits. Finally, we demonstrated the design of tunable gain op-amp incorporating FG-NCFETs. Programmable integrated circuit building blocks can be used in intelligent analog and digital systems.
New insights on SOI Tunnel FETs with low-temperature process flow for CoolCube™ integration
NASA Astrophysics Data System (ADS)
Diaz Llorente, C.; Le Royer, C.; Batude, P.; Fenouillet-Beranger, C.; Martinie, S.; Lu, C.-M. V.; Allain, F.; Colinge, J.-P.; Cristoloveanu, S.; Ghibaudo, G.; Vinet, M.
2018-06-01
This paper reports the fabrication and electrical characterization of planar SOI Tunnel FETs (TFETs) made using a Low-Temperature (LT) process designed for 3D sequential integration. These proof-of-concept TFETs feature junctions obtained by Solid Phase Epitaxy Regrowth (SPER). Their electrical behavior is analyzed and compared to reference samples (regular process using High-Temperature junction formation, HT). Dual ID-VDS measurements verify that the TFET structures present Band-to-Band tunnelling (BTBT) carrier injection and not Schottky Barrier tunnelling. P-mode operating LT TFETs deliver an ON state current similar to that of the HT reference, opening the door towards optimized devices operating with very low threshold voltage VTH and low supply voltage VDD.
NASA Astrophysics Data System (ADS)
Kitano, Naomu; Horie, Shinya; Arimura, Hiroaki; Kawahara, Takaaki; Sakashita, Shinsuke; Nishida, Yukio; Yugami, Jiro; Minami, Takashi; Kosuda, Motomu; Hosoi, Takuji; Shimura, Takayoshi; Watanabe, Heiji
2007-12-01
We demonstrated the use of an in situ metal/high-k fabrication method for improving the performance of metal-insulator-semiconductor field-effect transistors (MISFETs). Gate-first pMISFETs with polycrystalline silicon (poly-Si)/TiN/HfSiON stacks were fabricated by techniques based on low-damage physical vapor deposition, in which high-quality HfSiON dielectrics were formed by the interface reaction between an ultrathin metal-Hf layer (0.5 nm thick) and a SiO2 underlayer, and TiN electrodes were continuously deposited on the gate dielectrics without exposure to air. Gate-first pMISFETs with high carrier mobility and a low threshold voltage (Vth) were realized by reducing the carbon impurity in the gate stacks and improving the Vth stability against thermal treatment. As a result, we obtained superior current drivability (Ion = 350 μA/μm at Ioff = 200 pA/μm), which corresponds to a 13% improvement over that of conventional chemical vapor deposition-based metal/high-k devices.
Shin, Sang-Yeol; Choi, J M; Seo, Juhee; Ahn, Hyung-Woo; Choi, Yong Gyu; Cheong, Byung-ki; Lee, Suyoun
2014-11-18
The Ovonic Threshold Switch (OTS) based on an amorphous chalcogenide material has attracted much interest as a promising candidate for a high-performance thin-film switching device enabling 3D-stacking of memory devices. In this work, we studied on the electronic structure of amorphous Sb-doped Ge(0.6)Se(0.4) (in atomic mole fraction) film and its characteristics as to OTS devices. From the optical absorption spectroscopy measurement, the band gap (Eg) was found to decrease with increasing Sb content. In addition, as Sb content increased, the activation energy (Ea) for electrical conduction was found to decrease down to about one third of Eg from a half. As to the device characteristics, we found that the threshold switching voltage (Vth) drastically decreased with the Sb content. These results, being accountable in terms of the changes in the bonding configuration of constituent atoms as well as in the electronic structure such as the energy gap and trap states, advance an effective method of compositional adjustment to modulate Vth of an OTS device for various applications.
Low voltage operation of GaN vertical nanowire MOSFET
NASA Astrophysics Data System (ADS)
Son, Dong-Hyeok; Jo, Young-Woo; Seo, Jae Hwa; Won, Chul-Ho; Im, Ki-Sik; Lee, Yong Soo; Jang, Hwan Soo; Kim, Dae-Hyun; Kang, In Man; Lee, Jung-Hee
2018-07-01
GaN gate-all-around (GAA) vertical nanowire MOSFET (VNWMOSFET) with channel length of 300 nm and diameter of 120 nm, the narrowest GaN-based vertical nanowire transistor ever achieved from the top-down approach, was fabricated by utilizing anisotropic side-wall wet etching in TMAH solution and photoresist etch-back process. The VNWMOSFET exhibited output characteristics with very low saturation drain voltage of less than 0.5 V, which is hardly observed from the wide bandgap-based devices. Simulation results indicated that the narrow diameter of the VNWMOSFET with relatively short channel length is responsible for the low voltage operation. The VNWMOSFET also demonstrated normally-off mode with threshold voltage (VTH) of 0.7 V, extremely low leakage current of ∼10-14 A, low drain-induced barrier lowering (DIBL) of 125 mV/V, and subthreshold swing (SS) of 66-122 mV/decade. The GaN GAA VNWMOSFET with narrow channel diameter investigated in this work would be promising for new low voltage logic application. He has been a Professor with the School of Electrical Engineering and Computer Science, Kyungpook National University, Daegu, Korea, since 1993
Multi-layered nanocomposite dielectrics for high density organic memory devices
NASA Astrophysics Data System (ADS)
Kang, Moonyeong; Chung, Kyungwha; Baeg, Kang-Jun; Kim, Dong Ha; Kim, Choongik
2015-01-01
We fabricated organic memory devices with metal-pentacene-insulator-silicon structure which contain double dielectric layers comprising 3D pattern of Au nanoparticles (Au NPs) and block copolymer (PS-b-P2VP). The role of Au NPs is to charge/discharge carriers upon applied voltage, while block copolymer helps to form highly ordered Au NP patterns in the dielectric layer. Double-layered nanocomposite dielectrics enhanced the charge trap density (i.e., trapped charge per unit area) by Au NPs, resulting in increase of the memory window (ΔVth).
NASA Astrophysics Data System (ADS)
Nimmy John, V.; Varanakkottu, Subramanyan Namboodiri; Varghese, Soney
2018-06-01
Flexible polymer dispersed liquid crystal (F-PDLC) devices were fabricated using transparent conducting ITO/PET film. Polymerization induced phase separation (PIPS) method was used for pure and ferroelectric BaTiO3 (BTO) and ZnO doped PDLC devices. The distribution of nanoparticles in the PDLC and the formation of micro cavities were studied using field emission scanning electron microscopy (FESEM). It was observed that the addition of ferroelectric BTO nanoparticles has reduced the threshold voltage (Vth) and saturation voltage (Vsat) of FNP-PDLC by 85% and 41% respectively due to the spontaneous polarization of ferroelectric nanoparticles. The ferroelectric properties of BTO and ZnO in the fabricated devices were investigated using dynamic contact electrostatic force microscopy (DC EFM). Flexing the device can generate a potential due to the piezo-tribo electric effect of the ferroelectric nanomaterial doped in the PDLC matrix, which could be utilized as an energy generating system. The switching voltage after multiple flexing was also studied and found to be in par with non-flexing situations.
Shin, Sang-Yeol; Choi, J. M.; Seo, Juhee; Ahn, Hyung-Woo; Choi, Yong Gyu; Cheong, Byung-ki; Lee, Suyoun
2014-01-01
The Ovonic Threshold Switch (OTS) based on an amorphous chalcogenide material has attracted much interest as a promising candidate for a high-performance thin-film switching device enabling 3D-stacking of memory devices. In this work, we studied on the electronic structure of amorphous Sb-doped Ge0.6Se0.4 (in atomic mole fraction) film and its characteristics as to OTS devices. From the optical absorption spectroscopy measurement, the band gap (Eg) was found to decrease with increasing Sb content. In addition, as Sb content increased, the activation energy (Ea) for electrical conduction was found to decrease down to about one third of Eg from a half. As to the device characteristics, we found that the threshold switching voltage (Vth) drastically decreased with the Sb content. These results, being accountable in terms of the changes in the bonding configuration of constituent atoms as well as in the electronic structure such as the energy gap and trap states, advance an effective method of compositional adjustment to modulate Vth of an OTS device for various applications. PMID:25403772
Effects of target plasma electron-electron collisions on correlated motion of fragmented protons.
Barriga-Carrasco, Manuel D
2006-02-01
The objective of the present work is to examined the effects of plasma target electron-electron collisions on H2 + protons traversing it. Specifically, the target is deuterium in a plasma state with temperature Te=10 eV and density n=10(23) cm(-3), and proton velocities are vp=vth, vp=2vth, and vp=3vth, where vth is the electron thermal velocity of the target plasma. Proton interactions with plasma electrons are treated by means of the dielectric formalism. The interactions among close protons through plasma electronic medium are called vicinage forces. It is checked that these forces always screen the Coulomb explosions of the two fragmented protons from the same H2 + ion decreasing their relative distance. They also align the interproton vector along the motion direction, and increase the energy loss of the two protons at early dwell times while for longer times the energy loss tends to the value of two isolated protons. Nevertheless, vicinage forces and effects are modified by the target electron collisions. These collisions enhance the calculated self-stopping and vicinage forces over the collisionless results. Regarding proton correlated motion, when these collisions are included, the interproton vector along the motion direction overaligns at slower proton velocities (vp=vth) and misaligns for faster ones (vp=2vth, vp=3vth). They also contribute to a great extend to increase the energy loss of the fragmented H2 + ion. This later effect is more significant in reducing projectile velocity.
Scaling behavior of fully spin-coated TFT
NASA Astrophysics Data System (ADS)
Mondal, Sandip; Kumar, Arvind; Rao, K. S. R. Koteswara; Venkataraman, V.
2017-05-01
We studied channel scaling behavior of fully spin coated, low temperature solution processed thin film transistor (TFT) fabricated on p++ - Si (˜1021 cm-3) as bottom gate. The solution processed, spin coated 40 nm thick amorphous Indium Gallium Zinc Oxide (a-IGZO) and 50 nm thick amorphous zirconium di-oxide (a-ZrO2) has been used as channel and low leakage dielectric at 350°C respectively. The channel scaling effect of the TFT with different width/length ratio (W/L= 2.5, 5 and 15) for same channel length (L = 10 μm) has been demonstrated. The lowest threshold voltage (Vth) is 6.25 V for the W/L=50/10. The maximum field effect mobility (μFE) has been found to be 0.123 cm2/Vs from W/L of 50/10 with the drain to source voltage (VD) of 10V and 20V gate to source voltage (VG). We also demonstrated that there is no contact resistance effect on the mobility of the fully sol-gel spin coated TFT.
NASA Astrophysics Data System (ADS)
Tomita, Toshihiro; Miyaji, Kousuke
2015-04-01
The dependence of spatial and statistical distribution of random telegraph noise (RTN) in a 30 nm NAND flash memory on channel doping concentration NA and cell program state Vth is comprehensively investigated using three-dimensional Monte Carlo device simulation considering random dopant fluctuation (RDF). It is found that single trap RTN amplitude ΔVth is larger at the center of the channel region in the NAND flash memory, which is closer to the jellium (uniform) doping results since NA is relatively low to suppress junction leakage current. In addition, ΔVth peak at the center of the channel decreases in the higher Vth state due to the current concentration at the shallow trench isolation (STI) edges induced by the high vertical electrical field through the fringing capacitance between the channel and control gate. In such cases, ΔVth distribution slope λ cannot be determined by only considering RDF and single trap.
NASA Astrophysics Data System (ADS)
Zhang, Yu; Jin, Lei; Jiang, Dandan; Zou, Xingqi; Zhao, Zhiguo; Gao, Jing; Zeng, Ming; Zhou, Wenbin; Tang, Zhaoyun; Huo, Zongliang
2018-03-01
In order to optimize program disturbance characteristics effectively, a characterization approach that measures top select transistor (TSG) leakage from bit-line is proposed to quantify TSG leakage under program inhibit condition in 3D NAND flash memory. Based on this approach, the effect of Vth modulation of two-cell TSG on leakage is evaluated. By checking the dependence of leakage and corresponding program disturbance on upper and lower TSG Vth, this approach is validated. The optimal Vth pattern with high upper TSG Vth and low lower TSG Vth has been suggested for low leakage current and high boosted channel potential. It is found that upper TSG plays dominant role in preventing drain induced barrier lowering (DIBL) leakage from boosted channel to bit-line, while lower TSG assists to further suppress TSG leakage by providing smooth potential drop from dummy WL to edge of TSG, consequently suppressing trap assisted band-to-band tunneling current (BTBT) between dummy WL and TSG.
NASA Astrophysics Data System (ADS)
Huang, Shyh-Jer; Chou, Cheng-Wei; Su, Yan-Kuin; Lin, Jyun-Hao; Yu, Hsin-Chieh; Chen, De-Long; Ruan, Jian-Long
2017-04-01
In this paper, we present a technique to fabricate normally off GaN-based high-electron mobility transistor (HEMT) by sputtering and post-annealing p-NiOx capping layer. The p-NiOx layer is produced by sputtering at room temperature and post-annealing at 500 °C for 30 min in pure O2 environment to achieve high hole concentration. The Vth shifts from -3 V in the conventional transistor to 0.33 V, and on/off current ratio became 107. The forward and reverse gate breakdown increase from 3.5 V and -78 V to 10 V and -198 V, respectively. The reverse gate leakage current is 10-9 A/mm, and the off-state drain-leakage current is 10-8 A/mm. The Vth hysteresis is extremely small at about 33 mV. We also investigate the mechanism that increases hole concentration of p-NiOx after annealing in oxygen environment resulted from the change of Ni2+ to Ni3+ and the surge of (111)-orientation.
Processor-Based Strong Physical Unclonable Functions with Aging-Based Response Tuning (Preprint)
2013-01-01
NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON GARRET S. ROSE a. REPORT U b . ABSTRACT U c. THIS PAGE U 19b. TELEPHONE NUMBER (Include area code...generated by quad-tree process variation model [1]. The number in the right side of the figures means Z value of Gaussian distribution. B . Delay model To...and B are technology dependent constants. As shown in Equation 2, the Vth shift heavily depends on temperature (T ) and stress time (t). By applying
IC Piracy Protection by APUF and Logic Obfuscation
2014-01-01
ABSTRACT UU 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON GARRETT S. ROSE a. REPORT U b . ABSTRACT U c. THIS PAGE U 19b. TELEPHONE NUMBER...activation energy respectively. A and B are technology dependent constants. As shown in Equation 2, the Vth shift heavily depends on temperature (T) and...shown in Figure 2, two 4-bit operands (operand A and B ) are fed into each ALU and a 4-bit output (S1~ S4) can be obtained from each ALU. For delay
Hospital management principles applicable to the veterinary teaching hospital.
Harris, Donna L; Lloyd, James W; Marrinan, Mike
2004-01-01
The Skills, Knowledge, Aptitude, and Attitude (SKA) Subcommittee of the National Commission on Veterinary Economic Issues (NCVEI) has identified the need for veterinary teaching hospitals (VTH) to be at the forefront of progressive business management to serve as a model for both students and practitioners to emulate. To provide a foundation for developing a model, this study reviewed pertinent literature applicable to the management of a VTH. Much of the literature relevant to VTH management relates to work completed for the human side of medicine (academic health centers, or AHCs) or to the private sector. This review explores management practices in strategic planning, financial management, human resource management, marketing, pricing, operations, and legal issues. It is concluded that strategic management is important to provide the foundation for success in the VTH. In addition, periodic financial reports are recommended, as are the development and use of benchmarks for financial management. Establishing positive, motivating human resource practices is also suggested, along with development of a marketing plan based on a clear understanding of VTH core competencies and the market's specific needs.
95 MeV oxygen ion irradiation effects on N-channel MOSFETs
NASA Astrophysics Data System (ADS)
Prakash, A. P. G.; Ke, S. C.; Siddappa, K.
2003-09-01
The N-channel metal oxide semiconductor field effect transistors (MOSFETs) were exposed to 95 MeV oxygen ions, in the fluence range of 5 x 10(10) to 5 x 10(13) ions/cm(2). The influence of ion irradiation on threshold voltage (V-TH), linear drain current (I-DLin), leakage current (I-L), drain conductance (g(D)), transconductance (g(m)), mobility (mu) and drain saturation current (I-DSat) of MOSFETs was studied systematically for various fluence. The V-TH of the irradiated MOSFET was found to decrease significantly after irradiation. The interface (N-it) and oxide trapped charge (N-ot) were estimated from the subthreshold measurements and were found to increase after irradiation. The densities of oxide-trapped (DeltaN(it)) charge in irradiated MOSFETs were found to he higher than those of the interface trapped charge (DeltaN(ot)). The I-DLin and I-Dsat of MOSFETs were also found to decrease significantly after irradiation. Studies on effects of 95 MeV oxygen ion irradiation on g(m), g(D) and mu show a degradation varying front 70 to 75% after irradiation. The mobility degradation coefficients for N-it(alpha(it)) and N-ot(alpha(it)) were estimated. The results of these studies are presented and discussed.
Variability Analysis of MOS Differential Amplifier
NASA Astrophysics Data System (ADS)
Aoki, Masakazu; Seto, Kenji; Yamawaki, Taizo; Tanaka, Satoshi
Variation characteristics in MOS differential amplifier are evaluated by using the concise statistical model parameters for SPICE simulation. We find that the variation in the differential-mode gain, Adm, induced by the current factor variation, Δβ0, in the Id-variation of the differential MOS transistors is more than one order of magnitude larger than that induced by the threshold voltage variation, ΔVth, which has been regarded as a major factor for circuit variations in SoC's (2). The results obtained by the Monte Carlo simulations are verified by the theoretical analysis combined with the sensitivity analysis which clarifies the specific device parameter dependences of the variation in Adm.
NASA Astrophysics Data System (ADS)
Lee, Jae-Hoon; Park, Sang-Geun; Jeon, Jae-Hong; Goh, Joon-chul; Huh, Jong-moo; Choi, Joonhoo; Chung, Kyuha; Han, Min-Koo
2007-03-01
We propose and fabricate a new hydrogenated amorphous silicon (a-Si:H) thin-film transistor (TFT) pixel employing a fraction time annealing (FTA), which can supply a negative gate bias during a fraction time of each frame rather than the entire whole frame, in order to improve the organic light emitting diode (OLED) current stability for an active matrix (AM) OLED. When an electrical bias for an initial reference current of 2 μA at 60 °C is applied to an FTA-driven pixel more than 100 h and the temperature is increased up to 60 °C rather than room temperature, the OLED current is reduced by 22% in the FTA-driven pixel, whereas it is reduced by 53% in a conventional pixel. The current stability of the proposed pixel is improved, because the applied negative bias can suppress the threshold voltage degradation of the a-Si:H TFT itself, which may be attributed to hole trapping into SiNx. The proposed fraction time annealing method can successfully suppress Vth shift of the a-Si:H TFT itself due to hole trapping into SiNx induced by negative gate bias annealing.
NASA Astrophysics Data System (ADS)
Ebrahimi, Behzad; Asad, Mohsen
2015-07-01
In this paper, we propose a fully AlGaN high electron mobility (HEMT) in which the gate electrode, the barrier and the channel are all AlGaN. The p-type AlGaN gate facilitates the normally-off operation to be compatible with the state-of-the-art power amplifiers. In addition, the AlGaN channel increases the breakdown voltage (VBR) to 598 V due to the higher breakdown field of AlGaN compared to GaN. To assess the efficiency of the proposed structure, its characteristics are compared with the conventional and recently proposed structures. The two-dimensional device simulation results show that the proposed structure has the highest threshold voltage (Vth) and the VBR with the moderately low ON-resistance (RON). These features lead to the highest figure of merit (2.49 × 1012) among the structures which is 83%, 59%, 47% and 49% more than those of the conventional, with a field plate, AlGaN gate and AlGaN channel structures, respectively.
NASA Astrophysics Data System (ADS)
Imamoto, Takuya; Ma, Yitao; Muraguchi, Masakazu; Endoh, Tetsuo
2015-04-01
In this paper, DC and low-frequency noise (LFN) characteristics have been investigated with actual measurement data in both n- and p-type vertical MOSFETs (V-MOSFETs) for the first time. The V-MOSFETs which was fabricated on 300 mm bulk silicon wafer process have realized excellent DC performance and a significant reduction of flicker (1/f) noise. The measurement results show that the fabricated V-MOSFETs with 60 nm silicon pillar and 100 nm gate length achieve excellent steep sub-threshold swing (69 mV/decade for n-type and 66 mV/decade for p-type), good on-current (281 µA/µm for n-type 149 µA/µm for p-type), low off-leakage current (28.1 pA/µm for n-type and 79.6 pA/µm for p-type), and excellent on-off ratio (1 × 107 for n-type and 2 × 106 for p-type). In addition, it is demonstrated that our fabricated V-MOSFETs can control the threshold voltage (Vth) by changing the channel doping condition, which is the useful and low-cost technique as it has been widely used in the conventional bulk planar MOSFET. This result indicates that V-MOSFETs can control Vth more finely and flexibly by the combined the use of the doping technique with other techniques such as work function engineering of metal-gate. Moreover, it is also shown that V-MOSFETs can suppress 1/f noise (L\\text{gate}WS\\text{Id}/I\\text{d}2 of 10-13-10-11 µm2/Hz for n-type and 10-12-10-10 µm2/Hz for p-type) to one or two order lower level than previously reported nanowire type MOSFET, FinFET, Tri-Gate, and planar MOSFETs. The results have also proved that both DC and 1/f noise performances are independent from the bias voltage which is applied to substrate or well layer. Therefore, it is verified that V-MOSFETs can eliminate the effects from substrate or well layer, which always adversely affects the circuit performances due to this serial connection.
Sol-gel-derived double-layered nanocrystal memory
NASA Astrophysics Data System (ADS)
Ko, Fu-Hsiang; You, Hsin-Chiang; Lei, Tan-Fu
2006-12-01
The authors have used the sol-gel spin-coating method to fabricate a coexisting hafnium silicate and zirconium silicate double-layered nanocrystal (NC) memories. From transmission electron microscopic and x-ray photoelectron spectroscopic analyses, the authors determined that the hafnium silicate and zirconium silicate NCs formed after annealing at 900°C for 1min. When using channel hot electron injection for charging and band-to-band tunneling-induced hot hole injection for discharging, the NC memories exhibited superior Vth shifting because of the higher probability for trapping the charge carrier.
NASA Astrophysics Data System (ADS)
Halim, N. Syafira Abdul; Wahid, M. Halim A.; Hambali, N. Azura M. Ahmad; Rashid, Shanise; Shahimin, Mukhzeer M.
2017-11-01
Light emitting diode (LED) employed a numerous applications such as displaying information, communication, sensing, illumination and lighting. In this paper, InGaN/AlGaN based on one quantum well (1QW) light emitting diode (LED) is modeled and studied numerically by using COMSOL Multiphysics 5.1 version. We have selected In0.06Ga0.94N as the active layer with thickness 50nm sandwiched between 0.15μm thick layers of p and n-type Al0.15Ga0.85N of cladding layers. We investigated an effect of doping concentration on InGaN/AlGaN double heterostructure of light-emitting diode (LED). Thus, energy levels, carrier concentration, electron concentration and forward voltage (IV) are extracted from the simulation results. As the doping concentration is increasing, the performance of threshold voltage, Vth on one quantum well (1QW) is also increases from 2.8V to 3.1V.
NASA Astrophysics Data System (ADS)
Hamadeh, Emad; Gunther, Norman G.; Niemann, Darrell; Rahman, Mahmud
2006-06-01
Random fluctuations in fabrication process outcomes such as gate line edge roughness (LER) give rise to corresponding fluctuations in scaled down MOS device characteristics. A thermodynamic-variational model is presented to study the effects of LER on threshold voltage and capacitance of sub-50 nm MOS devices. Conceptually, we treat the geometric definition of the MOS devices on a die as consisting of a collection of gates. In turn, each of these gates has an area, A, and a perimeter, P, defined by nominally straight lines subject to random process outcomes producing roughness. We treat roughness as being deviations from straightness consisting of both transverse amplitude and longitudinal wavelength each having lognormal distribution. We obtain closed-form expressions for variance of threshold voltage ( Vth), and device capacitance ( C) at Onset of Strong Inversion (OSI) for a small device. Using our variational model, we characterized the device electrical properties such as σ and σC in terms of the statistical parameters of the roughness amplitude and spatial frequency, i.e., inverse roughness wavelength. We then verified our model with numerical analysis of Vth roll-off for small devices and σ due to dopant fluctuation. Our model was also benchmarked against TCAD of σ as a function of LER. We then extended our analysis to predict variations in σ and σC versus average LER spatial frequency and amplitude, and oxide-thickness. Given the intuitive expectation that LER of very short wavelengths must also have small amplitude, we have investigated the case in which the amplitude mean is inversely related to the frequency mean. We compare with the situation in which amplitude and frequency mean are unrelated. Given also that the gate perimeter may consist of different LER signature for each side, we have extended our analysis to the case when the LER statistical difference between gate sides is moderate, as well as when it is significantly large.
NASA Astrophysics Data System (ADS)
Liau, Leo Chau-Kuang; Lin, Yun-Guo
2015-01-01
Ceramic-based metal-oxide-semiconductor (MOS) field-effect thin film transistors (TFTs), which were assembled by ZnO and TiO2 heterojunction films coated using solution processing technique, were fabricated and characterized. The fabrication of the device began with the preparation of ZnO and TiO2 films by spin coating. The ZnO and TiO2 films that were stacked together and annealed at 450 °C were characterized as a p-n junction diode. Two types of the devices, p-channel and n-channel TFTs, were produced using different assemblies of ZnO and TiO2 films. Results show that the p-channel TFTs (p-TFTs) and n-channel TFTs (n-TFTs) using the assemblies of ZnO and TiO2 films were demonstrated by source-drain current vs. drain voltage (IDS-VDS) measurements. Several electronic properties of the p- and n- TFTs, such as threshold voltage (Vth), on-off ratio, channel mobility, and subthreshold swing (SS), were determined by current-voltage (I-V) data analysis. The ZnO/TiO2-based TFTs can be produced using solution processing technique and an assembly approach.
Reduction of channel resistance in amorphous oxide thin-film transistors with buried layer
NASA Astrophysics Data System (ADS)
Chong, Eugene; Kim, Bosul; Lee, Sang Yeol
2012-04-01
A silicon-indium-zinc-oxide (SIZO) thin film transistor (TFT) with low channel-resistance (RCH) indium-zinc-oxide (In2O3:ZnO = 9:1) buried layer annealed at low temperature of 200°C exhibited high field-effect mobility (μFE) over 55.8 cm2/V·s which is 5 times higher than that of the conventional TFTs due to small threshold voltage (Vth) change of 1.8 V under bias-temperature stress (BTS) condition for 420 minutes. The low-RCH buried-layer allows more strong current-path formed in channel layer well within relatively high-RCH channel-layer since it is less affected by the channel bulk and/or back interface trap with high carrier concentration.
High performance thin film transistor with ZnO channel layer deposited by DC magnetron sputtering.
Moon, Yeon-Keon; Moon, Dae-Yong; Lee, Sang-Ho; Jeong, Chang-Oh; Park, Jong-Wan
2008-09-01
Research in large area electronics, especially for low-temperature plastic substrates, focuses commonly on limitations of the semiconductor in thin film transistors (TFTs), in particular its low mobility. ZnO is an emerging example of a semiconductor material for TFTs that can have high mobility, while a-Si and organic semiconductors have low mobility (<1 cm2/Vs). ZnO-based TFTs have achieved high mobility, along with low-voltage operation low off-state current, and low gate leakage current. In general, ZnO thin films for the channel layer of TFTs are deposited with RF magnetron sputtering methods. On the other hand, we studied ZnO thin films deposited with DC magnetron sputtering for the channel layer of TFTs. After analyzing the basic physical and chemical properties of ZnO thin films, we fabricated a TFT-unit cell using ZnO thin films for the channel layer. The field effect mobility (micro(sat)) of 1.8 cm2/Vs and threshold voltage (Vth) of -0.7 V were obtained.
Fabrication of solution-processed InSnZnO/ZrO2 thin film transistors.
Hwang, Soo Min; Lee, Seung Muk; Choi, Jun Hyuk; Lim, Jun Hyung; Joo, Jinho
2013-11-01
We fabricated InSnZnO (ITZO) thin-film transistors (TFTs) with a high-permittivity (K) ZrO2 gate insulator using a solution process and explored the microstructure and electrical properties. ZrO2 and ITZO (In:Sn:Zn = 2:1:1) precursor solutions were deposited using consecutive spin-coating and drying steps on highly doped p-type Si substrate, followed by annealing at 700 degrees C in ambient air. The ITZO/ZrO2 TFT device showed n-channel depletion mode characteristics, and it possessed a high saturation mobility of approximately 9.8 cm2/V x s, a small subthreshold voltage swing of approximately 2.3 V/decade, and a negative V(TH) of approximately 1.5 V, but a relatively low on/off current ratio of approximately 10(-3). These results were thought to be due to the use of the high-kappa crystallized ZrO2 dielectric (kappa approximately 21.8) as the gate insulator, which could permit low-voltage operation of the solution-processed ITZO TFT devices for applications to high-throughput, low-cost, flexible and transparent electronics.
NASA Astrophysics Data System (ADS)
Lagger, P.; Steinschifter, P.; Reiner, M.; Stadtmüller, M.; Denifl, G.; Naumann, A.; Müller, J.; Wilde, L.; Sundqvist, J.; Pogany, D.; Ostermaier, C.
2014-07-01
The high density of defect states at the dielectric/III-N interface in GaN based metal-insulator-semiconductor structures causes tremendous threshold voltage drifts, ΔVth, under forward gate bias conditions. A comprehensive study on different dielectric materials, as well as varying dielectric thickness tD and barrier thickness tB, is performed using capacitance-voltage analysis. It is revealed that the density of trapped electrons, ΔNit, scales with the dielectric capacitance under spill-over conditions, i.e., the accumulation of a second electron channel at the dielectric/AlGaN barrier interface. Hence, the density of trapped electrons is defined by the charging of the dielectric capacitance. The scaling behavior of ΔNit is explained universally by the density of accumulated electrons at the dielectric/III-N interface under spill-over conditions. We conclude that the overall density of interface defects is higher than what can be electrically measured, due to limits set by dielectric breakdown. These findings have a significant impact on the correct interpretation of threshold voltage drift data and are of relevance for the development of normally off and normally on III-N/GaN high electron mobility transistors with gate insulation.
NASA Astrophysics Data System (ADS)
Gnana Prakash, A. P.; Pradeep, T. M.; Hegde, Vinayakprasanna N.; Pushpa, N.; Bajpai, P. K.; Patel, S. P.; Trivedi, Tarkeshwar; Bhushan, K. G.
2017-12-01
NPN transistors and N-channel depletion metal oxide semiconductor field effect transistors (MOSFETs) were irradiated with 5 MeV protons and 60Co gamma radiation in the dose ranging from 1 Mrad(Si) to 100 Mrad(Si). The different electrical characteristics of the NPN transistor such as Gummel characteristics, excess base current (ΔIB), dc current gain (hFE), transconductance (gm), displacement damage factor (K) and output characteristics were studied as a function of total dose. The different electrical characteristics of N-channel MOSFETs such as threshold voltage (Vth), density of interface trapped charges (ΔNit), density of oxide trapped charges (ΔNot), transconductance (gm), mobility (µ) and drain saturation current (IDSat) were studied systematically before and after irradiation in the same dose ranges. A considerable increase in the base current (IB) and decrease in the hFE, gm and collector saturation current (ICSat) were observed after irradiation in the case of the NPN transistor. In the N-channel MOSFETs, the ΔNit and ΔNot were found to increase and Vth, gm, µ and IDSat were found to decrease with increase in the radiation dose. The 5 MeV proton irradiation results of both the NPN transistor and N-channel MOSFETs were compared with 60Co gamma-irradiated devices in the same dose ranges. It was observed that the degradation in 5 MeV proton-irradiated devices is more when compared with the 60Co gamma-irradiated devices at higher total doses.
Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing
NASA Astrophysics Data System (ADS)
Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.
2015-08-01
A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.
Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patel, N.; Department of Electrical and Computer Engineering, MSC01 1100, University of New Mexico, Albuquerque, New Mexico 87131-0001; Branch, D. W.
2015-08-15
A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO{sub 3}) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5more » μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less
Comparative study of 0° X-cut and Y+36°-cut lithium niobate high-voltage sensing
Patel, N.; Branch, D. W.; Schamiloglu, E.; ...
2015-08-11
A comparison study between Y+36° and 0° X-cut lithium niobate (LiNbO 3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y+36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses tomore » both crystals, the voltage-induced shift scaled linearly with voltage. For the Y+36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y+36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y+36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. Furthermore, when the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less
NASA Technical Reports Server (NTRS)
Poe, C. H.; Owocki, S. P.; Castor, J. I.
1990-01-01
The steady state solution topology for absorption line-driven flows is investigated for the condition that the Sobolev approximation is not used to compute the line force. The solution topology near the sonic point is of the nodal type with two positive slope solutions. The shallower of these slopes applies to reasonable lower boundary conditions and realistic ion thermal speed v(th) and to the Sobolev limit of zero of the usual Castor, Abbott, and Klein model. At finite v(th), this solution consists of a family of very similar solutions converging on the sonic point. It is concluded that a non-Sobolev, absorption line-driven flow with a realistic values of v(th) has no uniquely defined steady state. To the extent that a pure absorption model of the outflow of stellar winds is applicable, radiatively driven winds should be intrinsically variable.
Electrical switching in Sb doped Al23Te77 glasses
NASA Astrophysics Data System (ADS)
Pumlianmunga; Ramesh, K.
2017-08-01
Bulk glasses (Al23Te77)Sbx (0≤ x≤10) prepared by melt quenching method show a change in switching type from threshold to memory for x≥5. An increase in threshold current (Ith) and a concomitant decrease in threshold voltage (Vth) and resisitivity(ρ) have been observed with the increase of Sb content. Raman spectra of the switched region in memory switching compositions show a red shift with respect to the as prepared glasses whereas in threshold switching compositions no such shift is observed. The magic angle spinning nuclear magnetic resonance (MAS NMR) of 27Al atom shows three different environments for Al ([4]Al, [5]Al and [6]Al). The samples annealed at their respective crystallization temperatures show rapid increase in [4]Al sites by annihilating [5]Al sites. The melts of threshold switching glasses (x≤2.5) quenched in water at room temperature (27 °C) show amorphous structure whereas, the melt of memory switching glasses (x>2.5) solidify into crystalline structure. The higher coordination of Al increases the cross-linking and rigidity. The addition of Sb increases the glass transition(Tg) and decreases the crystallization temperature(Tc). The decrease in the interval between the Tg and Tc eases the transition between the amorphous and crystalline states and improves the memory properties. The temperature rise at the time of switching can be as high as its melting temperature and the material in between the electrodes may melt to form a filament. The filament may consists of temporary (high resistive amorphous) and permanent (high conducting crystalline) units. The ratio between the temporary and the permanent units may decide the switching type. The filament is dominated by the permanent units in memory switching compositions and by the temporary units in threshold switching compositions. The present study suggests that both the threshold and memory switching can be understood by the thermal model and filament formation.
Haddad, Georges A.
2011-01-01
The voltage sensors of voltage-gated ion channels undergo a conformational change upon depolarization of the membrane that leads to pore opening. This conformational change can be measured as gating currents and is thought to be transferred to the pore domain via an annealing of the covalent link between voltage sensor and pore (S4-S5 linker) and the C terminus of the pore domain (S6). Upon prolonged depolarizations, the voltage dependence of the charge movement shifts to more hyperpolarized potentials. This mode shift had been linked to C-type inactivation but has recently been suggested to be caused by a relaxation of the voltage sensor itself. In this study, we identified two ShakerIR mutations in the S4-S5 linker (I384N) and S6 (F484G) that, when mutated, completely uncouple voltage sensor movement from pore opening. Using these mutants, we show that the pore transfers energy onto the voltage sensor and that uncoupling the pore from the voltage sensor leads the voltage sensors to be activated at more negative potentials. This uncoupling also eliminates the mode shift occurring during prolonged depolarizations, indicating that the pore influences entry into the mode shift. Using voltage-clamp fluorometry, we identified that the slow conformational change of the S4 previously correlated with the mode shift disappears when uncoupling the pore. The effects can be explained by a mechanical load that is imposed upon the voltage sensors by the pore domain and allosterically modulates its conformation. Mode shift is caused by the stabilization of the open state but leads to a conformational change in the voltage sensor. PMID:21518834
An Evaluation of Flash Cells Used in Critical Applications
NASA Technical Reports Server (NTRS)
Katz, Rich; Flowers, David; Bergevin, Keith
2016-01-01
Due to the common use of Flash technology in many commercial and industrial Programmable Logic Devices (PLDs) such as FPGAs and mixed-signal microcontrollers, flash technology is being utilized in fuzed munition applications. This presents a long-term reliability issue for both DoD and NASA safety- and mission-critical applications. A thorough understanding of the data retention failure modes and statistics associated with Flash data retention is of vital concern to the fuze safety community. A key retention parameter for a flash cell is the threshold voltage (VTH), which is an indirect indicator of the amount of charge stored on the cells floating gate. Initial test results based on a study of charge loss in flash cells in an FPGA device is presented. Statistical data taken from a small sample set indicates quantifiable charge loss for devices stored at both room temperature and 150 C. Initial evaluation of the distribution of threshold voltage in a large sample set (800 devices) is presented. The magnitude of charge loss from exposure to electrostatic discharge and electromagnetic fields is measured and presented. Simulated data (and measured data as available) resultant from harsh-environment testing (neutron, heavy ion, EMP) is presented.
Frequency stabilization in nonlinear MEMS and NEMS oscillators
Lopez, Omar Daniel; Antonio, Dario
2014-09-16
An illustrative system includes an amplifier operably connected to a phase shifter. The amplifier is configured to amplify a voltage from an oscillator. The phase shifter is operably connected to a driving amplitude control, wherein the phase shifter is configured to phase shift the amplified voltage and is configured to set an amplitude of the phase shifted voltage. The oscillator is operably connected to the driving amplitude control. The phase shifted voltage drives the oscillator. The oscillator is at an internal resonance condition, based at least on the amplitude of the phase shifted voltage, that stabilizes frequency oscillations in the oscillator.
Baral, Jayanta K; Majumdar, Himadri S; Laiho, Ari; Jiang, Hua; Kauppinen, Esko I; Ras, Robin H A; Ruokolainen, Janne; Ikkala, Olli; Osterbacka, Ronald
2008-01-23
We report a simple memory device in which the fullerene-derivative [6,6]-phenyl-C(61) butyric acid methyl ester (PCBM) mixed with inert polystyrene (PS) matrix is sandwiched between two aluminum (Al) electrodes. Transmission electron microscopy (TEM) images of PCBM:PS films showed well controlled morphology without forming any aggregates at low weight percentages (<10 wt%) of PCBM in PS. Energy dispersive x-ray spectroscopy (EDX) analysis of the device cross-sections indicated that the thermal evaporation of the Al electrodes did not lead to the inclusion of Al metal nanoparticles into the active PCBM:PS film. Above a threshold voltage of <3 V, independent of thickness, a consistent negative differential resistance (NDR) is observed in devices in the thickness range from 200 to 350 nm made from solutions with 4-10 wt% of PCBM in PS. We found that the threshold voltage (V(th)) for switching from the high-impedance state to the low-impedance state, the voltage at maximum current density (V(max)) and the voltage at minimum current density (V(min)) in the NDR regime are constant within this thickness range. The current density ratio at V(max) and V(min) is more than or equal to 10, increasing with thickness. Furthermore, the current density is exponentially dependent on the longest tunneling jump between two PCBM molecules, suggesting a tunneling mechanism between individual PCBM molecules. This is further supported with temperature independent NDR down to 240 K.
Ahn, Byung Du; Jeon, Hye Ji; Park, Jin-Seong
2014-06-25
This paper addressed the effect of gallium nitrate hydrate addition on thin film transistor (TFT) performance and positive bias stability of amorphous zinc tin oxide (ZTO) TFTs by solution processing, Further, the mechanisms responsible for chemical properties and electronic band structure are explored. A broad exothermic peak accompanied by weight loss appeared in the range from about 350 to 570 °C for the ZTO solution; the thermal reaction of the Ga-ZTO:N solution was completed at 520 °C. This is because the gallium nitrate hydrate precursor promoted the decomposition and dehydroxylation reaction for Zn(CH3COO)2·2H2O and/or SnCl2·2H2O precursors. The concentrations of carbon and chloride in gallium nitrate hydrate added ZTO films annealed at 400 °C have a lower value (C 0.65, Cl 0.65 at. %) compared with those of ZTO films (C 3.15, Cl 0.82 at. %). Absorption bands at 416, 1550, and 1350 cm(-1) for GaZTO:N films indicated the presence of ZnGa2O4, N-H, and N═O groups by Fourier transform infrared spectroscopy measurement, respectively. As a result, an inverted staggered Ga-ZTO:N TFT exhibited a mobility of 4.84 cm(2) V(-1) s(-1) in the saturation region, a subthreshold swing of 0.35 V/decade, and a threshold gate voltage (Vth) of 0.04 V. In addition, the instability of Vth values of the ZTO TFTs under positive bias stress conditions was suppressed by adding Ga and N from 13.6 to 3.17 V, which caused a reduction in the oxygen-related defects located near the conduction band.
NASA Astrophysics Data System (ADS)
Wang, Chao; Meng, You; Guo, Zidong; Shin, Byoungchul; Liu, Guoxia; Shan, Fukai
2018-05-01
One-dimensional metal oxide nanofibers have been regarded as promising building blocks for large area low cost electronic devices. As one of the representative metal oxide semiconducting materials, In2O3 based materials have attracted much interest due to their excellent electrical and optical properties. However, most of the field-effect transistors (FETs) based on In2O3 nanofibers usually operate in a depletion mode, which lead to large power consumption and a complicated integrated circuit design. In this report, gadolinium (Gd) doped In2O3 (InGdO) nanofibers were fabricated by electrospinning and applied as channels in the FETs. By optimizing the doping concentration and the nanofiber density, the device performance could be precisely manipulated. It was found that the FETs based on InGdO nanofibers, with a Gd doping concentration of 3% and a nanofiber density of 2.9 μm-1, exhibited the best device performance, including a field-effect mobility (μFE) of 2.83 cm2/V s, an on/off current ratio of ˜4 × 108, a threshold voltage (VTH) of 5.8 V, and a subthreshold swing (SS) of 2.4 V/decade. By employing the high-k ZrOx thin films as the gate dielectrics in the FETs, the μFE, VTH and SS can be further improved to be 17.4 cm2/V s, 0.7 V and 160 mV/decade, respectively. Finally, an inverter based on the InGdO nanofibers/ZrOx FETs was constructed and a gain of ˜11 was achieved.
NASA Astrophysics Data System (ADS)
Wang, Yijiao; Huang, Peng; Xin, Zheng; Zeng, Lang; Liu, Xiaoyan; Du, Gang; Kang, Jinfeng
2014-01-01
In this work, three dimensional technology computer-aided design (TCAD) simulations are performed to investigate the impact of random discrete dopant (RDD) including extension induced fluctuation in 14 nm silicon-on-insulator (SOI) gate-source/drain (G-S/D) underlap fin field effect transistor (FinFET). To fully understand the RDD impact in extension, RDD effect is evaluated in channel and extension separately and together. The statistical variability of FinFET performance parameters including threshold voltage (Vth), subthreshold slope (SS), drain induced barrier lowering (DIBL), drive current (Ion), and leakage current (Ioff) are analyzed. The results indicate that RDD in extension can lead to substantial variability, especially for SS, DIBL, and Ion and should be taken into account together with that in channel to get an accurate estimation on RDF. Meanwhile, higher doping concentration of extension region is suggested from the perspective of overall variability control.
Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267
Peters, Colin H; Yu, Alec; Zhu, Wandi; Silva, Jonathan R; Ruben, Peter C
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.
Energy reduction through voltage scaling and lightweight checking
NASA Astrophysics Data System (ADS)
Kadric, Edin
As the semiconductor roadmap reaches smaller feature sizes and the end of Dennard Scaling, design goals change, and managing the power envelope often dominates delay minimization. Voltage scaling remains a powerful tool to reduce energy. We find that it results in about 60% geomean energy reduction on top of other common low-energy optimizations with 22nm CMOS technology. However, when voltage is reduced, it becomes easier for noise and particle strikes to upset a node, potentially causing Silent Data Corruption (SDC). The 60% energy reduction, therefore, comes with a significant drop in reliability. Duplication with checking and triple-modular redundancy are traditional approaches used to combat transient errors, but spending 2--3x the energy for redundant computation can diminish or reverse the benefits of voltage scaling. As an alternative, we explore the opportunity to use checking operations that are cheaper than the base computation they are guarding. We devise a classification system for applications and their lightweight checking characteristics. In particular, we identify and evaluate the effectiveness of lightweight checks in a broad set of common tasks in scientific computing and signal processing. We find that the lightweight checks cost only a fraction of the base computation (0-25%) and allow us to recover the reliability losses from voltage scaling. Overall, we show about 50% net energy reduction without compromising reliability compared to operation at the nominal voltage. We use FPGAs (Field-Programmable Gate Arrays) in our work, although the same ideas can be applied to different systems. On top of voltage scaling, we explore other common low-energy techniques for FPGAs: transmission gates, gate boosting, power gating, low-leakage (high-Vth) processes, and dual-V dd architectures. We do not scale voltage for memories, so lower voltages help us reduce logic and interconnect energy, but not memory energy. At lower voltages, memories become dominant, and we get diminishing returns from continuing to scale voltage. To ensure that memories do not become a bottleneck, we also design an energy-robust FPGA memory architecture, which attempts to minimize communication energy due to mismatches between application and architecture. We do this alongside application parallelism tuning. We show our techniques on a wide range of applications, including a large real-time system used for Wide-Area Motion Imaging (WAMI).
Microstructure and electrical properties of Sb2Te phase-change material
NASA Astrophysics Data System (ADS)
Liu, Guangyu; Wu, Liangcai; Li, Tao; Rao, Feng; Song, Sannian; Liu, Bo; Song, Zhitang
2016-10-01
Phase Change Memory (PCM) has great potential for commercial applications of next generation non-volatile memory (NVM) due to its high operation speed, high endurance and low power consumption. Sb2Te (ST) is a common phase-change material and has fast crystallization speed, while thermal stability is relatively poor and its crystallization temperature is about 142°C. According to the Arrhenius law, the extrapolated failure temperature is about 55°C for ten years. When heated above the crystallization temperature while below the melting point, its structure can be transformed from amorphous phase to hexagonal phase. Due to the growth-dominated crystallization mechanism, the grain size of ST film is large and the diameter of about 300 nm is too large compared with Ge2Sb2Te5 (GST), which may deteriorate the device performance. High resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED) were employed to study the microstructures and the results indicate that the crystal plane is {110}. In addition, device cells were manufactured and their current-voltage (I-V) and resistance-voltage characteristics were tested, and the results reveal that the threshold voltage (Vth) of ST film is 0.87 V. By researching the basic properties of ST, we can understand its disadvantages and manage to improve its performance by doping or other proper methods. Finally, the improved ST can be a candidate for optical discs and PCM.
Polarization engineered enhancement mode GaN HEMT: Design and investigation
NASA Astrophysics Data System (ADS)
Verma, Sumit; Loan, Sajad A.; Alharbi, Abdullah G.
2018-07-01
In this paper, we propose and perform the experimentally calibrated simulation of a novel structure of a GaN/AlGaN high electron mobility transistor (HEMT). The novelty of the structure is the realization of enhancement mode operation by employing polarization engineering approach. In the proposed polarization engineered HEMT (PE-HEMT) a buried Aluminum Nitride (AlN) box is employed in the GaN layer just below the gate. The AlN box creates a two-dimensional hole gas (2DHG) at the GaN/AlN interface, which creates a conduction band barrier in the path of the already existing two-dimensional electron gas (2DEG) at GaN/AlGaN. Therefore, there is no direct path between the source and drain regions at zero gate voltage due to the barrier created by AIN and the device is initially OFF, an enhancement mode operation. A two dimensional (2D) calibrated simulation study of proposed PE-HEMT shows that the device has a threshold voltage (Vth) of 2.3 V. The PE-HEMT also reduces the electron spillover and thus improves the breakdown voltage by 108% as compared to conventional HEMT. The thermal analysis of the GaN PE-HEMT shows that a hot zone occurs on the drain side gate edge. It has been observed that the drain current in the PE-HEMT structure can be improved by 157% by using AlN heat sink.
Hasegawa, Hiroaki; Lind, Erin J.; Boin, Markus A.; Häse, Claudia C.
2008-01-01
Vibrio tubiashii is a recently reemerging pathogen of larval bivalve mollusks, causing both toxigenic and invasive disease. Marine Vibrio spp. produce an array of extracellular products as potential pathogenicity factors. Culture supernatants of V. tubiashii have been shown to be toxic to oyster larvae and were reported to contain a metalloprotease and a cytolysin/hemolysin. However, the structural genes responsible for these proteins have yet to be identified, and it is uncertain which extracellular products play a role in pathogenicity. We investigated the effects of the metalloprotease and hemolysin secreted by V. tubiashii on its ability to kill Pacific oyster (Crassostrea gigas) larvae. While V. tubiashii supernatants treated with metalloprotease inhibitors severely reduced the toxicity to oyster larvae, inhibition of the hemolytic activity did not affect larval toxicity. We identified structural genes of V. tubiashii encoding a metalloprotease (vtpA) and a hemolysin (vthA). Sequence analyses revealed that VtpA shared high homology with metalloproteases from a variety of Vibrio species, while VthA showed high homology only to the cytolysin/hemolysin of Vibrio vulnificus. Compared to the wild-type strain, a VtpA mutant of V. tubiashii not only produced reduced amounts of protease but also showed decreased toxicity to C. gigas larvae. Vibrio cholerae strains carrying the vtpA or vthA gene successfully secreted the heterologous protein. Culture supernatants of V. cholerae carrying vtpA but not vthA were highly toxic to Pacific oyster larvae. Together, these results suggest that the V. tubiashii extracellular metalloprotease is important in its pathogenicity to C. gigas larvae. PMID:18456850
Performance improvement of doped TFET by using plasma formation concept
NASA Astrophysics Data System (ADS)
Soni, Deepak; Sharma, Dheeraj; Yadav, Shivendra; Aslam, Mohd.; Sharma, Neeraj
2018-01-01
Formation of abrupt doping profile at tunneling junction for the nanoscale tunnel field effect transistor (TFET) is a critical issue for attaining improved electrical behaviour. The realization of abrupt doping profile is more difficult in the case of physically doped TFETs due to material solubility limit. In this concern, we propose a novel design of TFET. For this, P+ (source)-I (channel)-N (drain) type structure has been considered, wherein a metal electrode is deposited over the source region. In addition to this, a negative voltage is applied to the source electrode (SE). It induces the surface plasma layer of holes in the source region, which is responsible for steepness in the bands at source/channel junction and provides the advantage of higher doping in source region without any addition of the physical impurity. The proposed modification is helpful for achieving steeper band bending at the source/channel interface, which enables higher tunneling generation rate of charge carriers at this interface and overcomes the issue of low ON-state current. Thus, the proposed device shows the increment of 2 decades in drain current and 252 mV reduction in threshold voltage compared with conventional device. The optimization of spacer length (LSG) between source/gate (LSG) and applied negative voltage (Vpg) over source electrode have been performed to obtain optimum drain current and threshold voltage (Vth). Further, for the suppression of ambipolar current, drain region is kept lightly doped, which reduces the ambipolar current up to level of Off state current. Moreover, in the proposed device gate electrode is underlapped for improving RF performance. It also reduces gate to drain capacitances (Cgd) and increases cut-off-frequency (fT), fmax, GBP, TFP. In addition to these, linearity analysis has been performed to validate the applicability of the device.
Solvothermal synthesis of gallium-indium-zinc-oxide nanoparticles for electrolyte-gated transistors.
Santos, Lídia; Nunes, Daniela; Calmeiro, Tomás; Branquinho, Rita; Salgueiro, Daniela; Barquinha, Pedro; Pereira, Luís; Martins, Rodrigo; Fortunato, Elvira
2015-01-14
Solution-processed field-effect transistors are strategic building blocks when considering low-cost sustainable flexible electronics. Nevertheless, some challenges (e.g., processing temperature, reliability, reproducibility in large areas, and cost effectiveness) are requirements that must be surpassed in order to achieve high-performance transistors. The present work reports electrolyte-gated transistors using as channel layer gallium-indium-zinc-oxide nanoparticles produced by solvothermal synthesis combined with a solid-state electrolyte based on aqueous dispersions of vinyl acetate stabilized with cellulose derivatives, acrylic acid ester in styrene and lithium perchlorate. The devices fabricated using this approach display a ION/IOFF up to 1 × 10(6), threshold voltage (VTh) of 0.3-1.9 V, and mobility up to 1 cm(2)/(V s), as a function of gallium-indium-zinc-oxide ink formulation and two different annealing temperatures. These results validates the usage of electrolyte-gated transistors as a viable and promising alternative for nanoparticle based semiconductor devices as the electrolyte improves the interface and promotes a more efficient step coverage of the channel layer, reducing the operating voltage when compared with conventional dielectrics gating. Moreover, it is shown that by controlling the applied gate potential, the operation mechanism of the electrolyte-gated transistors can be modified from electric double layer to electrochemical doping.
NASA Astrophysics Data System (ADS)
Oh, Kyonghwan; Kwon, Oh-Kyong
2012-03-01
A threshold-voltage-shift compensation and suppression method for active matrix organic light-emitting diode (AMOLED) displays fabricated using a hydrogenated amorphous silicon thin-film transistor (TFT) backplane is proposed. The proposed method compensates for the threshold voltage variation of TFTs due to different threshold voltage shifts during emission time and extends the lifetime of the AMOLED panel. Measurement results show that the error range of emission current is from -1.1 to +1.7% when the threshold voltage of TFTs varies from 1.2 to 3.0 V.
Response of pMOS dosemeters on gamma-ray irradiation during its re-use.
Pejovic, Milic M; Pejovic, Momcilo M; Jaksic, Aleksandar B
2013-08-01
Response of pMOS dosemeters during two successive irradiations with gamma-ray irradiation to a dose of 35 Gy and annealing at room and elevated temperature has been studied. The response was followed on the basis of threshold voltage shift, determined from transfer characteristics, as a function of absorbed dose or annealing time. It was shown that the threshold voltage shifts during first and second irradiation for the gate bias during irradiation of 5 and 2.5 V insignificantly differ although complete fading was not achieved after the first cycle of annealing. In order to analyse the defects formed in oxide and at the interface during irradiation and annealing, which are responsible for threshold voltage shift, midgap and charge-pumping techniques were used. It was shown that during first irradiation and annealing a dominant influence to threshold voltage shift is made by fixed oxide traps, while at the beginning of the second annealing cycle, threshold voltage shift is a consequence of both fixed oxide traps and slow switching traps.
Role of AlGaN/GaN interface traps on negative threshold voltage shift in AlGaN/GaN HEMT
NASA Astrophysics Data System (ADS)
Malik, Amit; Sharma, Chandan; Laishram, Robert; Bag, Rajesh Kumar; Rawal, Dipendra Singh; Vinayak, Seema; Sharma, Rajesh Kumar
2018-04-01
This article reports negative shift in the threshold-voltage in AlGaN/GaN high electron mobility transistor (HEMT) with application of reverse gate bias stress. The device is biased in strong pinch-off and low drain to source voltage condition for a fixed time duration (reverse gate bias stress), followed by measurement of transfer characteristics. Negative threshold voltage shift after application of reverse gate bias stress indicates the presence of more carriers in channel as compared to the unstressed condition. We propose the presence of AlGaN/GaN interface states to be the reason of negative threshold voltage shift, and developed a process to electrically characterize AlGaN/GaN interface states. We verified the results with Technology Computer Aided Design (TCAD) ATLAS simulation and got a good match with experimental measurements.
Silicon induced stability and mobility of indium zinc oxide based bilayer thin film transistors
NASA Astrophysics Data System (ADS)
Chauhan, Ram Narayan; Tiwari, Nidhi; Liu, Po-Tsun; Shieh, Han-Ping D.; Kumar, Jitendra
2016-11-01
Indium zinc oxide (IZO), silicon containing IZO, and IZO/IZO:Si bilayer thin films have been prepared by dual radio frequency magnetron sputtering on glass and SiO2/Si substrates for studying their chemical compositions and electrical characteristics in order to ascertain reliability for thin film transistor (TFT) applications. An attempt is therefore made here to fabricate single IZO and IZO/IZO:Si bilayer TFTs to study the effect of film thickness, silicon incorporation, and bilayer active channel on device performance and negative bias illumination stress (NBIS) stability. TFTs with increasing single active IZO layer thickness exhibit decrease in carrier mobility but steady improvement in NBIS; the best values being μFE ˜ 27.0, 22.0 cm2/Vs and ΔVth ˜ -13.00, -6.75 V for a channel thickness of 7 and 27 nm, respectively. While silicon incorporation is shown to reduce the mobility somewhat, it raises the stability markedly (ΔVth ˜ -1.20 V). Further, IZO (7 nm)/IZO:Si (27 nm) bilayer based TFTs display useful characteristics (field effect mobility, μFE = 15.3 cm2/Vs and NBIS value, ΔVth =-0.75 V) for their application in transparent electronics.
Improvement of the positive bias stability of a-IGZO TFTs by the HCN treatment
NASA Astrophysics Data System (ADS)
Kim, Myeong-Ho; Choi, Myung-Jea; Kimura, Katsuya; Kobayashi, Hikaru; Choi, Duck-Kyun
2016-12-01
In recent years, many researchers have attempted to improve the bias stability of amorphous indium gallium zinc oxide (a-IGZO) thin-film transistors (TFTs). In this study, the hydrogen cyanide (HCN) treatment was carried out to improve the positive bias stability of bottom-gate a-IGZO TFTs. The HCN treatment was performed using a 0.1 M HCN solution with a pH of 10 at room temperature. Before applying the positive bias stress, there were no differences in the major electrical properties, including the saturation mobility (μsat), threshold voltage (Vth), and subthreshold swing (S/S), between HCN-treated and non-HCN-treated devices. However, after applying the positive bias stress, the HCN-treated device showed superior bias stability compared to the non-HCN-treated device. This difference is associated with the passivation of the defect states and the surface of the back-channel layer of the HCN-treated device by cyanide ions.
Low voltage to high voltage level shifter and related methods
NASA Technical Reports Server (NTRS)
Mentze, Erik J. (Inventor); Buck, Kevin M. (Inventor); Hess, Herbert L. (Inventor); Cox, David F. (Inventor)
2006-01-01
A shifter circuit comprises a high and low voltage buffer stages and an output buffer stage. The high voltage buffer stage comprises multiple transistors arranged in a transistor stack having a plurality of intermediate nodes connecting individual transistors along the stack. The transistor stack is connected between a voltage level being shifted to and an input voltage. An inverter of this stage comprises multiple inputs and an output. Inverter inputs are connected to a respective intermediate node of the transistor stack. The low voltage buffer stage has an input connected to the input voltage and an output, and is operably connected to the high voltage buffer stage. The low voltage buffer stage is connected between a voltage level being shifted away from and a lower voltage. The output buffer stage is driven by the outputs of the high voltage buffer stage inverter and the low voltage buffer stage.
Characteristics of Ion Distribution Functions in Dipolarizing FluxBundles: THEMIS Event Studies
NASA Astrophysics Data System (ADS)
Runov, A.; Artemyev, A.; Birn, J.; Pritchett, P. L.; Zhou, X.
2016-12-01
Taking advantage of multi-point observations from repeating configuration of the Time History of Events and Macroscale Interactions during Substorms (THEMIS) fleet with probe separation of 1 to 2 Earth radii (RE) along X, Y, and Z in the geocentric solar magnetospheric system (GSM), we study ion distribution functions observed by the probes during three transient dipolarization events. Comparing observations by the multiple probes, we characterize changes in the ion distribution functions with respect to geocentric distance (X), cross-tail probe separation (Y), and levels of |Bx|, which characterize the distance from the neutral sheet. We examined 2-D and 1-D cuts of the 3-D velocity distribution functions by the {Vb,Vbxv} plane. The results indicate that the velocity distribution functions observed inside the dipolarizing flux bundles (DFB) close to the magnetic equator are often perpendicularly anisotropic for velocities Vth≤v≤2Vth, where Vth is the ion thermal velocity. Ions of higher energies (v>2Vth) are isotropic. Hence, interaction of DFBs and ambient ions may result in the perpendicular anisotropy of the injecting energetic ions, which is an important factor for plasma waves and instabilities excitation and further particle acceleration in the inner magnetosphere. We also compare the observations with the results of test-particles and PIC simulations.
Light programmable organic transistor memory device based on hybrid dielectric
NASA Astrophysics Data System (ADS)
Ren, Xiaochen; Chan, Paddy K. L.
2013-09-01
We have fabricated the transistor memory devices based on SiO2 and polystyrene (PS) hybrid dielectric. The trap states densities with different semiconductors have been investigated and a maximum 160V memory window between programming and erasing is realized. For DNTT based transistor, the trapped electron density is limited by the number of mobile electrons in semiconductor. The charge transport mechanism is verified by light induced Vth shift effect. Furthermore, in order to meet the low operating power requirement of portable electronic devices, we fabricated the organic memory transistor based on AlOx/self-assembly monolayer (SAM)/PS hybrid dielectric, the effective capacitance of hybrid dielectric is 210 nF cm-2 and the transistor can reach saturation state at -3V gate bias. The memory window in transfer I-V curve is around 1V under +/-5V programming and erasing bias.
Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P
2012-09-01
Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.
NASA Astrophysics Data System (ADS)
Zhou, Wei; Hou, Yun; Gao, Yan Qing; Zhang, Leibo; Huang, Zhi Ming
2011-08-01
As a typical thermal sensitive material, Mn1.56Co0.96Ni0.48O4 (MCN) has achieved widely applications in uncooled bolometer. In this paper, we report that a large increase in electrical conductivity of MCN is obtained with moderate electric-field strengths (E~103V/cm) applied at room temperature (about 300K). Great enhancement in the responsivity is observed when operating with a proper electric bias field, which corresponds to a threshold voltage VTh. MCN bulk materials are prepared by using the sintering method. Micro MCN detector is fabricated by scribing the bulk material into pieces sized 200×100×10μm. The detector is clinged to an Al2O3 substrate with some electrical insulated epoxy glue which is mounted onto a Cu sink. The surrounding temperature is controlled precisely by a temperature controller with a precision of 1mK. Voltage-current characteristics at 270-330K are carefully examined. Different sweeping speeds of the bias-voltage are applied in different orders so as to find out a proper scanning rate, in which the electrical measurement is proceeded in a state of quasi-thermal equilibrium. According to quasi-thermal equilibrium and the time dependent nominal D.C. power, the temperature increase during the measurement is estimated. The conduction mechanism can be well explained with small polaron theory. Empirical equations are used to describe the thermal dynamic process in the pulsed mode, and the process is also simply simulated via numerical calculations. The experimental results and simulation works will be of some referential value to future studies in uncooled microbolometer made in transition metal oxides.
Simulation of Dual-Electrode Capacitively Coupled Plasma Discharges
NASA Astrophysics Data System (ADS)
Lu, Yijia; Ji, Linhong; Cheng, Jia
2016-12-01
Dual-electrode capacitively coupled plasma discharges are investigated here to lower the non-uniformity of plasma density. The dual-electrode structure proposed by Jung splits the electrode region and increases the flexibility of fine tuning non-uniformity. Different RF voltages, frequencies, phase-shifts and electrode areas are simulated and the influences are discussed. RF voltage and electrode area have a non-monotonic effect on non-uniformity, while frequency has a monotonic effect. Phase-shift has a cyclical influence on non-uniformity. A special combination of 224 V voltage and 11% area ratio with 10 MHz lowers the non-uniformity of the original set (200 V voltage and 0% area ratio with 10 MHz) by 46.5%. The position of the plasma density peak at the probe line has been tracked and properly tuning the phase-shift can obtain the same trace as tuning frequency or voltage. supported by National Natural Science Foundation of China (No. 51405261)
Lashkari, Negin; Poshtan, Javad; Azgomi, Hamid Fekri
2015-11-01
The three-phase shift between line current and phase voltage of induction motors can be used as an efficient fault indicator to detect and locate inter-turn stator short-circuit (ITSC) fault. However, unbalanced supply voltage is one of the contributing factors that inevitably affect stator currents and therefore the three-phase shift. Thus, it is necessary to propose a method that is able to identify whether the unbalance of three currents is caused by ITSC or supply voltage fault. This paper presents a feedforward multilayer-perceptron Neural Network (NN) trained by back propagation, based on monitoring negative sequence voltage and the three-phase shift. The data which are required for training and test NN are generated using simulated model of stator. The experimental results are presented to verify the superior accuracy of the proposed method. Copyright © 2015. Published by Elsevier Ltd.
EMG changes in thigh and calf muscles in fin swimming exercise.
Jammes, Y; Delliaux, S; Coulange, M; Jammes, C; Kipson, N; Brerro-Saby, C; Bregeon, F
2010-08-01
Because previous researchers have reported a reduced lactic acid production that accompanies a delayed or an absent ventilatory threshold (VTh) in water-based exercise, we hypothesized that the metaboreflex, activated by muscle acidosis, might be absent in fin swimming. This motor response, delaying the occurrence of fatigue, is characterized by a decreased median frequency (MF) of electromyographic (EMG) power spectrum. Seven healthy subjects performed a maximal fin swimming exercise protocol with simultaneous recordings of surface EMGs in VASTUS MEDIALIS (VM), TIBIALIS ANTERIOR (TA) and GASTROCNEMIUS MEDIALIS (GM). We computed the root mean square (RMS) and MF and recorded the compound evoked muscle potential (M-wave) in VM. We also measured the propulsive force and oxygen uptake (VO (2)), and determined VTh. VTh was absent in 4/7 subjects and measured at 70-90% of VO (2max) in the other three. In the three studied muscles, the global EMG activity (RMS) increased while the MF decreased in proportion of VO (2), the MF changes being significantly higher in VM (-29%) and GM (-39%) than in TA (-19%). Because no M-wave changes were noted, the MF decline was attributed to the recruitment of low-frequency, fatigue-resistant motor units. Our most important finding is the persistence of the metaboreflex even in a situation of reduced muscle acidosis. (c) Georg Thieme Verlag KG Stuttgart . New York.
Vertical-cavity surface-emitting lasers come of age
NASA Astrophysics Data System (ADS)
Morgan, Robert A.; Lehman, John A.; Hibbs-Brenner, Mary K.
1996-04-01
This manuscript reviews our efforts in demonstrating state-of-the-art planar, batch-fabricable, high-performance vertical-cavity surface-emitting lasers (VCSELs). All performance requirements for short-haul data communication applications are clearly established. We concentrate on the flexibility of the established proton-implanted AlGaAs-based (emitting near 850 nm) technology platform, focusing on a standard device design. This structure is shown to meet or exceed performance and producibility requirements. These include > 99% device yield across 3-in-dia. metal-organic vapor phase epitaxy (MOVPE)-grown wafers and wavelength operation across a > 100-nm range. Recent progress in device performance [low threshold voltage (Vth equals 1.53 V); threshold current (Ith equals 0.68 mA); continuous wave (CW) power (Pcw equals 59 mW); maximum and minimum CW lasing temperature (T equals 200 degree(s)C, 10 K); and wall-plug efficiencies ((eta) wp equals 28%)] should enable great advances in VCSEL-based technologies. We also discuss the viability of VCSELs in cryogenic and avionic/military environments. Also reviewed is a novel technique, modifying this established platform, to engineer low-threshold, high-speed, single- mode VCSELs.
NASA Astrophysics Data System (ADS)
Lee, Ching-Sung; Liao, Chen-Hsian
2007-12-01
Kink effects in an In-rich InxGa1-xAs (x=0.53-0.63) linearly graded channel of an In0.45Al0.55As/InxGa1-xAs metamorphic high-electron-mobility transistor have been effectively relieved by depositing a high-barrier Ni /Au gate with the silicon nitride passivation. Complete physical investigations for the relieved kink effects have been made by comparing identical devices with/without a high-barrier Schottky gate or the surface passivation. After successfully suppressing the kink effects, the proposed device has shown a superior voltage gain of 173.8, low output conductance of 2.09mS/mm, and excellent power-added efficiency of 54.1% with high output power (power gain) of 14.87dBm (14.53dB). Improved linearity and excellent thermal threshold coefficient (∂Vth/∂T) of -0.14mV/K have also been achieved. The proposed design provides good potential for high-gain and high-linearity circuit applications.
Effective work function engineering for a TiN/XO(X = La, Zr, Al)/SiO{sub 2} stack structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Dongjin, E-mail: dongjin0710.lee@samsung.com; Lee, Jieun; Jung, Kyoungho
In this study, we demonstrated that work function engineering is possible over a wide range (+200 mV to −430 mV) in a TiN/XO (X = La, Zr, or Al)/SiO{sub 2} stack structures. From ab initio simulations, we selected the optimal material for the work function engineering. The work function engineering mechanism was described by metal diffusion into the TiN film and silicate formation in the TiN/SiO{sub 2} interface. The metal doping and the silicate formation were confirmed by transmission electron microscopy and energy dispersive spectroscopy line profiling, respectively. In addition, the amount of doped metal in the TiN film depended on the thickness ofmore » the insertion layer XO. From the work function engineering technique, which can control a variety of threshold voltages (Vth), an improvement in transistors with different V{sub th} values in the TiN/XO/SiO{sub 2} stack structures is expected.« less
Environmental Effects on Data Retention in Flash Cells
NASA Technical Reports Server (NTRS)
Katz, Rich; Flowers, David; Bergevin, Keith
2017-01-01
Flash technology is being utilized in fuzed munition applications and, based on the development of digital logic devices in the commercial world, usage of flash technology will increase. Antifuse technology, prevalent in non-volatile field programmable gate arrays (FPGAs), will eventually be phased out as new devices have not been developed for approximately a decade. The reliance on flash technology presents a long-term reliability issue for both DoD and NASA safety- and mission-critical applications. A thorough understanding of the data retention failure modes and statistics associated with Flash data retention is of vital concern to the fuze safety community. A key retention parameter for a flash cell is the threshold voltage (VTH), which is an indirect indicator of the amount of charge stored on the cells floating gate. This paper will present the results of our on-going tests: long-term storage at 150 C for a small population of devices, neutron radiation exposure, electrostatic discharge (ESD) testing, and the trends of large populations (over 300 devices for each condition) exposed to three difference temperatures: 25 C, 125 C, and 150 C.
Application of the superposition principle to solar-cell analysis
NASA Technical Reports Server (NTRS)
Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.
1979-01-01
The superposition principle of differential-equation theory - which applies if and only if the relevant boundary-value problems are linear - is used to derive the widely used shifting approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. Analytical methods are presented to treat cases where shifting is not strictly valid. Well-defined conditions necessary for superposition to apply are established. For high injection in the base region, the method of analysis accurately yields the dependence of the open-circuit voltage on the short-circuit current (or the illumination level).
NASA Astrophysics Data System (ADS)
Kim, Tae-Soo; Lim, Seung-Young; Park, Yong-Keun; Jung, Gunwoo; Song, Jung-Hoon; Cha, Ho-Young; Han, Sang-Woo
2018-06-01
We investigated the distributions and the energy levels of defects in SiO2/AlGaN/GaN highelectron-mobility transistors (HEMTs) by using frequency-dependent ( F- D) capacitance-voltage ( C- V) measurements with resonant optical excitation. A Schottky barrier (SB) and a metal-oxidesemiconductor (MOS) HEMT were prepared to compare the effects of defects in their respective layers. We also investigated the effects of those layers on the threshold voltage ( V th ). A drastic voltage shift in the C- V curve at higher frequencies was caused by the large number of defect levels in the SiO2/GaN interface. A significant shift in V th with additional light illumination was observed due to a charging of the defect states in the SiO2/GaN interface. The voltage shifts were attributed to the detrapping of defect states at the SiO2/GaN interface.
Tanaka, Yasuaki; Rahmutula, Dolkun; Duggirala, Srikant; Nazer, Babak; Fang, Qizhi; Olgin, Jeffrey; Sievers, Richard; Gerstenfeld, Edward P
2016-02-01
Frequent premature ventricular contractions (PVCs) may lead to dilated cardiomyopathy. A leftward shift in the unipolar voltage distribution in patients with cardiomyopathy has also been described and attributed to increased fibrosis. We established a swine model of PVC-induced cardiomyopathy and assessed (1) whether an increase in left ventricular fibrosis occurs and (2) whether increased fibrosis leads to a leftward shift in the unipolar voltage distribution. Ten swine underwent implantation of ventricular pacemakers; 6 programmed to deliver a 50% PVC burden and 4 controls without pacing. Voltage maps were acquired at baseline and after 14 weeks of ventricular bigeminy. In the PVC group, left ventricular ejection fraction decreased from 67% ± 7% to 44% ± 15% (P < .05) with no change in controls (71% ± 6% to 73% ± 4%; P = .56). The fifth percentile of the bipolar and unipolar voltage distribution at baseline was 1.63 and 5.36 mV, respectively. In the control group, after 14 weeks of pacing there was no significant change in % bipolar voltage <1.5 mV (pre 1.2% vs post 2.2%; P = .34) or % unipolar voltage <5.5 mV (pre 4.0% vs post 3.5%; P = .20). In the PVC group, there was a significant increase in % unipolar voltage <5.5 mV (5.4% vs 12.6%; P < .01), with a leftward shift in the unipolar voltage distribution. Histologically, % fibrosis was increased in the PVC group (control 1.8% ± 1.3% vs PVC 3.4% ± 2.6%; P < .01). PVC-induced cardiomyopathy in swine leads to an increase in interstitial fibrosis and a leftward shift in the unipolar voltage distribution. These findings are consistent with findings in humans with PVC-induced cardiomyopathy. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Thouta, Samrat; Hull, Christina M; Shi, Yu Patrick; Sergeev, Valentine; Young, James; Cheng, Yen M; Claydon, Thomas W
2017-01-24
Slow deactivation of hERG channels is critical for preventing cardiac arrhythmia yet the mechanistic basis for the slow gating transition is unclear. Here, we characterized the temporal sequence of events leading to voltage sensor stabilization upon membrane depolarization. Progressive increase in step depolarization duration slowed voltage-sensor return in a biphasic manner (τ fast = 34 ms, τ slow = 2.5 s). The faster phase of voltage-sensor return slowing correlated with the kinetics of pore opening. The slower component occurred over durations that exceeded channel activation and was consistent with voltage sensor relaxation. The S4-S5 linker mutation, G546L, impeded the faster phase of voltage sensor stabilization without attenuating the slower phase, suggesting that the S4-S5 linker is important for communications between the pore gate and the voltage sensor during deactivation. These data also demonstrate that the mechanisms of pore gate-opening-induced and relaxation-induced voltage-sensor stabilization are separable. Deletion of the distal N-terminus (Δ2-135) accelerated off-gating current, but did not influence the relative contribution of either mechanism of stabilization of the voltage sensor. Lastly, we characterized mode-shift behavior in hERG channels, which results from stabilization of activated channel states. The apparent mode-shift depended greatly on recording conditions. By measuring slow activation and deactivation at steady state we found the "true" mode-shift to be ∼15 mV. Interestingly, the "true" mode-shift of gating currents was ∼40 mV, much greater than that of the pore gate. This demonstrates that voltage sensor return is less energetically favorable upon repolarization than pore gate closure. We interpret this to indicate that stabilization of the activated voltage sensor limits the return of hERG channels to rest. The data suggest that this stabilization occurs as a result of reconfiguration of the pore gate upon opening by a mechanism that is influenced by the S4-S5 linker, and by a separable voltage-sensor intrinsic relaxation mechanism. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-01
Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.
NASA Astrophysics Data System (ADS)
Xu, Zhaozhao; Qian, Wensheng; Chen, Hualun; Xiong, Wei; Hu, Jun; Liu, Donghua; Duan, Wenting; Kong, Weiran; Na, Wei; Zou, Shichang
2017-03-01
The mechanism and distribution of drain disturb (DD) are investigated in silicon-oxide-nitride-oxide-silicon (SONOS) flash cells. It is shown that DD is the only concern in this paper. First, the distribution of trapped charge in nitride layer is found to be non-localized (trapped in entire nitride layer along the channel) after programming. Likewise, the erase is also non-localized. Then, the main disturb mechanism: Fowler Nordheim tunneling (FNT) has been confirmed in this paper with negligible disturb effect from hot-hole injection (HHI). And then, distribution of DD is confirmed to be non-localized similarly, which denotes that DD exists in entire tunneling oxide (Oxide for short). Next, four process optimization ways are proposed for minimization of DD, and VTH shift is measured. It reveals that optimized lightly doped drain (LDD), halo, and channel implant are required for the fabrication of a robust SONOS cell. Finally, data retention and endurance of the optimized SONOS are demonstrated.
Muroi, Yukiko; Chanda, Baron
2009-01-01
Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.
Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins.
Zeimpekis, I; Sun, K; Hu, C; Ditshego, N M J; Thomas, O; de Planque, M R R; Chong, H M H; Morgan, H; Ashburn, P
2016-04-22
We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH(-1) is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH(-1) measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.
Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins
NASA Astrophysics Data System (ADS)
Zeimpekis, I.; Sun, K.; Hu, C.; Ditshego, N. M. J.; Thomas, O.; de Planque, M. R. R.; Chong, H. M. H.; Morgan, H.; Ashburn, P.
2016-04-01
We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH-1 is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH-1 measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.
Biosensing in a microelectrofluidic system using optical whispering-gallery mode spectroscopy
Huang, Lei; Guo, Zhixiong
2011-01-01
Label-free detection of biomolecules using an optical whispering-gallery mode sensor in a microelectrofluidic channel is simulated. Negatively charged bovine serum albumin is considered as the model protein analyte. The analyte transport in aqueous solution is controlled by an externally applied electrical field. The finite element method is employed for solving the equations of the charged species transport, the Poisson equation of electric potential, the equations of conservation of momentum and energy, and the Helmholtz equations of electromagnetic waves. The adsorption process of the protein molecules on the microsensor head surface is monitored by the resonance frequency shifts. Frequency shift caused by temperature variation due to Joule heating is analyzed and found to be negligible. The induced shifts behave in a manner similar to Langmuir-like adsorption kinetics; but the time constant increases due to the presence of the external electrical field. A correlation of the frequency shift, the analyte feed concentration in the solution, and the applied voltage gradient is obtained, in which an excellent linear relationship between the frequency shift and the analyte concentration is revealed. The applied voltage gradient enhances significantly the analyte concentration in the vicinity of the sensor surface; thus, the sensor sensitivity which has a power function of the voltage gradient with exponent 2.85 in the controlled voltage range. Simulated detection of extremely low protein concentration to the pico-molar level is carried out. PMID:22662041
NASA Astrophysics Data System (ADS)
Han, Dedong; Zhang, Yi; Cong, Yingying; Yu, Wen; Zhang, Xing; Wang, Yi
2016-12-01
In this work, we have successfully fabricated bottom gate fully transparent tin-doped zinc oxide thin film transistors (TZO TFTs) fabricated on flexible plastic substrate at low temperature by RF magnetron sputtering. The effect of O2/Ar gas flow ratio during channel deposition on the electrical properties of TZO TFTs was investigated, and we found that the O2/Ar gas flow ratio have a great influence on the electrical properties. TZO TFTs on flexible substrate has very nice electrical characteristics with a low off-state current (Ioff) of 3 pA, a high on/off current ratio of 2 × 107, a high saturation mobility (μsat) of 66.7 cm2/V•s, a steep subthreshold slope (SS) of 333 mV/decade and a threshold voltage (Vth) of 1.2 V. Root-Mean-Square (RMS) roughness of TZO thin film is about 0.52 nm. The transmittance of TZO thin film is about 98%. These results highlight that the excellent device performance can be realized in TZO film and TZO TFT can be a promising candidate for flexible displays.
Feng, Xing-Yao; Liu, Hong-Xia; Wang, Xing; Zhao, Lu; Fei, Chen-Xi; Liu, He-Lei
2016-12-01
The mechanism of flat band voltage (VFB) shift for alternate La2O3/Al2O3 multilayer stack structures in different annealing condition is investigated. The samples were prepared for alternate multilayer structures, which were annealed in different conditions. The capacitance-voltage (C-V) measuring results indicate that the VFB of samples shift negatively for thinner bottom Al2O3 layer, increasing annealing temperature or longer annealing duration. Simultaneously, the diffusion of high-k material to interfaces in different multilayer structures and annealing conditions is observed by X-ray photoelectron spectroscopy (XPS). Based on the dipole theory, a correlation between the diffusion effect of La towards bottom Al2O3/Si interface and VFB shift is found. Without changing the dielectric constant k of films, VFB shift can be manipulated by controlling the single-layer cycles and annealing conditions of alternate high-k multilayer stack.
A CMOS matrix for extracting MOSFET parameters before and after irradiation
NASA Technical Reports Server (NTRS)
Blaes, B. R.; Buehler, M. G.; Lin, Y.-S.; Hicks, K. A.
1988-01-01
An addressable matrix of 16 n- and 16 p-MOSFETs was designed to extract the dc MOSFET parameters for all dc gate bias conditions before and after irradiation. The matrix contains four sets of MOSFETs, each with four different geometries that can be biased independently. Thus the worst-case bias scenarios can be determined. The MOSFET matrix was fabricated at a silicon foundry using a radiation-soft CMOS p-well LOCOS process. Co-60 irradiation results for the n-MOSFETs showed a threshold-voltage shift of -3 mV/krad(Si), whereas the p-MOSFETs showed a shift of 21 mV/krad(Si). The worst-case threshold-voltage shift occurred for the n-MOSFETs, with a gate bias of 5 V during the anneal. For the p-MOSFETs, biasing did not affect the shift in the threshold voltage. A parasitic MOSFET dominated the leakage of the n-MOSFET biased with 5 V on the gate during irradiation. Co-60 test results for other parameters are also presented.
NASA Astrophysics Data System (ADS)
Shin, Hee-Sun; Lee, Won-Kyu; Park, Sang-Guen; Kuk, Seung-Hee; Han, Min-Koo
2009-03-01
A new hydrogenated amorphous silicon (a-Si:H) thin film transistor (TFT) pixel circuit for active-matrix organic light emission diodes (AM-OLEDs), which significantly compensates the OLED current degradation by memorizing the threshold voltage of driving TFT and suppresses the threshold voltage shift of a-Si:H TFTs by negative bias annealing, is proposed and fabricated. During the first half of each frame, the driving TFT of the proposed pixel circuit supplies current to the OLED, which is determined by modified data voltage in the compensation scheme. The proposed pixel circuit was able to compensate the threshold voltage shift of the driving TFT as well as the OLED. During the remaining half of each frame, the proposed pixel circuit induces the recovery of the threshold voltage degradation of a-Si:H TFTs owing to the negative bias annealing. The experimental results show that the proposed pixel circuit was able to successfully compensate for the OLED current degradation and suppress the threshold voltage degradation of the driving TFT.
Method, memory media and apparatus for detection of grid disconnect
Ye, Zhihong [Clifton Park, NY; Du, Pengwei [Troy, NY
2008-09-23
A phase shift procedure for detecting a disconnect of a power grid from a feeder that is connected to a load and a distributed generator. The phase shift procedure compares a current phase shift of the output voltage of the distributed generator with a predetermined threshold and if greater, a command is issued for a disconnect of the distributed generator from the feeder. To extend the range of detection, the phase shift procedure is used when a power mismatch between the distributed generator and the load exceeds a threshold and either or both of an under/over frequency procedure and an under/over voltage procedure is used when any power mismatch does not exceed the threshold.
A new low voltage level-shifted FVF current mirror with enhanced bandwidth and output resistance
NASA Astrophysics Data System (ADS)
Aggarwal, Bhawna; Gupta, Maneesha; Gupta, Anil Kumar; Sangal, Ankur
2016-10-01
This paper proposes a new high-performance level-shifted flipped voltage follower (LSFVF) based low-voltage current mirror (CM). The proposed CM utilises the low-supply voltage and low-input resistance characteristics of a flipped voltage follower (FVF) CM. In the proposed CM, level-shifting configuration is used to obtain a wide operating current range and resistive compensation technique is employed to increase the operating bandwidth. The peaking in frequency response is reduced by using an additional large MOSFET. Moreover, a very high output resistance (in GΩ range) along with low-current transfer error is achieved through super-cascode configuration for a wide current range (0-440 µA). Small signal analysis is carried out to show the improvements achieved at each step. The proposed CM is simulated by Mentor Graphics Eldospice in TSMC 0.18 µm CMOS, BSIM3 and Level 53 technology. In the proposed CM, a bandwidth of 6.1799 GHz, 1% settling time of 0.719 ns, input and output resistances of 21.43 Ω and 1.14 GΩ, respectively, are obtained with a single supply voltage of 1 V. The layout of the proposed CM has been designed and post-layout simulation results have been shown. The post-layout simulation results for Monte Carlo and temperature analysis have also been included to show the reliability of the CM against the variations in process parameters and temperature changes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Senova, Suhan; Service de Neurochirurgie, Centre Hospitalier Universitaire; Inserm, U955, Equipe 14, Université Paris Est, Faculté de médecine, Créteil
Purpose: To analyze the relationship between dosimetric characteristics and symptoms related to trigeminal neuropathy (TN) observed after radiosurgery (RS) for vestibular schwannomas (VS); to propose guidelines to optimize planification in VS RS regarding TN preservation; and to detail the mechanism of TN impairment after VS RS. Methods and Materials: One hundred seventy-nine patients treated between 2011 and 2013 for VS RS and without trigeminal impairment before RS were included in a retrospective study. Univariate and multivariate analyses were performed to determine predictors of TN among characteristics of the patients, the dosimetry, and the VS. Results: There were 20 Koos grade 1,more » 99 grade 2, 57 grade 3, and 3 grade 4. Fourteen patients (7.8%) presented a transitory or permanent TN. Between the patients with and without TN after VS RS, there was no significant difference regarding dosimetry or VS volume itself. Significant differences (univariate analysis P<.05, Mann-Whitney test) were found for parameters related to the cisternal portion of the trigeminal nerve: total integrated dose, maximum dose, mean dose, volume of the Vth nerve (Vol{sub v}), and volume of the Vth nerve receiving at least 11 Gy (Vol{sub Vcist>11Gy}), but also for maximal dose to the Vth nerve nucleus and intra-axial portion (Dose max{sub Vax}). After multivariate analysis, the best model predicting TN included Vol{sub Vcist>11Gy} (P=.0045), Dose max{sub Vax} (P=.0006), and Vol{sub v} (P=.0058). The negative predictive value of this model was 97%. Conclusions: The parameters Vol{sub Vcist>11Gy}, Dose max{sub Vax}, and Vol{sub v} should be checked when designing dosimetry for VS RS.« less
MOSFET and MOS capacitor responses to ionizing radiation
NASA Technical Reports Server (NTRS)
Benedetto, J. M.; Boesch, H. E., Jr.
1984-01-01
The ionizing radiation responses of metal oxide semiconductor (MOS) field-effect transistors (FETs) and MOS capacitors are compared. It is shown that the radiation-induced threshold voltage shift correlates closely with the shift in the MOS capacitor inversion voltage. The radiation-induced interface-state density of the MOSFETs and MOS capacitors was determined by several techniques. It is shown that the presence of 'slow' states can interfere with the interface-state measurements.
NASA Astrophysics Data System (ADS)
Jizhi, Liu; Xingbi, Chen
2009-12-01
A new quasi-three-dimensional (quasi-3D) numeric simulation method for a high-voltage level-shifting circuit structure is proposed. The performances of the 3D structure are analyzed by combining some 2D device structures; the 2D devices are in two planes perpendicular to each other and to the surface of the semiconductor. In comparison with Davinci, the full 3D device simulation tool, the quasi-3D simulation method can give results for the potential and current distribution of the 3D high-voltage level-shifting circuit structure with appropriate accuracy and the total CPU time for simulation is significantly reduced. The quasi-3D simulation technique can be used in many cases with advantages such as saving computing time, making no demands on the high-end computer terminals, and being easy to operate.
The use of hydrogenous material for sensitizing pMOS dosimeters to neutrons
NASA Astrophysics Data System (ADS)
Kronenberg, S.; Brucker, G. J.
1995-02-01
This paper is concerned with the application of pMOS dosimeters to measuring neutron dose by the use of hydrogenous materials to convert incident neutron flux to recoil protons. These latter charged particles can generate electron-hole pairs, and consequently, charge trapping takes place at the MOS interfaces, and threshold voltage shifts are produced. The use of pMOS devices for measuring gamma doses has been described extensively in the literature. Clearly, if measurable voltage shifts could be generated in a MOS device by neutrons, then a radiation detection instrument containing two MOS devices, back to back, with hydrogenous shields, and one MOS dosimeter without a converter would allow 4/spl pi/ measurements of neutron and gamma doses to be made. The results obtained in this study indicate that paraffin or polyethylene will convert incident, 2.82 MeV neutrons to recoil protons, which subsequently cause measurable voltage shifts.
NASA Astrophysics Data System (ADS)
Caraveo-Frescas, J. A.; Hedhili, M. N.; Wang, H.; Schwingenschlögl, U.; Alshareef, H. N.
2012-03-01
It is shown that the well-known negative flatband voltage (VFB) shift, induced by rare-earth oxide capping in metal gate stacks, can be completely reversed in the absence of the silicon overlayer. Using TaN metal gates and Gd2O3-doped dielectric, we measure a ˜350 mV negative shift with the Si overlayer present and a ˜110 mV positive shift with the Si overlayer removed. This effect is correlated to a positive change in the average electrostatic potential at the TaN/dielectric interface which originates from an interfacial dipole. The dipole is created by the replacement of interfacial oxygen atoms in the HfO2 lattice with nitrogen atoms from TaN.
NASA Astrophysics Data System (ADS)
Sometani, Mitsuru; Okamoto, Mitsuo; Hatakeyama, Tetsuo; Iwahashi, Yohei; Hayashi, Mariko; Okamoto, Dai; Yano, Hiroshi; Harada, Shinsuke; Yonezawa, Yoshiyuki; Okumura, Hajime
2018-04-01
We investigated methods of measuring the threshold voltage (V th) shift of 4H-silicon carbide (SiC) metal–oxide–semiconductor field-effect transistors (MOSFETs) under positive DC, negative DC, and AC gate bias stresses. A fast measurement method for V th shift under both positive and negative DC stresses revealed the existence of an extremely large V th shift in the short-stress-time region. We then examined the effect of fast V th shifts on drain current (I d) changes within a pulse under AC operation. The fast V th shifts were suppressed by nitridation. However, the I d change within one pulse occurred even in commercially available SiC MOSFETs. The correlation between I d changes within one pulse and V th shifts measured by a conventional method is weak. Thus, a fast and in situ measurement method is indispensable for the accurate evaluation of I d changes under AC operation.
Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene.
Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen
2018-07-01
Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. Graphical Abstract ᅟ.
Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene
NASA Astrophysics Data System (ADS)
Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen
2018-04-01
Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. [Figure not available: see fulltext.
NASA Astrophysics Data System (ADS)
Kim, Jong Beom; Lee, Dong Ryeol
2018-04-01
We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.
Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen
2015-10-21
The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.
Vertical-cavity surface-emitting lasers: present and future
NASA Astrophysics Data System (ADS)
Morgan, Robert A.
1997-04-01
This manuscript reviews the present status of 'commercial- grade,' state-of-the-art planar, batch-fabricable, vertical- cavity surface-emitting lasers (VCSELs). Commercial-grade performance on all fronts for high-speed data communications is clearly established. In discussing the 'present,' we focus on the entrenched proton-implanted AlGaAs-based (emitting near 850 nm) technology. Renditions of this VCSEL design exist in commercial products and have enabled numerous application demonstrations. Our designs more than adequately meet producibility, performance, and robustness stipulations. Producibility milestones include greater than 99% device yield across 3-in-dia metal-organic vapor phase epitaxy (MOVPE)-grown wafers and wavelength operation across greater than 100-nm range. Progress in performance includes the elimination of the excessive voltage-drop that plagued VCSELs as recently as 2 to 3 years ago. Threshold voltages as low as Vth equals 1.53 V (and routinely less than 1.6 V) are now commonplace. Submilliamp threshold currents (Ith equals 0.68 mA) have even been demonstrated with this planar structure. Moreover, continuous wave (cw) power Pcw greater than 59 mW and respectable wall-plug efficiencies ((eta) wp equals 28%) have been demonstrated. VCSEL robustness is evidenced by maximum cw lasing temperature T equals 200 degrees Celsius and temperature ranges of 10 K to 400 K and minus 55 degrees Celsius to 155 degrees Celsius on a single VCSEL. These characteristics should enable great advances in VCSEL-based technologies and beckon the notion that 'commercial-grade' VCSELs are viable in cryogenic and avionics/military environments. We also discuss what the future may hold in extensions of this platform to different wavelengths, increased integration, and advanced structures. This includes low-threshold, high- speed, single-mode VCSELs, hybrid VCSEL transceivers, and self-pulsating VCSELs.
Infant breathing rate counter based on variable resistor for pneumonia
NASA Astrophysics Data System (ADS)
Sakti, Novi Angga; Hardiyanto, Ardy Dwi; La Febry Andira R., C.; Camelya, Kesa; Widiyanti, Prihartini
2016-03-01
Pneumonia is one of the leading causes of death in new born baby in Indonesia. According to WHO in 2002, breathing rate is very important index to be the symptom of pneumonia. In the Community Health Center, the nurses count with a stopwatch for exactly one minute. Miscalculation in Community Health Center occurs because of long time concentration and focus on two object at once. This calculation errors can cause the baby who should be admitted to the hospital only be attended at home. Therefore, an accurate breathing rate counter at Community Health Center level is necessary. In this work, resistance change of variable resistor is made to be breathing rate counter. Resistance change in voltage divider can produce voltage change. If the variable resistance moves periodically, the voltage will change periodically too. The voltage change counted by software in the microcontroller. For the every mm shift at the variable resistor produce average 0.96 voltage change. The software can count the number of wave generated by shifting resistor.
Estacion, Mark
2017-01-01
The Nav1.7 sodium channel is preferentially expressed within dorsal root ganglion (DRG) and sympathetic ganglion neurons. Gain-of-function mutations that cause the painful disorder inherited erythromelalgia (IEM) shift channel activation in a hyperpolarizing direction. When expressed within DRG neurons, these mutations produce a depolarization of resting membrane potential (RMP). The biophysical basis for the depolarized RMP has to date not been established. To explore the effect on RMP of the shift in activation associated with a prototypical IEM mutation (L858H), we used dynamic-clamp models that represent graded shifts that fractionate the effect of the mutation on activation voltage dependence. Dynamic-clamp recording from DRG neurons using a before-and-after protocol for each cell made it possible, even in the presence of cell-to-cell variation in starting RMP, to assess the effects of these graded mutant models. Our results demonstrate a nonlinear, progressively larger effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. The observed differences in RMP were predicted by the “late” current of each mutant model. Since the depolarization of RMP imposed by IEM mutant channels is known, in itself, to produce hyperexcitability of DRG neurons, the development of pharmacological agents that normalize or partially normalize activation voltage dependence of IEM mutant channels merits further study. NEW & NOTEWORTHY Inherited erythromelalgia (IEM), the first human pain disorder linked to a sodium channel, is widely regarded as a genetic model of neuropathic pain. IEM is produced by Nav1.7 mutations that hyperpolarize activation. These mutations produce a depolarization of resting membrane potential (RMP) in dorsal root ganglion neurons. Using dynamic clamp to explore the effect on RMP of the shift in activation, we demonstrate a nonlinear effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. PMID:28148645
NASA Astrophysics Data System (ADS)
Dong, Xiaofei; Xu, Jianping; Shi, Shaobo; Zhang, Xiaosong; Li, Lan; Yin, Shougen
2017-05-01
We report tunable electroluminescence (EL) from solution-processed ZnCuInS/ZnS (ZCIS/ZnS) quantum dots (QDs)/poly(9-vinlycarbazole) multilayer films. The EL spectra exhibit a red shift as the QD layer thickness increases. By analyzing the dependence of the applied voltage and the ZCIS/ZnS QD layer thickness on the EL spectra, the origin of the red shift is associated with the increased trap density of QDs that induces the injected electrons to be trapped in the deep donor level. The current conduction mechanism based on the current density-voltage curves at different voltage regions was discussed.
Charge movement in gating-locked HCN channels reveals weak coupling of voltage sensors and gate.
Ryu, Sujung; Yellen, Gary
2012-11-01
HCN (hyperpolarization-activated cyclic nucleotide gated) pacemaker channels have an architecture similar to that of voltage-gated K(+) channels, but they open with the opposite voltage dependence. HCN channels use essentially the same positively charged voltage sensors and intracellular activation gates as K(+) channels, but apparently these two components are coupled differently. In this study, we examine the energetics of coupling between the voltage sensor and the pore by using cysteine mutant channels for which low concentrations of Cd(2+) ions freeze the open-closed gating machinery but still allow the sensors to move. We were able to lock mutant channels either into open or into closed states by the application of Cd(2+) and measure the effect on voltage sensor movement. Cd(2+) did not immobilize the gating charge, as expected for strict coupling, but rather it produced shifts in the voltage dependence of voltage sensor charge movement, consistent with its effect of confining transitions to either closed or open states. From the magnitude of the Cd(2+)-induced shifts, we estimate that each voltage sensor produces a roughly three- to sevenfold effect on the open-closed equilibrium, corresponding to a coupling energy of ∼1.3-2 kT per sensor. Such coupling is not only opposite in sign to the coupling in K(+) channels, but also much weaker.
Effects of acidic pH on voltage-gated ion channels in rat trigeminal mesencephalic nucleus neurons.
Han, Jin-Eon; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung
2017-03-01
The effects of acidic pH on several voltage-dependent ion channels, such as voltage-dependent K + and Ca 2+ channels, and hyperpolarization-gated and cyclic nucleotide-activated cation (HCN) channels, were examined using a whole-cell patch clamp technique on mechanically isolated rat mesencephalic trigeminal nucleus neurons. The application of a pH 6.5 solution had no effect on the peak amplitude of voltage-dependent K + currents. A pH 6.0 solution slightly, but significantly inhibited the peak amplitude of voltage-dependent K + currents. The pH 6.0 also shifted both the current-voltage and conductance-voltage relationships to the depolarization range. The application of a pH 6.5 solution scarcely affected the peak amplitude of membrane currents mediated by HCN channels, which were profoundly inhibited by the general HCN channel blocker Cs + (1 mM). However, the pH 6.0 solution slightly, but significantly inhibited the peak amplitude of HCN-mediated currents. Although the pH 6.0 solution showed complex modulation of the current-voltage and conductance-voltage relationships, the midpoint voltages for the activation of HCN channels were not changed by acidic pH. On the other hand, voltage-dependent Ca 2+ channels were significantly inhibited by an acidic pH. The application of an acidic pH solution significantly shifted the current-voltage and conductance-voltage relationships to the depolarization range. The modulation of several voltage-dependent ion channels by an acidic pH might affect the excitability of mesencephalic trigeminal nucleus neurons, and thus physiological functions mediated by the mesencephalic trigeminal nucleus could be affected in acidic pH conditions.
NASA Astrophysics Data System (ADS)
Tang, Lan-Feng; Yu, Guang; Lu, Hai; Wu, Chen-Fei; Qian, Hui-Min; Zhou, Dong; Zhang, Rong; Zheng, You-Dou; Huang, Xiao-Ming
2015-08-01
The influence of white light illumination on the stability of an amorphous InGaZnO thin film transistor is investigated in this work. Under prolonged positive gate bias stress, the device illuminated by white light exhibits smaller positive threshold voltage shift than the device stressed under dark. There are simultaneous degradations of field-effect mobility for both stressed devices, which follows a similar trend to that of the threshold voltage shift. The reduced threshold voltage shift under illumination is explained by a competition between bias-induced interface carrier trapping effect and photon-induced carrier detrapping effect. It is further found that white light illumination could even excite and release trapped carriers originally exiting at the device interface before positive gate bias stress, so that the threshold voltage could recover to an even lower value than that in an equilibrium state. The effect of photo-excitation of oxygen vacancies within the a-IGZO film is also discussed. Project supported by the State Key Program for Basic Research of China (Grant Nos. 2011CB301900 and 2011CB922100) and the Priority Academic Program Development of Jiangsu Higher Education Institutions, China.
Choi, Sungjin; Lee, Junhyuk; Kim, Donghyoun; Oh, Seulki; Song, Wangyu; Choi, Seonjun; Choi, Eunsuk; Lee, Seung-Beck
2011-12-01
We report on the fabrication and capacitance-voltage characteristics of double layer nickel-silicide nanocrystals with Si3N4 interlayer tunnel barrier for nano-floating gate memory applications. Compared with devices using SiO2 interlayer, the use of Si3N4 interlayer separation reduced the average size (4 nm) and distribution (+/- 2.5 nm) of NiSi2 nanocrystal (NC) charge traps by more than 50% and giving a two fold increase in NC density to 2.3 x 10(12) cm(-2). The increased density and reduced NC size distribution resulted in a significantly decrease in the distribution of the device C-V characteristics. For each program voltage, the distribution of the shift in the threshold voltage was reduced by more than 50% on average to less than 0.7 V demonstrating possible multi-level-cell operation.
NASA Astrophysics Data System (ADS)
Zonno, Irene; Martinez-Otero, Alberto; Hebig, Jan-Christoph; Kirchartz, Thomas
2017-03-01
The Mott-Schottky analysis in the dark is a frequently used method to determine the doping concentration of semiconductors from capacitance-voltage measurements, even for such complex systems as polymer:fullerene blends used for organic solar cells. While the analysis of capacitance-voltage measurements in the dark is relatively well established, the analysis of data taken under illumination is currently not fully understood. Here, we present experiments and simulations to show which physical mechanisms affect the Mott-Schottky analysis under illumination. We show that the mobility of the blend has a major influence on the shape of the capacitance-voltage curve and can be obtained from data taken under reverse bias. In addition, we show that the apparent shift of the built-in voltage observed previously can be explained by a shift of the onset of space-charge-limited collection with illumination intensity.
NASA Astrophysics Data System (ADS)
Kim, Youngjun; Cho, Seongeun; Kim, Hyeran; Seo, Soonjoo; Lee, Hyun Uk; Lee, Jouhahn; Ko, Hyungduk; Chang, Mincheol; Park, Byoungnam
2017-09-01
Electric field-induced charge trapping and exciton dissociation were demonstrated at a penatcene/grapheme quantum dot (GQD) interface using a bottom contact bi-layer field effect transistor (FET) as an electrical nano-probe. Large threshold voltage shift in a pentacene/GQD FET in the dark arises from field-induced carrier trapping in the GQD layer or GQD-induced trap states at the pentacene/GQD interface. As the gate electric field increases, hysteresis characterized by the threshold voltage shift depending on the direction of the gate voltage scan becomes stronger due to carrier trapping associated with the presence of a GQD layer. Upon illumination, exciton dissociation and gate electric field-induced charge trapping simultaneously contribute to increase the threshold voltage window, which can potentially be exploited for photoelectric memory and/or photovoltaic devices through interface engineering.
Cheng, Lan; Sanguinetti, Michael C
2009-05-01
Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.
Cho, Young-Je; Kim, HyunHo; Park, Kyoung-Yun; Lee, Jaegab; Bobade, Santosh M; Wu, Fu-Chung; Choi, Duck-Kyun
2011-01-01
Interest in transparent oxide thin film transistors utilizing ZnO material has been on the rise for many years. Recently, however, IGZO has begun to draw more attention due to its higher stability and superior electric field mobility when compared to ZnO. In this work, we address an improved method for patterning an a-IGZO film using the SAM process, which employs a cost-efficient micro-contact printing method instead of the conventional lithography process. After a-IGZO film deposition on the surface of a SiO2-layered Si wafer, the wafer was illuminated with UV light; sources and drains were then patterned using n-octadecyltrichlorosilane (OTS) molecules by a printing method. Due to the low surface energy of OTS, cobalt was selectively deposited on the OTS-free a-IGZO surface. The selective deposition of cobalt electrodes was successful, as confirmed by an optical microscope. The a-IZGO TFT fabricated using the SAM process exhibited good transistor performance: electric field mobility (micro(FE)), threshold voltage (V(th)), subthreshold slope (SS) and on/off ratio were 2.1 cm2/Vs, 2.4 V, 0.35 V/dec and 2.9 x 10(6), respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niang, K. M.; Flewitt, A. J., E-mail: ajf@eng.cam.ac.uk; Barquinha, P. M. C.
Thin film transistors (TFTs) employing an amorphous indium gallium zinc oxide (a-IGZO) channel layer exhibit a positive shift in the threshold voltage under the application of positive gate bias stress (PBS). The time and temperature dependence of the threshold voltage shift was measured and analysed using the thermalization energy concept. The peak energy barrier to defect conversion is extracted to be 0.75 eV and the attempt-to-escape frequency is extracted to be 10{sup 7} s{sup −1}. These values are in remarkable agreement with measurements in a-IGZO TFTs under negative gate bias illumination stress (NBIS) reported recently (Flewitt and Powell, J. Appl. Phys.more » 115, 134501 (2014)). This suggests that the same physical process is responsible for both PBS and NBIS, and supports the oxygen vacancy defect migration model that the authors have previously proposed.« less
Weiss, Jonathan D.
1997-01-01
A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field.
Capacitance-voltage measurement in memory devices using ferroelectric polymer
NASA Astrophysics Data System (ADS)
Nguyen, Chien A.; Lee, Pooi See
2006-01-01
Application of thin polymer film as storing mean for non-volatile memory devices is investigated. Capacitance-voltage (C-V) measurement of metal-ferroelectric-metal device using ferroelectric copolymer P(VDF-TrFE) as dielectric layer shows stable 'butter-fly' curve. The two peaks in C-V measurement corresponding to the largest capacitance are coincidental at the coercive voltages that give rise to zero polarization in the polarization hysteresis measurement. By comparing data of C-V and P-E measurement, a correlation between two types of hysteresis is established in which it reveals simultaneous electrical processes occurring inside the device. These processes are caused by the response of irreversible and reversible polarization to the applied electric field that can be used to present a memory window. The memory effect of ferroelectric copolymer is further demonstrated for fabricating polymeric non-volatile memory devices using metal-ferroelectric-insulator-semiconductor structure (MFIS). By applying different sweeping voltages at the gate, bidirectional flat-band voltage shift is observed in the ferroelectric capacitor. The asymmetrical shift after negative sweeping is resulted from charge accumulation at the surface of Si substrate caused by the dipole direction in the polymer layer. The effect is reversed for positive voltage sweeping.
Digitally controlled distributed phase shifter
Hietala, V.M.; Kravitz, S.H.; Vawter, G.A.
1993-08-17
A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.
Digitally controlled distributed phase shifter
Hietala, Vincent M.; Kravitz, Stanley H.; Vawter, Gregory A.
1993-01-01
A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.
NASA Astrophysics Data System (ADS)
Li, Yunlong; Suhard, Samuel; Van Huylenbroeck, Stefaan; Meersschaut, Johan; Van Besien, Els; Stucchi, Michele; Croes, Kristof; Beyer, Gerald; Beyne, Eric
2017-12-01
A Through Silicon Via (TSV) is a key component for 3D integrated circuit stacking technology, and the diameter of a TSV keeps scaling down to reduce the footprint in silicon. The TSV aspect ratio, defined as the TSV depth/diameter, tends to increase consequently. Starting from the aspect ratio of 10, to improve the TSV sidewall coverage and reduce the process thermal budget, the TSV dielectric liner deposition process has evolved from sub-atmospheric chemical vapour deposition to plasma-enhanced atomic layer deposition (PE-ALD). However, with this change, a strong negative shift in the flatband voltage is observed in the capacitance-voltage characteristic of the vertical metal-oxide-semiconductor (MOS) parasitic capacitor formed between the TSV copper metal and the p-Si substrate. And, no shift is present in planar MOS capacitors manufactured with the same PE-ALD oxide. By comparing the integration process of these two MOS capacitor structures, and by using Elastic Recoil Detection to study the elemental composition of our films, it is found that the origin of the negative flatband voltage shift is the positive charge trapping at the Si/SiO2 interface, due to the positive PE-ALD reactants confined to the narrow cavity of high aspect ratio TSVs. This interface charge trapping effect can be effectively mitigated by high temperature annealing. However, this is limited in the real process due to the high thermal budget. Further investigation on liner oxide process optimization is needed.
Kumar, Satyendra; Kumar, Narendra; Panda, Siddhartha
2016-04-01
Miniaturization of the sandwich enzyme-based immunosensor has several advantages but could result in lower signal strength due to lower enzyme loading. Hence, technologies for amplification of the signal are needed. Signal amplification in a field effect-based electrochemical immunosensor utilizing chip-based ELISA is presented in this work. First, the molarities of phosphate buffer saline (PBS) and concentrations of KCl as ionic strength adjuster were optimized to maximize the GOx glucose-based enzymatic reactions in a beaker for signal amplification measured by change in the voltage shift with an EIS device (using 20 μl of solution) and validated with a commercial pH meter (using 3 ml of solution). The PBS molarity of 100 μM with 25 mM KCl provided the maximum voltage shift. These optimized buffer conditions were further verified for GOx immobilized on silicon chips, and similar trends with decreased PBS molarity were obtained; however, the voltage shift values obtained on chip reaction were lower as compared to the reactions occurring in the beaker. The decreased voltage shift with immobilized enzyme on chip could be attributed to the increased Km (Michaelis-Menten constant) values in the immobilized GOx. Finally, a more than sixfold signal enhancement (from 8 to 47 mV) for the chip-based sandwich immunoassay was obtained by altering the PBS molarity from 10 to 100 μM with 25 mM KCl.
Barbiturates Block Sodium and Potassium Conductance Increases in Voltage-Clamped Lobster Axons
Blaustein, M. P.
1968-01-01
Sodium pentobarbital and sodium thiopental decrease both the peak initial (Na) and late steady-state (K) currents and reduce the maximum sodium and potassium conductance increases in voltage-clamped lobster giant axons. These barbiturates also slow the rate at which the sodium conductance turns on, and shift the normalized sodium conductance vs. voltage curves in the direction of depolarization along the voltage axis. Since pentobarbital (pKa = 8.0) blocks the action potential more effectively at pH 8.5 than at pH 6.7, the anionic form of the drug appears to be active. The data suggest that these drugs affect the axon membrane directly, rather than secondarily through effects on intermediary metabolism. It is suggested that penetration of the lipid layer of the membrane by the nonpolar portion of the barbiturate molecules may cause the decrease in membrane conductances, while electrostatic interactions involving the anionic group on the barbiturate, divalent cations, and "fixed charges" in the membrane could account for the slowing of the rate of sodium conductance turn-on and the shift of the normalized conductance curves along the voltage axis. PMID:5648829
Modulation of spin dynamics via voltage control of spin-lattice coupling in multiferroics
Zhu, Mingmin; Zhou, Ziyao; Peng, Bin; ...
2017-02-03
Our work aims at magnonics manipulation by the magnetoelectric coupling effect and is motivated by the most recent progresses in both magnonics (spin dynamics) and multiferroics fields. Here, voltage control of magnonics, particularly the surface spin waves, is achieved in La 0.7Sr 0.3MnO 3/0.7Pb(Mg 1/3Nb 2/3)O 3-0.3PbTiO 3 multiferroic heterostructures. With the electron spin resonance method, a large 135 Oe shift of surface spin wave resonance (≈7 times greater than conventional voltage-induced ferromagnetic resonance shift of 20 Oe) is determined. A model of the spin-lattice coupling effect, i.e., varying exchange stiffness due to voltage-induced anisotropic lattice changes, has been establishedmore » to explain experiment results with good agreement. In addition, an “on” and “off” spin wave state switch near the critical angle upon applying a voltage is created. The modulation of spin dynamics by spin-lattice coupling effect provides a platform for realizing energy-efficient, tunable magnonics devices.« less
A Concept for Measuring Electron Distribution Functions Using Collective Thomson Scattering
NASA Astrophysics Data System (ADS)
Milder, A. L.; Froula, D. H.
2017-10-01
A.B. Langdon proposed that stable non-Maxwellian distribution functions are realized in coronal inertial confinement fusion plasmas via inverse bremsstrahlung heating. For Zvosc2
NASA Astrophysics Data System (ADS)
Han, Genquan; Wang, Yibo; Liu, Yan; Wang, Hongjuan; Liu, Mingshan; Zhang, Chunfu; Zhang, Jincheng; Cheng, Buwen; Hao, Yue
2015-05-01
In this work, relaxed GeSn p-channel tunneling field-effect transistors (pTFETs) with various Sn compositions are fabricated on Si. Enhancement of on-state current ION with the increase of Sn composition is observed in transistors, due to the reduction of direct bandgap EG. Ge0.93Sn0.07 and Ge0.95Sn0.05 pTFETs achieve 110% and 75% enhancement in ION, respectively, compared to Ge0.97Sn0.03 devices, at VGS - VTH = VDS = - 1.0 V. For the first time, ION enhancement in GeSn pTFET utilizing uniaxial tensile strain is reported. By applying 0.14% uniaxial tensile strain along [110] channel direction, Ge0.95Sn0.05 pTFETs achieve 12% ION improvement, over unstrained control devices at VGS - VTH = VDS = - 1.0 V. Theoretical study demonstrates that uniaxial tensile strain leads to the reduction of direct EG and affects the reduced tunneling mass, which bring the GBTBT rising, benefiting the tunneling current enhancement in GeSn TFETs.
A mathematical approach for evaluating nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Leibecki, H. F.
1986-01-01
A mathematical equation is presented which gives a quantitative relationship between time-voltage discharge curves, when a cell's ampere-hour capacity is determined at a constant discharge current. In particular the equation quantifies the initial exponential voltage decay; the rate of voltage decay; the overall voltage shift of the curve and the total capacity of the cell at the given discharge current. The results of 12 nickel-hydrogen boiler plate cells cycled to 80 percent depth-of-discharge (DOD) are discussed in association with these equations.
Raman spectrum method for characterization of pull-in voltages of graphene capacitive shunt switches
NASA Astrophysics Data System (ADS)
Li, Peng; You, Zheng; Cui, Tianhong
2012-12-01
An approach using Raman spectrum method is reported to measure pull-in voltages of graphene capacitive shunt switches. When the bias excesses the pull-in voltage, the Raman spectrum's intensity largely decreases. Two factors that contribute to the intensity reduction are investigated. Moreover, by monitoring the frequency shift of G peak and 2D band, we are able to detect the pull-in voltage and measure the strain change in graphene beams during switching.
NASA Technical Reports Server (NTRS)
1997-01-01
Frank Nola invented the Power Factor Controller (PFC) at Marshall Space Flight Center more than a decade ago. Nola came up with a way to curb power wastage in AC induction motors. The PFC matches voltage with the motor's actual need by continuously sensing shifts between voltage and current. When it senses a light load it cuts the voltage to the minimum needed. Potential energy savings range from 8 to 65 percent.
1997-01-01
Frank Nola invented the Power Factor Controller (PFC) at Marshall Space Flight Center more than a decade ago. Nola came up with a way to curb power wastage in AC induction motors. The PFC matches voltage with the motor's actual need by continuously sensing shifts between voltage and current. When it senses a light load it cuts the voltage to the minimum needed. Potential energy savings range from 8 to 65 percent.
Weiss, J.D.
1997-01-14
A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field. 6 figs.
van der Wel, C M; Kortschot, R J; Bakelaar, I A; Erné, B H; Kuipers, B W M
2013-03-01
The sensitivity of an imperfectly balanced impedance bridge is limited by the remaining offset voltage. Here, we present a procedure for offset reduction in impedance measurements using a lock-in amplifier, by applying a complex compensating voltage external to the bridge. This procedure takes into account instrumental damping and phase shifting, which generally occur at the high end of the operational frequency range. Measurements demonstrate that the output of the circuit rapidly converges to the instrumentally limited noise at any frequency.
Basic corrections to predictions of solar cell performance required by nonlinearities
NASA Technical Reports Server (NTRS)
Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.
1976-01-01
The superposition principle is used to derive the approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. The derivation requires the linearity of the boundary value problems that underlie the electrical characteristics. The shifting approximation is invalid if considerable photocurrent and considerable dark current both occur within the junction space-charge region; it is invalid also if sizable series resistance is present or if high-injection concentrations of holes and electrons exist within the quasi-neutral regions.
NASA Astrophysics Data System (ADS)
Kim, Youngjun; Cho, Seongeun; Park, Byoungnam
2018-03-01
We report ultraviolet (UV)-induced optical gating in a Zn1-x Mg x O nanocrystal solid solution (NCSS) field effect transistor (FET) through a systematic study in which UV-induced charge transport properties are probed as a function of Mg composition. Change in the electrical properties of Zn1-x Mg x O NCSS associated with electronic traps is investigated by field effect-modulated current-voltage characteristic curves in the dark and under illumination. Under UV illumination, significant threshold voltage shift to a more negative value in an n-channel Zn1-x Mg x O NCSS FET is observed. Importantly, as the Mg composition increases, the effect of UV illumination on the threshold voltage shift is alleviated. We found that threshold voltage shift as a function of Mg composition in the dark and under illumination is due to difference in the deep trap density in the Zn1-x Mg x O NCSS. This is supported by Mg composition dependent photoluminescence intensity in the visible range and reduced FET mobility with Mg addition. The presence of the deep traps and the corresponding trap energy levels in the Zn1-x Mg x O NCSS are ensured by photoelectron spectroscopy in air.
Tsai, Cheng-Tao; Tseng, Sheng-Yu
2013-01-01
This paper presents comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier. In high current capability and high step-down voltage conversion, a phase-shift full-bridge converter with a conventional current-doubler rectifier has the common limitations of extremely low duty ratio and high component stresses. To overcome these limitations, a phase-shift full-bridge converter with a noncoupled current-doubler rectifier (NCDR) or a coupled current-doubler rectifier (CCDR) is, respectively, proposed and implemented. In this study, performance analysis and efficiency obtained from a 500 W phase-shift full-bridge converter with two improved current-doubler rectifiers are presented and compared. From their prototypes, experimental results have verified that the phase-shift full-bridge converter with NCDR has optimal duty ratio, lower component stresses, and output current ripple. In component count and efficiency comparison, CCDR has fewer components and higher efficiency at full load condition. For small size and high efficiency requirements, CCDR is relatively suitable for high step-down voltage and high efficiency applications. PMID:24381521
Tsai, Cheng-Tao; Su, Jye-Chau; Tseng, Sheng-Yu
2013-01-01
This paper presents comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier. In high current capability and high step-down voltage conversion, a phase-shift full-bridge converter with a conventional current-doubler rectifier has the common limitations of extremely low duty ratio and high component stresses. To overcome these limitations, a phase-shift full-bridge converter with a noncoupled current-doubler rectifier (NCDR) or a coupled current-doubler rectifier (CCDR) is, respectively, proposed and implemented. In this study, performance analysis and efficiency obtained from a 500 W phase-shift full-bridge converter with two improved current-doubler rectifiers are presented and compared. From their prototypes, experimental results have verified that the phase-shift full-bridge converter with NCDR has optimal duty ratio, lower component stresses, and output current ripple. In component count and efficiency comparison, CCDR has fewer components and higher efficiency at full load condition. For small size and high efficiency requirements, CCDR is relatively suitable for high step-down voltage and high efficiency applications.
Inhibitory effects of magnolol on voltage-gated Na+ and K+ channels of NG108-15 cells.
Gong, Chi-Li; Wong, Kar-Lok; Cheng, Ka-Shun; Kuo, Chang-Shin; Chao, Chia-Chia; Tsai, Min-Fan; Leung, Yuk-Man
2012-05-05
Magnolol, a polyphenolic compound isolated from Houpu, a Chinese herb from the bark of Magnolia officinalis, has been reported to have in vitro and in vivo neuroprotective effects. In spite of these reported beneficial effects, studies on the direct impact of magnolol on neuronal ion channels have been scarce. Whether magnolol affects voltage-gated Na(+) channels (VGSC) and voltage-gated K(+) (Kv) channels is unknown. Using the whole-cell voltage-clamp method, we studied the effects of magnolol on voltage-gated ion channels in neuronal NG108-15 cells. Magnolol inhibited VGSC channels with mild state-dependence (IC(50) of 15 and 30 μM, at holding potentials of -70 and -100 mV, respectively). No frequency-dependence was observed in magnolol block. Magnolol caused a left-shift of 18 mV in the steady-state inactivation curve but did not affect the voltage-dependence of activation. Magnolol inhibited Kv channels with an IC(50) of 21 μM, and it caused a 20-mV left-shift in the steady-state inactivation curve without affecting the voltage-dependence of activation. In conclusion, magnolol is an inhibitor of both VGSC and Kv channels and these inhibitory effects may in part contribute to some of the reported neuroprotective effects of magnolol. Copyright © 2012 Elsevier B.V. All rights reserved.
Yang, Shiqian; Wang, Qin; Zhang, Manhong; Long, Shibing; Liu, Jing; Liu, Ming
2010-06-18
Titanium-tungsten nanocrystals (NCs) were fabricated by a self-assembly rapid thermal annealing (RTA) process. Well isolated Ti(0.46)W(0.54) NCs were embedded in the gate dielectric stack of SiO(2)/Al(2)O(3). A metal-oxide-semiconductor (MOS) capacitor was fabricated to investigate its application in a non-volatile memory (NVM) device. It demonstrated a large memory window of 6.2 V in terms of flat-band voltage (V(FB)) shift under a dual-directional sweeping gate voltage of - 10 to 10 V. A 1.1 V V(FB) shift under a low dual-directional sweeping gate voltage of - 4 to 4 V was also observed. The retention characteristic of this MOS capacitor was demonstrated by a 0.5 V memory window after 10(4) s of elapsed time at room temperature. The endurance characteristic was demonstrated by a program/erase cycling test.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J
2008-11-01
External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.
2008-01-01
External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222
NASA Technical Reports Server (NTRS)
1986-01-01
The power factor controller (PFC) was invented by a NASA engineer. It matches voltage with a motor's actual need by sensing shifts in the relationship between voltage and current flow. With the device, power can be trimmed as much as 65%. Intellinet adopted this technology and designed "soft start" and "load-responsive" control modes to start engines gradually and recycle voltage without reducing motor speed. Other features are lower motor heat and faster fault identification.
A finite state machine read-out chip for integrated surface acoustic wave sensors
NASA Astrophysics Data System (ADS)
Rakshit, Sambarta; Iliadis, Agis A.
2015-01-01
A finite state machine based integrated sensor circuit suitable for the read-out module of a monolithically integrated SAW sensor on Si is reported. The primary sensor closed loop consists of a voltage controlled oscillator (VCO), a peak detecting comparator, a finite state machine (FSM), and a monolithically integrated SAW sensor device. The output of the system oscillates within a narrow voltage range that correlates with the SAW pass-band response. The period of oscillation is of the order of the SAW phase delay. We use timing information from the FSM to convert SAW phase delay to an on-chip 10 bit digital output operating on the principle of time to digital conversion (TDC). The control inputs of this digital conversion block are generated by a second finite state machine operating under a divided system clock. The average output varies with changes in SAW center frequency, thus tracking mass sensing events in real time. Based on measured VCO gain of 16 MHz/V our system will convert a 10 kHz SAW frequency shift to a corresponding mean voltage shift of 0.7 mV. A corresponding shift in phase delay is converted to a one or two bit shift in the TDC output code. The system can handle alternate SAW center frequencies and group delays simply by adjusting the VCO control and TDC delay control inputs. Because of frequency to voltage and phase to digital conversion, this topology does not require external frequency counter setups and is uniquely suitable for full monolithic integration of autonomous sensor systems and tags.
Method of coating graphite tubes with refractory metal carbides
Wohlberg, C.
1973-12-11
A method of coating graphite tubes with a refractory metal carbide is described. An alkali halide is reacted with a metallic oxide, the metallic portion being selected from the IVth or Vth group of the Periodic Table, the resulting salt reacting in turn with the carbon to give the desired refractory metal carbide coating. (Official Gazette)
Abstracts, 19th Annual Meeting Society of Engineering Science, Inc. October 27, 28, & 29, 1982.
1982-10-01
nickel best syperellys used as turbine disk merlals t Mr Force engines. The types of tess and date are described alang Vth the pre- cedres for...microplar boundary layers. The specific geo- mtries of the flow are the flat plate flew, cross flow on a circular eylinder and longituadinal flow alang
NASA Astrophysics Data System (ADS)
Kim, Woo-Byung; Lee, Dong Keun; Ryu, Sang Ouk
2014-07-01
The a-IGZO deposited by using the rf sputtering method features a conductive or an insulator characteristic based on amount of oxygen. We demonstrated that a post-treatment affects the resistance patterns of particular-sized InGaZnO(IGZO) thin films in a-IGZO thin-film transistors (TFTs). Post-annealing shifted the driving voltage of a-IGZO TFT to positive or negative values, depending on the annealing temperatures. Post-annealing may introduce oxygen vacancies or desorbed oxygen in the IGZO thin film. The changed driving voltage of IGZO TFTs coincides with the shift of the resistance pattern of IGZO. The fabricated a-IGZO TFTs exhibited a field effect mobility of 6.2 cm2/Vs, an excellent subthreshold gate swing of 0.32 V/decade, and a high I on/off ratio of > 109. Under positive bias illumination stress (PBIS) and negative bias illumination stress (NBIS), after 3,600 seconds, the device threshold voltage shifted about 0.2 V and 0.3 V, respectively.
Stability study of solution-processed zinc tin oxide thin-film transistors
NASA Astrophysics Data System (ADS)
Zhang, Xue; Ndabakuranye, Jean Pierre; Kim, Dong Wook; Choi, Jong Sun; Park, Jaehoon
2015-11-01
In this study, the environmental dependence of the electrical stability of solution-processed n-channel zinc tin oxide (ZTO) thin-film transistors (TFTs) is reported. Under a prolonged negative gate bias stress, a negative shift in threshold voltage occurs in atmospheric air, whereas a negligible positive shift in threshold voltage occurs under vacuum. In the positive bias-stress experiments, a positive shift in threshold voltage was invariably observed both in atmospheric air and under vacuum. In this study, the negative gate-bias-stress-induced instability in atmospheric air is explained through an internal potential in the ZTO semiconductor, which can be generated owing to the interplay between H2O molecules and majority carrier electrons at the surface of the ZTO film. The positive bias-stress-induced instability is ascribed to electron-trapping phenomenon in and around the TFT channel region, which can be further augmented in the presence of air O2 molecules. These results suggest that the interaction between majority carriers and air molecules will have crucial implications for a reliable operation of solution-processed ZTO TFTs. [Figure not available: see fulltext.
NASA Astrophysics Data System (ADS)
Sakamoto, Yuri; Uemura, Kohei; Ikuta, Takashi; Maehashi, Kenzo
2018-04-01
We have succeeded in fabricating a hydrogen gas sensor based on palladium-modified graphene field-effect transistors (FETs). The negative-voltage shift in the transfer characteristics was observed with exposure to hydrogen gas, which was explained by the change in work function. The hydrogen concentration dependence of the voltage shift was investigated using graphene FETs with palladium deposited by three different evaporation processes. The results indicate that the hydrogen detection sensitivity of the palladium-modified graphene FETs is strongly dependent on the palladium configuration. Therefore, the palladium-modified graphene FET is a candidate for breath analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rajachidambaram, Meena Suhanya; Pandey, Archana; Vilayur Ganapathy, Subramanian
The role of back channel surface chemistry on amorphous zinc tin oxide (ZTO) bottom gate thin film transistors (TFT) have been characterized by positive bias-stress measurements and x-ray photoelectron spectroscopy. Positive bias-stress turn-on voltage shifts for ZTO-TFTs were significantly reduced by passivation of back channel surfaces with self-assembled monolayers of n-hexylphosphonic acid (n-HPA) when compared to ZTO-TFTs with no passivation. These results indicate that adsorption of molecular species on exposed back channel of ZTO-TFTs strongly influence observed turn-on voltage shifts, as opposed to charge injection into the dielectric or trapping due to oxygen vacancies.
Photocurrent Suppression of Transparent Organic Thin Film Transistors
NASA Astrophysics Data System (ADS)
Chuang, Chiao-Shun; Tsai, Shu-Ting; Lin, Yung-Sheng; Chen, Fang-Chung; Shieh, Hang-Ping D.
2007-12-01
Organic thin-film transistors (OTFTs) with high transmittance and low photosensitivity have been demonstrated. By using titanium dioxide nanoparticles as the additives in the polymer gate insulators, the level of device photoresponse has been reduced. The device shows simultaneously a high transparence and a minimal threshold voltage shift under white light illumination. It is inferred that the localized energy levels deep in the energy gap of pentacene behave as the recombination centers, enhancing substantially the recombination process in the conducting channel of the OTFTs. Therefore, the electron trapping is relieved and the shift of threshold voltage is reduced upon illumination.
Side-gate modulation effects on high-quality BN-Graphene-BN nanoribbon capacitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yang; Chen, Xiaolong; Ye, Weiguang
High-quality BN-Graphene-BN nanoribbon capacitors with double side-gates of graphene have been experimentally realized. The double side-gates can effectively modulate the electronic properties of graphene nanoribbon capacitors. By applying anti-symmetric side-gate voltages, we observed significant upward shifting and flattening of the V-shaped capacitance curve near the charge neutrality point. Symmetric side-gate voltages, however, only resulted in tilted upward shifting along the opposite direction of applied gate voltages. These modulation effects followed the behavior of graphene nanoribbons predicted theoretically for metallic side-gate modulation. The negative quantum capacitance phenomenon predicted by numerical simulations for graphene nanoribbons modulated by graphene side-gates was not observed,more » possibly due to the weakened interactions between the graphene nanoribbon and side-gate electrodes caused by the Ga{sup +} beam etching process.« less
Investigation of AlGaN/GaN HEMTs degradation with gate pulse stressing at cryogenic temperature
NASA Astrophysics Data System (ADS)
Wang, Ning; Wang, Hui; Lin, Xinpeng; Qi, Yongle; Duan, Tianli; Jiang, Lingli; Iervolino, Elina; Cheng, Kai; Yu, Hongyu
2017-09-01
Degradation on DC characteristics of AlGaN/GaN high electron mobility transistors (HEMTs) after applying pulsed gate stress at cryogenic temperatures is presented in this paper. The nitrogen vacancy near to the AlGaN/GaN interface leads to threshold voltage of stress-free sample shifting positively at low temperature. The anomalous behavior of threshold voltage variation (decrease first and then increase) under gate stressing as compared to stress-free sample is observed when lowing temperature. This can be correlated with the pre-existing electron traps in SiNX layer or at SiNX/AlGaN interface which can be de-activated and the captured electrons inject back to channel with lowering temperature, which counterbalances the influence of nitrogen vacancy on threshold voltage shift.
NASA Astrophysics Data System (ADS)
Shin, Min-Seok; Jo, Yun-Rae; Kwon, Oh-Kyong
2011-03-01
In this paper, we propose a driving method for compensating the electrical instability of hydrogenated amorphous silicon (a-Si:H) thin film transistors (TFTs) and the luminance degradation of organic light-emitting diode (OLED) devices for large active matrix OLED (AMOLED) displays. The proposed driving method senses the electrical characteristics of a-Si:H TFTs and OLEDs using current integrators and compensates them by an external compensation method. Threshold voltage shift is controlled a using negative bias voltage. After applying the proposed driving method, the measured error of the maximum emission current ranges from -1.23 to +1.59 least significant bit (LSB) of a 10-bit gray scale under the threshold voltage shift ranging from -0.16 to 0.17 V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chida, K.; Yamauchi, Y.; Arakawa, T.
2013-12-04
We performed the resistively-detected nuclear magnetic resonance (RDNMR) to study the electron spin polarization in the non-equilibrium quantum Hall regime. By measuring the Knight shift, we derive source-drain bias voltage dependence of the electron spin polarization in quantum wires. The electron spin polarization shows minimum value around the threshold voltage of the dynamic nuclear polarization.
NASA Technical Reports Server (NTRS)
1983-01-01
The power factor controller (PFC) senses shifts in the relationship between voltage and current, and matches them with a motor's need. This prevents waste as motors do not need a high voltage when they are not operating at full load conditions. PFC is manufactured by Nordic Controls Company, among others, and has proved extremely cost effective.
Voltage gating of mechanosensitive PIEZO channels.
Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R
2018-03-15
Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.
Frequency Invariability of (Pb,La)(Zr,Ti)O₃ Antiferroelectric Thick-Film Micro-Cantilevers.
An, Kun; Jin, Xuechen; Meng, Jiang; Li, Xiao; Ren, Yifeng
2018-05-13
Micro-electromechanical systems comprising antiferroelectric layers can offer both actuation and transduction to integrated technologies. Micro-cantilevers based on the (Pb 0.97 La 0.02 )(Zr 0.95 Ti 0.05 )O₃ (PLZT) antiferroelectric thick film are fabricated by the micro-nano manufacturing process, to utilize the effect of phase transition induced strain and sharp phase switch of antiferroelectric materials. When micro-cantilevers made of antiferroelectric thick films were driven by sweep voltages, there were two resonant peaks corresponding to the natural frequency shift from 27.8 to 27.0 kHz, before and after phase transition. This is the compensation principle for the PLZT micro-cantilever to tune the natural frequency by the amplitude modulation of driving voltage, rather than of frequency modulation. Considering the natural frequency shift about 0.8 kHz and the frequency tuning ability about 156 Hz/V before the phase transition, this can compensate the frequency shift caused by increasing temperature by tuning only the amplitude of driving voltage, when the ultrasonic micro-transducer made of antiferroelectric thick films works for such a long period. Therefore, antiferroelectric thick films with hetero-structures incorporated into PLZT micro-cantilevers not only require a lower driving voltage (no more than 40 V) than rival bulk piezoelectric ceramics, but also exhibit better performance of frequency invariability, based on the amplitude modulation.
Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo
2017-08-29
Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff <5 msec). However, the signal was small (ΔF/F= 0.6%/200 mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
NASA Astrophysics Data System (ADS)
Lin, Yi-Hsin; Chen, Ming-Syuan; Lin, Wei-Chih; Tsou, Yu-Shih
2012-07-01
A polarization-independent liquid crystal phase modulation using polymer-network liquid crystals in a 90° twisted cell (T-PNLC) is demonstrated. T-PNLC consists of three layers. Liquid crystal (LC) directors in the two layers near glass substrates are orthogonal to each other and those two layers modulate two eigen-polarizations of an incident light. As a result, two eigen-polarizations of an incident light experience the same phase shift. In the middle layer, LC directors are perpendicular to the glass substrate and contribute no phase shift. The phase shift of T-PNLC is electrically tunable and polarization-independent. T-PNLC does not require any bias voltage for operation. The phase shift is 0.28 π rad for the voltage of 30 Vrms. By measuring and analyzing the optical phase shift of T-PNLC at the oblique incidence of transverse magnetic wave, the pretilt angle of LC directors and the effective thickness of three layers are obtained and discussed. The potential applications are spatial light modulators, laser beam steering, and micro-lens arrays.
NASA Astrophysics Data System (ADS)
He, Yi
2000-10-01
Organic light-emitting devices (OLEDs) made of single-layer and double-layer polymer thin films have been fabricated and studied. The hole transporting (polymer A) and emissive (polymer B) polymers were poly(9,9' -dioctyl fluorene-2,7-diyl)-co-poly(diphenyl-p-tolyl-amine-4,4 '-diyl) and poly(9,9'-dioctyl fluorene-2,7-diyl)-co-poly(benzothiadiazole 2,5-diyl), respectively. The optical bandgaps of polymer A and B were 2.72 and 2.82 eV, respectively. The photoluminescence (PL) peaks for polymer A and B were 502 and 546 nm, respectively. The electroluminescence (EL) peak for polymer B was 547 nm. No EL has been observed from polymer A single layer OLEDs. To obtain the spectral distribution of the emission properties of the light-emitting devices, a new light-output measurement technique was developed. Using this technique, the spectral distribution of the luminance, radiance, photon density emission can be obtained. Moreover, the device external quantum efficiency calculated using this technique is accurate and insensitive to the light emission spectrum shape. Organic light-emitting devices have been fabricated and studied on both glass and flexible plastic substrates. The OLEDs showed a near-linear relationship between the luminance and the applied current density over four orders of magnitude. For the OLEDs fabricated on the glass substrate, luminance ˜9,300 cd/m2, emission efficiency ˜14.5 cd/A, luminescence power efficiency ˜2.26 lm/W, and external quantum efficiency ˜3.85% have been achieved. For the OLEDs fabricated on the flexible plastic substrates, both aluminum and calcium were used as cathode materials. The achieved maximum OLED luminance, emission efficiency, luminescence power efficiency, and external quantum efficiency were ˜13,000 cd/m2, ˜66.1 cd/A, ˜17.2 lm/W, and 16.7%, respectively. To make an active-matrix organic light-emitting display (AM-OLED), a two-TFT pixel electrode circuit was designed and fabricated based on amorphous silicon TFT technology. This circuit was capable of providing continuous pixel excitation and a simple driving scheme. However, it showed an output current variation of ˜40% to 80% due to the drive TFT threshold voltage (V th) shift after long-term operation. To improve the pixel circuit electrical reliability, a four-TFT pixel electrode circuit was proposed and fabricated. This circuit only showed an output current variation <1% for the high currents (>0.5muA) even when a TFT Vth shift as large as 3V was present. This four-TFT pixel electrode circuit was used to fabricate small size active-matrix monochrome organic light-emitting display.
Koo, Hyunmo; Lee, Wookyu; Choi, Younchang; Sun, Junfeng; Bak, Jina; Noh, Jinsoo; Subramanian, Vivek; Azuma, Yasuo; Majima, Yutaka; Cho, Gyoujin
2015-01-01
To demonstrate that roll-to-roll (R2R) gravure printing is a suitable advanced manufacturing method for flexible thin film transistor (TFT)-based electronic circuits, three different nanomaterial-based inks (silver nanoparticles, BaTiO3 nanoparticles and single-walled carbon nanotubes (SWNTs)) were selected and optimized to enable the realization of fully printed SWNT-based TFTs (SWNT-TFTs) on 150-m-long rolls of 0.25-m-wide poly(ethylene terephthalate) (PET). SWNT-TFTs with 5 different channel lengths, namely, 30, 80, 130, 180, and 230 μm, were fabricated using a printing speed of 8 m/min. These SWNT-TFTs were characterized, and the obtained electrical parameters were related to major mechanical factors such as web tension, registration accuracy, impression roll pressure and printing speed to determine whether these mechanical factors were the sources of the observed device-to-device variations. By utilizing the electrical parameters from the SWNT-TFTs, a Monte Carlo simulation for a 1-bit adder circuit, as a reference, was conducted to demonstrate that functional circuits with reasonable complexity can indeed be manufactured using R2R gravure printing. The simulation results suggest that circuits with complexity, similar to the full adder circuit, can be printed with a 76% circuit yield if threshold voltage (Vth) variations of less than 30% can be maintained. PMID:26411839
A fully roll-to-roll gravure-printed carbon nanotube-based active matrix for multi-touch sensors
Lee, Wookyu; Koo, Hyunmo; Sun, Junfeng; Noh, Jinsoo; Kwon, Kye-Si; Yeom, Chiseon; Choi, Younchang; Chen, Kevin; Javey, Ali; Cho, Gyoujin
2015-01-01
Roll-to-roll (R2R) printing has been pursued as a commercially viable high-throughput technology to manufacture flexible, disposable, and inexpensive printed electronic devices. However, in recent years, pessimism has prevailed because of the barriers faced when attempting to fabricate and integrate thin film transistors (TFTs) using an R2R printing method. In this paper, we report 20 × 20 active matrices (AMs) based on single-walled carbon nanotubes (SWCNTs) with a resolution of 9.3 points per inch (ppi) resolution, obtained using a fully R2R gravure printing process. By using SWCNTs as the semiconducting layer and poly(ethylene terephthalate) (PET) as the substrate, we have obtained a device yield above 98%, and extracted the key scalability factors required for a feasible R2R gravure manufacturing process. Multi-touch sensor arrays were achieved by laminating a pressure sensitive rubber onto the SWCNT-TFT AM. This R2R gravure printing system overcomes the barriers associated with the registration accuracy of printing each layer and the variation of the threshold voltage (Vth). By overcoming these barriers, the R2R gravure printing method can be viable as an advanced manufacturing technology, thus enabling the high-throughput production of flexible, disposable, and human-interactive cutting-edge electronic devices based on SWCNT-TFT AMs. PMID:26635237
Nagel, Wolfram; Katz, Uri
2003-02-01
The effect of xanthine derivatives on the voltage-activated Cl(-) conductance (G(Cl)) of amphibian skin was analyzed. 3-Isobutyl-1-methylxanthine (IBMX) and the recently synthesized xanthine derivatives 3,7-dimethyl-1-propyl xanthine (X-32) and 3,7-dimethyl-1-isobutyl xanthine (X-33), which lack inhibitory effects on phosphodiesterases in CHO and Calu-3 cells, increased voltage-activated G(Cl) without effect on baseline conductance at inactivating voltage. Half-maximal stimulation of G(Cl) occurred at 108 +/- 9 microM for X-32 and X-33 after apical or basolateral application. The stimulation of G(Cl), which occurs only in the presence of Cl(-) in the mucosal solution, is caused by a shift of the voltage sensitivity to lower clamp potentials and an increase of the maximally activated level. Furosemide reversed both the shift of sensitivity and the increase in magnitude. These patterns are fundamentally different from those seen after application of membrane-permeant, nonmetabolized analogs of cAMP, and they indicate that the xanthines stimulate G(Cl) directly. This notion is strengthened by the lack of influence on intracellular cAMP content, which is consistent with the observations in CHO and Calu-3 cells. We propose that the xanthine derivatives increase the voltage sensitivity of a regulative component in the conductive Cl(-) pathway across amphibian skin.
NASA Astrophysics Data System (ADS)
Zhang, Z.; Cardwell, D.; Sasikumar, A.; Kyle, E. C. H.; Chen, J.; Zhang, E. X.; Fleetwood, D. M.; Schrimpf, R. D.; Speck, J. S.; Arehart, A. R.; Ringel, S. A.
2016-04-01
The impact of proton irradiation on the threshold voltage (VT) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of VT was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 1014 cm-2. Silvaco Atlas simulations of VT shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different VT dependences on proton irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed VT shifts. The proton irradiation induced VT shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Deflection amplifier for image dissectors
NASA Technical Reports Server (NTRS)
Salomon, P. M.
1977-01-01
Balanced symmetrical y-axis amplifier uses zener-diode level shifting to interface operational amplifiers to high voltage bipolar output stages. Nominal voltage transfer characteristic is 40 differential output volts per input volt; bandwidth, between -3-dB points, is approximately 8 kHz; loop gain is nominally 89 dB with closed loop gain of 26 dB.
Organic memory capacitor device fabricated with Ag nanoparticles.
Kim, Yo-Han; Jung, Sung Mok; Hu, Quanli; Kim, Yong-Sang; Yoon, Tae-Sik; Lee, Hyun Ho
2011-07-01
In this study, it is demonstrated that an organic memory structure using pentacene and citrate-stabilized silver nanoparticles (Ag NPs) as charge storage elements on dielectric SiO2 layer and silicon substrate. The Ag NPs were synthesized by thermal reduction method of silver trifluoroacetate with oleic acid. The synthesized Ag NPs were analyzed with high resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED) for their crystalline structure. The capacitance versus voltage (C-V) curves obtained for the Ag NPs embedded capacitor exhibited flat-band voltage shifts, which demonstrated the presence of charge storages. The citrate-capping of the Ag NPs was confirmed by ultraviolet-visible (UV-VIS) and Fourier transformed infrared (FTIR) spectroscopy. With voltage sweeping of +/-7 V, a hysteresis loop having flatband voltage shift of 7.1 V was obtained. The hysteresis loop showed a counter-clockwise direction. In addition, electrical performance test for charge storage showed more than 10,000 second charge retention time. The device with Ag NPs can be applied to an organic memory device for flexible electronics.
NASA Astrophysics Data System (ADS)
Chen, Ming-Syuan; Lin, Wei-Chih; Tsou, Yu-Shih; Lin, Yi-Hsin
2012-10-01
A polarization-independent liquid crystal (LC) phase modulation using polymer-network liquid crystals with orthogonal alignments layers (T-PNLC) is demonstrated. T-PNLC consists of three layers. LC directors in the two layers near glass substrates are orthogonal to each other. In the middle layer, LC directors are perpendicular to the glass substrate. The advantages of such T-PNLC include polarizer-free, larger phase shift (~0.4π rad) than the residual phase type (<0.05π rad), and low operating voltage (< 30Vrms). It does not require bias voltage for avoiding scattering because the refractive index of liquid crystals matches that of polymers. The phase shift of T-PNLC is affected by the cell gap and the curing voltages. The potential applications are laser beam steering, spatial light modulators and electrically tunable micro-lens arrays.
Metal-oxide thin-film transistor-based pH sensor with a silver nanowire top gate electrode
NASA Astrophysics Data System (ADS)
Yoo, Tae-Hee; Sang, Byoung-In; Wang, Byung-Yong; Lim, Dae-Soon; Kang, Hyun Wook; Choi, Won Kook; Lee, Young Tack; Oh, Young-Jei; Hwang, Do Kyung
2016-04-01
Amorphous InGaZnO (IGZO) metal-oxide-semiconductor thin-film transistors (TFTs) are one of the most promising technologies to replace amorphous and polycrystalline Si TFTs. Recently, TFT-based sensing platforms have been gaining significant interests. Here, we report on IGZO transistor-based pH sensors in aqueous medium. In order to achieve stable operation in aqueous environment and enhance sensitivity, we used Al2O3 grown by using atomic layer deposition (ALD) and a porous Ag nanowire (NW) mesh as the top gate dielectric and electrode layers, respectively. Such devices with a Ag NW mesh at the top gate electrode rapidly respond to the pH of solutions by shifting the turn-on voltage. Furthermore, the output voltage signals induced by the voltage shifts can be directly extracted by implantation of a resistive load inverter.
Sheets, Michael F; Chen, Tiehua; Hanck, Dorothy A
2013-10-15
To determine the roles of the individual S4 segments in domains I and II to activation and inactivation kinetics of sodium current (INa) in NaV1.5, we used a tethered biotin and avidin approach after a site-directed cysteine substitution was made in the second outermost Arg in each S4 (DI-R2C and DII-R2C). We first determined the fraction of gating charge contributed by the individual S4's to maximal gating current (Qmax), and found that the outermost Arg residue in each S4 contributed ∼19% to Qmax with minimal contributions by other arginines. Stabilization of the S4's in DI-R2C and DII-R2C was confirmed by measuring the expected reduction in Qmax. In DI-R2C, stabilization resulted in a decrease in peak INa of ∼45%, while its peak current-voltage (I-V) and voltage-dependent Na channel availability (SSI) curves were nearly unchanged from wild type (WT). In contrast, stabilization of the DII-R2C enhanced activation with a negative shift in the peak I-V relationship by -7 mV and a larger -17 mV shift in the voltage-dependent SSI curve. Furthermore, its INa decay time constants and time-to-peak INa became more rapid than WT. An explanation for these results is that the depolarized conformation of DII-S4, but not DI-S4, affects the receptor for the inactivation particle formed by the interdomain linker between DIII and IV. In addition, the leftward shifts of both activation and inactivation and the decrease in Gmax after stabilization of the DII-S4 support previous studies that showed β-scorpion toxins trap the voltage sensor of DII in an activated conformation.
Park, Byoungnam; Whitham, Kevin; Bian, Kaifu; Lim, Yee-Fun; Hanrath, Tobias
2014-12-21
We used a bilayer field effect transistor (FET) consisting of a thin PbS nanocrystals (NCs) film interfaced with vacuum-deposited pentacene to probe trap states in NCs. We interpret the observed threshold voltage shift in context of charge carrier trapping by PbS NCs and relate the magnitude of the threshold voltage shift to the number of trapped carriers. We explored a series of NC surface ligands to modify the interface between PbS NCs and pentacene and demonstrate the impact of interface chemistry on charge carrier density and the FET mobility in a pentacene FET.
Toward Quantifying the Electrostatic Transduction Mechanism in Carbon Nanotube Biomolecular Sensors
NASA Astrophysics Data System (ADS)
Lerner, Mitchell; Kybert, Nicholas; Mendoza, Ryan; Dailey, Jennifer; Johnson, A. T. Charlie
2013-03-01
Despite the great promise of carbon nanotube field-effect transistors (CNT FETs) for applications in chemical and biochemical detection, a quantitative understanding of sensor responses is lacking. To explore the role of electrostatics in sensor transduction, experiments were conducted with a set of similar compounds designed to adsorb onto the CNT FET via a pyrene linker group and take on a set of known charge states under ambient conditions. Acidic and basic species were observed to induce threshold voltage shifts of opposite sign, consistent with gating of the CNT FET by local charges due to protonation or deprotonation of the pyrene compounds by interfacial water. The magnitude of the gate voltage shift was controlled by the distance between the charged group and the CNT. Additionally, functionalization with an uncharged pyrene compound showed a threshold shift ascribed to its molecular dipole moment. This work illustrates a method for producing CNT FETs with controlled values of the turnoff gate voltage, and more generally, these results will inform the development of quantitative models for the response of CNT FET chemical and biochemical sensors. As an example, the results of an experiment detecting biomarkers of Lyme disease will be discussed in the context of this model.
NASA Astrophysics Data System (ADS)
Kawamura, Yumi; Tani, Mai; Hattori, Nozomu; Miyatake, Naomasa; Horita, Masahiro; Ishikawa, Yasuaki; Uraoka, Yukiharu
2012-02-01
We investigated zinc oxide (ZnO) thin films prepared by plasma assisted atomic layer deposition (PA-ALD), and thin-film transistors (TFTs) with the ALD ZnO channel layer for application to next-generation displays. We deposited the ZnO channel layer by PA-ALD at 100 or 300 °C, and fabricated TFTs. The transfer characteristic of the 300 °C-deposited ZnO TFT exhibited high mobility (5.7 cm2 V-1 s-1), although the threshold voltage largely shifted toward the negative (-16 V). Furthermore, we deposited Al2O3 thin film as a gate insulator by PA-ALD at 100 °C for the low-temperature TFT fabrication process. In the case of ZnO TFTs with the Al2O3 gate insulator, the shift of the threshold voltage improved (-0.1 V). This improvement of the negative shift seems to be due to the negative charges of the Al2O3 film deposited by PA-ALD. On the basis of the experimental results, we confirmed that the threshold voltage of ZnO TFTs is controlled by PA-ALD for the deposition of the gate insulator.
The effect of electrostatic and gravity force on offset wire inside tube
NASA Astrophysics Data System (ADS)
Oh, S. H.; Hazineh, D.; Wang, C.
2018-04-01
In a straw-tube detector, a wire that is offset with respect to the tube axis experiences a Coulomb force when high voltage is applied between the anode wire and the tube. This force results in a shifting of the wire and straw, in addition to the gravitational sag, and is a function of the tube and wire radius, initial offset, high voltage, tension and length. The presence of such effects is well known, but the precise magnitude of the shift for the anode wires under conditions of detector operation have not been previously documented with measurable confidence. In this work, we provide the first systematic measurements for the wire shift in straw-tube detectors due to gravity and the electrostatic force using an x-ray scanner developed for the Mu2e experiment. The data are compared to the solutions of the differential equations governing the system, and we find a good match between the two. The solutions can predict the final wire and straw positions from the initial positions measured without the high voltage, and the final wire and straw positions can then be used as an input to the track reconstruction software to improve the track position resolution.
Instability of phosphorous doped SiO2 in 4H-SiC MOS capacitors at high temperatures
NASA Astrophysics Data System (ADS)
Idris, M. I.; Weng, M. H.; Chan, H.-K.; Murphy, A. E.; Clark, D. T.; Young, R. A. R.; Ramsay, E. P.; Wright, N. G.; Horsfall, A. B.
2016-12-01
In this paper, the effect of inclusion of phosphorous (at a concentration below 1%) on the high temperature characteristics (up to 300 °C) of the SiO2/SiC interface is investigated. Capacitance-voltage measurements taken for a range of frequencies have been utilized to extract parameters including flatband voltage, threshold voltage, effective oxide charge, and interface state density. The variation of these parameters with temperature has been investigated for bias sweeps in opposing directions and a comparison made between phosphorous doped and as-grown oxides. At room temperature, the effective oxide charge for SiO2 may be reduced by the phosphorous termination of dangling bonds at the interface. However, at high temperatures, the effective charge in the phosphorous doped oxide remains unstable and effects such as flatband voltage shift and threshold voltage shift dominate the characteristics. The instability in these characteristics was found to result from the trapped charges in the oxide (±1012 cm-3) or near interface traps at the interface of the gate oxide and the semiconductor (1012-1013 cm-2 eV-1). Hence, the performance enhancements observed for phosphorous doped oxides are not realised in devices operated at elevated temperatures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiang, Lanyi; Ying, Jun; Han, Jinhua
2016-04-25
In this letter, we demonstrate a high reliable and stable organic field-effect transistor (OFET) based nonvolatile memory (NVM) with a polymer poly(4-vinyl phenol) (PVP) as the charge trapping layer. In the unipolar OFETs, the inreversible shifts of the turn-on voltage (V{sub on}) and severe degradation of the memory window (ΔV{sub on}) at programming (P) and erasing (E) voltages, respectively, block their application in NVMs. The obstacle is overcome by using a pn-heterojunction as the active layer in the OFET memory, which supplied a holes and electrons accumulating channel at the supplied P and E voltages, respectively. Both holes and electronsmore » transferring from the channels to PVP layer and overwriting the trapped charges with an opposite polarity result in the reliable bidirectional shifts of V{sub on} at P and E voltages, respectively. The heterojunction OFET exhibits excellent nonvolatile memory characteristics, with a large ΔV{sub on} of 8.5 V, desired reading (R) voltage at 0 V, reliable P/R/E/R dynamic endurance over 100 cycles and a long retention time over 10 years.« less
Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke
2011-05-06
Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.
Permeation and gating properties of the L-type calcium channel in mouse pancreatic beta cells
1993-01-01
Ba2+ currents through L-type Ca2+ channels were recorded from cell- attached patches on mouse pancreatic beta cells. In 10 mM Ba2+, single- channel currents were recorded at -70 mV, the beta cell resting membrane potential. This suggests that Ca2+ influx at negative membrane potentials may contribute to the resting intracellular Ca2+ concentration and thus to basal insulin release. Increasing external Ba2+ increased the single-channel current amplitude and shifted the current-voltage relation to more positive potentials. This voltage shift could be modeled by assuming that divalent cations both screen and bind to surface charges located at the channel mouth. The single- channel conductance was related to the bulk Ba2+ concentration by a Langmuir isotherm with a dissociation constant (Kd(gamma)) of 5.5 mM and a maximum single-channel conductance (gamma max) of 22 pS. A closer fit to the data was obtained when the barium concentration at the membrane surface was used (Kd(gamma) = 200 mM and gamma max = 47 pS), which suggests that saturation of the concentration-conductance curve may be due to saturation of the surface Ba2+ concentration. Increasing external Ba2+ also shifted the voltage dependence of ensemble currents to positive potentials, consistent with Ba2+ screening and binding to membrane surface charge associated with gating. Ensemble currents recorded with 10 mM Ca2+ activated at more positive potentials than in 10 mM Ba2+, suggesting that external Ca2+ binds more tightly to membrane surface charge associated with gating. The perforated-patch technique was used to record whole-cell currents flowing through L-type Ca2+ channels. Inward currents in 10 mM Ba2+ had a similar voltage dependence to those recorded at a physiological Ca2+ concentration (2.6 mM). BAY-K 8644 (1 microM) increased the amplitude of the ensemble and whole-cell currents but did not alter their voltage dependence. Our results suggest that the high divalent cation solutions usually used to record single L-type Ca2+ channel activity produce a positive shift in the voltage dependence of activation (approximately 32 mV in 100 mM Ba2+). PMID:7687645
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)<5ms). However, the signal was small (ΔF/F=0.4%/200mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June
2017-01-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition. PMID:29093633
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
ERIC Educational Resources Information Center
Zheltukhina, Marina R.; Vikulova, Larisa G.; Slyshkin, Gennady G.; Vasileva, Ekaterina G.
2016-01-01
The article examines the onomastic aspect of a medieval worldview through the analysis of naming principles for the kings of the Merovingian, the Carolingian and the Wessex dynasties. The etymological, structural and semantic analysis of the first Frankish and Anglo-Saxon kings' names and bynames is used. The etymology of the first Frankish and…
NASA Astrophysics Data System (ADS)
Yücel, Haluk; Budak, Mustafa Guray; Karadag, Mustafa; Yüksel, Alptuğ Özer
2014-11-01
For the applicability of instrumental neutron activation analysis (NAA) technique, an irradiation unit with a 37 GBq 241Am-Be neutron source was installed at Institute of Nuclear Sciences of Ankara University. Design and configuration properties of the irradiation unit are described. It has two different sample irradiation positions, one is called site #1 having a pneumatic sample transfer system and the other is site #2 having a location for manual use. In order to characterize neutron flux spectra in the irradiation sites, the measurement results were obtained for thermal (Vth) and epithermal neutron fluxes (Vepi), thermal to epithermal flux ratio (f) and epithermal spectrum shaping factors (α) by employing cadmium ratios of gold (Au) and molybdenum (Mo) monitors. The activities produced in these foils were measured by using a p-type, 44.8% relative efficiency HPGe well detector. For the measured γ-rays, self-absorption and true coincidence summing effects were taken into account. Additionally, thermal neutron self-shielding and resonance neutron self-shielding effects were taken into account in the measured results. For characterization of site #1, the required parameters were found to be Vth = (2.11 ± 0.05) × 103 n cm-2 s-1, Vepi = (3.32 ± 0.17) × 101 n cm-2 s-1, f = 63.6 ± 1.5, α = 0.045 ± 0.009, respectively. Similarly, those parameters were measured in site #2 as Vth = (1.49 ± 0.04) × 103 n cm-2 s-1, Vepi = (2.93 ± 0.15) × 101 n cm-2 s-1, f = 50.9 ± 1.3 and α = 0.038 ± 0.008. The results for f-values indicate that good thermalization of fast neutrons on the order of 98% was achieved in both sample irradiation sites. This is because an optimum combination of water and paraffin moderator is used in the present configuration. In addition, the shielding requirements are met by using natural boron oxide powder (5.5 cm) and boron loaded paraffin layers against neutrons, and a 15 cm thick lead bricks against gamma-rays from source and its surrounding materials.
Abdelfattah, Ahmed S.; Farhi, Samouil L.; Zhao, Yongxin; Brinks, Daan; Zou, Peng; Ruangkittisakul, Araya; Platisa, Jelena; Pieribone, Vincent A.; Ballanyi, Klaus; Cohen, Adam E.
2016-01-01
Optical imaging of voltage indicators based on green fluorescent proteins (FPs) or archaerhodopsin has emerged as a powerful approach for detecting the activity of many individual neurons with high spatial and temporal resolution. Relative to green FP-based voltage indicators, a bright red-shifted FP-based voltage indicator has the intrinsic advantages of lower phototoxicity, lower autofluorescent background, and compatibility with blue-light-excitable channelrhodopsins. Here, we report a bright red fluorescent voltage indicator (fluorescent indicator for voltage imaging red; FlicR1) with properties that are comparable to the best available green indicators. To develop FlicR1, we used directed protein evolution and rational engineering to screen libraries of thousands of variants. FlicR1 faithfully reports single action potentials (∼3% ΔF/F) and tracks electrically driven voltage oscillations at 100 Hz in dissociated Sprague Dawley rat hippocampal neurons in single trial recordings. Furthermore, FlicR1 can be easily imaged with wide-field fluorescence microscopy. We demonstrate that FlicR1 can be used in conjunction with a blue-shifted channelrhodopsin for all-optical electrophysiology, although blue light photoactivation of the FlicR1 chromophore presents a challenge for applications that require spatially overlapping yellow and blue excitation. SIGNIFICANCE STATEMENT Fluorescent-protein-based voltage indicators enable imaging of the electrical activity of many genetically targeted neurons with high spatial and temporal resolution. Here, we describe the engineering of a bright red fluorescent protein-based voltage indicator designated as FlicR1 (fluorescent indicator for voltage imaging red). FlicR1 has sufficient speed and sensitivity to report single action potentials and voltage fluctuations at frequencies up to 100 Hz in single-trial recordings with wide-field microscopy. Because it is excitable with yellow light, FlicR1 can be used in conjunction with blue-light-activated optogenetic actuators. However, spatially distinct patterns of optogenetic activation and voltage imaging are required to avoid fluorescence artifacts due to photoactivation of the FlicR1 chromophore. PMID:26911693
Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.
Carvalho-de-Souza, Joao L; Bezanilla, Francisco
2018-02-05
Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018 Carvalho-de-Souza and Bezanilla.
NASA Astrophysics Data System (ADS)
Mondal, Sandip
2018-04-01
This experiment demonstrates the electrical behaviors of fully solution processed HfO2(MOS) in presence of different optical illumination. The capacitance voltage measurement was performed at frequency of 100 kHz with a DC gate sweep voltage of ±5V (with additional AC voltage of 100mV) in presence of deep UV (wavelength of 365nm with power of 25W) as well as white light (20W). It is found that there is a large shift in flatband voltage of 120mV due presence of white light during the CV measurement. However there is negligible change in flatband voltage (30mV) has been observed due to illumination of deep UV light.
Multilevel cascade voltage source inverter with seperate DC sources
Peng, Fang Zheng; Lai, Jih-Sheng
1997-01-01
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.
Multilevel cascade voltage source inverter with seperate DC sources
Peng, Fang Zheng; Lai, Jih-Sheng
2002-01-01
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.
Multilevel cascade voltage source inverter with seperate DC sources
Peng, Fang Zheng; Lai, Jih-Sheng
2001-04-03
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.
Multilevel cascade voltage source inverter with separate DC sources
Peng, F.Z.; Lai, J.S.
1997-06-24
A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations. 15 figs.
NASA Astrophysics Data System (ADS)
Mahata, C.; Bera, M. K.; Bose, P. K.; Maiti, C. K.
2009-02-01
Internal photoemission and magnetic resonance studies have been performed to investigate the charge trapping behavior and chemical nature of defects in ultrathin (~14 nm) high-k ZrO2 dielectric films deposited on p-Ge (1 0 0) substrates at low temperature (<200 °C) by plasma-enhanced chemical vapor deposition (PECVD) in a microwave (700 W, 2.45 GHz) plasma at a pressure of ~65 Pa. Both the band and defect-related electron states have been characterized using electron paramagnetic resonance, internal photoemission, capacitance-voltage and current-voltage measurements under UV illumination. Capacitance-voltage and photocurrent-voltage measurements were used to determine the centroid of oxide charge within the high-k gate stack. The observed shifts in photocurrent response of the Al/ZrO2/GeO2/p-Ge metal-insulator-semiconductor (MIS) capacitors indicate the location of the centroids to be within the ZrO2 dielectric near to the gate electrode. Moreover, the measured flat band voltage and photocurrent shifts also indicate a large density of traps in the dielectric. The impact of plasma nitridation on the interfacial quality of the oxides has been investigated. Different N sources, such as NO and NH3, have been used for nitrogen engineering. Oxynitride samples show a lower defect density and trapping over the non-nitrided samples. The charge trapping and detrapping properties of MIS capacitors under stressing in constant current and voltage modes have been investigated in detail.
Perchlorate enhances transmission in skeletal muscle excitation- contraction coupling
1993-01-01
The effects of the anion perchlorate (present extracellularly at 8 mM) were studied on functional skeletal muscle fibers from Rana pipiens, voltage-clamped in a Vaseline gap chamber. Established methods were used to monitor intramembranous charge movement and flux of Ca release from the sarcoplasmic reticulum (SR) during pulse depolarization. Saponin permeabilization of the end portions of the fiber segment (Irving, M., J. Maylie, N. L. Sizto, and W. K. Chandler. 1987. Journal of General Physiology. 89:1-41) substantially reduced the amount of charge moving during conventional control pulses, thus minimizing a technical error that plagued our previous studies. Perchlorate prolonged the ON time course of charge movement, especially at low and intermediate voltages. The OFFs were also made slower, the time constant increasing twofold. The hump kinetic component was exaggerated by ClO4- or was made to appear in fibers that did not have it in reference conditions. ClO4- had essentially no kinetic ON effects at high voltages (> or = 10 mV). ClO4- changed the voltage distribution of mobile charge. In single Boltzmann fits, the midpoint potential V was shifted -20 mV and the steepness parameter K was reduced by 4.7 mV (or 1.78-fold), but the maximum charge was unchanged (n = 9). Total Ca content in the SR, estimated using the method of Schneider et al. (Schneider, M. F., B. J. Simon, and G. Szucs. 1987. Journal of Physiology. 392:167-192) for correcting for depletion, stayed constant over tens of minutes in reference conditions but decayed in ClO4- at an average rate of 0.3 mumol/liter myoplasmic water per s. ClO4- changed the kinetics of release flux, reducing the fractional inactivation of release after the peak. ClO4- shifted the voltage dependence of Ca release flux. In particular, the threshold voltage for Ca release was shifted by about -20 mV, and the activation of the steady component of release flux was shifted by > 20 mV in the negative direction. The shift of release activation was greater than that of mobile charge. Thus the threshold charge, defined as the minimum charge moved for eliciting a detectable Ca transient, was reduced from 6 nC/microF (0.55, n = 7) to 3.4 (0.53). The average of the paired differences was 2.8 (0.33, P < 0.01). The effects of ClO4- were then studied in fibers in modified functional situations. Depletion of Ca in the SR, achieved by high frequency pulsing in the presence of intracellular BAPTA and EGTA, simplified but did not eliminate the effects of ClO4-.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8245817
Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg
2014-04-01
Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages without affecting QON-V. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Temporal differentiation of pH-dependent capacitive current from dopamine.
Yoshimi, Kenji; Weitemier, Adam
2014-09-02
Voltammetric recording of dopamine (DA) with fast-scan cyclic voltammetry (FSCV) on carbon fiber microelectrodes have been widely used, because of its high sensitivity to dopamine. However, since an electric double layer on a carbon fiber surface in a physiological ionic solution behaves as a capacitor, fast voltage manipulation in FSCV induces large capacitive current. The faradic current from oxidation/reduction of target chemicals must be extracted from this large background current. It is known that ionic shifts, including H(+), influence this capacitance, and pH shift can cause confounding influences on the FSCV recordings within a wide range of voltage. Besides FSCV with a triangular waveform, we have been using rectangular pulse voltammetry (RPV) for dopamine detection in the brain. In this method, the onset of a single pulse causes a large capacitive current, but unlike FSCV, the capacitive current is restricted to a narrow temporal window of just after pulse onset (<5 ms). In contrast, the peak of faradic current from dopamine oxidation occurs after a delay of more than a few milliseconds. Taking advantage of the temporal difference, we show that RPV could distinguish dopamine from pH shifts clearly and easily. In addition, the early onset current was useful to evaluate pH shifts. The narrow voltage window of our RPV pulse allowed a clear differentiation of dopamine and serotonin (5-HT), as we have shown previously. Additional recording with RPV, alongside FSCV, would improve identification of chemicals such as dopamine, pH, and 5-HT.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurishima, Kazunori, E-mail: ce41034@meiji.ac.jp; Nabatame, Toshihide, E-mail: NABATAME.Toshihide@nims.go.jp; Shimizu, Maki
To investigate the influence of ionic/covalent interface of Al{sub 2}O{sub 3}/SiO{sub 2} gate insulator on the electrical properties of thin-film transistors (TFTs) with ionic Ga-In-Zn-O (GIZO) semiconducting channel layers, Al{sub 2}O{sub 3} layers of different thickness were introduced between SiO{sub 2} and GIZO using plasma-enhanced atomic layer deposition. The GIZO layers were obtained by DC magnetron sputtering using a GIZO target (Ga:In:Zn = 1:1:1 mol. %). The GIZO TFTs with an Al{sub 2}O{sub 3}/SiO{sub 2} gate insulator exhibited positive threshold voltage (V{sub th}) shift (about 1.1 V), V{sub th} hysteresis suppression (0.23 V), and electron mobility degradation (about 13%) compared with thosemore » of a GIZO TFT with SiO{sub 2} gate insulator by the influence of ionic/ionic and ionic/covalent interface at Al{sub 2}O{sub 3}/GIZO and Al{sub 2}O{sub 3}/SiO{sub 2}, respectively. To clarify the origin of the positive V{sub th} shift, the authors estimated the shifts of flatband voltage (0.4 V) due to the dipole and the fixed charge (−1.1 × 10{sup 11}/cm{sup 2}) at Al{sub 2}O{sub 3}/SiO{sub 2} interface, from capacitance–voltage data for Pt/Al{sub 2}O{sub 3}/SiO{sub 2}/p-Si capacitors. Based on these experimental data, the authors found that the positive V{sub th} shift (1.1 V) could be divided into three components: the dipole (−0.4 V) and fixed charge (0.15 V) at the SiO{sub 2}/Al{sub 2}O{sub 3} interface, and the fixed charge (1.35 V) at the Al{sub 2}O{sub 3}/GIZO interface. Finally, it is noted that heterointerface of SiO{sub 2}/Al{sub 2}O{sub 3}/GIZO stacks is important not only to recognize mechanism of V{sub th} shift but also to design future TFTs with high-k dielectrics and low operating voltage.« less
Pathogenic plasticity of Kv7.2/3 channel activity is essential for the induction of tinnitus.
Li, Shuang; Choi, Veronica; Tzounopoulos, Thanos
2013-06-11
Tinnitus, the perception of phantom sound, is often a debilitating condition that affects many millions of people. Little is known, however, about the molecules that participate in the induction of tinnitus. In brain slices containing the dorsal cochlear nucleus, we reveal a tinnitus-specific increase in the spontaneous firing rate of principal neurons (hyperactivity). This hyperactivity is observed only in noise-exposed mice that develop tinnitus and only in the dorsal cochlear nucleus regions that are sensitive to high frequency sounds. We show that a reduction in Kv7.2/3 channel activity is essential for tinnitus induction and for the tinnitus-specific hyperactivity. This reduction is due to a shift in the voltage dependence of Kv7 channel activation to more positive voltages. Our in vivo studies demonstrate that a pharmacological manipulation that shifts the voltage dependence of Kv7 to more negative voltages prevents the development of tinnitus. Together, our studies provide an important link between the biophysical properties of the Kv7 channel and the generation of tinnitus. Moreover, our findings point to previously unknown biological targets for designing therapeutic drugs that may prevent the development of tinnitus in humans.
New design of a passive type RADFET reader for enhanced sensitivity
NASA Astrophysics Data System (ADS)
Lee, Dae-Hee
2016-07-01
We present a new design of a passive type RADFET reader with enhanced radiation sensitivity. Using a electostatic plate, we have applied a static electric field to the gate voltage, which impacts a positive biasing on the p-type MOSFET. The resultant effect shows that 1.8 times of radiation sensitivity increased when we measured the threshold voltage shift of the RADFET exposed to 30 krad irradiation. We discuss further about the characteristic changes of a RADFET according to the positive biasing on the gate voltage.
Tandon, Shishir; Mittal, Ashutosh K; Pant, A K
2008-06-01
Essential oils of Vitex trifolia and Vitex agnus-castus were evaluated against Vth instar larvae of Spilosoma obliqua, when applied topically on the dorsal side of mesothoracic region, for insect growth regulatory activity. This treatment caused extended larval period and pupal period, increase in larval mortality and adult deformity and decrease in adult emergence, fecundity of female and egg fertility of test insect.
Association between the electromyographic fatigue threshold and ventilatory threshold.
Camata, T V; Lacerda, T R; Altimari, L R; Bortolloti, H; Fontes, E B; Dantas, J L; Nakamura, F Y; Abrão, T; Chacon-Mikahil, M P T; Moraes, A C
2009-01-01
The objective of this study is to verify the coincidence between the occurrence of the electromyographic fatigue threshold (EMGth) and the ventilatory threshold (Vth) in an incremental test in the cyclosimulator, as well as to compare the calculation of the RMS from the EMG signal using different time windows. Thirteen male cyclists (73.7 +/- 12.4 kg and 174.3 +/- 6.2 cm) performed a ramp incremental test (TI) in a cyclosimulator until voluntary exhaustion. Before the start of each TI subjects had the active bipolar electrodes placed over the superficial muscles of the quadriceps femoris (QF) of the right leg: rectus femoris (RF), vastus medialis (VM) and vastus lateralis (VL). The paired student's t test, pearson's correlation coefficient and the analysis method described by Bland and Altman for the determination of the concordance level were used for statistical analysis. The significance level adopted was P < 0.05. Although no significant differences were found between Vth and the EMGth calculated from windows of 2, 5, 10, 30 and 60 seconds in the studied muscles, it is suggested that the EMGth values determined from the calculation of the RMS curve with windows of 5 and 10 seconds seem to be more appropriate for the calculation of the RMS curve and determination of EMGth from visual inspection.
NASA Astrophysics Data System (ADS)
Ian, Ka Wa; Zawawiand, Mohamad Adzhar Md; Missous, Mohamed
2014-03-01
This work described the fabrication and performances of strained channel In0.52Al0.47As/In0.7Ga0.3As/InP pHEMTs with thermally evaporated Pd/Ti/Au gate metallization. The electrical characteristics of these Pd-gate devices are studied to investigate the effects of changing the Pd metal thickness, annealing temperature and annealing time. Following annealing at 200 °C for 35 min, a 10 nm Pd-gate device displays a VTH of -0.25 V, which is significantly smaller compared to those with Ti/Au gate schemes showing VTH = -0.75 V. A 1 um gate length device exhibits an improved Gm of 580 mS mm-1 (from 500 mS mm-1), a high IDSmax of 400 mA mm-1 (from 330 mA mm-1) and good fT and fmax of 24.5 and 49 GHz commensurate with the 1 µm gate length. All these enhancements are attributed to the controllable gate sinking of Pd. The device shows no significant degradation even after annealing at 230 °C for more than 5 h, which implies that the reliability of these Pd-gate structures is excellent.
Temporal and voltage stress stability of high performance indium-zinc-oxide thin film transistors
NASA Astrophysics Data System (ADS)
Song, Yang; Katsman, Alexander; Butcher, Amy L.; Paine, David C.; Zaslavsky, Alexander
2017-10-01
Thin film transistors (TFTs) based on transparent oxide semiconductors, such as indium zinc oxide (IZO), are of interest due to their improved characteristics compared to traditional a-Si TFTs. Previously, we reported on top-gated IZO TFTs with an in-situ formed HfO2 gate insulator and IZO active channel, showing high performance: on/off ratio of ∼107, threshold voltage VT near zero, extracted low-field mobility μ0 = 95 cm2/V·s, and near-perfect subthreshold slope at 62 mV/decade. Since device stability is essential for technological applications, in this paper we report on the temporal and voltage stress stability of IZO TFTs. Our devices exhibit a small negative VT shift as they age, consistent with an increasing carrier density resulting from an increasing oxygen vacancy concentration in the channel. Under gate bias stress, freshly annealed TFTs show a negative VT shift during negative VG gate bias stress, while aged (>1 week) TFTs show a positive VT shift during negative VG stress. This indicates two competing mechanisms, which we identify as the field-enhanced generation of oxygen vacancies and the field-assisted migration of oxygen vacancies, respectively. A simplified kinetic model of the vacancy concentration evolution in the IZO channel under electrical stress is provided.
Carvacrol modulates voltage-gated sodium channels kinetics in dorsal root ganglia.
Joca, Humberto Cavalcante; Vieira, Daiana Cardoso Oliveira; Vasconcelos, Aliny Perreira; Araújo, Demetrius Antônio Machado; Cruz, Jader Santos
2015-06-05
Recent studies have shown that many of plant-derived compounds interact with specific ion channels and thereby modulate many sensing mechanisms, such as nociception. The monoterpenoid carvacrol (5-isopropyl-2-methylphenol) has an anti-nociceptive effect related to a reduction in neuronal excitability and voltage-gated Na(+) channels (NaV) inhibition in peripheral neurons. However, the detailed mechanisms of carvacrol-induced inhibition of neuronal NaV remain elusive. This study explores the interaction between carvacrol and NaV in isolated dorsal root ganglia neurons. Carvacrol reduced the total voltage-gated Na(+) current and tetrodotoxin-resistant (TTX-R) Na(+) current component in a concentration-dependent manner. Carvacrol accelerates current inactivation and induced a negative-shift in voltage-dependence of steady-state fast inactivation in total and TTX-R Na(+) current. Furthermore, carvacrol slowed the recovery from inactivation. Carvacrol provoked a leftward shift in both the voltage-dependence of steady-state inactivation and activation of the TTX-R Na(+) current component. In addition, carvacrol-induced inhibition of TTX-R Na(+) current was enhanced by an increase in stimulation frequency and when neurons were pre-conditioned with long depolarization pulse (5s at -50 mV). Taken all results together, we herein demonstrated that carvacrol affects NaV gating properties. The present findings would help to explain the mechanisms underlying the analgesic activity of carvacrol. Copyright © 2015 Elsevier B.V. All rights reserved.
Breakdown in helium in high-voltage open discharge with subnanosecond current front rise
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schweigert, I. V., E-mail: ischweig@itam.nsc.ru; Alexandrov, A. L.; Bokhan, P. A.
Investigations of high-voltage open discharge in helium have shown a possibility of generation of current pulses with subnanosecond front rise, due to ultra-fast breakdown development. The open discharge is ignited between two planar cathodes with mesh anode in the middle between them. For gas pressure 6 Torr and 20 kV applied voltage, the rate of current rise reaches 500 A/(cm{sup 2} ns) for current density 200 A/cm{sup 2} and more. The time of breakdown development was measured for different helium pressures and a kinetic model of breakdown in open discharge is presented, based on elementary reactions for electrons, ions andmore » fast atoms. The model also includes various cathode emission processes due to cathode bombardment by ions, fast atoms, electrons and photons of resonant radiation with Doppler shift of frequency. It is shown, that the dominating emission processes depend on the evolution of the discharge voltage during the breakdown. In the simulations, two cases of voltage behavior were considered: (i) the voltage is kept constant during the breakdown; (ii) the voltage is reduced with the growth of current. For the first case, the exponentially growing current is maintained due to photoemission by the resonant photons with Doppler-shifted frequency. For the second case, the dominating factor of current growth is the secondary electron emission. In both cases, the subnanosecond rise of discharge current was obtained. Also the effect of gas pressure on breakdown development was considered. It was found that for 20 Torr gas pressure the time of current rise decreases to 0.1 ns, which is in agreement with experimental data.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bean, Bruce Palmer
The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in themore » hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.« less
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred
2016-01-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857
Welding Experiments of Aluminum Alloy by Space GHTA Welding at ISS Orbital Pressure
NASA Astrophysics Data System (ADS)
Suita, Yoshikazu; Takai, Daisuke; Sugiyama, Satoshi; Terajima, Noboru; Tsukuda, Yoshiyuki; Fujisawa, Shoichiro; Imagawa, Kichiro
As a feasible welding method in space, the authors previously proposed the space GHTA (Gas Hollow Tungsten Arc) welding process. However, space GHTA welding with a high-frequency device for arc start may cause electromagnetic noise problems for the computer equipment placed on the ISS (International Space Station). Therefore, in this report, welding experiments of space GHTA welding using aluminum alloy with a high-voltage DC device for arc start were carried out at the ISS orbital pressure, 10-5 Pa. It is clear from the experiments using a high-voltage DC device in a high-vacuum condition, that there is a shifting phenomenon in which the spark discharge shifts to either a glow discharge or an arc discharge when starting the arc. Welding projects in space need an arc discharge, so we investigated the effects of welding parameters on the arc formation ratio. As a result, space GHTA welding with a high-voltage DC device can be used for arc start when welding at the ISS orbital pressure.
Apparatus and method for monitoring the presence of a conductive media
DuVall, Bruce W.; Valentine, James W.; Morey, Kenneth O.
1979-01-01
An inductive level sensor has inductively coupled primary and secondary windings. Circuitry drives the primary with an AC signal of constant current magnitude and selected frequency f to induce in the secondary, a voltage signal V of magnitude .vertline.V.vertline., frequency f and phase difference .phi. from the driving signal. Circuitry operates to generate a voltage output signal proportional to .vertline.V.vertline. cos (.phi.-.theta.), where .theta. is a selectively set phase shift factor. By properly and selectively adjusting the frequency f and phase shift factor .theta., an output signal .vertline.V.vertline. cos (.phi.-.theta.) can be provided which self-compensates for changes in mutual inductance caused by operating temperature variations so that an output signal is produced which is substantially linearly proportional to changes in the level of a pool of liquid metal being monitored. Disclosed also is calibration circuitry and circuitry for converting the voltage signal .vertline.V.vertline. cos (.phi.-.theta.) into a current signal.
Colcombet, Jean; Lelièvre, Françoise; Thomine, Sébastien; Barbier-Brygoo, Hélène; Frachisse, Jean-Marie
2005-07-01
Variations in both intracellular and extracellular pH are known to be involved in a wealth of physiological responses. Using the patch-clamp technique on Arabidopsis hypocotyl cells, it is shown that rapid-type and slow-type anion channels at the plasma membrane are both regulated by pH via distinct mechanisms. Modifications of pH modulate the voltage-dependent gating of the rapid channel. While intracellular alkalinization facilitates channel activation by shifting the voltage gate towards negative potentials, extracellular alkalinization shifts the activation threshold to more positive potentials, away from physiological resting membrane potentials. By contrast, pH modulates slow anion channel activity in a voltage-independent manner. Intracellular acidification and extracellular alkalinization increase slow anion channel currents. The possible role of these distinct modulations in physiological processes involving anion efflux and modulation of extracellular and/or intracellular pH, such as elicitor and ABA signalling, are discussed.
External protons destabilize the activated voltage sensor in hERG channels.
Shi, Yu Patrick; Cheng, Yen May; Van Slyke, Aaron C; Claydon, Tom W
2014-03-01
Extracellular acidosis shifts hERG channel activation to more depolarized potentials and accelerates channel deactivation; however, the mechanisms underlying these effects are unclear. External divalent cations, e.g., Ca(2+) and Cd(2+), mimic these effects and coordinate within a metal ion binding pocket composed of three acidic residues in hERG: D456 and D460 in S2 and D509 in S3. A common mechanism may underlie divalent cation and proton effects on hERG gating. Using two-electrode voltage clamp, we show proton sensitivity of hERG channel activation (pKa = 5.6), but not deactivation, was greatly reduced in the presence of Cd(2+) (0.1 mM), suggesting a common binding site for the Cd(2+) and proton effect on activation and separable effects of protons on activation and deactivation. Mutational analysis confirmed that D509 plays a critical role in the pH dependence of activation, as shown previously, and that cooperative actions involving D456 and D460 are also required. Importantly, neutralization of all three acidic residues abolished the proton-induced shift of activation, suggesting that the metal ion binding pocket alone accounts for the effects of protons on hERG channel activation. Voltage-clamp fluorimetry measurements demonstrated that protons shifted the voltage dependence of S4 movement to more depolarized potentials. The data indicate a site and mechanism of action for protons on hERG activation gating; protonation of D456, D460 and D509 disrupts interactions between these residues and S4 gating charges to destabilize the activated configuration of S4.
Anode reactive bleed and injector shift control strategy
Cai, Jun [Rochester, NY; Chowdhury, Akbar [Pittsford, NY; Lerner, Seth E [Honeoye Falls, NY; Marley, William S [Rush, NY; Savage, David R [Rochester, NY; Leary, James K [Rochester, NY
2012-01-03
A system and method for correcting a large fuel cell voltage spread for a split sub-stack fuel cell system. The system includes a hydrogen source that provides hydrogen to each split sub-stack and bleed valves for bleeding the anode side of the sub-stacks. The system also includes a voltage measuring device for measuring the voltage of each cell in the split sub-stacks. The system provides two levels for correcting a large stack voltage spread problem. The first level includes sending fresh hydrogen to the weak sub-stack well before a normal reactive bleed would occur, and the second level includes sending fresh hydrogen to the weak sub-stack and opening the bleed valve of the other sub-stack when the cell voltage spread is close to stack failure.
Membrane permeable local anesthetics modulate NaV1.5 mechanosensitivity
Beyder, Arthur; Strege, Peter R.; Bernard, Cheryl; Farrugia, Gianrico
2012-01-01
Voltage-gated sodium selective ion channel NaV1.5 is expressed in the heart and the gastrointestinal tract, which are mechanically active organs. NaV1.5 is mechanosensitive at stimuli that gate other mechanosensitive ion channels. Local anesthetic and antiarrhythmic drugs act upon NaV1.5 to modulate activity by multiple mechanisms. This study examined whether NaV1.5 mechanosensitivity is modulated by local anesthetics. NaV1.5 channels wereexpressed in HEK-293 cells, and mechanosensitivity was tested in cell-attached and excised inside-out configurations. Using a novel protocol with paired voltage ladders and short pressure pulses, negative patch pressure (-30 mmHg) in both configurations produced a hyperpolarizing shift in the half-point of the voltage-dependence of activation (V1/2a) and inactivation (V1/2i) by about -10 mV. Lidocaine (50 µM) inhibited the pressure-induced shift of V1/2a but not V1/2i. Lidocaine inhibited the tonic increase in pressure-induced peak current in a use-dependence protocol, but it did not otherwise affect use-dependent block. The local anesthetic benzocaine, which does not show use-dependent block, also effectively blocked a pressure-induced shift in V1/2a. Lidocaine inhibited mechanosensitivity in NaV1.5 at the local anesthetic binding site mutated (F1760A). However, a membrane impermeable lidocaine analog QX-314 did not affect mechanosensitivity of F1760A NaV1.5 when applied from either side of the membrane. These data suggest that the mechanism of lidocaine inhibition of the pressure-induced shift in the half-point of voltage-dependence of activation is separate from the mechanisms of use-dependent block. Modulation of NaV1.5 mechanosensitivity by the membrane permeable local anesthetics may require hydrophobic access and may involve membrane-protein interactions. PMID:22874086
Electro-optic voltage sensor for sensing voltage in an E-field
Woods, G.K.; Renak, T.W.
1999-04-06
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 18 figs.
Electro-optic voltage sensor for sensing voltage in an E-field
Woods, Gregory K.; Renak, Todd W.
1999-01-01
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.
Voltage-Clamp Studies on Uterine Smooth Muscle
Anderson, Nels C.
1969-01-01
These studies have developed and tested an experimental approach to the study of membrane ionic conductance mechanisms in strips of uterine smooth muscle. The experimental and theoretical basis for applying the double sucrose-gap technique is described along with the limitations of this system. Nonpropagating membrane action potentials were produced in response to depolarizing current pulses under current-clamp conditions. The stepwise change of membrane potential under voltage-clamp conditions resulted in a family of ionic currents with voltage- and time-dependent characteristics. In sodium-free solution the peak transient current decreased and its equilibrium potential shifted along the voltage axis toward a more negative internal potential. These studies indicate a sodium-dependent, regenerative excitation mechanism. PMID:5796366
Crebanine inhibits voltage-dependent Na+ current in guinea-pig ventricular myocytes.
Xiao-Shan, He; Qing, Lin; Yun-Shu, Ma; Ze-Pu, Yu
2014-01-01
To study the effects of crebanine on voltage-gated Na(+) channels in cardiac tissues. Single ventricular myocytes were enzymatically dissociated from adult guinea-pig heart. Voltage-dependent Na(+) current was recorded using the whole cell voltage-clamp technique. Crebanine reversibly inhibited Na(+) current with an IC50 value of 0.283 mmol·L(-1) (95% confidence range: 0.248-0.318 mmol·L(-1)). Crebanine at 0.262 mmol·L(-1) caused a negative shift (about 12 mV) in the voltage-dependence of steady-state inactivation of Na(+) current, and retarded its recovery from inactivation, but did not affect its activation curve. In addition to blocking other voltage-gated ion channels, crebanine blocked Na(+) channels in guinea-pig ventricular myocytes. Crebanine acted as an inactivation stabilizer of Na(+) channels in cardiac tissues. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Voltage and frequency dependence of prestin-associated charge transfer
Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.
2009-01-01
Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917
Rotstein, Horacio G
2014-01-01
We investigate the dynamic mechanisms of generation of subthreshold and phase resonance in two-dimensional linear and linearized biophysical (conductance-based) models, and we extend our analysis to account for the effect of simple, but not necessarily weak, types of nonlinearities. Subthreshold resonance refers to the ability of neurons to exhibit a peak in their voltage amplitude response to oscillatory input currents at a preferred non-zero (resonant) frequency. Phase-resonance refers to the ability of neurons to exhibit a zero-phase (or zero-phase-shift) response to oscillatory input currents at a non-zero (phase-resonant) frequency. We adapt the classical phase-plane analysis approach to account for the dynamic effects of oscillatory inputs and develop a tool, the envelope-plane diagrams, that captures the role that conductances and time scales play in amplifying the voltage response at the resonant frequency band as compared to smaller and larger frequencies. We use envelope-plane diagrams in our analysis. We explain why the resonance phenomena do not necessarily arise from the presence of imaginary eigenvalues at rest, but rather they emerge from the interplay of the intrinsic and input time scales. We further explain why an increase in the time-scale separation causes an amplification of the voltage response in addition to shifting the resonant and phase-resonant frequencies. This is of fundamental importance for neural models since neurons typically exhibit a strong separation of time scales. We extend this approach to explain the effects of nonlinearities on both resonance and phase-resonance. We demonstrate that nonlinearities in the voltage equation cause amplifications of the voltage response and shifts in the resonant and phase-resonant frequencies that are not predicted by the corresponding linearized model. The differences between the nonlinear response and the linear prediction increase with increasing levels of the time scale separation between the voltage and the gating variable, and they almost disappear when both equations evolve at comparable rates. In contrast, voltage responses are almost insensitive to nonlinearities located in the gating variable equation. The method we develop provides a framework for the investigation of the preferred frequency responses in three-dimensional and nonlinear neuronal models as well as simple models of coupled neurons.
NASA Astrophysics Data System (ADS)
Yao, Rihui; Zheng, Zeke; Xiong, Mei; Zhang, Xiaochen; Li, Xiaoqing; Ning, Honglong; Fang, Zhiqiang; Xie, Weiguang; Lu, Xubing; Peng, Junbiao
2018-03-01
In this work, low temperature fabrication of a sputtered high-k HfO2 gate dielectric for flexible a-IGZO thin film transistors (TFTs) on polyimide substrates was investigated. The effects of Ar-pressure during the sputtering process and then especially the post-annealing treatments at low temperature (≤200 °C) for HfO2 on reducing the density of defects in the bulk and on the surface were systematically studied. X-ray reflectivity, UV-vis and X-ray photoelectron spectroscopy, and micro-wave photoconductivity decay measurements were carried out and indicated that the high quality of optimized HfO2 film and its high dielectric properties contributed to the low concentration of structural defects and shallow localized defects such as oxygen vacancies. As a result, the well-structured HfO2 gate dielectric exhibited a high density of 9.7 g/cm3, a high dielectric constant of 28.5, a wide optical bandgap of 4.75 eV, and relatively low leakage current. The corresponding flexible a-IGZO TFT on polyimide exhibited an optimal device performance with a saturation mobility of 10.3 cm2 V-1 s-1, an Ion/Ioff ratio of 4.3 × 107, a SS value of 0.28 V dec-1, and a threshold voltage (Vth) of 1.1 V, as well as favorable stability under NBS/PBS gate bias and bending stress.
Kilian, Daniel; Polster, Sebastian; Vogeler, Isabell; Jank, Michael P M; Frey, Lothar; Peukert, Wolfgang
2014-08-13
Indium-zinc oxide (IZO) films were deposited via flame spray pyrolysis (FSP) by pulsewise shooting a Si/SiO2 substrate directly into the combustion area of the flame. Based on UV-vis measurements of thin-films deposited on glass substrates, the optimal deposition parameters with respect to low haze values and film thicknesses of around 100 nm were determined. Thermal annealing of the deposited films at temperatures between 300 and 700 °C was carried out and staggered bottom gate thin-film transistors (TFT) were fabricated. The thin films were investigated by scanning electron microscopy, atomic force microscopy, X-ray diffraction, Fourier transformed infrared spectroscopy, and room-temperature photoluminescence measurements. The outcome of these investigations lead to two major requirements in order to implement a working TFT: (i) organic residues from the deposition process need to be removed and (ii) the net free charge carrier concentration has to be minimized by controlling the trap states in the semiconductor. The optimal annealing temperature was 300 °C as both requirements are fulfilled best in this case. This leads to field effect transistors with a low hysteresis, a saturation mobility of μSat = 0.1 cm(2)/(V s), a threshold voltage of Vth = -18.9 V, and an Ion/Ioff ratio on the order of 10(7). Depending on thermal treatment, the defect density changes significantly strongly influencing the transfer characteristics of the device.
Qian, Qingkai; Li, Baikui; Hua, Mengyuan; Zhang, Zhaofu; Lan, Feifei; Xu, Yongkuan; Yan, Ruyue; Chen, Kevin J
2016-06-09
Transistors based on MoS2 and other TMDs have been widely studied. The dangling-bond free surface of MoS2 has made the deposition of high-quality high-k dielectrics on MoS2 a challenge. The resulted transistors often suffer from the threshold voltage instability induced by the high density traps near MoS2/dielectric interface or inside the gate dielectric, which is detrimental for the practical applications of MoS2 metal-oxide-semiconductor field-effect transistor (MOSFET). In this work, by using AlN deposited by plasma enhanced atomic layer deposition (PEALD) as an interfacial layer, top-gate dielectrics as thin as 6 nm for single-layer MoS2 transistors are demonstrated. The AlN interfacial layer not only promotes the conformal deposition of high-quality Al2O3 on the dangling-bond free MoS2, but also greatly enhances the electrical stability of the MoS2 transistors. Very small hysteresis (ΔVth) is observed even at large gate biases and high temperatures. The transistor also exhibits a low level of flicker noise, which clearly originates from the Hooge mobility fluctuation instead of the carrier number fluctuation. The observed superior electrical stability of MoS2 transistor is attributed to the low border trap density of the AlN interfacial layer, as well as the small gate leakage and high dielectric strength of AlN/Al2O3 dielectric stack.
NASA Astrophysics Data System (ADS)
Hossain Chowdhury, Md Delwar; Migliorato, Piero; Jang, Jin
2013-04-01
We have investigated the temperature dependence of negative bias under illumination stress and recovery. The transfer characteristics exhibits a non-rigid shift towards negative gate voltages. For both stress and recovery, the voltage shift in deep depletion is twice that in accumulation. The results support the mechanism we previously proposed, which is creation and annealing of a double donor, likely to be an oxygen vacancy. The time dependence of stress and recovery can be fitted to stretched exponentials. Both processes are thermally activated with activation energies 1.06 eV and 1.25 eV for stress and recovery, respectively. A potential energy diagram is proposed to explain the results.
Triple voltage dc-to-dc converter and method
Su, Gui-Jia
2008-08-05
A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.
Ri, Y; Ballesteros, J A; Abrams, C K; Oh, S; Verselis, V K; Weinstein, H; Bargiello, T A
1999-01-01
We have explored the role of a proline residue located at position 87 in the second transmembrane segment (TM2) of gap junctions in the mechanism of voltage-dependent gating of connexin32 (Cx32). Substitution of this proline (denoted Cx32P87) with residues G, A, or V affects channel function in a progressive manner consistent with the expectation that a proline kink (PK) motif exists in the second transmembrane segment (TM2) of this connexin. Mutations of the preceding threonine residue T86 to S, A, C, V, N, or L shift the conductance-voltage relation of wild-type Cx32, such that the mutated channels close at smaller transjunctional voltages. The observed shift in voltage dependence is consistent with a reduction in the open probability of the mutant hemichannels at a transjunctional voltage (Vj) of 0 mV. In both cases in which kinetics were examined, the time constants for reaching steady state were faster for T86N and T86A than for wild type at comparable voltages, suggesting that the T86 mutations cause the energetic destabilization of the open state relative to the other states of the channel protein. The structural underpinnings of the observed effects were explored with Monte Carlo simulations. The conformational space of TM2 helices was found to differ for the T86A, V, N, and L mutants, which produce a less bent helix ( approximately 20 degrees bend angle) compared to the wild type, which has a approximately 37 degrees bend angle. The greater bend angle of the wild-type helix reflects the propensity of the T86 residue to hydrogen bond with the backbone carbonyl of amino acid residue I82. The relative differences in propensity for hydrogen bonding of the mutants relative to the wild-type threonine residue in the constructs we studied (T86A, V, N, L, S, and C) correlate with the shift in the conductance-voltage relation observed for T86 mutations. The data are consistent with a structural model in which the open conformation of the Cx32 channel corresponds to a more bent TM2 helix, and the closed conformation corresponds to a less bent helix. We propose that the modulation of the hydrogen-bonding potential of the T86 residue alters the bend angle of the PK motif and mediates conformational changes between open and closed channel states. PMID:10354417
Electro-optical voltage sensor head
Woods, Gregory K.
1998-01-01
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.
Electro-optical voltage sensor head
Woods, G.K.
1998-03-24
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 6 figs.
Nonlinear focal shift beyond the geometrical focus in moderately focused acoustic beams.
Camarena, Francisco; Adrián-Martínez, Silvia; Jiménez, Noé; Sánchez-Morcillo, Víctor
2013-08-01
The phenomenon of the displacement of the position along the axis of the pressure, intensity, and radiation force maxima of focused acoustic beams under increasing driving voltages (nonlinear focal shift) is studied for the case of a moderately focused beam. The theoretical and experimental results show the existence of this shift along the axis when the initial pressure in the transducer increases until the acoustic field reaches the fully developed nonlinear regime of propagation. Experimental data show that at high amplitudes and for moderate focusing, the position of the on-axis pressure maximum and radiation force maximum can surpass the geometrical focal length. On the contrary, the on-axis pressure minimum approaches the transducer under increasing driving voltages, increasing the distance between the positive and negative peak pressure in the beam. These results are in agreement with numerical KZK model predictions and the existed data of other authors and can be explained according to the effect of self-refraction characteristic of the nonlinear regime of propagation.
NASA Astrophysics Data System (ADS)
Makov, Y. N.; Espinosa, V.; Sánchez-Morcillo, V. J.; Ramis, J.; Cruañes, J.; Camarena, F.
2006-05-01
On the basis of theoretical concepts, an accurate and complete experimental and numerical examination of the on-axis distribution and the corresponding temporal profiles for low-Fresnel-number focused ultrasound beams under increasing transducer input voltage has been performed. For a real focusing transducer with sufficiently small Fresnel number, a strong initial (linear) shift of the main on-axis pressure maximum from geometrical focal point towards the transducer, and its following displacement towards the focal point and backward motion as the driving transducer voltage increase until highly nonlinear regimes were fixed. The simultaneous monitoring of the temporal waveform modifications determines the real roles and interplay between different nonlinear effects (refraction and attenuation) in the observed dynamics of on-axis pressure maximum. The experimental results are in good agreement with numerical solutions of KZK equation, confirming that the observed dynamic shift of the maximum pressure point is related only to the interplay between diffraction, dissipation and nonlinearity of the acoustic wave.
NASA Technical Reports Server (NTRS)
1988-01-01
M.H. Marks Enterprises' Power Factor Controller (PFC) matches voltage with motor's actual need. Plugged into a motor, PFC continuously determines motor load by sensing shifts between voltage and current flow. When it senses a light load, it cuts voltage to the minimum needed. It offers potential energy savings ranging from eight percent up to 65 percent depending on the application. Myles Marks started out with the notion of writing an article for Popular Electronics magazine at the same time offering to furnish kits to readers interested in assembling PFC's. Within two weeks from publication he had orders for 500 kits and orders are still coming three years later.
A model of VDAC structural rearrangement in the presence of a salt activity gradient
NASA Astrophysics Data System (ADS)
Levadny, Victor; Colombini, Marco; Aguilella, Vicente M.
2001-11-01
We have considered the structural transformations of a voltage dependent anion-selective channel (VDAC) known as `gating'. We analysed the redistribution of VDAC among its states. The difference in electrostatic energy between the trans-closed and cis-closed states of VDAC is shown to be the cause of changes in the voltage dependence of the gating in the presence of a salt activity gradient. The asymmetry in the voltage dependence of the open probability about zero millivolts was connected with the apparent location of the voltage sensor. The theory describes the experimental data satisfactorily and explains the nature of the shift of the probability curve as well as the differences found in the asymmetry of the curve for different salts.
Electroluminescence in CdSe/PVA nanocomposites
NASA Astrophysics Data System (ADS)
Kumari, Sarita; Ramrakhiani, M.; Khare, P. K.
2018-05-01
The synthesis of II-VI nanocrystal into the polymer matrix to form nanocomposites with adjustable nanocrystal is of great interest size is a big challenge to the scientific community. In present work semiconducting CdSe/PVA thin film were synthesized by single step solution method with different concentration of CdSe. The as-prepared products were characterized by UV-Visible absorption spectra and FESEM. Absorption spectra of CdSe/PVA nanocomposites indicated that the position of absorption edge shifts to smaller wavelength by increasing the concentration of CdSe. For Electroluminescence a turn on voltage is required for light emission and brightness increases with voltage. Turn on voltage is found to decrease as CdSe concentration is increased. The voltage-current curve represents ohmic nature for all EL cells.
Electron refrigeration in hybrid structures with spin-split superconductors
NASA Astrophysics Data System (ADS)
Rouco, M.; Heikkilä, T. T.; Bergeret, F. S.
2018-01-01
Electron tunneling between superconductors and normal metals has been used for an efficient refrigeration of electrons in the latter. Such cooling is a nonlinear effect and usually requires a large voltage. Here we study the electron cooling in heterostructures based on superconductors with a spin-splitting field coupled to normal metals via spin-filtering barriers. The cooling power shows a linear term in the applied voltage. This improves the coefficient of performance of electron refrigeration in the normal metal by shifting its optimum cooling to lower voltage, and also allows for cooling the spin-split superconductor by reverting the sign of the voltage. We also show how tunnel coupling spin-split superconductors with regular ones allows for a highly efficient refrigeration of the latter.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Z.; Cardwell, D.; Sasikumar, A.
2016-04-28
The impact of proton irradiation on the threshold voltage (V{sub T}) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of V{sub T} was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 10{sup 14} cm{sup −2}. Silvaco Atlas simulations of V{sub T} shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different V{sub T} dependences on protonmore » irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed V{sub T} shifts. The proton irradiation induced V{sub T} shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.« less
Davidson, James R.; Lassahn, Gordon D.
2001-01-01
A small sized electro-optic voltage sensor capable of accurate measurement of high levels of voltages without contact with a conductor or voltage source is provided. When placed in the presence of an electric field, the sensor receives an input beam of electromagnetic radiation into the sensor. A polarization beam displacer serves as a filter to separate the input beam into two beams with orthogonal linear polarizations. The beam displacer is oriented in such a way as to rotate the linearly polarized beams such that they enter a Pockels crystal at a preferred angle of 45 degrees. The beam displacer is therefore capable of causing a linearly polarized beam to impinge a crystal at a desired angle independent of temperature. The Pockels electro-optic effect induces a differential phase shift on the major and minor axes of the input beam as it travels through the Pockels crystal, which causes the input beam to be elliptically polarized. A reflecting prism redirects the beam back through the crystal and the beam displacer. On the return path, the polarization beam displacer separates the elliptically polarized beam into two output beams of orthogonal linear polarization representing the major and minor axes. In crystals that introduce a phase differential attributable to temperature, a compensating crystal is provided to cancel the effect of temperature on the phase differential of the input beam. The system may include a detector for converting the output beams into electrical signals, and a signal processor for determining the voltage based on an analysis of the output beams. The output beams are amplitude modulated by the frequency of the electric field and the amplitude of the output beams is proportional to the magnitude of the electric field, which is related to the voltage being measured.
NASA Technical Reports Server (NTRS)
Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav
2014-01-01
The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.
Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert
2011-04-01
The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges.
Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert
2011-01-01
Abstract The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges. PMID:21300746
Coherent control of the Goos-Hänchen shift via Fano interference
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Shaopeng; Yang, Wen-Xing, E-mail: wenxingyang@seu.edu.cn; Zhu, Zhonghu
2016-04-14
A scheme of enhanced Goos-Hänchen (GH) shifts in reflected and transmitted light beams is exploited in a cavity, where an asymmetric double AlGaAs/GaAs quantum well structure with resonant tunneling to a common continuum is employed as the intracavity medium. With the help of Fano-type interference induced by resonant tunneling, the generated GH shifts that contain a negative lateral shift in reflected light beam and a positive lateral shift in transmitted light beam are found to be significantly enhanced. More interestingly, these GH shifts in reflected and transmitted light beams are modulated by means of a control beam and external biasmore » voltage, in which maximum negative shift of 1.86 mm and positive shift of 0.37 mm are achievable.« less
Hypersonic Flight Vehicle and Ramjet Engine. Considerations of Coordination and Configuration,
1980-04-01
oxidizing agent tank of the rocket and the initial weight is reduced. Analysis shows that the weight reduced by liquifying oxygen from the air not opnly...6fvaVThL- tE ~ dtid J ~v~Vf / Prick t D~ri, y? 1~ O 9 21 22 Hight lv’b ,~,i~ ~ 1cvV/L R~e~ viol ~s. lht Plug Pf-05ram,, Ae,+rO"O(ih- 1961. ’- *, s
Ahn, Cheol Hyoun; Kang, Won Jun; Kim, Ye Kyun; Yun, Myeong Gu; Cho, Hyung Koun
2016-06-22
Highly repeatable and recoverable phototransistors were explored using a "multifunctional channels" structure with multistacked chalcogenide and oxide semiconductors. These devices were made of (i) photoactive CdS (with a visible band gap), (ii) fast charge transporting ZnO (with a high field-effect mobility), and (iii) a protection layer of Al2O3 (with high chemical durability). The CdS TFT without the Al2O3 protection layer did not show a transfer curve due to the chemical damage that occurred on the ZnO layer during the chemical bath deposition (CBD) process used for CdS deposition. Alternatively, compared to CdS phototransistors with long recovery time and high hysteresis (ΔVth = 19.5 V), our "multi-functional channels" phototransistors showed an extremely low hysteresis loop (ΔVth = 0.5V) and superior photosensitivity with repeatable high photoresponsivity (52.9 A/W at 400 nm). These improvements are likely caused by the physical isolation of the sensing region and charge transport region by the insertion of the ultrathin Al2O3 layer. This approach successfully addresses some of the existing problems in CdS phototransistors, such as the high gate-interface trap site density and high absorption of molecular oxygen, which originate from the polycrystalline CdS.
Total Ionizing Dose Effects in MOS Oxides and Devices
NASA Technical Reports Server (NTRS)
Oldham, Timothy R.; McLean, F. B.
2003-01-01
The development of military and space electronics technology has traditionally been heavily influenced by the commercial semiconductor industry. The development of MOS technology, and particularly CMOS technology, as dominant commercial technologies has occurred entirely within the lifetime of the NSREC. For this reason, it is not surprising that the study of radiation interactions with MOS materials, devices and circuits has been a major theme of this conference for most of its history. The basic radiation problem in a MOS transistor is illustrated. The application of an appropriate gate voltage causes a conducting channel to form between the source and drain, so that current flows when the device is turned on. In Fig. lb, the effect of ionizing radiation is illustrated. Radiation-induced trapped charge has built up in the gate oxide, which causes a shift in the threshold voltage (that is, a change in the voltage which must be applied to turn the device on). If this shift is large enough, the device cannot be turned off, even at zero volts applied, and the device is said to have failed by going depletion mode.
NASA Astrophysics Data System (ADS)
Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo
2018-04-01
The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.
Study of SiO2-Si and metal-oxide-semiconductor structures using positrons
NASA Astrophysics Data System (ADS)
Leung, T. C.; Asoka-Kumar, P.; Nielsen, B.; Lynn, K. G.
1993-01-01
Studies of SiO2-Si and metal-oxide-semiconductor (MOS) structures using positrons are summarized and a concise picture of the present understanding of positrons in these systems is provided. Positron annihilation line-shape S data are presented as a function of the positron incident energy, gate voltage, and annealing, and are described with a diffusion-annihilation equation for positrons. The data are compared with electrical measurements. Distinct annihilation characteristics were observed at the SiO2-Si interface and have been studied as a function of bias voltage and annealing conditions. The shift of the centroid (peak) of γ-ray energy distributions in the depletion region of the MOS structures was studied as a function of positron energy and gate voltage, and the shifts are explained by the corresponding variations in the strength of the electric field and thickness of the depletion layer. The potential role of the positron annihilation technique as a noncontact, nondestructive, and depth-sensitive characterization tool for the technologically important, deeply buried interface is shown.
NASA Astrophysics Data System (ADS)
Verbeeck, J.; Leroux, P.; Steyaert, M.
2011-01-01
A differential voltage amplifier with a gain-bandwidth product of 2.5Ghz and using adaptive biasing has been designed in a standard CMOS technology and assessed under radiation and temperature variations. The principle used in this ASIC will be employed in the design of a Gbps TIA with improved tolerance for γ-irradiation and temperature for an optical instrumentation (LIDAR) receiver aiming at operation in harsh environments. The voltage amplifier was tested under gamma radiation and features a gain degradation of merely 4.5% up to a total dose of 100kGy. In order to verify the radiation effects on the IC, the threshold voltage shift of the separate transistors has been investigated. Temperature characterization has shown that the amplifier features a reduction of the voltage gain by only 5.6% for a temperature range of -40 till 130 °C.
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna
2013-03-01
The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.
Holographic Structuring of Elastomer Actuator: First True Monolithic Tunable Elastomer Optics.
Ryabchun, Alexander; Kollosche, Matthias; Wegener, Michael; Sakhno, Oksana
2016-12-01
Volume diffraction gratings (VDGs) are inscribed selectively by diffusive introduction of benzophenone and subsequent UV-holographic structuring into an electroactive dielectric elastomer actuator (DEA), to afford a continuous voltage-controlled grating shift of 17%. The internal stress coupling of DEA and optical domain allows for a new generation of true monolithic tunable elastomer optics with voltage controlled properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Greene, Derek L; Kang, Seungwoo; Hoshi, Naoto
2017-07-01
M-channel inhibitors, especially XE991, are being used increasingly in animal experiments; however, insufficient characterization of XE991 at times confounds the interpretation of results when using this compound. Here, we demonstrate that XE991 and linopirdine are state-dependent inhibitors that favor the activated-subunit of neuronal Kv7/KCNQ channels. We performed patch-clamp experiments on homomeric Kv7.2 or heteromeric Kv7.2/3 channels expressed in Chinese hamster ovary cells to characterize XE991 and linopirdine. Neither inhibitor was efficacious around the resting membrane potential of cells in physiologic conditions. Inhibition of Kv7.2 and Kv7.2/3 channels by XE991 was closely related with channel activation. When the voltage dependence of activation was left-shifted by retigabine or right-shifted by the mutation, Kv7.2(R214D), the shift in half-activation voltage proportionally coincided with the shift in the half-effective potential for XE991 inhibition. Inhibition kinetics during XE991 wash-in was facilitated at depolarized potentials. Ten-minute washout of XE991 resulted in ∼30% current recovery, most of which was attributed to surface transport of Kv7.2 channels. Linopirdine also exhibited similar inhibition characteristics, with the exception of near- complete current recovery after washout at depolarized potentials. Inhibition kinetics of both XE991 and linopirdine was not as sensitive to changes in voltage as would be predicted by open- channel inhibition. Instead, they were well explained by binding to a single activated subunit. The characteristics of XE991 and linopirdine should be taken into account when these M-channel inhibitors are used in experiments. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Voltage-dependent formation of gramicidin channels in lipid bilayers.
Sandblom, J; Galvanovskis, J; Jilderos, B
2001-01-01
The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628
Saeki, Hiroyuki; Hirohara, Kazuto; Koshiba, Yasuko; Horie, Satoshi; Misaki, Masahiro; Takeshita, Kimiya; Ishida, Kenji; Ueda, Yasukiyo
2010-01-01
The current-voltage characteristics of benzoporphine-fullerene solar cells were measured subsequent to the deposition of Al as a cathode material. Even in vacuum, a shift in the open circuit voltage was observed at 20 min after Al deposition. Moreover, the displacement of inert gases (N2or Ar) in the evaporation chamber enhanced the photovoltaic parameters. The power conversion efficiency was increased by 24% over the initial characteristics (from 1.04% to 1.29%), which indicates that the structure of the organic-metal interface changed rapidly after Al deposition, even if the process was performed in an air-free glovebox. PMID:21151322
Organic memory device with self-assembly monolayered aptamer conjugated nanoparticles
NASA Astrophysics Data System (ADS)
Oh, Sewook; Kim, Minkeun; Kim, Yejin; Jung, Hunsang; Yoon, Tae-Sik; Choi, Young-Jin; Jung Kang, Chi; Moon, Myeong-Ju; Jeong, Yong-Yeon; Park, In-Kyu; Ho Lee, Hyun
2013-08-01
An organic memory structure using monolayered aptamer conjugated gold nanoparticles (Au NPs) as charge storage nodes was demonstrated. Metal-pentacene-insulator-semiconductor device was adopted for the non-volatile memory effect through self assembly monolayer of A10-aptamer conjugated Au NPs, which was formed on functionalized insulator surface with prostate-specific membrane antigen protein. The capacitance versus voltage (C-V) curves obtained for the monolayered Au NPs capacitor exhibited substantial flat-band voltage shift (ΔVFB) or memory window of 3.76 V under (+/-)7 V voltage sweep. The memory device format can be potentially expanded to a highly specific capacitive sensor for the aptamer-specific biomolecule detection.
Temperature dependence of frequency response characteristics in organic field-effect transistors
NASA Astrophysics Data System (ADS)
Lu, Xubing; Minari, Takeo; Liu, Chuan; Kumatani, Akichika; Liu, J.-M.; Tsukagoshi, Kazuhito
2012-04-01
The frequency response characteristics of semiconductor devices play an essential role in the high-speed operation of electronic devices. We investigated the temperature dependence of dynamic characteristics in pentacene-based organic field-effect transistors and metal-insulator-semiconductor capacitors. As the temperature decreased, the capacitance-voltage characteristics showed large frequency dispersion and a negative shift in the flat-band voltage at high frequencies. The cutoff frequency shows Arrhenius-type temperature dependence with different activation energy values for various gate voltages. These phenomena demonstrate the effects of charge trapping on the frequency response characteristics, since decreased mobility prevents a fast charge response for alternating current signals at low temperatures.
A pH sensor with a double-gate silicon nanowire field-effect transistor
NASA Astrophysics Data System (ADS)
Ahn, Jae-Hyuk; Kim, Jee-Yeon; Seol, Myeong-Lok; Baek, David J.; Guo, Zheng; Kim, Chang-Hoon; Choi, Sung-Jin; Choi, Yang-Kyu
2013-02-01
A pH sensor composed of a double-gate silicon nanowire field-effect transistor (DG Si-NW FET) is demonstrated. The proposed DG Si-NW FET allows the independent addressing of the gate voltage and hence improves the sensing capability through an application of asymmetric gate voltage between the two gates. One gate is a driving gate which controls the current flow, and the other is a supporting gate which amplifies the shift of the threshold voltage, which is a sensing metric, and which arises from changes in the pH. The pH signal is also amplified through modulation of the gate oxide thickness.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abbaszadeh, D.; Wetzelaer, G. A. H.; Dutch Polymer Institute, P.O. Box 902, 5600 AX, Eindhoven
The quenching of excitons at the poly(3,4-ethylenedioxythiophene):poly(styrenesulfonic acid) (PEDOT:PSS) anode in blue polyalkoxyspirobifluorene-arylamine polymer light-emitting diodes is investigated. Due to the combination of a higher electron mobility and the presence of electron traps, the recombination zone shifts from the cathode to the anode with increasing voltage. The exciton quenching at the anode at higher voltages leads to an efficiency roll-off. The voltage dependence of the luminous efficiency is reproduced by a drift-diffusion model under the condition that quenching of excitons at the PEDOT:PSS anode and metallic cathode is of equal strength. Experimentally, the efficiency roll-off at high voltages due tomore » anode quenching is eliminated by the use of an electron-blocking layer between the anode and the light-emitting polymer.« less
Hot-Electron-Induced Device Degradation during Gate-Induced Drain Leakage Stress
NASA Astrophysics Data System (ADS)
Kim, Kwang-Soo; Han, Chang-Hoon; Lee, Jun-Ki; Kim, Dong-Soo; Kim, Hyong-Joon; Shin, Joong-Shik; Lee, Hea-Beoum; Choi, Byoung-Deog
2012-11-01
We studied the interface state generation and electron trapping by hot electrons under gate-induced drain leakage (GIDL) stress in p-type metal oxide semiconductor field-effect transistors (P-MOSFETs), which are used as the high-voltage core circuit of flash memory devices. When negative voltage was applied to a drain in the off-state, a GIDL current was generated, but when high voltage was applied to the drain, electrons had a high energy. The hot electrons produced the interface state and electron trapping. As a result, the threshold voltage shifted and the off-state leakage current (trap-assisted drain junction leakage current) increased. On the other hand, electron trapping mitigated the energy band bending near the drain and thus suppressed the GIDL current generation.
Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana
Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing
2015-01-01
Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363
The Study of Phase-shift Super-Frequency Induction Heating Power Supply
NASA Astrophysics Data System (ADS)
Qi, Hairun; Peng, Yonglong; Li, Yabin
This paper combines pulse-width phase-shift power modulation with fixed-angle phase-locked-control to adjust the inverter's output power, this method not only meets the work conditions of voltage inverter, but also realizes the large-scale of power modulation, and the main circuit is simple, the switching devices realize soft switching. This paper analyzes the relationship between the output power and phase-shift angle, the control strategy is simulated by Matlab/Simulink, and the results show that the method is feasible and meets the theoretical analysis
NASA Astrophysics Data System (ADS)
Ko, Seung-Pil; Shin, Jong Mok; Jang, Ho Kyun; You, Min Youl; Jin, Jun-Eon; Choi, Miri; Cho, Jiung; Kim, Gyu-Tae
2018-02-01
Doping effects in devices based on two-dimensional (2D) materials have been widely studied. However, detailed analysis and the mechanism of the doping effect caused by encapsulation layers has not been sufficiently explored. In this work, we present experimental studies on the n-doping effect in WSe2 field effect transistors (FETs) with a high-k encapsulation layer (Al2O3) grown by atomic layer deposition. In addition, we demonstrate the mechanism and origin of the doping effect. After encapsulation of the Al2O3 layer, the threshold voltage of the WSe2 FET negatively shifted with the increase of the on-current. The capacitance-voltage measurements of the metal insulator semiconductor (MIS) structure proved the presence of the positive fixed charges within the Al2O3 layer. The flat-band voltage of the MIS structure of Au/Al2O3/SiO2/Si was shifted toward the negative direction on account of the positive fixed charges in the Al2O3 layer. Our results clearly revealed that the fixed charges in the Al2O3 encapsulation layer modulated the Fermi energy level via the field effect. Moreover, these results possibly provide fundamental ideas and guidelines to design 2D materials FETs with high-performance and reliability.
Palette of fluorinated voltage-sensitive hemicyanine dyes
Yan, Ping; Acker, Corey D.; Zhou, Wen-Liang; Lee, Peter; Bollensdorff, Christian; Negrean, Adrian; Lotti, Jacopo; Sacconi, Leonardo; Antic, Srdjan D.; Kohl, Peter; Mansvelder, Huibert D.; Pavone, Francesco S.; Loew, Leslie M.
2012-01-01
Optical recording of membrane potential permits spatially resolved measurement of electrical activity in subcellular regions of single cells, which would be inaccessible to electrodes, and imaging of spatiotemporal patterns of action potential propagation in excitable tissues, such as the brain or heart. However, the available voltage-sensitive dyes (VSDs) are not always spectrally compatible with newly available optical technologies for sensing or manipulating the physiological state of a system. Here, we describe a series of 19 fluorinated VSDs based on the hemicyanine class of chromophores. Strategic placement of the fluorine atoms on the chromophores can result in either blue or red shifts in the absorbance and emission spectra. The range of one-photon excitation wavelengths afforded by these new VSDs spans 440–670 nm; the two-photon excitation range is 900–1,340 nm. The emission of each VSD is shifted by at least 100 nm to the red of its one-photon excitation spectrum. The set of VSDs, thus, affords an extended toolkit for optical recording to match a broad range of experimental requirements. We show the sensitivity to voltage and the photostability of the new VSDs in a series of experimental preparations ranging in scale from single dendritic spines to whole heart. Among the advances shown in these applications are simultaneous recording of voltage and calcium in single dendritic spines and optical electrophysiology recordings using two-photon excitation above 1,100 nm. PMID:23169660
NASA Astrophysics Data System (ADS)
Yu, Kyeong Min; Bae, Byung Seong; Jung, Myunghee; Yun, Eui-Jung
2016-06-01
We investigate the effects of high temperatures in the range of 292 - 393 K on the electrical properties of solution-processed amorphous zinc-tin-oxide (a-ZTO) thin-film transistors (TFTs) operated in the saturation region. The fabricated a-ZTO TFTs have a non-patterned bottom gate and top contact structure, and they use a heavily-doped Si wafer and SiO2 as a gate electrode and a gate insulator layer, respectively. In a-ZTO TFTs, the trap release energy ( E TR ) was deduced by using Maxwell-Boltzmann statistics. The decreasing E TR toward zero with increasing gate voltage (the density of trap states ( n s )) in the a-ZTO active layer can be attributed to a shift of the Fermi level toward the mobility edge with increasing gate voltage. The TFTs with low gate voltage (low n s ) exhibit multiple trap and release characteristics and show thermally-activated behavior. In TFTs with a high gate voltage (high n s ), however, we observe decreasing mobility and conductivity with increasing temperature at temperatures ranging from 303 to 363 K. This confirms that the E TR can drop to zero, indicating a shift of the Fermi level beyond the mobility edge. Hence, the mobility edge is detected at the cusp between thermally-activated transport and band transport.
Tian, Kun; He, Cong-Cong; Xu, Hui-Nan; Wang, Yu-Xiang; Wang, Hong-Gang; An, Di; Heng, Bin; Pang, Wei; Jiang, Yu-Gang; Liu, Yan-Qiang
2017-05-01
In the present study, cultured rat primary neurons were exposed to a medium containing N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), a specific cell membrane-permeant Zn 2+ chelator, to establish a model of free Zn 2+ deficiency in neurons. The effects of TPEN-mediated free Zn 2+ ion reduction on neuronal viability and on the performance of voltage-gated sodium channels (VGSCs) and potassium channels (Kvs) were assessed. Free Zn 2+ deficiency 1) markedly reduced the neuronal survival rate, 2) reduced the peak amplitude of I Na , 3) shifted the I Na activation curve towards depolarization, 4) modulated the sensitivity of sodium channel voltage-dependent inactivation to a depolarization voltage, and 5) increased the time course of recovery from sodium channel inactivation. In addition, free Zn 2+ deficiency by TPEN notably enhanced the peak amplitude of transient outward K + currents (I A ) and delayed rectifier K + currents (I K ), as well as caused hyperpolarization and depolarization directional shifts in their steady-state activation curves, respectively. Zn 2+ supplementation reversed the effects induced by TPEN. Our results indicate that free Zn 2+ deficiency causes neuronal damage and alters the dynamic characteristics of VGSC and Kv currents. Thus, neuronal injury caused by free Zn 2+ deficiency may correlate with its modulation of the electrophysiological properties of VGSCs and Kvs. Copyright © 2017 Elsevier GmbH. All rights reserved.
Fighting blind: why US Army Divisions Need a Dedicated Reconnaissance and Security Force
2017-05-25
dedicated reconnaissance and security force. By the 2003 invasion of Iraq, 3d Infantry Division employed a division cavalry squadron that integrated...26 1 Introduction 3-7 Cavalry conducted reconnaissance and security tasks ahead of and on the flank of 3d Infantry Division as the...division led Vth Corp’s attack from Kuwait to Baghdad in 2003. 3-7 Cavalry’s movements confused the enemy about 3d Infantry Division’s location and intent
1986-06-10
system consisting of a sampler, a nonlinear rectifier, and a low-pass filter is evaluated generally , for arbitrary half-wave or full-wave v-th law...spectra, the possibility of using deliberate undersampling with no loss of performance is illustrated. The use of a half-wave rectifier generally ... some cases, significantly so. Programs for all procedures employed are presented so that investigation of additional cases or combinations of
Cherny, Vladimir V.; DeCoursey, Thomas E.
1999-01-01
Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017
Voltage-sensing phosphatase modulation by a C2 domain.
Castle, Paul M; Zolman, Kevin D; Kohout, Susy C
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function.
Voltage-sensing phosphatase modulation by a C2 domain
Castle, Paul M.; Zolman, Kevin D.; Kohout, Susy C.
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function. PMID:25904865
Investigation of the flatband voltage (V(FB)) shift of Al2O3 on N2 plasma treated Si substrate.
Kim, Hyungchul; Lee, Jaesang; Jeon, Heeyoung; Park, Jingyu; Jeon, Hyeongtag
2013-09-01
The relationships between the physical and electrical characteristics of films treated with N2 plasma followed by forming gas annealing (FGA) were investigated. The Si substrates were treated with various radio frequency (RF) power levels under a N2 ambient. Al2O3 films were then deposited on Si substrates via remote plasma atomic-layer deposition. The plasma characteristics, such as the radical and ion density, were investigated using optical emission spectroscopy. Through X-ray photoelectron spectroscopy, the chemical-bonding configurations of the samples treated with N2 plasma and FGA were examined. The quantity of Si-N bonds increased as the RF power was increased, and Si--O--N bonds were generated after FGA. The flatband voltage (VFB) was shifted in the negative direction with increasing RF power, but the VFB values of the samples after FGA shifted in the positive direction due to the formation of Si--O--N bonds. N2 plasma treatment with various RF power levels slightly increased the leakage current due to the generation of defect sites.
NASA Astrophysics Data System (ADS)
Arjmand, T.; Tagani, M. Bagheri; Soleimani, H. Rahimpour
2018-01-01
Bilayer germanene nanoribbons are investigated in different stacks like buckled and flat armchair and buckled zigzag germanene nanoribbons by performing theoretical calculations using the nonequilibrium Greens function method combined with density functional theory. In these bilayer types, the current oscillates with change of interlayer distances or intra-layer overlaps and is dependent on the type of the bilayer. Band gap of AA-stacked of shifted flat bilayer armchair germanene nanoribbon oscillates by change of interlayer distance which is in contrast to buckled bilayer armchair germanene nanoribbon. So, results show the buckling makes system tend to be a semiconductor with wide band gap. Therefore, AA-stacked of shifted flat bilayer armchair germanene nanoribbon has properties between zigzag and armchair edges, the higher current under bias voltages similar to zigzag edge and also oscillations in current like buckled armchair edges. Also, it is found that HOMO-LUMO band gap strongly affects oscillation in currents and their I-V characteristic. This kind of junction improves the switching properties at low voltages around the band gap.
ERIC Educational Resources Information Center
Physics Education, 1982
1982-01-01
Describes: (1) an apparatus which provides a simple method for measuring Stefan's constant; (2) a simple phase shifting circuit; (3) a radioactive decay computer program (for ZX81); and (4) phase difference between transformer voltages. (Author/JN)
NASA Astrophysics Data System (ADS)
Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In
2017-08-01
In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.
pH-dependent electron-transport properties of carbon nanotubes.
Back, Ju Hee; Shim, Moonsub
2006-11-30
Carbon nanotube electrochemical transistors integrated with microfluidic channels are utilized to examine the effects of aqueous electrolyte solutions on the electron-transport properties of single isolated carbon nanotubes. In particular, pH and concentration of supporting inert electrolytes are examined. A systematic threshold voltage shift with pH is observed while the transconductance and subthreshold swing remain independent of pH and concentration. Decreasing pH leads to a negative shift of the threshold voltage, indicating that protonation does not lead to hole doping. Changing the type of contact metal does not alter the observed pH response. The pH-dependent charging of SiO2 substrate is ruled out as the origin based on measurements with suspended nanotube transistors. Increasing the ionic strength leads to reduced pH response. Contributions from possible surface chargeable chemical groups are considered.
Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons.
Brown, Maile R; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H; Kaczmarek, Leonard K
2016-07-01
Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express "high threshold" voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. Copyright © 2016 the American Physiological Society.
Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons
Brown, Maile R.; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H.
2016-01-01
Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express “high threshold” voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. PMID:27052580
Qian, Qingkai; Li, Baikui; Hua, Mengyuan; Zhang, Zhaofu; Lan, Feifei; Xu, Yongkuan; Yan, Ruyue; Chen, Kevin J.
2016-01-01
Transistors based on MoS2 and other TMDs have been widely studied. The dangling-bond free surface of MoS2 has made the deposition of high-quality high-k dielectrics on MoS2 a challenge. The resulted transistors often suffer from the threshold voltage instability induced by the high density traps near MoS2/dielectric interface or inside the gate dielectric, which is detrimental for the practical applications of MoS2 metal-oxide-semiconductor field-effect transistor (MOSFET). In this work, by using AlN deposited by plasma enhanced atomic layer deposition (PEALD) as an interfacial layer, top-gate dielectrics as thin as 6 nm for single-layer MoS2 transistors are demonstrated. The AlN interfacial layer not only promotes the conformal deposition of high-quality Al2O3 on the dangling-bond free MoS2, but also greatly enhances the electrical stability of the MoS2 transistors. Very small hysteresis (ΔVth) is observed even at large gate biases and high temperatures. The transistor also exhibits a low level of flicker noise, which clearly originates from the Hooge mobility fluctuation instead of the carrier number fluctuation. The observed superior electrical stability of MoS2 transistor is attributed to the low border trap density of the AlN interfacial layer, as well as the small gate leakage and high dielectric strength of AlN/Al2O3 dielectric stack. PMID:27279454
Kim, Sung Yoon; Seo, Jae Hwa; Yoon, Young Jun; Lee, Ho-Young; Lee, Seong Min; Cho, Seongjae; Kang, In Man
2015-10-01
In this work, we design and analyze complementary metal-oxide-semiconductor (CMOS)-compatible III-V compound electron-hole bilayer (EHB) tunneling field-effect transistors (TFETs) by using two-dimensional (2D) technology computer-aided design (TCAD) simulations. A recently proposed EHB TFET exploits a bias-induced band-to-band tunneling (BTBT) across the electron-hole bilayer by an electric field from the top and bottom gates. This is in contrast to conventional planar p(+)-p(-)-n TFETs, which utilize BTBT across the source-to-channel junction. We applied III-V compound semiconductor materials to the EHB TFETs in order to enhance the current drivability and switching performance. Devices based on various compound semiconductor materials have been designed and analyzed in terms of their primary DC characteristics. In addition, the operational principles were validated by close examination of the electron concentrations and energy-band diagrams under various operation conditions. The simulation results of the optimally designed In0.533Ga0.47As EHB TFET show outstanding performance, with an on-state current (Ion) of 249.5 μA/μm, subthreshold swing (S) of 11.4 mV/dec, and threshold voltage (Vth) of 50 mV at VDS = 0.5 V. Based on the DC-optimized InGaAs EHB TFET, the CMOS inverter circuit was simulated in views of static and dynamic behaviors of the p-channel device with exchanges between top and bottom gates or between source and drain electrodes maintaining the device structure.
A wirelessly powered electro-acupuncture based on adaptive pulsewidth monophase stimulation.
Kiseok Song; Long Yan; Seulki Lee; Yoo, Jerald; Hoi-Jun Yoo
2011-04-01
A wirelessly powered electro-acupuncture (EA) system with adaptive-pulsewidth (APW) monophase stimulation is presented for convenient invasive medicine. The proposed system removes cumbersome wires connected between EA nodes and an EA controller in order to realize both patients' convenience and remedial values simultaneously. An ultra-low-power stimulator integrated circuit (IC) that is integrated on the flexible-printed-circuit board (F-PCB) is attached to the tip of a needle electrode. Combined with a conductive yarn helical antenna wound around the needle electrode, the EA node receives wireless power from the EA controller using 433 MHz with the maximum loss of 6 dB. A zero-Vth nMOS rectifier harvests a supply voltage of 1.0 V from a -16-dBm incoming power signal with 32% efficiency. To deal with a body impedance variation (BIV) in the range of 100-200 kΩ , the proposed APW stimulator IC, fabricated in a 0.18-μm 1P6M complementary metal-oxide semiconductor CMOS process and occupying 1.56 mm(2), enables constant charge injection of 80-nC/stimulation. To ensure the patients' safety, the EA node (a pair of EAs) shares ground and clock wires to operate in alternate monophase (AMP) fashion for neutralizing the injected charge. The proposed wirelessly powered EA node was verified by applying it to a chunk of pork as a body model with the wireless power supplied from an RF signal generator (output power of 10 dBm and located 30 cm away).
Impact of line edge roughness on the performance of 14-nm FinFET: Device-circuit Co-design
NASA Astrophysics Data System (ADS)
Rathore, Rituraj Singh; Rana, Ashwani K.
2018-01-01
With the evolution of sub-20 nm FinFET technology, line edge roughness (LER) has been identified as a critical problem and may result in critical device parameter variation and performance limitation in the future VLSI circuit application. In the present work, an analytical model of fin-LER has been presented, which shows the impact of correlated and uncorrelated LER on FinFET structure. Further, the influence of correlated and uncorrelated fin- LER on all electrical performance parameters is thoroughly investigated using the three-dimensional (3-D) Technology Computer Aided Design (TCAD) simulations for 14-nm technology node. Moreover, the impact of all possible fin shapes on threshold voltage (VTH), drain induced barrier lowering (DIBL), on-current (ION), and off-current (IOFF) has been compared with the well calibrated rectangular FinFET structure. In addition, the influence of all possible fin geometries on the read stability of six-transistor (6-T) Static-Random-Access-Memory (SRAM) has been investigated. The study reveals that fin-LER plays a vital role as it directly governs the electrostatics of the FinFET structure. This has been found that there is a high degree of fluctuations in all performance parameters for uncorrelated fin-LER type FinFETs as compared to correlated fin-LER with respect to rectangular FinFET structure. This paper gives physical insight of FinFET design, especially in sub-20 nm technology nodes by concluding that the impact of LER on electrical parameters are minimum for correlated LER.
Broadband linear high-voltage amplifier for radio frequency ion traps.
Kuhlicke, Alexander; Palis, Klaus; Benson, Oliver
2014-11-01
We developed a linear high-voltage amplifier for small capacitive loads consisting of a high-voltage power supply and a transistor amplifier. With this cost-effective circuit including only standard parts sinusoidal signals with a few volts can be amplified to 1.7 kVpp over a usable frequency range at large-signal response spanning four orders of magnitude from 20 Hz to 100 kHz under a load of 10 pF. For smaller output voltages the maximum frequency shifts up to megahertz. We test different capacitive loads to probe the influence on the performance. The presented amplifier is sustained short-circuit proof on the output side, which is a significant advantage over other amplifier concepts. The amplifier can be used to drive radio frequency ion traps for single charged nano- and microparticles, which will be presented in brief.
Plenoptic camera based on a liquid crystal microlens array
NASA Astrophysics Data System (ADS)
Lei, Yu; Tong, Qing; Zhang, Xinyu; Sang, Hongshi; Xie, Changsheng
2015-09-01
A type of liquid crystal microlens array (LCMLA) with tunable focal length by the voltage signals applied between its top and bottom electrodes, is fabricated and then the common optical focusing characteristics are tested. The relationship between the focal length and the applied voltage signals is given. The LCMLA is integrated with an image sensor and further coupled with a main lens so as to construct a plenoptic camera. Several raw images at different voltage signals applied are acquired and contrasted through the LCMLA-based plenoptic camera constructed by us. Our experiments demonstrate that through utilizing a LCMLA in a plenoptic camera, the focused zone of the LCMLA-based plenoptic camera can be shifted effectively only by changing the voltage signals loaded between the electrodes of the LCMLA, which is equivalent to the extension of the depth of field.
Low-voltage all-inorganic perovskite quantum dot transistor memory
NASA Astrophysics Data System (ADS)
Chen, Zhiliang; Zhang, Yating; Zhang, Heng; Yu, Yu; Song, Xiaoxian; Zhang, Haiting; Cao, Mingxuan; Che, Yongli; Jin, Lufan; Li, Yifan; Li, Qingyan; Dai, Haitao; Yang, Junbo; Yao, Jianquan
2018-05-01
An all-inorganic cesium lead halide quantum dot (QD) based Au nanoparticle (NP) floating-gate memory with a solution processed layer-by-layer method is demonstrated. Easy synthesis at room temperature and excellent stability make all-inorganic CsPbBr3 perovskite QDs suitable as a semiconductor layer in low voltage nonvolatile transistor memory. The bipolarity of QDs has both electrons and holes stored in the Au NP floating gate, resulting in bidirectional shifts of initial threshold voltage according to the applied programing and erasing pulses. Under low operation voltage (±5 V), the memory achieved a great memory window (˜2.4 V), long retention time (>105 s), and stable endurance properties after 200 cycles. So the proposed memory device based on CsPbBr3 perovskite QDs has a great potential in the flash memory market.
A theoretical approach to study the optical sensitivity of a MESFET
NASA Astrophysics Data System (ADS)
Dutta, Sutanu
2018-05-01
A theoretical model to study the optical sensitivity of a metal-semiconductor field effect transistor has been proposed for a relatively high drain field. An analytical expression of drain current of the device has been derived for a MESFET under optical illumination considering field dependent mobility of electrons across the channel. The variation of drain current with and without optical illumination has been studied with drain and gate voltages. The optical sensitivity of the drain current has been studied for different biasing conditions and gate lengths. In addition, the shift in threshold voltage of a MESFET under optical illumination is determined and optical sensitivity of the device in terms of its threshold voltage has been studied.
Direct electronic probing of biological complexes formation
NASA Astrophysics Data System (ADS)
Macchia, Eleonora; Magliulo, Maria; Manoli, Kyriaki; Giordano, Francesco; Palazzo, Gerardo; Torsi, Luisa
2014-10-01
Functional bio-interlayer organic field - effect transistors (FBI-OFET), embedding streptavidin, avidin and neutravidin as bio-recognition element, have been studied to probe the electronic properties of protein complexes. The threshold voltage control has been achieved modifying the SiO2 gate diaelectric surface by means of the deposition of an interlayer of bio-recognition elements. A threshold voltage shift with respect to the unmodified dielectric surface toward more negative potential values has been found for the three different proteins, in agreement with their isoelectric points. The relative responses in terms of source - drain current, mobility and threshold voltage upon exposure to biotin of the FBI-OFET devices have been compared for the three bio-recognition elements.
Addressable inverter matrix for process and device characterization
NASA Technical Reports Server (NTRS)
Buehler, M. G.; Sayah, H. R.
1985-01-01
The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.
FIBER AND INTEGRATED OPTICS: Nonlinearity of a channel-waveguide phase modulator
NASA Astrophysics Data System (ADS)
Parygin, V. N.; Zhmakin, I. N.; Baglikov, V. B.
1993-09-01
The phase velocity of light in a channel waveguide using a LiNbO3 crystal is analyzed as a function of the voltage applied to the crystal. A refinement of the method of an effective refractive index is proposed. This refinement makes it possible to use the method near the cutoff for a waveguide mode. At voltages on the order of 10 V, the nonlinearity of the phase characteristic amounts to ~ 5 · 10- 4 of the linear phase shift.
Fernandez, Fernando R.; Broicher, Tilman; Truong, Alan; White, John A.
2011-01-01
Modulating the gain of the input-output function of neurons is critical for processing of stimuli and network dynamics. Previous gain control mechanisms have suggested that voltage fluctuations play a key role in determining neuronal gain in vivo. Here we show that, under increased membrane conductance, voltage fluctuations restore Na+ current and reduce spike frequency adaptation in rat hippocampal CA1 pyramidal neurons in vitro. As a consequence, membrane voltage fluctuations produce a leftward shift in the f-I relationship without a change in gain, relative to an increase in conductance alone. Furthermore, we show that these changes have important implications for the integration of inhibitory inputs. Due to the ability to restore Na+ current, hyperpolarizing membrane voltage fluctuations mediated by GABAA-like inputs can increase firing rate in a high conductance state. Finally, our data show that the effects on gain and synaptic integration are mediated by voltage fluctuations within a physiologically relevant range of frequencies (10–40 Hz). PMID:21389243
Ågren, Richard; Sahlholm, Kristoffer; Nilsson, Johanna; Århem, Peter
2018-01-29
The muscarinic M 2 receptor (M 2 R) has been shown to display voltage-sensitive agonist binding, based on G protein-activated inward rectifier potassium channel (GIRK) opening and radioligand binding at different membrane voltages. A conserved aspartate in transmembrane segment (TM) II of M 2 R, D69, has been proposed as the voltage sensor. While a recent paper instead presented evidence of tyrosines in TMs III, VI, and VII acting as voltage sensors, these authors were not able to record GIRK channel activation by a D69N mutant M 2 R. In the present study, we succeeded in recording ACh-induced GIRK channel activation by this mutant at -80 and 0 mV. The acetylcholine EC 50 was about 2.5-fold higher at 0 mV, a potency shift very similar to that observed at wild-type M 2 R, indicating that voltage sensitivity persists at the D69N mutant. Thus, our present observations corroborate the notion that D69 is not responsible for voltage sensitivity of the M 2 R. Copyright © 2018 Elsevier Inc. All rights reserved.
Giga-seal formation alters properties of sodium channels of human myoballs.
Fahlke, C; Rüdel, R
1992-03-01
The influence of giga-seal formation on the properties of the Na+ channels within the covered membrane patch was investigated with a whole-cell pipette and a patch pipette applied to the same cell. Current kinetics, current/voltage relation and channel densities were determined in three combinations: (i) voltage-clamping and current recording with the whole-cell pipette, (ii) voltage-clamping with the whole-cell pipette and current recording with the patch pipette and, (iii) voltage-clamping and current recording with the patch pipette. The Hodgkin-Huxley (1952) parameters tau m and tau h were smaller for the patch currents than for the whole cell, and the h infinity curve was shifted in the negative direction. The channel density was of the order of 10 times smaller. All effects were independent of the extracellular Ca2+ concentration. The capacitive current generated in the patch by the whole-cell Na+ current and its effect on the transmembrane voltage of the patch were evaluated. The kinetic parameters of the Na+ channels in the patch did not depend on whether the voltage was clamped with the whole-cell pipette or the patch pipette. Thus, the results are not due to spurious voltage.
Improved frequency/voltage converters for fast quartz crystal microbalance applications.
Torres, R; García, J V; Arnau, A; Perrot, H; Kim, L To Thi; Gabrielli, C
2008-04-01
The monitoring of frequency changes in fast quartz crystal microbalance (QCM) applications is a real challenge in today's instrumentation. In these applications, such as ac electrogravimetry, small frequency shifts, in the order of tens of hertz, around the resonance of the sensor can occur up to a frequency modulation of 1 kHz. These frequency changes have to be monitored very accurately both in magnitude and phase. Phase-locked loop techniques can be used for obtaining a high performance frequency/voltage converter which can provide reliable measurements. Sensitivity higher than 10 mVHz, for a frequency shift resolution of 0.1 Hz, with very low distortion in tracking both the magnitude and phase of the frequency variations around the resonance frequency of the sensor are required specifications. Moreover, the resonance frequency can vary in a broad frequency range from 5 to 10 MHz in typical QCM sensors, which introduces an additional difficulty. A new frequency-voltage conversion system based on a double tuning analog-digital phase-locked loop is proposed. The reported electronic characterization and experimental results obtained with conducting polymers prove its reliability for ac-electrogravimetry measurements and, in general, for fast QCM applications.
An All Oxide-Based Imperceptible Thin-Film Transistor with Humidity Sensing Properties.
Kim, Kyung Su; Ahn, Cheol Hyoun; Kang, Won Jun; Cho, Sung Woon; Jung, Sung Hyeon; Yoon, Dae Ho; Cho, Hyung Koun
2017-05-13
We have examined the effects of oxygen content and thickness in sputtered InSnO (ITO) electrodes, especially for the application of imperceptible amorphous-InGaZnO ( a -IGZO) thin-film transistors (TFTs) in humidity sensors. The imperceptible a -IGZO TFT with 50-nm ITO electrodes deposited at Ar:O₂ = 29:0.3 exhibited good electrical performances with V th of -0.23 V, SS of 0.34 V/dec, µ FE of 7.86 cm²/V∙s, on/off ratio of 8.8 × 10⁷, and has no degradation for bending stress up to a 3.5-mm curvature. The imperceptible oxide TFT sensors showed the highest sensitivity for the low and wide gate bias of -1~2 V under a wide range of relative humidity (40-90%) at drain voltage 1 V, resulting in low power consumption by the sensors. Exposure to water vapor led to a negative shift in the threshold voltage (or current enhancement), and an increase in relative humidity induced continuous threshold voltage shift. In particular, compared to conventional resistor-type sensors, the imperceptible oxide TFT sensors exhibited extremely high sensitivity from a current amplification of >10³.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pfeffer, H.; Saewert, G.
This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less
A Paramagnetic Molecular Voltmeter
Surek, Jack T.; Thomas, David D.
2008-01-01
We have developed a general electron paramagnetic resonance (EPR) method to measure electrostatic potential at spin labels on proteins to millivolt accuracy. Electrostatic potential is fundamental to energy-transducing proteins like myosin, because molecular energy storage and retrieval is primarily electrostatic. Quantitative analysis of protein electrostatics demands a site-specific spectroscopic method sensitive to millivolt changes. Previous electrostatic potential studies on macromolecules fell short in sensitivity, accuracy and/or specificity. Our approach uses fast-relaxing charged and neutral paramagnetic relaxation agents (PRAs) to increase nitroxide spin label relaxation rate solely through collisional spin exchange. These PRAs were calibrated in experiments on small nitroxides of known structure and charge to account for differences in their relaxation efficiency. Nitroxide longitudinal (R1) and transverse (R2) relaxation rates were separated by applying lineshape analysis to progressive saturation spectra. The ratio of measured R1 increases for each pair of charged and neutral PRAs measures the shift in local PRA concentration due to electrostatic potential. Voltage at the spin label is then calculated using the Boltzmann equation. Measured voltages for two small charged nitroxides agree with Debye-Hückel calculations. Voltage for spin-labeled myosin fragment S1 also agrees with calculation based on the pK shift of the reacted cysteine. PMID:17964835
Improved frequency/voltage converters for fast quartz crystal microbalance applications
NASA Astrophysics Data System (ADS)
Torres, R.; García, J. V.; Arnau, A.; Perrot, H.; Kim, L. To Thi; Gabrielli, C.
2008-04-01
The monitoring of frequency changes in fast quartz crystal microbalance (QCM) applications is a real challenge in today's instrumentation. In these applications, such as ac electrogravimetry, small frequency shifts, in the order of tens of hertz, around the resonance of the sensor can occur up to a frequency modulation of 1kHz. These frequency changes have to be monitored very accurately both in magnitude and phase. Phase-locked loop techniques can be used for obtaining a high performance frequency/voltage converter which can provide reliable measurements. Sensitivity higher than 10mV/Hz, for a frequency shift resolution of 0.1Hz, with very low distortion in tracking both the magnitude and phase of the frequency variations around the resonance frequency of the sensor are required specifications. Moreover, the resonance frequency can vary in a broad frequency range from 5to10MHz in typical QCM sensors, which introduces an additional difficulty. A new frequency-voltage conversion system based on a double tuning analog-digital phase-locked loop is proposed. The reported electronic characterization and experimental results obtained with conducting polymers prove its reliability for ac-electrogravimetry measurements and, in general, for fast QCM applications.
NASA Astrophysics Data System (ADS)
Wu, Shikai; Xiao, Rongshi
2015-04-01
The effects of laser radiation on the characteristics of the DC tungsten inert gas (TIG) arc were investigated by applying a high power slab CO2 laser and a Yb:YAG disc laser. Experiment results reveal that the arc voltage-current curve shifts downwards, the arc column expands, and the arc temperature rises while the high power CO2 laser beam vertically interacts with the TIG arc in argon. With the increase of the laser power, the voltage-current curve of the arc shifts downwards more significantly, and the closer the laser beam impingement on the arc to the cathode, the more the decrease in arc voltage. Moreover, the arc column expansion and the arc temperature rise occur mainly in the region between the laser beam incident position and the anode. However, the arc characteristics hardly change in the cases of the CO2 laser-helium arc and YAG laser-arc interactions. The reason is that the inverse Bremsstrahlung absorption coefficients are greatly different due to the different electron densities of the argon and helium arcs and the different wave lengths of CO2 and YAG lasers.
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L.; Thiel, Gerhard
2013-01-01
The modular architecture of voltage-gated K+ (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates KvSynth1, a functional voltage-gated, outwardly rectifying K+ channel. KvSynth1 displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V1/2 = +56 mV; z of ∼1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains. PMID:23440279
Hamilton, Elizabeth; Kaneene, John B; May, Katherine J; Kruger, John M; Schall, William; Beal, Matthew W; Hauptman, Joe G; DeCamp, Charles E
2012-06-15
To determine the prevalence and antimicrobial resistance of enterococci and staphylococci collected from environmental surfaces at a veterinary teaching hospital (VTH). Longitudinal study. Samples collected from surfaces in 5 areas (emergency and critical care, soft tissue and internal medicine, and orthopedic wards; surgery preparation and recovery rooms; and surgery office and operating rooms) of a VTH. Selected surfaces were swabbed every 3 months during the 3-year study period (2007 to 2009). Isolates of enterococci and staphylococci were identified via biochemical tests, and antimicrobial susceptibility was evaluated with a microbroth dilution technique. A subset of isolates was analyzed to assess clonality by use of pulsed-field gel electrophoresis. 430 samples were collected, and isolates of enterococci (n = 75) and staphylococci (110) were identified. Surfaces significantly associated with isolation of Enterococcus spp and Staphylococcus spp included cages and a weight scale. Fourteen Enterococcus spp isolates and 17 Staphylococcus spp isolates were resistant to ≥ 5 antimicrobials. Samples collected from the scale throughout the study suggested an overall increase in antimicrobial resistance of Enterococcus faecium over time. Clonality was detected for E faecium isolates collected from 2 different surfaces on the same day. Although not surprising, the apparent increase in antimicrobial resistance of E faecium was of concern because of the organism's ability to transmit antimicrobial resistance genes to other pathogens. Results reported here may aid in identification of critical control points to help prevent the spread of pathogens in VTHs.
NASA Astrophysics Data System (ADS)
Yang, Paul; Kim, Hyung Jun; Zheng, Hong; Beom, Geon Won; Park, Jong-Sung; Kang, Chi Jung; Yoon, Tae-Sik
2017-06-01
A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.
Yang, Paul; Jun Kim, Hyung; Zheng, Hong; Won Beom, Geon; Park, Jong-Sung; Jung Kang, Chi; Yoon, Tae-Sik
2017-06-02
A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.
Chen, Horng-Shyang; Liu, Zhan Hui; Shih, Pei-Ying; Su, Chia-Ying; Chen, Chih-Yen; Lin, Chun-Han; Yao, Yu-Feng; Kiang, Yean-Woei; Yang, C C
2014-04-07
A reverse-biased voltage is applied to either device in the vertical configuration of two light-emitting diodes (LEDs) grown on patterned and flat Si (110) substrates with weak and strong quantum-confined Stark effects (QCSEs), respectively, in the InGaN/GaN quantum wells for independently controlling the applied voltage across and the injection current into the p-i-n junction in the lateral configuration of LED operation. The results show that more carrier supply is needed in the LED of weaker QCSE to produce a carrier screening effect for balancing the potential tilt in increasing the forward-biased voltage, when compared with the LED of stronger QCSE. The small spectral shift range in increasing injection current in the LED of weaker QCSE is attributed not only to the weaker QCSE, but also to its smaller device resistance such that a given increment of applied voltage leads to a larger increment of injection current. From a viewpoint of practical application in LED operation, by applying a reverse-biased voltage in the vertical configuration, the applied voltage and injection current in the lateral configuration can be independently controlled by adjusting the vertical voltage for keeping the emission spectral peak fixed.
Ahern, Chris A; Vallejo, Paola; Mortenson, Lindsay; Coronado, Roberto
2001-01-01
Background The L-type Ca2+ channel formed by the dihydropyridine receptor (DHPR) of skeletal muscle senses the membrane voltage and opens the ryanodine receptor (RyR1). This channel-to-channel coupling is essential for Ca2+ signaling but poorly understood. We characterized a single-base frame-shift mutant of α1S, the pore subunit of the DHPR, that has the unusual ability to function voltage sensor for excitation-contraction (EC) coupling by virtue of expressing two complementary hemi-Ca2+ channel fragments. Results Functional analysis of cDNA transfected dysgenic myotubes lacking α1S were carried out using voltage-clamp, confocal Ca2+ indicator fluoresence, epitope immunofluorescence and immunoblots of expressed proteins. The frame-shift mutant (fs-α1S) expressed the N-terminal half of α1S (M1 to L670) and the C-terminal half starting at M701 separately. The C-terminal fragment was generated by an unexpected restart of translation of the fs-α1S message at M701 and was eliminated by a M701I mutation. Protein-protein complementation between the two fragments produced recovery of skeletal-type EC coupling but not L-type Ca2+ current. Discussion A premature stop codon in the II-III loop may not necessarily cause a loss of DHPR function due to a restart of translation within the II-III loop, presumably by a mechanism involving leaky ribosomal scanning. In these cases, function is recovered by expression of complementary protein fragments from the same cDNA. DHPR-RyR1 interactions can be achieved via protein-protein complementation between hemi-Ca2+ channel proteins, hence an intact II-III loop is not essential for coupling the DHPR voltage sensor to the opening of RyR1 channel. PMID:11806762
Yarov-Yarovoy, V; Brown, J; Sharp, E M; Clare, J J; Scheuer, T; Catterall, W A
2001-01-05
Mutations of amino acid residues in the inner two-thirds of the S6 segment in domain III of the rat brain type IIA Na(+) channel (G1460A to I1473A) caused periodic positive and negative shifts in the voltage dependence of activation, consistent with an alpha-helix having one face on which mutations to alanine oppose activation. Mutations in the outer one-third of the IIIS6 segment all favored activation. Mutations in the inner half of IIIS6 had strong effects on the voltage dependence of inactivation from closed states without effect on open-state inactivation. Only three mutations had strong effects on block by local anesthetics and anticonvulsants. Mutations L1465A and I1469A decreased affinity of inactivated Na(+) channels up to 8-fold for the anticonvulsant lamotrigine and its congeners 227c89, 4030w92, and 619c89 as well as for the local anesthetic etidocaine. N1466A decreased affinity of inactivated Na(+) channels for the anticonvulsant 4030w92 and etidocaine by 3- and 8-fold, respectively, but had no effect on affinity of the other tested compounds. Leu-1465, Asn-1466, and Ile-1469 are located on one side of the IIIS6 helix, and mutation of each caused a positive shift in the voltage dependence of activation. Evidently, these amino acid residues face the lumen of the pore, contribute to formation of the high-affinity receptor site for pore-blocking drugs, and are involved in voltage-dependent activation and coupling to closed-state inactivation.
von Stein, Richard T.
2012-01-01
Sodium channel inhibitor (SCI) insecticides selectively target voltage-gated sodium (Nav) channels in the slow-inactivated state by binding at or near the local anesthetic receptor within the sodium channel pore. Metaflumizone is a new insecticide for the treatment of fleas on domesticated pets and has recently been reported to block insect sodium channels in the slow-inactivated state, thereby implying that it is also a member of the SCI class. Using the two-electrode voltage-clamp technique, we examined metaflumizone inhibition of rat Nav1.4 sodium channels expressed in Xenopus laevis oocytes. Metaflumizone selectively inhibited Nav1.4 channels at potentials that promoted slow inactivation and shifted the voltage dependence of slow inactivation in the direction of hyperpolarization. Metaflumizone perfusion at a hyperpolarized holding potential also shifted the conductance-voltage curve for activation in the direction of depolarization and antagonized use-dependent lidocaine inhibition of fast-inactivated sodium channels, actions not previously observed with other SCI insecticides. We expressed mutated Nav1.4/F1579A and Nav1.4/Y1586A channels to investigate whether metaflumizone shares the domain IV segment S6 (DIV-S6) binding determinants identified for other SCI insecticides. Consistent with previous investigations of SCI insecticides on rat Nav1.4 channels, the F1579A mutation reduced sensitivity to block by metaflumizone, whereas the Y1586A mutation paradoxically increased the sensitivity to metaflumizone. We conclude that metaflumizone selectively inhibits slow-inactivated Nav1.4 channels and shares DIV-S6 binding determinants with other SCI insecticides and therapeutic drugs. However, our results suggest that metaflumizone interacts with resting and fast-inactivated channels in a manner that is distinct from other compounds in this insecticide class. PMID:22127519
Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S
2010-04-28
The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.
Effect of substrate thinning on the electronic transport characteristics of AlGaN/GaN HEMTs
NASA Astrophysics Data System (ADS)
Zhu, Hui; Meng, Xiao; Zheng, Xiang; Yang, Ying; Feng, Shiwei; Zhang, Yamin; Guo, Chunsheng
2018-07-01
We studied how substrate thinning affected the electronic transport characteristics of AlGaN/GaN HEMTs. By thinning their sapphire substrate from 460 μm to 80 μm, we varied the residual stress in these HEMTs. The thinned sample showed decreased drain-source current and occurrence of kink effect. Furthermore, shown by current transient measurements and time constant analysis, the detrapping behaviors of trap states shifted toward a larger time constant, and the detrapping behavior under the gate and in the gate-drain access region showed increased amplitude. By using pulsed current-voltage measurements, the thinned sample showed a positive shift of the threshold voltage, a decrease in peak transconductance, and an aggravation in current collapse, as compared with the thick one. The degradation of electrical behavior were associated with the structural degradation, as confirmed by the increase of pit density on the thinned sample surface.
Tunneling calculations for GaAs-Al(x)Ga(1-x)As graded band-gap sawtooth superlattices
NASA Technical Reports Server (NTRS)
Forrest, Kathrine; Meijer, Paul H. E.
1990-01-01
The transmission resonance spectra and tunneling current-voltage characteristics for direct conduction band electrons in sawtooth GaAs-Al(x)Ga(1-x)As superlattices are computed. Only direct-gap interfaces are considered. It is found that sawtooth superlattices exhibit resonant tunneling similar to that in step superlattices, manifested by correlation of peaks and regions of negative differential resistance in the current-voltage curves with transmission resonances. The Stark shift of the resonances of step-barrier superlattices is a linear function of the field, whereas in sawtooth superlattices under strong fields the shift is not a simple function of the field. This follows from the different ways in which the two structures deform under uniform electric fields: the sawtooth deforms into a staircase, at which field strength all barriers to tunneling are eradicated. The step-barrier superlattice always presents some barrier to tunneling, no matter how high the electric field strength.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Won Lee, Sang; Suh, Dongseok, E-mail: energy.suh@skku.edu; Department of Energy Science and Department of Physics, Sungkyunkwan University, Suwon 440-746
A prior requirement of any developed transistor for practical use is the stability test. Random network carbon nanotube-thin film transistor (CNT-TFT) was fabricated on SiO{sub 2}/Si. Gate bias stress stability was investigated with various passivation layers of HfO{sub 2} and Al{sub 2}O{sub 3}. Compared to the threshold voltage shift without passivation layer, the measured values in the presence of passivation layers were reduced independent of gate bias polarity except HfO{sub 2} under positive gate bias stress (PGBS). Al{sub 2}O{sub 3} capping layer was found to be the best passivation layer to prevent ambient gas adsorption, while gas adsorption on HfO{submore » 2} layer was unavoidable, inducing surface charges to increase threshold voltage shift in particular for PGBS. This high performance in the gate bias stress test of CNT-TFT even superior to that of amorphous silicon opens potential applications to active TFT industry for soft electronics.« less
1994-01-01
Previous studies reveal that the pH of the apoplastic solution in the guard cell walls may vary between 7.2 and 5.1 in closed and open stomata, respectively. During these aperture and pH changes, massive K+ fluxes cross the cellular plasma membrane driving the osmotic turgor and volume changes of guard cells. Therefore, we examined the effect of extracellular pH on the depolarization-activated K channels (KD channels), which constitute the K+ efflux pathway, in the plasma membrane of Vicia faba guard cell protoplasts. We used patch clamp, both in whole cells as well as in excised outside-out membrane patches. Approximately 500 KD channels, at least, could be activated by depolarization in one protoplast (density: approximately 0.6 micron-2). Acidification from ph 8.1 to 4.4 decreased markedly the whole-cell conductance, GK, of the KD channels, shifted its voltage dependence, GK- EM, to the right on the voltage axis, slowed the rate of activation and increased the rate of deactivation, whereas the single channel conductance was not affected significantly. Based on the GK-EM shifts, the estimated average negative surface charge spacing near the KD channel is 39 A. To quantify the effects of protons on the rates of transitions between the hypothesized conformational states of the channels, we fitted the experimental macroscopic steady state conductance-voltage relationship and the voltage dependence of time constants of activation and deactivation, simultaneously, with a sequential three-state model CCO. In terms of this model, protonation affects the voltage-dependent properties via a decrease in localized, rather than homogeneous, surface charge sensed by the gating moieties. In terms of either the CO or CCO model, the protonation of a site with a pKa of 4.8 decreases the voltage-independent number of channels, N, that are available for activation by depolarization. PMID:8035163
NASA Astrophysics Data System (ADS)
Deka, A. J.; Bharathi, P.; Pandya, K.; Bandyopadhyay, M.; Bhuyan, M.; Yadav, R. K.; Tyagi, H.; Gahlaut, A.; Chakraborty, A.
2018-01-01
The Doppler Shift Spectroscopy (DSS) diagnostic is in the conceptual stage to estimate beam divergence, stripping losses, and beam uniformity of the 100 keV hydrogen Diagnostics Neutral Beam of International Thermonuclear Experimental Reactor. This DSS diagnostic is used to measure the above-mentioned parameters with an error of less than 10%. To aid the design calculations and to establish a methodology for estimation of the beam divergence, DSS measurements were carried out on the existing prototype ion source RF Operated Beam Source in India for Negative ion Research. Emissions of the fast-excited neutrals that are generated from the extracted negative ions were collected in the target tank, and the line broadening of these emissions were used for estimating beam divergence. The observed broadening is a convolution of broadenings due to beam divergence, collection optics, voltage ripple, beam focusing, and instrumental broadening. Hence, for estimating the beam divergence from the observed line broadening, a systematic line profile analysis was performed. To minimize the error in the divergence measurements, a study on error propagation in the beam divergence measurements was carried out and the error was estimated. The measurements of beam divergence were done at a constant RF power of 50 kW and a source pressure of 0.6 Pa by varying the extraction voltage from 4 kV to10 kV and the acceleration voltage from 10 kV to 15 kV. These measurements were then compared with the calorimetric divergence, and the results seemed to agree within 10%. A minimum beam divergence of ˜3° was obtained when the source was operated at an extraction voltage of ˜5 kV and at a ˜10 kV acceleration voltage, i.e., at a total applied voltage of 15 kV. This is in agreement with the values reported in experiments carried out on similar sources elsewhere.
A study of charged particles/radiation damage to VLSI device materials
NASA Technical Reports Server (NTRS)
Okyere, John G.
1987-01-01
Future spacecraft systems such as the manned space station will be subjected to low-dose long term radiation particles. Most electronic systems are affected by such particles. There is therefore a great need to understand device physics and failure mechanisms affected by radiation and to design circuits that would be less susceptible to radiation. Using 2 MeV electron radiation and bias temperature aging, it was found that MOS capacitors that were prepositively biased have lower flatband voltage shift and lesser increase in density of surface state charge than those that were not prepositively biased. In addition, it was shown that there is continued recovery of flatband voltage and density of state charge in irradiated capacitors during both room temperature anneal and 137 degree anneal. When nMOS transistors were subjected to 1 MeV proton radiation, charge pumping and current versus voltage measurements indicated that transconductance degradation, threshold voltage shifts and changes in interface states density may be the primary cause of nMOS transistor failure after radiation. Simulation studies using SPICE were performed on CMOS SRAM cells of various transistor sizes. It is shown that transistor sizing affects the noise margins of CMOS SRAM cells, and that as the beta ratio of the transistors of the CMOS SRAM cell decreases, the effective noise margin of the SRAM cell increases. Some suggestions were made in connection with the design of CMOS SRAMS that are hardened against single event upsets.
NASA Astrophysics Data System (ADS)
Wang, Ruo Zheng; Wu, Sheng Li; Li, Xin Yu; Zhang, Jin Tao
2017-07-01
In this study, we set out to fabricate an amorphous indium gallium zinc oxide (a-IGZO) thin-film transistor (TFT) with SiNx/HfO2/SiNx (SHS) sandwiched dielectrics. The J-V and C-V of this SHS film were extracted by the Au/p-Si/SHS/Ti structure. At room temperature the a-IGZO with SHS dielectrics showed the following electrical properties: a threshold voltage of 2.9 V, a subthreshold slope of 0.35 V/decade, an on/off current ratio of 3.5 × 107, and a mobility of 12.8 cm2 V-1 s-1. Finally, we tested the influence of gate bias stress on the TFT, and the result showed that the threshold voltage shifted to a positive voltage when applying a positive gate voltage to the TFT.
Post, Richard F.
2016-02-23
A circuit-based technique enhances the power output of electrostatic generators employing an array of axially oriented rods or tubes or azimuthal corrugated metal surfaces for their electrodes. During generator operation, the peak voltage across the electrodes occurs at an azimuthal position that is intermediate between the position of minimum gap and maximum gap. If this position is also close to the azimuthal angle where the rate of change of capacity is a maximum, then the highest rf power output possible for a given maximum allowable voltage at the minimum gap can be attained. This rf power output is then coupled to the generator load through a coupling condenser that prevents suppression of the dc charging potential by conduction through the load. Optimized circuit values produce phase shifts in the rf output voltage that allow higher power output to occur at the same voltage limit at the minimum gap position.
Phosphatidic acid modulation of Kv channel voltage sensor function.
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-10-06
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid.
Investigation of the novel attributes in double recessed gate SiC MESFETs at drain side
NASA Astrophysics Data System (ADS)
Orouji, Ali A.; Razavi, S. M.; Ebrahim Hosseini, Seyed; Amini Moghadam, Hamid
2011-11-01
In this paper, the potential impact of drain side-double recessed gate (DS-DRG) on silicon carbide (SiC)-based metal semiconductor field effect transistors (MESFETs) is studied. We investigate the device performance focusing on breakdown voltage, threshold voltage, drain current and dc output conductance with two-dimensional and two-carrier device simulation. Our simulation results demonstrate that the channel thickness under the gate in the drain side is an important factor in the breakdown voltage. Also, the positive shift in the threshold voltage for the DS-DRG structure is larger in comparison with that for the source side-double recessed gate (SS-DRG) SiC MESFET. The saturated drain current for the DS-DRG structure is larger compared to that for the SS-DRG structure. The maximum dc output conductance in the DS-DRG structure is smaller than that in the SS-DRG structure.
Development of a digital solar simulator based on full-bridge converter
NASA Astrophysics Data System (ADS)
Liu, Chen; Feng, Jian; Liu, Zhilong; Tong, Weichao; Ji, Yibo
2014-02-01
With the development of solar photovoltaic, distribution schemes utilized in power grid had been commonly application, and photovoltaic (PV) inverter is an essential equipment in grid. In this paper, a digital solar simulator based on full-bridge structure is presented. The output characteristic curve of system is electrically similar to silicon solar cells, which can greatly simplify research methods of PV inverter, improve the efficiency of research and development. The proposed simulator consists on a main control board based on TM320F28335, phase-shifted zero-voltage-switching (ZVS) DC-DC full-bridge converter and voltage and current sampling circuit, that allows emulating the voltage-current curve with the open-circuit voltage (Voc) of 900V and the short-circuit current (Isc) of 18A .When the system connected to a PV inverter, the inverter can quickly track from the open-circuit to the maximum power point and keep stability.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lustikova, J., E-mail: lustikova@imr.tohoku.ac.jp; Shiomi, Y.; Handa, Y.
2015-02-21
We report on the deformation of microwave absorption spectra and of the inverse spin Hall voltage signals in thin film bilayers of yttrium iron garnet (YIG) and platinum at high microwave power levels in a 9.45-GHz TE{sub 011} cavity. As the microwave power increases from 0.15 to 200 mW, the resonance field shifts to higher values, and the initially Lorentzian spectra of the microwave absorption intensity as well as the inverse spin Hall voltage signals become asymmetric. The contributions from opening of the magnetization precession cone and heating of YIG cannot well reproduce the data. Control measurements of inverse spinmore » Hall voltages on thin-film YIG|Pt systems with a range of line widths underscore the role of spin-wave excitations in spectral deformation.« less
Advanced p-MOSFET Ionizing-Radiation Dosimeter
NASA Technical Reports Server (NTRS)
Buehler, Martin G.; Blaes, Brent R.
1994-01-01
Circuit measures total dose of ionizing radiation in terms of shift in threshold gate voltage of doped-channel metal oxide/semiconductor field-effect transistor (p-MOSFET). Drain current set at temperature-independent point to increase accuracy in determination of radiation dose.
NASA Astrophysics Data System (ADS)
Amrani, Aumeur El; Es-saghiri, Abdeljabbar; Boufounas, El-Mahjoub; Lucas, Bruno
2018-06-01
The performance of a pentacene based organic thin film transistor (OTFT) with polymethylmethacrylate as a dielectric insulator and indium tin oxide based electrical gate is investigated. On the one hand, we showed that the threshold voltage increases with gate voltage, and on the other hand that it decreases with drain voltage. Thus, we noticed that the onset voltage shifts toward positive voltage values with the drain voltage increase. In addition, threshold-onset differential voltage (TODV) is proposed as an original approach to estimate an averaged carrier density in pentacene. Indeed, a value of about 4.5 × 1016 cm-3 is reached at relatively high gate voltage of -50 V; this value is in good agreement with that reported in literature with other technique measurements. However, at a low applied gate voltage, the averaged pentacene carrier density remains two orders of magnitude lower; it is of about 2.8 × 1014 cm-3 and remains similar to that obtained from space charge limited current approach for low applied bias voltage of about 2.2 × 1014 cm-3. Furthermore, high IOn/IOff and IOn/IOnset current ratios of 5 × 106 and 7.5 × 107 are reported for lower drain voltage, respectively. The investigated OTFTs also showed good electrical performance including carrier mobility increasing with gate voltage; mobility values of 4.5 × 10-2 cm2 V-1 s-1 and of 4.25 × 10-2 cm2 V-1 s-1 are reached for linear and saturation regimes, respectively. These results remain enough interesting since current modulation ratio exceeds a value of 107 that is a quite important requirement than high mobility for some particular logic gate applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Bingjun; Soderlund, David M., E-mail: dms6@cornell.edu
We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased inmore » the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin shifted channel gating to hyperpolarized potentials. • The β1 subunit had opposite effects on the actions of tefluthrin and deltamethrin. • Auxiliary subunits are required for full reconstitution of channel function. • Channels in HEK293 cells exhibit properties similar to channels in neurons.« less
Analog circuit for controlling acoustic transducer arrays
Drumheller, Douglas S.
1991-01-01
A simplified ananlog circuit is presented for controlling electromechanical transducer pairs in an acoustic telemetry system. The analog circuit of this invention comprises a single electrical resistor which replaces all of the digital components in a known digital circuit. In accordance with this invention, a first transducer in a transducer pair of array is driven in series with the resistor. The voltage drop across this resistor is then amplified and used to drive the second transducer. The voltage drop across the resistor is proportional and in phase with the current to the transducer. This current is approximately 90 degrees out of phase with the driving voltage to the transducer. This phase shift replaces the digital delay required by the digital control circuit of the prior art.
An inductor-based converter with EMI reduction for low-voltage thermoelectric energy harvesting
NASA Astrophysics Data System (ADS)
Wang, Chuang; Zhao, Kai; Li, Zunchao
2017-07-01
This paper presents a self-powered inductor-based converter which harvests thermoelectric energy and boosts extremely low voltage to a typical voltage level for supplying body sensor nodes. Electromagnetic interference (EMI) of the converter is reduced by spreading spectrum of fundamental frequency and harmonics via pseudo-random modulation, which is obtained via combining the linear feedback shift register and digitally controlled oscillator. Besides, the methods, namely extracting energy near MPP and reducing the power dissipation, are employed to improve the power efficiency. The presented inductor-based converter is designed and verified in CSMC CMOS 0.18-µm 1P6M process. The results reveal that it achieves the high efficiency and EMI reduction at the same time.
Transport Signatures of Quasiparticle Poisoning in a Majorana Island.
Albrecht, S M; Hansen, E B; Higginbotham, A P; Kuemmeth, F; Jespersen, T S; Nygård, J; Krogstrup, P; Danon, J; Flensberg, K; Marcus, C M
2017-03-31
We investigate effects of quasiparticle poisoning in a Majorana island with strong tunnel coupling to normal-metal leads. In addition to the main Coulomb blockade diamonds, "shadow" diamonds appear, shifted by 1e in gate voltage, consistent with transport through an excited (poisoned) state of the island. Comparison to a simple model yields an estimate of parity lifetime for the strongly coupled island (∼1 μs) and sets a bound for a weakly coupled island (>10 μs). Fluctuations in the gate-voltage spacing of Coulomb peaks at high field, reflecting Majorana hybridization, are enhanced by the reduced lever arm at strong coupling. When converted from gate voltage to energy units, fluctuations are consistent with previous measurements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Junfeng; Institute of Materials Science, Darmstadt University of Technology, Petersenstr. 23, 64287 Darmstadt; Liao, Cheng, E-mail: Cliao@pku.edu.cn
2011-02-15
Graphical abstract: From XPS core level spectras, compared with as-depositing CdS (sample A), the Fermi level is shifting closer to the conduction band after annealing treatment in the oxygen (sample B) while it is shifting closer to the valence band after annealing treatment in the argon-hydrogen (sample C). That might be the main reason of the different performance of the final devices. The open circuit voltage of the CdS/CdTe solar cell increases when the CBD CdS is annealed with oxygen, while the performance of the solar cell decreases when the CBD CdS is annealed with argon-hydrogen. Research highlights: {yields} Twomore » different methods (oxidation and reduction) were used to anneal CdS films for CdTe solar cells. {yields} Electrical properties were analyzed by XPS (Fermi levels of CdS films). {yields} Annealing treatment in oxidation atmosphere could shift Fermi level of CdS film to higher position and consequently improve the CdS/CdTe junction and performance of solar cells. -- Abstract: CdS layers grown by chemical bath deposition (CBD) are annealed in the oxygen and argon-hydrogen atmosphere respectively. It has been found that the open circuit voltage of the CdS/CdTe solar cell increases when the CBD CdS is annealed with oxygen before the deposition of CdTe by close spaced sublimation (CSS), while the performance of the solar cell decreases when the CBD CdS is annealed with argon-hydrogen. Electronic properties of the CdS films are investigated using X-ray photo-electron spectroscopy (XPS), which indicates that the Fermi level is shifting closer to the conduction band after annealing in the oxygen and consequently a higher open circuit voltage of the solar cell can be obtained.« less
Computer-aided design comparisons of monolithic and hybrid MEM-tunable VCSELs
NASA Astrophysics Data System (ADS)
Ochoa, Edward M.; Nelson, Thomas R., Jr.; Blum-Spahn, Olga; Lott, James A.
2003-07-01
We report and use our micro-electro-mechanically tunable vertical cavity surface emitting laser (MEM-TVCSEL) computer-aided design methodology to investigate the resonant frequency design space for monolithic and hybrid MEM-TVCSELs. For various initial optical air gap thickness, we examine the sensitivity of monolithic or hybrid MEM-TVCSEL resonant frequency by simulating zero, two, and four percent variations in III-V material growth thickness. As expected, as initial optical airgap increases, tuning range decreases due to less coupling between the active region and the tuning mirror. However, each design has different resonant frequency sensitivity to variations in III-V growth parameters. In particular, since the monolithic design is comprised of III-V material, the shift in all growth thicknesses significantly shifts the resonant frequency response. However, for hybrid MEMTVCSELs, less shift results, since the lower reflector is an Au mirror with reflectivity independent of III-V growth variations. Finally, since the hybrid design is comprised of a MUMPS polysilicon mechanical actuator, pull-in voltage remains independent of the initial optical airgap between the tuning reflector and the III-V material. Conversely, as the initial airgap increases in the monolithic design, the pull-in voltage significantly increases.
Transmembrane potential measurements on plant cells using the voltage-sensitive dye ANNINE-6.
Flickinger, Bianca; Berghöfer, Thomas; Hohenberger, Petra; Eing, Christian; Frey, Wolfgang
2010-11-01
The charging of the plasma membrane is a necessary condition for the generation of an electric-field-induced permeability increase of the plasmalemma, which is usually explained by the creation and the growth of aqueous pores. For cells suspended in physiological buffers, the time domain of membrane charging is in the submicrosecond range. Systematic measurements using Nicotiana tabacum L. cv. Bright Yellow 2 (BY-2) protoplasts stained with the fast voltage-sensitive fluorescence dye ANNINE-6 have been performed using a pulsed laser fluorescence microscopy setup with a time resolution of 5 ns. A clear saturation of the membrane voltage could be measured, caused by a strong membrane permeability increase, commonly explained by enhanced pore formation, which prevents further membrane charging by external electric field exposure. The field strength dependence of the protoplast's transmembrane potential V (M) shows strong asymmetric saturation characteristics due to the high resting potential of the plants plasmalemma. At the pole of the hyperpolarized hemisphere of the cell, saturation starts at an external field strength of 0.3 kV/cm, resulting in a measured transmembrane voltage shift of ∆V(M) = -150 mV, while on the cathodic (depolarized) cell pole, the threshold for enhanced pore formation is reached at a field strength of approximately 1.0 kV/cm and ∆V(M) = 450 mV, respectively. From this asymmetry of the measured maximum membrane voltage shifts, the resting potential of BY-2 protoplasts at the given experimental conditions can be determined to V(R) = -150 mV. Consequently, a strong membrane permeability increase occurs when the membrane voltage diverges |V(M)| = 300 mV from the resting potential of the protoplast. The largest membrane voltage change at a given external electric field occurs at the cell poles. The azimuthal dependence of the transmembrane potential, measured in angular intervals of 10° along the circumference of the cell, shows a flattening and a slight decrease at higher fields at the pole region due to enhanced pore formation. Additionally, at the hyperpolarized cell pole, a polarization reversal could be observed at an external field range around 1.0 kV/cm. This behavior might be attributed to a fast charge transfer through the membrane at the hyperpolarized pole, e.g., by voltage-gated channels.
Upsets in Erased Floating Gate Cells With High-Energy Protons
Gerardin, S.; Bagatin, M.; Paccagnella, A.; ...
2017-01-01
We discuss upsets in erased floating gate cells, due to large threshold voltage shifts, using statistical distributions collected on a large number of memory cells. The spread in the neutral threshold voltage appears to be too low to quantitatively explain the experimental observations in terms of simple charge loss, at least in SLC devices. The possibility that memories exposed to high energy protons and heavy ions exhibit negative charge transfer between programmed and erased cells is investigated, although the analysis does not provide conclusive support to this hypothesis.
A Microwave Tunable Bandpass Filter for Liquid Crystal Applications
NASA Astrophysics Data System (ADS)
Cao, Weiping; Jiang, Di; Liu, Yupeng; Yang, Yuanwang; Gan, Baichuan
2017-07-01
In this paper, a novel microwave continuously tunable band-pass filter, based on nematic liquid crystals (LCs), is proposed. It uses liquid crystal (LC) as the electro-optic material to mainly realize frequency shift at microwave band by changing the dielectric anisotropy, when applying the bias voltage. According to simulation results, it achieves 840 MHz offset. Comparing to the existing tunable filter, it has many advantages, such as continuously tunable, miniaturization, low processing costs, low tuning voltage, etc. Thus, it has shown great potentials in frequency domain and practical applications in modern communication.
2009-12-22
b) From top to bottom, (i) AFM topograph of the p-i-n SiNW, (ii) plot of EFM phase-shift vs . position recorded along the nanowire axis and (iii...c) Current vs . applied voltage curve for a typical SiNW p-i-n junction at room temperature. (d) Current vs . applied reverse voltage data of a p-i...incident laser power. Iph vs . laser power (Figure 3c) measured at 22, 20 and 18 V show linear dependences with slopes of 1.16, 0.94 and 0.72 nA/μW
Ibrahim, Yehia M.; Smith, Richard D.
2016-01-26
An ion trap device is disclosed. The device includes a series of electrodes that define an ion flow path. A radio frequency (RF) field is applied to the series of electrodes such that each electrode is phase shifted approximately 180 degrees from an adjacent electrode. A DC voltage is superimposed with the RF field to create a DC gradient to drive ions in the direction of the gradient. A second RF field or DC voltage is applied to selectively trap and release the ions from the device. Further, the device may be gridless and utilized at high pressure.
Effect of Photogenerated Carriers on Ferroelectric Polarization Reversal
NASA Astrophysics Data System (ADS)
Weis, Martin; Li, Jun; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2011-12-01
Three non-symmetric switching peaks were observed in current-voltage (J-V) characteristic of the pentacene/poly(vinylidene fluoride-trifluoroethylene) double-layer device. However, upon illumination only two symmetric switching peaks appeared during the same J-V measurement. The similar difference between dark and illumination were also obtained in capacitance-voltage characteristics. These results showed the strong influence of internal fields by photogenerated carriers, which modifies the polarization reversal process of ferroelectric layer. The gradual shift of the polarization reversal with increase of illumination intensity is assigned to the space-charge field of trapped electrons.
An alternating voltage battery with two salt-water oscillators
NASA Astrophysics Data System (ADS)
Cervellati, Rinaldo; Soldà, Roberto
2001-05-01
We built a simple alternating voltage battery that periodically reverses value and sign of its electromotive force (emf). This battery consists of two coupled concentration salt-water oscillators that are phase shifted by initially extracting some drops of salt solution from one of the two oscillators. Although the actual frequency (period: ˜30 s) and emf (˜±55 mV) is low, our battery is suitable to demonstrate a practical application of oscillating systems in the physical, chemical, or biological laboratory for undergraduates. Interpretation of the phenomenon is given.
NASA Astrophysics Data System (ADS)
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Wang, Huiliang; Wei, Peng; Li, Yaoxuan; Han, Jeff; Lee, Hye Ryoung; Naab, Benjamin D.; Liu, Nan; Wang, Chenggong; Adijanto, Eric; Tee, Benjamin C.-K.; Morishita, Satoshi; Li, Qiaochu; Gao, Yongli; Cui, Yi; Bao, Zhenan
2014-01-01
Tuning the threshold voltage of a transistor is crucial for realizing robust digital circuits. For silicon transistors, the threshold voltage can be accurately controlled by doping. However, it remains challenging to tune the threshold voltage of single-wall nanotube (SWNT) thin-film transistors. Here, we report a facile method to controllably n-dope SWNTs using 1H-benzoimidazole derivatives processed via either solution coating or vacuum deposition. The threshold voltages of our polythiophene-sorted SWNT thin-film transistors can be tuned accurately and continuously over a wide range. Photoelectron spectroscopy measurements confirmed that the SWNT Fermi level shifted to the conduction band edge with increasing doping concentration. Using this doping approach, we proceeded to fabricate SWNT complementary inverters by inkjet printing of the dopants. We observed an unprecedented noise margin of 28 V at VDD = 80 V (70% of 1/2VDD) and a gain of 85. Additionally, robust SWNT complementary metal−oxide−semiconductor inverter (noise margin 72% of 1/2VDD) and logic gates with rail-to-rail output voltage swing and subnanowatt power consumption were fabricated onto a highly flexible substrate. PMID:24639537
Sodium channel dysfunction in intractable childhood epilepsy with generalized tonic–clonic seizures
Rhodes, Thomas H; Vanoye, Carlos G; Ohmori, Iori; Ogiwara, Ikuo; Yamakawa, Kazuhiro; George, Alfred L
2005-01-01
Mutations in SCN1A, the gene encoding the brain voltage-gated sodium channel α1 subunit (NaV1.1), are associated with genetic forms of epilepsy, including generalized epilepsy with febrile seizures plus (GEFS+ type 2), severe myoclonic epilepsy of infancy (SMEI) and related conditions. Several missense SCN1A mutations have been identified in probands affected by the syndrome of intractable childhood epilepsy with generalized tonic–clonic seizures (ICEGTC), which bears similarity to SMEI. To test whether ICEGTC arises from molecular mechanisms similar to those involved in SMEI, we characterized eight ICEGTC missense mutations by whole-cell patch clamp recording of recombinant human SCN1A heterologously expressed in cultured mammalian cells. Two mutations (G979R and T1709I) were non-functional. The remaining alleles (T808S, V983A, N1011I, V1611F, P1632S and F1808L) exhibited measurable sodium current, but had heterogeneous biophysical phenotypes. Mutant channels exhibited lower (V983A, N1011I and F1808L), greater (T808S) or similar (V1611F and P1632S) peak sodium current densities compared with wild-type (WT) SCN1A. Three mutations (V1611F, P1632S and F1808L) displayed hyperpolarized conductance–voltage relationships, while V983A exhibited a strong depolarizing shift in the voltage dependence of activation. All mutants except T808S had hyperpolarized shifts in the voltage dependence of steady-state channel availability. Three mutants (V1611F, P1632S and F1808L) exhibited persistent sodium current ranging from ∼1–3% of peak current amplitude that was significantly greater than WT-SCN1A. Several mutants had impaired slow inactivation, with V983A showing the most prominent effect. Finally, all of the functional alleles exhibited reduced use-dependent channel inhibition. In summary, SCN1A mutations associated with ICEGTC result in a wide spectrum of biophysical defects, including mild-to-moderate gating impairments, shifted voltage dependence and reduced use dependence. The constellation of biophysical abnormalities for some mutants is distinct from those previously observed for GEFS+ and SMEI, suggesting possible, but complex, genotype–phenotype correlations. PMID:16210358
Liu, Guoxia; Zakharov, Sergey I.; Yao, Yongneng
2015-01-01
The large-conductance, voltage- and Ca2+-gated K+ (BK) channel consists of four α subunits, which form a voltage- and Ca2+-gated channel, and up to four modulatory β subunits. The β1 subunit is expressed in smooth muscle, where it slows BK channel kinetics and shifts the conductance–voltage (G-V) curve to the left at [Ca2+] > 2 µM. In addition to the six transmembrane (TM) helices, S1–S6, conserved in all voltage-dependent K+ channels, BK α has a unique seventh TM helix, S0, which may contribute to the unusual rightward shift in the G-V curve of BK α in the absence of β1 and to a leftward shift in its presence. Such a role is supported by the close proximity of S0 to S3 and S4 in the voltage-sensing domain. Furthermore, on the extracellular side of the membrane, one of the two TM helices of β1, TM2, is adjacent to S0. We have now analyzed induced disulfide bond formation between substituted Cys residues on the cytoplasmic side of the membrane. There, in contrast, S0 is closest to the S2–S3 loop, from which position it is displaced on the addition of β1. The cytoplasmic ends of β1 TM1 and TM2 are adjacent and are located between the S2–S3 loop of one α subunit and S1 of a neighboring α subunit and are not adjacent to S0; i.e., S0 and TM2 have different trajectories through the membrane. In the absence of β1, 70% of disulfide bonding of W43C (S0) and L175C (S2–S3) has no effect on V50 for activation, implying that the cytoplasmic end of S0 and the S2–S3 loop move in concert, if at all, during activation. Otherwise, linking them together in one state would obstruct the transition to the other state, which would certainly change V50. PMID:25667410
Ionic currents in the guinea-pig taenia coli.
Inomata, H; Kao, C Y
1976-01-01
Short segments of portions of taenia coli of the guinea-pig averaging 54 mum X 219 mum X ca. 200 mum have been studied by a double sucrose-gap voltage-clamp technique. 2. The average total capacitance was 0-4 muF, corresponding to approximately 10(4) cells, if a specific membrane capacitance of 3 muF/cm2 were assumed. 3. A significant resistance, averaging 11-4omega, was in series with the membrane, and seriously limited the accuracy of the voltage control possible. 4. On depolarization, an early transient inward current was followed by a late maintained outwary current. 5. The late current was carried mainly by K+, because its direction could be reversed if the preparation were first depolarized in isotonic K2SO4 and held back to the original resting potential. 6. After appropriate corrections for residual capacitative and leakage currents, a reversal potential for the late current (Eb) was determined to be 15-20 mV more negative than the natural resting potential. It was not affected by the amplitude or the duration of the activating voltage step, but could be changed by prolonged applications of holding current. 7. At rest, the ratio of PNa:PK was 0-16:1; for Eb it was 0-05:1. 8. The reversal potential for the transient early inward current (Ea) averaged 22 mV in Krebs-bicarbonate solution, but was shifted to about 35 mV when the late current was first suppressed with tetraethylammonium ion. The shift suggested that there was some overlap of the early and late currents. 9. Reduction of [Na+]o to 50% of normal, or replacement of all Na+ with dimethyldiethanol ammonium ion and choline ion, failed to cause any significant shifts in the reversal potential of the early current or reduce the magnitude of the early current. 10. Reduction of [Ca2+]o to 0-25 or 0-1 of the normal caused shifts of the Ea toward the negative and reductions in the early current. These changes can occur without changes in the maximum chord conductance of the early current, such as might happen in ordinary Krebs-bicarbonate solution, or in preparations which had been depolarized by prior treatment with isotonic K2SO4 and then held back to the original membrane voltage. 11. Increase of [Ca2+]o to 5 times normal increased the early inward current, and the maximum chord conductances of the early and late currents, but did not shift the Ea. 12. In preparations pretreated with TEA, increasing [Ca2+]o to 5 times normal shifted Ea toward 45 mV. 13. The various observations are interpreted to mean that the early current in the taenia coli is carried principally by influx of Ca2+, and not by Na+. PMID:1255524
Origin of the transition voltage in gold-vacuum-gold atomic junctions.
Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin
2013-01-18
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments.
Microstructure of a-C:H films prepared on a microtrench and analysis of ions and radicals behavior
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hirata, Yuki; Choi, Junho, E-mail: choi@mech.t.u-tokyo.ac.jp
2015-08-28
Amorphous carbon films (a-C:H) were prepared on a microtrench (4-μm pitch and 4-μm depth), and the uniformity of film thickness and microstructure of the films on the top, sidewall, and bottom surfaces of the microtrench were evaluated by scanning electron microscopy and Raman spectroscopy. The a-C:H films were prepared by bipolar-type plasma based ion implantation and deposition (bipolar PBII&D), and the negative pulse voltage, which is the main parameter dominating the film structure, was changed from −1.0 to −15 kV. Moreover, the behavior of ions and radicals was analyzed simultaneously by combining the calculation methods of Particle-In-Cell/Monte Carlo Collision (PIC-MCC) andmore » Direct Simulation Monte Carlo (DSMC) to investigate the coating mechanism for the microtrench. The results reveal that the thickness uniformity of a-C:H films improves with decreasing negative pulse voltage due to the decreasing inertia of incoming ions from the trench mouth, although the film thickness on the sidewall tends to be much smaller than that on the top and bottom surfaces of the trench. The normalized flux and the film thickness show similar behavior, i.e., the normalized flux or thickness at the bottom surface increases at low negative pulse voltages and then saturates at a certain value, whereas at the sidewall it monotonically decreases with increasing negative voltage. The microstructure of a-C:H films on the sidewall surface is very different from that on the top and bottom surfaces. The film structure at a low negative pulse voltage shifts to more of a polymer-like carbon (PLC) structure due to the lower incident energy of ions. Although the radical flux on the sidewall increases slightly, the overall film structure is not significantly changed because this film formation at a low negative voltage is originally dominated by radicals. On the other hand, the flux of radicals is dominant on the sidewall in the case of high negative pulse voltage, resulting in a deviation from the Raman behavior of a-C:H films deposited by bipolar PBII&D. This tendency intensifies as the negative voltage becomes greater. Also, the energy of incident ions on the sidewall of the trench increases with increasing negative voltage, which causes a shift in the Raman data of the sidewall to the bottom right corner on the figure depicting the relationship of the FWHM(G) and the G-peak position, indicating increased graphitization of a-C:H film.« less
Microstructure of a-C:H films prepared on a microtrench and analysis of ions and radicals behavior
NASA Astrophysics Data System (ADS)
Hirata, Yuki; Choi, Junho
2015-08-01
Amorphous carbon films (a-C:H) were prepared on a microtrench (4-μm pitch and 4-μm depth), and the uniformity of film thickness and microstructure of the films on the top, sidewall, and bottom surfaces of the microtrench were evaluated by scanning electron microscopy and Raman spectroscopy. The a-C:H films were prepared by bipolar-type plasma based ion implantation and deposition (bipolar PBII&D), and the negative pulse voltage, which is the main parameter dominating the film structure, was changed from -1.0 to -15 kV. Moreover, the behavior of ions and radicals was analyzed simultaneously by combining the calculation methods of Particle-In-Cell/Monte Carlo Collision (PIC-MCC) and Direct Simulation Monte Carlo (DSMC) to investigate the coating mechanism for the microtrench. The results reveal that the thickness uniformity of a-C:H films improves with decreasing negative pulse voltage due to the decreasing inertia of incoming ions from the trench mouth, although the film thickness on the sidewall tends to be much smaller than that on the top and bottom surfaces of the trench. The normalized flux and the film thickness show similar behavior, i.e., the normalized flux or thickness at the bottom surface increases at low negative pulse voltages and then saturates at a certain value, whereas at the sidewall it monotonically decreases with increasing negative voltage. The microstructure of a-C:H films on the sidewall surface is very different from that on the top and bottom surfaces. The film structure at a low negative pulse voltage shifts to more of a polymer-like carbon (PLC) structure due to the lower incident energy of ions. Although the radical flux on the sidewall increases slightly, the overall film structure is not significantly changed because this film formation at a low negative voltage is originally dominated by radicals. On the other hand, the flux of radicals is dominant on the sidewall in the case of high negative pulse voltage, resulting in a deviation from the Raman behavior of a-C:H films deposited by bipolar PBII&D. This tendency intensifies as the negative voltage becomes greater. Also, the energy of incident ions on the sidewall of the trench increases with increasing negative voltage, which causes a shift in the Raman data of the sidewall to the bottom right corner on the figure depicting the relationship of the FWHM(G) and the G-peak position, indicating increased graphitization of a-C:H film.
A 6 kV arbitrary waveform generator for the Tevatron Electron Lens
Pfeffer, H.; Saewert, G.
2011-11-09
This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less
NASA Astrophysics Data System (ADS)
Hosoi, Takuji; Kutsuki, Katsuhiro; Okamoto, Gaku; Saito, Marina; Shimura, Takayoshi; Watanabe, Heiji
2009-05-01
Improvement in electrical properties of thermally grown GeO2/Ge metal-oxide-semiconductor (MOS) capacitors, such as significantly reduced flatband voltage (VFB) shift, small hysteresis, and minimized minority carrier response in capacitance-voltage (C-V) characteristics, has been demonstrated by in situ low temperature vacuum annealing prior to gate electrode deposition. Thermal desorption analysis has revealed that not only water but also hydrocarbons are easily infiltrated into GeO2 layers during air exposure and desorbed at around 300 °C, indicating that organic molecules within GeO2/Ge MOS structures are possible origins of electrical defects. The inversion capacitance, indicative of minority carrier generation, increases with air exposure time for Au/GeO2/Ge MOS capacitors, while maintaining an interface state density (Dit) of about a few 1011 cm-2 eV-1. Unusual increase in inversion capacitance was found to be suppressed by Al2O3 capping (Au/Al2O3/GeO2/Ge structures). This suggests that electrical defects induced outside the Au electrode by infiltrated molecules may enhance the minority carrier generation, and thus acting as a minority carrier source just like MOS field-effect transistors.
Yuan, Huijun; Lan, Tonghan; Lin, Jiarui
2005-01-01
Nano-Selenium, a novel Nano technology production, was demonstrated to be useful in medical and scientific researches. Here, we investigated the effects of Nano-Selenium on tetrodotoxin-sensitive (TTX-S) voltage-dependent Na+channels in isolated rat dorsal root ganglion neurons, using whole-cell patch-clamp method. Nano-Selenium irreversibly decreased TTX-S Na+current (I
Combine Flash-Based FPGA TID and Long-Term Retention Reliabilities Through VT Shift
NASA Astrophysics Data System (ADS)
Wang, Jih-Jong; Rezzak, Nadia; Dsilva, Durwyn; Xue, Fengliang; Samiee, Salim; Singaraju, Pavan; Jia, James; Nguyen, Victor; Hawley, Frank; Hamdy, Esmat
2016-08-01
Reliability test results of data retention and total ionizing dose (TID) in 65 nm Flash-based field programmable gate array (FPGA) are presented. Long-chain inverter design is recommended for reliability evaluation because it is the worst case design for both effects. Based on preliminary test data, both issues are unified and modeled by one natural decay equation. The relative contributions of TID induced threshold-voltage shift and retention mechanisms are evaluated by analyzing test data.
Electro-optic voltage sensor for sensing voltage in an E-field
Davidson, James R.; Crawford, Thomas M.; Seifert, Gary D.
2002-03-26
A miniature electro-optic voltage sensor and system capable of accurate operation at high voltages has a sensor body disposed in an E-field. The body receives a source beam of electromagnetic radiation. A polarization beam displacer separates the source light beam into two beams with orthogonal linear polarizations. A wave plate rotates the linear polarization to rotated polarization. A transducer utilizes Pockels electro-optic effect and induces a differential phase shift on the major and minor axes of the rotated polarization in response to the E-field. A prism redirects the beam back through the transducer, wave plate, and polarization beam displacer. The prism also converts the rotated polarization to circular or elliptical polarization. The wave plate rotates the major and minor axes of the circular or elliptical polarization to linear polarization. The polarization beam displacer separates the beam into two beams of orthogonal linear polarization representing the major and minor axes. The system may have a transmitter for producing the beam of electro-magnetic radiation; a detector for converting the two beams into electrical signals; and a signal processor for determining the voltage.
Design and construction of a home-made and cheaper argon arc lamp
NASA Astrophysics Data System (ADS)
Sabaeian, Mohammad; Nazari-Tarkarani, Zeinab; Ebrahimzadeh, Azadeh
2018-05-01
The authors report on the design and construction of an argon arc lamp which provides noticeably a cheaper instrument for laser and medical applications. Cesium-doped tungsten and pure tungsten rods were used, respectively, for the lamp cathode and anode. To seal the glassy tube, a 50-50 Fe-Ni alloy was successfully used as a medium to attach the tungsten electrodes to the borosilicate glass tube. Starting voltage of the lamp versus the gas pressure, operation voltage-current diagram at various gas pressures, and lamp spectrum in the various pressures were measured. A comparison was made with krypton arc lamp. The lamp operation was satisfactory without any crack or fracture during lightening operation. The results showed that the lamp-lightening threshold voltage depends linearly on the pressure and arc length in such a way that there is an increase in the voltage by raising these two parameters. We have also observed that by increasing the argon pressure, there is a shifting in emission spectrum from the ultraviolet to the visible region. Comparison with krypton arc lamp indicated that argon lamp needs a higher threshold lightening voltage.
Meshik, Xenia; Choi, Min; Baker, Adam; Malchow, R Paul; Covnot, Leigha; Doan, Samuel; Mukherjee, Souvik; Farid, Sidra; Dutta, Mitra; Stroscio, Michael A
2017-04-01
This study examines the ability of optically-excited titanium dioxide nanoparticles to influence voltage-gated ion channels in retinal horizontal cells. Voltage clamp recordings were obtained in the presence and absence of TiO 2 and ultraviolet laser excitation. Significant current changes were observed in response to UV light, particularly in the -40 mV to +40 mV region where voltage-gated Na + and K + channels have the highest conductance. Cells in proximity to UV-excited TiO 2 exhibited a left-shift in the current-voltage relation of around 10 mV in the activation of Na + currents. These trends were not observed in control experiments where cells were excited with UV light without being exposed to TiO 2 . Electrostatic force microscopy confirmed that electric fields can be induced in TiO 2 with UV light. Simulations using the Hodgkin-Huxley model yielded results which agreed with the experimental data and showed the I-V characteristics of individual ion channels in the presence of UV-excited TiO 2 . Copyright © 2016 Elsevier Inc. All rights reserved.
Action of certain tropine esters on voltage-clamped lobster axon.
Blaustein, M P
1968-03-01
Tropine p-tolylacetate (TPTA) and its quaternary analogue, tropine p-tolylacetate methiodide (TPTA MeI) decrease the early transient (Na) and late (K) currents in the voltage-clamped lobster giant axon. These agents, which block the nerve action potential, reduce the maximum Na and K conductance increases associated with membrane depolarization. They also slow the rate at which the sodium conductance is increased and shift the (normalized) membrane conductance vs. voltage curves in the direction of depolarization along the voltage axis. All these effects are qualitatively similar to those resulting from the action of procaine on the voltage-clamped axon. One unusual effect of the tropine esters, noticeable particularly at large depolarization steps, is that they cause the late, K current to reach a peak and then fall off with increasing pulse duration. This effect has not been reported to occur as a result of procaine action. Tropine p-chlorophenyl acetate (TPClphiA), which differs from TPTA only by the substitution of a p-Cl for a p-CH(3) group on the benzene ring, had a negligible effect on axonal excitability.
Action of Certain Tropine Esters on Voltage-Clamped Lobster Axon
Blaustein, M. P.
1968-01-01
Tropine p-tolylacetate (TPTA) and its quaternary analogue, tropine p-tolylacetate methiodide (TPTA MeI) decrease the early transient (Na) and late (K) currents in the voltage-clamped lobster giant axon. These agents, which block the nerve action potential, reduce the maximum Na and K conductance increases associated with membrane depolarization. They also slow the rate at which the sodium conductance is increased and shift the (normalized) membrane conductance vs. voltage curves in the direction of depolarization along the voltage axis. All these effects are qualitatively similar to those resulting from the action of procaine on the voltage-clamped axon. One unusual effect of the tropine esters, noticeable particularly at large depolarization steps, is that they cause the late, K current to reach a peak and then fall off with increasing pulse duration. This effect has not been reported to occur as a result of procaine action. Tropine p-chlorophenyl acetate (TPClφA), which differs from TPTA only by the substitution of a p-Cl for a p-CH3 group on the benzene ring, had a negligible effect on axonal excitability. PMID:5648830
Yamaguchi, Shinji; Kurokawa, Tatsuki; Taira, Ikuko; Aoki, Naoya; Sakata, Souhei; Okamura, Yasushi; Homma, Koichi J
2014-04-01
Voltage-sensing phosphatase, VSP, consists of the transmembrane domain, operating as the voltage sensor, and the cytoplasmic domain with phosphoinositide-phosphatase activities. The voltage sensor tightly couples with the cytoplasmic phosphatase and membrane depolarization induces dephosphorylation of several species of phosphoinositides. VSP gene is conserved from urochordate to human. There are some diversities among VSP ortholog proteins; range of voltage of voltage sensor motions as well as substrate selectivity. In contrast with recent understandings of biophysical mechanisms of VSPs, little is known about its physiological roles. Here we report that chick ortholog of VSP (designated as Gg-VSP) induces morphological feature of cell process outgrowths with round cell body in DF-1 fibroblasts upon its forced expression. Expression of the voltage sensor mutant, Gg-VSPR153Q with shifted voltage dependence to a lower voltage led to more frequent changes of cell morphology than the wild-type protein. Coexpression of PTEN that dephosphorylates PI(3,4)P2 suppressed this effect by Gg-VSP, indicating that the increase of PI(3,4)P2 leads to changes of cell shape. In addition, visualization of PI(3,4)P2 with the fluorescent protein fused with the TAPP1-derived pleckstrin homology (PH) domain suggested that Gg-VSP influenced the distribution of PI(3,4)P2 . These findings raise a possibility that one of the VSP's functions could be to regulate cell morphology through voltage-sensitive tuning of phosphoinositide profile. © 2013 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Samnakay, Rameez; Balandin, Alexander A.; Srinivasan, Purushothaman
2017-09-01
Bias temperature instability (BTI) is one of the critical device degradation mechanisms in poly-Si/SiON and metal gate/high-k complementary metal-oxide-semiconductor (CMOS) technologies. Using the pre- and post-BTI flicker noise measurements, we investigated the bulk trap density, Nt, in both of these technologies. The low-frequency noise spectra were predominantly of 1/fγ type with γ < 1 for NMOS and ∼1 for PMOS. For SiON based technologies, the lower VTH degradation due to PBTI was noticed while considerable VTH degradation was observed for NBTI in both SiON and MGHK technologies. Both MGHK and SiON pFETs show a clear increase in the effective volume trap density, Nt, after NBTI. The increase in Nt in MGHK n-MOSFETs during PBTI is markedly higher than that in MGHK p-MOSFETs during NBTI. From 2012-2016 he was a Research Assistant with the Nano-Device Laboratory at the University of California - Riverside, as well as a member of the Quality and Reliability engineering team at Globalfoundries, Inc. during the summer of 2014. He has currently authored or co-authored 10 journal publications and numerous conference presentations. His current research interests include 1/f noise in high-k dielectrics and fabricated 2D van der Waal thin-film devices Mr. Samnakay's awards and honors include the Dean's Distinguished Fellowship Award (University of California-Riverside) and induction into the IEEE-HKN honors society. He also serves as a reviewer for 6 journals including Applied Physics Letters, Journal of Physics: Condensed Matter and Nanotechnology journals.
A comparative study of charge movement in rat and frog skeletal muscle fibres.
Hollingworth, S; Marshall, M W
1981-12-01
1. The middle of the fibre voltage--clamp technique (Adrian & Marshall, 1977), modified where necessary for electrically short muscle fibres, has been used to measure non-linear charge movements in mammalian fast twitch (rat extensor digitorum longus), mammalian slow twitch (rat soleus) and frog (sartorius) muscles. 2. The maximum amount of charge moved in mammalian fast twitch muscle at 2 degrees C in hypertonic solution, was 3--5 times greater than in slow twitch muscle. The voltage distribution of fast twitch charge was 10--15 mV more positive when compared to slow twitch. 3. In both mammalian muscle types hypertonic Ringer solution negatively shifted the voltage distribution of charge some 6 mV. The steepness of charge moved around mechanical threshold was unaffected by hypertonicity. 4. The amount of charge in frog sartorius fibres at 2 degrees C in hypertonic solution was about half of that in rat fast twitch muscle; the voltage distribution of the frog charge was similar to rat soleus muscle. 5. Warming between 2 and 15 degrees C had no effect on either the amount of steady-state distribution of charge in mammalian or frog muscles. 6. At 2 degrees C, the kinetics of charge movement in fast and slow twitch mammalian muscles were similar and 2--3 times faster than frog muscle at the same temperature. In fast and slow mammalian fibres at 2 degrees C similar times were taken to shift the same fractions of the total amount of charge. The Q10 of charge movement kinetics was between 1.2 and 2.0 in the three muscles studied.
Rodgers, EW; Krenz, W-D; Baro, DJ
2012-01-01
Neuromodulatory effects can vary with their mode of transmission. Phasic release produces local and transient increases in dopamine (DA) up to micromolar concentrations. Additionally, since DA is released from open synapses and reuptake mechanisms are not nearby, tonic nanomolar DA exists in the extracellular space. Do phasic and tonic transmissions similarly regulate voltage dependent ionic conductances in a given neuron? It was previously shown that DA could immediately alter the transient potassium current (IA) of identified neurons in the stomatogastric ganglion (STG) of the spiny lobster, Panulirus interruptus. Here we show that DA can also persistently alter IA, and that DA’s immediate and persistent effects oppose one another. The lateral pyloric neuron (LP) exclusively expresses type 1 DA receptors (D1Rs). Micromolar DA produces immediate depolarizing shifts in the voltage dependence of LP IA, whereas tonic nanomolar DA produces a persistent increase in LP IA maximal conductance (Gmax) through a translation dependent mechanism involving target of rapamycin (TOR). The pyloric dilator neuron (PD) exclusively expresses type 2 DA receptors (D2Rs). Micromolar DA produces an immediate hyperpolarizing shift in PD IA voltage dependence of activation, whereas tonic DA persistently decreases PD IA Gmax through a translation dependent mechanism not involving TOR. The persistent effects on IA Gmax do not depend on LP or PD activity. These data suggest a role for tonic modulators in the regulation of voltage gated ion channel number; and furthermore, that dopaminergic systems may be organized to limit the amount of change they can impose on a circuit. PMID:21917788
Using Passive Two-Port Networks to Study the Forced Vibrations of Piezoceramic Transducers
NASA Astrophysics Data System (ADS)
Karlash, V. L.
2017-09-01
A generalization and subsequent development of experimental techniques, including methods of studying the phase-frequency relations between the measured components of admittance and instantaneous power are considered. The conditions of electric loading where electric currents, voltages, or instantaneous powers of constant amplitude in the piezoresonators are specified are numerically modeled. It is particularly established that the advanced Mason circuit with additional switch allows acquiring much more data on the forced vibrations of piezoceramic transducers than the classical circuit. The measured (at an arbitrary frequency) voltage drop across the piezoelement, its pull-up resistor, and at the input of the measuring circuit allow determining, with high accuracy, the current, conductivity, impedance, instantaneous power, and phase shifts when the amplitudes of electric current and voltage are given.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Taewoong; Seong, Tae-Yeon; School of Materials Science and Engineering, Korea University, Seoul 136-713
Efficiency droop is a phenomenon in which the efficiency of a light-emitting diode (LED) decreases with the increase in current density. To analyze efficiency droop, direct experimental observations on the energy conversion occurring inside the LED is required. Here, we present the measured voltage profiles on the cross section of an operating LED and analyze them with the cross-sectional temperature profiles obtained in a previous study under the same operation conditions. The measured voltage profiles suggest that with increases in the injection current density, electron depletion shifts from the multi-quantum well through an electron blocking layer to the p-GaN region.more » This is because electron leakage increases with increases in current density.« less
Acidic pH modulation of Na+ channels in trigeminal mesencephalic nucleus neurons.
Kang, In-Sik; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung
2016-12-07
Cell bodies of trigeminal mesencephalic nucleus (Vmes) neurons are located within the central nervous system, and therefore, peripheral as well as central acidosis can modulate the excitability of Vmes neurons. Here, we report the effect of acidic pH on voltage-gated Na channels in acutely isolated rat Vmes neurons using a conventional whole-cell patch clamp technique. Acidic pH (pH 6.0) slightly but significantly shifted both the activation and steady-state fast inactivation relationships toward depolarized potentials. However, acidic pH (pH 6.0) had a minor effect on the inactivation kinetics of voltage-gated Na channels. Less sensitivity of voltage-gated Na channels to acidic pH may allow Vmes neurons to transduce the precise proprioceptive information even under acidic pH conditions.
Artificial phosphorylation sites modulate the activity of a voltage-gated potassium channel
NASA Astrophysics Data System (ADS)
Ariyaratne, Amila; Zocchi, Giovanni
2015-03-01
The KvAP potassium channel is representative of a family of voltage-gated ion channels where the membrane potential is sensed by a transmembrane helix containing several positively charged arginines. Previous work by Wang and Zocchi [A. Wang and G. Zocchi, PLoS ONE 6, e18598 (2011), 10.1371/journal.pone.0018598] showed how a negatively charged polyelectrolyte attached in proximity to the voltage sensing element can bias the opening probability of the channel. Here we introduce three phosphorylation sites at the same location and show that the response curve of the channel shifts by about 20 mV upon phosphorylation, while other characteristics such as the single-channel conductance are unaffected. In summary, we construct an artificial phosphorylation site which confers allosteric regulation to the channel.
Redundancy Technology With A Focused Ion Beam
NASA Astrophysics Data System (ADS)
Komano, Haruki; Hashimoto, Kazuhiko; Takigawa, Tadahiro
1989-08-01
Fuse cutting with a focused ion beam to activate redundancy circuits is proposed. In order to verify its potential usefulness, experiments have been performed. Fuse-cutting time was evaluated using aluminum fuses with a thin passivation layer, which are difficult to cut by conventional laser-beam technology due to the material's high reflectivity. The fuse width and thickness were 2 and 0.8 μm, respectively. The fuse was cut in 5 seconds with a 30 keV focused ion beam of 0.3 A/cm2 current density. Since the fuses used in DRAMs will be smaller, their cutting time will become shorter by scanning an ion beam on narrower areas. Moreover, it can be shortened by increasing current density. Fuses for redundancy technology in 256 k CMOS SRAMs were cut with a focused ion beam. The operation of the memories was checked with a memory tester. It was confirmed that memories which had failure cells operated normally after focused-ion-beam fuse-cutting. Focused ion beam irradiation effects upon a device have been studied. When a 30 keV gallium focused ion beam was irradiated near the gate of MOSFETs, a threshold voltage shift was not observed at an ion dose of 0.3 C/cm2 which corresponded to the ion dose in cutting a fuse. However, when irradiated on the gate, a threshold voltage shift was observed at ion doses of more than 8 x 10-4 C/cm2. The voltage shift was caused by the charge of ions within the passivation layer. It is necessary at least not to irradiate a focused ion beam on a device in cutting fuses. It is concluded that the focused-ion-beam method will be advantageous for future redundancy technology application.
High transconductance zinc oxide thin-film transistors on flexible plastic substrates
NASA Astrophysics Data System (ADS)
Kimura, Yuta; Higaki, Tomohiro; Maemoto, Toshihiko; Sasa, Shigehiko; Inoue, Masataka
2012-02-01
We report the fabrication and characterization on high-performance ZnO based TFTs on unheated plastic substrate. ZnO films were grown by pulsed laser deposition (PLD) on polyethylene napthalate (PEN) substrates. Top-gate ZnO-TFTs were fabricated by photolithography and wet chemical etching. The source and drain contacts were formed by lift-off of e-beam deposited Ti(20 nm)/Au(200 nm). An HfO2 with thickness 100 nm was selected as the gate insulator, and top gate electrode Ti(20 nm)/Au(200 nm) was deposited by e-beam evaporation. We prepared a set of the structure with SiO2/TiO2 to investigate the characteristic changes that appear in the film characteristics in response to bending. From the ID-VDS and the transfer characteristics which are affected by bending and return for the ZnO-TFT with SiO2/TiO2 buffers, the TFTs were bent to a curvature radius of 8.5 mm. The transconductance, gm is obtained 1.7 mS/mm on flat, 1.4 mS/mm on bending and 1.3 mS/mm on returning the film, respectively. The ID-VDS characteristics were therefore not changed by bending. All of the devices exhibited a clear pinch-off behavior and a high on/off current ratio of ˜10^6. The threshold voltages, Vth were not changed drastically. Furthermore, TFT structures were changed from a conventional top-gate type to a bottom-gate type. A high transconductance of 95.8 mS/mm was achieved in the bottom-gate type TFT by using Al2O3 oxide buffer.
Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D
2018-01-01
Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p<0.0001). IIR of >0.74 corresponded to bipolar voltage <0.5 mV. A total of 1554 PBP-mapping points were matched to the nearest FAM-point. In an adjusted mixed-effects model, log-FAM bipolar voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, p<0.0001). At low-voltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Faraday-Shielded dc Stark-Shift-Free Optical Lattice Clock
NASA Astrophysics Data System (ADS)
Beloy, K.; Zhang, X.; McGrew, W. F.; Hinkley, N.; Yoon, T. H.; Nicolodi, D.; Fasano, R. J.; Schäffer, S. A.; Brown, R. C.; Ludlow, A. D.
2018-05-01
We demonstrate the absence of a dc Stark shift in an ytterbium optical lattice clock. Stray electric fields are suppressed through the introduction of an in-vacuum Faraday shield. Still, the effectiveness of the shielding must be experimentally assessed. Such diagnostics are accomplished by applying high voltage to six electrodes, which are grounded in normal operation to form part of the Faraday shield. Our measurements place a constraint on the dc Stark shift at the 10-20 level, in units of the clock frequency. Moreover, we discuss a potential source of error in strategies to precisely measure or cancel nonzero dc Stark shifts, attributed to field gradients coupled with the finite spatial extent of the lattice-trapped atoms. With this consideration, we find that Faraday shielding, complemented with experimental validation, provides both a practically appealing and effective solution to the problem of dc Stark shifts in optical lattice clocks.
Faraday-Shielded dc Stark-Shift-Free Optical Lattice Clock.
Beloy, K; Zhang, X; McGrew, W F; Hinkley, N; Yoon, T H; Nicolodi, D; Fasano, R J; Schäffer, S A; Brown, R C; Ludlow, A D
2018-05-04
We demonstrate the absence of a dc Stark shift in an ytterbium optical lattice clock. Stray electric fields are suppressed through the introduction of an in-vacuum Faraday shield. Still, the effectiveness of the shielding must be experimentally assessed. Such diagnostics are accomplished by applying high voltage to six electrodes, which are grounded in normal operation to form part of the Faraday shield. Our measurements place a constraint on the dc Stark shift at the 10^{-20} level, in units of the clock frequency. Moreover, we discuss a potential source of error in strategies to precisely measure or cancel nonzero dc Stark shifts, attributed to field gradients coupled with the finite spatial extent of the lattice-trapped atoms. With this consideration, we find that Faraday shielding, complemented with experimental validation, provides both a practically appealing and effective solution to the problem of dc Stark shifts in optical lattice clocks.
Investigation of interface property in Al/SiO2/ n-SiC structure with thin gate oxide by illumination
NASA Astrophysics Data System (ADS)
Chang, P. K.; Hwu, J. G.
2017-04-01
The reverse tunneling current of Al/SiO2/ n-SiC structure employing thin gate oxide is introduced to examine the interface property by illumination. The gate current at negative bias decreases under blue LED illumination, yet increases under UV lamp illumination. Light-induced electrons captured by interface states may be emitted after the light sources are off, leading to the recovery of gate currents. Based on transient characteristics of gate current, the extracted trap level is close to the light energy for blue LED, indicating that electron capture induced by lighting may result in the reduction of gate current. Furthermore, bidirectional C- V measurements exhibit a positive voltage shift caused by electron trapping under blue LED illumination, while a negative voltage shift is observed under UV lamp illumination. Distinct trapping and detrapping behaviors can be observed from variations in I- V and C- V curves utilizing different light sources for 4H-SiC MOS capacitors with thin insulators.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiazadeh, Asal; Universidade do Algarve, FCT, 8000-139 Faro; Gomes, Henrique L.
The impact of a parylene top-coating layer on the illumination and bias stress instabilities of indium-gallium-zinc oxide thin-film transistors (TFTs) is presented and discussed. The parylene coating substantially reduces the threshold voltage shift caused by continuous application of a gate bias and light exposure. The operational stability improves by 75%, and the light induced instability is reduced by 35%. The operational stability is quantified by fitting the threshold voltage shift with a stretched exponential model. Storage time as long as 7 months does not cause any measurable degradation on the electrical performance. It is proposed that parylene plays not onlymore » the role of an encapsulation layer but also of a defect passivation on the top semiconductor surface. It is also reported that depletion-mode TFTs are less sensitive to light induced instabilities. This is attributed to a defect neutralization process in the presence of free electrons.« less
Fully solution processed Al-TiO2-Si (MIS) structured photo-detector
NASA Astrophysics Data System (ADS)
Mondal, Sandip; Kumar, Arvind
2018-05-01
We demonstrate the fabrication of a high performance photo detector by fully solution processed technique. The detector is fabricated with photo sensitive, low temperature (200˚C) and sol-gel processed titanium dioxide (TiO2) dielectric material on silicon substrate in the form of MIS structure with top aluminum gate. The optical detection experiment is performed on Al—TiO2—Si (MIS) device by measuring the capacitance—voltage (CV at 100 kHz) curve within the visible region of light (365 — 700 nm). The presence of light shift the flat band voltage (VFB) from 290 mV to 360 mV due to the generation of photo activated charge carriers by UV (365 nm) and white light, respectively. Moreover, the generation of the charge carrier increases drastically by the combination of UV and white, which resulting as a very large shift (600 mV) in the VFB. The entire experiment was performed in normal lab conditions with open air environment, without any clean room facility.
NASA Astrophysics Data System (ADS)
Miller, Tristan; Smallwood, Chris; Zhang, Wentao; Eisaki, Hiroshi; Lee, Dung-Hai; Lanzara, Alessandra
2015-03-01
Time- and Angle-resolved photoemission spectroscopy (tr-ARPES) has been used to directly measure the dynamics of many different properties of high-temperature superconductors, including the quasiparticle relaxation, cooper pair recombination, and many-body interactions. There have also been several intriguing results on several materials showing how laser pulses can manipulate their chemical potential on ultrafast timescales, and it's been suggested that these effects could find applications in optoelectronic devices. Studies on GaAs have also found that laser pulses may induce a surface voltage effect. Here, we extend these studies for the first time to a Bi2212 sample in the superconducting state, and disentangle the shift in chemical potential from surface voltage effects. This work was supported by Berkeley Lab's program on Quantum Materials, funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Materials Sciences and Engineering Division, under Contract No. DE-AC02-05CH11231.
Electrostatic shape-shifting ion optics
Dahl, David A.; Scott, Jill R.; Appelhans, Anthony D.
2006-05-02
Electrostatic shape-shifting ion optics includes an outer electrode that defines an interior region between first and second opposed open ends. A first inner electrode is positioned within the interior region of the outer electrode at about the first open end. A second inner electrode is positioned within the interior region of the outer electrode at about the second open end. A first end cap electrode is positioned at about a first open end of the first inner electrode so that the first end cap electrode substantially encloses the first open end of the first inner electrode. A second end cap electrode is positioned at about a second open end of the second inner electrode so that the second end cap electrode substantially encloses the second open end of the second inner electrode. A voltage source operatively connected to each of the electrodes applies voltage functions to each of the electrodes to produce an electric field within an interior space enclosed by the electrodes.
Voltage Scaling of Graphene Device on SrTiO3 Epitaxial Thin Film.
Park, Jeongmin; Kang, Haeyong; Kang, Kyeong Tae; Yun, Yoojoo; Lee, Young Hee; Choi, Woo Seok; Suh, Dongseok
2016-03-09
Electrical transport in monolayer graphene on SrTiO3 (STO) thin film is examined in order to promote gate-voltage scaling using a high-k dielectric material. The atomically flat surface of thin STO layer epitaxially grown on Nb-doped STO single-crystal substrate offers good adhesion between the high-k film and graphene, resulting in nonhysteretic conductance as a function of gate voltage at all temperatures down to 2 K. The two-terminal conductance quantization under magnetic fields corresponding to quantum Hall states survives up to 200 K at a magnetic field of 14 T. In addition, the substantial shift of charge neutrality point in graphene seems to correlate with the temperature-dependent dielectric constant of the STO thin film, and its effective dielectric properties could be deduced from the universality of quantum phenomena in graphene. Our experimental data prove that the operating voltage reduction can be successfully realized due to the underlying high-k STO thin film, without any noticeable degradation of graphene device performance.
Phosphatidic acid modulation of Kv channel voltage sensor function
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-01-01
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. DOI: http://dx.doi.org/10.7554/eLife.04366.001 PMID:25285449
NASA Technical Reports Server (NTRS)
Asenov, Asen; Slavcheva, G.; Brown, A. R.; Davies, J. H.; Saini, S.
2000-01-01
In this paper we present a detailed simulation study of the influence of quantum mechanical effects in the inversion layer on random dopant induced threshold voltage fluctuations and lowering in sub 100 nm MOSFETs. The simulations have been performed using a 3-D implementation of the density gradient (DG) formalism incorporated in our established 3-D atomistic simulation approach. This results in a self-consistent 3-D quantum mechanical picture, which implies not only the vertical inversion layer quantisation but also the lateral confinement effects related to current filamentation in the 'valleys' of the random potential fluctuations. We have shown that the net result of including quantum mechanical effects, while considering statistical dopant fluctuations, is an increase in both threshold voltage fluctuations and lowering. At the same time, the random dopant induced threshold voltage lowering partially compensates for the quantum mechanical threshold voltage shift in aggressively scaled MOSFETs with ultrathin gate oxides.
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B; Mayor, Marcel
2005-06-21
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic pi -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical pi-systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode.
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-01-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208
Electron emission controller with pulsed heating of filament
NASA Astrophysics Data System (ADS)
Durakiewicz, Tomasz
1996-11-01
A novel circuit has been invented for the versatile and safe stabilization of the electron emission current (Ie) produced by a hot filament in mass spectrometers or in ionization gauges. The voltage signal, which is directly proportional to Ie, is provided to the inverting input of a comparator, whereas the noninverting input is connected to the reference voltage. In addition to the commonly used negative feedback loop, a positive feedback loop was introduced by siting a resistor between the noninverting input and the output of the comparator, which results in a pulsation of the filament voltage. The pulses are rectangular, so that the power dissipated by the transistor in the filament power supply circuit is radically reduced. To refine the switching action of the transistor, the output of the comparator is connected through a capacitor to the transistor gate. A concise discussion of the phase shift between Ie, the filament temperature Tf, and the filament voltage Vf, including time constants for different modes of power dissipation, is included.
Contribution of Sialic Acid to the Voltage Dependence of Sodium Channel Gating
Bennett, Eric; Urcan, Mary S.; Tinkle, Sally S.; Koszowski, Adam G.; Levinson, Simon R.
1997-01-01
A potential role for sialic acid in the voltage-dependent gating of rat skeletal muscle sodium channels (rSkM1) was investigated using Chinese hamster ovary (CHO) cells stably transfected with rSkM1. Changes in the voltage dependence of channel gating were observed after enzymatic (neuraminidase) removal of sialic acid from cells expressing rSkM1 and through the expression of rSkM1 in a sialylation-deficient cell line (lec2). The steady-state half-activation voltages (Va) of channels under each condition of reduced sialylation were ∼10 mV more depolarized than control channels. The voltage dependence of the time constants of channel activation and inactivation were also shifted in the same direction and by a similar magnitude. In addition, recombinant deletion of likely glycosylation sites from the rSkM1 sequence resulted in mutant channels that gated at voltages up to 10 mV more positive than wild-type channels. Thus three independent means of reducing channel sialylation show very similar effects on the voltage dependence of channel gating. Finally, steady-state activation voltages for channels subjected to reduced sialylation conditions were much less sensitive to the effects of external calcium than those measured under control conditions, indicating that sialic acid directly contributes to the negative surface potential. These results are consistent with an electrostatic mechanism by which external, negatively charged sialic acid residues on rSkM1 alter the electric field sensed by channel gating elements. PMID:9089440
Brauchi, Sebastian; Orio, Patricio; Latorre, Ramon
2004-01-01
The cold and menthol receptor, TRPM8, also designated CMR1, is a member of the transient receptor potential (TRP) family of excitatory ion channels. TRPM8 is a channel activated by cold temperatures, voltage, and menthol. In this study, we characterize the cold- and voltage-induced activation of TRPM8 channel in an attempt to identify the temperature- and voltage-dependent components involved in channel activation. Under equilibrium conditions, decreasing temperature has two effects. (i) It shifts the normalized conductance vs. voltage curves toward the left, along the voltage axis. This effect indicates that the degree of order is higher when the channel is in the open configuration. (ii) It increases the maximum channel open probability, suggesting that temperature affects both voltage-dependent and -independent pathways. In the temperature range between 18°C and 25°C, large changes in enthalpy (ΔH = -112 kcal/mol) and entropy (ΔS = -384 cal/mol K) accompany the activation process. The Q10 calculated in the same temperature range is 24. This thermodynamic analysis strongly suggests that the process of opening involves large conformational changes of the channel-forming protein. Therefore, the highly temperature-dependent transition between open and closed configurations is possible because enthalpy and entropy are both large and compensate each other. Our data also demonstrate that temperature and voltage interact allosterically to enhance channel opening. PMID:15492228
NASA Astrophysics Data System (ADS)
Bhowmik, R. N.; Vijayasri, G.
2015-06-01
We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Ambrosio, Leonardo A; Hernández-Figueroa, Hugo E
2010-11-08
Gradient forces on double negative (DNG) spherical dielectric particles are theoretically evaluated for v-th Bessel beams supposing geometrical optics approximations based on momentum transfer. For the first time in the literature, comparisons between these forces for double positive (DPS) and DNG particles are reported. We conclude that, contrary to the conventional case of positive refractive index, the gradient forces acting on a DNG particle may not reverse sign when the relative refractive index n goes from |n|>1 to |n|<1, thus revealing new and interesting trapping properties.
Reliable 6 PEP LTPS device for AMOLED's
NASA Astrophysics Data System (ADS)
Chou, Cheng-Wei; Wang, Pei-Yun; Hu, Chin-Wei; Chang, York; Chuang, Ching-Sang; Lin, Yusin
2013-09-01
This study presents a TFT structure which has less photo process and higher cost competitiveness in AMOLED display markets. A novel LTPS based 6 masks TFT structure for bottom emission AMOLED display is demonstrated in this paper. High field effect mobility (PMOS < 80 cm2/Vs ) and high reliability (PBTS △Vth< 0.02V @ 50oC VG=15V 10ks) was accomplished without the high temperature and rapid thermal annealing (RTA) activation process. Furthermore, a 14-inch AMOLED TV was achieved on the proposed 6-pep TFT backplane using the Gen. 3.5 mass production factory.
Correa, A M; Bezanilla, F; Latorre, R
1992-01-01
The gating kinetics of batrachotoxin-modified Na+ channels were studied in outside-out patches of axolemma from the squid giant axon by means of the cut-open axon technique. Single channel kinetics were characterized at different membrane voltages and temperatures. The probability of channel opening (Po) as a function of voltage was well described by a Boltzmann distribution with an equivalent number of gating particles of 3.58. The voltage at which the channel was open 50% of the time was a function of [Na+] and temperature. A decrease in the internal [Na+] induced a shift to the right of the Po vs. V curve, suggesting the presence of an integral negative fixed charge near the activation gate. An increase in temperature decreased Po, indicating a stabilization of the closed configuration of the channel and also a decrease in entropy upon channel opening. Probability density analysis of dwell times in the closed and open states of the channel at 0 degrees C revealed the presence of three closed and three open states. The slowest open kinetic component constituted only a small fraction of the total number of transitions and became negligible at voltages greater than -65 mV. Adjacent interval analysis showed that there is no correlation in the duration of successive open and closed events. Consistent with this analysis, maximum likelihood estimation of the rate constants for nine different single-channel models produced a preferred model (model 1) having a linear sequence of closed states and two open states emerging from the last closed state. The effect of temperature on the rate constants of model 1 was studied. An increase in temperature increased all rate constants; the shift in Po would be the result of an increase in the closing rates predominant over the change in the opening rates. The temperature study also provided the basis for building an energy diagram for the transitions between channel states. PMID:1318096
Píriz, Nazira; Brum, Gustavo; Pizarro, Gonzalo
2006-01-01
In voltage clamped frog skeletal muscle fibres 0.2 mM tetracaine strongly suppresses Ca(2+) release. After this treatment Ca(2+) release flux lacks its characteristic initial peak and the remaining steady component is strongly reduced when compared with the control condition. We studied the effect of two agonists of Ca(2+) release on these tetracaine treated fibres. 8 mM ClO(4)(-) added after tetracaine potentiated release flux from 0.11 +/- 0.03 mM s(-1) to 0.34 +/- 0.07 mM s(-1) (n = 6) although without recovery of the peak at any test voltage. The voltage dependence of the increased release was shifted towards more negative potentials (approximately -10 mV). The effects of ClO(4)(-) on charge movement under these conditions showed the previously described characteristic changes consisting in a left shift of its voltage dependence (approximately -9 mV) together with a slower kinetics, both at the ON and OFF transients. Caffeine at 0.5 mM in the presence of the same concentration of tetracaine failed to potentiate release flux independently of the test voltage applied. When the cut ends of the fibre were exposed to a 10 mM BAPTA intracellular solution, in the absence of tetracaine, the peak was progressively abolished. Under these conditions caffeine potentiated release restoring the peak (from 0.63 +/- 0.12 mM s(-1) to 1.82 +/- 0.23 mM s(-1)) with no effect on charge movement. Taken together the present results suggest that tetracaine is blocking a Ca(2+) sensitive component of release flux. It is speculated that the suppressed release includes a component that is dependent on Ca(2+) and mainly mediated by the activation of the beta ryanodine receptors (the RyR3 equivalent isoform). These receptors are located parajunctionally in the frog and are not interacting with the dihydropyridine receptor.
Magnetic Compensation for Second-Order Doppler Shift in LITS
NASA Technical Reports Server (NTRS)
Burt, Eric; Tjoelker, Robert
2008-01-01
The uncertainty in the frequency of a linear-ion-trap frequency standard (LITS) can be reduced substantially by use of a very small magnetic inhomogeneity tailored to compensate for the residual second-order Doppler shift. An effect associated with the relativistic time dilatation, one cause of the second-order Doppler shift, is ion motion that is attributable to the trapping radio-frequency (RF)electromagnetic field used to trap ions. The second-order Doppler shift is reduced by using a multi-pole trap; however it is still the largest source of systematic frequency shift in the latest generation of LITSs, which are among the most stable clocks in the world. The present compensation scheme reduces the frequency instability of the affected LITS to about a tenth of its previous value. The basic principles of prior generation LITSs were discussed in several prior NASA Tech Briefs articles. Below are recapitulated only those items of basic information necessary to place the present development in context. A LITS includes a microwave local oscillator, the frequency of which is stabilized by comparison with the frequency of the ground state hyperfine transition of 199Hg+ ions. The comparison involves a combination of optical and microwave excitation and interrogation of the ions in a linear ion trap in the presence of a nominally uniform magnetic field. In the current version of the LITS, there are two connected traps (see figure): (1) a quadrupole trap wherein the optical excitation and measurement take place and (2) a 12-pole trap (denoted the resonance trap), wherein the microwave interrogation takes place. The ions are initially loaded into the quadrupole trap and are thereafter shuttled between the two traps. Shuttling ions into the resonance trap allows sensitive microwave interrogation to take place well away from loading interference. The axial magnetic field for the resonance trap is generated by an electric current in a finely wound wire coil surrounded by magnetic shields. In the quadrupole and 12-pole traps, the potentials are produced by RF voltages applied to even numbers (4 and 12, respectively) of parallel rods equally spaced around a circle. The polarity of the voltage on each rod is opposite that of the voltage on the adjacent rod. As a result, the amplitude of the RF trapping field is zero along the centerline and increases, with radius, to a maximum value near the rods.
A Photostable Silicon Rhodamine Platform for Optical Voltage Sensing
Huang, Yi-Lin; Walker, Alison S.; Miller, Evan W.
2015-01-01
This paper describes the design and synthesis of a photostable, far-red to near-infrared (NIR) platform for optical voltage sensing. We developed a new, sulfonated silicon rhodamine fluorophore and integrated it with a phenylenevinylene molecular wire to create a Berkeley Red Sensor of Transmembrane potential, or BeRST 1 (“burst”). BeRST 1 is the first member of a class of farred to NIR voltage sensitive dyes that make use of a photoinduced electron transfer (PeT) trigger for optical interrogation of membrane voltage. We show that BeRST 1 displays bright, membrane-localized fluorescence in living cells, high photostability, and excellent voltage sensitivity in neurons. Depolarization of the plasma membrane results in rapid fluorescence increases (24% ΔF/F per 100 mV). BeRST 1 can be used in conjunction with fluorescent stains for organelles, Ca2+ indicators, and voltage-sensitive fluorescent proteins. In addition, the red-shifted spectral profile of BeRST 1, relative to commonly employed optogenetic actuators like ChannelRhodopsin2 (ChR2), which require blue light, enables optical electrophysiology in neurons. The high speed, sensitivity, photostability and long-wavelength fluorescence profiles of BeRST 1 make it a useful platform for the non-invasive, optical dissection of neuronal activity. PMID:26237573
New ion trap for atomic frequency standard applications
NASA Technical Reports Server (NTRS)
Prestage, J. D.; Dick, G. J.; Maleki, L.
1989-01-01
A novel linear ion trap that permits storage of a large number of ions with reduced susceptibility to the second-order Doppler effect caused by the radio frequency (RF) confining fields has been designed and built. This new trap should store about 20 times the number of ions a conventional RF trap stores with no corresponding increase in second-order Doppler shift from the confining field. In addition, the sensitivity of this shift to trapping parameters, i.e., RF voltage, RF frequency, and trap size, is greatly reduced.
Electro-optic-waveguide frequency translator in LiNbO(3) fabricated by proton exchange.
Wong, K K; De La Rue, R M; Wright, S
1982-11-01
An optical waveguide phase modulator has been fabricated on X-cut LiNbO(3) by using proton exchange in benzoic acid. The phase modulator was operated as a serrodyne optical-frequency translator with shifted-signal to imagesignal discrimination of 52 dB for a 4-MHz frequency shift. The amplitude of the sawtooth driving signal was 10 V peak to peak. Application of a de bias voltage of either polarity was found to cause a substantial reduction in transmitted-light intensity.
Modeling Proton Irradiation in AlGaN/GaN HEMTs: Understanding the Increase of Critical Voltage
NASA Astrophysics Data System (ADS)
Patrick, Erin; Law, Mark E.; Liu, Lu; Cuervo, Camilo Velez; Xi, Yuyin; Ren, Fan; Pearton, Stephen J.
2013-12-01
A combination of TRIM and FLOODS models the effect of radiation damage on AlGaN/GaN HEMTs. While excellent fits are obtained for threshold voltage shift, the models do not fully explain the increased reliability observed experimentally. In short, the addition of negatively-charged traps in the GaN buffer layer does not significantly change the electric field at the gate edges at radiation fluence levels seen in this study. We propose that negative trapped charge at the nitride/AlGaN interface actually produces the virtual-gate effect that results in decreasing the magnitude of the electric field at the gate edges and thus the increase in critical voltage. Simulation results including nitride interface charge show significant changes in electric field profiles while the I-V device characteristics do not change.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, H. X.; Zhang, T.; Wang, R. X.
A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfO{sub x} film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfO{sub x} matrix. Pt/Ni-NCs embedded HfO{sub x}/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 10{sup 12} electrons/cm{sup 2}, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 10{sup 4} cycles and excellent retention performance of 10{sup 5} s, fulfilling themore » requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.« less
Lo, Shun Qiang; Koh, Dawn X. P.; Sng, Judy C. G.; Augustine, George J.
2015-01-01
Abstract. We describe an experimental approach that uses light to both control and detect neuronal activity in mouse barrel cortex slices: blue light patterned by a digital micromirror array system allowed us to photostimulate specific layers and columns, while a red-shifted voltage-sensitive dye was used to map out large-scale circuit activity. We demonstrate that such all-optical mapping can interrogate various circuits in somatosensory cortex by sequentially activating different layers and columns. Further, mapping in slices from whisker-deprived mice demonstrated that chronic sensory deprivation did not significantly alter feedforward inhibition driven by layer 5 pyramidal neurons. Further development of voltage-sensitive optical probes should allow this all-optical mapping approach to become an important and high-throughput tool for mapping circuit interactions in the brain. PMID:26158003
Charge storage and tunneling mechanism of Ni nanocrystals embedded HfOx film
NASA Astrophysics Data System (ADS)
Zhu, H. X.; Zhang, T.; Wang, R. X.; Zhang, Y. Y.; Li, L. T.; Qiu, X. Y.
2016-05-01
A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfOx film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfOx matrix. Pt/Ni-NCs embedded HfOx/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 1012 electrons/cm2, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 104 cycles and excellent retention performance of 105 s, fulfilling the requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.
Yashchenok, Alexey M; Gorin, Dmitry A; Badylevich, Mikhail; Serdobintsev, Alexey A; Bedard, Matthieu; Fedorenko, Yanina G; Khomutov, Gennady B; Grigoriev, Dmitri O; Möhwald, Helmuth
2010-09-21
Optical and electrical properties of polyelectrolyte/iron oxide nanocomposite planar films on silicon substrates were investigated for different amount of iron oxide nanoparticles incorporated in the films. The nanocomposite assemblies prepared by the layer-by-layer assembly technique were characterized by ellipsometry, atomic force microscopy, and secondary ion mass-spectrometry. Absorption spectra of the films reveal a shift of the optical absorption edge to higher energy when the number of deposited layers decreases. Capacitance-voltage and current-voltage measurements were applied to study the electrical properties of metal-oxide-semiconductor structures prepared by thermal evaporation of gold electrodes on nanocomposite films. The capacitance-voltage measurements show that the dielectric constant of the film increases with the number of deposited layers and the fixed charge and the trapped charge densities have a negative sign.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
In situ NMR spectroscopy of supercapacitors: insight into the charge storage mechanism.
Wang, Hao; Forse, Alexander C; Griffin, John M; Trease, Nicole M; Trognko, Lorie; Taberna, Pierre-Louis; Simon, Patrice; Grey, Clare P
2013-12-18
Electrochemical capacitors, commonly known as supercapacitors, are important energy storage devices with high power capabilities and long cycle lives. Here we report the development and application of in situ nuclear magnetic resonance (NMR) methodologies to study changes at the electrode-electrolyte interface in working devices as they charge and discharge. For a supercapacitor comprising activated carbon electrodes and an organic electrolyte, NMR experiments carried out at different charge states allow quantification of the number of charge storing species and show that there are at least two distinct charge storage regimes. At cell voltages below 0.75 V, electrolyte anions are increasingly desorbed from the carbon micropores at the negative electrode, while at the positive electrode there is little change in the number of anions that are adsorbed as the voltage is increased. However, above a cell voltage of 0.75 V, dramatic increases in the amount of adsorbed anions in the positive electrode are observed while anions continue to be desorbed at the negative electrode. NMR experiments with simultaneous cyclic voltammetry show that supercapacitor charging causes marked changes to the local environments of charge storing species, with periodic changes of their chemical shift observed. NMR calculations on a model carbon fragment show that the addition and removal of electrons from a delocalized system should lead to considerable increases in the nucleus-independent chemical shift of nearby species, in agreement with our experimental observations.
In Situ NMR Spectroscopy of Supercapacitors: Insight into the Charge Storage Mechanism
2013-01-01
Electrochemical capacitors, commonly known as supercapacitors, are important energy storage devices with high power capabilities and long cycle lives. Here we report the development and application of in situ nuclear magnetic resonance (NMR) methodologies to study changes at the electrode–electrolyte interface in working devices as they charge and discharge. For a supercapacitor comprising activated carbon electrodes and an organic electrolyte, NMR experiments carried out at different charge states allow quantification of the number of charge storing species and show that there are at least two distinct charge storage regimes. At cell voltages below 0.75 V, electrolyte anions are increasingly desorbed from the carbon micropores at the negative electrode, while at the positive electrode there is little change in the number of anions that are adsorbed as the voltage is increased. However, above a cell voltage of 0.75 V, dramatic increases in the amount of adsorbed anions in the positive electrode are observed while anions continue to be desorbed at the negative electrode. NMR experiments with simultaneous cyclic voltammetry show that supercapacitor charging causes marked changes to the local environments of charge storing species, with periodic changes of their chemical shift observed. NMR calculations on a model carbon fragment show that the addition and removal of electrons from a delocalized system should lead to considerable increases in the nucleus-independent chemical shift of nearby species, in agreement with our experimental observations. PMID:24274637
NASA Astrophysics Data System (ADS)
Wong, Hon Fai; Ng, Sheung Mei; Cheng, Wang Fai; Liu, Yukuai; Chen, Xinxin; von Nordheim, Danny; Mak, Chee Leung; Dai, Jiyan; Ploss, Bernd; Leung, Chi Wah
2017-12-01
We investigated the tunability of the transport and magnetic properties in 7.5 nm La0.7Sr0.3MnO3 (LSMO) epitaxial films in a field effect geometry with the ferroelectric copolymer P(VDF-TrFE) as the gate insulator. Two different switching behaviors were observed upon application of gate voltages with either high or low magnitudes. The application of single voltage pulses of alternating polarity with an amplitude high enough to switch the remanent polarization of the ferroelectric copolymer led to a 15% change of the resistance of the LSMO channel at temperature 300 K (but less than 1% change at 20 K). A minimal shift of the peak in the resistance-temperature plot was observed, implying that the Curie temperature TC of the manganite layer is not changed. Alternatively, the application of a chain of low voltage pulses was found to shift TC by more than 16 K, and a change of the channel resistance by a 45% was obtained. We attribute this effect to the field-assisted injection and removal of oxygen vacancies in the LSMO layer, which can occur across the thickness of the oxide film. By controlling the oxygen migration, the low-field switching route offers a simple method for modulating the electric and magnetic properties of manganite films.
Ionic currents and charge movements in organ-cultured rat skeletal muscle.
Hollingworth, S; Marshall, M W; Robson, E
1984-12-01
The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.
Lu, Jing; Tu, Xinglong; Yin, Guilin; Wang, Hui; He, Dannong
2017-11-09
In this work, a spot laser modulated resistance switching (RS) effect is firstly observed on n-type Mn-doped ZnO/SiO 2 /Si structure by growing n-type Mn-doped ZnO film on Si wafer covered with a 1.2 nm native SiO 2 , which has a resistivity in the range of 50-80 Ω∙cm. The I-V curve obtained in dark condition evidences the structure a rectifying junction, which is further confirmed by placing external bias. Compared to the resistance state modulated by electric field only in dark (without illumination), the switching voltage driving the resistance state of the structure from one state to the other, shows clear shift under a spot laser illumination. Remarkably, the switching voltage shift shows a dual dependence on the illumination position and power of the spot laser. We ascribe this dual dependence to the electric filed produced by the redistribution of photo-generated carriers, which enhance the internal barrier of the hetero-junction. A complete theoretical analysis based on junction current and diffusion equation is presented. The dependence of the switching voltage on spot laser illumination makes the n-type Mn-doped ZnO/SiO 2 /Si structure sensitive to light, which thus allows for the integration of an extra functionality in the ZnO-based photoelectric device.
Sassani, Farrokh
2014-01-01
The simulation results for electromagnetic energy harvesters (EMEHs) under broad band stationary Gaussian random excitations indicate the importance of both a high transformation factor and a high mechanical quality factor to achieve favourable mean power, mean square load voltage, and output spectral density. The optimum load is different for random vibrations and for sinusoidal vibration. Reducing the total damping ratio under band-limited random excitation yields a higher mean square load voltage. Reduced bandwidth resulting from decreased mechanical damping can be compensated by increasing the electrical damping (transformation factor) leading to a higher mean square load voltage and power. Nonlinear EMEHs with a Duffing spring and with linear plus cubic damping are modeled using the method of statistical linearization. These nonlinear EMEHs exhibit approximately linear behaviour under low levels of broadband stationary Gaussian random vibration; however, at higher levels of such excitation the central (resonant) frequency of the spectral density of the output voltage shifts due to the increased nonlinear stiffness and the bandwidth broadens slightly. Nonlinear EMEHs exhibit lower maximum output voltage and central frequency of the spectral density with nonlinear damping compared to linear damping. Stronger nonlinear damping yields broader bandwidths at stable resonant frequency. PMID:24605063
Beyl, Stanislav; Depil, Katrin; Hohaus, Annette; Stary-Weinzinger, Anna; Linder, Tobias; Timin, Eugen; Hering, Steffen
2012-10-01
Voltage sensors trigger the closed-open transitions in the pore of voltage-gated ion channels. To probe the transmission of voltage sensor signalling to the channel pore of Ca(V)1.2, we investigated how elimination of positive charges in the S4 segments (charged residues were replaced by neutral glutamine) modulates gating perturbations induced by mutations in pore-lining S6 segments. Neutralisation of all positively charged residues in IIS4 produced a functional channel (IIS4(N)), while replacement of the charged residues in IS4, IIIS4 and IVS4 segments resulted in nonfunctional channels. The IIS4(N) channel displayed activation kinetics similar to wild type. Mutations in a highly conserved structure motif on S6 segments ("GAGA ring": G432W in IS6, A780T in IIS6, G1193T in IIIS6 and A1503G in IVS6) induce strong left-shifted activation curves and decelerated channel deactivation kinetics. When IIS4(N) was combined with these mutations, the activation curves were shifted back towards wild type and current kinetics were accelerated. In contrast, 12 other mutations adjacent to the GAGA ring in IS6-IVS6, which also affect activation gating, were not rescued by IIS4(N). Thus, the rescue of gating distortions in segments IS6-IVS6 by IIS4(N) is highly position-specific. Thermodynamic cycle analysis supports the hypothesis that IIS4 is energetically coupled with the distantly located GAGA residues. We speculate that conformational changes caused by neutralisation of IIS4 are not restricted to domain II (IIS6) but are transmitted to gating structures in domains I, III and IV via the GAGA ring.
Ding, Ziqian; Abbas, Gamal; Assender, Hazel E; Morrison, John J; Yeates, Stephen G; Patchett, Eifion R; Taylor, D Martin
2014-09-10
We report a systemic study of the stability of organic thin film transistors (OTFTs) both in storage and under operation. Apart from a thin polystyrene buffer layer spin-coated onto the gate dielectric, the constituent parts of the OTFTs were all prepared by vacuum evaporation. The OTFTs are based on the semiconducting small molecule dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT) deposited onto the surface of a polystyrene-buffered in situ polymerized diacrylate gate insulator. Over a period of 9 months, no degradation of the hole mobility occurred in devices stored either in the dark in dry air or in uncontrolled air and normal laboratory fluorescent lighting conditions. In the latter case, rather than decreasing, the mobility actually increased almost 2-fold to 1.5 cm(2)/(V · s). The devices also showed good stability during repeat on/off cycles in the dark in dry air. Exposure to oxygen and light during the on/off cycles led to a positive shift of the transfer curves due to electron trapping when the DNTT was biased into depletion by the application of positive gate voltage. When operated in accumulation, negative gate voltage under the same conditions, the transfer curves were stable. When voltage cycling in moist air in the dark, the transfer curves shifted to negative voltages, thought to be due to the generation of hole traps either in the semiconductor or its interface with the dielectric layer. When subjected to gate bias stress in dry air in the dark for at least 144 h, the device characteristics remained stable.
Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício
2015-02-01
This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.
29 CFR 1926.952 - Mechanical equipment.
Code of Federal Regulations, 2014 CFR
2014-07-01
... of each shift during which the equipment is to be used to determine that the brakes and operating systems are in proper working condition. (3) No employer shall use any motor vehicle equipment having an... certified for work on the proper voltage, mechanical equipment shall not be operated closer to any energized...
29 CFR 1926.952 - Mechanical equipment.
Code of Federal Regulations, 2013 CFR
2013-07-01
... of each shift during which the equipment is to be used to determine that the brakes and operating systems are in proper working condition. (3) No employer shall use any motor vehicle equipment having an... certified for work on the proper voltage, mechanical equipment shall not be operated closer to any energized...
Miniature Piezoelectric Macro-Mass Balance
NASA Technical Reports Server (NTRS)
Sherrit, Stewart; Trebi-Ollennu, Ashitey; Bonitz, Robert G.; Bar-Cohen, Yoseph
2010-01-01
Mass balances usually use a strain gauge that requires an impedance measurement and is susceptible to noise and thermal drift. A piezoelectric balance can be used to measure mass directly by monitoring the voltage developed across the piezoelectric balance, which is linear with weight or it can be used in resonance to produce a frequency change proportional to the mass change (see figure). The piezoelectric actuator/balance is swept in frequency through its fundamental resonance. If a small mass is added to the balance, the resonance frequency shifts down in proportion to the mass. By monitoring the frequency shift, the mass can be determined. This design allows for two independent measurements of mass. Additionally, more than one sample can be verified because this invention allows for each sample to be transported away from the measuring device upon completion of the measurement, if required. A piezoelectric actuator, or many piezoelectric actuators, was placed between the collection plate of the sampling system and the support structure. As the sample mass is added to the plate, the piezoelectrics are stressed, causing them to produce a voltage that is proportional to the mass and acceleration. In addition, a change in mass delta m produces a change in the resonance frequency with delta f proportional to delta m. In a microgravity environment, the spacecraft could be accelerated to produce a force on the piezoelectric actuator that would produce a voltage proportional to the mass and acceleration. Alternatively, the acceleration could be used to force the mass on the plate, and the inertial effects of the mass on the plate would produce a shift in the resonance frequency with the change in frequency related to the mass change. Three prototypes of the mass balance mechanism were developed. These macro-mass balances each consist of a solid base and an APA 60 Cedrat flextensional piezoelectric actuator supporting a measuring plate. A similar structure with 3 APA 120 Cedrat flextensional piezoelectric actuators spaced equidistantly at 120 degrees supporting the plate and a softer macro balance with an APA 150 actuator/sensor were developed. These flextensional actuators were chosen because they increase the sensitivity of the actuator to stress, allow the piezoelectric to be pre-stressed, and the piezoelectric element is a stacked multilayer actuator, which has a considerably lower input impedance than a monolithic element that allows for common instruments (e.g., input impedance of 10 megohms) to measure the voltage without rapidly discharging the charge/voltage on the piezoelectric actuator.
Transendoscopic Nd:YAG ablation of cystic lesions in 27 large animals: 1986-1995
NASA Astrophysics Data System (ADS)
Tate, Lloyd P.
1997-05-01
Hospital medical surgery records and laser logs were examined to determine the population of large animals presented to the College of Veterinary Medicine treated by laser and conventional means for cystic lesions. Cystic lesions were most frequently found in 2 anatomical locations: endometrial cysts and upper respiratory cysts. The majority of endometrial cysts were considered to be acquired, whereas the most frequently encountered upper respiratory cysts were believed to be congenital due to the fact they were most frequently seen in young animals. Nine mares, totaling 42 endometrial cysts, were presented to the Veterinary Teaching Hospital (VTH), all of which had been treated by transendoscopic Nd:YAG laser ablation. Eighteen of the respiratory cysts in the same time period were presented to the VTH, of which 10 received conventional surgery and 8 were laser photoablated. Respiratory cysts treated by conventional surgery were generally found in locations inaccessible to visualization by transendoscopic technique, and thus required a surgical approach under general anesthesia. All mares with endometrial cysts were presented with a history of conception failure. After laser ablation, a majority of the mares were able to carry a foal to term and none represented with recurrence of endometrial cysts. Horses that presented with upper respiratory cysts also did not experience recurrence of cysts; although several horses, 1 treated by laser ablation and 4 treated by conventional surgery for frontal and/or maxillary sinus cysts, had transitory sinusitis. Transendoscopic Nd:YAG photoablation of cysts appears to be a very satisfactory means of treating this particular form of lesion in large animals with minimal complications and it can be performed with the animal in a standing position as an outpatient.
[Prevention of HIV vertical transmission: obstetricians' attitude in Salvador, Brazil].
Farias, João Paulo Queiroz; Franco, Anamélia; Santos, Kleber Pimentel; Dourado, Inês; Galvão-Castro, Bernardo
2008-03-01
to evaluate the attitudes and knowledge of obstetricians from public maternities in Salvador city (PMS) about the recommendations from the Health Ministry (HM) for the prophylaxis of vertical transmission of HIV (VTH) and antiretroviral therapy in pregnant women. The influence of working conditions, availability for quick testing and antiretroviral therapy has also been evaluated concerning the application of these recommendations. a transversal study from August to November 2005, involving 129/152 (85%) of the obstetricians from all the PMS. The instrument used was a structured and self-explanatory anonymous questionnaire, with questions on the population characteristics, working conditions and availability of material, knowledge and attitudes related to HIV counseling and testing, and proceedings with the patients (use of AZT, recognition of risk factors, choice and management of type of delivery and puerperal care). 69% of the obstetricians stated they knew integrally the HM recommendations, 90.7% agreed with the compulsory request of quick testing for HIV; 63.6% chose the caesarean section as the type of delivery; 38% were against normal delivery; 37.5% recommended isolation of positive serum patients and 58.1% indicated tubal ligation. Most of them (90%) mentioned the existence of factors unfavorable to the recommendations applicability, and among those factors, the most pointed were the inadequate way the pre-natal admission was done and the lack of information at that occasion. Even though the quick testing was available, only one third of the interviewees stated that the result was always available in due time. some attitudes related to the assistance to the pregnant women with HIV were incompatible with the HM recommendations. According to the interviewees, the inadequacy of the pre-natal plus the non-availability of quick testing, influence negatively the applicability of VTH prophylaxis recommendations.
Mondal, Arobendo; Kaupp, Martin
2018-04-05
A novel protocol to compute and analyze NMR chemical shifts for extended paramagnetic solids, accounting comprehensively for Fermi-contact (FC), pseudocontact (PC), and orbital shifts, is reported and applied to the important lithium ion battery cathode materials LiFePO 4 and LiCoPO 4 . Using an EPR-parameter-based ansatz, the approach combines periodic (hybrid) DFT computation of hyperfine and orbital-shielding tensors with an incremental cluster model for g- and zero-field-splitting (ZFS) D-tensors. The cluster model allows the use of advanced multireference wave function methods (such as CASSCF or NEVPT2). Application of this protocol shows that the 7 Li shifts in the high-voltage cathode material LiCoPO 4 are dominated by spin-orbit-induced PC contributions, in contrast with previous assumptions, fundamentally changing interpretations of the shifts in terms of covalency. PC contributions are smaller for the 7 Li shifts of the related LiFePO 4 , where FC and orbital shifts dominate. The 31 P shifts of both materials finally are almost pure FC shifts. Nevertheless, large ZFS contributions can give rise to non-Curie temperature dependences for both 7 Li and 31 P shifts.
Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo
2012-10-16
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.
Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo
2013-01-01
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304
Threshold voltage control in TmSiO/HfO2 high-k/metal gate MOSFETs
NASA Astrophysics Data System (ADS)
Dentoni Litta, E.; Hellström, P.-E.; Östling, M.
2015-06-01
High-k interfacial layers have been proposed as a way to extend the scalability of Hf-based high-k/metal gate CMOS technology, which is currently limited by strong degradations in threshold voltage control, channel mobility and device reliability when the chemical oxide (SiOx) interfacial layer is scaled below 0.4 nm. We have previously demonstrated that thulium silicate (TmSiO) is a promising candidate as a high-k interfacial layer, providing competitive advantages in terms of EOT scalability and channel mobility. In this work, the effect of the TmSiO interfacial layer on threshold voltage control is evaluated, showing that the TmSiO/HfO2 dielectric stack is compatible with threshold voltage control techniques commonly used with SiOx/HfO2 stacks. Specifically, we show that the flatband voltage can be set in the range -1 V to +0.5 V by the choice of gate metal and that the effective workfunction of the stack is properly controlled by the metal workfunction in a gate-last process flow. Compatibility with a gate-first approach is also demonstrated, showing that integration of La2O3 and Al2O3 capping layers can induce a flatband voltage shift of at least 150 mV. Finally, the effect of the annealing conditions on flatband voltage is investigated, finding that the duration of the final forming gas anneal can be used as a further process knob to tune the threshold voltage. The evaluation performed on MOS capacitors is confirmed by the fabrication of TmSiO/HfO2/TiN MOSFETs achieving near-symmetric threshold voltages at sub-nm EOT.
Sensitivity-Enhanced CMOS Phase Luminometry System Using Xerogel-Based Sensors.
Lei Yao; Khan, R; Chodavarapu, V P; Tripathi, V S; Bright, F V
2009-10-01
We present the design and implementation of a phase luminometry sensor system with improved and tunable detection sensitivity achieved using a complementary metal-oxide semiconductor (CMOS) integrated circuit. We use sol-gel derived xerogel thin films as an immobilization media to house oxygen (O2) responsive luminescent molecules. The sensor operates on the principal of phase luminometry wherein a sinusoidal modulation signal is used to excite the luminophores encapsulated in the porous xerogel films and the corresponding phase shift of the emission signals is monitored. The phase shift is directly related to excited state lifetimes of the luminophores which in turn are related to the concentration of the target analyte species present in the vicinity of the luminophores. The CMOS IC, which consists of a 16 times 16 high-gain phototransistor array, current-to-voltage converter, amplifier and tunable phase shift detector, consumes an average power of 14 mW with 5-V power supply operating at a 38-kHz modulation frequency. The output of the IC is a dc voltage that corresponds to the detected luminescence phase shift with respect to the excitation signal. As a prototype, we demonstrate an oxygen sensor system by encapsulating the luminophore tris(4,7-diphenyl-1,10-phenanthroline)ruthenium(II) within the xerogel matrices. The sensor system showed a fast response on the order of few seconds and we obtained a detection sensitivity of 118 mV per 1% change in O2 concentration. The system demonstrates a novel concept to tune and improve the detection sensitivity for specific concentrations of the target analyte in many biomedical monitoring applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Tian-Li, E-mail: Tian-Li.Wu@imec.be; Groeseneken, Guido; Department of Electrical Engineering, KU Leuven, Leuven
2015-08-31
In this paper, three electrical techniques (frequency dependent conductance analysis, AC transconductance (AC-g{sub m}), and positive gate bias stress) were used to evaluate three different gate dielectrics (Plasma-Enhanced Atomic Layer Deposition Si{sub 3}N{sub 4}, Rapid Thermal Chemical Vapor Deposition Si{sub 3}N{sub 4}, and Atomic Layer Deposition (ALD) Al{sub 2}O{sub 3}) for AlGaN/GaN Metal-Insulator-Semiconductor High-Electron-Mobility Transistors. From these measurements, the interface state density (D{sub it}), the amount of border traps, and the threshold voltage (V{sub TH}) shift during a positive gate bias stress can be obtained. The results show that the V{sub TH} shift during a positive gate bias stress ismore » highly correlated to not only interface states but also border traps in the dielectric. A physical model is proposed describing that electrons can be trapped by both interface states and border traps. Therefore, in order to minimize the V{sub TH} shift during a positive gate bias stress, the gate dielectric needs to have a lower interface state density and less border traps. However, the results also show that the commonly used frequency dependent conductance analysis technique to extract D{sub it} needs to be cautiously used since the resulting value might be influenced by the border traps and, vice versa, i.e., the g{sub m} dispersion commonly attributed to border traps might be influenced by interface states.« less
Santos-Sacchi, Joseph; Song, Lei
2014-04-11
The outer hair cell is electromotile, its membrane motor identified as the protein SLC26a5 (prestin). An area motor model, based on two-state Boltzmann statistics, was developed about two decades ago and derives from the observation that outer hair cell surface area is voltage-dependent. Indeed, aside from the nonlinear capacitance imparted by the voltage sensor charge movement of prestin, linear capacitance (Clin) also displays voltage dependence as motors move between expanded and compact states. Naturally, motor surface area changes alter membrane capacitance. Unit linear motor capacitance fluctuation (δCsa) is on the order of 140 zeptofarads. A recent three-state model of prestin provides an alternative view, suggesting that voltage-dependent linear capacitance changes are not real but only apparent because the two component Boltzmann functions shift their midpoint voltages (Vh) in opposite directions during treatment with salicylate, a known competitor of required chloride binding. We show here using manipulations of nonlinear capacitance with both salicylate and chloride that an enhanced area motor model, including augmented δCsa by salicylate, can accurately account for our novel findings. We also show that although the three-state model implicitly avoids measuring voltage-dependent motor capacitance, it registers δCsa effects as a byproduct of its assessment of Clin, which increases during salicylate treatment as motors are locked in the expanded state. The area motor model, in contrast, captures the characteristics of the voltage dependence of δCsa, leading to a better understanding of prestin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G.
2015-06-15
We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling.more » The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.« less
NASA Astrophysics Data System (ADS)
Priya Darshini, B.; Ranjit, M.; Babu, V. Ramesh
2018-04-01
In this paper different Multicarrier PWM (MCPWM) techniques are proposed for dual inverter fed open end induction motor (IM) drive to achieve multilevel operation. To generate the switching pulses for the dual inverter sinusoidal modulating signal is compared with multi carrier signals. A common mode voltage (CMV) has been analyzed in the proposed open end winding induction motor drive. All the proposed techniques mitigate the CMV along with the harmonic distortion in the phase voltage. To authenticate the proposed work several simulation techniques have been carried out using MATLAB/SIMULINK and the corresponding results are presented and compared.
Tsuda, Sachiko; Kee, Michelle Z.L.; Cunha, Catarina; Kim, Jinsook; Yan, Ping; Loew, Leslie M.; Augustine, George J.
2013-01-01
Recent advances in our understanding of brain function have come from using light to either control or image neuronal activity. Here we describe an approach that combines both techniques: a micromirror array is used to photostimulate populations of presynaptic neurons expressing channelrhodopsin-2, while a red-shifted voltage-sensitive dye allows optical detection of resulting postsynaptic activity. Such technology allowed us to control the activity of cerebellar interneurons while simultaneously recording inhibitory responses in multiple Purkinje neurons, their postsynaptic targets. This approach should substantially accelerate our understanding of information processing by populations of neurons within brain circuits. PMID:23254260
Synchronization algorithm for three-phase voltages of an inverter and a grid
NASA Astrophysics Data System (ADS)
Nos, O. V.
2017-07-01
This paper presents the results of designing a joint phase-locked loop for adjusting the phase shifts (speed) and Euclidean norm of three-phase voltages of an inverter to the same grid parameters. The design can be used, in particular, to match the potentials of two parallel-connected power sources for the fundamental harmonic at the moments of switching the stator windings of an induction AC motor from a converter to a centralized power-supply system and back. Technical implementation of the developed synchronization algorithm will significantly reduce the inductance of the current-balancing reactor and exclude emergency operation modes in the electric motor power circuit.
NASA Astrophysics Data System (ADS)
Wang, Q.; Song, Z. T.; Liu, W. L.; Lin, C. L.; Wang, T. H.
2004-05-01
Monolayer-isolated silver (Ag) nanodots with the average diameter down to 7 nm are synthesized on Al 2O 3/Si substrate by vacuum electron-beam evaporation followed by annealing at 400 °C in N 2 ambient. Metal-insulator-silicon (MIS) structures with Ag nanodots embedded in Al 2O 3 gate dielectric are fabricated. Clear electron storage effect with the flatband voltage shift of 1.3 eV is observed through capacitance-conductance and conductance-voltage measurements. Our results demonstrate the feasibility of applying Ag nanodots for nanocrystal floating-gate memory devices.
Piacentino, V; Dipla, K; Gaughan, J P; Houser, S R
2000-03-15
1. Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. 2. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3',5'-monophosphate (cAMP) in the pipette or in the presence of the beta-adrenergic agonist isoproterenol (isoprenaline; ISO). 3. The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. 4. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (VŁ = -57.8 +/- 0.49 mV). 5. ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. 6. The voltage-contraction relationship in 200 microM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. 7. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis.
Sun, Qian-Quan; Dale, Nicholas
1998-01-01
In whole-cell patch clamp recordings made from non-sensory neurons acutely isolated from the spinal cord of Xenopus (stage 40–42) larvae, two forms of inhibition of the high voltage-activated (HVA) Ca2+ currents were produced by 5-HT. One was voltage dependent and associated with both slowing of the activation kinetics and shifting of the voltage dependence of the HVA currents. This inhibition was relieved by strong depolarizing prepulses. A second form of inhibition was neither associated with slowing of the activation kinetics nor relieved by depolarizing prepulses and was thus voltage independent. In all neurons examined, 5-HT (1 μM) reversibly reduced 34 ± 1.6 % (n = 102) of the HVA Ca2+ currents. In about 40 % of neurons, the inhibition was totally voltage independent. In another 5 %, the inhibition was totally voltage dependent. In the remaining neurons, inhibition was only partially (by around 40 %) relieved by a large depolarizing prepulse, suggesting that in these, the inhibition consisted of both voltage-dependent and -independent components. By using selective channel blockers, we found that 5-HT acted on both N- and P/Q-type channels. However, whereas the inhibition of P/Q-type currents was only voltage independent, the inhibition of N-type currents had both voltage-dependent and -independent components. The effects of 5-HT on HVA Ca2+ currents were mediated by 5-HT1A and 5-HT1D receptors. The 5-HT1A receptors not only preferentially caused voltage-independent inhibition, but did so by acting mainly on the ω-agatoxin-IVA-sensitive Ca2+ channels. In contrast, the 5-HT1D receptor produced both voltage-dependent and -independent inhibition and was preferentially coupled to ω-conotoxin-GVIA sensitive channels. This complexity of modulation may allow fine tuning of transmitter release and calcium signalling in the spinal circuitry of Xenopus larvae. PMID:9625870
NASA Astrophysics Data System (ADS)
Nishikata, Daisuke; Ali, Mohammad Alimudin Bin Mohd; Hosoda, Kento; Matsumoto, Hiroshi; Nakamura, Kazuyuki
2018-04-01
A 36-bit × 32-entry fully digital ternary content addressable memory (TCAM) using the ratioless static random access memory (RL-SRAM) technology and fully complementary hierarchical-AND matching comparators (HAMCs) was developed. Since its fully complementary and digital operation enables the effect of device variabilities to be avoided, it can operate with a quite low supply voltage. A test chip incorporating a conventional TCAM and a proposed 24-transistor ratioless TCAM (RL-TCAM) cells and HAMCs was developed using a 0.18 µm CMOS process. The minimum operating voltage of 0.25 V of the developed RL-TCAM, which is less than half of that of the conventional TCAM, was measured via the conventional CMOS push–pull output buffers with the level-shifting and flipping technique using optimized pull-up voltage and resistors.
A tunable acoustic metamaterial with double-negativity driven by electromagnets
Chen, Zhe; Xue, Cheng; Fan, Li; Zhang, Shu-yi; Li, Xiao-juan; Zhang, Hui; Ding, Jin
2016-01-01
With the advance of the research on acoustic metamaterials, the limits of passive metamaterials have been observed, which prompts the studies concerning actively tunable metamaterials with adjustable characteristic frequency bands. In this work, we present a tunable acoustic metamaterial with double-negativity composed of periodical membranes and side holes, in which the double-negativity pass band can be controlled by an external direct-current voltage. The tension and stiffness of the periodically arranged membranes are actively controlled by electromagnets producing additional stresses, and thus, the transmission and phase velocity of the metamaterial can be adjusted by the driving voltage of the electromagnets. It is demonstrated that a tiny direct-current voltage of 6V can arise a shift of double-negativity pass band by 40% bandwidth, which exhibits that it is an easily controlled and highly tunable acoustic metamaterial, and furthermore, the metamaterial marginally causes electromagnetic interference to the surroundings. PMID:27443196
Structural basis of lipid-driven conformational transitions in the KvAP voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Sompornpisut, Pornthep; Perozo, Eduardo
2014-02-01
Voltage-gated ion channels respond to transmembrane electric fields through reorientations of the positively charged S4 helix within the voltage-sensing domain (VSD). Despite a wealth of structural and functional data, the details of this conformational change remain controversial. Recent electrophysiological evidence showed that equilibrium between the resting ('down') and activated ('up') conformations of the KvAP VSD from Aeropyrum pernix can be biased through reconstitution in lipids with or without phosphate groups. We investigated the structural transition between these functional states, using site-directed spin-labeling and EPR spectroscopic methods. Solvent accessibility and interhelical distance determinations suggest that KvAP gates through S4 movements involving an ∼3-Å upward tilt and simultaneous ∼2-Å axial shift. This motion leads to large accessibly changes in the intracellular water-filled crevice and supports a new model of gating that combines structural rearrangements and electric-field remodeling.
NASA Astrophysics Data System (ADS)
Zhang, Kexiong; Liao, Meiyong; Imura, Masataka; Nabatame, Toshihide; Ohi, Akihiko; Sumiya, Masatomo; Koide, Yasuo; Sang, Liwen
2016-12-01
The electrical hysteresis in current-voltage (I-V) and capacitance-voltage characteristics was observed in an atomic-layer-deposited Al2O3/p-GaN metal-oxide-semiconductor capacitor (PMOSCAP). The absolute minimum leakage currents of the PMOSCAP for forward and backward I-V scans occurred not at 0 V but at -4.4 and +4.4 V, respectively. A negative flat-band voltage shift of 5.5 V was acquired with a capacitance step from +4.4 to +6.1 V during the forward scan. Mg surface accumulation on p-GaN was demonstrated to induce an Mg-Ga-Al-O oxidized layer with a trap density on the order of 1013 cm-2. The electrical hysteresis is attributed to the hole trapping and detrapping process in the traps of the Mg-Ga-Al-O layer via the Poole-Frenkel mechanism.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jo, Jeong-Wan; Park, Sung Kyu, E-mail: yhkim76@skku.edu, E-mail: skpark@cau.ac.kr; Kim, Yong-Hoon, E-mail: yhkim76@skku.edu, E-mail: skpark@cau.ac.kr
2014-07-28
In this report, photo-induced hysteresis, threshold voltage (V{sub T}) shift, and recovery behaviors in photochemically activated solution-processed indium-gallium-zinc oxide (IGZO) thin-film transistors (TFTs) are investigated. It was observed that a white light illumination caused negative V{sub T} shift along with creation of clockwise hysteresis in electrical characteristics which can be attributed to photo-generated doubly ionized oxygen vacancies at the semiconductor/gate dielectric interface. More importantly, the photochemically activated IGZO TFTs showed much reduced overall V{sub T} shift compared to thermally annealed TFTs. Reduced number of donor-like interface states creation under light illumination and more facile neutralization of ionized oxygen vacancies bymore » electron capture under positive gate potential are claimed to be the origin of the less V{sub T} shift in photochemically activated TFTs.« less
NASA Astrophysics Data System (ADS)
Kim, Hunho; Kwack, Young-Jin; Yun, Eui-Jung; Choi, Woon-Seop
2016-09-01
Solution-processed gate dielectrics were fabricated with the combined ZrO2 and Al2O3 (ZAO) in the form of mixed and stacked types for oxide thin film transistors (TFTs). ZAO thin films prepared with double coatings for solid gate dielectrics were characterized by analytical tools. For the first time, the capacitance of the oxide semiconductor was extracted from the capacitance-voltage properties of the zinc-tin oxide (ZTO) TFTs with the combined ZAO dielectrics by using the proposed metal-insulator-semiconductor (MIS) structure model. The capacitance evolution of the semiconductor from the TFT model structure described well the threshold voltage shift observed in the ZTO TFT with the ZAO (1:2) gate dielectric. The electrical properties of the ZTO TFT with a ZAO (1:2) gate dielectric showed low voltage driving with a field effect mobility of 37.01 cm2/Vs, a threshold voltage of 2.00 V, an on-to-off current ratio of 1.46 × 105, and a subthreshold slope of 0.10 V/dec.
NASA Astrophysics Data System (ADS)
Chou, Kuan-Yu; Hsu, Nai-Wen; Su, Yi-Hsin; Chou, Chung-Tao; Chiu, Po-Yuan; Chuang, Yen; Li, Jiun-Yun
2018-02-01
We investigate DC characteristics of a two-dimensional electron gas (2DEG) in an undoped Si/SiGe heterostructure and its temperature dependence. An insulated-gate field-effect transistor was fabricated, and transfer characteristics were measured at 4 K-300 K. At low temperatures (T < 45 K), source electrons are injected into the buried 2DEG channel first and drain current increases with the gate voltage. By increasing the gate voltage further, the current saturates followed by a negative transconductance observed, which can be attributed to electron tunneling from the buried channel to the surface channel. Finally, the drain current is saturated again at large gate biases due to parallel conduction of buried and surface channels. By increasing the temperature, an abrupt increase in threshold voltage is observed at T ˜ 45 K and it is speculated that negatively charged impurities at the Al2O3/Si interface are responsible for the threshold voltage shift. At T > 45 K, the current saturation and negative transconductance disappear and the device acts as a normal transistor.
Top-gate organic depletion and inversion transistors with doped channel and injection contact
NASA Astrophysics Data System (ADS)
Liu, Xuhai; Kasemann, Daniel; Leo, Karl
2015-03-01
Organic field-effect transistors constitute a vibrant research field and open application perspectives in flexible electronics. For a commercial breakthrough, however, significant performance improvements are still needed, e.g., stable and high charge carrier mobility and on-off ratio, tunable threshold voltage, as well as integrability criteria such as n- and p-channel operation and top-gate architecture. Here, we show pentacene-based top-gate organic transistors operated in depletion and inversion regimes, realized by doping source and drain contacts as well as a thin layer of the transistor channel. By varying the doping concentration and the thickness of the doped channel, we control the position of the threshold voltage without degrading on-off ratio or mobility. Capacitance-voltage measurements show that an inversion channel can indeed be formed, e.g., an n-doped channel can be inverted to a p-type inversion channel with highly p-doped contacts. The Cytop polymer dielectric minimizes hysteresis, and the transistors can be biased for prolonged cycles without a shift of threshold voltage, indicating excellent operation stability.
Fabrication and Characteristics of Pentacene/Vanadium Pentoxide Field-Effect Transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minagawa, M.; Nakai, K.; Baba, A.
2011-12-23
Organic field-effect transistors (OFETs) were fabricated using pentacene thin layer, and the effects of inserted Lewis-acid thin layers on electrical properties were investigated. The OFETs have active layers of pentacene and vanadium pentoxide (V{sub 2}O{sub 5}) as a Lewis-acid layer. Typical source-drain current (I{sub DS}) vs. source-drain voltage (V{sub DS}) curves were observed under negative gate voltages (V{sub G}S) application, and the shift of the threshold voltage for FET driving (V{sub t}) to positive side was also observed by V{sub 2}O{sub 5} layer insertion, that is, -2.5 V for device with V{sub 2}O{sub 5} layer and -5.7 V for devicemore » without V{sub 2}O{sub 5} layer. It was thought that charge transfer (CT) complexes which were formed at the interface between pentacene and V{sub 2}O{sub 5} layer were dissociated by the applied gate voltage, and the generated holes seem to contribute to drain current and the apparent V{sub t} improvement.« less
Kim, Hunho; Kwack, Young-Jin; Yun, Eui-Jung; Choi, Woon-Seop
2016-01-01
Solution-processed gate dielectrics were fabricated with the combined ZrO2 and Al2O3 (ZAO) in the form of mixed and stacked types for oxide thin film transistors (TFTs). ZAO thin films prepared with double coatings for solid gate dielectrics were characterized by analytical tools. For the first time, the capacitance of the oxide semiconductor was extracted from the capacitance-voltage properties of the zinc-tin oxide (ZTO) TFTs with the combined ZAO dielectrics by using the proposed metal-insulator-semiconductor (MIS) structure model. The capacitance evolution of the semiconductor from the TFT model structure described well the threshold voltage shift observed in the ZTO TFT with the ZAO (1:2) gate dielectric. The electrical properties of the ZTO TFT with a ZAO (1:2) gate dielectric showed low voltage driving with a field effect mobility of 37.01 cm2/Vs, a threshold voltage of 2.00 V, an on-to-off current ratio of 1.46 × 105, and a subthreshold slope of 0.10 V/dec. PMID:27641430
Stable organic thin-film transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin
Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperatureovertimeperiods upto5.9×105 s do not vary monotonically andmore » remain below 0.2 V in microcrystalline OTFTs (mc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V-1 s-1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies.« less
Stable organic thin-film transistors
Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin; ...
2018-01-12
Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperatureovertimeperiods upto5.9×105 s do not vary monotonically andmore » remain below 0.2 V in microcrystalline OTFTs (mc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V-1 s-1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies.« less
Stable organic thin-film transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin
2018-01-01
Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperatureovertimeperiods upto5.9×105 s do not vary monotonically andmore » remain below 0.2 V in microcrystalline OTFTs (mc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V−1 s−1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies.« less
Stable organic thin-film transistors
Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin; Park, Youngrak; Kippelen, Bernard
2018-01-01
Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperature over time periods up to 5.9 × 105 s do not vary monotonically and remain below 0.2 V in microcrystalline OTFTs (μc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V−1 s−1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies. PMID:29340301
Silicon graphene waveguide tunable broadband microwave photonics phase shifter.
Capmany, José; Domenech, David; Muñoz, Pascual
2014-04-07
We propose the use of silicon graphene waveguides to implement a tunable broadband microwave photonics phase shifter based on integrated ring cavities. Numerical computation results show the feasibility for broadband operation over 40 GHz bandwidth and full 360° radiofrequency phase-shift with a modest voltage excursion of 0.12 volt.
76 FR 22148 - Petitions for Modification of Application of Existing Mandatory Safety Standards
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-20
..., grounded phase, under-voltage, and ground monitoring protection; (b) the trailing cable short-circuit... activated; (c) the solenoid valves will be connected to the CO monitoring system through PLC programming... surface location, either the CO monitoring room or the security station. Either, two miners on each shift...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jae-Min; Kim, Doyoung; Kim, Hyungjun
We investigated the ultraviolet (UV) light photostability of plasma-enhanced and thermal atomic layer deposition of ZnO thin film transistor (TFT). The negative shift of threshold voltage was similarly observed in both cases by UV exposure due to the increment of carrier concentration. Additionally, the transfer curves of TFT using thermal ALD ZnO:N active layer were exhibited recovery characteristics.
Influence of Oil Saturation Upon Spectral Induced Polarization of Oil Bearing Sands
The presence of oil in an unconsolidated granular porous material such as sand changes both the resistivity of the material and the value of the phase shift between the low-frequency current and the voltage. The resistivity and the phase angle can be written as a complex-valued r...
49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements
Code of Federal Regulations, 2012 CFR
2012-10-01
... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...
49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements
Code of Federal Regulations, 2011 CFR
2011-10-01
... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...
49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements
Code of Federal Regulations, 2014 CFR
2014-10-01
... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...
49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements
Code of Federal Regulations, 2013 CFR
2013-10-01
... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...
NASA Astrophysics Data System (ADS)
Chen, Yang
2018-03-01
A novel wideband photonic microwave phase shifter with 360-degree phase tunable range is proposed based on a single dual-polarization quadrature phase shift-keying (DP-QPSK) modulator. The two dual-parallel Mach-Zehnder modulators (DP-MZMs) in the DP-QPSK modulator are properly biased to serve as a carrier-suppressed single-sideband (CS-SSB) modulator and an optical phase shifter (OPS), respectively. The microwave signal is applied to the CS-SSB modulator, while a control direct-current (DC) voltage is applied to the OPS. The first-order optical sideband generated from the CS-SSB modulator and the phase tunable optical carrier from the OPS are combined and then detected in a photodetector, where a microwave signal is generated with its phase controlled by the DC voltage applied to the OPS. The proposed technique is theoretically analyzed and experimentally demonstrated. Microwave signals with a carrier frequency from 10 to 23 GHz are continuously phase shifted over 360-degree phase range. The proposed technique features very compact configuration, easy phase tuning and wide operation bandwidth.
New Energy-Dependent Soft X-Rav Damage In MOS Devices
NASA Astrophysics Data System (ADS)
Chan, Tung-Yi; Gaw, Henry; Seligson, Daniel; Pan, Lawrence; King, Paul L.; Pianetta, Piero
1988-06-01
An energy-dependent soft x-ray-induced device damage has been discovered in MOS devices fabricated using standard CMOS process. MOS devices were irradiated by monochromatic x-rays in energy range just above and below the silicon K-edge (1.84 keV). Photons below the K-edge is found to create more damage in the oxide and oxide/silicon interface than photons above the K-edge. This energy-dependent damage effect is believed to be due to charge traps generated during device fabrication. It is found that data for both n- and p-type devices lie along a universal curve if normalized threshold voltage shifts are plotted against absorbed dose in the oxide. The threshold voltage shift saturates when the absorbed dose in the oxide exceeds 1.4X105 mJ/cm3, corresponding to 6 Mrad in the oxide. Using isochronal anneals, the trapped charge damage is found to recover with an activation energy of 0.38 eV. A discrete radiation-induced damage state appears in the low frequency C-V curve in a temperature range from 1750C to 325°C.
Fabrication of arrayed Si nanowire-based nano-floating gate memory devices on flexible plastics.
Yoon, Changjoon; Jeon, Youngin; Yun, Junggwon; Kim, Sangsig
2012-01-01
Arrayed Si nanowire (NW)-based nano-floating gate memory (NFGM) devices with Pt nanoparticles (NPs) embedded in Al2O3 gate layers are successfully constructed on flexible plastics by top-down approaches. Ten arrayed Si NW-based NFGM devices are positioned on the first level. Cross-linked poly-4-vinylphenol (PVP) layers are spin-coated on them as isolation layers between the first and second level, and another ten devices are stacked on the cross-linked PVP isolation layers. The electrical characteristics of the representative Si NW-based NFGM devices on the first and second levels exhibit threshold voltage shifts, indicating the trapping and detrapping of electrons in their NPs nodes. They have an average threshold voltage shift of 2.5 V with good retention times of more than 5 x 10(4) s. Moreover, most of the devices successfully retain their electrical characteristics after about one thousand bending cycles. These well-arrayed and stacked Si NW-based NFGM devices demonstrate the potential of nanowire-based devices for large-scale integration.
Tailoring the charge carrier in few layers MoS2 field-effect transistors by Au metal adsorbate
NASA Astrophysics Data System (ADS)
Singh, Arun Kumar; Pandey, Rajiv K.; Prakash, Rajiv; Eom, Jonghwa
2018-04-01
It is an essential to tune the charge carrier concentrations in semiconductor in order to approach high-performance of the electronic and optoelectronic devices. Here, we report the effect of thin layer of gold (Au) metal on few layer (FL) molybdenum disulfide (MoS2) by atomic force microscopy (AFM), Raman spectroscopy and electrical charge transport measurements. The Raman spectra and charge transport measurements show that Au thin layer affect the electronic properties of the FL MoS2. After deposition of Au thin layer, the threshold voltages of FL MoS2 field-effect transistors (FETs) shift towards positive gate voltages, this reveal the p-doping in FL MoS2 nanosheets. The shift of peak frequencies of the Raman bands are also analyzed after the deposition of Au metal films of different thickness on FL MoS2 nanosheets. The surface morphology of Au metal on FL MoS2 is characterized by AFM and shows the smoother and denser film in comparison to Au metal on SiO2.
1993-03-17
modulator: Number of Elements 16 x 16 Pixel Size 1 mmxl mm Area Fill Factor > 90% Reflectance > 90% Phase Shift 900 Frame Rate > 1 kHz Operational Spectral...electro-optic constants. By using reflected light from the second interface a factor of two increase in phase shift is obtained for an applied voltage vs...wavelengths in general require thinner PLZT wafers. One of the objectives of the SLM design was to maximize pixel area fill factor and thereby the
Wang, G K
1984-01-01
The effects of externally applied chloramine-T on the excitability of single toad myelinated nerve fibres were studied. Chloramine-T is a mild oxidant which reacts specifically with the cysteine and methionine residues of proteins. Chloramine-T prolongs the action potential of a single myelinated fibre by more than 1000-fold. This effect is concentration- and time-dependent; higher concentrations and longer incubation times increase prolongation. Under voltage-clamp conditions, sodium channel inactivation is markedly inhibited by chloramine-T while sodium channel activation remains normal. Prolonged depolarization of the membrane leads to a maintained sodium current. The maintained sodium currents show activation kinetics, dependence on membrane potential, and reversal potentials which are similar to those of normal, inactivating sodium currents in untreated fibres. Both the maintained and the peak sodium currents are equally inhibited by tetrodotoxin. After partial removal of sodium inactivation by brief exposures to chloramine-T, the voltage dependence of the steady-state sodium current inactivation (h infinity) is shifted in the depolarized direction by about 20 mV, even after correction for the non-inactivating component contributed by the maintained current. The phenomena described here imply that cysteine or methionine residues are critical for the sodium channel inactivation processes. The two different modifications of inactivation, its removal shown by the maintained current, and the shift in the voltage-dependence of the remaining inactivatable channels, reveal that at least two separate residues are modified by chloramine-T. PMID:6321714
NASA Astrophysics Data System (ADS)
Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.
2014-12-01
Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.