‘Sleepy’ inward rectifier channels in guinea-pig cardiomyocytes are activated only during strong hyperpolarization

PubMed Central

Liu, Gong Xin; Daut, Jürgen

2002-01-01

K+ channels of isolated guinea-pig cardiomyocytes were studied using the patch-clamp technique. At transmembrane potentials between −120 and −220 mV we observed inward currents through an apparently novel channel. The novel channel was strongly rectifying, no outward currents could be recorded. Between −200 and −160 mV it had a slope conductance of 42.8 ± 3.0 pS (s.d.; n = 96). The open probability (Po) showed a sigmoid voltage dependence and reached a maximum of 0.93 at −200 mV, half-maximal activation was approximately −150 mV. The voltage dependence of Po was not affected by application of 50 μm isoproterenol. The open-time distribution could be described by a single exponential function, the mean open time ranged between 73.5 ms at −220 mV and 1.4 ms at −160 mV. At least two exponential components were required to fit the closed time distribution. Experiments with different external Na+, K+ and Cl− concentrations suggested that the novel channel is K+ selective. Extracellular Ba2+ ions gave rise to a voltage-dependent reduction in Po by inducing long closed states; Cs+ markedly reduced mean open time at −200 mV. In cell-attached recordings the novel channel frequently converted to a classical inward rectifier channel, and vice versa. This conversion was not voltage dependent. After excision of the patch, the novel channel always converted to a classical inward rectifier channel within 0–3 min. This conversion was not affected by intracellular Mg2+, phosphatidylinositol (4,5)-bisphosphate or spermine. Taken together, our findings suggest that the novel K+ channel represents a different ‘mode’ of the classical inward rectifier channel in which opening occurs only at very negative potentials. PMID:11897847

Voltage Gating of Shaker K+ Channels

PubMed Central

Rodríguez, Beatriz M.; Sigg, Daniel; Bezanilla, Francisco

1998-01-01

Ionic (Ii) and gating currents (Ig) from noninactivating Shaker H4 K+ channels were recorded with the cut-open oocyte voltage clamp and macropatch techniques. Steady state and kinetic properties were studied in the temperature range 2–22°C. The time course of Ii elicited by large depolarizations consists of an initial delay followed by an exponential rise with two kinetic components. The main Ii component is highly temperature dependent (Q10 > 4) and mildly voltage dependent, having a valence times the fraction of electric field (z) of 0.2–0.3 eo. The Ig On response obtained between −60 and 20 mV consists of a rising phase followed by a decay with fast and slow kinetic components. The main Ig component of decay is highly temperature dependent (Q10 > 4) and has a z between 1.6 and 2.8 eo in the voltage range from −60 to −10 mV, and ∼0.45 eo at more depolarized potentials. After a pulse to 0 mV, a variable recovery period at −50 mV reactivates the gating charge with a high temperature dependence (Q10 > 4). In contrast, the reactivation occurring between −90 and −50 mV has a Q10 = 1.2. Fluctuation analysis of ionic currents reveals that the open probability decreases 20% between 18 and 8°C and the unitary conductance has a low temperature dependence with a Q10 of 1.44. Plots of conductance and gating charge displacement are displaced to the left along the voltage axis when the temperature is decreased. The temperature data suggests that activation consists of a series of early steps with low enthalpic and negative entropic changes, followed by at least one step with high enthalpic and positive entropic changes, leading to final transition to the open state, which has a negative entropic change. PMID:9689029

The properties of single cones isolated from the tiger salamander retina

PubMed Central

Attwell, David; Werblin, Frank S.; Wilson, Martin

1982-01-01

1. The properties of isolated single cones were studied using the voltage-clamp technique, with two micro-electrodes inserted under visual control. 2. Single cones had input resistances, when impaled with two electrodes, of up to 270 MΩ. This is probably lower than the true membrane resistance, because of damage by the impaling electrodes. The cone capacitance was about 85 pF. 3. The cone membrane contains a time-dependent current, IB, controlled by voltage, and a separate photosensitive current. 4. The gated current, IB, is an inward current with a reversal potential around -25 mV. It is activated by hyperpolarization over the range -30 to -80 mV, and at constant voltage obeys first order (exponential) kinetics. The gating time constant is typically 50 ms at the resting potential of -45 mV, rises to 170 ms at -70 mV, and decreases for further hyperpolarization. 5. The spectral sensitivity curve of the cone light response peaks at 620 nm wave-length, and is narrower than the nomogram for vitamin A2-based pigments. The light responses of isolated cones are spectrally univariant. 6. Voltage-clamped photocurrents were recorded at various membrane potentials, for light steps of various intensities. The photocurrent reversed at around -8 mV. The time course of the photocurrent, for a given intensity, was approximately independent of voltage (although its magnitude was voltage-dependent). The shape of the peak current—voltage relation of the light-sensitive current was independent of light intensity (although its magnitude was intensity-dependent). 7. These results can be explained if: (a) light simply changes the number of photosensitive channels open, without altering the properties of an open channel; (b) the reactions controlling the production of internal transmitter, the binding of internal transmitter to the photosensitive channels, and the closing and opening of the channels are unaffected by the electric field in the cone membrane, even though at least some of these reactions take place in the membrane. 8. IB plays only a small role in shaping the cone voltage response to light. ImagesPlate 1 PMID:7131315

Properties of an inward rectifying K channel in the membrane of guinea-pig atrial cardioballs.

PubMed

Bechem, M; Glitsch, H G; Pott, L

1983-11-01

Single channel outward current fluctuations are recorded in excised (outside-out) membrane patches of isolated atrial cells in culture (cardioballs) from hearts of adult guinea-pigs. The ionic channel displays a high selectivity to K ions. Accordingly the reversal potential of the single channel current is close to the K equilibrium potential. The open channel conductance is unaffected by the membrane potential but depends on the K concentration of the outside solution (19.7pS at 2 mM Ko to 30.7pS at 20 mM Ko). The open state probability (Po) of the channel shows a marked voltage dependence. Po amounts to c.0.9 at -40 mV and decreases to c.0.1 at +40 mV. Under the assumption of no channel interaction a macroscopic steady state current voltage relationship is reconstructed from the single channel data. The relationship displays inward-going rectification. The rectification is due to the voltage dependence of Po. The I-V curve displays a negative slope at membrane potentials positive to -15 mV. In bathing solutions containing Ba ions (0.2 mM) Po is reduced by rapid closures which interrupt the open state events. The unit channel conductance is unaffected by Ba ions. The channel block exerted by Ba ions is augmented with increasing membrane hyperpolarization. The results suggest that the channel studied may represent a background K conductance.

Resurgent current of voltage-gated Na+ channels

PubMed Central

Lewis, Amanda H; Raman, Indira M

2014-01-01

Resurgent Na+ current results from a distinctive form of Na+ channel gating, originally identified in cerebellar Purkinje neurons. In these neurons, the tetrodotoxin-sensitive voltage-gated Na+ channels responsible for action potential firing have specialized mechanisms that reduce the likelihood that they accumulate in fast inactivated states, thereby shortening refractory periods and permitting rapid, repetitive, and/or burst firing. Under voltage clamp, step depolarizations evoke transient Na+ currents that rapidly activate and quickly decay, and step repolarizations elicit slower channel reopening, or a ‘resurgent’ current. The generation of resurgent current depends on a factor in the Na+ channel complex, probably a subunit such as NaVβ4 (Scn4b), which blocks open Na+ channels at positive voltages, competing with the fast inactivation gate, and unblocks at negative voltages, permitting recovery from an open channel block along with a flow of current. Following its initial discovery, resurgent Na+ current has been found in nearly 20 types of neurons. Emerging research suggests that resurgent current is preferentially increased in a variety of clinical conditions associated with altered cellular excitability. Here we review the biophysical, molecular and structural mechanisms of resurgent current and their relation to the normal functions of excitable cells as well as pathophysiology. PMID:25172941

A Dihydropyridine-sensitive Voltage-dependent Calcium Channel in the Sarcolemmal Membrane of Crustacean Muscle

PubMed Central

Erxleben, Christian; Rathmayer, Werner

1997-01-01

Single-channel currents through calcium channels in muscle of a marine crustacean, the isopod Idotea baltica, were investigated in cell-attached patches. Inward barium currents were strongly voltage-dependent, and the channels were closed at the cell's resting membrane potential. The open probability (Po) increased e-fold for an 8.2 mV (±2.4, n = 13) depolarization. Channel openings were mainly brief (<0.3 ms) and evenly distributed throughout 100-ms pulses. Averaged, quasimacroscopic currents showed fast activation and deactivation and did not inactivate during 100-ms test pulses. Similarly, channel activity persisted at steadily depolarized holding potentials. With 200 mM Ba2+ as charge carrier, the average slope conductance from the unitary currents between +30 and +80 mV, was 20 pS (±2.6, n = 12). The proportion of long openings, which were very infrequent under control conditions, was greatly increased by preincubation of the muscle fibers with the calcium channel agonist, the dihydropyridine Bay K8644 (10–100 μM). Properties of these currents resemble those through the L-type calcium channels of mammalian nerve, smooth muscle, and cardiac muscle cells. PMID:9089439

Hydrophobic interaction between contiguous residues in the S6 transmembrane segment acts as a stimuli integration node in the BK channel

PubMed Central

Carrasquel-Ursulaez, Willy; Contreras, Gustavo F.; Sepúlveda, Romina V.; Aguayo, Daniel; González-Nilo, Fernando

2015-01-01

Large-conductance Ca2+- and voltage-activated K+ channel (BK) open probability is enhanced by depolarization, increasing Ca2+ concentration, or both. These stimuli activate modular voltage and Ca2+ sensors that are allosterically coupled to channel gating. Here, we report a point mutation of a phenylalanine (F380A) in the S6 transmembrane helix that, in the absence of internal Ca2+, profoundly hinders channel opening while showing only minor effects on the voltage sensor active–resting equilibrium. Interpretation of these results using an allosteric model suggests that the F380A mutation greatly increases the free energy difference between open and closed states and uncouples Ca2+ binding from voltage sensor activation and voltage sensor activation from channel opening. However, the presence of a bulky and more hydrophobic amino acid in the F380 position (F380W) increases the intrinsic open–closed equilibrium, weakening the coupling between both sensors with the pore domain. Based on these functional experiments and molecular dynamics simulations, we propose that F380 interacts with another S6 hydrophobic residue (L377) in contiguous subunits. This pair forms a hydrophobic ring important in determining the open–closed equilibrium and, like an integration node, participates in the communication between sensors and between the sensors and pore. Moreover, because of its effects on open probabilities, the F380A mutant can be used for detailed voltage sensor experiments in the presence of permeant cations. PMID:25548136

Volume-dependent ATP-conductive large-conductance anion channel as a pathway for swelling-induced ATP release.

PubMed

Sabirov, R Z; Dutta, A K; Okada, Y

2001-09-01

In mouse mammary C127i cells, during whole-cell clamp, osmotic cell swelling activated an anion channel current, when the phloretin-sensitive, volume-activated outwardly rectifying Cl(-) channel was eliminated. This current exhibited time-dependent inactivation at positive and negative voltages greater than around +/-25 mV. The whole-cell current was selective for anions and sensitive to Gd(3)+. In on-cell patches, single-channel events appeared with a lag period of approximately 15 min after a hypotonic challenge. Under isotonic conditions, cell-attached patches were silent, but patch excision led to activation of currents that consisted of multiple large-conductance unitary steps. The current displayed voltage- and time-dependent inactivation similar to that of whole-cell current. Voltage-dependent activation profile was bell-shaped with the maximum open probability at -20 to 0 mV. The channel in inside-out patches had the unitary conductance of approximately 400 pS, a linear current-voltage relationship, and anion selectivity. The outward (but not inward) single-channel conductance was suppressed by extracellular ATP with an IC(50) of 12.3 mM and an electric distance (delta) of 0.47, whereas the inward (but not outward) conductance was inhibited by intracellular ATP with an IC(50) of 12.9 mM and delta of 0.40. Despite the open channel block by ATP, the channel was ATP-conductive with P(ATP)/P(Cl) of 0.09. The single-channel activity was sensitive to Gd(3)+, SITS, and NPPB, but insensitive to phloretin, niflumic acid, and glibenclamide. The same pharmacological pattern was found in swelling-induced ATP release. Thus, it is concluded that the volume- and voltage-dependent ATP-conductive large-conductance anion channel serves as a conductive pathway for the swelling-induced ATP release in C127i cells.

Mechanism of Tacrine Block at Adult Human Muscle Nicotinic Acetylcholine Receptors

PubMed Central

Prince, Richard J.; Pennington, Richard A.; Sine, Steven M.

2002-01-01

We used single-channel kinetic analysis to study the inhibitory effects of tacrine on human adult nicotinic receptors (nAChRs) transiently expressed in HEK 293 cells. Single channel recording from cell-attached patches revealed concentration- and voltage-dependent decreases in mean channel open probability produced by tacrine (IC50 4.6 μM at −70 mV, 1.6 μM at −150 mV). Two main effects of tacrine were apparent in the open- and closed-time distributions. First, the mean channel open time decreased with increasing tacrine concentration in a voltage-dependent manner, strongly suggesting that tacrine acts as an open-channel blocker. Second, tacrine produced a new class of closings whose duration increased with increasing tacrine concentration. Concentration dependence of closed-times is not predicted by sequential models of channel block, suggesting that tacrine blocks the nAChR by an unusual mechanism. To probe tacrine's mechanism of action we fitted a series of kinetic models to our data using maximum likelihood techniques. Models incorporating two tacrine binding sites in the open receptor channel gave dramatically improved fits to our data compared with the classic sequential model, which contains one site. Improved fits relative to the sequential model were also obtained with schemes incorporating a binding site in the closed channel, but only if it is assumed that the channel cannot gate with tacrine bound. Overall, the best description of our data was obtained with a model that combined two binding sites in the open channel with a single site in the closed state of the receptor. PMID:12198092

Sequential interaction of chloride and proton ions with the fast gate steer the voltage-dependent gating in ClC-2 chloride channels

PubMed Central

Sánchez-Rodríguez, Jorge E; De Santiago-Castillo, José A; Contreras-Vite, Juan Antonio; Nieto-Delgado, Pablo G; Castro-Chong, Alejandra; Arreola, Jorge

2012-01-01

The interaction of either H+ or Cl− ions with the fast gate is the major source of voltage (Vm) dependence in ClC Cl− channels. However, the mechanism by which these ions confer Vm dependence to the ClC-2 Cl− channel remains unclear. By determining the Vm dependence of normalized conductance (Gnorm(Vm)), an index of open probability, ClC-2 gating was studied at different [H+]i, [H+]o and [Cl−]i. Changing [H+]i by five orders of magnitude whilst [Cl−]i/[Cl−]o = 140/140 or 10/140 mm slightly shifted Gnorm(Vm) to negative Vm without altering the onset kinetics; however, channel closing was slower at acidic pHi. A similar change in [H+]o with [Cl−]i/[Cl−]o = 140/140 mm enhanced Gnorm in a bell-shaped manner and shifted Gnorm(Vm) curves to positive Vm. Importantly, Gnorm was >0 with [H+]o = 10−10 m but channel closing was slower when [H+]o or [Cl−]i increased implying that ClC-2 was opened without protonation and that external H+ and/or internal Cl− ions stabilized the open conformation. The analysis of kinetics and steady-state properties at different [H+]o and [Cl−]i was carried out using a gating Scheme coupled to Cl− permeation. Unlike previous results showing Vm-dependent protonation, our analysis revealed that fast gate protonation was Vm and Cl− independent and the equilibrium constant for closed–open transition of unprotonated channels was facilitated by elevated [Cl−]i in a Vm-dependent manner. Hence a Vm dependence of pore occupancy by Cl− induces a conformational change in unprotonated closed channels, before the pore opens, and the open conformation is stabilized by Cl− occupancy and Vm-independent protonation. PMID:22753549

Calcium channel currents in bovine adrenal chromaffin cells and their modulation by anaesthetic agents.

PubMed Central

Charlesworth, P; Pocock, G; Richards, C D

1994-01-01

1. The calcium channel currents of bovine adrenal chromaffin cells were characterized using a variety of voltage pulse protocols and selective channel blockers before examination of their modulation by anaesthetic agents. 2. All the anaesthetics studied (halothane, methoxyflurane, etomidate and methohexitone) inhibited the calcium channel currents in a concentration-dependent manner and increased the rate of current decay. 3. The anaesthetics did not shift the current-voltage relation nor did they change the voltage for half-maximal channel activation derived from analysis of the voltage dependence of the tail currents. None of the anaesthetics appeared to alter the time constant of tail current decay. 4. To complement earlier studies of the inhibitory actions of anaesthetics on K(+)-evoked catecholamine secretion and the associated Ca2+ uptake, the IC50 values for etomidate and methohexitone were determined using a biochemical assay. The IC50 values for anaesthetic inhibition of calcium channel currents corresponded closely with those for inhibition of K(+)-evoked calcium uptake and catecholamine secretion. 5. The inhibitory effect of the volatile anaesthetics and etomidate is best explained by dual action: a reduction in the probability of channel opening coupled with an increase in the rate of channel inactivation. Methohexitone appeared to inhibit the currents by a use-dependent slow block. PMID:7707224

Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

NASA Astrophysics Data System (ADS)

Vaccaro, S. R.

2011-09-01

The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

A Voltage Dependent Non-Inactivating Na+ Channel Activated during Apoptosis in Xenopus Oocytes

PubMed Central

Englund, Ulrika H.; Gertow, Jens; Kågedal, Katarina; Elinder, Fredrik

2014-01-01

Ion channels in the plasma membrane are important for the apoptotic process. Different types of voltage-gated ion channels are up-regulated early in the apoptotic process and block of these channels prevents or delays apoptosis. In the present investigation we examined whether ion channels are up-regulated in oocytes from the frog Xenopus laevis during apoptosis. The two-electrode voltage-clamp technique was used to record endogenous ion currents in the oocytes. During staurosporine-induced apoptosis a voltage-dependent Na+ current increased three-fold. This current was activated at voltages more positive than 0 mV (midpoint of the open-probability curve was +55 mV) and showed almost no sign of inactivation during a 1-s pulse. The current was resistant to the Na+-channel blockers tetrodotoxin (1 µM) and amiloride (10 µM), while the Ca2+-channel blocker verapamil (50 µM) in the bath solution completely blocked the current. The intracellular Na+ concentration increased in staurosporine-treated oocytes, but could be prevented by replacing extracellular Na+ whith either K+ or Choline+. Prevention of this influx of Na+ also prevented the STS-induced up-regulation of the caspase-3 activity, suggesting that the intracellular Na+ increase is required to induce apoptosis. Taken together, we have found that a voltage dependent Na+ channel is up-regulated during apoptosis and that influx of Na+ is a crucial step in the apoptotic process in Xenopus oocytes. PMID:24586320

Gating kinetics of batrachotoxin-modified Na+ channels in the squid giant axon. Voltage and temperature effects.

PubMed Central

Correa, A M; Bezanilla, F; Latorre, R

1992-01-01

The gating kinetics of batrachotoxin-modified Na+ channels were studied in outside-out patches of axolemma from the squid giant axon by means of the cut-open axon technique. Single channel kinetics were characterized at different membrane voltages and temperatures. The probability of channel opening (Po) as a function of voltage was well described by a Boltzmann distribution with an equivalent number of gating particles of 3.58. The voltage at which the channel was open 50% of the time was a function of [Na+] and temperature. A decrease in the internal [Na+] induced a shift to the right of the Po vs. V curve, suggesting the presence of an integral negative fixed charge near the activation gate. An increase in temperature decreased Po, indicating a stabilization of the closed configuration of the channel and also a decrease in entropy upon channel opening. Probability density analysis of dwell times in the closed and open states of the channel at 0 degrees C revealed the presence of three closed and three open states. The slowest open kinetic component constituted only a small fraction of the total number of transitions and became negligible at voltages greater than -65 mV. Adjacent interval analysis showed that there is no correlation in the duration of successive open and closed events. Consistent with this analysis, maximum likelihood estimation of the rate constants for nine different single-channel models produced a preferred model (model 1) having a linear sequence of closed states and two open states emerging from the last closed state. The effect of temperature on the rate constants of model 1 was studied. An increase in temperature increased all rate constants; the shift in Po would be the result of an increase in the closing rates predominant over the change in the opening rates. The temperature study also provided the basis for building an energy diagram for the transitions between channel states. PMID:1318096

Binding of benzocaine in batrachotoxin-modified Na+ channels. State- dependent interactions

PubMed Central

1994-01-01

Hille (1977. Journal of General Physiology. 69:497-515) first proposed a modulated receptor hypothesis (MRH) to explain the action of benzocaine in voltage-gated Na+ channels. Using the MRH as a framework, we examined benzocaine binding in batrachotoxin (BTX)-modified Na+ channels under voltage-clamp conditions using either step or ramp command signals. We found that benzocaine binding is strongly voltage dependent. At -70 mV, the concentration of benzocaine that inhibits 50% of BTX-modified Na+ currents in GH3 cells (IC50) is 0.2 mM, whereas at +50 mV, the IC50 is 1.3 mM. Dose-response curves indicate that only one molecule of benzocaine is required to bind with one BTX-modified Na+ channel at -70 mV, whereas approximately two molecules are needed at +50 mV. Upon treatment with the inactivation modifier chloramine-T, the binding affinity of benzocaine is reduced significantly at -70 mV, probably as a result of the removal of the inactivated state of BTX- modified Na+ channels. The same treatment, however, enhances the binding affinity of cocaine near this voltage. External Na+ ions appear to have little effect on benzocaine binding, although they do affect cocaine binding. We conclude that two mechanisms underlie the action of local anesthetics in BTX-modified Na+ channels. Unlike open-channel blockers such as cocaine and bupivacaine, neutral benzocaine binds preferentially with BTX-modified Na+ channels in a closed state. Furthermore, benzocaine can be modified chemically so that it behaves like an open-channel blocker. This compound also elicits a use- dependent block in unmodified Na+ channels after repetitive depolarizations, whereas benzocaine does not. The implications of these findings for the MRH theory will be discussed. PMID:8195785

Charge movement in gating-locked HCN channels reveals weak coupling of voltage sensors and gate.

PubMed

Ryu, Sujung; Yellen, Gary

2012-11-01

HCN (hyperpolarization-activated cyclic nucleotide gated) pacemaker channels have an architecture similar to that of voltage-gated K(+) channels, but they open with the opposite voltage dependence. HCN channels use essentially the same positively charged voltage sensors and intracellular activation gates as K(+) channels, but apparently these two components are coupled differently. In this study, we examine the energetics of coupling between the voltage sensor and the pore by using cysteine mutant channels for which low concentrations of Cd(2+) ions freeze the open-closed gating machinery but still allow the sensors to move. We were able to lock mutant channels either into open or into closed states by the application of Cd(2+) and measure the effect on voltage sensor movement. Cd(2+) did not immobilize the gating charge, as expected for strict coupling, but rather it produced shifts in the voltage dependence of voltage sensor charge movement, consistent with its effect of confining transitions to either closed or open states. From the magnitude of the Cd(2+)-induced shifts, we estimate that each voltage sensor produces a roughly three- to sevenfold effect on the open-closed equilibrium, corresponding to a coupling energy of ∼1.3-2 kT per sensor. Such coupling is not only opposite in sign to the coupling in K(+) channels, but also much weaker.

The role of a conserved proline residue in mediating conformational changes associated with voltage gating of Cx32 gap junctions.

PubMed Central

Ri, Y; Ballesteros, J A; Abrams, C K; Oh, S; Verselis, V K; Weinstein, H; Bargiello, T A

1999-01-01

We have explored the role of a proline residue located at position 87 in the second transmembrane segment (TM2) of gap junctions in the mechanism of voltage-dependent gating of connexin32 (Cx32). Substitution of this proline (denoted Cx32P87) with residues G, A, or V affects channel function in a progressive manner consistent with the expectation that a proline kink (PK) motif exists in the second transmembrane segment (TM2) of this connexin. Mutations of the preceding threonine residue T86 to S, A, C, V, N, or L shift the conductance-voltage relation of wild-type Cx32, such that the mutated channels close at smaller transjunctional voltages. The observed shift in voltage dependence is consistent with a reduction in the open probability of the mutant hemichannels at a transjunctional voltage (Vj) of 0 mV. In both cases in which kinetics were examined, the time constants for reaching steady state were faster for T86N and T86A than for wild type at comparable voltages, suggesting that the T86 mutations cause the energetic destabilization of the open state relative to the other states of the channel protein. The structural underpinnings of the observed effects were explored with Monte Carlo simulations. The conformational space of TM2 helices was found to differ for the T86A, V, N, and L mutants, which produce a less bent helix ( approximately 20 degrees bend angle) compared to the wild type, which has a approximately 37 degrees bend angle. The greater bend angle of the wild-type helix reflects the propensity of the T86 residue to hydrogen bond with the backbone carbonyl of amino acid residue I82. The relative differences in propensity for hydrogen bonding of the mutants relative to the wild-type threonine residue in the constructs we studied (T86A, V, N, L, S, and C) correlate with the shift in the conductance-voltage relation observed for T86 mutations. The data are consistent with a structural model in which the open conformation of the Cx32 channel corresponds to a more bent TM2 helix, and the closed conformation corresponds to a less bent helix. We propose that the modulation of the hydrogen-bonding potential of the T86 residue alters the bend angle of the PK motif and mediates conformational changes between open and closed channel states. PMID:10354417

Scorpion β-toxin interference with NaV channel voltage sensor gives rise to excitatory and depressant modes

PubMed Central

Leipold, Enrico; Borges, Adolfo

2012-01-01

Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487

Blocking and isolation of a calcium channel from neurons in mammals and cephalopods utilizing a toxin fraction (FTX) from funnel-web spider poison.

PubMed Central

Llinás, R; Sugimori, M; Lin, J W; Cherksey, B

1989-01-01

A Ca2+-channel blocker derived from funnel-web spider toxin (FTX) has made it possible to define and study the ionic channels responsible for the Ca2+ conductance in mammalian Purkinje cell neurons and the preterminal in squid giant synapse. In cerebellar slices, FTX blocked Ca2+-dependent spikes in Purkinje cells, reduced the spike afterpotential hyperpolarization, and increased the Na+-dependent plateau potential. In the squid giant synapse, FTX blocked synaptic transmission without affecting the presynaptic action potential. Presynaptic voltage-clamp results show blockage of the inward Ca2+ current and of transmitter release. FTX was used to isolate channels from cerebellum and squid optic lobe. The isolated product was incorporated into black lipid membranes and was analyzed by using patch-clamp techniques. The channel from cerebellum exhibited a 10- to 12-pS conductance in 80 mM Ba2+ and 5-8 pS in 100 mM Ca2+ with voltage-dependent open probabilities and kinetics. High Ba2+ concentrations at the cytoplasmic side of the channel increased the average open time from 1 to 3 msec to more than 1 sec. A similar channel was also isolated from squid optic lobe. However, its conductance was higher in Ba2+, and the maximum opening probability was about half of that derived from cerebellar tissue and also was sensitive to high cytoplasmic Ba2+. Both channels were blocked by FTX, Cd2+, and Co2+ but were not blocked by omega-conotoxin or dihydropyridines. These results suggest that one of the main Ca2+ conductances in mammalian neurons and in the squid preterminal represents the activation of a previously undefined class of Ca2+ channel. We propose that it be termed the "P" channel, as it was first described in Purkinje cells. Images PMID:2537980

Blocking and isolation of a calcium channel from neurons in mammals and cephalopods utilizing a toxin fraction (FTX) from funnel-web spider poison.

PubMed

Llinás, R; Sugimori, M; Lin, J W; Cherksey, B

1989-03-01

A Ca2+-channel blocker derived from funnel-web spider toxin (FTX) has made it possible to define and study the ionic channels responsible for the Ca2+ conductance in mammalian Purkinje cell neurons and the preterminal in squid giant synapse. In cerebellar slices, FTX blocked Ca2+-dependent spikes in Purkinje cells, reduced the spike afterpotential hyperpolarization, and increased the Na+-dependent plateau potential. In the squid giant synapse, FTX blocked synaptic transmission without affecting the presynaptic action potential. Presynaptic voltage-clamp results show blockage of the inward Ca2+ current and of transmitter release. FTX was used to isolate channels from cerebellum and squid optic lobe. The isolated product was incorporated into black lipid membranes and was analyzed by using patch-clamp techniques. The channel from cerebellum exhibited a 10- to 12-pS conductance in 80 mM Ba2+ and 5-8 pS in 100 mM Ca2+ with voltage-dependent open probabilities and kinetics. High Ba2+ concentrations at the cytoplasmic side of the channel increased the average open time from 1 to 3 msec to more than 1 sec. A similar channel was also isolated from squid optic lobe. However, its conductance was higher in Ba2+, and the maximum opening probability was about half of that derived from cerebellar tissue and also was sensitive to high cytoplasmic Ba2+. Both channels were blocked by FTX, Cd2+, and Co2+ but were not blocked by omega-conotoxin or dihydropyridines. These results suggest that one of the main Ca2+ conductances in mammalian neurons and in the squid preterminal represents the activation of a previously undefined class of Ca2+ channel. We propose that it be termed the "P" channel, as it was first described in Purkinje cells.

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+) channels.

PubMed

Lee, Seok-Yong; Banerjee, Anirban; MacKinnon, Roderick

2009-03-03

Voltage-dependent K(+) (Kv) channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors), which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

"An estimate of the probability of vesicle exocytosis in a Monte Carlo model of buffered diffusion of calcium channel currents"

NASA Astrophysics Data System (ADS)

Dimcovic, Z. M.; Eagan, T. P.; Kidane, T. K.; Brown, R. W.; Petschek, R. G.; McEnery, M. W.

2001-10-01

The opening of voltage-dependent calcium channels results in an influx of calcium ions promoting the fusion of synaptic vesicles. The fusion leads to release of neurotransmitters, which in turn allow the propagation of nerve impulses. A Monte Carlo model of the diffusion of calcium following its surge into the cell is used to estimate the probability for exocytosis. Besides the calcium absorption by fixed and mobile buffers, key ingredients are the physical size and position of the tethered vesicle and a sensing model for the interaction of the vesicle and calcium. The release probability is compared to previously published studies where the finite vesicle size was not considered. (Supported by NIH MH55747, AHA 96001250, NSF0086643, and a CWRU Presidential Research Initiative grant.)

Analysis of a novel double-barreled anion channel from rat liver rough endoplasmic reticulum.

PubMed Central

Morier, N; Sauvé, R

1994-01-01

The presence of anionic channels in stripped rough endoplasmic reticulum membranes isolated from rat hepatocytes was investigated by fusing microsomes from these membranes to a planar lipid bilayer. Several types of anion-selective channels were observed including a voltage-gated Cl- channel, the activity of which appeared in bursts characterized by transitions among three distinct conductance levels of 0 pS (0 level), 160 pS (O1 level), and 320 pS (O2 level), respectively, in 450 mM (cis) 50 mM (trans) KCl conditions. A chi 2 analysis on current records where interburst silent periods were omitted showed that the relative probability of current levels 0 (baseline), O1, and O2 followed a binomial statistic. However, measurements of the conditional probabilities W(level 0 at tau/level O2 at 0) and W(level O2 at tau/level 0 at 0) provided clear evidence of direct transitions between the current levels 0 and O2 without any detectable transitions to the intermediate level O1. It was concluded on the basis of these results that the observed channel was controlled by at least two distinct gating processes, namely 1) a voltage-dependent activation mechanism in which the entire system behaves as two independent monomeric channels of 160 pS with each channel characterized by a simple Open-Closed kinetic, and 2) a slow voltage-dependent process that accounts for both the appearance of silent periods between bursts of channel activity and the transitions between the current levels 0 and O2. Finally, an analysis of the relative probability for the system to be in levels 0, O1, and O2 showed that our results are more compatible with a model in which all the states resulting from the superposition of the two independent monomeric channels have access at different rates to a common inactivated state than with a model where a simple Open-Closed main gate either occludes or exposes simultaneously two independent 160-pS monomers. Images FIGURE 2 FIGURE 6 PMID:7524709

Development of a voltage-dependent current noise algorithm for conductance-based stochastic modelling of auditory nerve fibres.

PubMed

Badenhorst, Werner; Hanekom, Tania; Hanekom, Johan J

2016-12-01

This study presents the development of an alternative noise current term and novel voltage-dependent current noise algorithm for conductance-based stochastic auditory nerve fibre (ANF) models. ANFs are known to have significant variance in threshold stimulus which affects temporal characteristics such as latency. This variance is primarily caused by the stochastic behaviour or microscopic fluctuations of the node of Ranvier's voltage-dependent sodium channels of which the intensity is a function of membrane voltage. Though easy to implement and low in computational cost, existing current noise models have two deficiencies: it is independent of membrane voltage, and it is unable to inherently determine the noise intensity required to produce in vivo measured discharge probability functions. The proposed algorithm overcomes these deficiencies while maintaining its low computational cost and ease of implementation compared to other conductance and Markovian-based stochastic models. The algorithm is applied to a Hodgkin-Huxley-based compartmental cat ANF model and validated via comparison of the threshold probability and latency distributions to measured cat ANF data. Simulation results show the algorithm's adherence to in vivo stochastic fibre characteristics such as an exponential relationship between the membrane noise and transmembrane voltage, a negative linear relationship between the log of the relative spread of the discharge probability and the log of the fibre diameter and a decrease in latency with an increase in stimulus intensity.

Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission

PubMed Central

Naranjo, David; Wen, Hua; Brehm, Paul

2015-01-01

The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925

Calcium/calmodulin-dependent serine protein kinase CASK modulates the L-type calcium current.

PubMed

Nafzger, Sabine; Rougier, Jean-Sebastien

2017-01-01

The L-type voltage-gated calcium channel Ca v 1.2 mediates the calcium influx into cells upon membrane depolarization. The list of cardiopathies associated to Ca v 1.2 dysfunctions highlights the importance of this channel in cardiac physiology. Calcium/calmodulin-dependent serine protein kinase (CASK), expressed in cardiac cells, has been identified as a regulator of Ca v 2.2 channels in neurons, but no experiments have been performed to investigate its role in Ca v 1.2 regulation. Full length or the distal C-terminal truncated of the pore-forming Ca v 1.2 channel (Ca v 1.2α1c), both present in cardiac cells, were expressed in TsA-201 cells. In addition, a shRNA silencer, or scramble as negative control, of CASK was co-transfected in order to silence CASK endogenously expressed. Three days post-transfection, the barium current was increased only for the truncated form without alteration of the steady state activation and inactivation biophysical properties. The calcium current, however, was increased after CASK silencing with both types of Ca v 1.2α1c subunits suggesting that, in absence of calcium, the distal C-terminal counteracts the CASK effect. Biochemistry experiments did not reveals neither an alteration of Ca v 1.2 channel protein expression after CASK silencing nor an interaction between Ca v 1.2α1c subunits and CASK. Nevertheless, after CASK silencing, single calcium channel recordings have shown an increase of the voltage-gated calcium channel Ca v 1.2 open probability explaining the increase of the whole-cell current. This study suggests CASK as a novel regulator of Ca v 1.2 via a modulation of the voltage-gated calcium channel Ca v 1.2 open probability. Copyright © 2016 Elsevier Ltd. All rights reserved.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Using lidocaine and benzocaine to link sodium channel molecular conformations to state-dependent antiarrhythmic drug affinity.

PubMed

Hanck, Dorothy A; Nikitina, Elena; McNulty, Megan M; Fozzard, Harry A; Lipkind, Gregory M; Sheets, Michael F

2009-08-28

Lidocaine and other antiarrhythmic drugs bind in the inner pore of voltage-gated Na channels and affect gating use-dependently. A phenylalanine in domain IV, S6 (Phe1759 in Na(V)1.5), modeled to face the inner pore just below the selectivity filter, is critical in use-dependent drug block. Measurement of gating currents and concentration-dependent availability curves to determine the role of Phe1759 in coupling of drug binding to the gating changes. The measurements showed that replacement of Phe1759 with a nonaromatic residue permits clear separation of action of lidocaine and benzocaine into 2 components that can be related to channel conformations. One component represents the drug acting as a voltage-independent, low-affinity blocker of closed channels (designated as lipophilic block), and the second represents high-affinity, voltage-dependent block of open/inactivated channels linked to stabilization of the S4s in domains III and IV (designated as voltage-sensor inhibition) by Phe1759. A homology model for how lidocaine and benzocaine bind in the closed and open/inactivated channel conformation is proposed. These 2 components, lipophilic block and voltage-sensor inhibition, can explain the differences in estimates between tonic and open-state/inactivated-state affinities, and they identify how differences in affinity for the 2 binding conformations can control use-dependence, the hallmark of successful antiarrhythmic drugs.

Characterization of a Ca(2+)-dependent anion channel from sheep tracheal epithelium incorporated into planar bilayers.

PubMed Central

Alton, E W; Manning, S D; Schlatter, P J; Geddes, D M; Williams, A J

1991-01-01

1. Anion-selective channels from the apical membrane of respiratory epithelia are involved in the secretion of chloride into the airway lumen. In cystic fibrosis (CF) there is an abnormality of phosphorylation-regulated chloride transport in this tissue, whilst a calcium-dependent pathway appears to function normally. 2. Using incorporation of apical membrane vesicles into planar phospholipid bilayers, we have characterized the most commonly seen anion-selective channel from sheep tracheal epithelium. 3. In symmetrical 200 mM-NaCl solutions the channel showed rectification, with a chord conductance at negative voltages of 107 pS and at positive voltages of 67 pS. The channel characteristically demonstrated subconductance states at 1/3 and 3/4 of the fully open level. Selectivity for chloride over sodium was approximately 6:1. 4. The channel required a minimum of approximately 100 microM-calcium on the presumed cytoplasmic surface (cis) for opening events to be observed. Open probability (Po) of the fully open state was markedly voltage dependent, but little effect of voltage was seen on the 1/3 subconductance state. 5. The relative permeabilities of monovalent anions monitored under bi-ionic conditions gave the following sequence: NO3- greater than I- greater than Cl- = Br- much much greater than F-. The order of conductances in symmetrical solutions was Cl- = NO3- greater than Br- greater than I- much much greater than F-. 6. The chloride channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoate (NPPB) produced a dose-related reduction in Po with a flickering block at 10-50 microM and complete block at higher concentrations. 7. ATP produced a dose-related reduction in Po with effects at 1 microM and complete closing at 1 mM. These effects were only seen with addition to the cis chamber. 8. The catalytic subunit of protein kinase A, either when incubated with vesicles prior to incorporation into bilayers, or when added directly to either chamber, produced no effect. 9. Channels with very similar properties were seen from transfected human tracheo-bronchial cells. 10. Recent whole-cell patch-clamp studies have suggested a distinct calcium-activated chloride current in secretory epithelia. The described channel has properties in common with this current and may be a candidate for its single-channel basis. PMID:1726592

Recombination in polymer-fullerene bulk heterojunction solar cells

NASA Astrophysics Data System (ADS)

Cowan, Sarah R.; Roy, Anshuman; Heeger, Alan J.

2010-12-01

Recombination of photogenerated charge carriers in polymer bulk heterojunction (BHJ) solar cells reduces the short circuit current (Jsc) and the fill factor (FF). Identifying the mechanism of recombination is, therefore, fundamentally important for increasing the power conversion efficiency. Light intensity and temperature-dependent current-voltage measurements on polymer BHJ cells made from a variety of different semiconducting polymers and fullerenes show that the recombination kinetics are voltage dependent and evolve from first-order recombination at short circuit to bimolecular recombination at open circuit as a result of increasing the voltage-dependent charge carrier density in the cell. The “missing 0.3 V” inferred from comparison of the band gaps of the bulk heterojunction materials and the measured open-circuit voltage at room-temperature results from the temperature dependence of the quasi-Fermi levels in the polymer and fullerene domains—a conclusion based on the fundamental statistics of fermions.

Derivation of Hodgkin-Huxley equations for a Na+ channel from a master equation for coupled activation and inactivation

NASA Astrophysics Data System (ADS)

Vaccaro, S. R.

2016-11-01

The Na+ current in nerve and muscle membranes may be described in terms of the activation variable m (t ) and the inactivation variable h (t ) , which are dependent on the transitions of S4 sensors of each of the Na+ channel domains DI to DIV. The time-dependence of the Na+ current and the rate equations satisfied by m (t ) and h (t ) may be derived from the solution to a master equation that describes the coupling between two or three activation sensors regulating the Na+ channel conductance and a two-stage inactivation process. If the inactivation rate from the closed or open states increases as the S4 sensors activate, a more general form of the Hodgkin-Huxley expression for the open-state probability may be derived where m (t ) is dependent on both activation and inactivation processes. The voltage dependence of the rate functions for inactivation and recovery from inactivation are consistent with the empirically determined expressions and exhibit saturation for both depolarized and hyperpolarized clamp potentials.

Evidence for a separate mechanism of toxicity for the Type I and the Type II pyrethroid insecticides.

PubMed

Breckenridge, Charles B; Holden, Larry; Sturgess, Nicholas; Weiner, Myra; Sheets, Larry; Sargent, Dana; Soderlund, David M; Choi, Jin-Sung; Symington, Steve; Clark, J Marshall; Burr, Steve; Ray, David

2009-11-01

Neurotoxicity and mechanistic data were collected for six alpha-cyano pyrethroids (beta-cyfluthrin, cypermethrin, deltamethrin, esfenvalerate, fenpropathrin and lambda-cyhalothrin) and up to six non-cyano containing pyrethroids (bifenthrin, S-bioallethrin [or allethrin], permethrin, pyrethrins, resmethrin [or its cis-isomer, cismethrin] and tefluthrin under standard conditions. Factor analysis and multivariate dissimilarity analysis were employed to evaluate four independent data sets comprised of (1) fifty-six behavioral and physiological parameters from an acute neurotoxicity functional observatory battery (FOB), (2) eight electrophysiological parameters from voltage clamp experiments conducted on the Na(v)1.8 sodium channel expressed in Xenopus oocytes, (3) indices of efficacy, potency and binding calculated for calcium ion influx across neuronal membranes, membrane depolarization and glutamate released from rat brain synaptosomes and (4) changes in chloride channel open state probability using a patch voltage clamp technique for membranes isolated from mouse neuroblastoma cells. The pyrethroids segregated into Type I (T--syndrome-tremors) and Type II (CS syndrome--choreoathetosis with salivation) groups based on FOB data. Of the alpha-cyano pyrethroids, deltamethrin, lambda-cyhalothrin, cyfluthrin and cypermethrin arrayed themselves strongly in a dose-dependent manner along two factors that characterize the CS syndrome. Esfenvalerate and fenpropathrin displayed weaker response profiles compared to the non-cyano pyrethroids. Visual clustering on multidimensional scaling (MDS) maps based upon sodium ion channel and calcium influx and glutamate release dissimilarities gave similar groupings. The non-cyano containing pyrethroids were arrayed in a dose-dependent manner along two different factors that characterize the T-syndrome. Bifenthrin was an outlier when MDS maps of the non-cyano pyrethroids were based on sodium ion channel characteristics and permethrin was an outlier when the MDS maps were based on calcium influx/glutamate release potency. Four of six alpha-cyano pyrethroids (lambda-cyfluthrin, cypermethrin, deltamethrin and fenpropathrin) reduced open chloride channel probability. The R-isomers of lambda-l-cyhalothrin reduced open channel probability whereas the S-isomers, antagonized the action of the R-isomers. None of the non-cyano pyrethroids reduced open channel probability, except bioallethrin, which gave a weak response. Overall, based upon neurotoxicity data and the effect of pyrethroids on sodium, calcium and chloride ion channels, it is proposed that bioallethrin, cismethrin, tefluthrin, bifenthrin and permethrin belong to one common mechanism group and deltamethrin, lambda-cyhalothrin, cyfluthrin and cypermethrin belong to a second. Fenpropathrin and esfenvalerate occupy an intermediate position between these two groups.

Voltage-dependent and -independent titration of specific residues accounts for complex gating of a ClC chloride channel by extracellular protons

PubMed Central

Niemeyer, María Isabel; Cid, L Pablo; Yusef, Yamil R; Briones, Rodolfo; Sepúlveda, Francisco V

2009-01-01

The ClC transport protein family comprises both Cl− ion channel and H+/Cl− and H+/NO3− exchanger members. Structural studies on a bacterial ClC transporter reveal a pore obstructed at its external opening by a glutamate side-chain which acts as a gate for Cl− passage and in addition serves as a staging post for H+ exchange. This same conserved glutamate acts as a gate to regulate Cl− flow in ClC channels. The activity of ClC-2, a genuine Cl− channel, has a biphasic response to extracellular pH with activation by moderate acidification followed by abrupt channel closure at pH values lower than ∼7. We have now investigated the molecular basis of this complex gating behaviour. First, we identify a sensor that couples extracellular acidification to complete closure of the channel. This is extracellularly-facing histidine 532 at the N-terminus of transmembrane helix Q whose neutralisation leads to channel closure in a cooperative manner. We go on to show that acidification-dependent activation of ClC-2 is voltage dependent and probably mediated by protonation of pore gate glutamate 207. Intracellular Cl− acts as a voltage-independent modulator, as though regulating the pKa of the protonatable residue. Our results suggest that voltage dependence of ClC-2 is given by hyperpolarisation-dependent penetration of protons from the extracellular side to neutralise the glutamate gate deep within the channel, which allows Cl− efflux. This is reminiscent of a partial exchanger cycle, suggesting that the ClC-2 channel evolved from its transporter counterparts. PMID:19153159

Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

NASA Astrophysics Data System (ADS)

Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

1993-06-01

Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

Extracellular protons enable activation of the calcium-dependent chloride channel TMEM16A.

PubMed

Cruz-Rangel, Silvia; De Jesús-Pérez, José J; Aréchiga-Figueroa, Iván A; Rodríguez-Menchaca, Aldo A; Pérez-Cornejo, Patricia; Hartzell, H Criss; Arreola, Jorge

2017-03-01

The calcium-activated chloride channel TMEM16A provides a pathway for chloride ion movements that are key in preventing polyspermy, allowing fluid secretion, controlling blood pressure, and enabling gastrointestinal activity. TMEM16A is opened by voltage-dependent calcium binding and regulated by permeant anions and intracellular protons. Here we show that a low proton concentration reduces TMEM16A activity while maximum activation is obtained when the external proton concentration is high. In addition, protonation conditions determine the open probability of TMEM16A without changing its calcium sensitivity. External glutamic acid 623 (E623) is key for TMEM16A's ability to respond to external protons. At physiological pH, E623 is un-protonated and TMEM16A is activated when intracellular calcium increases; however, under acidic conditions E623 is partially protonated and works synergistically with intracellular calcium to activate the channel. These findings are critical for understanding physiological and pathological processes that involve changes in pH and chloride flux via TMEM16A. Transmembrane protein 16A (TMEM16A), also known as ANO1, the pore-forming subunit of a Ca 2+ -dependent Cl - channel (CaCC), is activated by direct, voltage-dependent, binding of intracellular Ca 2+ . Endogenous CaCCs are regulated by extracellular protons; however, the molecular basis of such regulation remains unidentified. Here, we evaluated the effects of different extracellular proton concentrations ([H + ] o ) on mouse TMEM16A expressed in HEK-293 cells using whole-cell and inside-out patch-clamp recordings. We found that increasing the [H + ] o from 10 -10 to 10 -5.5  m caused a progressive increase in the chloride current (I Cl ) that is described by titration of a protonatable site with pK = 7.3. Protons regulate TMEM16A in a voltage-independent manner, regardless of channel state (open or closed), and without altering its apparent Ca 2+ sensitivity. Noise analysis showed that protons regulate TMEM16A by tuning its open probability without modifying the single channel current. We found a robust reduction of the proton effect at high [Ca 2+ ] i . To identify protonation targets we mutated all extracellular glutamate and histidine residues and 4 of 11 aspartates. Most mutants were sensitive to protons. However, mutation that substituted glutamic acid (E) for glutamine (Q) at amino acid position 623 (E623Q) displayed a titration curve shifted to the left relative to wild type channels and the I Cl was nearly insensitive to proton concentrations between 10 -5.5 and 10 -9.0  m. Additionally, I Cl of the mutant containing an aspartic acid (D) to asparagine (N) substitution at position 405 (D405N) mutant was partially inhibited by a proton concentration of 10 -5.5  m, but 10 -9.0  m produced the same effect as in wild type. Based on our findings we propose that external protons titrate glutamic acid 623, which enables voltage activation of TMEM16A at non-saturating [Ca 2+ ] i . © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

Using Lidocaine and Benzocaine to Link Sodium Channel Molecular Conformations to State-Dependent Antiarrhythmic Drug Affinity

PubMed Central

Hanck, Dorothy A.; Nikitina, Elena; McNulty, Megan M.; Fozzard, Harry A.; Lipkind, Gregory M.; Sheets, Michael F.

2009-01-01

Rationale Lidocaine and other antiarrhythmic drugs bind in the inner pore of voltage-gated Na channels and affect gating use-dependently. A phenylalanine in domain IV, S6 (Phe1759 in NaV1.5), modeled to face the inner pore just below the selectivity filter, is critical in use-dependent drug block. Objective Measurement of gating currents and concentration-dependent availability curves to determine the role of Phe1759 in coupling of drug binding to the gating changes. Methods & Results The measurements showed that replacement of Phe1759 with a non-aromatic residue permits clear separation of action of lidocaine and benzocaine into two components that can be related to channel conformations. One component represents the drug acting as a voltage-independent, low-affinity blocker of closed channels (designated as lipophilic block), and the second represents high-affinity, voltage-dependent block of open/inactivated channels linked to stabilization of the S4's in domains III and IV (designated as voltage-sensor inhibition) by Phe1759. A homology model for how lidocaine and benzocaine bind in the closed and open/inactivated channel conformation is proposed. Conclusions These two components, lipophilic block and voltage-sensor inhibition, can explain the differences in estimates between tonic and open-state/inactivated-state affinities, and they identify how differences in affinity for the two binding conformations can control use-dependence, the hallmark of successful antiarrhythmic drugs. PMID:19661462

Differential effect of brief electrical stimulation on voltage-gated potassium channels

PubMed Central

Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H.; Morley, John W.

2017-01-01

Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (NaV channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (KV channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different KV-channel subtypes. Computational modeling reveals substantial differences in the response of specific KV-channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different KV-channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that KV-channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (KV channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between KV channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or “fading,” may be attributed to KV-channel activation. PMID:28202576

The potent insulin secretagogue effect of betulinic acid is mediated by potassium and chloride channels.

PubMed

Gomes Castro, Allisson Jhonatan; Cazarolli, Luisa Helena; Bretanha, Lizandra C; Sulis, Paola Miranda; Rey Padilla, Diana Patricia; Aragón Novoa, Diana Marcela; Dambrós, Betina Fernanda; Pizzolatti, Moacir G; Mena Barreto Silva, Fátima Regina

2018-06-15

Betulinic acid (BA) has been described as an insulin secretagogue which may explain its potent antihyperglycemic effect; however, the exact role of BA as an insulinogenic agent is not clear. The aim of this study was to investigate the mechanism of BA on calcium influx and static insulin secretion in pancreatic islets isolated from euglycemic rats. We found that BA triggers calcium influx by a mechanism dependent on ATP-dependent potassium channels and L-type voltage-dependent calcium channels. Additionally, the voltage-dependent and calcium-dependent chloride channels are also involved in the mechanism of BA, probably due to an indirect stimulation of calcium entry and increased intracellular calcium. Additionally, the downstream activation of PKC, which is necessary for the effect of BA on calcium influx, is involved in the full stimulatory response of the triterpene. BA stimulated the static secretion of insulin in pancreatic islets, indicating that the abrupt calcium influx may be a key step in its secretagogue effect. As such, BA stimulates insulin secretion through the activation of electrophysiological mechanisms, such as the closure of potassium channels and opening of calcium and chloride channels, inducing cellular depolarization associated with metabolic-biochemical effects, in turn activating PKC and ensuring the secretion of insulin. Copyright © 2018 Elsevier Inc. All rights reserved.

Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.

PubMed

Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin

2013-08-06

Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.

Spontaneous action potentials and neural coding in unmyelinated axons.

PubMed

O'Donnell, Cian; van Rossum, Mark C W

2015-04-01

The voltage-gated Na and K channels in neurons are responsible for action potential generation. Because ion channels open and close in a stochastic fashion, spontaneous (ectopic) action potentials can result even in the absence of stimulation. While spontaneous action potentials have been studied in detail in single-compartment models, studies on spatially extended processes have been limited. The simulations and analysis presented here show that spontaneous rate in unmyelinated axon depends nonmonotonically on the length of the axon, that the spontaneous activity has sub-Poisson statistics, and that neural coding can be hampered by the spontaneous spikes by reducing the probability of transmitting the first spike in a train.

Investigation of Dielectric Breakdown Characteristics for Double-break Vacuum Interrupter and Dielectric Breakdown Probability Distribution in Vacuum Interrupter

NASA Astrophysics Data System (ADS)

Shioiri, Tetsu; Asari, Naoki; Sato, Junichi; Sasage, Kosuke; Yokokura, Kunio; Homma, Mitsutaka; Suzuki, Katsumi

To investigate the reliability of equipment of vacuum insulation, a study was carried out to clarify breakdown probability distributions in vacuum gap. Further, a double-break vacuum circuit breaker was investigated for breakdown probability distribution. The test results show that the breakdown probability distribution of the vacuum gap can be represented by a Weibull distribution using a location parameter, which shows the voltage that permits a zero breakdown probability. The location parameter obtained from Weibull plot depends on electrode area. The shape parameter obtained from Weibull plot of vacuum gap was 10∼14, and is constant irrespective non-uniform field factor. The breakdown probability distribution after no-load switching can be represented by Weibull distribution using a location parameter. The shape parameter after no-load switching was 6∼8.5, and is constant, irrespective of gap length. This indicates that the scatter of breakdown voltage was increased by no-load switching. If the vacuum circuit breaker uses a double break, breakdown probability at low voltage becomes lower than single-break probability. Although potential distribution is a concern in the double-break vacuum cuicuit breaker, its insulation reliability is better than that of the single-break vacuum interrupter even if the bias of the vacuum interrupter's sharing voltage is taken into account.

C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

PubMed

Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

2014-04-01

Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages without affecting QON-V. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Voltage-Dependent Gating of hERG Potassium Channels

PubMed Central

Cheng, Yen May; Claydon, Tom W.

2012-01-01

The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

PubMed

Held, Katharina; Voets, Thomas; Vriens, Joris

2016-01-01

Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

Molecular Coupling between Voltage Sensor and Pore Opening in the Arabidopsis Inward Rectifier K+ Channel KAT1

PubMed Central

Latorre, Ramon; Olcese, Riccardo; Basso, Claudia; Gonzalez, Carlos; Muñoz, Fabian; Cosmelli, Diego; Alvarez, Osvaldo

2003-01-01

Animal and plant voltage-gated ion channels share a common architecture. They are made up of four subunits and the positive charges on helical S4 segments of the protein in animal K+ channels are the main voltage-sensing elements. The KAT1 channel cloned from Arabidopsis thaliana, despite its structural similarity to animal outward rectifier K+ channels is, however, an inward rectifier. Here we detected KAT1-gating currents due to the existence of an intrinsic voltage sensor in this channel. The measured gating currents evoked in response to hyperpolarizing voltage steps consist of a very fast (τ = 318 ± 34 μs at −180 mV) and a slower component (4.5 ± 0.5 ms at −180 mV) representing charge moved when most channels are closed. The observed gating currents precede in time the ionic currents and they are measurable at voltages (less than or equal to −60) at which the channel open probability is negligible (≈10−4). These two observations, together with the fact that there is a delay in the onset of the ionic currents, indicate that gating charge transits between several closed states before the KAT1 channel opens. To gain insight into the molecular mechanisms that give rise to the gating currents and lead to channel opening, we probed external accessibility of S4 domain residues to methanethiosulfonate-ethyltrimethylammonium (MTSET) in both closed and open cysteine-substituted KAT1 channels. The results demonstrate that the putative voltage–sensing charges of S4 move inward when the KAT1 channels open. PMID:14517271

The human two-pore channel 1 is modulated by cytosolic and luminal calcium

PubMed Central

Lagostena, Laura; Festa, Margherita; Pusch, Michael; Carpaneto, Armando

2017-01-01

Two-pore channels (TPC) are intracellular endo-lysosomal proteins with only recently emerging roles in organellar signalling and involvement in severe human diseases. Here, we investigated the functional properties of human TPC1 expressed in TPC-free vacuoles from Arabidopsis thaliana cells. Large (20 pA/pF) TPC1 currents were elicited by cytosolic addition of the phosphoinositide phosphatidylinositol-(3,5)-bisphosphate (PI(3,5)P2) with an apparent binding constant of ~15 nM. The channel is voltage-dependent, activating at positive potentials with single exponential kinetics and currents are Na+ selective, with measurable but low permeability to Ca2+. Cytosolic Ca2+ modulated hTPC1 in dual way: low μM cytosolic Ca2+ increased activity by shifting the open probability towards negative voltages and by accelerating the time course of activation. This mechanism was well-described by an allosteric model. Higher levels of cytosolic Ca2+ induced a voltage-dependent decrease of the currents compatible with Ca2+ binding in the permeation pore. Conversely, an increase in luminal Ca2+ decreased hTPC1 activity. Our data point to a process in which Ca2+ permeation in hTPC1 has a positive feedback on channel activity while Na+ acts as a negative regulator. We speculate that the peculiar Ca2+ and Na+ dependence are key for the physiological roles of the channel in organellar homeostasis and signalling. PMID:28252105

Modulation of Cardiac Ryanodine Receptor Channels by Alkaline Earth Cations

PubMed Central

Diaz-Sylvester, Paula L.; Porta, Maura; Copello, Julio A.

2011-01-01

Cardiac ryanodine receptor (RyR2) function is modulated by Ca2+ and Mg2+. To better characterize Ca2+ and Mg2+ binding sites involved in RyR2 regulation, the effects of cytosolic and luminal earth alkaline divalent cations (M2+: Mg2+, Ca2+, Sr2+, Ba2+) were studied on RyR2 from pig ventricle reconstituted in bilayers. RyR2 were activated by M2+ binding to high affinity activating sites at the cytosolic channel surface, specific for Ca2+ or Sr2+. This activation was interfered by Mg2+ and Ba2+ acting at low affinity M2+-unspecific binding sites. When testing the effects of luminal M2+ as current carriers, all M2+ increased maximal RyR2 open probability (compared to Cs+), suggesting the existence of low affinity activating M2+-unspecific sites at the luminal surface. Responses to M2+ vary from channel to channel (heterogeneity). However, with luminal Ba2+or Mg2+, RyR2 were less sensitive to cytosolic Ca2+ and caffeine-mediated activation, openings were shorter and voltage-dependence was more marked (compared to RyR2 with luminal Ca2+or Sr2+). Kinetics of RyR2 with mixtures of luminal Ba2+/Ca2+ and additive action of luminal plus cytosolic Ba2+ or Mg2+ suggest luminal M2+ differentially act on luminal sites rather than accessing cytosolic sites through the pore. This suggests the presence of additional luminal activating Ca2+/Sr2+-specific sites, which stabilize high Po mode (less voltage-dependent) and increase RyR2 sensitivity to cytosolic Ca2+ activation. In summary, RyR2 luminal and cytosolic surfaces have at least two sets of M2+ binding sites (specific for Ca2+ and unspecific for Ca2+/Mg2+) that dynamically modulate channel activity and gating status, depending on SR voltage. PMID:22039534

Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

PubMed

Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

2018-01-01

Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use the resulting information to derive a consensus atomic structure that is then subjected to rigorous validation. In this paper, we summarize our efforts to obtain and validate atomic models of the open and voltage-driven closed states of undocked connexin hemichannels. This article is part of a Special Issue entitled: Gap Junction Proteins edited by Jean Claude Herve. Copyright © 2017 Elsevier B.V. All rights reserved.

Importance of vesicle release stochasticity in neuro-spike communication.

PubMed

Ramezani, Hamideh; Akan, Ozgur B

2017-07-01

Aim of this paper is proposing a stochastic model for vesicle release process, a part of neuro-spike communication. Hence, we study biological events occurring in this process and use microphysiological simulations to observe functionality of these events. Since the most important source of variability in vesicle release probability is opening of voltage dependent calcium channels (VDCCs) followed by influx of calcium ions through these channels, we propose a stochastic model for this event, while using a deterministic model for other variability sources. To capture the stochasticity of calcium influx to pre-synaptic neuron in our model, we study its statistics and find that it can be modeled by a distribution defined based on Normal and Logistic distributions.

Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.

PubMed

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-23

Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

Differential effect of brief electrical stimulation on voltage-gated potassium channels.

PubMed

Cameron, Morven A; Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H; Morley, John W

2017-05-01

Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (Na V channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (K V channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different K V -channel subtypes. Computational modeling reveals substantial differences in the response of specific K V -channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different K V -channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that K V -channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (K V channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between K V channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or "fading," may be attributed to K V -channel activation. Copyright © 2017 the American Physiological Society.

Interaction between permeation and gating in a putative pore domain mutant in the cystic fibrosis transmembrane conductance regulator.

PubMed Central

Zhang, Z R; McDonough, S I; McCarty, N A

2000-01-01

The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel with distinctive kinetics. At the whole-cell level, CFTR currents in response to voltage steps are time independent for wild type and for the many mutants reported so far. Single channels open for periods lasting up to tens of seconds; the openings are interrupted by brief closures at hyperpolarized, but not depolarized, potentials. Here we report a serine-to-phenylalanine mutation (S1118F) in the 11th transmembrane domain that confers voltage-dependent, single-exponential current relaxations and moderate inward rectification of the macroscopic currents upon expression in Xenopus oocytes. At steady state, the S1118F-CFTR single-channel conductance rectifies, corresponding to the whole-cell rectification. In addition, the open-channel burst duration is decreased 10-fold compared with wild-type channels. S1118F-CFTR currents are blocked in a voltage-dependent manner by diphenylamine-2-carboxylate (DPC); the affinity of S1118F-CFTR for DPC is similar to that of the wild-type channel, but blockade exhibits moderately reduced voltage dependence. Selectivity of the channel to a range of anions is also affected by this mutation. Furthermore, the permeation properties change during the relaxations, which suggests that there is an interaction between gating and permeation in this mutant. The existence of a mutation that confers voltage dependence upon CFTR currents and that changes kinetics and permeation properties of the channel suggests a functional role for the 11th transmembrane domain in the pore in the wild-type channel. PMID:10866956

Induced Voltage in an Open Wire

NASA Astrophysics Data System (ADS)

Morawetz, K.; Gilbert, M.; Trupp, A.

2017-07-01

A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.

Electrical properties of nano-resistors made from the Zr-doped HfO2 high-k dielectric film

NASA Astrophysics Data System (ADS)

Zhang, Shumao; Kuo, Yue

2018-03-01

Electrical properties of nano-sized resistors made from the breakdown of the metal-oxide-semiconductor capacitor composed of the amorphous high-k gate dielectric have been investigated under different stress voltages and temperatures. The effective resistance of nano-resistors in the device was estimated from the I-V curve in the high voltage range. It decreased with the increase of the number of resistors. The resistance showed complicated temperature dependence, i.e. it neither behaves like a conductor nor a semiconductor. In the low voltage operation range, the charge transfer was controlled by the Schottky barrier at the nano-resistor/Si interface. The barrier height decreased with the increase of stress voltage, which was probably caused by the change of the nano-resistor composition. Separately, it was observed that the barrier height was dependent on the temperature, which was probably due to the dynamic nano-resistor formation process and the inhomogeneous barrier height distribution. The unique electrical characteristics of this new type of nano-resistors are important for many electronic and optoelectronic applications.

An electrostatic potassium channel opener targeting the final voltage sensor transition

PubMed Central

Börjesson, Sara I.

2011-01-01

Free polyunsaturated fatty acids (PUFAs) modulate the voltage dependence of voltage-gated ion channels. As an important consequence thereof, PUFAs can suppress epileptic seizures and cardiac arrhythmia. However, molecular details for the interaction between PUFA and ion channels are not well understood. In this study, we have localized the site of action for PUFAs on the voltage-gated Shaker K channel by introducing positive charges on the channel surface, which potentiated the PUFA effect. Furthermore, we found that PUFA mainly affects the final voltage sensor movement, which is closely linked to channel opening, and that specific charges at the extracellular end of the voltage sensor are critical for the PUFA effect. Because different voltage-gated K channels have different charge profiles, this implies channel-specific PUFA effects. The identified site and the pharmacological mechanism will potentially be very useful in future drug design of small-molecule compounds specifically targeting neuronal and cardiac excitability. PMID:21624947

The elementary events of Ca2+ release elicited by membrane depolarization in mammalian muscle.

PubMed

Csernoch, L; Zhou, J; Stern, M D; Brum, G; Ríos, E

2004-05-15

Cytosolic [Ca(2+)] transients elicited by voltage clamp depolarization were examined by confocal line scanning of rat skeletal muscle fibres. Ca(2+) sparks were observed in the fibres' membrane-permeabilized ends, but not in responses to voltage in the membrane-intact area. Elementary events of the depolarization-evoked response could be separated either at low voltages (near -50 mV) or at -20 mV in partially inactivated cells. These were of lower amplitude, narrower and of much longer duration than sparks, similar to 'lone embers' observed in the permeabilized segments. Their average amplitude was 0.19 and spatial half-width 1.3 microm. Other parameters depended on voltage. At -50 mV average duration was 111 ms and latency 185 ms. At -20 mV duration was 203 ms and latency 24 ms. Ca(2+) release current, calculated on an average of events, was nearly steady at 0.5-0.6 pA. Accordingly, simulations of the fluorescence event elicited by a subresolution source of 0.5 pA open for 100 ms had morphology similar to the experimental average. Because 0.5 pA is approximately the current measured for single RyR channels in physiological conditions, the elementary fluorescence events in rat muscle probably reflect opening of a single RyR channel. A reconstruction of cell-averaged release flux at -20 mV based on the observed distribution of latencies and calculated elementary release had qualitatively correct but slower kinetics than the release flux in prior whole-cell measurements. The qualitative agreement indicates that global Ca(2+) release flux results from summation of these discrete events. The quantitative discrepancies suggest that the partial inactivation strategy may lead to events of greater duration than those occurring physiologically in fully polarized cells.

Functional coupling between sodium-activated potassium channels and voltage-dependent persistent sodium currents in cricket Kenyon cells.

PubMed

Takahashi, Izumi; Yoshino, Masami

2015-10-01

In this study, we examined the functional coupling between Na(+)-activated potassium (KNa) channels and Na(+) influx through voltage-dependent Na(+) channels in Kenyon cells isolated from the mushroom body of the cricket Gryllus bimaculatus. Single-channel activity of KNa channels was recorded with the cell-attached patch configuration. The open probability (Po) of KNa channels increased with increasing Na(+) concentration in a bath solution, whereas it decreased by the substitution of Na(+) with an equimolar concentration of Li(+). The Po of KNa channels was also found to be reduced by bath application of a high concentration of TTX (1 μM) and riluzole (100 μM), which inhibits both fast (INaf) and persistent (INaP) Na(+) currents, whereas it was unaffected by a low concentration of TTX (10 nM), which selectively blocks INaf. Bath application of Cd(2+) at a low concentration (50 μM), as an inhibitor of INaP, also decreased the Po of KNa channels. Conversely, bath application of the inorganic Ca(2+)-channel blockers Co(2+) and Ni(2+) at high concentrations (500 μM) had little effect on the Po of KNa channels, although Cd(2+) (500 μM) reduced the Po of KNa channels. Perforated whole cell clamp analysis further indicated the presence of sustained outward currents for which amplitude was dependent on the amount of Na(+) influx. Taken together, these results indicate that KNa channels could be activated by Na(+) influx passing through voltage-dependent persistent Na(+) channels. The functional significance of this coupling mechanism was discussed in relation to the membrane excitability of Kenyon cells and its possible role in the formation of long-term memory. Copyright © 2015 the American Physiological Society.

Disease-causing mutations C277R and C277Y modify gating of human ClC-1 chloride channels in myotonia congenita

PubMed Central

Weinberger, Sebastian; Wojciechowski, Daniel; Sternberg, Damien; Lehmann-Horn, Frank; Jurkat-Rott, Karin; Becher, Toni; Begemann, Birgit; Fahlke, Christoph; Fischer, Martin

2012-01-01

Myotonia congenita is a genetic condition that is caused by mutations in the muscle chloride channel gene CLCN1 and characterized by delayed muscle relaxation and muscle stiffness. We here investigate the functional consequences of two novel disease-causing missense mutations, C277R and C277Y, using heterologous expression in HEK293T cells and patch clamp recording. Both mutations reduce macroscopic anion currents in transfected cells. Since hClC-1 is a double-barrelled anion channel, this reduction in current amplitude might be caused by altered gating of individual protopores or of joint openings and closing of both protopores. We used non-stationary noise analysis and single channel recordings to separate the mutants’ effects on individual and common gating processes. We found that C277Y inverts the voltage dependence and reduces the open probabilities of protopore and common gates resulting in decreases of absolute open probabilities of homodimeric channels to values below 3%. In heterodimeric channels, C277R and C277Y also reduce open probabilities and shift the common gate activation curve towards positive potentials. Moreover, C277Y modifies pore properties of hClC-1. It reduces single protopore current amplitudes to about two-thirds of wild-type values, and inverts the anion permeability sequence to I− = NO3− > Br− > Cl−. Our findings predict a dramatic reduction of the muscle fibre resting chloride conductance and thus fully explain the disease-causing effects of mutations C277R and C277Y. Moreover, they provide additional insights into the function of C277, a residue recently implicated in common gating of ClC channels. PMID:22641783

Simulating the inception of pulsed discharges near positive electrodes

NASA Astrophysics Data System (ADS)

Teunissen, Jannis; Ebert, Ute

2013-09-01

With 3D particle simulations we study the inception of pulsed discharges near positive electrodes. In different geometries, we first determine the breakdown voltage. Then we study the probability of inception for a fast voltage pulse. This probability mostly depends on the availability of seed electrons to generate the initial electron avalanches. These results are compared with experimental observations. Then we investigate how the shape of a starting discharge affects its further development. In particular, we discuss the formation of so-called ``inception clouds.'' JT was supported by STW-project 10755.

Total Charge Movement per Channel

PubMed Central

Sigg, Daniel; Bezanilla, Francisco

1997-01-01

One measure of the voltage dependence of ion channel conductance is the amount of gating charge that moves during activation and vice versa. The limiting slope method, introduced by Almers (Almers, W. 1978. Rev. Physiol. Biochem. Pharmacol. 82:96–190), exploits the relationship of charge movement and voltage sensitivity, yielding a lower limit to the range of single channel gating charge displacement. In practice, the technique is plagued by low experimental resolution due to the requirement that the logarithmic voltage sensitivity of activation be measured at very low probabilities of opening. In addition, the linear sequential models to which the original theory was restricted needed to be expanded to accommodate the complexity of mechanisms available for the activation of channels. In this communication, we refine the theory by developing a relationship between the mean activation charge displacement (a measure of the voltage sensitivity of activation) and the gating charge displacement (the integral of gating current). We demonstrate that recording the equilibrium gating charge displacement as an adjunct to the limiting slope technique greatly improves accuracy under conditions where the plots of mean activation charge displacement and gross gating charge displacement versus voltage can be superimposed. We explore this relationship for a wide variety of channel models, which include those having a continuous density of states, nonsequential activation pathways, and subconductance states. We introduce new criteria for the appropriate use of the limiting slope procedure and provide a practical example of the theory applied to low resolution simulation data. PMID:8997663

Grafting voltage and pharmacological sensitivity in potassium channels.

PubMed

Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

2016-08-01

A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

The luminal K+ channel of the thick ascending limb of Henle's loop.

PubMed

Bleich, M; Schlatter, E; Greger, R

1990-01-01

In vitro perfused rat thick ascending limbs of Henle's loop (TAL) were used (n = 260) to analyse the conductance properties of the luminal membrane applying the patch-clamp technique. Medullary (mTAL) and cortical (cTAL) tubule segments were dissected and perfused in vitro. The free end of the tubule was held and immobilized at one edge by a holding pipette kept under continuous suction. A micropositioner was used to insert a patch pipette into the lumen, and a gigaohm seal with the luminal membrane was achieved in 455 instances out of considerably more trials. In approximately 20% of all gigaohm seals recordings of single ionic channels were obtained. We have identified only one single type of K+ channel in these cell-attached and cell-excised recordings. In the cell-attached configuration with KCl or NaCl in the pipette, the channel had a conductance of 60 +/- 6 pS (n = 24) and 31 +/- 7 pS (n = 4) respectively. In cell-free patches with KCl either in the patch pipette or in the bath and with a Ringer-type solution (NaCl) on the opposite side the conductance was 72 +/- 4 pS (n = 37) at a clamp voltage of 0 mV. The permeability was 0.33 +/- 0.02 . 10(-12) cm3/s. The selectivity sequence of this channel was: K+ = Rb+ = NH4+ = Cs+ greater than Li+ much greater than Na+ = 0; the conductance sequence was K+ much greater than Li+ much greater than Rb+ = Cs+ = NH4+ = Na+ = 0. In excised patches Rb+, Cs+ and NH4+ when present in the bath at 145 mmol/l all inhibited K+ currents out of the pipette. The channel kinetics were described by one open (9.5 +/- 1.5 ms, n = 18) and by two closed (1.4 +/- 0.1 and 14 +/- 2 ms) time constants. The open probability of this channel was increased by depolarization. The channel open probability was reduced voltage dependently by Ba2+ (half maximal inhibition at 0 mV: 0.07 mmol/l) from the cytosolic side. Verapamil, diltiazem, quinine and quinidine inhibited at approximately 1 mumol/l -0.1 mmol/l from either side. Similarly, the amino cations lidocaine, tetraethylammonium and choline inhibited at 10-100 mmol/l. The channel was downregulated in its open probability by cytosolic Ca2+ activities greater than 10(-7) mol/l and by adenosine triphosphate greater than or equal to 10(-4) mol/l. The open probability was downregulated by decreasing cytosolic pH (2-fold by a decrease in pH by less than or equal to 0.2 units).(ABSTRACT TRUNCATED AT 400 WORDS)

Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

PubMed

Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

2012-02-14

Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.

PubMed

Kajma, Anna; Szewczyk, Adam

2012-10-01

Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

Role of the pH in state-dependent blockade of hERG currents

NASA Astrophysics Data System (ADS)

Wang, Yibo; Guo, Jiqing; Perissinotti, Laura L.; Lees-Miller, James; Teng, Guoqi; Durdagi, Serdar; Duff, Henry J.; Noskov, Sergei Yu.

2016-10-01

Mutations that reduce inactivation of the voltage-gated Kv11.1 potassium channel (hERG) reduce binding for a number of blockers. State specific block of the inactivated state of hERG block may increase risks of drug-induced Torsade de pointes. In this study, molecular simulations of dofetilide binding to the previously developed and experimentally validated models of the hERG channel in open and open-inactivated states were combined with voltage-clamp experiments to unravel the mechanism(s) of state-dependent blockade. The computations of the free energy profiles associated with the drug block to its binding pocket in the intra-cavitary site display startling differences in the open and open-inactivated states of the channel. It was also found that drug ionization may play a crucial role in preferential targeting to the open-inactivated state of the pore domain. pH-dependent hERG blockade by dofetilie was studied with patch-clamp recordings. The results show that low pH increases the extent and speed of drug-induced block. Both experimental and computational findings indicate that binding to the open-inactivated state is of key importance to our understanding of the dofetilide’s mode of action.

Temperature gradient measurements by using thermoelectric effect in CNTs-silicone adhesive composite.

PubMed

Chani, Muhammad Tariq Saeed; Karimov, Kh S; Asiri, Abdullah M; Ahmed, Nisar; Bashir, Muhammad Mehran; Khan, Sher Bahadar; Rub, Malik Abdul; Azum, Naved

2014-01-01

This work presents the fabrication and investigation of thermoelectric cells based on composite of carbon nanotubes (CNT) and silicone adhesive. The composite contains CNT and silicon adhesive 1∶1 by weight. The current-voltage characteristics and dependences of voltage, current and Seebeck coefficient on the temperature gradient of cell were studied. It was observed that with increase in temperature gradient the open circuit voltage, short circuit current and the Seebeck coefficient of the cells increase. Approximately 7 times increase in temperature gradient increases the open circuit voltage and short circuit current up to 40 and 5 times, respectively. The simulation of experimental results is also carried out; the simulated results are well matched with experimental results.

Temperature Gradient Measurements by Using Thermoelectric Effect in CNTs-Silicone Adhesive Composite

PubMed Central

Chani, Muhammad Tariq Saeed; Karimov, Kh. S.; Asiri, Abdullah M.; Ahmed, Nisar; Bashir, Muhammad Mehran; Khan, Sher Bahadar; Rub, Malik Abdul; Azum, Naved

2014-01-01

This work presents the fabrication and investigation of thermoelectric cells based on composite of carbon nanotubes (CNT) and silicone adhesive. The composite contains CNT and silicon adhesive 1∶1 by weight. The current-voltage characteristics and dependences of voltage, current and Seebeck coefficient on the temperature gradient of cell were studied. It was observed that with increase in temperature gradient the open circuit voltage, short circuit current and the Seebeck coefficient of the cells increase. Approximately 7 times increase in temperature gradient increases the open circuit voltage and short circuit current up to 40 and 5 times, respectively. The simulation of experimental results is also carried out; the simulated results are well matched with experimental results. PMID:24748375

Local anaesthetics transiently block currents through single acetylcholine-receptor channels.

PubMed Central

Neher, E; Steinbach, J H

1978-01-01

1. Single channel currents through acetylcholine receptor channels (ACh channels) were recorded at chronically denervated frog muscle extrajunctional membranes in the absence and presence of the lidocaine derivatives QX-222 and QX-314. 2. The current wave forms due to the opening and closing of single ACh channels (activated by suberyldicholine) normally are square pulses. These single pulses appear to be chopped into bursts of much shorter pulses, when the drug QX-222 is present in addition to the agonist. 3. The mean duration of the bursts is comparable to or longer than the normal channel open time, and increases with increasing drug concentration. 4. The duration of the short pulses within a burst decreases with increasing drug concentration. 5. It is concluded that drug molecules reversibly block open end-plate channels and that the flickering within a burst represents this fast, repeatedly occurring reaction. 6. The voltage dependence of the reaction rates involved, suggested that the site of the blocking reaction is in the centre of the membrane, probably inside the ionic channel. PMID:306437

Multiple pore conformations driven by asynchronous movements of voltage sensors in a eukaryotic sodium channel

PubMed Central

Goldschen-Ohm, Marcel P.; Capes, Deborah L.; Oelstrom, Kevin M.; Chanda, Baron

2013-01-01

Voltage-dependent Na+ channels are crucial for electrical signalling in excitable cells. Membrane depolarization initiates asynchronous movements in four non-identical voltage-sensing domains of the Na+ channel. It remains unclear to what extent this structural asymmetry influences pore gating as compared with outwardly rectifying K+ channels, where channel opening results from a final concerted transition of symmetric pore gates. Here we combine single channel recordings, cysteine accessibility and voltage clamp fluorimetry to probe the relationships between voltage sensors and pore conformations in an inactivation deficient Nav1.4 channel. We observe three distinct conductance levels such that DI-III voltage sensor activation is kinetically correlated with formation of a fully open pore, whereas DIV voltage sensor movement underlies formation of a distinct subconducting pore conformation preceding inactivation in wild-type channels. Our experiments reveal that pore gating in sodium channels involves multiple transitions driven by asynchronous movements of voltage sensors. These findings shed new light on the mechanism of coupling between activation and fast inactivation in voltage-gated sodium channels. PMID:23322038

Chiral tunneling modulated by a time-periodic potential on the surface states of a topological insulator

PubMed Central

Li, Yuan; Jalil, Mansoor B. A.; Tan, S. G.; Zhao, W.; Bai, R.; Zhou, G. H.

2014-01-01

Time-periodic perturbation can be used to modify the transport properties of the surface states of topological insulators, specifically their chiral tunneling property. Using the scattering matrix method, we study the tunneling transmission of the surface states of a topological insulator under the influence of a time-dependent potential and finite gate bias voltage. It is found that perfect transmission is obtained for electrons which are injected normally into the time-periodic potential region in the absence of any bias voltage. However, this signature of Klein tunneling is destroyed when a bias voltage is applied, with the transmission probability of normally incident electrons decreasing with increasing gate bias voltage. Likewise, the overall conductance of the system decreases significantly when a gate bias voltage is applied. The characteristic left-handed helicity of the transmitted spin polarization is also broken by the finite gate bias voltage. In addition, the time-dependent potential modifies the large-angle transmission profile, which exhibits an oscillatory or resonance-like behavior. Finally, time-dependent transport modes (with oscillating potential in the THz frequency) can result in enhanced overall conductance, irrespective of the presence or absence of the gate bias voltage. PMID:24713634

Opening of K+ channels by capacitive stimulation from silicon chip

NASA Astrophysics Data System (ADS)

Ulbrich, M. H.; Fromherz, P.

2005-10-01

The development of stable neuroelectronic systems requires a stimulation of nerve cells from semiconductor devices without electrochemical effects at the electrolyte/solid interface and without damage of the cell membrane. The interaction must rely on a reversible opening of voltage-gated ion channels by capacitive coupling. In a proof-of-principle experiment, we demonstrate that Kv1.3 potassium channels expressed in HEK293 cells can be opened from an electrolyte/oxide/silicon (EOS) capacitor. A sufficient strength of electrical coupling is achieved by insulating silicon with a thin film of TiO2 to achieve a high capacitance and by removing NaCl from the electrolyte to enhance the resistance of the cell-chip contact. When a decaying voltage ramp is applied to the EOS capacitor, an outward current through the attached cell membrane is observed that is specific for Kv1.3 channels. An open probability up to fifty percent is estimated by comparison with a numerical simulation of the cell-chip contact.

Evolutionarily conserved intracellular gate of voltage-dependent sodium channels

NASA Astrophysics Data System (ADS)

Oelstrom, Kevin; Goldschen-Ohm, Marcel P.; Holmgren, Miguel; Chanda, Baron

2014-03-01

Members of the voltage-gated ion channel superfamily (VGIC) regulate ion flux and generate electrical signals in excitable cells by opening and closing pore gates. The location of the gate in voltage-gated sodium channels, a founding member of this superfamily, remains unresolved. Here we explore the chemical modification rates of introduced cysteines along the S6 helix of domain IV in an inactivation-removed background. We find that state-dependent accessibility is demarcated by an S6 hydrophobic residue; substituted cysteines above this site are not modified by charged thiol reagents when the channel is closed. These accessibilities are consistent with those inferred from open- and closed-state structures of prokaryotic sodium channels. Our findings suggest that an intracellular gate composed of a ring of hydrophobic residues is not only responsible for regulating access to the pore of sodium channels, but is also a conserved feature within canonical members of the VGIC superfamily.

Single-Pixel Optical Fluctuation Analysis of Calcium Channel Function in Active Zones of Motor Nerve Terminals

PubMed Central

Luo, Fujun; Dittrich, Markus; Stiles, Joel R.; Meriney, Stephen D.

2011-01-01

We used high-resolution fluorescence imaging and single-pixel optical fluctuation analysis to estimate the opening probability of individual voltage-gated calcium (Ca2+) channels during an action potential and the number of such Ca2+ channels within active zones of frog neuromuscular junctions. Analysis revealed ~36 Ca2+ channels within each active zone, similar to the number of docked synaptic vesicles but far less than the total number of transmembrane particles reported based on freeze-fracture analysis (~200–250). The probability that each channel opened during an action potential was only ~0.2. These results suggest why each active zone averages only one quantal release event during every other action potential, despite a substantial number of docked vesicles. With sparse Ca2+ channels and low opening probability, triggering of fusion for each vesicle is primarily controlled by Ca2+ influx through individual Ca2+ channels. In contrast, the entire synapse is highly reliable because it contains hundreds of active zones. PMID:21813687

Gating of the late Na+ channel in normal and failing human myocardium.

PubMed

Undrovinas, Albertas I; Maltsev, Victor A; Kyle, John W; Silverman, Norman; Sabbah, Hani N

2002-11-01

We previously reported an ultraslow inactivating late Na+ current (INaL) in left ventricular cardiomyocytes (VC) isolated from normal (NVC) and failing (FVC) human hearts. This current could play a role in heart failure-induced repolarization abnormalities. To identify properties of NaCh contributing to INaL, we examined early and late openings in cell-attached patches of HEK293 cells expressing human cardiac NaCh alpha-subunit (alpha-HEK) and in VC of one normal and three failing human hearts. Two types of the late NaCh openings underlay INaL in all three preparations: scattered late (SLO) and bursts (BO). Amplitude analysis revealed that slope conductance for both SLO and BO was the same compared to the main level of early openings (EO) in both VC (21 vs 22.7pS, NVC; 22.7 vs 22.6pS, FVC) and alpha-HEK (23.2 vs 23pS), respectively. Analysis of SLO latencies revealed voltage-independent ultraslow inactivation in all preparations with tendency to be slower in FVC compared to NCV. EO and SLO render one open voltage-independent state (tau approximately 0.4ms) for NVC and FVC. One open (voltage-dependent) and two closed states (one voltage-dependent and another voltage-independent) were found in BO of both specimens. Burst duration tend to be longer in FVC ( approximately 50ms) than in NVC ( approximately 30ms). In FVC we found both modes SLO and BO at membrane potential of -10mV that is attribute for take-off voltages (from -18 to -2mV) for early afterdepolarizations (EAD's) in FVC. In conclusions, we found a novel gating mode SLO that manifest slow (hundreds of ms), voltage-independent inactivation in both NVC and FVC. We were unable to reliably demonstrate any differences in the properties of the late NaCh in failing vs a normal human heart. Accordingly, the late current appears to be generated by a single population of channels in normal and failing human ventricular myocardium. Both SLO and BO could be implicated in EADs in HF.

Chitosugar translocation by an unexpressed monomeric protein channel

NASA Astrophysics Data System (ADS)

Soysa, H. Sasimali M.; Suginta, Wipa; Moonsap, Watcharaporn; Smith, M. F.

2018-05-01

The outer membrane protein channel Ec ChiP , associated with a silent gene in E . coli, is a monomeric chitoporin. In a glucose-deficient environment, E . coli can express the ChiP gene to exploit chitin degradation products. Single-channel small ion current measurements, which reveal the dynamics of single sugar molecules trapped in channel, are used here to study the exotic transport of chitosugars by E . coli. Molecules escape from the channel on multiple timescales. Voltage-dependent trapping rates observed for charged chitosan molecules, as well as model calculations, indicate that the rapid escape processes are those in which the molecule escapes back to the side of the membrane from which it originated. The probability that a sugar molecule is translocated through the membrane is thus estimated from the current data and the dependence of this translocation probability on the length of the chitosugar molecule and the applied voltage analyzed. The described method for obtaining the translocation probability and related molecular translocation current is applicable to other transport channels.

Interactions among DIV voltage-sensor movement, fast inactivation, and resurgent Na current induced by the NaVβ4 open-channel blocking peptide

PubMed Central

Lewis, Amanda H.

2013-01-01

Resurgent Na current flows as voltage-gated Na channels recover through open states from block by an endogenous open-channel blocking protein, such as the NaVβ4 subunit. The open-channel blocker and fast-inactivation gate apparently compete directly, as slowing the onset of fast inactivation increases resurgent currents by favoring binding of the blocker. Here, we tested whether open-channel block is also sensitive to deployment of the DIV voltage sensor, which facilitates fast inactivation. We expressed NaV1.4 channels in HEK293t cells and assessed block by a free peptide replicating the cytoplasmic tail of NaVβ4 (the “β4 peptide”). Macroscopic fast inactivation was disrupted by mutations of DIS6 (L443C/A444W; “CW” channels), which reduce fast-inactivation gate binding, and/or by the site-3 toxin ATX-II, which interferes with DIV movement. In wild-type channels, the β4 peptide competed poorly with fast inactivation, but block was enhanced by ATX. With the CW mutation, large peptide-induced resurgent currents were present even without ATX, consistent with increased open-channel block upon depolarization and slower deactivation after blocker unbinding upon repolarization. The addition of ATX greatly increased transient current amplitudes and further enlarged resurgent currents, suggesting that pore access by the blocker is actually decreased by full deployment of the DIV voltage sensor. ATX accelerated recovery from block at hyperpolarized potentials, however, suggesting that the peptide unbinds more readily when DIV voltage-sensor deployment is disrupted. These results are consistent with two open states in Na channels, dependent on the DIV voltage-sensor position, which differ in affinity for the blocking protein. PMID:23940261

Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

PubMed

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-01

Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

The β1 Subunit Enhances Oxidative Regulation of Large-Conductance Calcium-activated K+ Channels

PubMed Central

Santarelli, Lindsey Ciali; Chen, Jianguo; Heinemann, Stefan H.; Hoshi, Toshinori

2004-01-01

Oxidative stress may alter the functions of many proteins including the Slo1 large conductance calcium-activated potassium channel (BKCa). Previous results demonstrated that in the virtual absence of Ca2+, the oxidant chloramine-T (Ch-T), without the involvement of cysteine oxidation, increases the open probability and slows the deactivation of BKCa channels formed by human Slo1 (hSlo1) α subunits alone. Because native BKCa channel complexes may include the auxiliary subunit β1, we investigated whether β1 influences the oxidative regulation of hSlo1. Oxidation by Ch-T with β1 present shifted the half-activation voltage much further in the hyperpolarizing direction (−75 mV) as compared with that with α alone (−30 mV). This shift was eliminated in the presence of high [Ca2+]i, but the increase in open probability in the virtual absence of Ca2+ remained significant at physiologically relevant voltages. Furthermore, the slowing of channel deactivation after oxidation was even more dramatic in the presence of β1. Oxidation of cysteine and methionine residues within β1 was not involved in these potentiated effects because expression of mutant β1 subunits lacking cysteine or methionine residues produced results similar to those with wild-type β1. Unlike the results with α alone, oxidation by Ch-T caused a significant acceleration of channel activation only when β1 was present. The β1 M177 mutation disrupted normal channel activation and prevented the Ch-T–induced acceleration of activation. Overall, the functional effects of oxidation of the hSlo1 pore-forming α subunit are greatly amplified by the presence of β1, which leads to the additional increase in channel open probability and the slowing of deactivation. Furthermore, M177 within β1 is a critical structural determinant of channel activation and oxidative sensitivity. Together, the oxidized BKCa channel complex with β1 has a considerable chance of being open within the physiological voltage range even at low [Ca2+]i. PMID:15452197

Direct block by bisindolylmaleimide of rat Kv1.5 expressed in Chinese hamster ovary cells.

PubMed

Choi, B H; Choi, J S; Jeong, S W; Hahn, S J; Yoon, S H; Jo, Y H; Kim, M S

2000-05-01

The interaction of bisindolylmaleimide (BIM), widely used as a specific protein kinase C (PKC) inhibitor, with rat brain Kv1.5 (rKv1.5) channels stably expressed in Chinese hamster ovary cells was investigated using the whole-cell patch-clamp technique. BIM (I) and its inactive analog, BIM (V), inhibited rKv1.5 currents at +50 mV in a reversible concentration-dependent manner with an apparent K(d) value of 0.38 and 1.70 microM, respectively. BIM (I) accelerated the decay rate of inactivation of rKv1.5 currents but did not significantly modify the kinetics of current activation. Other specific PKC inhibitors, chelerythrine and PKC 19-36, had no effect on rKv1.5 and did not prevent the inhibitory effect of BIM (I). The inhibition of rKv1.5 by BIM (I) and BIM (V) was highly voltage-dependent between -30 and 0 mV (voltage range of channel opening), suggesting that both drugs interact preferentially with the open state of the channel. The additional inhibition by BIM (I) displayed a voltage dependence (delta = 0.19) in the full activation voltage range positive to 0 mV, but was not shown in BIM (V) (delta = 0). The rate constants of association and dissociation for BIM (I) were 9.63 microM(-1) s(-1) and 5.82 s(-1), respectively. BIM (I) increased the time constant of deactivation of tail currents from 26. 35 to 45.79 ms, resulting in tail crossover phenomenon. BIM (I) had no effect on the voltage dependence of steady-state inactivation. BIM (I) produced use-dependent inhibition of rKv1.5, which was consistent with the slow recovery from inactivation in the presence of drug. These results suggest that BIM (I) directly inhibits rKv1.5 channels in a phosphorylation-independent, and state-, voltage-, time-, and use-dependent manner.

Identification of the pH sensor and activation by chemical modification of the ClC-2G Cl- channel.

PubMed

Stroffekova, K; Kupert, E Y; Malinowska, D H; Cuppoletti, J

1998-10-01

Rabbit and human ClC-2G Cl- channels are voltage sensitive and activated by protein kinase A and low extracellular pH. The objective of the present study was to investigate the mechanism involved in acid activation of the ClC-2G Cl- channel and to determine which amino acid residues play a role in this acid activation. Channel open probability (Po) at +/-80 mV holding potentials increased fourfold in a concentration-dependent manner with extracellular H+ concentration (that is, extracellular pH, pHtrans), with an apparent acidic dissociation constant of pH 4.95 +/- 0.27. 1-Ethyl-3(3-dimethylaminopropyl)carbodiimide-catalyzed amidation of the channel with glycine methyl ester increased Po threefold at pHtrans 7.4, at which the channel normally exhibits low Po. With extracellular pH reduction (protonation) or amidation, increased Po was due to a significant increase in open time constants and a significant decrease in closed time constants of the channel gating, and this effect was insensitive to applied voltage. With the use of site-directed mutagenesis, the extracellular region EELE (amino acids 416-419) was identified as the pH sensor and amino acid Glu-419 was found to play the key or predominant role in activation of the ClC-2G Cl- channel by extracellular acid.

Coupling between the Voltage-sensing and Pore Domains in a Voltage-gated Potassium Channel

PubMed Central

Schow, Eric V.; Freites, J. Alfredo; Nizkorodov, Alex; White, Stephen H.; Tobias, Douglas J.

2012-01-01

Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence. PMID:22425907

Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

PubMed

Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

2012-07-01

Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

Measuring Multi-Megavolt Diode Voltages

NASA Astrophysics Data System (ADS)

Pereira, N. R.; Swanekamp, S. B.; Weber, B. V.; Commisso, R. J.; Hinshelwood, D. D.; Stephanakis, S. J.

2002-12-01

The voltage in high-power diodes can be determined by measuring the Compton electrons generated by the diode's bremsstrahlung radiation. This technique is implemented with a Compton-Hall (C-H) voltmeter that collimates the bremsstrahlung onto a Compton target and bends the emitted Compton electron orbits off to the side with an applied magnetic field off to Si pin diode detectors. Voltage is determined from the ratio of the Compton electron dose to the forward x-ray dose. The instrument's calibration and response are determined from coupled electron/photon transport calculations. The applicable voltage range is tuned by adjusting the position of the electron detector relative to the Compton target or by varying the magnetic field strength. The instrument was used to obtain time-dependent voltage measurements for a pinched-beam diode whose voltage is enhanced by an upstream opening switch. In this case, plasmas and vacuum electron flow from the opening switch make it difficult to determine the voltage accurately from electrical measurements. The C-H voltmeter gives voltages that are significantly higher than those obtained from electrical measurements but are consistent with measurements of peak voltage based on nuclear activation of boron-nitride targets.

Mode shift of the voltage sensors in Shaker K+ channels is caused by energetic coupling to the pore domain

PubMed Central

Haddad, Georges A.

2011-01-01

The voltage sensors of voltage-gated ion channels undergo a conformational change upon depolarization of the membrane that leads to pore opening. This conformational change can be measured as gating currents and is thought to be transferred to the pore domain via an annealing of the covalent link between voltage sensor and pore (S4-S5 linker) and the C terminus of the pore domain (S6). Upon prolonged depolarizations, the voltage dependence of the charge movement shifts to more hyperpolarized potentials. This mode shift had been linked to C-type inactivation but has recently been suggested to be caused by a relaxation of the voltage sensor itself. In this study, we identified two ShakerIR mutations in the S4-S5 linker (I384N) and S6 (F484G) that, when mutated, completely uncouple voltage sensor movement from pore opening. Using these mutants, we show that the pore transfers energy onto the voltage sensor and that uncoupling the pore from the voltage sensor leads the voltage sensors to be activated at more negative potentials. This uncoupling also eliminates the mode shift occurring during prolonged depolarizations, indicating that the pore influences entry into the mode shift. Using voltage-clamp fluorometry, we identified that the slow conformational change of the S4 previously correlated with the mode shift disappears when uncoupling the pore. The effects can be explained by a mechanical load that is imposed upon the voltage sensors by the pore domain and allosterically modulates its conformation. Mode shift is caused by the stabilization of the open state but leads to a conformational change in the voltage sensor. PMID:21518834

The elementary events of Ca2+ release elicited by membrane depolarization in mammalian muscle

PubMed Central

Csernoch, L; Zhou, J; Stern, M D; Brum, G; Ríos, E

2004-01-01

Cytosolic [Ca2+] transients elicited by voltage clamp depolarization were examined by confocal line scanning of rat skeletal muscle fibres. Ca2+ sparks were observed in the fibres' membrane-permeabilized ends, but not in responses to voltage in the membrane-intact area. Elementary events of the depolarization-evoked response could be separated either at low voltages (near −50 mV) or at −20mV in partially inactivated cells. These were of lower amplitude, narrower and of much longer duration than sparks, similar to ‘lone embers’ observed in the permeabilized segments. Their average amplitude was 0.19 and spatial half-width 1.3 μm. Other parameters depended on voltage. At −50 mV average duration was 111 ms and latency 185 ms. At −20 mV duration was 203 ms and latency 24 ms. Ca2+ release current, calculated on an average of events, was nearly steady at 0.5–0.6 pA. Accordingly, simulations of the fluorescence event elicited by a subresolution source of 0.5 pA open for 100 ms had morphology similar to the experimental average. Because 0.5 pA is approximately the current measured for single RyR channels in physiological conditions, the elementary fluorescence events in rat muscle probably reflect opening of a single RyR channel. A reconstruction of cell-averaged release flux at −20 mV based on the observed distribution of latencies and calculated elementary release had qualitatively correct but slower kinetics than the release flux in prior whole-cell measurements. The qualitative agreement indicates that global Ca2+ release flux results from summation of these discrete events. The quantitative discrepancies suggest that the partial inactivation strategy may lead to events of greater duration than those occurring physiologically in fully polarized cells. PMID:14990680

Aconitum and Delphinium sp. Alkaloids as Antagonist Modulators of Voltage-Gated Na+ Channels. AM1/DFT Electronic Structure Investigations and QSAR Studies

PubMed Central

Turabekova, Malakhat A.; Rasulev, Bakhtiyor F.; Levkovich, Mikhail G.; Abdullaev, Nasrulla D.; Leszczynski, Jerzy

2015-01-01

Early pharmacological studies of Aconitum and Delphinium sp. alkaloids suggested that these neurotoxins act at site 2 of voltage-gated Na+ channel and allosterically modulate its function. Understanding structural requirements for these compounds to exhibit binding activity at voltage-gated Na+ channel has been important in various fields. This paper reports quantum-chemical studies and quantitative structure-activity relationships (QSARs) based on a total of 65 natural alkaloids from two plant species, which includes both blockers and openers of sodium ion channel. A series of 18 antagonist alkaloids (9 blockers and 9 openers) have been studied using AM1 and DFT computational methods in order to reveal their structure-activity (structure-toxicity) relationship at electronic level. An examination of frontier orbitals obtained for ground and protonated forms of the compounds revealed that HOMOs and LUMOs were mainly represented by nitrogen atom and benzyl/benzoylester orbitals with –OH and –OCOCH3 contributions. The results obtained from this research have confirmed the experimental findings suggesting that neurotoxins acting at type 2 receptor site of voltage-dependent sodium channel are activators and blockers with common structural features and differ only in efficacy. The energetic tendency of HOMO-LUMO energy gap can probably distinguish activators and blockers that have been observed. Genetic Algorithm with Multiple Linear Regression Analysis (GA-MLRA) technique was also applied for the generation of two-descriptor QSAR models for the set of 65 blockers. Additionally to the computational studies, the HOMO-LUMO gap descriptor in each obtained QSAR model has confirmed the crucial role of charge transfer in receptor-ligand interactions. A number of other descriptors such as logP, IBEG, nNH2, nHDon, nCO have been selected as complementary ones to LUMO and their role in activity alteration has also been discussed. PMID:18201930

Derivation of the open-circuit voltage of organic solar cells

NASA Astrophysics Data System (ADS)

Staple, Douglas B.; Oliver, Patricia A. K.; Hill, Ian G.

2014-05-01

Organic photovoltaic cells have improved in efficiency from 1% two decades ago to over 10% today. Continued improvement necessitates a theoretical understanding of the factors determining efficiency. Organic photovoltaic efficiency can be parameterized in terms of open-circuit voltage, short-circuit current, and fill factor. Here we present a theory that explains the dependencies of open-circuit voltage on semiconductor energy levels, light intensity, solar cell and light-source temperatures, charge-carrier recombination, and external fluorescence efficiency. The present theory also explains why recombination at the donor-acceptor heterointerface is a dominant process in heterojunction-based cells. Furthermore, the Carnot efficiency appears, highlighting the connection to basic thermodynamics. The theory presented here is consistent with and builds on the experimental and theoretical observations already in the literature. Crucially, the present theory can be straightforwardly derived in a line-by-line fashion using standard tools from statistical physics.

Investigation of correlation between open-circuit voltage deficit and carrier recombination rates in Cu(In,Ga)(S,Se)2-based thin-film solar cells

NASA Astrophysics Data System (ADS)

Chantana, Jakapan; Kato, Takuya; Sugimoto, Hiroki; Minemoto, Takashi

2018-04-01

The temperature-illumination-dependent open-circuit voltage (VOC) method is utilized to separately and quantitatively estimate carrier recombination rates at the buffer/absorber interface, in the space-charge region (SCR), and in the quasi-neutral region (QNR) of Cu(In,Ga)(S,Se)2 (CIGSSe)-based thin-film solar cells with various device structures. The correlation between open-circuit voltage deficits (VOC,def) among the carrier recombination rates of the CIGSSe solar cells with a conversion efficiency (η) above 17% is examined. It is revealed that VOC,def is decreased to 0.373 V with the reduced carrier recombination rate at the buffer/absorber interface through the development of device structures. To further decrease VOC,def (for the improved η), the carrier recombination rates in SCR and QNR are essential to be reduced by the further improvement of CIGSSe quality. Consequently, understanding the quantitative carrier recombination rates across the device, estimated from the temperature-illumination-dependent VOC method, is practical to know which part of the solar cell needs to be developed for high η above 20%.

Comment on 'Power loss in open cavity diodes and a modified Child-Langmuir law' [Phys. Plasmas 12, 093102 (2005)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swanekamp, S. B.; Ottinger, P. F.

In this Comment, it is shown that no modification of the Child-Langmuir law [Phys. Rev.32, 492 (1911); Phys. Rev. 2, 450 (1913)] is necessary to treat the space-charge-limited flow from a diode with an open boundary as reported in Phys. Plasmas 12, 093102 (2005). The open boundary condition in their simulations can be represented by a voltage source and a resistor whose value is the vacuum-wave impedance of the opening. The diode can be represented as a variable resistor whose value depends on the voltage drop across the diode (as measured by the line integral of E across the diodemore » gap). This is a simple voltage-divider circuit whose analysis shows that the real diode voltage drops as the vacuum-wave impedance increases. Furthermore, it is shown that in equilibrium, the voltage drop between the anode and cathode is independent of the path chosen for the line integral of the electric field so that E=-{nabla}{phi} is valid. In this case, the equations of electrostatics are applicable. This clearly demonstrates that the electric field is electrostatic and static fields DO NOT RADIATE. It is shown that the diode voltage drops as the vacuum wave impedance increases and the current drops according to the Child-Langmuir law. Therefore, the observed drop in circuit current can be explained by a real drop in voltage across the diode and not an effective drop as claimed by the authors.« less

Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence

PubMed Central

Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang

2016-01-01

Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation, emphasizing that VSPs can cleave the 3-phosphate of PI(3,4,5)P3. PMID:27222577

Origin of Open-Circuit Voltage Loss in Polymer Solar Cells and Perovskite Solar Cells.

PubMed

Kim, Hyung Do; Yanagawa, Nayu; Shimazaki, Ai; Endo, Masaru; Wakamiya, Atsushi; Ohkita, Hideo; Benten, Hiroaki; Ito, Shinzaburo

2017-06-14

Herein, the open-circuit voltage (V OC ) loss in both polymer solar cells and perovskite solar cells is quantitatively analyzed by measuring the temperature dependence of V OC to discuss the difference in the primary loss mechanism of V OC between them. As a result, the photon energy loss for polymer solar cells is in the range of about 0.7-1.4 eV, which is ascribed to temperature-independent and -dependent loss mechanisms, while that for perovskite solar cells is as small as about 0.5 eV, which is ascribed to a temperature-dependent loss mechanism. This difference is attributed to the different charge generation and recombination mechanisms between the two devices. The potential strategies for the improvement of V OC in both solar cells are further discussed on the basis of the experimental data.

Heme Regulates Allosteric Activation of the Slo1 BK Channel

PubMed Central

Horrigan, Frank T.; Heinemann, Stefan H.; Hoshi, Toshinori

2005-01-01

Large conductance calcium-dependent (Slo1 BK) channels are allosterically activated by membrane depolarization and divalent cations, and possess a rich modulatory repertoire. Recently, intracellular heme has been identified as a potent regulator of Slo1 BK channels (Tang, X.D., R. Xu, M.F. Reynolds, M.L. Garcia, S.H. Heinemann, and T. Hoshi. 2003. Nature. 425:531–535). Here we investigated the mechanism of the regulatory action of heme on heterologously expressed Slo1 BK channels by separating the influences of voltage and divalent cations. In the absence of divalent cations, heme generally decreased ionic currents by shifting the channel's G–V curve toward more depolarized voltages and by rendering the curve less steep. In contrast, gating currents remained largely unaffected by heme. Simulations suggest that a decrease in the strength of allosteric coupling between the voltage sensor and the activation gate and a concomitant stabilization of the open state account for the essential features of the heme action in the absence of divalent ions. At saturating levels of divalent cations, heme remained similarly effective with its influence on the G–V simulated by weakening the coupling of both Ca2+ binding and voltage sensor activation to channel opening. The results thus show that heme dampens the influence of allosteric activators on the activation gate of the Slo1 BK channel. To account for these effects, we consider the possibility that heme binding alters the structure of the RCK gating ring and thereby disrupts both Ca2+- and voltage-dependent gating as well as intrinsic stability of the open state. PMID:15955873

An open circuit voltage decay system for performing injection dependent lifetime spectroscopy

NASA Astrophysics Data System (ADS)

Lacouture, Shelby; Schrock, James; Hirsch, Emily; Bayne, Stephen; O'Brien, Heather; Ogunniyi, Aderinto A.

2017-09-01

Of all of the material parameters associated with a semiconductor, the carrier lifetime is by far the most complex and dynamic, being a function of the dominant recombination mechanism, the equilibrium number of carriers, the perturbations in carriers (e.g., carrier injection), and the temperature, to name the most prominent variables. The carrier lifetime is one of the most important parameters in bipolar devices, greatly affecting conductivity modulation, on-state voltage, and reverse recovery. Carrier lifetime is also a useful metric for device fabrication process control and material quality. As it is such a dynamic quantity, carrier lifetime cannot be quoted in a general range such as mobility; it must be measured. The following describes a stand-alone, wide-injection range open circuit voltage decay system with unique lifetime extraction algorithms. The system is initially used along with various lifetime spectroscopy techniques to extract fundamental recombination parameters from a commercial high-voltage PIN diode.

Direct Analysis of JV-Curves Applied to an Outdoor-Degrading CdTe Module (Presentation)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jordan, D; Kurtz, S.; Ulbrich, C.

2014-03-01

We present the application of a phenomenological four parameter equation to fit and analyze regularly measured current density-voltage JV curves of a CdTe module during 2.5 years of outdoor operation. The parameters are physically meaningful, i.e. the short circuit current density Jsc, open circuit voltage Voc and differential resistances Rsc, and Roc. For the chosen module, the fill factor FF degradation overweighs the degradation of Jsc and Voc. Interestingly, with outdoor exposure, not only the conductance at short circuit, Gsc, increases but also the Gsc(Jsc)-dependence. This is well explained with an increase in voltage dependent charge carrier collection in CdTe.

Inter-subunit interactions across the upper voltage sensing-pore domain interface contribute to the concerted pore opening transition of Kv channels.

PubMed

Shem-Ad, Tzilhav; Irit, Orr; Yifrach, Ofer

2013-01-01

The tight electro-mechanical coupling between the voltage-sensing and pore domains of Kv channels lies at the heart of their fundamental roles in electrical signaling. Structural data have identified two voltage sensor pore inter-domain interaction surfaces, thus providing a framework to explain the molecular basis for the tight coupling of these domains. While the contribution of the intra-subunit lower domain interface to the electro-mechanical coupling that underlies channel opening is relatively well understood, the contribution of the inter-subunit upper interface to channel gating is not yet clear. Relying on energy perturbation and thermodynamic coupling analyses of tandem-dimeric Shaker Kv channels, we show that mutation of upper interface residues from both sides of the voltage sensor-pore domain interface stabilizes the closed channel state. These mutations, however, do not affect slow inactivation gating. We, moreover, find that upper interface residues form a network of state-dependent interactions that stabilize the open channel state. Finally, we note that the observed residue interaction network does not change during slow inactivation gating. The upper voltage sensing-pore interaction surface thus only undergoes conformational rearrangements during channel activation gating. We suggest that inter-subunit interactions across the upper domain interface mediate allosteric communication between channel subunits that contributes to the concerted nature of the late pore opening transition of Kv channels.

Time‐dependent renewal‐model probabilities when date of last earthquake is unknown

USGS Publications Warehouse

Field, Edward H.; Jordan, Thomas H.

2015-01-01

We derive time-dependent, renewal-model earthquake probabilities for the case in which the date of the last event is completely unknown, and compare these with the time-independent Poisson probabilities that are customarily used as an approximation in this situation. For typical parameter values, the renewal-model probabilities exceed Poisson results by more than 10% when the forecast duration exceeds ~20% of the mean recurrence interval. We also derive probabilities for the case in which the last event is further constrained to have occurred before historical record keeping began (the historic open interval), which can only serve to increase earthquake probabilities for typically applied renewal models.We conclude that accounting for the historic open interval can improve long-term earthquake rupture forecasts for California and elsewhere.

Artificial phosphorylation sites modulate the activity of a voltage-gated potassium channel

NASA Astrophysics Data System (ADS)

Ariyaratne, Amila; Zocchi, Giovanni

2015-03-01

The KvAP potassium channel is representative of a family of voltage-gated ion channels where the membrane potential is sensed by a transmembrane helix containing several positively charged arginines. Previous work by Wang and Zocchi [A. Wang and G. Zocchi, PLoS ONE 6, e18598 (2011), 10.1371/journal.pone.0018598] showed how a negatively charged polyelectrolyte attached in proximity to the voltage sensing element can bias the opening probability of the channel. Here we introduce three phosphorylation sites at the same location and show that the response curve of the channel shifts by about 20 mV upon phosphorylation, while other characteristics such as the single-channel conductance are unaffected. In summary, we construct an artificial phosphorylation site which confers allosteric regulation to the channel.

Effects of the β1 auxiliary subunit on modification of Rat Na{sub v}1.6 sodium channels expressed in HEK293 cells by the pyrethroid insecticides tefluthrin and deltamethrin

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Bingjun; Soderlund, David M., E-mail: dms6@cornell.edu

We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased inmore » the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin shifted channel gating to hyperpolarized potentials. • The β1 subunit had opposite effects on the actions of tefluthrin and deltamethrin. • Auxiliary subunits are required for full reconstitution of channel function. • Channels in HEK293 cells exhibit properties similar to channels in neurons.« less

Green Fluorescent Protein Changes the Conductance of Connexin 43 (Cx43) Hemichannels Reconstituted in Planar Lipid Bilayers*

PubMed Central

Carnarius, Christian; Kreir, Mohamed; Krick, Marcel; Methfessel, Christoph; Moehrle, Volker; Valerius, Oliver; Brüggemann, Andrea; Steinem, Claudia; Fertig, Niels

2012-01-01

In mammalian tissues, connexin 43 (Cx43) is the most prominent member of the connexin family. In a single lipid bilayer, six connexin subunits assemble into a hemichannel (connexon). Direct communication of apposing cells is realized by two adjacent hemichannels, which can form gap junction channels. Here, we established an expression system in Pichia pastoris to recombinantly produce and purify Cx43 as well as Cx43 fused to green fluorescent protein (GFP). Proteins were isolated from crude cell membrane fractions via affinity chromatography. Cx43 and Cx43-GFP hemichannels were reconstituted in giant unilamellar vesicles as proven by fluorescence microscopy, and their electrophysiological behavior was analyzed on the single channel level by planar patch clamping. Cx43 and Cx43-GFP both showed an ohmic behavior and a voltage-dependent open probability. Cx43 hemichannels exhibited one major mean conductance of 224 ± 26 picosiemens (pS). In addition, a subconductance state at 124 ± 5 pS was identified. In contrast, the analysis of Cx43-GFP single channels revealed 10 distinct conductance states in the range of 15 to 250 pS, with a larger open probability at 0 mV as compared with Cx43, which suggests that intermolecular interactions between the GFP molecules alter the electrophysiology of the protein. PMID:22139870

Green fluorescent protein changes the conductance of connexin 43 (Cx43) hemichannels reconstituted in planar lipid bilayers.

PubMed

Carnarius, Christian; Kreir, Mohamed; Krick, Marcel; Methfessel, Christoph; Moehrle, Volker; Valerius, Oliver; Brüggemann, Andrea; Steinem, Claudia; Fertig, Niels

2012-01-20

In mammalian tissues, connexin 43 (Cx43) is the most prominent member of the connexin family. In a single lipid bilayer, six connexin subunits assemble into a hemichannel (connexon). Direct communication of apposing cells is realized by two adjacent hemichannels, which can form gap junction channels. Here, we established an expression system in Pichia pastoris to recombinantly produce and purify Cx43 as well as Cx43 fused to green fluorescent protein (GFP). Proteins were isolated from crude cell membrane fractions via affinity chromatography. Cx43 and Cx43-GFP hemichannels were reconstituted in giant unilamellar vesicles as proven by fluorescence microscopy, and their electrophysiological behavior was analyzed on the single channel level by planar patch clamping. Cx43 and Cx43-GFP both showed an ohmic behavior and a voltage-dependent open probability. Cx43 hemichannels exhibited one major mean conductance of 224 ± 26 picosiemens (pS). In addition, a subconductance state at 124 ± 5 pS was identified. In contrast, the analysis of Cx43-GFP single channels revealed 10 distinct conductance states in the range of 15 to 250 pS, with a larger open probability at 0 mV as compared with Cx43, which suggests that intermolecular interactions between the GFP molecules alter the electrophysiology of the protein.

Potassium Channels in Regulation of Vascular Smooth Muscle Contraction and Growth

PubMed Central

Jackson, William F.

2017-01-01

Potassium channels importantly contribute to the regulation of vascular smooth muscle (VSM) contraction and growth. They are the dominant ion conductance of the VSM cell membrane and importantly determine and regulate membrane potential. Membrane potential, in turn, regulates the open-state probability of voltage-gated Ca2+ channels (VGCC), Ca2+ influx through VGCC, intracellular Ca2+ and VSM contraction. Membrane potential also affects release of Ca2+ from internal stores and the Ca2+ sensitivity of the contractile machinery such that K+ channels participate in all aspects of regulation of VSM contraction. Potassium channels also regulate proliferation of VSM cells through membrane potential-dependent and membrane potential-independent mechanisms. Vascular smooth muscle cells express multiple isoforms of at least five classes of K+ channels contribute to the regulation of contraction and cell proliferation (growth). This review will examine the structure, expression and function of large-conductance, Ca2+-activated K+ (BKCa) channels, intermediate-conductance Ca2+-activated K+ (KCa3.1) channels, multiple isoforms of voltage-gated K+ (KV) channels, ATP-sensitive K+ (KATP) channels, and inward-rectifier K+ (KIR) channels in both contractile and proliferating VSM cells. PMID:28212804

Breakdown in helium in high-voltage open discharge with subnanosecond current front rise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schweigert, I. V., E-mail: ischweig@itam.nsc.ru; Alexandrov, A. L.; Bokhan, P. A.

Investigations of high-voltage open discharge in helium have shown a possibility of generation of current pulses with subnanosecond front rise, due to ultra-fast breakdown development. The open discharge is ignited between two planar cathodes with mesh anode in the middle between them. For gas pressure 6 Torr and 20 kV applied voltage, the rate of current rise reaches 500 A/(cm{sup 2} ns) for current density 200 A/cm{sup 2} and more. The time of breakdown development was measured for different helium pressures and a kinetic model of breakdown in open discharge is presented, based on elementary reactions for electrons, ions andmore » fast atoms. The model also includes various cathode emission processes due to cathode bombardment by ions, fast atoms, electrons and photons of resonant radiation with Doppler shift of frequency. It is shown, that the dominating emission processes depend on the evolution of the discharge voltage during the breakdown. In the simulations, two cases of voltage behavior were considered: (i) the voltage is kept constant during the breakdown; (ii) the voltage is reduced with the growth of current. For the first case, the exponentially growing current is maintained due to photoemission by the resonant photons with Doppler-shifted frequency. For the second case, the dominating factor of current growth is the secondary electron emission. In both cases, the subnanosecond rise of discharge current was obtained. Also the effect of gas pressure on breakdown development was considered. It was found that for 20 Torr gas pressure the time of current rise decreases to 0.1 ns, which is in agreement with experimental data.« less

Large-conductance voltage- and Ca2+-activated K+ channel regulation by protein kinase C in guinea pig urinary bladder smooth muscle

PubMed Central

Hristov, Kiril L.; Smith, Amy C.; Parajuli, Shankar P.; Malysz, John

2013-01-01

Large-conductance voltage- and Ca2+-activated K+ (BK) channels are critical regulators of detrusor smooth muscle (DSM) excitability and contractility. PKC modulates the contraction of DSM and BK channel activity in non-DSM cells; however, the cellular mechanism regulating the PKC-BK channel interaction in DSM remains unknown. We provide a novel mechanistic insight into BK channel regulation by PKC in DSM. We used patch-clamp electrophysiology, live-cell Ca2+ imaging, and functional studies of DSM contractility to elucidate BK channel regulation by PKC at cellular and tissue levels. Voltage-clamp experiments showed that pharmacological activation of PKC with PMA inhibited the spontaneous transient BK currents in native freshly isolated guinea pig DSM cells. Current-clamp recordings revealed that PMA significantly depolarized DSM membrane potential and inhibited the spontaneous transient hyperpolarizations in DSM cells. The PMA inhibitory effects on DSM membrane potential were completely abolished by the selective BK channel inhibitor paxilline. Activation of PKC with PMA did not affect the amplitude of the voltage-step-induced whole cell steady-state BK current or the single BK channel open probability (recorded in cell-attached mode) upon inhibition of all major Ca2+ sources for BK channel activation with thapsigargin, ryanodine, and nifedipine. PKC activation with PMA elevated intracellular Ca2+ levels in DSM cells and increased spontaneous phasic and nerve-evoked contractions of DSM isolated strips. Our results support the concept that PKC activation leads to a reduction of BK channel activity in DSM via a Ca2+-dependent mechanism, thus increasing DSM contractility. PMID:24352333

Biphasic Effect of Nitric Oxide on the Cardiac Voltage-dependent Anion Channel

PubMed Central

Cheng, Qunli; Sedlic, Filip; Pravdic, Danijel; Bosnjak, Zeljko J.; Kwok, Wai-Meng

2010-01-01

Nitric oxide (NO˙) effects on the cardiac mitochondrial voltage-dependent anion channel (VDAC) are unknown. The effects of exogenous NO˙ on VDAC purified from rat hearts were investigated in this study. When incorporated into lipid bilayers, VDAC was inhibited directly by an NO˙ donor, PAPA NONOate, in a concentration-dependent biphasic manner. This was prevented by an NO˙ scavenger, PTIO. The effect paralleled that of NO˙ in delaying the opening of the mitochondrial permeability transition (PT) pore. These biphasic effects on the cardiac VDAC and the PT pore reveal a tandem impact of NO˙ on the two mitochondrial entities. PMID:21156174

Structures of closed and open states of a voltage-gated sodium channel

PubMed Central

Lenaeus, Michael J.; Gamal El-Din, Tamer M.; Ramanadane, Karthik; Pomès, Régis; Zheng, Ning; Catterall, William A.

2017-01-01

Bacterial voltage-gated sodium channels (BacNavs) serve as models of their vertebrate counterparts. BacNavs contain conserved voltage-sensing and pore-forming domains, but they are homotetramers of four identical subunits, rather than pseudotetramers of four homologous domains. Here, we present structures of two NaVAb mutants that capture tightly closed and open states at a resolution of 2.8–3.2 Å. Introduction of two humanizing mutations in the S6 segment (NaVAb/FY: T206F and V213Y) generates a persistently closed form of the activation gate in which the intracellular ends of the four S6 segments are drawn tightly together to block ion permeation completely. This construct also revealed the complete structure of the four-helix bundle that forms the C-terminal domain. In contrast, truncation of the C-terminal 40 residues in NavAb/1–226 captures the activation gate in an open conformation, revealing the open state of a BacNav with intact voltage sensors. Comparing these structures illustrates the full range of motion of the activation gate, from closed with its orifice fully occluded to open with an orifice of ∼10 Å. Molecular dynamics and free-energy simulations confirm designation of NaVAb/1–226 as an open state that allows permeation of hydrated Na+, and these results also support a hydrophobic gating mechanism for control of ion permeation. These two structures allow completion of a closed–open–inactivated conformational cycle in a single voltage-gated sodium channel and give insight into the structural basis for state-dependent binding of sodium channel-blocking drugs. PMID:28348242

Single-channel kinetics of BK (Slo1) channels

PubMed Central

Geng, Yanyan; Magleby, Karl L.

2014-01-01

Single-channel kinetics has proven a powerful tool to reveal information about the gating mechanisms that control the opening and closing of ion channels. This introductory review focuses on the gating of large conductance Ca2+- and voltage-activated K+ (BK or Slo1) channels at the single-channel level. It starts with single-channel current records and progresses to presentation and analysis of single-channel data and the development of gating mechanisms in terms of discrete state Markov (DSM) models. The DSM models are formulated in terms of the tetrameric modular structure of BK channels, consisting of a central transmembrane pore-gate domain (PGD) attached to four surrounding transmembrane voltage sensing domains (VSD) and a large intracellular cytosolic domain (CTD), also referred to as the gating ring. The modular structure and data analysis shows that the Ca2+ and voltage dependent gating considered separately can each be approximated by 10-state two-tiered models with five closed states on the upper tier and five open states on the lower tier. The modular structure and joint Ca2+ and voltage dependent gating are consistent with a 50 state two-tiered model with 25 closed states on the upper tier and 25 open states on the lower tier. Adding an additional tier of brief closed (flicker states) to the 10-state or 50-state models improved the description of the gating. For fixed experimental conditions a channel would gate in only a subset of the potential number of states. The detected number of states and the correlations between adjacent interval durations are consistent with the tiered models. The examined models can account for the single-channel kinetics and the bursting behavior of gating. Ca2+ and voltage activate BK channels by predominantly increasing the effective opening rate of the channel with a smaller decrease in the effective closing rate. Ca2+ and depolarization thus activate by mainly destabilizing the closed states. PMID:25653620

Temperature, illumination and fluence dependence of current and voltage in electron irradiated solar cells

NASA Technical Reports Server (NTRS)

Obenschain, A. F.; Faith, T. J.

1973-01-01

Emperical equations have been derived from measurements of solar cell photovoltaic characteristics relating light generated current, IL, and open circuit voltage, VO, to cell temperature, T, intensity of illumination, W, and 1 Mev electron fluence, phi both 2 ohm-cm and 10 ohm-cm cells were tested. The temperature dependency of IL is similar for both resistivities at 140mw/sq cm; at high temperature the coefficient varies with fluence as phi 0.18, while at low temperatures the coefficient is relatively independent of fluence. Fluence dependent degration causes a decrease in IL at a rate proportional to phi 0.153 for both resistivities. At all intensities other than 560 mw/sq cm, a linear dependence of IL on illumination was found. The temperature coefficient of voltage was, to a good approximation, independent of both temperature and illumination for both resistivities. Illumination dependence of VOC was logarithmic, while the decrease with fluence of VOC varied as phi 0.25 for both resistivities.

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

PubMed

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free energy barrier that follow the trend of the equilibrium fluctuation relation and the Marcus theory of electron transfer. These energetics also allow for a direct estimation of the voltage dependence of channel activation (Q-V curve), offering a quantitative rationale for a correlation between the voltage dependence parabolas and the Q-V curve, upon site-directed mutagenesis or drug binding. Taken together, by introducing the voltage coupling as the energy gap reaction coordinate, our framework brings new perspectives to the thermodynamic models of voltage activation in voltage-sensitive membrane proteins, offering an a framework for a better understating of the structure-function correlations of voltage gating in ion channels as well as electrogenic phenomena in ion pumps and transporters. Significantly, this formulation also provides a powerful bridge between the CG model of voltage coupling and the conventional macroscopic treatments. Copyright © 2015 Elsevier B.V. All rights reserved.

Electrothermal Feedback and Absorption-Induced Open-Circuit-Voltage Turnover in Solar Cells

NASA Astrophysics Data System (ADS)

Ullbrich, Sascha; Fischer, Axel; Tang, Zheng; Ávila, Jorge; Bolink, Henk J.; Reineke, Sebastian; Vandewal, Koen

2018-05-01

Solar panels easily heat up upon intense solar radiation due to excess energy dissipation of the absorbed photons or by nonradiative recombination of charge carriers. Still, photoinduced self-heating is often ignored when characterizing lab-sized samples. For light-intensity-dependent measurements of the open-circuit voltage (Suns-VO C ), allowing us to characterize the recombination mechanism, sample heating is often not considered, although almost 100% of the absorbed energy is converted into heat. Here, we show that the frequently observed stagnation or even decrease in VOC at increasingly high light intensities can be explained by considering an effective electrothermal feedback between the recombination current and the open-circuit voltage. Our analytical model fully explains the experimental data for various solar-cell technologies, comprising conventional inorganic semiconductors as well as organic and perovskite materials. Furthermore, the model can be exploited to determine the ideality factor, the effective gap, and the temperature rise from a single Suns-VOC measurement at ambient conditions.

Functional Properties of a Newly Identified C-terminal Splice Variant of Cav1.3 L-type Ca2+ Channels*

PubMed Central

Bock, Gabriella; Gebhart, Mathias; Scharinger, Anja; Jangsangthong, Wanchana; Busquet, Perrine; Poggiani, Chiara; Sartori, Simone; Mangoni, Matteo E.; Sinnegger-Brauns, Martina J.; Herzig, Stefan; Striessnig, Jörg; Koschak, Alexandra

2011-01-01

An intramolecular interaction between a distal (DCRD) and a proximal regulatory domain (PCRD) within the C terminus of long Cav1.3 L-type Ca2+ channels (Cav1.3L) is a major determinant of their voltage- and Ca2+-dependent gating kinetics. Removal of these regulatory domains by alternative splicing generates Cav1.342A channels that activate at a more negative voltage range and exhibit more pronounced Ca2+-dependent inactivation. Here we describe the discovery of a novel short splice variant (Cav1.343S) that is expressed at high levels in the brain but not in the heart. It lacks the DCRD but, in contrast to Cav1.342A, still contains PCRD. When expressed together with α2δ1 and β3 subunits in tsA-201 cells, Cav1.343S also activated at more negative voltages like Cav1.342A but Ca2+-dependent inactivation was less pronounced. Single channel recordings revealed much higher channel open probabilities for both short splice variants as compared with Cav1.3L. The presence of the proximal C terminus in Cav1.343S channels preserved their modulation by distal C terminus-containing Cav1.3- and Cav1.2-derived C-terminal peptides. Removal of the C-terminal modulation by alternative splicing also induced a faster decay of Ca2+ influx during electrical activities mimicking trains of neuronal action potentials. Our findings extend the spectrum of functionally diverse Cav1.3 L-type channels produced by tissue-specific alternative splicing. This diversity may help to fine tune Ca2+ channel signaling and, in the case of short variants lacking a functional C-terminal modulation, prevent excessive Ca2+ accumulation during burst firing in neurons. This may be especially important in neurons that are affected by Ca2+-induced neurodegenerative processes. PMID:21998310

Ultraviolet irradiation at elevated temperatures and thermal cycling in vacuum of FEP-A covered silicon solar cells

NASA Technical Reports Server (NTRS)

Broder, J. D.; Marsik, S. J.

1978-01-01

Experiments were designed and performed on silicon solar cells covered with heat-bonded FEP-A in an effort to explain the rapid degeneration of open-circuit voltage and maximum power observered on cells of this type included in an experiment on the ATS-6 spacecraft. Solar cells were exposed to ultraviolet light in vacuum at temperatures ranging from 30 to 105 C. The samples were then subjected to thermal cycling from 130 to -130 C. Inspection following irradiation indicated that all the covers remained physically intact. However, during the temperature cycling heat-bonded covers showed cracking. The test showed that heat-bonded FEP-A covers embrittle during UV exposure and the embrittlement is dependent upon sample temperature during irradiation. The results of the experiment suggest a probable mechanism for the degradation of the FEP-A cells on ATS-6.

KCNE1 divides the voltage sensor movement in KCNQ1/KCNE1 channels into two steps

NASA Astrophysics Data System (ADS)

Barro-Soria, Rene; Rebolledo, Santiago; Liin, Sara I.; Perez, Marta E.; Sampson, Kevin J.; Kass, Robert S.; Larsson, H. Peter

2014-04-01

The functional properties of KCNQ1 channels are highly dependent on associated KCNE-β subunits. Mutations in KCNQ1 or KCNE subunits can cause congenital channelopathies, such as deafness, cardiac arrhythmias and epilepsy. The mechanism by which KCNE1-β subunits slow the kinetics of KCNQ1 channels is a matter of current controversy. Here we show that KCNQ1/KCNE1 channel activation occurs in two steps: first, mutually independent voltage sensor movements in the four KCNQ1 subunits generate the main gating charge movement and underlie the initial delay in the activation time course of KCNQ1/KCNE1 currents. Second, a slower and concerted conformational change of all four voltage sensors and the gate, which opens the KCNQ1/KCNE1 channel. Our data show that KCNE1 divides the voltage sensor movement into two steps with widely different voltage dependences and kinetics. The two voltage sensor steps in KCNQ1/KCNE1 channels can be pharmacologically isolated and further separated by a disease-causing mutation.

A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

PubMed

Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

2016-02-25

Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Lack of voltage-dependent calcium channel opening during the calcium influx induced by progesterone in human sperm. Effect of calcium channel deactivation and inactivation.

PubMed

Guzmán-Grenfell, Alberto Martín; González-Martínez, Marco T

2004-01-01

Progesterone induces calcium influx and acrosomal exocytosis in human sperm. Pharmacologic evidence suggests that voltage-dependent calcium channels (VDCCs) are involved. In this study, membrane potential (Vm) and intracellular calcium concentration ([Ca(2+)](i)) were monitored simultaneously to assess the effect of VDCC gating on the calcium influx triggered by progesterone. Holding the Vm to values that maintained VDCCs in a deactivated (-71 mV) closed state inhibited the calcium influx induced by progesterone by approximately 40%. At this Vm, the acrosomal reaction induced by progesterone, but not by A23187, was inhibited. However, when the Vm was held at -15 mV (which maintains VDCCs in an inactivated closed state), the progesterone-induced calcium influx was stimulated. Furthermore, the progesterone and voltage-dependent calcium influxes were additive. These findings indicate that progesterone does not produce VDCC gating in human sperm.

L-Type Calcium Channels Modulation by Estradiol.

PubMed

Vega-Vela, Nelson E; Osorio, Daniel; Avila-Rodriguez, Marco; Gonzalez, Janneth; García-Segura, Luis Miguel; Echeverria, Valentina; Barreto, George E

2017-09-01

Voltage-gated calcium channels are key regulators of brain function, and their dysfunction has been associated with multiple conditions and neurodegenerative diseases because they couple membrane depolarization to the influx of calcium-and other processes such as gene expression-in excitable cells. L-type calcium channels, one of the three major classes and probably the best characterized of the voltage-gated calcium channels, act as an essential calcium binding proteins with a significant biological relevance. It is well known that estradiol can activate rapidly brain signaling pathways and modulatory/regulatory proteins through non-genomic (or non-transcriptional) mechanisms, which lead to an increase of intracellular calcium that activate multiple kinases and signaling cascades, in the same way as L-type calcium channels responses. In this context, estrogens-L-type calcium channels signaling raises intracellular calcium levels and activates the same signaling cascades in the brain probably through estrogen receptor-independent modulatory mechanisms. In this review, we discuss the available literature on this area, which seems to suggest that estradiol exerts dual effects/modulation on these channels in a concentration-dependent manner (as a potentiator of these channels in pM concentrations and as an inhibitor in nM concentrations). Indeed, estradiol may orchestrate multiple neurotrophic responses, which open a new avenue for the development of novel estrogen-based therapies to alleviate different neuropathologies. We also highlight that it is essential to determine through computational and/or experimental approaches the interaction between estradiol and L-type calcium channels to assist these developments, which is an interesting area of research that deserves a closer look in future biomedical research.

Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

PubMed

Minor, Daniel L; Findeisen, Felix

2010-01-01

Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

PubMed Central

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de la Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-01-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4–S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4–S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules. PMID:25818916

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains.

PubMed

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de la Peña, Pilar; Tomczak, Adam P; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A

2015-03-30

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

NASA Astrophysics Data System (ADS)

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-03-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons.

PubMed

Brown, Maile R; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H; Kaczmarek, Leonard K

2016-07-01

Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express "high threshold" voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. Copyright © 2016 the American Physiological Society.

Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons

PubMed Central

Brown, Maile R.; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H.

2016-01-01

Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express “high threshold” voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. PMID:27052580

Gating currents from Kv7 channels carrying neuronal hyperexcitability mutations in the voltage-sensing domain.

PubMed

Miceli, Francesco; Vargas, Ernesto; Bezanilla, Francisco; Taglialatela, Maurizio

2012-03-21

Changes in voltage-dependent gating represent a common pathogenetic mechanism for genetically inherited channelopathies, such as benign familial neonatal seizures or peripheral nerve hyperexcitability caused by mutations in neuronal K(v)7.2 channels. Mutation-induced changes in channel voltage dependence are most often inferred from macroscopic current measurements, a technique unable to provide a detailed assessment of the structural rearrangements underlying channel gating behavior; by contrast, gating currents directly measure voltage-sensor displacement during voltage-dependent gating. In this work, we describe macroscopic and gating current measurements, together with molecular modeling and molecular-dynamics simulations, from channels carrying mutations responsible for benign familial neonatal seizures and/or peripheral nerve hyperexcitability; K(v)7.4 channels, highly related to K(v)7.2 channels both functionally and structurally, were used for these experiments. The data obtained showed that mutations affecting charged residues located in the more distal portion of S(4) decrease the stability of the open state and the active voltage-sensing domain configuration but do not directly participate in voltage sensing, whereas mutations affecting a residue (R4) located more proximally in S(4) caused activation of gating-pore currents at depolarized potentials. These results reveal that distinct molecular mechanisms underlie the altered gating behavior of channels carrying disease-causing mutations at different voltage-sensing domain locations, thereby expanding our current view of the pathogenesis of neuronal hyperexcitability diseases. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moore, James E.; Purdue University, West Lafayette, Indiana 47907; Hages, Charles J.

2016-07-11

Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependencemore » and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.« less

Transient current interruption mechanism in a magnetically delayed vacuum switch

NASA Technical Reports Server (NTRS)

Morris, Gibson, Jr.; Dougal, Roger A.

1993-01-01

The capacity of a magnetically delayed vacuum switch to conduct current depends on the density of plasma injected into the switch. Exceeding the current capacity results in the switch entering a lossy mode of operation characterized by a transient interruption of the main current (opening behavior) and a rapid increase of voltage across the vacuum gap. Streak and framing photographs of the discharge indicate that a decrease of luminosity near the middle of the gap preceeds the transition to the opening phase. The zone of low luminosity propagates toward the cathode. This evidence suggests that the mechanism causing the opening phase is erosion of the background plasma in a manner similar to that in a plasma-opening switch. The resulting ion depletion forces a space-charge-limited conduction mode. The switch inductance maintains a high discharge current even during the space-charge-limited conduction phase, thus producing high internal fields. The high accelerating voltage, in turn, produces electron and ion beams that heat the electrode surfaces. As a result of the heating, jets of electrode vapor issue from the electrodes, either cathode or anode, depending on the selection of electrode materials.

Equilibrium Fluctuation Relations for Voltage Coupling in Membrane Proteins

PubMed Central

Kim, Ilsoo; Warshel, Arieh

2015-01-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the reaction coordinate of “voltage coupling”, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference at zero membrane potential (i.e., between the two “non-equilibrium” conformational states) is shown to be equivalent to the free energy difference between the two “equilibrium” conformational states along the one-dimensional reaction coordinate of voltage coupling. Furthermore, the requirement that the application of linear response approximation to the free energy functions (free energies) of voltage coupling should satisfy the general free energy relations, yields a novel expression for the gating charge in terms of other experimentally measurable quantities. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the movement of a unit charge within the membrane under the influence of an external potential, using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus–type voltage dependent free energy parabolas for the two conformational states, which allow for quantitative estimations of an equilibrium free energy difference, a free energy of barrier, and the voltage dependency of channel activation (Q-V curve) for the unit charge movement. In addition, our analysis offers a quantitative rationale for the correlation between the free energy landscapes (parabolas) and the Q-V curve, upon site-directed mutagenesis or drug binding. Taken together, by introducing the voltage coupling as a reaction coordinate of energy gab, the present theory offers a firm physical foundation from the equilibrium theory of statistical mechanics for the thermodynamic models of voltage activation in voltage-sensitive membrane proteins. This formulation also provides a powerful bridge between the CG model and the conventional macroscopic treatments, offering an intuitive and quantitative framework for a better understating of the structure-function correlations of voltage gating in ion channels as well as electrogenic phenomena in ion pumps and transporters. PMID:26290960

MarkoLAB: A simulator to study ionic channel's stochastic behavior.

PubMed

da Silva, Robson Rodrigues; Goroso, Daniel Gustavo; Bers, Donald M; Puglisi, José Luis

2017-08-01

Mathematical models of the cardiac cell have started to include markovian representations of the ionic channels instead of the traditional Hodgkin & Huxley formulations. There are many reasons for this: Markov models are not restricted to the idea of independent gates defining the channel, they allow more complex description with specific transitions between open, closed or inactivated states, and more importantly those states can be closely related to the underlying channel structure and conformational changes. We used the LabVIEW ® and MATLAB ® programs to implement the simulator MarkoLAB that allow a dynamical 3D representation of the markovian model of the channel. The Monte Carlo simulation was used to implement the stochastic transitions among states. The user can specify the voltage protocol by setting the holding potential, the step-to voltage and the duration of the stimuli. The most studied feature of a channel is the current flowing through it. This happens when the channel stays in the open state, but most of the time, as revealed by the low open probability values, the channel remains on the inactive or closed states. By focusing only when the channel enters or leaves the open state we are missing most of its activity. MarkoLAB proved to be quite useful to visualize the whole behavior of the channel and not only when the channel produces a current. Such dynamic representation provides more complete information about channel kinetics and will be a powerful tool to demonstrate the effect of gene mutations or drugs on the channel function. MarkoLAB provides an original way of visualizing the stochastic behavior of a channel. It clarifies concepts, such as recovery from inactivation, calcium- versus voltage-dependent inactivation, and tail currents. It is not restricted to ionic channels only but it can be extended to other transporters, such as exchangers and pumps. This program is intended as a didactical tool to illustrate the dynamical behavior of a channel. It has been implemented in two platforms MATLAB ® and LabVIEW ® to enhance the target users of this new didactical tool. The computational cost of implementing a stochastic simulation is within the range of a personal computer performance; making MarkoLAB suitable to be run during a lecture or presentation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Switch contact device for interrupting high current, high voltage, AC and DC circuits

DOEpatents

Via, Lester C.; Witherspoon, F. Douglas; Ryan, John M.

2005-01-04

A high voltage switch contact structure capable of interrupting high voltage, high current AC and DC circuits. The contact structure confines the arc created when contacts open to the thin area between two insulating surfaces in intimate contact. This forces the arc into the shape of a thin sheet which loses heat energy far more rapidly than an arc column having a circular cross-section. These high heat losses require a dramatic increase in the voltage required to maintain the arc, thus extinguishing it when the required voltage exceeds the available voltage. The arc extinguishing process with this invention is not dependent on the occurrence of a current zero crossing and, consequently, is capable of rapidly interrupting both AC and DC circuits. The contact structure achieves its high performance without the use of sulfur hexafluoride.

Effect of an N-terminus deletion on voltage-dependent gating of the ClC-2 chloride channel

PubMed Central

Varela, Diego; Niemeyer, María Isabel; Cid, L Pablo; Sepúlveda, Francisco V

2002-01-01

ClC-2, a chloride channel widely expressed in mammalian tissues, is activated by hyperpolarisation and extracellular acidification. Deletion of amino acids 16–61 in rat ClC-2 abolishes voltage and pH dependence in two-electrode voltage-clamp experiments in amphibian oocytes. These results have been interpreted in terms of a ball-and-chain type of mechanism in which the N-terminus would behave as a ball that is removed from an inactivating site upon hyperpolarisation. We now report whole-cell patch-clamp measurements in mammalian cells showing hyperpolarization-activation of rClC-2Δ16–61 differing only in presenting faster opening and closing kinetics than rClC-2. The lack of time and voltage dependence observed previously was reproduced, however, in nystatin-perforated patch experiments. The behaviour of wild-type rClC-2 did not differ between conventional and nystatin-perforated patches. Similar results were obtained with ClC-2 from guinea-pig. One possible explanation of the results is that some diffusible component is able to lock the channel in an open state but does so only to the mutated channel. Alternative explanations involving the osmotic state of the cell and cytoskeleton structure are also considered. Low extracellular pH activates the wild-type channel but not rClC-2Δ16–61 when expressed in oocytes, a result that had been interpreted to suggest that protons affect the ball-and-chain mechanism. In our experiments no difference was seen in the effect of extracellular pH upon rClC-2 and rClC-2Δ16–61 in either recording configuration, suggesting that protons act independently from possible effects of the N-terminus on gating. Our observations of voltage-dependent gating of the N-terminal deleted ClC-2 are an argument against a ball-and-chain mechanism for this channel. PMID:12381811

High voltage pulse ignition of mercury discharge hollow cathodes

NASA Technical Reports Server (NTRS)

Wintucky, E. G.

1973-01-01

A high voltage pulse generated by a capacitor discharge into a step-up transformer has been demonstrated capable of consistently igniting hollow cathode mercury discharges at propellant flows and heater power levels much below those required by conventional cathode starting. Results are presented for 3.2-mm diameter enclosed and open keeper cathodes. Starting characteristics are shown to depend on keeper voltage, mercury flow rate, heater power, keeper orifice size, emissive materials, and electrode to which the pulse is applied. This starting technique has been used to start a cathode over 10,000 times without any degradation of starting capability.

Inhibition of heterologously expressed cystic fibrosis transmembrane conductance regulator Cl− channels by non-sulphonylurea hypoglycaemic agents

PubMed Central

Cai, Z; Lansdell, K A; Sheppard, D N

1999-01-01

Hypoglycaemia-inducing sulphonylureas, such as glibenclamide, inhibit cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channels. In search of modulators of CFTR, we investigated the effects of the non-sulphonylurea hypoglycaemic agents meglitinide, repaglinide, and mitiglinide (KAD-1229) on CFTR Cl− channels in excised inside-out membrane patches from C127 cells expressing wild-type human CFTR. When added to the intracellular solution, meglitinide and mitiglinide inhibited CFTR Cl− currents with half-maximal concentrations of 164±19 μM and 148±36 μM, respectively. However, repaglinide only weakly inhibited CFTR Cl− currents. To understand better how non-sulphonylurea hypoglycaemic agents inhibit CFTR, we studied single channels. Channel blockade by both meglitinide and mitiglinide was characterized by flickery closures and a significant decrease in open probability (Po). In contrast, repaglinide was without effect on either channel gating or Po, but caused a small decrease in single-channel current amplitude. Analysis of the dwell time distributions of single channels indicated that both meglitinide and mitiglinide greatly decreased the open time of CFTR. Mitiglinide-induced channel closures were about 3-fold longer than those of meglitinide. Inhibition of CFTR by meglitinide and mitiglinide was voltage-dependent: at positive voltages channel blockade was relieved. The data demonstrate that non-sulphonylurea hypoglycaemic agents inhibit CFTR. This indicates that these agents have a wider specificity of action than previously recognized. Like glibenclamide, non-sulphonylurea hypoglycaemic agents may inhibit CFTR by occluding the channel pore and preventing Cl− permeation. PMID:10498841

Radiation damage in high voltage silicon solar cells

NASA Technical Reports Server (NTRS)

Weinberg, I.; Brandhorst, H., Jr.; Swartz, C. K.; Weizer, V. G.

1980-01-01

Three high open-circuit voltage cell designs based on 0.1 ohm-cm p-type silicon were irradiated with 1 MeV electrons and their performance determined to fluences as high as 10 to the 15th power/sq cm. Of the three cell designs, radiation induced degradation was greatest in the high-low emitter (HLE cell). The diffused and ion implanted cells degraded approximately equally but less than the HLE cell. Degradation was greatest in an HLE cell exposed to X-rays before electron irradiation. The cell regions controlling both short-circuit current and open-circuit voltage degradation were defined in all three cell types. An increase in front surface recombination velocity accompanied time dependent degradation of an HLE cell after X-irradiation. It was speculated that this was indirectly due to a decrease in positive charge at the silicon-oxide interface. Modifications aimed at reducing radiation induced degradation are proposed for all three cell types.

Influence of a MoOx interlayer on the open-circuit voltage in organic photovoltaic cells

NASA Astrophysics Data System (ADS)

Zou, Yunlong; Holmes, Russell J.

2013-07-01

Metal-oxides have been used as interlayers at the anode-organic interface in organic photovoltaic cells (OPVs) to increase the open-circuit voltage (VOC). We examine the role of MoOx in determining the maximum VOC in a planar heterojunction OPV and find that the interlayer strongly affects the temperature dependence of VOC. Boron subphthalocyanine chloride (SubPc)-C60 OPVs that contain no interlayer show a maximum VOC of 1.2 V at low temperature, while those with MoOx show no saturation, reaching VOC > 1.4 V. We propose that the MoOx-SubPc interface forms a Schottky junction that provides an additional contribution to VOC at low temperature.

Antagonism of Lidocaine Inhibition by Open-Channel Blockers That Generate Resurgent Na Current

PubMed Central

Bant, Jason S.; Aman, Teresa K.; Raman, Indira M.

2013-01-01

Na channels that generate resurgent current express an intracellular endogenous open-channel blocking protein, whose rapid binding upon depolarization and unbinding upon repolarization minimizes fast and slow inactivation. Na channels also bind exogenous compounds, such as lidocaine, which functionally stabilize inactivation. Like the endogenous blocking protein, these use-dependent inhibitors bind most effectively at depolarized potentials, raising the question of how lidocaine-like compounds affect neurons with resurgent Na current. We therefore recorded lidocaine inhibition of voltage-clamped, tetrodotoxin-sensitive Na currents in mouse Purkinje neurons, which express a native blocking protein, and in mouse hippocampal CA3 pyramidal neurons with and without a peptide from the cytoplasmic tail of NaVβ4 (the β4 peptide), which mimics endogenous open-channel block. To control channel states during drug exposure, lidocaine was applied with rapid-solution exchange techniques during steps to specific voltages. Inhibition of Na currents by lidocaine was diminished by either the β4 peptide or the native blocking protein. In peptide-free CA3 cells, prolonging channel opening with a site-3 toxin, anemone toxin II, reduced lidocaine inhibition; this effect was largely occluded by open-channel blockers, suggesting that lidocaine binding is favored by inactivation but prevented by open-channel block. In constant 100 μM lidocaine, current-clamped Purkinje cells continued to fire spontaneously. Similarly, the β4 peptide reduced lidocaine-dependent suppression of spiking in CA3 neurons in slices. Thus, the open-channel blocking protein responsible for resurgent current acts as a natural antagonist of lidocaine. Neurons with resurgent current may therefore be less susceptible to use-dependent Na channel inhibitors used as local anesthetic, antiarrhythmic, and anticonvulsant drugs. PMID:23486968

The ladder-shaped polyether toxin gambierol anchors the gating machinery of Kv3.1 channels in the resting state

PubMed Central

Kopljar, Ivan; Labro, Alain J.; de Block, Tessa; Rainier, Jon D.; Tytgat, Jan

2013-01-01

Voltage-gated potassium (Kv) and sodium (Nav) channels are key determinants of cellular excitability and serve as targets of neurotoxins. Most marine ciguatoxins potentiate Nav channels and cause ciguatera seafood poisoning. Several ciguatoxins have also been shown to affect Kv channels, and we showed previously that the ladder-shaped polyether toxin gambierol is a potent Kv channel inhibitor. Most likely, gambierol acts via a lipid-exposed binding site, located outside the K+ permeation pathway. However, the mechanism by which gambierol inhibits Kv channels remained unknown. Using gating and ionic current analysis to investigate how gambierol affected S6 gate opening and voltage-sensing domain (VSD) movements, we show that the resting (closed) channel conformation forms the high-affinity state for gambierol. The voltage dependence of activation was shifted by >120 mV in the depolarizing direction, precluding channel opening in the physiological voltage range. The (early) transitions between the resting and the open state were monitored with gating currents, and provided evidence that strong depolarizations allowed VSD movement up to the activated-not-open state. However, for transition to the fully open (ion-conducting) state, the toxin first needed to dissociate. These dissociation kinetics were markedly accelerated in the activated-not-open state, presumably because this state displayed a much lower affinity for gambierol. A tetrameric concatemer with only one high-affinity binding site still displayed high toxin sensitivity, suggesting that interaction with a single binding site prevented the concerted step required for channel opening. We propose a mechanism whereby gambierol anchors the channel’s gating machinery in the resting state, requiring more work from the VSD to open the channel. This mechanism is quite different from the action of classical gating modifier peptides (e.g., hanatoxin). Therefore, polyether toxins open new opportunities in structure–function relationship studies in Kv channels and in drug design to modulate channel function. PMID:23401573

Update on the mechanism of action of antiepileptic drugs.

PubMed

Meldrum, B S

1996-01-01

Novel antiepileptic drugs (AEDs) are thought to act on voltage-sensitive ion channels, on inhibitory neurotransmission or on excitatory neurotransmission. Two successful examples of rational AED design that potentiate GABA-mediated inhibition are vigabatrin (VGB) by irreversible inhibition of GABA-transaminase, and tiagabine (TGB) by blocking GABA uptake. Lamotrigine (LTG) prolongs inactivation of voltage-dependent sodium channels. The anticonvulsant action of remacemide (RCM) is probably largely due to blockade of NMDA receptors and prolonged inactivation of sodium channels induced by its desglycinated metabolite. Felbamate (FBM) apparently blocks NMDA receptors, potentiates GABA-mediated responses, blocks L-type calcium channels, and possibly also prolongs sodium channel inactivation. Similarly, topiramate (TPM) has multiple probable sites of action, including sodium channels, GABA receptors, and glutamate (AMPA) receptors. Gabapentin (GBP) apparently has a completely novel type of action, probably involving potentiation of GABA-mediated inhibition and possibly also inactivation of sodium channels. The therapeutic advantages of the novel AEDs are as yet only partially explained by our present understanding of their mechanisms of action.

Comparative radiation resistance, temperature dependence and performance of diffused junction indium phosphide solar cells

NASA Technical Reports Server (NTRS)

Weinberg, I.; Swartz, C. K.; Hart, R. E., Jr.; Ghandhi, S. K.; Borrego, J. M.

1987-01-01

Indium phosphide solar cells whose p-n junctions were processed by the open tube capped diffusion and by the closed tube uncapped diffusion of sulfur into Czochralski-grown p-type substrates are compared. Differences found in radiation resistance were attributed to the effects of increased base dopant concentration. Both sets of cells showed superior radiation resistance to that of gallium arsenide cells, in agreement with previous results. No correlation was, however, found between the open-circuit voltage and the temperature dependence of the maximum power.

The polar T1 interface is linked to conformational changes that open the voltage-gated potassium channel.

PubMed

Minor, D L; Lin, Y F; Mobley, B C; Avelar, A; Jan, Y N; Jan, L Y; Berger, J M

2000-09-01

Kv voltage-gated potassium channels share a cytoplasmic assembly domain, T1. Recent mutagenesis of two T1 C-terminal loop residues implicates T1 in channel gating. However, structural alterations of these mutants leave open the question concerning direct involvement of T1 in gating. We find in mammalian Kv1.2 that gating depends critically on residues at complementary T1 surfaces in an unusually polar interface. An isosteric mutation in this interface causes surprisingly little structural alteration while stabilizing the closed channel and increasing the stability of T1 tetramers. Replacing T1 with a tetrameric coiled-coil destabilizes the closed channel. Together, these data suggest that structural changes involving the buried polar T1 surfaces play a key role in the conformational changes leading to channel opening.

Process Research On Polycrystalline Silicon Material (PROPSM). [flat plate solar array project

NASA Technical Reports Server (NTRS)

Culik, J. S.

1983-01-01

The performance-limiting mechanisms in large-grain (greater than 1 to 2 mm in diameter) polycrystalline silicon solar cells were investigated by fabricating a matrix of 4 sq cm solar cells of various thickness from 10 cm x 10 cm polycrystalline silicon wafers of several bulk resistivities. Analysis of the illuminated I-V characteristics of these cells suggests that bulk recombination is the dominant factor limiting the short-circuit current. The average open-circuit voltage of the polycrystalline solar cells is 30 to 70 mV lower than that of co-processed single-crystal cells; the fill-factor is comparable. Both open-circuit voltage and fill-factor of the polycrystalline cells have substantial scatter that is not related to either thickness or resistivity. This implies that these characteristics are sensitive to an additional mechanism that is probably spatial in nature. A damage-gettering heat-treatment improved the minority-carrier diffusion length in low lifetime polycrystalline silicon, however, extended high temperature heat-treatment degraded the lifetime.

Stabilization of the Activated hERG Channel Voltage Sensor by Depolarization Involves the S4-S5 Linker.

PubMed

Thouta, Samrat; Hull, Christina M; Shi, Yu Patrick; Sergeev, Valentine; Young, James; Cheng, Yen M; Claydon, Thomas W

2017-01-24

Slow deactivation of hERG channels is critical for preventing cardiac arrhythmia yet the mechanistic basis for the slow gating transition is unclear. Here, we characterized the temporal sequence of events leading to voltage sensor stabilization upon membrane depolarization. Progressive increase in step depolarization duration slowed voltage-sensor return in a biphasic manner (τ fast = 34 ms, τ slow  = 2.5 s). The faster phase of voltage-sensor return slowing correlated with the kinetics of pore opening. The slower component occurred over durations that exceeded channel activation and was consistent with voltage sensor relaxation. The S4-S5 linker mutation, G546L, impeded the faster phase of voltage sensor stabilization without attenuating the slower phase, suggesting that the S4-S5 linker is important for communications between the pore gate and the voltage sensor during deactivation. These data also demonstrate that the mechanisms of pore gate-opening-induced and relaxation-induced voltage-sensor stabilization are separable. Deletion of the distal N-terminus (Δ2-135) accelerated off-gating current, but did not influence the relative contribution of either mechanism of stabilization of the voltage sensor. Lastly, we characterized mode-shift behavior in hERG channels, which results from stabilization of activated channel states. The apparent mode-shift depended greatly on recording conditions. By measuring slow activation and deactivation at steady state we found the "true" mode-shift to be ∼15 mV. Interestingly, the "true" mode-shift of gating currents was ∼40 mV, much greater than that of the pore gate. This demonstrates that voltage sensor return is less energetically favorable upon repolarization than pore gate closure. We interpret this to indicate that stabilization of the activated voltage sensor limits the return of hERG channels to rest. The data suggest that this stabilization occurs as a result of reconfiguration of the pore gate upon opening by a mechanism that is influenced by the S4-S5 linker, and by a separable voltage-sensor intrinsic relaxation mechanism. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

S3b amino acid residues do not shuttle across the bilayer in voltage-dependent Shaker K+ channels

PubMed Central

Gonzalez, Carlos; Morera, Francisco J.; Rosenmann, Eduardo; Alvarez, Osvaldo; Latorre, Ramon

2005-01-01

In voltage-dependent channels, positive charges contained within the S4 domain are the voltage-sensing elements. The “voltage-sensor paddle” gating mechanism proposed for the KvAP K+ channel has been the subject of intense discussion regarding its general applicability to the family of voltage-gated channels. In this model, the voltage sensor composed of the S3b and the S4 segment shuttles across the lipid bilayer during channel activation. Guided by this mechanism, we assessed here the accessibility of residues in the S3 segment of the Shaker K+ channel by using cysteine-scanning mutagenesis. Mutants expressed robust K+ currents in Xenopus oocytes and reacted with methanethiosulfonate ethyltrimethylammonium in both closed and open conformations of the channel. Because Shaker has a long S3–S4 linker segment, we generated a deletion mutant with only three residues to emulate the KvAP structure. In this short linker mutant, all of the tested residues in the S3b were accessible to methanethiosulfonate ethyltrimethylammonium in both closed and open conformations. Because the S3b moves together with the S4 domain in the paddle model, we tested the effects of deleting two negative charges or adding a positive charge to this region of the channel. We found that altering the S3b net charge does not modify the total gating charge involved in channel activation. We conclude that the S3b segment is always exposed to the external milieu of the Shaker K+ channel. Our results are incompatible with any model involving a large membrane displacement of segment S3b. PMID:15774578

Activation by intracellular GDP, metabolic inhibition and pinacidil of a glibenclamide-sensitive K-channel in smooth muscle cells of rat mesenteric artery.

PubMed Central

Zhang, H; Bolton, T B

1995-01-01

1. Single-channel recordings were made from cell-attached and isolated patches, and whole-cell currents were recorded under voltage clamp from single smooth muscle cells obtained by enzymic digestion of a small branch of the rat mesenteric artery. 2. In single voltage-clamped cells 1 mM uridine diphosphate (UDP) or guanidine diphosphate (GDP) added to the pipette solution, or pinacidil (100 microM) a K-channel opener (KCO) applied in the bathing solution, evoked an outward current of up to 100pA which was blocked by glibenclamide (10 microM). In single cells from which recordings were made by the 'perforated patch' (nystatin pipette) technique, metabolic inhibition by 1 mM NaCN and 10 mM 2-deoxy-glucose also evoked a similar glibenclamide-sensitive current. 3. Single K-channel activity was observed in cell-attached patches only infrequently unless the metabolism of the cell was inhibited, whereupon channel activity blocked by glibenclamide was seen; pinacidil applied to the cell evoked similar glibenclamide-sensitive channel activity. If the patch was pulled off the cell to form an isolated inside-out patch, similar glibenclamide-sensitive single-channel currents were observed in the presence of UDP and/or pinacidil to those seen in cell-attached mode; channel conductance was 20 pS (60:130 K-gradient) and openings showed no voltage-dependence and noisy inward currents, typical of the nucleoside diphosphate (NDP) activated K-channel (KNDP) seen previously in rabbit portal vein. 4. Formation of an isolated inside-out patch into an ATP-free solution did not increase the probability of channel opening which declined with time even when some single-channel activity had occurred in the cell-attached mode before detachment. However, application of 1 mM UDP or GDP, but not ATP, to inside-out patches evoked single-channel activity. Application of ATP-free solution to isolated patches, previously exposed to ATP and in which channel activity had been seen, did not evoke channel activity. 5. It is concluded that small conductance K-channels (KNDP) open in smooth muscle cells from this small artery in response to UDP or GDP acting from the inside, or pinacidil acting from the outside; the same channels open during inhibition of metabolism presumably mainly due to the rise in nucleoside diphosphates, but a fall in the ATP concentration on the inside of the channel did not by itself evoke channel activity.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:7735693

Sodium cyanate-induced opening of calcium-activated potassium currents in hippocampal neuron-derived H19-7 cells.

PubMed

Huang, Chin-Wei; Huang, Chao-Ching; Huang, Mei-Han; Wu, Sheng-Nan; Hsieh, Yi-Jung

2005-03-29

We investigated the chemical toxic agent sodium cyanate (NaOCN) on the large conductance calcium-activated potassium channels (BK(Ca)) on hippocampal neuron-derived H19-7 cells. The whole-cell and cell-attach configuration of patch-clamp technique were applied to investigate the BK(Ca) currents in H19-7 cells in the presence of NaOCN (0.3 mM). NaOCN activated BK(Ca) channels on H19-7 cells. The single-channel conductance of BK(Ca) channels was 138+/-7pS. The presence of NaOCN (0.3 mM) caused an obvious increase in open probability of BK(Ca) channels. NaOCN did not exert effect on the slope of the activation curve and stimulated the activity of BK(Ca) channels in a voltage-dependent fashion in H19-7 cells. The presence of paxilline or EGTA significantly reduced the BK(Ca) amplitude, in comparison with the presence of NaOCN. These findings suggest that during NaOCN exposure, the activation of BK(Ca) channels in neurons could be one of the ionic mechanisms underlying the decreased neuronal excitability and neurological disorders.

TH-CD-207B-07: Noise Modeling of Single Photon Avalanche Diode (SPAD) for Photon Counting CT Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Z; Zheng, X; Deen, J

Purpose: Silicon photomultiplier (SiPM) has recently emerged as a promising photodetector for biomedical imaging applications. Due to its high multiplication gain (comparable to PMT), fast timing, low cost and compactness, it is considered a good candidate for photon counting CT. Dark noise is a limiting factor which impacts both energy resolution and detection dynamic range. Our goal is to develop a comprehensive model for noise sources for SiPM sensors. Methods: The physical parameters used in this work were based upon a test SPAD fabricated in 130nm CMOS process. The SPAD uses an n+/p-well junction, which is isolated from the p-substratemore » by a deep n-well junction. Inter-avalanche time measurement was used to record the time interval between two adjacent avalanche pulses. After collecting 1×106 counts, the histogram was obtained and multiple exponential fitting process was used to extract the lifetime associated with the traps within the bandgap. Results: At room temperature, the breakdown voltage of the SPAD is ∼11.4V and shows a temperature coefficient of 7.7mV/°C. The dark noise of SPAD increases with both the excess biasing voltage and temperature. The primary dark counts from the model were validated against the measurement results. A maximum relative error of 8.7% is observed at 20 °C with an excess voltage of 0.5V. The probabilities of after-pulsing are found to be dependent of both temperature and excess voltage. With 0.5V excess voltage, the after-pulsing probability is 63.5% at - 30 °C and drops to ∼6.6% at 40 °C. Conclusion: A comprehensive noise model for SPAD sensor was proposed. The model takes into account of static, dynamic and statistical behavior of SPADs. We believe that this is the first SPAD circuit simulation model that includes the band-to-band tunneling dark noise contribution and temporal dependence of the after-pulsing probability.« less

Voltage-Gated Channel Mechanosensitivity: Fact or Friction?

PubMed Central

Morris, Catherine E.

2011-01-01

The heart is a continually active pulsatile fluid pump. It generates appropriate forces by precisely timed and spaced engagement of its contractile machinery. Largely, it makes its own control signals, the most crucial of which are precisely timed and spaced fluxes of ions across the sarcolemma, achieved by the timely opening and closing of diverse voltage-gated channels (VGC). VGCs have four voltage sensors around a central ion-selective pore that opens and closes under the influence of membrane voltage. Operation of any VGC is secondarily tuned by the mechanical state (i.e., structure) of the bilayer in which it is embedded. Rates of opening and closing, in other words, vary with bilayer structure. Thus, in the intensely mechanical environment of the myocardium and its vasculature, VGCs kinetics might be routinely modulated by reversible and irreversible nano-scale changes in bilayer structure. If subtle bilayer deformations are routine in the pumping heart, VGCs could be subtly transducing bilayer mechanical signals, thereby tuning cardiac rhythmicity, collectively contributing to mechano-electric feedback. Reversible bilayer deformations would be expected with changing shear flows and tissue distension, while irreversible bilayer restructuring occurs with ischemia, inflammation, membrane remodeling, etc. I suggest that tools now available could be deployed to help probe whether/how the inherent mechanosensitivity of VGCs – an attribute substantially reflecting the dependence of voltage sensor stability on bilayer structure – contributes to cardiac rhythmicity. Chief among these tools are voltage sensor toxins (whose inhibitory efficacy varies with the mechanical state of bilayer) and arrhythmia-inducing VGC mutants with distinctive mechano-phenotypes. PMID:21660289

Design and Simulation Test of an Open D-Dot Voltage Sensor

PubMed Central

Bai, Yunjie; Wang, Jingang; Wei, Gang; Yang, Yongming

2015-01-01

Nowadays, sensor development focuses on miniaturization and non-contact measurement. According to the D-dot principle, a D-dot voltage sensor with a new structure was designed based on the differential D-dot sensor with a symmetrical structure, called an asymmetric open D-dot voltage sensor. It is easier to install. The electric field distribution of the sensor was analyzed through Ansoft Maxwell and an open D-dot voltage sensor was designed. This open D-voltage sensor is characteristic of accessible insulating strength and small electric field distortion. The steady and transient performance test under 10 kV-voltage reported satisfying performances of the designed open D-dot voltage sensor. It conforms to requirements for a smart grid measuring sensor in intelligence, miniaturization and facilitation. PMID:26393590

Electromechanical properties of biomembranes and nerves

NASA Astrophysics Data System (ADS)

Heimburg, T.; Blicher, A.; Mosgaard, L. D.; Zecchi, K.

2014-12-01

Lipid membranes are insulators and capacitors, which can be charged by an external electric field. This phenomenon plays an important role in the field of electrophysiology, for instance when describing nerve pulse conduction. Membranes are also made of polar molecules meaning that they contain molecules with permanent electrical dipole moments. Therefore, the properties of membranes are subject to changes in trans-membrane voltage. Vice versa, mechanical forces on membranes lead to changes in the membrane potential. Associated effects are flexoelectricity, piezoelectricity, and electrostriction. Lipid membranes can melt from an ordered to a disordered state. Due to the change of membrane dimensions associated with lipid membrane melting, electrical properties are linked to the melting transition. Melting of the membrane can induce changes in trans-membrane potential, and application of voltage can lead to a shift of the melting transition. Further, close to transitions membranes are very susceptible to piezoelectric phenomena. We discuss these phenomena in relation with the occurrence of lipid ion channels. Close to melting transitions, lipid membranes display step-wise ion conduction events, which are indistinguishable from protein ion channels. These channels display a voltage-dependent open probability. One finds asymmetric current-voltage relations of the pure membrane very similar to those found for various protein channels. This asymmetry falsely has been considered a criterion to distinguish lipid channels from protein channels. However, we show that the asymmetry can arise from the electromechanical properties of the lipid membrane itself. Finally, we discuss electromechanical behavior in connection with the electromechanical theory of nerve pulse transduction. It has been found experimentally that nerve pulses are related to changes in nerve thickness. Thus, during the nerve pulse a solitary mechanical pulse travels along the nerve. Due to electromechanical coupling it is unavoidable that this pulse generates a trans-membrane voltage. In the past, we have proposed that this electromechanical pulse is the origin of the action potential in nerves.

Mechanism of block by tedisamil of transient outward current in human ventricular subepicardial myocytes

PubMed Central

Wettwer, Erich; Himmel, Herbert M; Amos, Gregory J; Li, Qi; Metzger, Franz; Ravens, Ursula

1998-01-01

Tedisamil is a new antiarrhythmic drug with predominant class III action. The aim of the present study was to investigate the blocking pattern of the compound on the transient outward current (Ito) in human subepicardial myocytes isolated from explanted left ventricles. Using the single electrode whole cell voltage clamp technique, Ito was analysed after appropriate voltage inactivation of sodium current and block of calcium current.Tedisamil reduced the amplitude of peak Ito, but did not affect the amplitude of non-inactivating outward current. The drug accelerated the apparent rate of Ito inactivation. The reduction in time constant of Ito inactivation depended on drug concentration, the apparent IC50 value was 4.4 μM.Tedisamil affected Ito amplitude in a use-dependent manner. After 2 min at −80 mV, maximum block of Ito was reached after 4–5 clamp steps either at the frequency of 0.2 or 2 Hz, indicating that the block was not frequency-dependent in an experimentally relevant range. Recovery from block was very slow and proceeded with a time constant of 12.1±1.8 s. Also in the presence of drug, a fraction of channels recovered from inactivation with a similar time constant as in control myocytes (i.e. 81±40 ms and 51±8 ms, respectively, n.s.).From the onset of fractional block of Ito by tedisamil during the initial 60 ms of a clamp step, we calculated k1=9×106 mol−1 s−1 for the association rate constant, and k2=23 s−1 for the dissociation rate constant. The resulting apparent KD was 2.6 μM and is similar to the IC50 value.The effects of tedisamil on Ito could be simulated by assuming a four state channel model where the drug binds to the channel in an open (activated) conformation. It is concluded that in human subepicardial myocytes tedisamil is an open channel blocker of Ito and that this effect probably contributes to the antiarrhythmic potential of this drug. PMID:9831899

New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

PubMed

Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

2004-10-01

We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

The Everett-Wheeler interpretation and the open future

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sudbery, Anthony

2011-03-28

I discuss the meaning of probability in the Everett-Wheeler interpretation of quantum mechanics, together with the problem of defining histories. To resolve these, I propose an understanding of probability arising from a form of temporal logic: the probability of a future-tense proposition is identified with its truth value in a many-valued and context-dependent logic. In short, probability is degree of truth. These ideas relate to traditional naive ideas of time and chance. Indeed, I argue that Everettian quantum mechanics is the only form of scientific theory that truly incorporates the perception that the future is open.

Insulin activates single amiloride-blockable Na channels in a distal nephron cell line (A6).

PubMed

Marunaka, Y; Hagiwara, N; Tohda, H

1992-09-01

Using the patch-clamp technique, we studied the effect of insulin on an amiloride-blockable Na channel in the apical membrane of a distal nephron cell line (A6) cultured on permeable collagen films for 10-14 days. NPo (N, number of channels per patch membrane; Po, average value of open probability of individual channels in the patch) under baseline conditions was 0.88 +/- 0.12 (SE)(n = 17). After making cell-attached patches on the apical membrane which contained Na channels, insulin (1 mU/ml) was applied to the serosal bath. While maintaining the cell-attached patch, NPo significantly increased to 1.48 +/- 0.19 (n = 17; P less than 0.001) after 5-10 min of insulin application. The open probability of Na channels was 0.39 +/- 0.01 (n = 38) under baseline condition, and increased to 0.66 +/- 0.03 (n = 38, P less than 0.001) after addition of insulin. The baseline single-channel conductance was 4pS, and neither the single-channel conductance nor the current-voltage relationship was significantly changed by insulin. These results indicate that insulin increases Na absorption in the distal nephron by increasing the open probability of the amiloride-blockable Na channel.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bean, Bruce Palmer

The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in themore » hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.« less

Application of the superposition principle to solar-cell analysis

NASA Technical Reports Server (NTRS)

Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.

1979-01-01

The superposition principle of differential-equation theory - which applies if and only if the relevant boundary-value problems are linear - is used to derive the widely used shifting approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. Analytical methods are presented to treat cases where shifting is not strictly valid. Well-defined conditions necessary for superposition to apply are established. For high injection in the base region, the method of analysis accurately yields the dependence of the open-circuit voltage on the short-circuit current (or the illumination level).

Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation

PubMed Central

Findeisen, Felix

2010-01-01

Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts. PMID:21139419

M-currents and other potassium currents in bullfrog sympathetic neurones

PubMed Central

Adams, P. R.; Brown, D. A.; Constanti, A.

1982-01-01

1. Bullfrog lumbar sympathetic neurones were voltage-clamped in vitro through twin micro-electrodes. Four different outward (K+) currents could be identified: (i) a large sustained voltage-sensitive delayed rectifier current (IK) activated at membrane potentials more positive than -25 mV; (ii) a calcium-dependent sustained outward current (IC) activated at similar positive potentials and peaking at +20 to +60 mV; (iii) a transient current (IA) activated at membrane potentials more positive than -60 mV after a hyperpolarizing pre-pulse, but which was rapidly and totally inactivated at all potentials within its activation range; and (iv) a new K+ current, the M-current (IM). 2. IM was detected as a non-inactivating current with a threshold at -60 mV. The underlying conductance GM showed a sigmoidal activation curve between -60 and -10 mV, with half-activation at -35 mV and a maximal value (ḠM) of 84±14 (S.E.M.) nS per neurone. The voltage sensitivity of GM could be expressed in terms of a simple Boltzmann distribution for a single multivalent gating particle. 3. IM activated and de-activated along an exponential time course with a time constant uniquely dependent upon voltage, maximizing at ≃ 150 ms at -35 mV at 22 °C. 4. Instantaneous current—voltage (I/V) curves were approximately linear in the presence of IM, suggesting that the M-channels do not show appreciable rectification. However, the time- and voltage-dependent opening of the M-channels induced considerable rectification in the steady-state I/V curves recorded under both voltage-clamp and current-clamp modes between -60 and -25 mV. Both time- and voltage-dependent rectification in the voltage responses to current injection over this range could be predicted from the kinetic properties of IM. 5. It is suggested that IM exerts a strong potential-clamping effect on the behaviour of these neurones at membrane potentials subthreshold to excitation. PMID:6294290

Fabrication of Double Layered Hybrid Solar Cells Consisting of Low-Temperature Anatase Titanium Oxide and Conducting Polymer

NASA Astrophysics Data System (ADS)

Itoh, Eiji; Takamizawa, Yuta; Miyairi, Keiichi

2008-01-01

We have prepared a photovoltaic device consisting of poly[2-methoxy,5-(2'-ethyl-hexyloxy)-p-phenylenevinylene] (MEHPPV) and an n-type crystalline TiO2 (anatase) thin film by high-temperature process and low-temperature process at a temperature lower than 150 °C by sol-gel techniques. The refluxed sol of titanium-tetraisopropoxide (TTI) with water and nitric acid formed anatase phase TiO2 without requiring the high-temperature process, and the wettability of sol is successfully improved by diluting sol with ethanol. The short circuit current JSC, fill factor, and the power conversion efficiency increase with the heat-treatment temperature of TiO2, which is attributed to the improvement of series resistance of the TiO2 film. On the other hand, the open circuit voltage remains almost constant (ca. 1.0 V) with the change in heat-treatment temperature between 60 and 120 °C, whereas it decreases to 0.76 V in the device prepared on the TiO2 film sintered at 500 °C, probably owing to the change in crystallinity. The origin of open circuit voltage in indium tin oxide (ITO)/TiO2/MEHPPV/Au is also discussed. The open circuit voltage corresponds well to the energy difference of the conduction band edge of TiO2 and the highest occupied molecular orbital (HOMO) of MEHPPV (ca. 1 eV) in the device consisting of the ITO/low-temperature TiO2/MEHPPV/Au system.

Modeling and measurement of vesicle pools at the cone ribbon synapse: changes in release probability are solely responsible for voltage-dependent changes in release

PubMed Central

Thoreson, Wallace B.; Van Hook, Matthew J.; Parmelee, Caitlyn; Curto, Carina

2015-01-01

Post-synaptic responses are a product of quantal amplitude (Q), size of the releasable vesicle pool (N), and release probability (P). Voltage-dependent changes in presynaptic Ca2+ entry alter post-synaptic responses primarily by changing P but have also been shown to influence N. With simultaneous whole cell recordings from cone photoreceptors and horizontal cells in tiger salamander retinal slices, we measured N and P at cone ribbon synapses by using a train of depolarizing pulses to stimulate release and deplete the pool. We developed an analytical model that calculates the total pool size contributing to release under different stimulus conditions by taking into account the prior history of release and empirically-determined properties of replenishment. The model provided a formula that calculates vesicle pool size from measurements of the initial post-synaptic response and limiting rate of release evoked by a train of pulses, the fraction of release sites available for replenishment, and the time constant for replenishment. Results of the model showed that weak and strong depolarizing stimuli evoked release with differing probabilities but the same size vesicle pool. Enhancing intraterminal Ca2+ spread by lowering Ca2+ buffering or applying BayK8644 did not increase PSCs evoked with strong test steps showing there is a fixed upper limit to pool size. Together, these results suggest that light-evoked changes in cone membrane potential alter synaptic release solely by changing release probability. PMID:26541100

Method of determining the open circuit voltage of a battery in a closed circuit

DOEpatents

Brown, William E.

1980-01-01

The open circuit voltage of a battery which is connected in a closed circuit is determined without breaking the circuit or causing voltage upsets therein. The closed circuit voltage across the battery and the current flowing through it are determined under normal load and then a fractional change is made in the load and the new current and voltage values determined. The open circuit voltage is then calculated, according to known principles, from the two sets of values.

New quantum oscillations in current driven small junctions

NASA Technical Reports Server (NTRS)

Ben-Jacob, E.; Gefen, Y.

1985-01-01

The response of current-biased Josephson and normal tunnel junctions (JJs and NTJs) such as those fabricated by Voss and Webb (1981) is predicted from a quantum-mechanical description based on the observation that the response of a current-driven open system is equivalent to that of a closed system subject to an external time-dependent voltage bias. Phenomena expected include voltage oscillations with no dc voltage applied, inverse Shapiro steps of dc voltage in the presence of microwave radiation, voltage oscillation in a JJ and an NTJ coupled by a capacitance to a current-biased junction, JJ voltage oscillation frequency = I/e rather than I/2e, and different NTJ resistance than in the voltage-driven case. The effects require approximate experimental parameter values Ic = 15 nA, C = 1 fF, and T much less than 0.4 K for JJs and Ic = a few nA, C = 1 fF, and R = 3 kiloohms for 100-microV inverse Shapiro steps at 10 GHz in NTJs.

A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du Yuzhe; Song Weizhong; Groome, James R.

2010-08-15

Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action ofmore » pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.« less

Dynamical characterization of inactivation path in voltage-gated Na+ ion channel by non-equilibrium response spectroscopy

PubMed Central

Pal, Krishnendu; Gangopadhyay, Gautam

2016-01-01

ABSTRACT Inactivation path of voltage gated sodium channel has been studied here under various voltage protocols as it is the main governing factor for the periodic occurrence and shape of the action potential. These voltage protocols actually serve as non-equilibrium response spectroscopic tools to study the ion channel in non-equilibrium environment. In contrast to a lot of effort in finding the crystal structure based molecular mechanism of closed-state(CSI) and open-state inactivation(OSI); here our approach is to understand the dynamical characterization of inactivation. The kinetic flux as well as energetic contribution of the closed and open- state inactivation path is compared here for voltage protocols, namely constant, pulsed and oscillating. The non-equilibrium thermodynamic quantities used in response to these voltage protocols serve as improved characterization tools for theoretical understanding which not only agrees with the previously known kinetic measurements but also predict the energetically optimum processes to sustain the auto-regulatory mechanism of action potential and the consequent inactivation steps needed. The time dependent voltage pattern governs the population of the conformational states which when couple with characteristic rate parameters, the CSI and OSI selectivity arise dynamically to control the inactivation path. Using constant, pulsed and continuous oscillating voltage protocols we have shown that during depolarization the OSI path is more favored path of inactivation however, in the hyper-polarized situation the CSI is favored. It is also shown that the re-factorisation of inactivated sodium channel to resting state occurs via CSI path. Here we have shown how the subtle energetic and entropic cost due to the change in the depolarization magnitude determines the optimum path of inactivation. It is shown that an efficient CSI and OSI dynamical profile in principle can characterize the open-state drug blocking phenomena. PMID:27367642

Correlation between tunability and anisotropy in magnetoelectric voltage tunable inductor (VTI).

PubMed

Yan, Yongke; Geng, Liwei D; Zhang, Lujie; Gao, Xiangyu; Gollapudi, Sreenivasulu; Song, Hyun-Cheol; Dong, Shuxiang; Sanghadasa, Mohan; Ngo, Khai; Wang, Yu U; Priya, Shashank

2017-11-22

Electric field modulation of magnetic properties via magnetoelectric coupling in composite materials is of fundamental and technological importance for realizing tunable energy efficient electronics. Here we provide foundational analysis on magnetoelectric voltage tunable inductor (VTI) that exhibits extremely large inductance tunability of up to 1150% under moderate electric fields. This field dependence of inductance arises from the change of permeability, which correlates with the stress dependence of magnetic anisotropy. Through combination of analytical models that were validated by experimental results, comprehensive understanding of various anisotropies on the tunability of VTI is provided. Results indicate that inclusion of magnetic materials with low magnetocrystalline anisotropy is one of the most effective ways to achieve high VTI tunability. This study opens pathway towards design of tunable circuit components that exhibit field-dependent electronic behavior.

Crystal Structure of a Mammalian Voltage-Dependent Shaker Family K+ Channel

NASA Astrophysics Data System (ADS)

Long, Stephen B.; Campbell, Ernest B.; MacKinnon, Roderick

2005-08-01

Voltage-dependent potassium ion (K+) channels (Kv channels) conduct K+ ions across the cell membrane in response to changes in the membrane voltage, thereby regulating neuronal excitability by modulating the shape and frequency of action potentials. Here we report the crystal structure, at a resolution of 2.9 angstroms, of a mammalian Kv channel, Kv1.2, which is a member of the Shaker K+ channel family. This structure is in complex with an oxido-reductase β subunit of the kind that can regulate mammalian Kv channels in their native cell environment. The activation gate of the pore is open. Large side portals communicate between the pore and the cytoplasm. Electrostatic properties of the side portals and positions of the T1 domain and β subunit are consistent with electrophysiological studies of inactivation gating and with the possibility of K+ channel regulation by the β subunit.

Escitalopram block of hERG potassium channels.

PubMed

Chae, Yun Ju; Jeon, Ji Hyun; Lee, Hong Joon; Kim, In-Beom; Choi, Jin-Sung; Sung, Ki-Wug; Hahn, Sang June

2014-01-01

Escitalopram, a selective serotonin reuptake inhibitor, is the pharmacologically active S-enantiomer of the racemic mixture of RS-citalopram and is widely used in the treatment of depression. The effects of escitalopram and citalopram on the human ether-a-go-go-related gene (hERG) channels expressed in human embryonic kidney cells were investigated using voltage-clamp and Western blot analyses. Both drugs blocked hERG currents in a concentration-dependent manner with an IC50 value of 2.6 μM for escitalopram and an IC50 value of 3.2 μM for citalopram. The blocking of hERG by escitalopram was voltage-dependent, with a steep increase across the voltage range of channel activation. However, voltage independence was observed over the full range of activation. The blocking by escitalopram was frequency dependent. A rapid application of escitalopram induced a rapid and reversible blocking of the tail current of hERG. The extent of the blocking by escitalopram during the depolarizing pulse was less than that during the repolarizing pulse, suggesting that escitalopram has a high affinity for the open state of the hERG channel, with a relatively lower affinity for the inactivated state. Both escitalopram and citalopram produced a reduction of hERG channel protein trafficking to the plasma membrane but did not affect the short-term internalization of the hERG channel. These results suggest that escitalopram blocked hERG currents at a supratherapeutic concentration and that it did so by preferentially binding to both the open and the inactivated states of the channels and by inhibiting the trafficking of hERG channel protein to the plasma membrane.

Geiger mode avalanche photodiodes for microarray systems

NASA Astrophysics Data System (ADS)

Phelan, Don; Jackson, Carl; Redfern, R. Michael; Morrison, Alan P.; Mathewson, Alan

2002-06-01

New Geiger Mode Avalanche Photodiodes (GM-APD) have been designed and characterized specifically for use in microarray systems. Critical parameters such as excess reverse bias voltage, hold-off time and optimum operating temperature have been experimentally determined for these photon-counting devices. The photon detection probability, dark count rate and afterpulsing probability have been measured under different operating conditions. An active- quench circuit (AQC) is presented for operating these GM- APDs. This circuit is relatively simple, robust and has such benefits as reducing average power dissipation and afterpulsing. Arrays of these GM-APDs have already been designed and together with AQCs open up the possibility of having a solid-state microarray detector that enables parallel analysis on a single chip. Another advantage of these GM-APDs over current technology is their low voltage CMOS compatibility which could allow for the fabrication of an AQC on the same device. Small are detectors have already been employed in the time-resolved detection of fluorescence from labeled proteins. It is envisaged that operating these new GM-APDs with this active-quench circuit will have numerous applications for the detection of fluorescence in microarray systems.

High voltage pulse ignition of mercury discharge hollow cathodes

NASA Technical Reports Server (NTRS)

Wintucky, E. G.

1973-01-01

A high voltage pulse generated by a capacitor discharge into a step-up transformer has been demonstrated capable of consistently igniting hollow cathode mercury discharges at propellant flows and heater power levels much below those required by conventional cathode starting. Results are presented for 3.2-mm diameter enclosed and open keeper cathodes. Starting characteristics are shown to depend on keeper voltage, mercury flow rate, heater power, keeper orifice size, emissive materials, and electrode to which the pulse is applied. This starting technique has been used to start a cathode over 10,000 times without any degradation of starting capability. The starting reliability, propellant and power savings offered by the high voltage pulse start should favorably impact performance of electron bombardment thrusters in missions requiring many on-off duty cycles.

Thickness dependence of the MoO3 blocking layers on ZnO nanorod-inverted organic photovoltaic devices

PubMed Central

Wang, Mingjun; Li, Yuan; Huang, Huihui; Peterson, Eric D.; Nie, Wanyi; Zhou, Wei; Zeng, Wei; Huang, Wenxiao; Fang, Guojia; Sun, Nanhai; Zhao, Xingzhong; Carroll, David L.

2011-01-01

Organic solar cells based on vertically aligned zinc oxide nanorod arrays (ZNR) in an inverted structure of indium tin oxide (ITO)∕ZNR∕poly(3-hexylthiophene): (6,6)-phenyl C61 butyric acid methyl ester(P3HT:PCBM)∕MoO3∕aluminum(Al) were studied. We found that the optimum MoO3 layer thickness condition of 20 nm, the MoO3 can effectively decrease the probability of bimolecular recombination either at the Al interface or within the active layer itself. For this optimum condition we get a power conversion efficiency of 2.15%, a short-circuit current density of 9.02 mA∕cm2, an open-circuit voltage of 0.55V, and a fill factor of 0.44 under 100 mW∕cm2 irradiation. Our investigations also show that the highly crystallized ZNR can create short and continuous pathways for electron transport and increase the contact area between the ZNR and the organic materials. PMID:21464889

Simulation Study on Understanding the Spin Transport in MgO Adsorbed Graphene Based Magnetic Tunnel Junction

NASA Astrophysics Data System (ADS)

Raturi, Ashish; Choudhary, Sudhanshu

2016-11-01

First principles calculations of spin-dependent electronic transport properties of magnetic tunnel junction (MTJ) consisting of MgO adsorbed graphene nanosheet sandwiched between two CrO2 half-metallic ferromagnetic (HMF) electrodes is reported. MgO adsorption on graphene opens bandgap in graphene nanosheet which makes it more suitable for use as a tunnel barrier in MTJs. It was found that MgO adsorption suppresses transmission probabilities for spin-down channel in case of parallel configuration (PC) and also suppresses transmission in antiparallel configuration (APC) for both spin-up and spin-down channel. Tunnel magneto-resistance (TMR) of 100% is obtained at all bias voltages in MgO adsorbed graphene-based MTJ which is higher than that reported in pristine graphene-based MTJ. HMF electrodes were found suitable to achieve perfect spin filtration effect and high TMR. I-V characteristics for both parallel and antiparallel magnetization states of junction are calculated. High TMR suggests its usefulness in spin valves and other spintronics-based applications.

Functional properties of a newly identified C-terminal splice variant of Cav1.3 L-type Ca2+ channels.

PubMed

Bock, Gabriella; Gebhart, Mathias; Scharinger, Anja; Jangsangthong, Wanchana; Busquet, Perrine; Poggiani, Chiara; Sartori, Simone; Mangoni, Matteo E; Sinnegger-Brauns, Martina J; Herzig, Stefan; Striessnig, Jörg; Koschak, Alexandra

2011-12-09

An intramolecular interaction between a distal (DCRD) and a proximal regulatory domain (PCRD) within the C terminus of long Ca(v)1.3 L-type Ca(2+) channels (Ca(v)1.3(L)) is a major determinant of their voltage- and Ca(2+)-dependent gating kinetics. Removal of these regulatory domains by alternative splicing generates Ca(v)1.3(42A) channels that activate at a more negative voltage range and exhibit more pronounced Ca(2+)-dependent inactivation. Here we describe the discovery of a novel short splice variant (Ca(v)1.3(43S)) that is expressed at high levels in the brain but not in the heart. It lacks the DCRD but, in contrast to Ca(v)1.3(42A), still contains PCRD. When expressed together with α2δ1 and β3 subunits in tsA-201 cells, Ca(v)1.3(43S) also activated at more negative voltages like Ca(v)1.3(42A) but Ca(2+)-dependent inactivation was less pronounced. Single channel recordings revealed much higher channel open probabilities for both short splice variants as compared with Ca(v)1.3(L). The presence of the proximal C terminus in Ca(v)1.3(43S) channels preserved their modulation by distal C terminus-containing Ca(v)1.3- and Ca(v)1.2-derived C-terminal peptides. Removal of the C-terminal modulation by alternative splicing also induced a faster decay of Ca(2+) influx during electrical activities mimicking trains of neuronal action potentials. Our findings extend the spectrum of functionally diverse Ca(v)1.3 L-type channels produced by tissue-specific alternative splicing. This diversity may help to fine tune Ca(2+) channel signaling and, in the case of short variants lacking a functional C-terminal modulation, prevent excessive Ca(2+) accumulation during burst firing in neurons. This may be especially important in neurons that are affected by Ca(2+)-induced neurodegenerative processes.

Single-nanowire, low-bandgap hot carrier solar cells with tunable open-circuit voltage

NASA Astrophysics Data System (ADS)

Limpert, Steven; Burke, Adam; Chen, I.-Ju; Anttu, Nicklas; Lehmann, Sebastian; Fahlvik, Sofia; Bremner, Stephen; Conibeer, Gavin; Thelander, Claes; Pistol, Mats-Erik; Linke, Heiner

2017-10-01

Compared to traditional pn-junction photovoltaics, hot carrier solar cells offer potentially higher efficiency by extracting work from the kinetic energy of photogenerated ‘hot carriers’ before they cool to the lattice temperature. Hot carrier solar cells have been demonstrated in high-bandgap ferroelectric insulators and GaAs/AlGaAs heterostructures, but so far not in low-bandgap materials, where the potential efficiency gain is highest. Recently, a high open-circuit voltage was demonstrated in an illuminated wurtzite InAs nanowire with a low bandgap of 0.39 eV, and was interpreted in terms of a photothermoelectric effect. Here, we point out that this device is a hot carrier solar cell and discuss its performance in those terms. In the demonstrated devices, InP heterostructures are used as energy filters in order to thermoelectrically harvest the energy of hot electrons photogenerated in InAs absorber segments. The obtained photovoltage depends on the heterostructure design of the energy filter and is therefore tunable. By using a high-resistance, thermionic barrier, an open-circuit voltage is obtained that is in excess of the Shockley-Queisser limit. These results provide generalizable insight into how to realize high voltage hot carrier solar cells in low-bandgap materials, and therefore are a step towards the demonstration of higher efficiency hot carrier solar cells.

Real-Time Nanoscale Open-Circuit Voltage Dynamics of Perovskite Solar Cells.

PubMed

Garrett, Joseph L; Tennyson, Elizabeth M; Hu, Miao; Huang, Jinsong; Munday, Jeremy N; Leite, Marina S

2017-04-12

Hybrid organic-inorganic perovskites based on methylammonium lead (MAPbI 3 ) are an emerging material with great potential for high-performance and low-cost photovoltaics. However, for perovskites to become a competitive and reliable solar cell technology their instability and spatial variation must be understood and controlled. While the macroscopic characterization of the devices as a function of time is very informative, a nanoscale identification of their real-time local optoelectronic response is still missing. Here, we implement a four-dimensional imaging method through illuminated heterodyne Kelvin probe force microscopy to spatially (<50 nm) and temporally (16 s/scan) resolve the voltage of perovskite solar cells in a low relative humidity environment. Local open-circuit voltage (V oc ) images show nanoscale sites with voltage variation >300 mV under 1-sun illumination. Surprisingly, regions of voltage that relax in seconds and after several minutes consistently coexist. Time-dependent changes of the local V oc are likely due to intragrain ion migration and are reversible at low injection level. These results show for the first time the real-time transient behavior of the V oc in perovskite solar cells at the nanoscale. Understanding and controlling the light-induced electrical changes that affect device performance are critical to the further development of stable perovskite-based solar technologies.

Redefining the Speed Limit of Phase Change Memory Revealed by Time-resolved Steep Threshold-Switching Dynamics of AgInSbTe Devices

NASA Astrophysics Data System (ADS)

Shukla, Krishna Dayal; Saxena, Nishant; Durai, Suresh; Manivannan, Anbarasu

2016-11-01

Although phase-change memory (PCM) offers promising features for a ‘universal memory’ owing to high-speed and non-volatility, achieving fast electrical switching remains a key challenge. In this work, a correlation between the rate of applied voltage and the dynamics of threshold-switching is investigated at picosecond-timescale. A distinct characteristic feature of enabling a rapid threshold-switching at a critical voltage known as the threshold voltage as validated by an instantaneous response of steep current rise from an amorphous off to on state is achieved within 250 picoseconds and this is followed by a slower current rise leading to crystallization. Also, we demonstrate that the extraordinary nature of threshold-switching dynamics in AgInSbTe cells is independent to the rate of applied voltage unlike other chalcogenide-based phase change materials exhibiting the voltage dependent transient switching characteristics. Furthermore, numerical solutions of time-dependent conduction process validate the experimental results, which reveal the electronic nature of threshold-switching. These findings of steep threshold-switching of ‘sub-50 ps delay time’, opens up a new way for achieving high-speed non-volatile memory for mainstream computing.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

NASA Astrophysics Data System (ADS)

Bhowmik, R. N.; Vijayasri, G.

2015-06-01

We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Voltage-gated proton (H(v)1) channels, a singular voltage sensing domain.

PubMed

Castillo, Karen; Pupo, Amaury; Baez-Nieto, David; Contreras, Gustavo F; Morera, Francisco J; Neely, Alan; Latorre, Ramon; Gonzalez, Carlos

2015-11-14

The main role of voltage-gated proton channels (Hv1) is to extrude protons from the intracellular milieu when, mediated by different cellular processes, the H(+) concentration increases. Hv1 are exquisitely selective for protons and their structure is homologous to the voltage sensing domain (VSD) of other voltage-gated ion channels like sodium, potassium, and calcium channels. In clear contrast to the classical voltage-dependent channels, Hv1 lacks a pore domain and thus permeation necessarily occurs through the voltage sensing domain. Hv1 channels are activated by depolarizing voltages, and increases in internal proton concentration. It has been proposed that local conformational changes of the transmembrane segment S4, driven by depolarization, trigger the molecular rearrangements that open Hv1. However, it is still unclear how the electromechanical coupling is achieved between the VSD and the potential pore, allowing the proton flux from the intracellular to the extracellular side. Here we provide a revised view of voltage activation in Hv1 channels, offering a comparative scenario with other voltage sensing channels domains. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Polymer solar cells with enhanced open-circuit voltage and efficiency

NASA Astrophysics Data System (ADS)

Chen, Hsiang-Yu; Hou, Jianhui; Zhang, Shaoqing; Liang, Yongye; Yang, Guanwen; Yang, Yang; Yu, Luping; Wu, Yue; Li, Gang

2009-11-01

Following the development of the bulk heterojunction structure, recent years have seen a dramatic improvement in the efficiency of polymer solar cells. Maximizing the open-circuit voltage in a low-bandgap polymer is one of the critical factors towards enabling high-efficiency solar cells. Study of the relation between open-circuit voltage and the energy levels of the donor/acceptor in bulk heterojunction polymer solar cells has stimulated interest in modifying the open-circuit voltage by tuning the energy levels of polymers. Here, we show that the open-circuit voltage of polymer solar cells constructed based on the structure of a low-bandgap polymer, PBDTTT, can be tuned, step by step, using different functional groups, to achieve values as high as 0.76 V. This increased open-circuit voltage combined with a high short-circuit current density results in a polymer solar cell with a power conversion efficiency as high as 6.77%, as certified by the National Renewable Energy Laboratory.

Optical Voltage Sensing Using DNA Origami

PubMed Central

2018-01-01

We explore the potential of DNA nanotechnology for developing novel optical voltage sensing nanodevices that convert a local change of electric potential into optical signals. As a proof-of-concept of the sensing mechanism, we assembled voltage responsive DNA origami structures labeled with a single pair of FRET dyes. The DNA structures were reversibly immobilized on a nanocapillary tip and underwent controlled structural changes upon application of an electric field. The applied field was monitored through a change in FRET efficiency. By exchanging the position of a single dye, we could tune the voltage sensitivity of our DNA origami structure, demonstrating the flexibility and versatility of our approach. The experimental studies were complemented by coarse-grained simulations that characterized voltage-dependent elastic deformation of the DNA nanostructures and the associated change in the distance between the FRET pair. Our work opens a novel pathway for determining the mechanical properties of DNA origami structures and highlights potential applications of dynamic DNA nanostructures as voltage sensors. PMID:29430924

Relationship between open-circuit voltage in Cu(In,Ga)Se2 solar cell and peak position of (220/204) preferred orientation near its absorber surface

NASA Astrophysics Data System (ADS)

Chantana, J.; Watanabe, T.; Teraji, S.; Kawamura, K.; Minemoto, T.

2013-11-01

Cu(In,Ga)Se2 (CIGS) absorbers with various Ga/III, Ga/(In+Ga), profiles are prepared by the so-called "multi-layer precursor method" using multi-layer co-evaporation of material sources. It is revealed that open-circuit voltage (VOC) of CIGS solar cell is primarily dependent on averaged Ga/III near the surface of its absorber. This averaged Ga/III is well predicted by peak position of (220/204) preferred orientation of CIGS film near its surface investigated by glancing-incidence X-ray diffraction with 0.1° incident angle. Finally, the peak position of (220/204) preferred orientation is proposed as a measure of VOC before solar cell fabrication.

Stacking Orientation Mediation of Pentacene and Derivatives for High Open-Circuit Voltage Organic Solar Cells.

PubMed

Chou, Chi-Ta; Lin, Chien-Hung; Tai, Yian; Liu, Chin-Hsin J; Chen, Li-Chyong; Chen, Kuei-Hsien

2012-05-03

In this Letter, we investigated the effect of the molecular stacking orientation on the open circuit voltage (VOC) of pentacene-based organic solar cells. Two functionalized pentacenes, namely, 6,13-diphenyl-pentacene (DP-penta) and 6,13-dibiphenyl-4-yl-pentacene (DB-penta), were utilized. Different molecular stacking orientations of the pentacene derivatives from the pristine pentacene were identified by angle-dependent near-edge X-ray absorption fine structure measurements. It is concluded that pentacene molecules stand up on the substrate surface, while both functionalized pentacenes lie down. A significant increase of the VOC from 0.28 to 0.83 V can be achieved upon the utilization of functionalized pentacene, owing to the modulation of molecular stacking orientation, which induced a vacuum-level shift.

Investigation of the open-circuit voltage in wide-bandgap InGaP-host InP quantum dot intermediate-band solar cells

NASA Astrophysics Data System (ADS)

Aihara, Taketo; Tayagaki, Takeshi; Nagato, Yuki; Okano, Yoshinobu; Sugaya, Takeyoshi

2018-04-01

To analyze the open-circuit voltage (V oc) in intermediate-band solar cells, we investigated the current-voltage characteristics in wide-bandgap InGaP-based InP quantum dot (QD) solar cells. From the temperature dependence of the current-voltage curves, we show that the V oc in InP QD solar cells increases with decreasing temperature. We use a simple diode model to extract V oc at the zero-temperature limit, V 0, and the temperature coefficient C of the solar cells. Our results show that, while the C of InP QD solar cells is slightly larger than that of the reference InGaP solar cells, V 0 significantly decreases and coincides with the bandgap energy of the InP QDs rather than that of the InGaP host. This V 0 indicates that the V oc reduction in the InP QD solar cells is primarily caused by the breaking of the Fermi energy separation between the QDs and the host semiconductor in intermediate-band solar cells, rather than by enhanced carrier recombination.

Quantitative Analysis of Color Differences within High Contrast, Low Power Reversible Electrophoretic Displays

DOE PAGES

Giera, Brian; Bukosky, Scott; Lee, Elaine; ...

2018-01-23

Here, quantitative color analysis is performed on videos of high contrast, low power reversible electrophoretic deposition (EPD)-based displays operated under different applied voltages. This analysis is coded in an open-source software, relies on a color differentiation metric, ΔE * 00, derived from digital video, and provides an intuitive relationship between the operating conditions of the devices and their performance. Time-dependent ΔE * 00 color analysis reveals color relaxation behavior, recoverability for different voltage sequences, and operating conditions that can lead to optimal performance.

Quantitative Analysis of Color Differences within High Contrast, Low Power Reversible Electrophoretic Displays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giera, Brian; Bukosky, Scott; Lee, Elaine

Here, quantitative color analysis is performed on videos of high contrast, low power reversible electrophoretic deposition (EPD)-based displays operated under different applied voltages. This analysis is coded in an open-source software, relies on a color differentiation metric, ΔE * 00, derived from digital video, and provides an intuitive relationship between the operating conditions of the devices and their performance. Time-dependent ΔE * 00 color analysis reveals color relaxation behavior, recoverability for different voltage sequences, and operating conditions that can lead to optimal performance.

The relationship between Q gamma and Ca release from the sarcoplasmic reticulum in skeletal muscle

PubMed Central

1991-01-01

Asymmetric membrane currents and fluxes of Ca2+ release were determined in skeletal muscle fibers voltage clamped in a Vaseline-gap chamber. The conditioning pulse protocol 1 for suppressing Ca2+ release and the "hump" component of charge movement current (I gamma), described in the first paper of this series, was applied at different test pulse voltages. The amplitude of the current suppressed during the ON transient reached a maximum at slightly suprathreshold test voltages (- 50 to -40 mV) and decayed at higher voltages. The component of charge movement current suppressed by 20 microM tetracaine also went through a maximum at low pulse voltages. This anomalous voltage dependence is thus a property of I gamma, defined by either the conditioning protocol or the tetracaine effect. A negative (inward-going) phase was often observed in the asymmetric current during the ON of depolarizing pulses. This inward phase was shown to be an intramembranous charge movement based on (a) its presence in the records of total membrane current, (b) its voltage dependence, with a maximum at slightly suprathreshold voltages, (c) its association with a "hump" in the asymmetric current, (d) its inhibition by interventions that reduce the "hump", (e) equality of ON and OFF areas in the records of asymmetric current presenting this inward phase, and (f) its kinetic relationship with the time derivative of Ca release flux. The nonmonotonic voltage dependence of the amplitude of the hump and the possibility of an inward phase of intramembranous charge movement are used as the main criteria in the quantitative testing of a specific model. According to this model, released Ca2+ binds to negatively charged sites on the myoplasmic face of the voltage sensor and increases the local transmembrane potential, thus driving additional charge movement (the hump). This model successfully predicts the anomalous voltage dependence and all the kinetic properties of I gamma described in the previous papers. It also accounts for the inward phase in total asymmetric current and in the current suppressed by protocol 1. According to this model, I gamma accompanies activating transitions at the same set of voltage sensors as I beta. Therefore it should open additional release channels, which in turn should cause more I gamma, providing a positive feedback mechanism in the regulation of calcium release. PMID:1650812

Effect of stochastic gating on channel-facilitated transport of non-interacting and strongly repelling solutes.

PubMed

Berezhkovskii, Alexander M; Bezrukov, Sergey M

2017-08-28

Ligand- or voltage-driven stochastic gating-the structural rearrangements by which the channel switches between its open and closed states-is a fundamental property of biological membrane channels. Gating underlies the channel's ability to respond to different stimuli and, therefore, to be functionally regulated by the changing environment. The accepted understanding of the gating effect on the solute flux through the channel is that the mean flux is the product of the flux through the open channel and the probability of finding the channel in the open state. Here, using a diffusion model of channel-facilitated transport, we show that this is true only when the gating is much slower than the dynamics of solute translocation through the channel. If this condition breaks, the mean flux could differ from this simple estimate by orders of magnitude.

Effect of stochastic gating on channel-facilitated transport of non-interacting and strongly repelling solutes

NASA Astrophysics Data System (ADS)

Berezhkovskii, Alexander M.; Bezrukov, Sergey M.

2017-08-01

Ligand- or voltage-driven stochastic gating—the structural rearrangements by which the channel switches between its open and closed states—is a fundamental property of biological membrane channels. Gating underlies the channel's ability to respond to different stimuli and, therefore, to be functionally regulated by the changing environment. The accepted understanding of the gating effect on the solute flux through the channel is that the mean flux is the product of the flux through the open channel and the probability of finding the channel in the open state. Here, using a diffusion model of channel-facilitated transport, we show that this is true only when the gating is much slower than the dynamics of solute translocation through the channel. If this condition breaks, the mean flux could differ from this simple estimate by orders of magnitude.

Molecular determinants of voltage-dependent gating and binding of pore-blocking drugs in transmembrane segment IIIS6 of the Na(+) channel alpha subunit.

PubMed

Yarov-Yarovoy, V; Brown, J; Sharp, E M; Clare, J J; Scheuer, T; Catterall, W A

2001-01-05

Mutations of amino acid residues in the inner two-thirds of the S6 segment in domain III of the rat brain type IIA Na(+) channel (G1460A to I1473A) caused periodic positive and negative shifts in the voltage dependence of activation, consistent with an alpha-helix having one face on which mutations to alanine oppose activation. Mutations in the outer one-third of the IIIS6 segment all favored activation. Mutations in the inner half of IIIS6 had strong effects on the voltage dependence of inactivation from closed states without effect on open-state inactivation. Only three mutations had strong effects on block by local anesthetics and anticonvulsants. Mutations L1465A and I1469A decreased affinity of inactivated Na(+) channels up to 8-fold for the anticonvulsant lamotrigine and its congeners 227c89, 4030w92, and 619c89 as well as for the local anesthetic etidocaine. N1466A decreased affinity of inactivated Na(+) channels for the anticonvulsant 4030w92 and etidocaine by 3- and 8-fold, respectively, but had no effect on affinity of the other tested compounds. Leu-1465, Asn-1466, and Ile-1469 are located on one side of the IIIS6 helix, and mutation of each caused a positive shift in the voltage dependence of activation. Evidently, these amino acid residues face the lumen of the pore, contribute to formation of the high-affinity receptor site for pore-blocking drugs, and are involved in voltage-dependent activation and coupling to closed-state inactivation.

Giant magnetoelectric effect in negative magnetostrictive/piezoelectric/positive magnetostrictive semiring structure

NASA Astrophysics Data System (ADS)

Zeng, Lingyu; Zhou, Minhong; Bi, Ke; Lei, Ming

2016-01-01

Magnetoelectric (ME) Ni/PZT/TbFe2 and TbFe2/PZT composites with two semiring structures are prepared. The dependence between ME coupling and magnetostrictive property of the composite is discussed. Because Ni possesses negative magnetostrictive property and TbFe2 shows positive magnetostrictive property, the ME voltage coefficient of Ni/PZT/TbFe2 semiring structure is much larger than that of TbFe2/PZT. In these composites, the ME voltage coefficient increases and the resonance frequency gradually decreases with the increase of the semiring radius, showing that structural parameters are key factors to the composite properties. Due to the strong ME coupling effect, a giant ME voltage coefficient αE = 44.8 V cm-1 Oe-1 is obtained. This approach opens a way for the design of ME composites with giant ME voltage coefficient.

Structural Implications of Fluorescence Quenching in the Shaker K+ Channel

PubMed Central

Cha, Albert; Bezanilla, Francisco

1998-01-01

When attached to specific sites near the S4 segment of the nonconducting (W434F) Shaker potassium channel, the fluorescent probe tetramethylrhodamine maleimide undergoes voltage-dependent changes in intensity that correlate with the movement of the voltage sensor (Mannuzzu, L.M., M.M. Moronne, and E.Y. Isacoff. 1996. Science. 271:213–216; Cha, A., and F. Bezanilla. 1997. Neuron. 19:1127–1140). The characteristics of this voltage-dependent fluorescence quenching are different in a conducting version of the channel with a different pore substitution (T449Y). Blocking the pore of the T449Y construct with either tetraethylammonium or agitoxin removes a fluorescence component that correlates with the voltage dependence but not the kinetics of ionic activation. This pore-mediated modulation of the fluorescence quenching near the S4 segment suggests that the fluorophore is affected by the state of the external pore. In addition, this modulation may reflect conformational changes associated with channel opening that are prevented by tetraethylammonium or agitoxin. Studies of pH titration, collisional quenchers, and anisotropy indicate that fluorophores attached to residues near the S4 segment are constrained by a nearby region of protein. The mechanism of fluorescence quenching near the S4 segment does not involve either reorientation of the fluorophore or a voltage-dependent excitation shift and is different from the quenching mechanism observed at a site near the S2 segment. Taken together, these results suggest that the extracellular portion of the S4 segment resides in an aqueous protein vestibule and is influenced by the state of the external pore. PMID:9758859

Multijunction high voltage concentrator solar cells

NASA Technical Reports Server (NTRS)

Valco, G. J.; Kapoor, V. J.; Evans, J. C.; Chai, A.-T.

1981-01-01

The standard integrated circuit technology has been developed to design and fabricate new innovative planar multi-junction solar cell chips for concentrated sunlight applications. This 1 cm x 1 cm cell consisted of several voltage generating regions called unit cells which were internally connected in series within a single chip resulting in high open circuit voltages. Typical open-circuit voltages of 3.6 V and short-circuit currents of 90 ma were obtained at 80 AM1 suns. A dramatic increase in both short circuit current and open circuit voltage with increased light levels was observed.

Tank testing of a 2500-cm2 solar panel

NASA Technical Reports Server (NTRS)

Bever, R. S.; Staskus, J.

1981-01-01

A 50 cm by 50 cm solar array panel test patch was investigated for spacecraft charging and arcing effects. Bombardment with monochromatic electron was carried out. Some objectives of the test were: (1) to estimate at what voltage of electron bombardment arcing would be probable; (2) to find whether the arc's energy would be tolerable or damagingly large; (3) to try and separate thermal and photoeffects; and, (4) to see whether materials used were such as to minimize arcing. Some conclusions were: In sunlight the tracking data relay satellite's solar panel which has ceria glass on the front and conductive paint on the backside is probably a good design for reducing charge-up. In a geomagnetic substorm simulated in testing there will be arcing at the interconnects during eclipse and transitions into and out of eclipse in testing especially in view of the very cold temperatures that will be reached by this lightweight array. Ceria-doped glass is preferred to fused silica glass for reducing charge build up. The Kapton bare patch should still be conductively painted. The differential voltages on the panel determine when arcing first begins, and the electron beam voltages vary depending upon whether the metallic structure is directly grounded or semifloating.

Tonic dopamine induces persistent changes in the transient potassium current through translational regulation

PubMed Central

Rodgers, EW; Krenz, W-D; Baro, DJ

2012-01-01

Neuromodulatory effects can vary with their mode of transmission. Phasic release produces local and transient increases in dopamine (DA) up to micromolar concentrations. Additionally, since DA is released from open synapses and reuptake mechanisms are not nearby, tonic nanomolar DA exists in the extracellular space. Do phasic and tonic transmissions similarly regulate voltage dependent ionic conductances in a given neuron? It was previously shown that DA could immediately alter the transient potassium current (IA) of identified neurons in the stomatogastric ganglion (STG) of the spiny lobster, Panulirus interruptus. Here we show that DA can also persistently alter IA, and that DA’s immediate and persistent effects oppose one another. The lateral pyloric neuron (LP) exclusively expresses type 1 DA receptors (D1Rs). Micromolar DA produces immediate depolarizing shifts in the voltage dependence of LP IA, whereas tonic nanomolar DA produces a persistent increase in LP IA maximal conductance (Gmax) through a translation dependent mechanism involving target of rapamycin (TOR). The pyloric dilator neuron (PD) exclusively expresses type 2 DA receptors (D2Rs). Micromolar DA produces an immediate hyperpolarizing shift in PD IA voltage dependence of activation, whereas tonic DA persistently decreases PD IA Gmax through a translation dependent mechanism not involving TOR. The persistent effects on IA Gmax do not depend on LP or PD activity. These data suggest a role for tonic modulators in the regulation of voltage gated ion channel number; and furthermore, that dopaminergic systems may be organized to limit the amount of change they can impose on a circuit. PMID:21917788

Voltage-Rectified Current and Fluid Flow in Conical Nanopores.

PubMed

Lan, Wen-Jie; Edwards, Martin A; Luo, Long; Perera, Rukshan T; Wu, Xiaojian; Martin, Charles R; White, Henry S

2016-11-15

Ion current rectification (ICR) refers to the asymmetric potential-dependent rate of the passage of solution ions through a nanopore, giving rise to electrical current-voltage characteristics that mimic those of a solid-state electrical diode. Since the discovery of ICR in quartz nanopipettes two decades ago, synthetic nanopores and nanochannels of various geometries, fabricated in membranes and on wafers, have been extensively investigated to understand fundamental aspects of ion transport in highly confined geometries. It is now generally accepted that ICR requires an asymmetric electrical double layer within the nanopore, producing an accumulation or depletion of charge-carrying ions at opposite voltage polarities. Our research groups have recently explored how the voltage-dependent ion distributions and ICR within nanopores can induce novel nanoscale flow phenomena that have applications in understanding ionics in porous materials used in energy storage devices, chemical sensing, and low-cost electrical pumping of fluids. In this Account, we review our most recent investigations on this topic, based on experiments using conical nanopores (10-300 nm tip opening) fabricated in thin glass, mica, and polymer membranes. Measurable fluid flow in nanopores can be induced either using external pressure forces, electrically via electroosmotic forces, or by a combination of these two forces. We demonstrate that pressure-driven flow can greatly alter the electrical properties of nanopores and, vice versa, that the nonlinear electrical properties of conical nanopores can impart novel and useful flow phenomena. Electroosmotic flow (EOF), which depends on the magnitude of the ion fluxes within the double layer of the nanopore, is strongly coupled to the accumulation/depletion of ions. Thus, the same underlying cause of ICR also leads to EOF rectification, i.e., unequal flows occurring for the same voltage but opposite polarities. EOF rectification can be used to electrically pump fluids with very precise control across membranes containing conical pores via the application of a symmetric sinusoidal voltage. The combination of pressure and asymmetric EOF can also provide a means to generate new nanopore electrical behaviors, including negative differential resistance (NDR), in which the current through a conical pore decreases with increasing driving force (applied voltage), similar to solid-state tunnel diodes. NDR results from a positive feedback mechanism between the ion distributions and EOF, yielding a true bistability in both fluid flow and electrical current at a critical applied voltage. Nanopore-based NDR is extremely sensitive to the surface charge near the nanopore opening, suggesting possible applications in chemical sensing.

Kinetic and functional analysis of transient, persistent and resurgent sodium currents in rat cerebellar granule cells in situ: an electrophysiological and modelling study

PubMed Central

Magistretti, Jacopo; Castelli, Loretta; Forti, Lia; D'Angelo, Egidio

2006-01-01

Cerebellar neurones show complex and differentiated mechanisms of action potential generation that have been proposed to depend on peculiar properties of their voltage-dependent Na+ currents. In this study we analysed voltage-dependent Na+ currents of rat cerebellar granule cells (GCs) by performing whole-cell, patch-clamp experiments in acute rat cerebellar slices. A transient Na+ current (INaT) was always present and had the properties of a typical fast-activating/inactivating Na+ current. In addition to INaT, robust persistent (INaP) and resurgent (INaR) Na+ currents were observed. INaP peaked at ∼−40 mV, showed half-maximal activation at ∼−55 mV, and its maximal amplitude was about 1.5% of that of INaT. INaR was elicited by repolarizing pulses applied following step depolarizations able to activate/inactivate INaT, and showed voltage- and time-dependent activation and voltage-dependent decay kinetics. The conductance underlying INaR showed a bell-shaped voltage dependence, with peak at −35 mV. A significant correlation was found between GC INaR and INaT peak amplitudes; however, GCs expressing INaT of similar size showed marked variability in terms of INaR amplitude, and in a fraction of cells INaR was undetectable. INaT, INaP and INaR could be accounted for by a 13-state kinetic scheme comprising closed, open, inactivated and blocked states. Current-clamp experiments carried out to identify possible functional correlates of INaP and/or INaR revealed that in GCs single action potentials were followed by depolarizing afterpotentials (DAPs). In a majority of cells, DAPs showed properties consistent with INaR playing a role in their generation. Computer modelling showed that INaR promotes DAP generation and enhances high-frequency firing, whereas INaP boosts near-threshold firing activity. Our findings suggest that special properties of voltage-dependent Na+ currents provides GCs with mechanisms suitable for shaping activity patterns, with potentially important consequences for cerebellar information transfer and computation. PMID:16527854

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G.

2015-06-15

We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling.more » The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.« less

Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, Yan; Lin, Zuoxian; Xia, Menghang

Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependentmore » inhibitions of HERG channel currents with IC{sub 50} values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds.« less

Models of Voltage-Dependent Conformational Changes in NaChBac Channels

PubMed Central

Shafrir, Yinon; Durell, Stewart R.; Guy, H. Robert

2008-01-01

Models of the transmembrane region of the NaChBac channel were developed in two open/inactivated and several closed conformations. Homology models of NaChBac were developed using crystal structures of Kv1.2 and a Kv1.2/2.1 chimera as templates for open conformations, and MlotiK and KcsA channels as templates for closed conformations. Multiple molecular-dynamic simulations were performed to refine and evaluate these models. A striking difference between the S4 structures of the Kv1.2-like open models and MlotiK-like closed models is the secondary structure. In the open model, the first part of S4 forms an α-helix, and the last part forms a 310 helix, whereas in the closed model, the first part of S4 forms a 310 helix, and the last part forms an α-helix. A conformational change that involves this type of transition in secondary structure should be voltage-dependent. However, this transition alone is not sufficient to account for the large gating charge movement reported for NaChBac channels and for experimental results in other voltage-gated channels. To increase the magnitude of the motion of S4, we developed another model of an open/inactivated conformation, in which S4 is displaced farther outward, and a number of closed models in which S4 is displaced farther inward. A helical screw motion for the α-helical part of S4 and a simple axial translation for the 310 portion were used to develop models of these additional conformations. In our models, four positively charged residues of S4 moved outwardly during activation, across a transition barrier formed by highly conserved hydrophobic residues on S1, S2, and S3. The S4 movement was coupled to an opening of the activation gate formed by S6 through interactions with the segment linking S4 to S5. Consistencies of our models with experimental studies of NaChBac and Kv channels are discussed. PMID:18641074

Mitochondrial permeability transition pore (MPTP) desensitization increases sea urchin spermatozoa fertilization rate.

PubMed

Torrezan-Nitao, Elis; Boni, Raianna; Marques-Santos, Luis Fernando

2016-10-01

Mitochondrial permeability transition pore (MPTP) is a protein complex whose opening promotes an abrupt increase in mitochondrial inner membrane permeability. Calcium signaling pathways are described in gametes and are involved in the fertilization process. Although mitochondria may act as Ca(2+) store and have a fast calcium-releasing mechanism through MPTP, its contribution to fertilization remains unclear. The work aimed to investigate the MPTP phenomenon in sea urchin spermatozoa and its role on the fertilization. Several pharmacological tools were used to evaluate the MPTP's physiology. Our results demonstrated that MPTP occurs in male gametes in a Ca(2+) - and voltage-dependent manner and it is sensitive to cyclosporine A. Additionally, our data show that MPTP opening does not alter ROS generation in sperm cells. Inhibition of MPTP in spermatozoa strongly improved the fertilization rate, which may involve mechanisms that increase the spermatozoa lifespan. The present work is the first report of the presence of a voltage- and Ca(2+) -dependent MPTP in gametes of invertebrates and indicates MPTP opening as another evolutionary feature shared by sea urchins and mammals. Studies about MPTP in sea urchin male gametes may contribute to the elucidation of several mechanisms involved in sperm infertility. © 2016 International Federation for Cell Biology.

Relationship between open-circuit voltage in Cu(In,Ga)Se{sub 2} solar cell and peak position of (220/204) preferred orientation near its absorber surface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chantana, J., E-mail: jakapan@fc.ritsumei.ac.jp; Minemoto, T.; Watanabe, T.

2013-11-25

Cu(In,Ga)Se{sub 2} (CIGS) absorbers with various Ga/III, Ga/(In+Ga), profiles are prepared by the so-called “multi-layer precursor method” using multi-layer co-evaporation of material sources. It is revealed that open-circuit voltage (V{sub OC}) of CIGS solar cell is primarily dependent on averaged Ga/III near the surface of its absorber. This averaged Ga/III is well predicted by peak position of (220/204) preferred orientation of CIGS film near its surface investigated by glancing-incidence X-ray diffraction with 0.1° incident angle. Finally, the peak position of (220/204) preferred orientation is proposed as a measure of V{sub OC} before solar cell fabrication.

High performance of PbSe/PbS core/shell quantum dot heterojunction solar cells: short circuit current enhancement without the loss of open circuit voltage by shell thickness control.

PubMed

Choi, Hyekyoung; Song, Jung Hoon; Jang, Jihoon; Mai, Xuan Dung; Kim, Sungwoo; Jeong, Sohee

2015-11-07

We fabricated heterojunction solar cells with PbSe/PbS core shell quantum dots and studied the precisely controlled PbS shell thickness dependency in terms of optical properties, electronic structure, and solar cell performances. When the PbS shell thickness increases, the short circuit current density (JSC) increases from 6.4 to 11.8 mA cm(-2) and the fill factor (FF) enhances from 30 to 49% while the open circuit voltage (VOC) remains unchanged at 0.46 V even with the decreased effective band gap. We found that the Fermi level and the valence band maximum level remain unchanged in both the PbSe core and PbSe/PbS core/shell with a less than 1 nm thick PbS shell as probed via ultraviolet photoelectron spectroscopy (UPS). The PbS shell reduces their surface trap density as confirmed by relative quantum yield measurements. Consequently, PbS shell formation on the PbSe core mitigates the trade-off relationship between the open circuit voltage and the short circuit current density. Finally, under the optimized conditions, the PbSe core with a 0.9 nm thick shell yielded a power conversion efficiency of 6.5% under AM 1.5.

Binding and effects of KATP channel openers in the vascular smooth muscle cell line, A10

PubMed Central

Russ, Ulrich; Metzger, Friedrich; Kickenweiz, Elisabeth; Hambrock, Annette; Krippeit-Drews, Peter; Quast, Ulrich

1997-01-01

The ATP-sensitive K+ channel (KATP channel) in A10 cells, a cell line derived from rat thoracic aorta, was characterized by binding studies with the tritiated KATP channel opener, [3H]-P1075, and by electrophysiological techniques. Saturation binding experiments gave a KD value of 9.2±5.2 nM and a binding capacity (BMax) of 140±40 fmol mg−1 protein for [3H]-P1075 binding to A10 cells; from the BMax value a density of binding sites of 5–10 per μm2 plasmalemma was estimated. KATP channel modulators such as the openers P1075, pinacidil, levcromakalim and minoxidil sulphate and the blocker glibenclamide inhibited [3H]-P1075 binding. The extent of inhibition at saturation depended on the compound, levcromakalim inhibiting specific [3H]-P1075 binding by 85%, minoxidil sulphate and glibenclamide by 70%. The inhibition constants were similar to those determined in strips of rat aorta. Resting membrane potential, recorded with microelectrodes, was −51±1 mV. P1075 and levcromakalim produced a concentration-dependent hyperpolarization by up to −25 mV with EC50 values of 170±40 nM and 870±190 nM, respectively. The hyperpolarization induced by levcromakalim (3 μM) was completely reversed by glibenclamide with an IC50 value of 86±17 nM. Voltage clamp experiments were performed in the whole cell configuration under a physiological K+ gradient. Levcromakalim (10 μM) induced a current which reversed around −80 mV; the current-voltage relationship showed considerable outward rectification. Glibenclamide (3 μM) abolished the effect of levcromakalim. Analysis of the noise of the levcromakalim (10 μM)-induced current at −40 and −20 mV yielded estimates of the channel density, the single channel conductance and the probability of the channel to be open of 0.14 μm−2, 8.8 pS and 0.39, respectively. The experiments showed that A10 cells are endowed with functional KATP channels which resemble those in vascular tissue; hence, these cells provide an easily accessible source of channels for biochemical and pharmacological studies. The density of binding sites for [3H]-P1075 was estimated to be one order of magnitude higher than the density of functional KATP channels; assuming a plasmalemmal localization of the binding sites this suggests a large receptor reserve for the openers in A10 cells. PMID:9401776

Characterization of a C-type natriuretic peptide (CNP-39)-formed cation-selective channel from platypus (Ornithorhynchus anatinus) venom

PubMed Central

Kourie, Joseph I

1999-01-01

The lipid bilayer technique is used to characterize the biophysical and pharmacological properties of a novel, fast, cation-selective channel formed by incorporating platypus (Ornithorhynchus anatinus) venom (OaV) into lipid membranes.A synthetic C-type natriuretic peptide OaCNP-39, which is identical to that present in platypus venom, mimics the conductance, kinetics, selectivity and pharmacological properties of the OaV-formed fast cation-selective channel. The N-terminal fragment containing residues 1-17, i.e. OaCNP-39(1-17), induces the channel activity.The current amplitude of the TEACl-insensitive fast cation-selective channel is dependent on cytoplasmic K+, [K+]cis. The increase in the current amplitude, as a function of increasing [K+]cis, is non-linear and can be described by the Michaelis-Menten equation. At +140 mV, the values of γmax and KS are 63·1 pS and 169 mM, respectively, whereas at 0 mV the values of γmax and KS are 21·1 pS and 307 mM, respectively. γmax and KS are maximal single channel conductance and concentration for half-maximal γ, respectively. The calculated permeability ratios, PK:PRb:PNa: PCs:PLi, were 1:0·76:0·21:0·09:0·03, respectively.The probability of the fast channel being open, Po, increases from 0·15 at 0 mV to 0·75 at +140 mV. In contrast, the channel frequency, Fo, decreases from 400 to 180 events per second for voltages between 0 mV and +140. The mean open time, To, increases as the bilayer is made more positive, between 0 and +140 mV. The mean values of the voltage-dependent kinetic parameters, Po, Fo, To and mean closed time (Tc), are independent of [KCl]cis between 50 and 750 mM (P > 0·05).It is proposed that some of the symptoms of envenomation by platypus venom may be caused partly by changes in cellular functions mediated via the OaCNP-39-formed fast cation-selective channel, which affects signal transduction. PMID:10381585

The passive cable properties of hair cell stereocilia and their contribution to somatic capacitance measurements.

PubMed

Breneman, Kathryn D; Highstein, Stephen M; Boyle, Richard D; Rabbitt, Richard D

2009-01-01

Somatic measurements of whole-cell capacitance are routinely used to understand physiologic events occurring in remote portions of cells. These studies often assume the intracellular space is voltage-clamped. We questioned this assumption in auditory and vestibular hair cells with respect to their stereocilia based on earlier studies showing that neurons, with radial dimensions similar to stereocilia, are not always isopotential under voltage-clamp. To explore this, we modeled the stereocilia as passive cables with transduction channels located at their tips. We found that the input capacitance measured at the soma changes when the transduction channels at the tips of the stereocilia are open compared to when the channels are closed. The maximum capacitance is felt with the transducer closed but will decrease as the transducer opens due to a length-dependent voltage drop along the stereocilium length. This potential drop is proportional to the intracellular resistance and stereocilium tip conductance and can produce a maximum capacitance error on the order of fF for single stereocilia and pF for the bundle.

Properties of Single K+ and Cl− Channels in Asclepias tuberosa Protoplasts 1

PubMed Central

Schauf, Charles L.; Wilson, Kathryn J.

1987-01-01

Potassium and chloride channels were characterized in Asclepias tuberosa suspension cell derived protoplasts by patch voltage-clamp. Whole-cell currents and single channels in excised patches had linear instantaneous current-voltage relations, reversing at the Nernst potentials for K+ and Cl−, respectively. Whole cell K+ currents activated exponentially during step depolarizations, while voltage-dependent Cl− channels were activated by hyperpolarizations. Single K+ channel conductance was 40 ± 5 pS with a mean open time of 4.5 milliseconds at 100 millivolts. Potassium channels were blocked by Cs+ and tetraethylammonium, but were insensitive to 4-aminopyridine. Chloride channels had a single-channel conductance of 100 ± 17 picosiemens, mean open time of 8.8 milliseconds, and were blocked by Zn2+ and ethacrynic acid. Whole-cell Cl− currents were inhibited by abscisic acid, and were unaffected by indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid. Since internal and external composition can be controlled, patch-clamped protoplasts are ideal systems for studying the role of ion channels in plant physiology and development. Images Fig. 5 PMID:16665712

JPS heater and sensor lightning qualification

NASA Technical Reports Server (NTRS)

Cook, M.

1989-01-01

Simulated lightning strike testing of the Redesigned Solid Rocket Motor (RSRM) field joint protection system heater assembly was performed at Thiokol Corp., Wendover Lightning Facility. Testing consisted of subjecting the lightning evaluation test article to simulated lightning strikes and evaluating the effects of heater cable transients on cables within the systems tunnel. The maximum short circuit current coupled onto a United Space Boosters, Inc. operational flight cable within the systems tunnel, induced by transients from all cables external to the systems tunnel, was 92 amperes. The maximum open-circuit voltage coupled was 316 volts. The maximum short circuit current coupled onto a United Space Boosters, Inc. operational flight cable within the systems tunnel, induced by heater power cable transients only, was 2.7 amperes; the maximum open-circuit voltage coupled was 39 volts. All heater power cable induced coupling was due to simulated lightning discharges only, no heater operating power was applied during the test. The results showed that, for a worst-case lightning discharge, the heater power cable is responsible for a 3.9 decibel increase in voltage coupling to operational flight cables within the systems tunnel. Testing also showed that current and voltage levels coupled onto cables within the systems tunnel are partially dependant on the relative locations of the cables within the systems tunnel.

Calcium-dependent inactivation of calcium channels in cochlear hair cells of the chicken.

PubMed

Lee, Seunghwan; Briklin, Olga; Hiel, Hakim; Fuchs, Paul

2007-09-15

Voltage-gated calcium channels support both spontaneous and sound-evoked neurotransmitter release from ribbon synapses of cochlear hair cells. A variety of regulatory mechanisms must cooperate to ensure the appropriate level of activity in the restricted pool of synaptic calcium channels ( approximately 100) available to each synaptic ribbon. One potential feedback mechanism, calcium-dependent inactivation (CDI) of voltage-gated, L-type calcium channels, can be modulated by calmodulin-like calcium-binding proteins. CDI of voltage-gated calcium current was studied in hair cells of the chicken's basilar papilla (analogous to the mammalian cochlea) after blocking the predominant potassium conductances. For inactivating currents produced by 2.5 s steps to the peak of the current-voltage relation (1 mm EGTA internal calcium buffer), single exponential fits yielded an average decay time constant of 1.92 +/- 0.18 s (mean +/- s.e.m., n = 12) at 20-22 degrees C, while recovery occurred with a half-time of approximately 10 s. Inactivation produced no change in reversal potential, arguing that the observed relaxation did not result from alternative processes such as calcium accumulation or activation of residual potassium currents. Substitution of external calcium with barium greatly reduced inactivation, while inhibition of endoplasmic calcium pumps with t-benzohydroquinone (BHQ) or thapsigargin made inactivation occur faster and to a greater extent. Raising external calcium 10-fold (from 2 to 20 mm) increased peak current 3-fold, but did not alter the extent or time course of CDI. However, increasing levels of internal calcium buffer consistently reduced the rate and extent of inactivation. With 1 mm EGTA buffering and in 2 mm external calcium, the available pool of calcium channels was half-inactivated near the resting membrane potential (-50 mV). CDI may be further regulated by calmodulin-like calcium-binding proteins (CaBPs). mRNAs for several CaBPs are expressed in chicken cochlear tissue, and antibodies to CaBP4 label hair cells, but not supporting cells, equivalent to the pattern seen in mammalian cochlea. Thus, molecular mechanisms that underlie CDI appeared to be conserved across vertebrate species, may provide a means to adjust calcium channel open probability, and could serve to maintain the set-point for spontaneous release from the ribbon synapse.

Calcium-dependent inactivation of calcium channels in cochlear hair cells of the chicken

PubMed Central

Lee, Seunghwan; Briklin, Olga; Hiel, Hakim; Fuchs, Paul

2007-01-01

Voltage-gated calcium channels support both spontaneous and sound-evoked neurotransmitter release from ribbon synapses of cochlear hair cells. A variety of regulatory mechanisms must cooperate to ensure the appropriate level of activity in the restricted pool of synaptic calcium channels (∼100) available to each synaptic ribbon. One potential feedback mechanism, calcium-dependent inactivation (CDI) of voltage-gated, L-type calcium channels, can be modulated by calmodulin-like calcium-binding proteins. CDI of voltage-gated calcium current was studied in hair cells of the chicken's basilar papilla (analogous to the mammalian cochlea) after blocking the predominant potassium conductances. For inactivating currents produced by 2.5 s steps to the peak of the current–voltage relation (1 mm EGTA internal calcium buffer), single exponential fits yielded an average decay time constant of 1.92 ± 0.18 s (mean ±s.e.m., n = 12) at 20–22°C, while recovery occurred with a half-time of ∼10 s. Inactivation produced no change in reversal potential, arguing that the observed relaxation did not result from alternative processes such as calcium accumulation or activation of residual potassium currents. Substitution of external calcium with barium greatly reduced inactivation, while inhibition of endoplasmic calcium pumps with t-benzohydroquinone (BHQ) or thapsigargin made inactivation occur faster and to a greater extent. Raising external calcium 10-fold (from 2 to 20 mm) increased peak current 3-fold, but did not alter the extent or time course of CDI. However, increasing levels of internal calcium buffer consistently reduced the rate and extent of inactivation. With 1 mm EGTA buffering and in 2 mm external calcium, the available pool of calcium channels was half-inactivated near the resting membrane potential (−50 mV). CDI may be further regulated by calmodulin-like calcium-binding proteins (CaBPs). mRNAs for several CaBPs are expressed in chicken cochlear tissue, and antibodies to CaBP4 label hair cells, but not supporting cells, equivalent to the pattern seen in mammalian cochlea. Thus, molecular mechanisms that underlie CDI appeared to be conserved across vertebrate species, may provide a means to adjust calcium channel open probability, and could serve to maintain the set-point for spontaneous release from the ribbon synapse. PMID:17656437

Low-Voltage Continuous Electrospinning Patterning.

PubMed

Li, Xia; Li, Zhaoying; Wang, Liyun; Ma, Guokun; Meng, Fanlong; Pritchard, Robyn H; Gill, Elisabeth L; Liu, Ye; Huang, Yan Yan Shery

2016-11-30

Electrospinning is a versatile technique for the construction of microfibrous and nanofibrous structures with considerable potential in applications ranging from textile manufacturing to tissue engineering scaffolds. In the simplest form, electrospinning uses a high voltage of tens of thousands volts to draw out ultrafine polymer fibers over a large distance. However, the high voltage limits the flexible combination of material selection, deposition substrate, and control of patterns. Prior studies show that by performing electrospinning with a well-defined "near-field" condition, the operation voltage can be decreased to the kilovolt range, and further enable more precise patterning of fibril structures on a planar surface. In this work, by using solution dependent "initiators", we demonstrate a further lowering of voltage with an ultralow voltage continuous electrospinning patterning (LEP) technique, which reduces the applied voltage threshold to as low as 50 V, simultaneously permitting direct fiber patterning. The versatility of LEP is shown using a wide range of combination of polymer and solvent systems for thermoplastics and biopolymers. Novel functionalities are also incorporated when a low voltage mode is used in place of a high voltage mode, such as direct printing of living bacteria; the construction of suspended single fibers and membrane networks. The LEP technique reported here should open up new avenues in the patterning of bioelements and free-form nano- to microscale fibrous structures.

Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels.

PubMed

Elinder, Fredrik; Liin, Sara I

2017-01-01

Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (Na V ), potassium (K V ), calcium (Ca V ), and proton (H V ) channels, as well as calcium-activated potassium (K Ca ), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1 : The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2 : The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3 : The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4 : The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5 : The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels.

Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels

PubMed Central

Elinder, Fredrik; Liin, Sara I.

2017-01-01

Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (NaV), potassium (KV), calcium (CaV), and proton (HV) channels, as well as calcium-activated potassium (KCa), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1: The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2: The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3: The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4: The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5: The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels. PMID:28220076

Factors affecting the open-circuit voltage and electrode kinetics of some iron/titanium redox flow cells

NASA Technical Reports Server (NTRS)

Reid, M. A.; Gahn, R. F.

1977-01-01

Performance of the iron-titanium redox flow cell was studied as a function of acid concentration. Anion permeable membranes separated the compartments. Electrodes were graphite cloth. Current densities ranged up to 25 mA/square centimeter. Open-circuit and load voltages decreased as the acidity was increased on the iron side as predicted. On the titanium side, open-circuit voltages decreased as the acidity was increased in agreement with theory, but load voltages increased due to decreased polarization with increasing acidity. High acidity on the titanium side coupled with low acidity on the iron side gives the best load voltage, but such cells show voltage losses as they are repeatedly cycled. Analyses show that the bulk of the voltage losses are due to diffusion of acid through the membrane.

Possibility designing XNOR and NAND molecular logic gates by using single benzene ring

NASA Astrophysics Data System (ADS)

Abbas, Mohammed A.; Hanoon, Falah H.; Al-Badry, Lafy F.

2017-09-01

This study focused on examining electronic transport through single benzene ring and suggested how such ring can be employed to design XNOR and NAND molecular logic gates. The single benzene ring was threaded by a magnetic flux. The magnetic flux and applied gate voltages were considered as the key tuning parameter in the XNOR and NAND gates operation. All the calculations are achieved by using steady-state theoretical model, which is based on the time-dependent Hamiltonian model. The transmission probability and the electric current are calculated as functions of electron energy and bias voltage, respectively. The application of the anticipated results can be a base for the progress of molecular electronics.

Voltage dependence of acetylcholine receptor channel gating in rat myoballs

PubMed Central

1992-01-01

Whole-cell currents from nicotinic acetylcholine receptor (AChR) channels were studied in rat myoballs using a light-activated agonist to determine the voltage dependence of the macroscopic opening and closing rate constants. Myoballs were bathed in a solution containing a low concentration of the inactive isomer of the photoisomerizable azobenzene derivative, cis-Bis-Q. A light flash was then presented to produce a known concentration jump of agonist, trans-Bis-Q, across a wide range of membrane potentials in symmetrical solutions (NaCl or CsCl on both sides) or asymmetrical solutions (NaCl in the bath and CsCl in the pipette). At the low agonist concentration used in this study, the reciprocal of the macroscopic time constants gives an unambiguous measure of the effective closing rate. It showed an exponential decrease with membrane hyperpolarization between +20 and - 100 mV, but tended to level off at more depolarized and at more hyperpolarized membrane potentials. The relative effective opening rate was derived from the steady-state conductance, the single-channel conductance, and the apparent closing rate; it decreased sharply in the depolarizing region and tended to level off and then turn up in the hyperpolarizing region. The two effective rate constants were shown to depend on the first, second, and third power of membrane potential. PMID:1460456

A path integral approach to the Hodgkin-Huxley model

NASA Astrophysics Data System (ADS)

Baravalle, Roman; Rosso, Osvaldo A.; Montani, Fernando

2017-11-01

To understand how single neurons process sensory information, it is necessary to develop suitable stochastic models to describe the response variability of the recorded spike trains. Spikes in a given neuron are produced by the synergistic action of sodium and potassium of the voltage-dependent channels that open or close the gates. Hodgkin and Huxley (HH) equations describe the ionic mechanisms underlying the initiation and propagation of action potentials, through a set of nonlinear ordinary differential equations that approximate the electrical characteristics of the excitable cell. Path integral provides an adequate approach to compute quantities such as transition probabilities, and any stochastic system can be expressed in terms of this methodology. We use the technique of path integrals to determine the analytical solution driven by a non-Gaussian colored noise when considering the HH equations as a stochastic system. The different neuronal dynamics are investigated by estimating the path integral solutions driven by a non-Gaussian colored noise q. More specifically we take into account the correlational structures of the complex neuronal signals not just by estimating the transition probability associated to the Gaussian approach of the stochastic HH equations, but instead considering much more subtle processes accounting for the non-Gaussian noise that could be induced by the surrounding neural network and by feedforward correlations. This allows us to investigate the underlying dynamics of the neural system when different scenarios of noise correlations are considered.

Measured opening characteristics of an electromagnetically opened diaphragm for the Langley expansion tunnel

NASA Technical Reports Server (NTRS)

Moore, J. A.

1976-01-01

Results from an experimental study of the opening characteristics of an electromagnetically opened, 15.24 cm diameter diaphragm are presented. This diaphragm consists of a polyester film bonded to a preformed wire and is opened by passing a current pulse (capacitor discharge) through the wire. The diaphragm separates the acceleration section of the expansion tunnel from the nozzle so that the nozzle may be at a lower pressure than the acceleration section prior to a test. Opening times and cleanness of the opened area were examined for dependence on diaphragm thickness, on wire diameter, on technique of bonding the wire to the diaphragm, and on voltage and energy level of the energy source. Time histories of the pitot pressure measured at the expansion-tunnel nozzle entrance location are presented for (1) no diaphragm, (2) a flow-opened diaphragm, and (3) an electromagnetically opened diaphragm.

Calcium release and its voltage dependence in frog cut muscle fibers equilibrated with 20 mM EGTA

PubMed Central

1995-01-01

Sarcoplasmic reticulum (SR) Ca release was studied at 13-16 degrees C in cut fibers (sarcomere length, 3.4-3.9 microns) mounted in a double Vaseline-gap chamber. The amplitude and duration of the action- potential stimulated free [Ca] transient were reduced by equilibration with end-pool solutions that contained 20 mM EGTA with 1.76 mM Ca and 0.63 mM phenol red, a maneuver that appeared to markedly reduce the amount of Ca complexed by troponin. A theoretical analysis shows that, under these conditions, the increase in myoplasmic free [Ca] is expected to be restricted to within a few hundred nanometers of the SR Ca release sites and to have a time course that essentially matches that of release. Furthermore, almost all of the Ca that is released from the SR is expected to be rapidly bound by EGTA and exchanged for protons with a 1:2 stoichiometry. Consequently, the time course of SR Ca release can be estimated by scaling the delta pH signal measured with phenol red by -beta/2. The value of beta, the buffering power of myoplasm, was determined in fibers equilibrated with a combination of EGTA, phenol red, and fura-2; its mean value was 22 mM/pH unit. The Ca content of the SR (expressed as myoplasmic concentration) was estimated from the total amount of Ca released by either a train of action potentials or a depleting voltage step; its mean value was 2,685 microM in the action-potential experiments and 2,544 microM in the voltage- clamp experiments. An action potential released, on average, 0.14 of the SR Ca content with a peak rate of release of approximately 5%/ms. A second action potential, elicited 20 ms later, released only 0.6 times as much Ca (expressed as a fraction of the SR content), probably because Ca inactivation of Ca release was produced by the first action potential. During a depolarizing voltage step to 60 mV, the rate of Ca release rapidly increased to a peak value of approximately 3%/ms and then decreased to a quasi-steady level that was only 0.6 times as large; this decrease was also probably due to Ca inactivation of Ca release. SR Ca release was studied with small step depolarizations that open no more than one SR Ca channel in 7,000 and increase the value of spatially averaged myoplasmic free [Ca] by only 0.2 nM. PMID:8537818

Performance and Reliability of Solid Tantalum Capacitors at Cryogenic Conditions

NASA Technical Reports Server (NTRS)

Teverovsky, Alexander

2006-01-01

Performance of different types of solid tantalum capacitors was evaluated at room and low temperatures, down to 15 K. The effect of temperature on frequency dependencies of capacitance, effective series resistances (ESR), leakage currents, and breakdown voltages has been investigated and analyzed. To assess thermo-mechanical robustness of the parts, several groups of loose capacitors and those soldered on FR4 boards were subjected to multiple (up to 500) temperature cycles between room temperature and 77 K. Experiments and mathematical modeling have shown that degradation in tantalum capacitors at low temperatures is mostly due to increasing resistance of the manganese cathode layer, resulting in substantial decrease of the roll-off frequency. Absorption currents follow a power law, I approximately t(sup -m), with the exponent m varying from 0.8 to 1.1. These currents do not change significantly at cryogenic conditions and the value of the exponent remains the same down to 15 K. Variations of leakage currents with voltage can be described by Pool-Frenkel and Schottky mechanisms of conductivity, with the Schottky mechanism prevailing at cryogenic conditions. Breakdown voltages of tantalum capacitors increase and the probability of scintillations decreases at cryogenic temperatures. However, breakdown voltages measured during surge current testing decrease at liquid nitrogen (LN) compared to room-temperature conditions. Results of temperature cycling suggest that tantalum capacitors are capable of withstanding multiple exposures to cryogenic conditions, but the probability of failures varies for different part types.

Impact of open-core threading dislocations on the performance of AlGaN metal-semiconductor-metal photodetectors

NASA Astrophysics Data System (ADS)

Walde, S.; Brendel, M.; Zeimer, U.; Brunner, F.; Hagedorn, S.; Weyers, M.

2018-04-01

The influence of open-core threading dislocations on the bias-dependent external quantum efficiency (EQE) of bottom-illuminated Al0.5Ga0.5N/AlN metal-semiconductor-metal (MSM) photodetectors (PDs) is presented. These defects originate at the Al0.5Ga0.5N/AlN interface and terminate on the Al0.5Ga0.5N surface as hexagonal prisms. They work as electrically active paths bypassing the Al0.5Ga0.5N absorber layer and therefore alter the behavior of the MSM PDs under bias voltage. This effect is included in the model of carrier collection in the MSM PDs showing a good agreement with the experimental data. While such dislocations usually limit the device performance, the MSM PDs benefit by high EQE at a reduced bias voltage while maintaining a low dark current.

Probing molecular orientation of P3HT nanofibers in fiber-based organic solar cells

NASA Astrophysics Data System (ADS)

Yoon, Sangcheol; Han, Yaeeun; Hwang, Inchan

2018-01-01

Molecular orientation of conjugated polymers plays a key role in exciton generation/separation and charge transport, and thus significantly influence photovoltaic devices. Herein, we fabricated fiber-based organic solar cells and investigated the photovoltaic parameters with different diameters of fibers and PCBM diffusion. The open-circuit voltage that varies with molecular orientation whether it is face-on or edge-on was observed to differ. The investigation of the open-circuit voltage dependence reveals that thick fibers have core/shell like structures with different orientations. Thick fibers have face-on in the core and edge-on orientations in the shell. The face-on orientations are not preferentially formed in thin fibers, but the PCBM diffusion can induce face-on orientations that exist within the intermixed phase. Our results may shed a light on better understanding on fiber-based solar cells and suggest a way toward improving photovoltaic efficiency. [Figure not available: see fulltext.

Temperature dependence of an AlInP 63Ni betavoltaic cell

NASA Astrophysics Data System (ADS)

Butera, S.; Lioliou, G.; Krysa, A. B.; Barnett, A. M.

2016-10-01

In this paper, the performance of an Al0.52In0.48P 63Ni radioisotope cell is reported over the temperature range of -20 °C to 140 °C. A 400 μm diameter p+-i-n+ (2 μm i-layer) Al0.52In0.48P mesa photodiode was used as a conversion device in a novel betavoltaic cell. Dark current measurements on the Al0.52In0.48P detector showed that the saturation current increased increasing the temperature, while the ideality factor decreased. The effects of the temperature on the key cell parameters were studied in detail showing that the open circuit voltage, the maximum output power, and the internal conversion efficiency decreased when the temperature was increased. At -20 °C, an open circuit voltage and a maximum output power of 0.52 V and 0.28 pW, respectively, were measured.

Connexin and Pannexin hemichannels are regulated by redox potential

PubMed Central

Retamal, Mauricio A.

2014-01-01

Connexins (Cxs) and Pannexins (Panxs) are two non-related protein families, having both the property to form hemichannels at the plasma membrane. There are 21 genes coding for different Cx based proteins and only 3 for Panx. Under physiological conditions, these hemichannels (Cxs and Panxs) present a low open probability, but when open, they allow the release of signaling molecules to the extracellular space. However, under pathological conditions, these hemichannels increase their open probability, inducing important lysis of metabolites, and ionic imbalance, which in turn induce the massive entry of Ca+2 to the cell. Actually, it is well recognized that Cxs and Panxs based channels play an important role in several diseases and -in many cases- this is associated with an aberrant hemichannel opening. Hemichannel opening and closing are controlled by a plethora of signaling including changes of the voltage plasma membrane, protein-protein interactions, and several posttranslational modifications, including protein cleavage, phosphorylation, glycosylation, hydroxylation and S-nitrosylation, among others. In particular, it has been recently shown that the cellular redox status modulates the opening/closing and permeability of at least Cx43, Cx46, and Panx1 hemichannels. Thus, for example, the gaseous transmitter nitric oxide (NO) can induce the S-nitrosylation of these proteins modulating in turn several of their properties. The reason is that the redox status of a cell is fundamental to set their response to the environment and also plays an important role in several pathologies. In this review, I will discuss how NO and other molecules associated with redox signaling modulate Cxs and Panx hemichannels properties. PMID:24611056

Molecular analysis of the Na+ channel blocking actions of the novel class I anti-arrhythmic agent RSD 921

PubMed Central

Pugsley, Michael K; Goldin, Alan L

1999-01-01

RSD 921 is a novel, structurally unique, class I Na+ channel blocking drug under development as a local anaesthetic agent and possibly for the treatment of cardiac arrhythmias. The effects of RSD 921 on wild-type heart, skeletal muscle, neuronal and non-inactivating IFMQ3 mutant neuronal Na+ channels expressed in Xenopus laevis oocytes were examined using a two-electrode voltage clamp.RSD 921 produced similarly potent tonic block of all three wild-type channel isoforms, with EC50 values between 35 and 47 μM, whereas the EC50 for block of the IFMQ3 mutant channel was 110±5.5 μM.Block of Na+ channels by RSD 921 was concentration and use-dependent, with marked frequency-dependent block of heart channels and mild frequency-dependent block of skeletal muscle, wild-type neuronal and IFMQ3 mutant channels.RSD 921 produced a minimal hyperpolarizing shift in the steady-state voltage-dependence of inactivation of all three wild-type channel isoforms.Open channel block of the IFMQ3 mutant channel was best fit with a first order blocking scheme with kon equal to 0.11±0.012×106 M−1 s−1 and koff equal to 12.5±2.5 s−1, resulting in KD of 117±31 μM. Recovery from open channel block occurred with a time constant of 14±2.7 s−1.These results suggest that RSD 921 preferentially interacts with the open state of the Na+ channel, and that the drug may produce potent local anaesthetic or anti-arrhythmic action under conditions of shortened action potentials, such as during anoxia or ischaemia. PMID:10369450

Molecular analysis of the Na+ channel blocking actions of the novel class I anti-arrhythmic agent RSD 921.

PubMed

Pugsley, M K; Goldin, A L

1999-05-01

RSD 921 is a novel, structurally unique, class I Na+ channel blocking drug under development as a local anaesthetic agent and possibly for the treatment of cardiac arrhythmias. The effects of RSD 921 on wild-type heart, skeletal muscle, neuronal and non-inactivating IFMQ3 mutant neuronal Na+ channels expressed in Xenopus laevis oocytes were examined using a two-electrode voltage clamp. RSD 921 produced similarly potent tonic block of all three wild-type channel isoforms, with EC50 values between 35 and 47 microM, whereas the EC50 for block of the IFMQ3 mutant channel was 110+5.5 microM. Block of Na+ channels by RSD 921 was concentration and use-dependent, with marked frequency-dependent block of heart channels and mild frequency-dependent block of skeletal muscle, wild-type neuronal and IFMQ3 mutant channels. RSD 921 produced a minimal hyperpolarizing shift in the steady-state voltage-dependence of inactivation of all three wild-type channel isoforms. Open channel block of the IFMQ3 mutant channel was best fit with a first order blocking scheme with k(on) equal to 0.11+/-0.012x10(6) M(-1) s(-1) and k(off) equal to 12.5+/-2.5 s(-1), resulting in KD of 117+/-31 microM. Recovery from open channel block occurred with a time constant of 14+/-2.7 s(-1). These results suggest that RSD 921 preferentially interacts with the open state of the Na+ channel, and that the drug may produce potent local anaesthetic or anti-arrhythmic action under conditions of shortened action potentials, such as during anoxia or ischaemia.

APPLIED OPTICS. Voltage-tunable circular photogalvanic effect in silicon nanowires.

PubMed

Dhara, Sajal; Mele, Eugene J; Agarwal, Ritesh

2015-08-14

Electronic bands in crystals can support nontrivial topological textures arising from spin-orbit interactions, but purely orbital mechanisms can realize closely related dynamics without breaking spin degeneracies, opening up applications in materials containing only light elements. One such application is the circular photogalvanic effect (CPGE), which is the generation of photocurrents whose magnitude and polarity depend on the chirality of optical excitation. We show that the CPGE can arise from interband transitions at the metal contacts to silicon nanowires, where inversion symmetry is locally broken by an electric field. Bias voltage that modulates this field further controls the sign and magnitude of the CPGE. The generation of chirality-dependent photocurrents in silicon with a purely orbital-based mechanism will enable new functionalities in silicon that can be integrated with conventional electronics. Copyright © 2015, American Association for the Advancement of Science.

The First Extracellular Linker Is Important for Several Aspects of the Gating Mechanism of Human TRPA1 Channel

PubMed Central

Marsakova, Lenka; Barvik, Ivan; Zima, Vlastimil; Zimova, Lucie; Vlachova, Viktorie

2017-01-01

Transient receptor potential ankyrin 1 (TRPA1) is an excitatory ion channel involved in pain, inflammation and itching. This channel gates in response to many irritant and proalgesic agents, and can be modulated by calcium and depolarizing voltage. While the closed-state structure of TRPA1 has been recently resolved, also having its open state is essential for understanding how this channel works. Here we use molecular dynamics simulations combined with electrophysiological measurements and systematic mutagenesis to predict and explore the conformational changes coupled to the expansion of the presumptive channel's lower gate. We show that, upon opening, the upper part of the sensor module approaches the pore domain of an adjacent subunit and the conformational dynamics of the first extracellular flexible loop may govern the voltage-dependence of multimodal gating, thereby serving to stabilize the open state of the channel. These results are generally important in understanding the structure and function of TRPA1 and offer new insights into the gating mechanism of TRPA1 and related channels. PMID:28197074

Chemical sensors are hybrid-input memristors

NASA Astrophysics Data System (ADS)

Sysoev, V. I.; Arkhipov, V. E.; Okotrub, A. V.; Pershin, Y. V.

2018-04-01

Memristors are two-terminal electronic devices whose resistance depends on the history of input signal (voltage or current). Here we demonstrate that the chemical gas sensors can be considered as memristors with a generalized (hybrid) input, namely, with the input consisting of the voltage, analyte concentrations and applied temperature. The concept of hybrid-input memristors is demonstrated experimentally using a single-walled carbon nanotubes chemical sensor. It is shown that with respect to the hybrid input, the sensor exhibits some features common with memristors such as the hysteretic input-output characteristics. This different perspective on chemical gas sensors may open new possibilities for smart sensor applications.

Voltage Dependence of a Neuromodulator-Activated Ionic Current.

PubMed

Gray, Michael; Golowasch, Jorge

2016-01-01

The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca(2+), but that, in conditions of low Ca(2+), calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca(2+)/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR.

Voltage Dependence of a Neuromodulator-Activated Ionic Current123

PubMed Central

2016-01-01

Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

The probability of quantal secretion near a single calcium channel of an active zone.

PubMed Central

Bennett, M R; Farnell, L; Gibson, W G

2000-01-01

A Monte Carlo analysis has been made of calcium dynamics and quantal secretion at microdomains in which the calcium reaches very high concentrations over distances of <50 nm from a channel and for which calcium dynamics are dominated by diffusion. The kinetics of calcium ions in microdomains due to either the spontaneous or evoked opening of a calcium channel, both of which are stochastic events, are described in the presence of endogenous fixed and mobile buffers. Fluctuations in the number of calcium ions within 50 nm of a channel are considerable, with the standard deviation about half the mean. Within 10 nm of a channel these numbers of ions can give rise to calcium concentrations of the order of 100 microM. The temporal changes in free calcium and calcium bound to different affinity indicators in the volume of an entire varicosity or bouton following the opening of a single channel are also determined. A Monte Carlo analysis is also presented of how the dynamics of calcium ions at active zones, after the arrival of an action potential and the stochastic opening of a calcium channel, determine the probability of exocytosis from docked vesicles near the channel. The synaptic vesicles in active zones are found docked in a complex with their calcium-sensor associated proteins and a voltage-sensitive calcium channel, forming a secretory unit. The probability of quantal secretion from an isolated secretory unit has been determined for different distances of an open calcium channel from the calcium sensor within an individual unit: a threefold decrease in the probability of secretion of a quantum occurs with a doubling of the distance from 25 to 50 nm. The Monte Carlo analysis also shows that the probability of secretion of a quantum is most sensitive to the size of the single-channel current compared with its sensitivity to either the binding rates of the sites on the calcium-sensor protein or to the number of these sites that must bind a calcium ion to trigger exocytosis of a vesicle. PMID:10777721

Identification of a vacuolar proton channel that triggers the bioluminescent flash in dinoflagellates.

PubMed

Rodriguez, Juan D; Haq, Saddef; Bachvaroff, Tsvetan; Nowak, Kristine F; Nowak, Scott J; Morgan, Deri; Cherny, Vladimir V; Sapp, Maredith M; Bernstein, Steven; Bolt, Andrew; DeCoursey, Thomas E; Place, Allen R; Smith, Susan M E

2017-01-01

In 1972, J. Woodland Hastings and colleagues predicted the existence of a proton selective channel (HV1) that opens in response to depolarizing voltage across the vacuole membrane of bioluminescent dinoflagellates and conducts protons into specialized luminescence compartments (scintillons), thereby causing a pH drop that triggers light emission. HV1 channels were subsequently identified and demonstrated to have important functions in a multitude of eukaryotic cells. Here we report a predicted protein from Lingulodinium polyedrum that displays hallmark properties of bona fide HV1, including time-dependent opening with depolarization, perfect proton selectivity, and characteristic ΔpH dependent gating. Western blotting and fluorescence confocal microscopy of isolated L. polyedrum scintillons immunostained with antibody to LpHV1 confirm LpHV1's predicted organellar location. Proteomics analysis demonstrates that isolated scintillon preparations contain peptides that map to LpHV1. Finally, Zn2+ inhibits both LpHV1 proton current and the acid-induced flash in isolated scintillons. These results implicate LpHV1 as the voltage gated proton channel that triggers bioluminescence in L. polyedrum, confirming Hastings' hypothesis. The same channel likely mediates the action potential that communicates the signal along the tonoplast to the scintillon.

Identification of a vacuolar proton channel that triggers the bioluminescent flash in dinoflagellates

PubMed Central

Rodriguez, Juan D.; Haq, Saddef; Bachvaroff, Tsvetan; Nowak, Kristine F.; Nowak, Scott J.; Morgan, Deri; Cherny, Vladimir V.; Sapp, Maredith M.; Bernstein, Steven; Bolt, Andrew; DeCoursey, Thomas E.; Place, Allen R.; Smith, Susan M. E.

2017-01-01

In 1972, J. Woodland Hastings and colleagues predicted the existence of a proton selective channel (HV1) that opens in response to depolarizing voltage across the vacuole membrane of bioluminescent dinoflagellates and conducts protons into specialized luminescence compartments (scintillons), thereby causing a pH drop that triggers light emission. HV1 channels were subsequently identified and demonstrated to have important functions in a multitude of eukaryotic cells. Here we report a predicted protein from Lingulodinium polyedrum that displays hallmark properties of bona fide HV1, including time-dependent opening with depolarization, perfect proton selectivity, and characteristic ΔpH dependent gating. Western blotting and fluorescence confocal microscopy of isolated L. polyedrum scintillons immunostained with antibody to LpHV1 confirm LpHV1’s predicted organellar location. Proteomics analysis demonstrates that isolated scintillon preparations contain peptides that map to LpHV1. Finally, Zn2+ inhibits both LpHV1 proton current and the acid-induced flash in isolated scintillons. These results implicate LpHV1 as the voltage gated proton channel that triggers bioluminescence in L. polyedrum, confirming Hastings’ hypothesis. The same channel likely mediates the action potential that communicates the signal along the tonoplast to the scintillon. PMID:28178296

Retigabine holds KV7 channels open and stabilizes the resting potential

PubMed Central

Corbin-Leftwich, Aaron; Mossadeq, Sayeed M.; Ha, Junghoon; Ruchala, Iwona; Le, Audrey Han Ngoc

2016-01-01

The anticonvulsant Retigabine is a KV7 channel agonist used to treat hyperexcitability disorders in humans. Retigabine shifts the voltage dependence for activation of the heteromeric KV7.2/KV7.3 channel to more negative potentials, thus facilitating activation. Although the molecular mechanism underlying Retigabine’s action remains unknown, previous studies have identified the pore region of KV7 channels as the drug’s target. This suggested that the Retigabine-induced shift in voltage dependence likely derives from the stabilization of the pore domain in an open (conducting) conformation. Testing this idea, we show that the heteromeric KV7.2/KV7.3 channel has at least two open states, which we named O1 and O2, with O2 being more stable. The O1 state was reached after short membrane depolarizations, whereas O2 was reached after prolonged depolarization or during steady state at the typical neuronal resting potentials. We also found that activation and deactivation seem to follow distinct pathways, suggesting that the KV7.2/KV7.3 channel activity displays hysteresis. As for the action of Retigabine, we discovered that this agonist discriminates between open states, preferentially acting on the O2 state and further stabilizing it. Based on these findings, we proposed a novel mechanism for the therapeutic effect of Retigabine whereby this drug reduces excitability by enhancing the resting potential open state stability of KV7.2/KV7.3 channels. To address this hypothesis, we used a model for action potential (AP) in Xenopus laevis oocytes and found that the resting membrane potential became more negative as a function of Retigabine concentration, whereas the threshold potential for AP firing remained unaltered. PMID:26880756

Retigabine holds KV7 channels open and stabilizes the resting potential.

PubMed

Corbin-Leftwich, Aaron; Mossadeq, Sayeed M; Ha, Junghoon; Ruchala, Iwona; Le, Audrey Han Ngoc; Villalba-Galea, Carlos A

2016-03-01

The anticonvulsant Retigabine is a KV7 channel agonist used to treat hyperexcitability disorders in humans. Retigabine shifts the voltage dependence for activation of the heteromeric KV7.2/KV7.3 channel to more negative potentials, thus facilitating activation. Although the molecular mechanism underlying Retigabine's action remains unknown, previous studies have identified the pore region of KV7 channels as the drug's target. This suggested that the Retigabine-induced shift in voltage dependence likely derives from the stabilization of the pore domain in an open (conducting) conformation. Testing this idea, we show that the heteromeric KV7.2/KV7.3 channel has at least two open states, which we named O1 and O2, with O2 being more stable. The O1 state was reached after short membrane depolarizations, whereas O2 was reached after prolonged depolarization or during steady state at the typical neuronal resting potentials. We also found that activation and deactivation seem to follow distinct pathways, suggesting that the KV7.2/KV7.3 channel activity displays hysteresis. As for the action of Retigabine, we discovered that this agonist discriminates between open states, preferentially acting on the O2 state and further stabilizing it. Based on these findings, we proposed a novel mechanism for the therapeutic effect of Retigabine whereby this drug reduces excitability by enhancing the resting potential open state stability of KV7.2/KV7.3 channels. To address this hypothesis, we used a model for action potential (AP) in Xenopus laevis oocytes and found that the resting membrane potential became more negative as a function of Retigabine concentration, whereas the threshold potential for AP firing remained unaltered. © 2016 Corbin-Leftwich et al.

Domain IV voltage-sensor movement is both sufficient and rate limiting for fast inactivation in sodium channels.

PubMed

Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron

2013-08-01

Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.

Modeling recombination processes and predicting energy conversion efficiency of dye sensitized solar cells from first principles

NASA Astrophysics Data System (ADS)

Ma, Wei; Meng, Sheng

2014-03-01

We present a set of algorithms based on solo first principles calculations, to accurately calculate key properties of a DSC device including sunlight harvest, electron injection, electron-hole recombination, and open circuit voltages. Two series of D- π-A dyes are adopted as sample dyes. The short circuit current can be predicted by calculating the dyes' photo absorption, and the electron injection and recombination lifetime using real-time time-dependent density functional theory (TDDFT) simulations. Open circuit voltage can be reproduced by calculating energy difference between the quasi-Fermi level of electrons in the semiconductor and the electrolyte redox potential, considering the influence of electron recombination. Based on timescales obtained from real time TDDFT dynamics for excited states, the estimated power conversion efficiency of DSC fits nicely with the experiment, with deviation below 1-2%. Light harvesting efficiency, incident photon-to-electron conversion efficiency and the current-voltage characteristics can also be well reproduced. The predicted efficiency can serve as either an ideal limit for optimizing photovoltaic performance of a given dye, or a virtual device that closely mimicking the performance of a real device under different experimental settings.

Magnetic field dependence of spin torque switching in nanoscale magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Yang, Liu; Rowlands, Graham; Katine, Jordan; Langer, Juergen; Krivorotov, Ilya

2012-02-01

Magnetic random access memory based on spin transfer torque effect in nanoscale magnetic tunnel junctions (STT-RAM) is emerging as a promising candidate for embedded and stand-alone computer memory. An important performance parameter of STT-RAM is stability of its free magnetic layer against thermal fluctuations. Measurements of the free layer switching probability as a function of sub-critical voltage at zero effective magnetic field (read disturb rate or RDR measurements) have been proposed as a method for quantitative evaluation of the free layer thermal stability at zero voltage. In this presentation, we report RDR measurement as a function of external magnetic field, which provide a test of the RDR method self-consistency and reliability.

Acetylcholine-induced current in perfused rat myoballs

PubMed Central

1980-01-01

Spherical "myoballs" were grown under tissue culture conditions from striated muscle of neonatal rat thighs. The myoballs were examined electrophysiologically with a suction pipette which was used to pass current and perfuse internally. A microelectrode was used to record membrane potential. Experiments were performed with approximately symmetrical (intracellular and extracellular) sodium aspartate solutions. The resting potential, acetylcholine (ACh) reversal potential, and sodium channel reversal potential were all approximately 0 mV. ACh-induced currents were examined by use of both voltage jumps and voltage ramps in the presence of iontophoretically applied agonist. The voltage-jump relaxations had a single exponential time-course. The time constant, tau, was exponentially related to membrane potential, increasing e-fold for 81 mV hyperpolarization. The equilibrium current- voltage relationship was also approximately exponential, from -120 to +81 mV, increasing e-fold for 104 mV hyperpolarization. The data are consistent with a first-order gating process in which the channel opening rate constant is slightly voltage dependent. The instantaneous current-voltage relationship was sublinear in the hyperpolarizing direction. Several models are discussed which can account for the nonlinearity. Evidence is presented that the "selectivity filter" for the ACh channel is located near the intracellular membrane surface. PMID:7381423

Ionic Dependence of Reversal Voltage of the Light Response in Limulus Ventral Photoreceptors

PubMed Central

Brown, J. E.; Mote, M. I.

1974-01-01

The light-induced current as measured using a voltage clamp (holding voltage at resting potential) is attenuated when sodium ions in the bathing solution, Nao, are replaced by Tris, choline, or Li or when NaCl is replaced by sucrose. After replacement of NaCl by sucrose, the reversal voltage, V rev, for the light response becomes more negative. In this case, the slope of the V rev vs. log Nao near Nao = 425 mM is approximately 55 mV/decade increase of Nao (mean for 13 cells). The slope decreases at lower values of Nao. Choline is not impermeant and partially substitutes for Na; the slope of V rev vs. log Nao is 20 mV/decade (mean for three cells). V rev does not change when Na is replaced by Li. Decreases in the bath concentrations of Ca, Mg, Cl, or K do not affect V rev. When Nao = 212 mM, V rev becomes more positive when Ko is increased. Thus, light induces a change in membrane permeability to Na and probably also to K. PMID:4817353

Methods/Labor Standards Application Program - Phase IV

DTIC Science & Technology

1985-01-01

Engine Platform a. Pressure switch b. Compressor motor c. Voltage regulator d. Open and clean generator exciter and main windings S3 . Main Collector...clean motors b. Slip rings Gantry #3 Annual: S2. Engine Platform a. Pressure switch b. Compressor motor Voltage regulator d. Open and clean generator...Travel Motors Open and clean motorsa. b. Slip rings Gantry #4 S2 . S3. S4 . S5 . Engine Platform a. Pressure switch b. Compressor motor Voltage regulator

Block of the delayed rectifier current (IK) by the 5-HT3 antagonists ondansetron and granisetron in feline ventricular myocytes.

PubMed Central

de Lorenzi, F G; Bridal, T R; Spinelli, W

1994-01-01

1. We investigated the effects of two 5-HT3 antagonists, ondansetron and granisetron, on the action potential duration (APD) and the delayed rectifier current (IK) of feline isolated ventricular myocytes. Whole-cell current and action potential recordings were performed at 37 degrees C with the patch clamp technique. 2. Ondansetron and granisetron blocked IK with a KD of 1.7 +/- 1.0 and 4.3 +/- 1.7 microM, respectively. At a higher concentration (30 microM), both drugs blocked the inward rectifier (IKl). 3. The block of IK was dependent on channel activation. Both drugs slowed the decay of IK tail currents and produced a crossover with the pre-drug current trace. These results are consistent with block and unblock from the open state of the channel. 4. Granisetron showed an intrinsic voltage-dependence as the block increased with depolarization. The equivalent voltage-dependency of block (delta) was 0.10 +/- 0.04, suggesting that granisetron blocks from the intracellular side at a binding site located 10% across the transmembrane electrical field. 5. Ondansetron (1 microM) and granisetron (3 microM) prolonged APD by about 30% at 0.5 Hz. The prolongation of APD by ondansetron was abolished at faster frequencies (3 Hz) showing reverse rate dependence. 6. In conclusion, the 5-HT3 antagonists, ondansetron and granisetron, are open state blockers of the ventricular delayed rectifier and show a clear class III action. PMID:7834204

Structure of a eukaryotic cyclic nucleotide-gated channel

PubMed Central

Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

2018-01-01

Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

Physical mechanisms for reduction of the breakdown voltage in the circuit of a rod lightning protector with an opening microswitch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobrov, Yu. K.; Zhuravkov, I. V.; Ostapenko, E. I.

2010-12-15

The effect of air gap breakdown voltage reduction in the circuit with an opening microswitch is substantiated from the physical point of view. This effect can be used to increase the efficiency of lightning protection system with a rod lightning protector. The processes which take place in the electric circuit of a lightning protector with a microswitch during a voltage breakdown are investigated. Openings of the microswitch are shown to lead to resonance overvoltages in the dc circuit and, as a result, efficient reduction in the breakdown voltage in a lightning protector-thundercloud air gap.

Ethanol-mediated relaxation of guinea pig urinary bladder smooth muscle: involvement of BK and L-type Ca2+ channels

PubMed Central

Malysz, John; Afeli, Serge A. Y.; Provence, Aaron

2013-01-01

Mechanisms underlying ethanol (EtOH)-induced detrusor smooth muscle (DSM) relaxation and increased urinary bladder capacity remain unknown. We investigated whether the large conductance Ca2+-activated K+ (BK) channels or L-type voltage-dependent Ca2+ channels (VDCCs), major regulators of DSM excitability and contractility, are targets for EtOH by patch-clamp electrophysiology (conventional and perforated whole cell and excised patch single channel) and isometric tension recordings using guinea pig DSM cells and isolated tissue strips, respectively. EtOH at 0.3% vol/vol (∼50 mM) enhanced whole cell BK currents at +30 mV and above, determined by the selective BK channel blocker paxilline. In excised patches recorded at +40 mV and ∼300 nM intracellular Ca2+ concentration ([Ca2+]), EtOH (0.1–0.3%) affected single BK channels (mean conductance ∼210 pS and blocked by paxilline) by increasing the open channel probability, number of open channel events, and open dwell-time constants. The amplitude of single BK channel currents and unitary conductance were not altered by EtOH. Conversely, at ∼10 μM but not ∼2 μM intracellular [Ca2+], EtOH (0.3%) decreased the single BK channel activity. EtOH (0.3%) affected transient BK currents (TBKCs) by either increasing frequency or decreasing amplitude, depending on the basal level of TBKC frequency. In isolated DSM strips, EtOH (0.1–1%) reduced the amplitude and muscle force of spontaneous phasic contractions. The EtOH-induced DSM relaxation, except at 1%, was attenuated by paxilline. EtOH (1%) inhibited L-type VDCC currents in DSM cells. In summary, we reveal the involvement of BK channels and L-type VDCCs in mediating EtOH-induced urinary bladder relaxation accommodating alcohol-induced diuresis. PMID:24153429

Three methionine residues located within the regulator of conductance for K+ (RCK) domains confer oxidative sensitivity to large-conductance Ca2+-activated K+ channels.

PubMed

Santarelli, Lindsey Ciali; Wassef, Ramez; Heinemann, Stefan H; Hoshi, Toshinori

2006-03-01

Methionine-directed oxidation of the human Slo1 potassium channel (hSlo1) shifts the half-activation voltage by -30 mV and markedly slows channel deactivation at low concentrations of intracellular Ca2+ ([Ca2+]i). We demonstrate here that the contemporaneous mutation of M536, M712 and M739 to leucine renders the channel functionally insensitive to methionine oxidation caused by the oxidant chloramine-T (Ch-T) without altering other functional characteristics. Coexpression with the auxiliary beta1 subunit fails to restore the full oxidative sensitivity to this triple mutant channel. The Ch-T effect is mediated specifically by M536, M712 and M739 because even small changes in this residue combination interfere with the ability to remove the oxidant sensitivity following mutation. Replacement of M712 or M739, but not M536, with the hydrophilic residue glutamate largely mimics oxidation of the channel and essentially removes the Ch-T sensitivity, suggesting that M712 and M739 may be part of a hydrophobic pocket disrupted by oxidation of non-polar methionine to the more hydrophilic methionine sulfoxide. The increase in wild-type hSlo1 open probability caused by methionine oxidation disappears at high [Ca2+]i and biophysical modelling of the Ch-T effect on steady-state activation implicates a decrease in the allosteric coupling between Ca2+ binding and the pore. The dramatic increase in open probability at low [Ca2+]i especially within the physiological voltage range suggests that oxidation of M536, M712 or M739 may enhance the Slo1 BK activity during conditions of oxidative stress, such as those associated with ischaemia-reperfusion and neurodegenerative disease, or in response to metabolic cues.

Rapid kinetics of endocytosis at rod photoreceptor synapses depends upon endocytic load and calcium.

PubMed

Cork, Karlene M; Thoreson, Wallace B

2014-05-01

Release from rods is triggered by the opening of L-type Ca2+ channels that lie beneath synaptic ribbons. After exocytosis, vesicles are retrieved by compensatory endocytosis. Previous work showed that endocytosis is dynamin-dependent in rods but dynamin-independent in cones. We hypothesized that fast endocytosis in rods may also differ from cones in its dependence upon the amount of Ca2+ influx and/or endocytic load. We measured exocytosis and endocytosis from membrane capacitance (C m) changes evoked by depolarizing steps in voltage clamped rods from tiger salamander retinal slices. Similar to cones, the time constant for endocytosis in rods was quite fast, averaging <200 ms. We manipulated Ca2+ influx and the amount of vesicle release by altering the duration and voltage of depolarizing steps. Unlike cones, endocytosis kinetics in rods slowed after increasing Ca2+ channel activation with longer step durations or more strongly depolarized voltage steps. Endocytosis kinetics also slowed as Ca2+ buffering was decreased by replacing BAPTA (10 or 1 mM) with the slower Ca2+ buffer EGTA (5 or 0.5 mM) in the pipette solution. These data provide further evidence that endocytosis mechanisms differ in rods and cones and suggest that endocytosis in rods is regulated by both endocytic load and local Ca2+ levels.

Rapid kinetics of endocytosis at rod photoreceptor synapses depends upon endocytic load and calcium

PubMed Central

CORK, KARLENE M.; THORESON, WALLACE B.

2015-01-01

Release from rods is triggered by the opening of L-type Ca2+ channels that lie beneath synaptic ribbons. After exocytosis, vesicles are retrieved by compensatory endocytosis. Previous work showed that endocytosis is dynamin-dependent in rods but dynamin-independent in cones. We hypothesized that fast endocytosis in rods may also differ from cones in its dependence upon the amount of Ca2+ influx and/or endocytic load. We measured exocytosis and endocytosis from membrane capacitance (Cm) changes evoked by depolarizing steps in voltage clamped rods from tiger salamander retinal slices. Similar to cones, the time constant for endocytosis in rods was quite fast, averaging <200 ms. We manipulated Ca2+ influx and the amount of vesicle release by altering the duration and voltage of depolarizing steps. Unlike cones, endocytosis kinetics in rods slowed after increasing Ca2+ channel activation with longer step durations or more strongly depolarized voltage steps. Endocytosis kinetics also slowed as Ca2+ buffering was decreased by replacing BAPTA (10 or 1 mM) with the slower Ca2+ buffer EGTA (5 or 0.5 mM) in the pipette solution. These data provide further evidence that endocytosis mechanisms differ in rods and cones and suggest that endocytosis in rods is regulated by both endocytic load and local Ca2+ levels. PMID:24735554

Amorphous/crystalline silicon interface passivation: Ambient-temperature dependence and implications for solar cell performance

DOE PAGES

Seif, Johannes P.; Krishnamani, Gopal; Demaurex, Benedicte; ...

2015-03-02

Silicon heterojunction (SHJ) solar cells feature amorphous silicon passivation films, which enable very high voltages. We report how such passivation increases with operating temperature for amorphous silicon stacks involving doped layers and decreases for intrinsic-layer-only passivation. We discuss the implications of this phenomenon on the solar cell's temperature coefficient, which represents an important figure-of-merit for the energy yield of devices deployed in the field. We show evidence that both open-circuit voltage (Voc) and fill factor (FF) are affected by these variations in passivation and quantify these temperature-mediated effects, compared with those expected from standard diode equations. We confirm that devicesmore » with high Voc values at 25°C show better high-temperature performance. Thus, we also argue that the precise device architecture, such as the presence of charge-transport barriers, may affect the temperature-dependent device performance as well.« less

Intrinsic inhomogeneous barrier height at the n-TiO2/p-Si hole-blocking junction

NASA Astrophysics Data System (ADS)

Kumar, Mohit; Singh, Ranveer; Som, Tapobrata

2018-01-01

Using Kelvin probe force microscopy (KPFM) and temperature-dependent current-voltage characteristics, we study the charge transport across an n-TiO2/p-Si heterojunction. In particular, the KPFM result shows a variation in the work function at the TiO2 surface. On the other hand, temperature-dependent current-voltage characteristics depict a non-ideal hole-blocking behaviour of the same. In addition, the measured barrier height is found to decrease with temperature and does not follow the thermionic emission theory, strongly suggesting an inhomogeneous nature of the barrier. The observed barrier inhomogeneity is attributed to the nanoscale height modulation, arising due to the growth dynamics of TiO2 and corroborates well with the KPFM map. The presented results will open a new avenue to understand the charge transport in TiO2-based nanoscale devices.

Dependence of Actuation Strain of Dielectric Elastomer on Equi-biaxial, Pure Shear and Uniaxial Modes of Pre-stretching

NASA Astrophysics Data System (ADS)

Kumar, Ajeet; Ahmad, Dilshad; Patra, Karali

2018-02-01

A dielectric elastomer is capable of large deformation under three basic modes of deformation: equi-biaxial, pure shear and uniaxial. Pre-stretching of dielectric elastomer improves the actuation strain appreciably. Experimental results shows that pre-stretching using equal biaxial mode can result to higher actuation strain compared to other two modes of stretching, i.e., uniaxial and pure shear. However, analysis of the experimental results shows that the actuation strain is independent of the modes of pre-stretching rather it is dependent upon the thickness stretch. For same thickness stretch at a particular voltage, the actuation strain is almost similar for all pre-stretching modes. Power trend lines are obtained to predict the actuation strain at any thickness stretch for a particular voltage. The present analysis opens the door to easily design the actuators, sensors and energy harvesting devices.

Light intensity dependence of open-circuit voltage and short-circuit current of polymer/fullerene solar cells

NASA Astrophysics Data System (ADS)

Koster, L. Jan A.; Mihailetchi, Valentin D.; Ramaker, Robert; Xie, Hangxing; Blom, Paul W. M.

2006-04-01

The open-circuit voltage (Voc) of polymer/fullerene bulk heterojunction solar cells is investigated as a function of light intensity for different temperatures. The observed photogenerated current and V oc are at variance with classical p-n junctionbased models. The influence of light intensity and recombination strength on V oc is consistently explained by a model based on the notion that the quasi-Fermi levels are constant throughout the device, including both drift and diffusion of charge carriers. The light intensity dependence of the short-circuit current density (J sc) is also addressed. A typical feature of polymer/fullerene based solar cells is that Jsc does not scale exactly linearly with light intensity (I). Instead, a power law relationship is found given by Jsc~ Iα, where α ranges from 0.9 to 1. In a number of reports this deviation from unity is attributed to the occurrence of bimolecular recombination. We demonstrate that the dependence of the photocurrent in bulk heterojunction solar cells is governed by the build-up of space charge in the device. The occurrence of space-charge stems from the difference in charge carrier mobility of electrons and holes. In blends of poly(3-hexylthiophene) and 6,6- phenyl C61-butyric acid methyl ester this mobility difference can be tuned in between one and three orders of magnitude, depending on the annealing conditions. This allows us to experimentally verify the relation between space charge build-up and intensity dependence of Jsc. Model calculations confirm that bimolecular recombination leads only to a typical loss of 1% of all free charge carriers at Jsc for these devices. Therefore, bimolecular recombination plays only a minor role as compared to the effect of space charge in the intensity dependence of J sc.

Fe²⁺ block and permeation of CaV3.1 (α1G) T-type calcium channels: candidate mechanism for non-transferrin-mediated Fe²⁺ influx.

PubMed

Lopin, Kyle V; Gray, I Patrick; Obejero-Paz, Carlos A; Thévenod, Frank; Jones, Stephen W

2012-12-01

Iron is a biologically essential metal, but excess iron can cause damage to the cardiovascular and nervous systems. We examined the effects of extracellular Fe²⁺ on permeation and gating of Ca(V)3.1 channels stably transfected in HEK293 cells, by using whole-cell recording. Precautions were taken to maintain iron in the Fe²⁺ state (e.g., use of extracellular ascorbate). With the use of instantaneous I-V currents (measured after strong depolarization) to isolate the effects on permeation, extracellular Fe²⁺ rapidly blocked currents with 2 mM extracellular Ca²⁺ in a voltage-dependent manner, as described by a Woodhull model with K(D) = 2.5 mM at 0 mV and apparent electrical distance δ = 0.17. Extracellular Fe²⁺ also shifted activation to more-depolarized voltages (by ∼10 mV with 1.8 mM extracellular Fe²⁺) somewhat more strongly than did extracellular Ca²⁺ or Mg²⁺, which is consistent with a Gouy-Chapman-Stern model with surface charge density σ = 1 e(-)/98 Ų and K(Fe) = 4.5 M⁻¹ for extracellular Fe²⁺. In the absence of extracellular Ca²⁺ (and with extracellular Na⁺ replaced by TEA), Fe²⁺ carried detectable, whole-cell, inward currents at millimolar concentrations (73 ± 7 pA at -60 mV with 10 mM extracellular Fe²⁺). With a two-site/three-barrier Eyring model for permeation of Ca(V)3.1 channels, we estimated a transport rate for Fe²⁺ of ∼20 ions/s for each open channel at -60 mV and pH 7.2, with 1 μM extracellular Fe²⁺ (with 2 mM extracellular Ca²⁺). Because Ca(V)3.1 channels exhibit a significant "window current" at that voltage (open probability, ∼1%), Ca(V)3.1 channels represent a likely pathway for Fe²⁺ entry into cells with clinically relevant concentrations of extracellular Fe²⁺.

Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

NASA Astrophysics Data System (ADS)

Smallwood, Jeremy; Swenson, David E.

2011-06-01

Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest "peaks" and "valleys" of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

Laser beam apparatus and method for analyzing solar cells

DOEpatents

Staebler, David L.

1980-01-01

A laser beam apparatus and method for analyzing, inter alia, the current versus voltage curve at the point of illumination on a solar cell and the open circuit voltage of a solar cell. The apparatus incorporates a lock-in amplifier, and a laser beam light chopper which permits the measurement of the AC current of the solar cell at an applied DC voltage at the position on the solar cell where the cell is illuminated and a feedback scheme which permits the direct scanning measurements of the open circuit voltage. The accuracy of the measurement is a function of the intensity and wavelength of the laser light with respect to the intensity and wavelength distribution of sunlight and the percentage the dark current is at the open circuit voltage to the short circuit current of the solar cell.

External pH effects on the depolarization-activated K channels in guard cell protoplasts of Vicia faba

PubMed Central

1994-01-01

Previous studies reveal that the pH of the apoplastic solution in the guard cell walls may vary between 7.2 and 5.1 in closed and open stomata, respectively. During these aperture and pH changes, massive K+ fluxes cross the cellular plasma membrane driving the osmotic turgor and volume changes of guard cells. Therefore, we examined the effect of extracellular pH on the depolarization-activated K channels (KD channels), which constitute the K+ efflux pathway, in the plasma membrane of Vicia faba guard cell protoplasts. We used patch clamp, both in whole cells as well as in excised outside-out membrane patches. Approximately 500 KD channels, at least, could be activated by depolarization in one protoplast (density: approximately 0.6 micron-2). Acidification from ph 8.1 to 4.4 decreased markedly the whole-cell conductance, GK, of the KD channels, shifted its voltage dependence, GK- EM, to the right on the voltage axis, slowed the rate of activation and increased the rate of deactivation, whereas the single channel conductance was not affected significantly. Based on the GK-EM shifts, the estimated average negative surface charge spacing near the KD channel is 39 A. To quantify the effects of protons on the rates of transitions between the hypothesized conformational states of the channels, we fitted the experimental macroscopic steady state conductance-voltage relationship and the voltage dependence of time constants of activation and deactivation, simultaneously, with a sequential three-state model CCO. In terms of this model, protonation affects the voltage-dependent properties via a decrease in localized, rather than homogeneous, surface charge sensed by the gating moieties. In terms of either the CO or CCO model, the protonation of a site with a pKa of 4.8 decreases the voltage-independent number of channels, N, that are available for activation by depolarization. PMID:8035163

Functional ion channels in human pulmonary artery smooth muscle cells: Voltage-dependent cation channels

PubMed Central

Firth, Amy L.; Remillard, Carmelle V.; Platoshyn, Oleksandr; Fantozzi, Ivana; Ko, Eun A.; Yuan, Jason X.-J.

2011-01-01

The activity of voltage-gated ion channels is critical for the maintenance of cellular membrane potential and generation of action potentials. In turn, membrane potential regulates cellular ion homeostasis, triggering the opening and closing of ion channels in the plasma membrane and, thus, enabling ion transport across the membrane. Such transmembrane ion fluxes are important for excitation–contraction coupling in pulmonary artery smooth muscle cells (PASMC). Families of voltage-dependent cation channels known to be present in PASMC include voltage-gated K+ (Kv) channels, voltage-dependent Ca2+-activated K+ (Kca) channels, L- and T- type voltage-dependent Ca2+ channels, voltage-gated Na+ channels and voltage-gated proton channels. When cells are dialyzed with Ca2+-free K+- solutions, depolarization elicits four components of 4-aminopyridine (4-AP)-sensitive Kvcurrents based on the kinetics of current activation and inactivation. In cell-attached membrane patches, depolarization elicits a wide range of single-channel K+ currents, with conductances ranging between 6 and 290 pS. Macroscopic 4-AP-sensitive Kv currents and iberiotoxin-sensitive Kca currents are also observed. Transcripts of (a) two Na+ channel α-subunit genes (SCN5A and SCN6A), (b) six Ca2+ channel α–subunit genes (α1A, α1B, α1X, α1D, α1Eand α1G) and many regulatory subunits (α2δ1, β1-4, and γ6), (c) 22 Kv channel α–subunit genes (Kv1.1 - Kv1.7, Kv1.10, Kv2.1, Kv3.1, Kv3.3, Kv3.4, Kv4.1, Kv4.2, Kv5.1, Kv 6.1-Kv6.3, Kv9.1, Kv9.3, Kv10.1 and Kv11.1) and three Kv channel β-subunit genes (Kvβ1-3) and (d) four Kca channel α–subunit genes (Sloα1 and SK2-SK4) and four Kca channel β-subunit genes (Kcaβ1-4) have been detected in PASMC. Tetrodotoxin-sensitive and rapidly inactivating Na+ currents have been recorded with properties similar to those in cardiac myocytes. In the presence of 20 mM external Ca2+, membrane depolarization from a holding potential of -100 mV elicits a rapidly inactivating T-type Ca2+ current, while depolarization from a holding potential of -70 mV elicits a slowly inactivating dihydropyridine-sensitive L-type Ca2+ current. This review will focus on describing the electrophysiological properties and molecular identities of these voltage-dependent cation channels in PASMC and their contribution to the regulation of pulmonary vascular function and its potential role in the pathogenesis of pulmonary vascular disease. PMID:21927714

Diverse inhibitory actions of quaternary ammonium cholinesterase inhibitors on Torpedo nicotinic ACh receptors transplanted to Xenopus oocytes

PubMed Central

Olivera-Bravo, Silvia; Ivorra, Isabel; Morales, Andrés

2007-01-01

Background and purpose: This work was aimed at comparing and analysing the effects and mechanisms of action of the quaternary ammonium cholinesterase inhibitors (QChEIs) BW284c51, decamethonium and edrophonium, on nicotinic ACh receptor (nAChR) function. Experimental approach: nAChRs purified from Torpedo electroplax were transplanted to oocytes and currents elicited by ACh (IACh) either alone or in presence of these QChEIs were recorded. Key results: None of the QChEIs, by itself, elicited changes in membrane conductance; however, when co-applied with ACh, all of them decreased IACh in a concentration-dependent way. The mechanisms of nAChR inhibition were different for these QChEIs. BW284c51 blockade was non-competitive and voltage-dependent, although it also affected the nH of the dose-response curve. By contrast, decamethonium and edrophonium inhibition, at –60 mV, was apparently competitive and did not modify either desensitisation or nH. Decamethonium effects were voltage-independent and washed out slowly after its removal; by contrast, edrophonium blockade had strong voltage dependence and its effects disappeared quickly after its withdrawal. Analysis of the voltage-dependent blockade indicated that BW284c51 bound to a shallow site into the channel pore, whereas edrophonium bound to a deeper locus. Accordingly, additive inhibitory effects on IACh were found among any pairs of these QChEIs. Conclusions and implications: The tested QChEIs bound to the nAChR at several and different loci, which might account for their complex inhibitory behaviour, acting both as allosteric effectors and, in the case of BW284c51 and edrophonium, as open channel blockers. PMID:17572698

Dependence of the photovoltaic performance of pseudomorphic InGaN/GaN multiple-quantum-well solar cells on the active region thickness

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mukhtarova, Anna; Valdueza-Felip, Sirona; Redaelli, Luca

2016-04-18

We investigate the photovoltaic performance of pseudomorphic In{sub 0.1}Ga{sub 0.9}N/GaN multiple-quantum well (MQW) solar cells as a function of the total active region thickness. An increase in the number of wells from 5 to 40 improves the short-circuit current and the open-circuit voltage, resulting in a 10-fold enhancement of the overall conversion efficiency. Further increasing the number of wells leads to carrier collection losses due to an incomplete depletion of the active region. Capacitance-voltage measurements point to a hole diffusion length of 48 nm in the MQW region.

Alterations in voltage-sensing of the mitochondrial permeability transition pore in ANT1-deficient cells

PubMed Central

Doczi, Judit; Torocsik, Beata; Echaniz-Laguna, Andoni; Mousson de Camaret, Bénédicte; Starkov, Anatoly; Starkova, Natalia; Gál, Aniko; Molnár, Mária J; Kawamata, Hibiki; Manfredi, Giovanni; Adam-Vizi, Vera; Chinopoulos, Christos

2016-01-01

The probability of mitochondrial permeability transition (mPT) pore opening is inversely related to the magnitude of the proton electrochemical gradient. The module conferring sensitivity of the pore to this gradient has not been identified. We investigated mPT’s voltage-sensing properties elicited by calcimycin or H2O2 in human fibroblasts exhibiting partial or complete lack of ANT1 and in C2C12 myotubes with knocked-down ANT1 expression. mPT onset was assessed by measuring in situ mitochondrial volume using the ‘thinness ratio’ and the ‘cobalt-calcein’ technique. De-energization hastened calcimycin-induced swelling in control and partially-expressing ANT1 fibroblasts, but not in cells lacking ANT1, despite greater losses of mitochondrial membrane potential. Matrix Ca2+ levels measured by X-rhod-1 or mitochondrially-targeted ratiometric biosensor 4mtD3cpv, or ADP-ATP exchange rates did not differ among cell types. ANT1-null fibroblasts were also resistant to H2O2-induced mitochondrial swelling. Permeabilized C2C12 myotubes with knocked-down ANT1 exhibited higher calcium uptake capacity and voltage-thresholds of mPT opening inferred from cytochrome c release, but intact cells showed no differences in calcimycin-induced onset of mPT, irrespective of energization and ANT1 expression, albeit the number of cells undergoing mPT increased less significantly upon chemically-induced hypoxia than control cells. We conclude that ANT1 confers sensitivity of the pore to the electrochemical gradient. PMID:27221760

Open channel noise. I. Noise in acetylcholine receptor currents suggests conformational fluctuations.

PubMed

Sigworth, F J

1985-05-01

The random passage of ions through an open channel is expected to result in shot noise fluctuations in the channel current. The patch-clamp technique now allows fluctuations of this size to be observed in single-channel currents. In the experiments reported here the acetylcholine-induced currents in cultured rat muscle cells were analyzed; fluctuations were found that were considerably larger than expected for shot noise. A low-frequency component, which was fitted with a Lorentzian, was examined in detail; it appears to arise from fluctuations in channel conductance of approximately 3% on a time scale of 1 ms. The characteristic relaxation time is voltage dependent and temperature dependent (Q10 approximately equal to 3) suggesting that the fluctuations arise from conformational fluctuations in the channel protein.

Effects of cycling temperatures on the voltage fade phenomenon in 0.5Li 2 MnO 3 ·0.5LiNi 0.375 Mn 0.375 Co 0.25 O 2 cathodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vu, Anh; Walker, Lee K.; Bareño, Javier

2015-04-01

The rate of voltage fade in 0.5Li2MnO3•0.5LiNi0.375Mn0.375Co0.25O2 cathodes was measured in half-cells in a temperature range of 25 to 55°C. On the basis of the dependence of the values of the open-circuit potential with cycle count and temperature, the voltage fade phenomenon seems to consist of two chemical processes: one that can be described using a parabolic rate law and another that uses a linear-with-time law. As the cycling temperature increased, the relative contributions of the two processes changed. On the basis of the overall rate versus temperature data, we believe the two processes may be in competition with onemore » another.« less

Controlling the layer localization of gapless states in bilayer graphene with a gate voltage

NASA Astrophysics Data System (ADS)

Jaskólski, W.; Pelc, M.; Bryant, Garnett W.; Chico, Leonor; Ayuela, A.

2018-04-01

Experiments in gated bilayer graphene with stacking domain walls present topological gapless states protected by no-valley mixing. Here we research these states under gate voltages using atomistic models, which allow us to elucidate their origin. We find that the gate potential controls the layer localization of the two states, which switches non-trivially between layers depending on the applied gate voltage magnitude. We also show how these bilayer gapless states arise from bands of single-layer graphene by analyzing the formation of carbon bonds between layers. Based on this analysis we provide a model Hamiltonian with analytical solutions, which explains the layer localization as a function of the ratio between the applied potential and interlayer hopping. Our results open a route for the manipulation of gapless states in electronic devices, analogous to the proposed writing and reading memories in topological insulators.

Quantum transport under ac drive from the leads: A Redfield quantum master equation approach

NASA Astrophysics Data System (ADS)

Purkayastha, Archak; Dubi, Yonatan

2017-08-01

Evaluating the time-dependent dynamics of driven open quantum systems is relevant for a theoretical description of many systems, including molecular junctions, quantum dots, cavity-QED experiments, cold atoms experiments, and more. Here, we formulate a rigorous microscopic theory of an out-of-equilibrium open quantum system of noninteracting particles on a lattice weakly coupled bilinearly to multiple baths and driven by periodically varying thermodynamic parameters like temperature and chemical potential of the bath. The particles can be either bosonic or fermionic and the lattice can be of any dimension and geometry. Based on the Redfield quantum master equation under Born-Markov approximation, we derive a linear differential equation for an equal time two point correlation matrix, sometimes also called a single-particle density matrix, from which various physical observables, for example, current, can be calculated. Various interesting physical effects, such as resonance, can be directly read off from the equations. Thus, our theory is quite general and gives quite transparent and easy-to-calculate results. We validate our theory by comparing with exact numerical simulations. We apply our method to a generic open quantum system, namely, a double quantum dot coupled to leads with modulating chemical potentials. The two most important experimentally relevant insights from this are as follows: (i) Time-dependent measurements of current for symmetric oscillating voltages (with zero instantaneous voltage bias) can point to the degree of asymmetry in the system-bath coupling and (ii) under certain conditions time-dependent currents can exceed time-averaged currents by several orders of magnitude, and can therefore be detected even when the average current is below the measurement threshold.

Sodium Fluxes through Nonselective Cation Channels in the Plasma Membrane of Protoplasts from Arabidopsis Roots1

PubMed Central

Demidchik, Vadim; Tester, Mark

2002-01-01

The aim of the present work was to characterize Na+ currents through nonselective cation channels (NSCCs) in protoplasts derived from root cells of Arabidopsis. The procedure of the protoplast isolation was modified to increase the stability of Arabidopsis root protoplasts in low external Ca2+ by digesting tissue in elevated Ca2+. Experiments in whole-cell and outside-out modes were carried out. We found that Na+ currents in Arabidopsis root protoplasts were mediated by cation channels that were insensitive to externally applied tetraethylammonium+ and verapamil, had no time-dependent activation (permanently opened or completely activated within 1–2 ms), were voltage independent, and were weakly selective for monovalent cations. The selectivity sequence was as follows: K+ (1.49) > NH4+ (1.24) > Rb+ (1.15) ≈ Cs+ (1.10) ≈ Na+ (1.00) > Li+ (0.73) > tetraethylammonium+ (0.47). Arabidopsis root NSCCs were blocked by H+ (pK ≈ 6.0), Ca2+ (K1/2 ≈ 0.1 mm), Ba2+, Zn2+, La3+, Gd3+, quinine, and the His modifier diethylpyrocarbonate. They were insensitive to most organic blockers (nifedipine, verapamil, flufenamate, and amiloride) and to the SH-group modifier p-chloromercuriphenyl sulfonic acid. Voltage-insensitive, Ca2+-sensitive single channels were also resolved. Properties of Arabidopsis root NSCCs are discussed and compared with characteristics of similar conductances studied previously in plants and animals. It is suggested that NSCCs present a distinct group of plant ion channels, mediating toxic Na+ influx to the cell and probably having other important roles in physiological processes of plants. PMID:11842142

Quantum Mechanical Calculations of Free Energy and Open-Circuit Voltage in Lattice Modeled Organic Photovoltaic Devices

NASA Astrophysics Data System (ADS)

Lankevich, Vladimir; Bittner, Eric

In organic photovoltaic devices (OPVs), initially bound electron and hole can take many different paths to dissociate and become free charge carriers. This leads to the increase in their density of states and therefore increase in the entropy of the system. Accurate description of the energy barriers that charges have to overcome, therefore requires calculation of the free energy. Free energy of an OPV is directly related to its open-circuit voltage and depends only on few important parameters such as average life-time of a charge-transfer state, average energy of the charge-transfer state and energetic disorder in the system. We extend these ideas to the quantum mechanical simulations of the dissociation in the lattice modeled bulk-heterojunction system. We observe average excitonic and free energies that agree with theoretical predictions and the number of experimental results from previous studies. We study effects of the energy disorder and importance of the dimensionality and morphology in materials such as polymer-fullerene blends.

Achieving 12.8% Efficiency by Simultaneously Improving Open-Circuit Voltage and Short-Circuit Current Density in Tandem Organic Solar Cells.

PubMed

Qin, Yunpeng; Chen, Yu; Cui, Yong; Zhang, Shaoqing; Yao, Huifeng; Huang, Jiang; Li, Wanning; Zheng, Zhong; Hou, Jianhui

2017-06-01

Tandem organic solar cells (TOSCs), which integrate multiple organic photovoltaic layers with complementary absorption in series, have been proved to be a strong contender in organic photovoltaic depending on their advantages in harvesting a greater part of the solar spectrum and more efficient photon utilization than traditional single-junction organic solar cells. However, simultaneously improving open circuit voltage (V oc ) and short current density (J sc ) is a still particularly tricky issue for highly efficient TOSCs. In this work, by employing the low-bandgap nonfullerene acceptor, IEICO, into the rear cell to extend absorption, and meanwhile introducing PBDD4T-2F into the front cell for improving V oc , an impressive efficiency of 12.8% has been achieved in well-designed TOSC. This result is also one of the highest efficiencies reported in state-of-the-art organic solar cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

PubMed

Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

2017-08-29

Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

Voltage-gated calcium flux mediates Escherichia coli mechanosensation

PubMed Central

Weekley, R. Andrew; Dodd, Benjamin J. T.

2017-01-01

Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli, including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings. PMID:28808010

Recombination in liquid-filled ionization chambers beyond the Boag limit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brualla-González, L.; Roselló, J.

Purpose: The high mass density and low mobilities of charge carriers can cause important recombination in liquid-filled ionization chambers (LICs). Saturation correction methods have been proposed for LICs. Correction methods for pulsed irradiation are based on Boag equation. However, Boag equation assumes that the charge ionized by one pulse is fully collected before the arrival of the next pulse. This condition does not hold in many clinical beams where the pulse repetition period may be shorter than the charge collection time, causing overlapping between charge carriers ionized by different pulses, and Boag equation is not applicable there. In this work,more » the authors present an experimental and numerical characterization of collection efficiencies in LICs beyond the Boag limit, with overlapping between charge carriers ionized by different pulses. Methods: The authors have studied recombination in a LIC array for different dose-per-pulse, pulse repetition frequency, and polarization voltage values. Measurements were performed in a Truebeam Linac using FF and FFF modalities. Dose-per-pulse and pulse repetition frequency have been obtained by monitoring the target current with an oscilloscope. Experimental collection efficiencies have been obtained by using a combination of the two-dose-rate method and ratios to the readout of a reference chamber (CC13, IBA). The authors have also used numerical simulation to complement the experimental data. Results: The authors have found that overlap significantly increases recombination in LICs, as expected. However, the functional dependence of collection efficiencies on the dose-per-pulse does not change (a linear dependence has been observed in the near-saturation region for different degrees of overlapping, the same dependence observed in the nonoverlapping scenario). On the other hand, the dependence of collection efficiencies on the polarization voltage changes in the overlapping scenario and does not follow that of Boag equation, the reason being that changing the polarization voltage also affects the charge collection time, thus changing the amount of overlapping. Conclusions: These results have important consequences for saturation correction methods for LICs. On one hand, the two-dose-rate method, which relies on the functional dependence of the collection efficiencies on dose-per-pulse, can also be used in the overlapping situation, provided that the two measurements needed to feed the method are performed at the same pulse repetition frequency (monitor unit rate). This result opens the door to computing collection efficiencies in LICs in many clinical setups where charge overlap in the LIC exists. On the other hand, correction methods based on the voltage-dependence of Boag equation like the three-voltage method or the modified two-voltage method will not work in the overlapping scenario due to the different functional dependence of collection efficiencies on the polarization voltage.« less

Extracellular protons enable activation of the calcium‐dependent chloride channel TMEM16A

PubMed Central

Cruz‐Rangel, Silvia; De Jesús‐Pérez, José J.; Aréchiga‐Figueroa, Iván A.; Rodríguez‐Menchaca, Aldo A.; Pérez‐Cornejo, Patricia; Hartzell, H. Criss

2017-01-01

Key points The calcium‐activated chloride channel TMEM16A provides a pathway for chloride ion movements that are key in preventing polyspermy, allowing fluid secretion, controlling blood pressure, and enabling gastrointestinal activity.TMEM16A is opened by voltage‐dependent calcium binding and regulated by permeant anions and intracellular protons.Here we show that a low proton concentration reduces TMEM16A activity while maximum activation is obtained when the external proton concentration is high.In addition, protonation conditions determine the open probability of TMEM16A without changing its calcium sensitivity. External glutamic acid 623 (E623) is key for TMEM16A's ability to respond to external protons.At physiological pH, E623 is un‐protonated and TMEM16A is activated when intracellular calcium increases; however, under acidic conditions E623 is partially protonated and works synergistically with intracellular calcium to activate the channel. These findings are critical for understanding physiological and pathological processes that involve changes in pH and chloride flux via TMEM16A. Abstract Transmembrane protein 16A (TMEM16A), also known as ANO1, the pore‐forming subunit of a Ca2+‐dependent Cl− channel (CaCC), is activated by direct, voltage‐dependent, binding of intracellular Ca2+. Endogenous CaCCs are regulated by extracellular protons; however, the molecular basis of such regulation remains unidentified. Here, we evaluated the effects of different extracellular proton concentrations ([H+]o) on mouse TMEM16A expressed in HEK‐293 cells using whole‐cell and inside‐out patch‐clamp recordings. We found that increasing the [H+]o from 10−10 to 10−5.5 m caused a progressive increase in the chloride current (I Cl) that is described by titration of a protonatable site with pK = 7.3. Protons regulate TMEM16A in a voltage‐independent manner, regardless of channel state (open or closed), and without altering its apparent Ca2+ sensitivity. Noise analysis showed that protons regulate TMEM16A by tuning its open probability without modifying the single channel current. We found a robust reduction of the proton effect at high [Ca2+]i. To identify protonation targets we mutated all extracellular glutamate and histidine residues and 4 of 11 aspartates. Most mutants were sensitive to protons. However, mutation that substituted glutamic acid (E) for glutamine (Q) at amino acid position 623 (E623Q) displayed a titration curve shifted to the left relative to wild type channels and the I Cl was nearly insensitive to proton concentrations between 10−5.5 and 10−9.0 m. Additionally, I Cl of the mutant containing an aspartic acid (D) to asparagine (N) substitution at position 405 (D405N) mutant was partially inhibited by a proton concentration of 10−5.5 m, but 10−9.0 m produced the same effect as in wild type. Based on our findings we propose that external protons titrate glutamic acid 623, which enables voltage activation of TMEM16A at non‐saturating [Ca2+]i. PMID:27859335

Temperature-dependence of L-type Ca(2+) current in ventricular cardiomyocytes of the Alaska blackfish (Dallia pectoralis).

PubMed

Kubly, Kerry L; Stecyk, Jonathan A W

2015-12-01

To lend insight into the overwintering strategy of the Alaska blackfish (Dallia pectoralis), we acclimated fish to 15 or 5 °C and then utilized whole-cell patch clamp to characterize the effects of thermal acclimation and acute temperature change on the density and kinetics of ventricular L-type Ca(2+) current (I Ca). Peak I Ca density at 5 °C (-1.1 ± 0.1 pA pF(-1)) was 1/8th that at 15 °C (-8.8 ± 0.6 pA pF(-1)). However, alterations of the Ca(2+)- and voltage-dependent inactivation properties of L-type Ca(2+) channels partially compensated against the decrease. The time constant tau (τ) for the kinetics of inactivation of I Ca was ~4.5 times greater at 5 °C than at 15 °C, and the voltage for half-maximal inactivation was shifted from -23.3 ± 1.0 mV at 15 °C to -19.8 ± 1.2 mV at 5 °C. These modifications increase the open probability of the channel and culminate in an approximate doubling of the L-type Ca(2+) window current, which contributes to approximately 15% of the maximal Ca(2+) conductance at 5 °C. Consequently, the charge density of I Ca (Q Ca) and the total Ca(2+) transferred through the L-type Ca(2+) channels (Δ[Ca(2+)]) were not as severely reduced at 5 °C as compared to peak I Ca density. In combination, the results suggest that while the Alaska blackfish substantially down-regulates I Ca with acclimation to low temperature, there is sufficient compensation in the kinetics of the L-type Ca(2+) channel to support the level of cardiac performance required for the fish to remain active throughout the winter.

Temperature-dependence of L-type Ca2+ current in ventricular cardiomyocytes of the Alaska blackfish (Dallia pectoralis)

PubMed Central

Kubly, Kerry L.; Stecyk, Jonathan A.W.

2016-01-01

Summary To lend insight into the overwintering strategy of the Alaska blackfish (Dallia pectoralis), we acclimated fish to 15°C or 5°C and then utilized whole-cell patch-clamp to characterize the effects of thermal acclimation and acute temperature change on the density and kinetics of ventricular L-type Ca2+ current (ICa). Peak ICa density at 5°C (−1.1± 0.1 pA pF−1) was 1/8th that at 15°C (−8.8 ± 0.6 pA pF−1). However, alterations of the Ca2+- and voltage-dependent inactivation properties of L-type Ca2+ channels partially compensated against the decrease. The time constant tau (τ) for the kinetics of inactivation of ICa was ~4.5-times greater at 5°C than at 15°C, and the voltage for half-maximal inactivation was shifted from −23.3 ± 1.0 mV at 15°C to - 19.8 ± 1.2 mV at 5°C. These modifications increase the open probability of the channel and culminated in an approximate doubling of the L-type Ca2+ window current, which contributed to approximately 15% of the maximal Ca2+ conductance at 5°C. Consequently, the charge density of ICa (QCa) and the total Ca2+ transferred through the L-type Ca channels (Δ[Ca2+]) were not as severely reduced at 5°C as compared to peak ICa density. In combination, the results suggest that while the Alaska blackfish substantially down-regulates ICa with acclimation to low temperature, there is sufficient compensation in the kinetics of the L-type Ca2+ channel to support the level of cardiac performance required for the fish to remain active throughout the winter. PMID:26439127

The theoretical link between voltage loss, reduction in field enhancement factor, and Fowler-Nordheim-plot saturation

NASA Astrophysics Data System (ADS)

Forbes, Richard G.

2017-03-01

With a large-area field electron emitter, when an individual post-like emitter is sufficiently resistive, and current through it is sufficiently large, then voltage loss occurs along it. This letter provides a simple analytical and conceptual demonstration that this voltage loss is directly and inextricably linked to a reduction in the field enhancement factor (FEF) at the post apex. A formula relating apex-FEF reduction to this voltage loss was obtained in the paper by Minoux et al. [Nano Lett. 5, 2135 (2005)] by fitting to numerical results from a Laplace solver. This letter derives the same formula analytically, by using a "floating sphere" model. The analytical proof brings out the underlying physics more clearly and shows that the effect is a general phenomenon, related to reduction in the magnitude of the surface charge in the most protruding parts of an emitter. Voltage-dependent FEF-reduction is one cause of "saturation" in Fowler-Nordheim (FN) plots. Another is a voltage-divider effect, due to measurement-circuit resistance. An integrated theory of both effects is presented. Both together, or either by itself, can cause saturation. Experimentally, if saturation occurs but voltage loss is small (<20 V, say), then saturation is more probably due to FEF-reduction than voltage division. In this case, existing treatments of electrostatic interaction ("shielding") between closely spaced emitters may need modification. Other putative causes of saturation exist, so the present theory is a partial story. Its extension seems possible and could lead to a more general physical understanding of the causes of FN-plot saturation.

Spin-Dependent Processes Measured without a Permanent Magnet.

PubMed

Fontanesi, Claudio; Capua, Eyal; Paltiel, Yossi; Waldeck, David H; Naaman, Ron

2018-05-07

A novel Hall circuit design that can be incorporated into a working electrode, which is used to probe spin-selective charge transfer and charge displacement processes, is reviewed herein. The general design of a Hall circuit based on a semiconductor heterostructure, which forms a shallow 2D electron gas and is used as an electrode, is described. Three different types of spin-selective processes have been studied with this device in the past: i) photoinduced charge exchange between quantum dots and the working electrode through chiral molecules is associated with spin polarization that creates a local magnetization and generates a Hall voltage; ii) charge polarization of chiral molecules by an applied voltage is accompanied by a spin polarization that generates a Hall voltage; and iii) cyclic voltammetry (current-voltage) measurements of electrochemical redox reactions that can be spin-analyzed by the Hall circuit to provide a third dimension (spin) in addition to the well-known current and voltage dimensions. The three studies reviewed open new doors into understanding both the spin current and the charge current in electronic materials and electrochemical processes. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A study of dielectric breakdown along insulators surrounding conductors in liquid argon

DOE PAGES

Lockwitz, Sarah; Jostlein, Hans

2016-03-22

High voltage breakdown in liquid argon is an important concern in the design of liquid argon time projection chambers, which are often used as neutrino and dark matter detectors. We have made systematic measurements of breakdown voltages in liquid argon along insulators surrounding negative rod electrodes where the breakdown is initiated at the anode. The measurements were performed in an open cryostat filled with commercial grade liquid argon exposed to air, and not the ultra-pure argon required for electron drift. While not addressing all high voltage concerns in liquid argon, these measurements have direct relevance to the design of highmore » voltage feedthroughs especially for averting the common problem of flash-over breakdown. The purpose of these tests is to understand the effects of materials, of breakdown path length, and of surface topology for this geometry and setup. We have found that the only material-specific effects are those due to their permittivity. We have found that the breakdown voltage has no dependence on the length of the exposed insulator. Lastly, a model for the breakdown mechanism is presented that can help inform future designs.« less

A study on the dependency of the open-circuit voltage on temperature and actual aging state of lithium-ion batteries

NASA Astrophysics Data System (ADS)

Farmann, Alexander; Sauer, Dirk Uwe

2017-04-01

The knowledge of nonlinear monotonic correlation between State-of-Charge (SoC) and open-circuit voltage (OCV) is necessary for an accurate battery state estimation in battery management systems. Among the main factors influencing the OCV behavior of lithium-ion batteries (LIBs) are aging, temperature and previous history of the battery. In order to develop an accurate OCV-based SoC estimator, it is necessary that the OCV behavior of the LIBs is sufficiently investigated and understood. In this study, the impact of the mentioned factors on OCV of LIBs at different aging states using various active materials (C/NMC, C/LFP, LTO/NMC) is investigated over a wide temperature range (from -20 °C to +45 °C) comprehensively. It is shown that temperature and aging of the battery influence the battery's relaxation behavior significantly where a linear dependence between the required relaxation time and the temperature can be assumed. Moreover, the required relaxation time increases with decreasing SoC and temperature. Furthermore, we state that for individual LIB, the OCV and the OCV hysteresis change over the battery lifetime. Based on the obtained results a simplified OCV model considering temperature correction term and aging of the battery is proposed.

Symmetry-breaking charge transfer in a zinc chlorodipyrrin acceptor for high open circuit voltage organic photovoltaics.

PubMed

Bartynski, Andrew N; Gruber, Mark; Das, Saptaparna; Rangan, Sylvie; Mollinger, Sonya; Trinh, Cong; Bradforth, Stephen E; Vandewal, Koen; Salleo, Alberto; Bartynski, Robert A; Bruetting, Wolfgang; Thompson, Mark E

2015-04-29

Low open-circuit voltages significantly limit the power conversion efficiency of organic photovoltaic devices. Typical strategies to enhance the open-circuit voltage involve tuning the HOMO and LUMO positions of the donor (D) and acceptor (A), respectively, to increase the interfacial energy gap or to tailor the donor or acceptor structure at the D/A interface. Here, we present an alternative approach to improve the open-circuit voltage through the use of a zinc chlorodipyrrin, ZCl [bis(dodecachloro-5-mesityldipyrrinato)zinc], as an acceptor, which undergoes symmetry-breaking charge transfer (CT) at the donor/acceptor interface. DBP/ZCl cells exhibit open-circuit voltages of 1.33 V compared to 0.88 V for analogous tetraphenyldibenzoperyflanthrene (DBP)/C60-based devices. Charge transfer state energies measured by Fourier-transform photocurrent spectroscopy and electroluminescence show that C60 forms a CT state of 1.45 ± 0.05 eV in a DBP/C60-based organic photovoltaic device, while ZCl as acceptor gives a CT state energy of 1.70 ± 0.05 eV in the corresponding device structure. In the ZCl device this results in an energetic loss between E(CT) and qV(OC) of 0.37 eV, substantially less than the 0.6 eV typically observed for organic systems and equal to the recombination losses seen in high-efficiency Si and GaAs devices. The substantial increase in open-circuit voltage and reduction in recombination losses for devices utilizing ZCl demonstrate the great promise of symmetry-breaking charge transfer in organic photovoltaic devices.

A conserved threonine in the S1-S2 loop of KV7.2 and K V7.3 channels regulates voltage-dependent activation.

PubMed

Füll, Yvonne; Seebohm, Guiscard; Lerche, Holger; Maljevic, Snezana

2013-06-01

The voltage-gated potassium channels KV7.2 and KV7.3 (KCNQ2/3 genes) play an important role in regulating neuronal excitability. More than 50 KCNQ2/3 mutations have been identified to cause an inherited form of epilepsy in newborns. For two of those (E119G and S122L) found in the S1-S2 region of KV7.2, we previously showed a decreased channel availability mainly at action potential subthreshold voltages caused by a slight depolarizing shift of the activation curve. Interestingly, recent studies revealed that a threonine residue within the S1-S2 loop, highly conserved among different classes of KV channels, is crucial for both their function and surface expression. To investigate the functional role of the homologous threonine residues in KV7.2 (T114) and KV7.3 (T144) channels, we replaced them with alanine and examined the electrophysiological properties using heterologous expression in CHO cells and whole cell patch clamping. Channels comprising mutant subunits yielded decreased potassium currents with slowed activation and accelerated deactivation kinetics. However, the most striking effect was a depolarizing shift in the voltage dependence of activation reaching +30 mV upon co-expression of both mutant subunits. Potential interactions of T114 within the channel were analyzed by creating a 3D homology model of KV7.2 in an open state suggesting that this residue plays a central role in the formation of a stable interface between the S1-S2 and the S5 segment helices. This could be the explanation why substitution of the conserved threonine in KV7.2 and KV7.3 channels destabilizes the open and favors the closed state of these channels.

Mutation of I696 and W697 in the TRP box of vanilloid receptor subtype I modulates allosteric channel activation.

PubMed

Gregorio-Teruel, Lucia; Valente, Pierluigi; González-Ros, José Manuel; Fernández-Ballester, Gregorio; Ferrer-Montiel, Antonio

2014-03-01

The transient receptor potential vanilloid receptor subtype I (TRPV1) channel acts as a polymodal sensory receptor gated by chemical and physical stimuli. Like other TRP channels, TRPV1 contains in its C terminus a short, conserved domain called the TRP box, which is necessary for channel gating. Substitution of two TRP box residues-I696 and W697-with Ala markedly affects TRPV1's response to all activating stimuli, which indicates that these two residues play a crucial role in channel gating. We systematically replaced I696 and W697 with 18 native l-amino acids (excluding cysteine) and evaluated the effect on voltage- and capsaicin-dependent gating. Mutation of I696 decreased channel activation by either voltage or capsaicin; furthermore, gating was only observed with substitution of hydrophobic amino acids. Substitution of W697 with any of the 18 amino acids abolished gating in response to depolarization alone, shifting the threshold to unreachable voltages, but not capsaicin-mediated gating. Moreover, vanilloid-activated responses of W697X mutants showed voltage-dependent gating along with a strong voltage-independent component. Analysis of the data using an allosteric model of activation indicates that mutation of I696 and W697 primarily affects the allosteric coupling constants of the ligand and voltage sensors to the channel pore. Together, our findings substantiate the notion that inter- and/or intrasubunit interactions at the level of the TRP box are critical for efficient coupling of stimulus sensing and gate opening. Perturbation of these interactions markedly reduces the efficacy and potency of the activating stimuli. Furthermore, our results identify these interactions as potential sites for pharmacological intervention.

Starting Circuit For Erasable Programmable Logic Device

NASA Technical Reports Server (NTRS)

Cole, Steven W.

1990-01-01

Voltage regulator bypassed to supply starting current. Starting or "pullup" circuit supplies large inrush of current required by erasable programmable logic device (EPLD) while being turned on. Operates only during such intervals of high demand for current and has little effect any other time. Performs needed bypass, acting as current-dependent shunt connecting battery or other source of power more nearly directly to EPLD. Input capacitor of regulator removed when starting circuit installed, reducing probability of damage to transistor in event of short circuit in or across load.

Open-loop frequency acquisition for suppressed-carrier biphase signals using one-pole arm filters

NASA Technical Reports Server (NTRS)

Shah, B.; Holmes, J. K.

1991-01-01

Open loop frequency acquisition performance is discussed for suppressed carrier binary phase shift keyed signals in terms of the probability of detecting the carrier frequency offset when the arms of the Costas loop detector have one pole filters. The approach, which does not require symbol timing, uses fast Fourier transforms (FFTs) to detect the carrier frequency offset. The detection probability, which depends on both the 3 dB arm filter bandwidth and the received symbol signal to noise ratio, is derived and is shown to be independent of symbol timing. It is shown that the performance of this technique is slightly better that other open loop acquisition techniques which use integrators in the arms and whose detection performance varies with symbol timing.

The Development and Practical Use of A New 24kV Dry Air Insulated Switchgear

NASA Astrophysics Data System (ADS)

Yoshida, Tadahiro; Yano, Tomotaka; Tohya, Nobumoto; Inoue, Naoaki; Arioka, Masahiro; Sato, Shinji; Takeuchi, Toshie

We have developed a new environmentally fitted 24kV cubicle-type gas insulated switchgear (C-GIS) applying our dry air insulation technology and the electromagnetic actuation technology. Firstly, we clarified the relationship between the breakdown field strength at the tip/edge of high-voltage electrode in dry air and the field utilization factor expressing non-uniformity of the insulation gap. Based on the relationship, we designed the most suitable configuration and arrangement of the parts such as high-voltage conductors, disconnecting blades and some mechanical parts in a gas vessel. We succeeded in reducing both the number of insulation barriers and their size, compared with the former product. To reduce them, we produced some sample gaps simulated a practical insulation gap in the C-GIS and investigated its breakdown voltage dependence on the barrier height. Secondly, to apply the electromagnetic actuators for the operation mechanisms of the vacuum circuit breaker, we developed a new coupled analysis method that estimates the movement of a plunger inside the electromagnetic actuator and the electric current flowing through a closing/opening coil. Based on the analysis method, we could reduce both the number of the parts and close/open energy 45% and 80%, respectively, compared with the former spring-charged mechanism.

Enhancement of delayed-rectifier potassium conductance by low concentrations of local anaesthetics in spinal sensory neurones

PubMed Central

Olschewski, Andrea; Wolff, Matthias; Bräu, Michael E; Hempelmann, Gunter; Vogel, Werner; Safronov, Boris V

2002-01-01

Combining the patch-clamp recordings in slice preparation with the ‘entire soma isolation' method we studied action of several local anaesthetics on delayed-rectifier K+ currents in spinal dorsal horn neurones.Bupivacaine, lidocaine and mepivacaine at low concentrations (1–100 μM) enhanced delayed-rectifier K+ current in intact neurones within the spinal cord slice, while exhibiting a partial blocking effect at higher concentrations (>100 μM). In isolated somata 0.1–10 μM bupivacaine enhanced delayed-rectifier K+ current by shifting its steady-state activation characteristic and the voltage-dependence of the activation time constant to more negative potentials by 10–20 mV.Detailed analysis has revealed that bupivacaine also increased the maximum delayed-rectifier K+ conductance by changing the open probability, rather than the unitary conductance, of the channel.It is concluded that local anaesthetics show a dual effect on delayed-rectifier K+ currents by potentiating them at low concentrations and partially suppressing at high concentrations. The phenomenon observed demonstrated the complex action of local anaesthetics during spinal and epidural anaesthesia, which is not restricted to a suppression of Na+ conductance only. PMID:12055132

Modeling of matter-wave solitons in a nonlinear inductor-capacitor network through a Gross-Pitaevskii equation with time-dependent linear potential

NASA Astrophysics Data System (ADS)

Kengne, E.; Lakhssassi, A.; Liu, W. M.

2017-08-01

A lossless nonlinear L C transmission network is considered. With the use of the reductive perturbation method in the semidiscrete limit, we show that the dynamics of matter-wave solitons in the network can be modeled by a one-dimensional Gross-Pitaevskii (GP) equation with a time-dependent linear potential in the presence of a chemical potential. An explicit expression for the growth rate of a purely growing modulational instability (MI) is presented and analyzed. We find that the potential parameter of the GP equation of the system does not affect the different regions of the MI. Neglecting the chemical potential in the GP equation, we derive exact analytical solutions which describe the propagation of both bright and dark solitary waves on continuous-wave (cw) backgrounds. Using the found exact analytical solutions of the GP equation, we investigate numerically the transmission of both bright and dark solitary voltage signals in the network. Our numerical studies show that the amplitude of a bright solitary voltage signal and the depth of a dark solitary voltage signal as well as their width, their motion, and their behavior depend on (i) the propagation frequencies, (ii) the potential parameter, and (iii) the amplitude of the cw background. The GP equation derived in this paper with a time-dependent linear potential opens up different ideas that may be of considerable theoretical interest for the management of matter-wave solitons in nonlinear L C transmission networks.

Local anesthetics disrupt energetic coupling between the voltage-sensing segments of a sodium channel.

PubMed

Muroi, Yukiko; Chanda, Baron

2009-01-01

Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.

Open-circuit voltage improvements in low-resistivity solar cells

NASA Technical Reports Server (NTRS)

Godlewski, M. P.; Klucher, T. M.; Mazaris, G. A.; Weizer, V. G.

1979-01-01

Mechanisms limiting the open-circuit voltage in 0.1 ohm-cm solar cells were investigated. It was found that a rather complicated multistep diffusion process could produce cells with significantly improved voltages. The voltage capabilities of various laboratory cells were compared independent of their absorption and collection efficiencies. This was accomplished by comparing the cells on the basis of their saturation currents or, equivalently, comparing their voltage outputs at a constant current-density level. The results show that for both the Lewis diffused emitter cell and the Spire ion-implanted emitter cell the base component of the saturation current is voltage controlling. The evidence for the University of Florida cells, although not very conclusive, suggests emitter control of the voltage in this device. The data suggest further that the critical voltage-limiting parameter for the Lewis cell is the electron mobility in the cell base.

Actions of Bupivacaine, a Widely Used Local Anesthetic, on NMDA Receptor Responses

PubMed Central

Paganelli, Meaghan A.

2015-01-01

NMDA receptors mediate excitatory neurotransmission in brain and spinal cord and play a pivotal role in the neurological disease state of chronic pain, which is caused by central sensitization. Bupivacaine is the indicated local anesthetic in caudal, epidural, and spinal anesthesia and is widely used clinically to manage acute and chronic pain. In addition to blocking Na+ channels, bupivacaine affects the activity of many other channels, including NMDA receptors. Importantly, bupivacaine inhibits NMDA receptor-mediated synaptic transmission in the dorsal horn of the spinal cord, an area critically involved in central sensitization. We used recombinant NMDA receptors expressed in HEK293 cells and found that increasing concentrations of bupivacaine decreased channel open probability in GluN2 subunit- and pH-independent manner by increasing the mean duration of closures and decreasing the mean duration of openings. Using kinetic modeling of one-channel currents, we attributed the observed current decrease to two main mechanisms: a voltage-dependent “foot-in-the-door” pore block and an allosteric gating effect. Further, the inhibition was state-independent because it occurred to the same degree whether the drug was applied before or after glutamate stimulation and was mediated by extracellular and intracellular inhibitory sites, via hydrophilic and hydrophobic pathways. These results predict that clinical doses of bupivacaine would decrease the peak and accelerate the decay of synaptic NMDA receptor currents during normal synaptic transmission. These quantitative predictions inform possible applications of bupivacaine as preventative and therapeutic approaches in chronic pain. PMID:25589775

The sodium-activated potassium channel Slack is modulated by hypercapnia and acidosis.

PubMed

Ruffin, V A; Gu, X Q; Zhou, D; Douglas, R M; Sun, X; Trouth, C O; Haddad, G G

2008-01-24

Slack (Slo 2.2), a member of the Slo potassium channel family, is activated by both voltage and cytosolic factors, such as Na(+) ([Na(+)](i)) and Cl(-) ([Cl(-)](i)). Since the Slo family is known to play a role in hypoxia, and since hypoxia/ischemia is associated with an increase in H(+) and CO(2) intracellularly, we hypothesized that the Slack channel may be affected by changes in intracellular concentrations of CO(2) and H(+). To examine this, we expressed the Slack channel in Xenopus oocytes and the Slo 2.2 protein was allowed to be inserted into the plasma membrane. Inside-out patch recordings were performed to examine the response of Slack to different CO(2) concentrations (0.038%, 5%, 12%) and to different pH levels (6.3, 6.8, 7.3, 7.8, 8.3). In the presence of low [Na(+)](i) (5 mM), the Slack channel open probability decreased when exposed to decreased pH or increased CO(2) in a dose-dependent fashion (from 0.28+/-0.03, n=3, at pH 7.3 to 0.006+/-0.005, n=3, P=0.0004, at pH 6.8; and from 0.65+/-0.17, n=3, at 0.038% CO(2) to 0.22+/-0.07, n=3, P=0.04 at 12% CO(2)). In the presence of high [Na(+)](i) (45 mM), Slack open probability increased (from 0.03+/-0.01 at 5 mM [Na(+)](i), n=3, to 0.11+/-0.01, n=3, P=0.01) even in the presence of decreased pH (6.3). Since Slack activity increases significantly when exposed to increased [Na(+)](i), even in presence of increased H(+), we propose that Slack may play an important role in pathological conditions during which there is an increase in the intracellular concentrations of both acid and Na(+), such as in ischemia/hypoxia.

Improved High/Low Junction Silicon Solar Cell

NASA Technical Reports Server (NTRS)

Neugroschel, A.; Pao, S. C.; Lindholm, F. A.; Fossum, J. G.

1986-01-01

Method developed to raise value of open-circuit voltage in silicon solar cells by incorporating high/low junction in cell emitter. Power-conversion efficiency of low-resistivity silicon solar cell considerably less than maximum theoretical value mainly because open-circuit voltage is smaller than simple p/n junction theory predicts. With this method, air-mass-zero opencircuit voltage increased from 600 mV level to approximately 650 mV.

Characterization of perovskite solar cells: Towards a reliable measurement protocol

NASA Astrophysics Data System (ADS)

Zimmermann, Eugen; Wong, Ka Kan; Müller, Michael; Hu, Hao; Ehrenreich, Philipp; Kohlstädt, Markus; Würfel, Uli; Mastroianni, Simone; Mathiazhagan, Gayathri; Hinsch, Andreas; Gujar, Tanaji P.; Thelakkat, Mukundan; Pfadler, Thomas; Schmidt-Mende, Lukas

2016-09-01

Lead halide perovskite solar cells have shown a tremendous rise in power conversion efficiency with reported record efficiencies of over 20% making this material very promising as a low cost alternative to conventional inorganic solar cells. However, due to a differently severe "hysteretic" behaviour during current density-voltage measurements, which strongly depends on scan rate, device and measurement history, preparation method, device architecture, etc., commonly used solar cell measurements do not give reliable or even reproducible results. For the aspect of commercialization and the possibility to compare results of different devices among different laboratories, it is necessary to establish a measurement protocol which gives reproducible results. Therefore, we compare device characteristics derived from standard current density-voltage measurements with stabilized values obtained from an adaptive tracking of the maximum power point and the open circuit voltage as well as characteristics extracted from time resolved current density-voltage measurements. Our results provide insight into the challenges of a correct determination of device performance and propose a measurement protocol for a reliable characterisation which is easy to implement and has been tested on varying perovskite solar cells fabricated in different laboratories.

Leakage Current Induced by Energetic Disorder in Organic Bulk Heterojunction Solar Cells: Comprehending the Ultrahigh Loss of Open-Circuit Voltage at Low Temperatures

NASA Astrophysics Data System (ADS)

Yang, Wenchao; Luo, Yongsong; Guo, Pengfei; Sun, Haibin; Yao, Yao

2017-04-01

The open-circuit voltage (Voc ) of organic solar cells generally approaches its maximum obtainable values as the temperature decreases. However, recent experiments have revealed that the Voc may suffer from an ultrahigh loss at low temperatures. In order to verify this explanation and investigate the impacts of energetic disorder on the temperature-dependent behaviors of the Voc in general, we calculate the Voc-T plots with the drift-diffusion method under various device working parameters. With the disorder being incorporated into the device model by considering the disorder-suppressed (temperature-dependent) charge-carrier mobilities, it is found that the ultrahigh Voc losses cannot be reproduced under the Onsager-Braun-type charge generation rate. With the charge generation rate being constant or weakly dependent on temperature, for nonselective contacts, the Voc reduces drastically at low temperatures, while for selective contacts, the Voc increases monotonically with decreasing temperature. With higher carrier mobilities or smaller device thicknesses, the ultrahigh loss occurs at lower temperatures. The mechanism is that, since the disorder-suppressed charge mobilities give rise to both low charge-extraction efficiency and small bimolecular recombination rate, plenty of charge carriers can be extracted from the wrong electrode and can form a large leakage current, which counteracts the majority-carrier current and reduces the Voc at low temperatures. Our results thus highlight the essential role of charge-carrier kinetics, except for the charge-filling effect, on dominating the disorder-induced Voc losses.

Device physics of hydrogenated amorphous silicon solar cells

NASA Astrophysics Data System (ADS)

Liang, Jianjun

This dissertation reports measurements on and modeling of hydrogenated amorphous silicon (a-Si:H) nip solar cells. Cells with thicknesses from 200-900 nm were prepared at United Solar Ovonic LLC. The current density-voltage (J-V) relations were measured under laser illumination (685 nm wavelength, up to 200 mW/cm2) over the temperature range 240 K--350 K. The changes in the cells' open-circuit voltage during extended laser illumination (light-soaking) were measured, as were the cell properties in several light-soaked states. The J-V properties of cells in their as-deposited and light-soaked states converge at low-temperatures. Electromodulation spectra for the cells were also measured over the range 240 K--350 K to determine the temperature-dependent bandgap. These experimental results were compared to computer calculations of J-V relations using the AMPS ((c)Pennsylvania State University) computer code. Bandtail parameters (for electron and hole mobility and recombination) were consistent with published drift-mobility and transient photocurrent measurements on a-Si:H. The open-circuit voltage and power density measurements on as-deposited cells, as a function of temperature and thickness, were predicted well. The calculations support a general "hole mobility limited" approach to analyzing a-Si:H solar cells, and indicate that the doped electrode layers, the as-deposited density of dangling bonds, and the electron mobility are of secondary importance to as-deposited cells. For light-soaked a-Si:H solar cells, incorporation of a density of dangling bonds in the computer calculations accounted satisfactorily for the power and open-circuit voltage measurements, including the low-temperature convergence effect. The calculations indicate that, in the light-soaked state at room-temperature, electron recombination is split nearly evenly between holes trapped in the valence bandtail and holes trapped on dangling bonds. The result supports Stutzmann, Jackson, and Tsai's 1985 conjecture that dangling bond creation results only from bandtail recombination events. We compared the predictions of the hydrogen-collision model proposed by Branz with the kinetics of the open-circuit voltage as light-soaking progressed. We obtained satisfactory agreement for the initial phases of light-soaking with the conjecture that only bandtail recombination leads to dangling bond creation, and the computer calculations for this recombination channel's diminishment in the cell as the dangling bond density grows.

Comparison of Deterministic and Probabilistic Radial Distribution Systems Load Flow

NASA Astrophysics Data System (ADS)

Gupta, Atma Ram; Kumar, Ashwani

2017-12-01

Distribution system network today is facing the challenge of meeting increased load demands from the industrial, commercial and residential sectors. The pattern of load is highly dependent on consumer behavior and temporal factors such as season of the year, day of the week or time of the day. For deterministic radial distribution load flow studies load is taken as constant. But, load varies continually with a high degree of uncertainty. So, there is a need to model probable realistic load. Monte-Carlo Simulation is used to model the probable realistic load by generating random values of active and reactive power load from the mean and standard deviation of the load and for solving a Deterministic Radial Load Flow with these values. The probabilistic solution is reconstructed from deterministic data obtained for each simulation. The main contribution of the work is: Finding impact of probable realistic ZIP load modeling on balanced radial distribution load flow. Finding impact of probable realistic ZIP load modeling on unbalanced radial distribution load flow. Compare the voltage profile and losses with probable realistic ZIP load modeling for balanced and unbalanced radial distribution load flow.

Long‐term time‐dependent probabilities for the third Uniform California Earthquake Rupture Forecast (UCERF3)

USGS Publications Warehouse

Field, Edward; Biasi, Glenn P.; Bird, Peter; Dawson, Timothy E.; Felzer, Karen R.; Jackson, David A.; Johnson, Kaj M.; Jordan, Thomas H.; Madden, Christopher; Michael, Andrew J.; Milner, Kevin; Page, Morgan T.; Parsons, Thomas E.; Powers, Peter; Shaw, Bruce E.; Thatcher, Wayne R.; Weldon, Ray J.; Zeng, Yuehua

2015-01-01

The 2014 Working Group on California Earthquake Probabilities (WGCEP 2014) presents time-dependent earthquake probabilities for the third Uniform California Earthquake Rupture Forecast (UCERF3). Building on the UCERF3 time-independent model, published previously, renewal models are utilized to represent elastic-rebound-implied probabilities. A new methodology has been developed that solves applicability issues in the previous approach for un-segmented models. The new methodology also supports magnitude-dependent aperiodicity and accounts for the historic open interval on faults that lack a date-of-last-event constraint. Epistemic uncertainties are represented with a logic tree, producing 5,760 different forecasts. Results for a variety of evaluation metrics are presented, including logic-tree sensitivity analyses and comparisons to the previous model (UCERF2). For 30-year M≥6.7 probabilities, the most significant changes from UCERF2 are a threefold increase on the Calaveras fault and a threefold decrease on the San Jacinto fault. Such changes are due mostly to differences in the time-independent models (e.g., fault slip rates), with relaxation of segmentation and inclusion of multi-fault ruptures being particularly influential. In fact, some UCERF2 faults were simply too long to produce M 6.7 sized events given the segmentation assumptions in that study. Probability model differences are also influential, with the implied gains (relative to a Poisson model) being generally higher in UCERF3. Accounting for the historic open interval is one reason. Another is an effective 27% increase in the total elastic-rebound-model weight. The exact factors influencing differences between UCERF2 and UCERF3, as well as the relative importance of logic-tree branches, vary throughout the region, and depend on the evaluation metric of interest. For example, M≥6.7 probabilities may not be a good proxy for other hazard or loss measures. This sensitivity, coupled with the approximate nature of the model and known limitations, means the applicability of UCERF3 should be evaluated on a case-by-case basis.

SiO 2/SiC interface proved by positron annihilation

NASA Astrophysics Data System (ADS)

Maekawa, M.; Kawasuso, A.; Yoshikawa, M.; Itoh, H.

2003-06-01

We have studied positron annihilation in a Silicon carbide (SiC)-metal/oxide/semiconductor (MOS) structure using a monoenergetic positron beam. The Doppler broadening of annihilation quanta were measured as functions of the incident positron energy and the gate bias. Applying negative gate bias, significant increases in S-parameters were observed. This indicates the migration of implanted positrons towards SiO 2/SiC interface and annihilation at open-volume type defects. The behavior of S-parameters depending on the bias voltage was well correlated with the capacitance-voltage ( C- V) characteristics. We observed higher S-parameters and the interfacial trap density in MOS structures fabricated using the dry oxidation method as compared to those by pyrogenic oxidation method.

Factors affecting the open-circuit voltage and electrode kinetics of some iron/titanium/redox flow cells

NASA Technical Reports Server (NTRS)

Reid, M. A.; Gahn, R. F.

1977-01-01

The effect of acid concentration on the performance of the iron-titanium redox flow cell was studied. When the acidity was increased, open-circuit voltages decreased on the titanium side but load voltages increased due to decreased polarization. The best load voltage occurs when there is high acidity on the titanium side coupled with low acidity on the iron side, but such cells show voltage losses with repeated cycling because of the diffusion of acid through the membrane. No membrane tested has been found capable of maintaining the differences in acidity. Chelating agents show some promise in reducing polarization at the Ti electrode and thus improving energy efficiency.

Molecular interfaces for plasmonic hot electron photovoltaics

NASA Astrophysics Data System (ADS)

Pelayo García de Arquer, F.; Mihi, Agustín; Konstantatos, Gerasimos

2015-01-01

The use of self-assembled monolayers (SAMs) to improve and tailor the photovoltaic performance of plasmonic hot-electron Schottky solar cells is presented. SAMs allow the simultaneous control of open-circuit voltage, hot-electron injection and short-circuit current. To that end, a plurality of molecule structural parameters can be adjusted: SAM molecule's length can be adjusted to control plasmonic hot electron injection. Modifying SAMs dipole moment allows for a precise tuning of the open-circuit voltage. The functionalization of the SAM can also be selected to modify short-circuit current. This allows the simultaneous achievement of high open-circuit voltages (0.56 V) and fill-factors (0.58), IPCE above 5% at the plasmon resonance and maximum power-conversion efficiencies of 0.11%, record for this class of devices.The use of self-assembled monolayers (SAMs) to improve and tailor the photovoltaic performance of plasmonic hot-electron Schottky solar cells is presented. SAMs allow the simultaneous control of open-circuit voltage, hot-electron injection and short-circuit current. To that end, a plurality of molecule structural parameters can be adjusted: SAM molecule's length can be adjusted to control plasmonic hot electron injection. Modifying SAMs dipole moment allows for a precise tuning of the open-circuit voltage. The functionalization of the SAM can also be selected to modify short-circuit current. This allows the simultaneous achievement of high open-circuit voltages (0.56 V) and fill-factors (0.58), IPCE above 5% at the plasmon resonance and maximum power-conversion efficiencies of 0.11%, record for this class of devices. Electronic supplementary information (ESI) available: Contact-potential differentiometry measurements, FTIR characterization, performance statistics and gold devices. See DOI: 10.1039/c4nr06356b

Antenna-coupled unbiased detectors for LW-IR regime

NASA Astrophysics Data System (ADS)

Tiwari, Badri Nath

At room temperature (300K), the electromagnetic (EM) radiation emitted by humans and other living beings peaks mostly in the long-wavelength infrared (LW-IR) regime. And since the atmosphere shows relatively little absorption in this band, applications such as target detection, tracking, active homing, and navigation in autonomous vehicles extensively use the LW-IR frequency range. The present research work is focused on developing antenna-based, uncooled, and unbiased detectors for the LW-IR regime. In the first part of this research, antenna-coupled metal-oxide-metal diodes (ACMOMD) are investigated. In response to the EM radiation, high-frequency antenna currents are induced in the antenna. An asymmetric-barrier Al-Al2O3-Pt MOM diode rectifies the antenna currents. Two different types of fabrication processes have been developed for ACMOMDs namely one-step lithography and two-step lithography. The major drawbacks of MOM-based devices include hard-to-control fabrication processes, generally very high zero-biased resistances, and vulnerability to electrostatic discharges, leading to unstable electrical characteristics. The second part of this research focuses on the development of unbiased LW-IR sensors based on the Seebeck effect. If two different metals are joined together at one end and their other ends are open-circuited, and if a non-zero temperature difference exists between the joined end and the open ends, then a non-zero open-circuit voltage can be measured between the open ends of the wires. Based on this effect, we have developed antenna-coupled nano-thermocouples (ACNTs) in which radiation-induced antenna currents produce polarization-dependent heating of the joined end of the two metals whereas the open ends remain at substrate temperature. This polarization-dependent heating induces polarization-dependent temperature difference between the joined end and the open ends of the metals leading to a polarization-dependent open-circuit voltage between the open ends of the metals. A CW CO2 laser tuned at 10.6 mum wavelength has been used for infrared characterization of these sensors. For these sensors, average responsivity of 22.7 mV/W, signal-to-noise (SNR) ratio of 29 dB, noise equivalent power (NEP) of 1.55 nW, and specific detectivity (D*) of 1.77x105 cm. Hz .W--1 were measured. ACNTs are expected to operate at frequencies much beyond 400 KHz. The third part of this research focuses on the effect of DC read-out interconnects on polarization characteristics of the planar dipole antennas. Different geometries of the interconnects present different electromagnetic boundary conditions to the antenna, and thus affect the far-field polarization characteristics of the antenna. Four designs of DC read-out interconnects are fabricated and their polarization-dependent IR responses are experimentally measured. The High Frequency Structure Simulator (HFSS) from ANSYS is used to simulate the polarization characteristics of the antenna with different read-out geometries.

Magnetopause reconnection rate estimates for Jupiter's magnetosphere based on interplanetary measurements at ~5AU

NASA Astrophysics Data System (ADS)

Nichols, J. D.; Cowley, S. W. H.; McComas, D. J.

2006-03-01

We make the first quantitative estimates of the magnetopause reconnection rate at Jupiter using extended in situ data sets, building on simple order of magnitude estimates made some thirty years ago by Brice and Ionannidis (1970) and Kennel and Coroniti (1975, 1977). The jovian low-latitude magnetopause (open flux production) reconnection voltage is estimated using the Jackman et al. (2004) algorithm, validated at Earth, previously applied to Saturn, and here adapted to Jupiter. The high-latitude (lobe) magnetopause reconnection voltage is similarly calculated using the related Gérard et al. (2005) algorithm, also previously used for Saturn. We employ data from the Ulysses spacecraft obtained during periods when it was located near 5AU and within 5° of the ecliptic plane (January to June 1992, January to August 1998, and April to October 2004), along with data from the Cassini spacecraft obtained during the Jupiter flyby in 2000/2001. We include the effect of magnetospheric compression through dynamic pressure modulation, and also examine the effect of variations in the direction of Jupiter's magnetic axis throughout the jovian day and year. The intervals of data considered represent different phases in the solar cycle, such that we are also able to examine solar cycle dependency. The overall average low-latitude reconnection voltage is estimated to be ~230 kV, such that the average amount of open flux created over one solar rotation is ~500 GWb. We thus estimate the average time to replenish Jupiter's magnetotail, which contains ~300-500 GWb of open flux, to be ~15-25 days, corresponding to a tail length of ~3.8-6.5 AU. The average high-latitude reconnection voltage is estimated to be ~130 kV, associated with lobe "stirring". Within these averages, however, the estimated voltages undergo considerable variation. Generally, the low-latitude reconnection voltage exhibits a "background" of ~100 kV that is punctuated by one or two significant enhancement events during each solar rotation, in which the voltage is elevated to ~1-3 MV. The high-latitude voltages are estimated to be about a half of these values. We note that the peak values of order a few MV are comparable to the potential drop due to sub-corotating plasma flows in the equatorial magnetosphere between ~20 RJ and the magnetopause, such that during these periods magnetopause reconnection may have a significant effect on the otherwise rotationally dominated magnetosphere. Despite such variations during each solar rotation, however, the total amount of open flux produced during each solar rotation varies typically by less than ~30% on either side of the overall average for that epoch. The averages over individual data epochs vary over the solar cycle from ~600 GWb per solar rotation at solar maximum to ~400 GWb at solar minimum. In addition we show that the IMF sector with positive clock angle is favoured for reconnection when the jovian spin axis clock angle is also positive, and vice versa, although this effect represents a first order correction to the voltage, which is primarily modulated by IMF strength and direction.

Investigation of transient overvoltages in heavily meshed low-voltage underground distribution networks

NASA Astrophysics Data System (ADS)

Salcedo Ulerio, Reynaldo Odalis

The analysis of overvoltages in electrical distribution networks is of considerable significance since they may damage the power system infrastructure and the associated electrical equipment. Overvoltages in distribution networks arise due to switching transients, resonance, lightning strikes and ground faults, among other causes. The operation of network protectors (NWP), low voltage circuit breakers with directional power relay, in a secondary network prevents the continuous flow of reverse power. There are three modes of operation for the network protectors: sensitive, time delayed, and insensitive. In case of a fault, although all of the network protectors sense the fault at the same time, their operation is not simultaneous. Many of them open very quickly with opening times similar to those of the feeder breaker. However, some operate a few cycles later, others take several seconds to open and a few might even fail to operate. Therefore, depending on the settings of the network protectors, faults can last for significantly long time due to backfeeding of current from the low voltage (LV) network into the medium voltage (MV) network. In this work, low voltages are defined as 208V/460V and medium voltage are defined as 25kV/35kV. This thesis presents overvoltages which arise because of the occurrence of a single-line-to-ground (SLG) fault on the MV side (connected in delta) of the system. The thesis reveals that overvoltage stresses are imposed on insulation, micro-processor controlled equipment, and switching devices by overvoltages during current backfeeding. Also, it establishes a relationship between overvoltage magnitude, its duration, and the network loading conditions. Overvoltages above 3 p.u. may be developed as a result of a simultaneous occurrence of three phenomena: neutral displacement, Ferranti effect, and magnetic current chopping. Furthermore, this thesis exposes the possibility of occurrence of the ferro-resonance phenomena in a distribution network having secondary grid, making the study of extreme importance especially in the case of a misoperating network protector. The test systems for both studies were designed following the conventional distribution network with secondary grid, similar to those in the New York City Area. Simulations were performed using the electro-magnetic transient program revised version (EMTP-RV) considering detailed representation of system components as well as the non-linear magnetization and losses of transformers.

A study of short test and charge retention test methods for nickel-cadmium spacecraft cells

NASA Technical Reports Server (NTRS)

Scott, W. R.

1975-01-01

Methods for testing nickel-cadmium cells for internal shorts and charge retention were studied. Included were (a) open circuit voltage decay after a brief charge, (b) open circuit voltage recovery after shorting, and (c) open circuit voltage decay and capacity loss after a full charge. The investigation included consideration of the effects of prior history, of conditioning cells prior to testing, and of various test method variables on the results of the tests. Sensitivity of the tests was calibrated in terms of equivalent external resistance. The results were correlated. It was shown that a large number of variables may affect the results of these tests. It is concluded that the voltage decay after a brief charge and the voltage recovery methods are more sensitive than the charged stand method, and can detect an internal short equivalent to a resistance of about (10,000/C)ohms where "C' is the numerical value of the capacity of the cell in ampere hours.

Voltage-sensing domain of voltage-gated proton channel Hv1 shares mechanism of block with pore domains.

PubMed

Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco

2013-01-23

Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.

Open circuit voltage-decay behavior in amorphous p-i-n solar due to injection

NASA Astrophysics Data System (ADS)

Smrity, Manu; Dhariwal, S. R.

2018-05-01

The paper deals with the basic recombination processes at the dangling bond and the band tail states at various levels of injection, expressed in terms of short-circuit current density and their role in the behavior of amorphous solar cells. As the level of injection increases the fill factor decreases whereas the open circuit voltage increases very slowly, showing a saturation tendency. Calculations have been done for two values of tail state densities and shows that with an increase in tail state densities both, the fill factor and open circuit voltage decreases, results an overall degradation of the solar cell.

Methods for improving solar cell open circuit voltage

DOEpatents

Jordan, John F.; Singh, Vijay P.

1979-01-01

A method for producing a solar cell having an increased open circuit voltage. A layer of cadmium sulfide (CdS) produced by a chemical spray technique and having residual chlorides is exposed to a flow of hydrogen sulfide (H.sub.2 S) heated to a temperature of 400.degree.-600.degree. C. The residual chlorides are reduced and any remaining CdCl.sub.2 is converted to CdS. A heterojunction is formed over the CdS and electrodes are formed. Application of chromium as the positive electrode results in a further increase in the open circuit voltage available from the H.sub.2 S-treated solar cell.

A wireless transmission system powered by an enzyme biofuel cell implanted in an orange.

PubMed

MacVittie, Kevin; Conlon, Tyler; Katz, Evgeny

2015-12-01

A biofuel cell composed of catalytic electrodes made of "buckypaper" modified with PQQ-dependent glucose dehydrogenase and FAD-dependent fructose dehydrogenase on the anode and with laccase on the cathode was used to activate a wireless information transmission system. The cathode/anode pair was implanted in orange pulp extracting power from its content (glucose and fructose in the juice). The open circuit voltage, Voc, short circuit current density, jsc, and maximum power produced by the biofuel cell, Pmax, were found as ca. 0.6 V, ca. 0.33 mA·cm(-2) and 670 μW, respectively. The voltage produced by the biofuel cell was amplified with an energy harvesting circuit and applied to a wireless transmitter. The present study continues the research line where different implantable biofuel cells are used for the activation of electronic devices. The study emphasizes the biosensor and environmental monitoring applications of implantable biofuel cells harvesting power from natural sources, rather than their biomedical use. Copyright © 2014 Elsevier B.V. All rights reserved.

Thermodynamic derivation of open circuit voltage in vanadium redox flow batteries

NASA Astrophysics Data System (ADS)

Pavelka, Michal; Wandschneider, Frank; Mazur, Petr

2015-10-01

Open circuit voltage of vanadium redox flow batteries is carefully calculated using equilibrium thermodynamics. This analysis reveals some terms in the Nernst relation which are usually omitted in literature. Due to the careful thermodynamic treatment, all uncertainties about the form of Nernst relation are removed except for uncertainties in activity coefficients of particular species. Moreover, it is shown (based again on equilibrium thermodynamics) that batteries with anion-exchange membranes follow different Nernst relation than batteries with cation-exchange membranes. The difference is calculated, and it is verified experimentally that the formula for anion-exchange membranes describes experiments with anion-exchange membranes better than the corresponding formula for cation-exchange membranes. In summary, careful thermodynamic calculation of open circuit voltage of vanadium redox flow batteries is presented, and the difference between voltage for anion-exchange and cation-exchange membranes is revealed.

Electrically induced spontaneous emission in open electronic system

NASA Astrophysics Data System (ADS)

Wang, Rulin; Zhang, Yu; Yam, Chiyung; Computation Algorithms Division (CSRC) Team; Theoretical; Computational Chemistry (HKU) Collaboration

A quantum mechanical approach is formulated for simulation of electroluminescence process in open electronic system. Based on nonequilibrium Green's function quantum transport equations and combining with photon-electron interaction, this method is used to describe electrically induced spontaneous emission caused by electron-hole recombination. The accuracy and reliability of simulation depends critically on correct description of the electronic band structure and the electron occupancy in the system. In this work, instead of considering electron-hole recombination in discrete states in the previous work, we take continuous states into account to simulate the spontaneous emission in open electronic system, and discover that the polarization of emitted photon is closely related to its propagation direction. Numerical studies have been performed to silicon nanowire-based P-N junction with different bias voltage.

Common Gating of Both CLC Transporter Subunits Underlies Voltage-dependent Activation of the 2Cl−/1H+ Exchanger ClC-7/Ostm1*

PubMed Central

Ludwig, Carmen F.; Ullrich, Florian; Leisle, Lilia; Stauber, Tobias; Jentsch, Thomas J.

2013-01-01

CLC anion transporters form dimers that function either as Cl− channels or as electrogenic Cl−/H+ exchangers. CLC channels display two different types of “gates,” “protopore” gates that open and close the two pores of a CLC dimer independently of each other and common gates that act on both pores simultaneously. ClC-7/Ostm1 is a lysosomal 2Cl−/1H+ exchanger that is slowly activated by depolarization. This gating process is drastically accelerated by many CLCN7 mutations underlying human osteopetrosis. Making use of some of these mutants, we now investigate whether slow voltage activation of plasma membrane-targeted ClC-7/Ostm1 involves protopore or common gates. Voltage activation of wild-type ClC-7 subunits was accelerated by co-expressing an excess of ClC-7 subunits carrying an accelerating mutation together with a point mutation rendering these subunits transport-deficient. Conversely, voltage activation of a fast ClC-7 mutant could be slowed by co-expressing an excess of a transport-deficient mutant. These effects did not depend on whether the accelerating mutation localized to the transmembrane part or to cytoplasmic cystathionine-β-synthase (CBS) domains of ClC-7. Combining accelerating mutations in the same subunit did not speed up gating further. No currents were observed when ClC-7 was truncated after the last intramembrane helix. Currents and slow gating were restored when the C terminus was co-expressed by itself or fused to the C terminus of the β-subunit Ostm1. We conclude that common gating underlies the slow voltage activation of ClC-7. It depends on the CBS domain-containing C terminus that does not require covalent binding to the membrane domain of ClC-7. PMID:23983121

Origin of Reduced Open-Circuit Voltage in Highly Efficient Small-Molecule-Based Solar Cells upon Solvent Vapor Annealing.

PubMed

Deng, Wanyuan; Gao, Ke; Yan, Jun; Liang, Quanbin; Xie, Yuan; He, Zhicai; Wu, Hongbin; Peng, Xiaobin; Cao, Yong

2018-03-07

In this study, we demonstrate that remarkably reduced open-circuit voltage in highly efficient organic solar cells (OSCs) from a blend of phenyl-C 61 -butyric acid methyl ester and a recently developed conjugated small molecule (DPPEZnP-THD) upon solvent vapor annealing (SVA) is due to two independent sources: increased radiative recombination and increased nonradiative recombination. Through the measurements of electroluminescence due to the emission of the charge-transfer state and photovoltaic external quantum efficiency measurement, we can quantify that the open-circuit voltage losses in a device with SVA due to the radiative recombination and nonradiative recombination are 0.23 and 0.31 V, respectively, which are 0.04 and 0.07 V higher than those of the as-cast device. Despite of the reduced open-circuit voltage, the device with SVA exhibited enhanced dissociation of charge-transfer excitons, leading to an improved short-circuit current density and a remarkable power conversion efficiency (PCE) of 9.41%, one of the best for solution-processed OSCs based on small-molecule donor materials. Our study also clearly shows that removing the nonradiative recombination pathways and/or suppressing energetic disorder in the active layer would result in more long-lived charge carriers and enhanced open-circuit voltage, which are prerequisites for further improving the PCE.

Bio-inspired feedback-circuit implementation of discrete, free energy optimizing, winner-take-all computations.

PubMed

Genewein, Tim; Braun, Daniel A

2016-06-01

Bayesian inference and bounded rational decision-making require the accumulation of evidence or utility, respectively, to transform a prior belief or strategy into a posterior probability distribution over hypotheses or actions. Crucially, this process cannot be simply realized by independent integrators, since the different hypotheses and actions also compete with each other. In continuous time, this competitive integration process can be described by a special case of the replicator equation. Here we investigate simple analog electric circuits that implement the underlying differential equation under the constraint that we only permit a limited set of building blocks that we regard as biologically interpretable, such as capacitors, resistors, voltage-dependent conductances and voltage- or current-controlled current and voltage sources. The appeal of these circuits is that they intrinsically perform normalization without requiring an explicit divisive normalization. However, even in idealized simulations, we find that these circuits are very sensitive to internal noise as they accumulate error over time. We discuss in how far neural circuits could implement these operations that might provide a generic competitive principle underlying both perception and action.

Transient, polarity-dependent dielectric response in a twisted nematic liquid crystal under very low frequency excitation.

PubMed

Krishnamurthy, K S

2015-09-01

The electric Freedericksz transition is a second-order quadratic effect, which, in a planarly aligned nematic liquid crystal layer, manifests above a threshold field as a homogeneous symmetric distortion with maximum director-tilt in the midplane. We find that, upon excitation by a low frequency (<0.2Hz) square-wave field, the instability becomes spatially and temporally varying. This is demonstrated using calamitic liquid crystals, initially in the 90°-twisted planar configuration. The distortion occurs close to the negative electrode following each polarity switch and, for low-voltage amplitudes, decays completely in time. We use the elastically favorable geometry of Brochard-Leger walls to establish the location of maximum distortion. Thus, at successive polarity changes, the direction of extension of both annular and open walls switches between the alignment directions at the two substrates. For high voltages, this direction is largely along the midplane director, while remaining marginally oscillatory. These results are broadly understood by taking into account the time-varying and inhomogeneous field conditions that prevail soon after the polarity reverses. Polarity dependence of the instability is traced to the formation of intrinsic double layers that lead to an asymmetry in field distribution in the presence of an external bias. Momentary field elevation near the negative electrode following a voltage sign reversal leads to locally enhanced dielectric and gradient flexoelectric torques, which accounts for the surface-like phenomenon observed at low voltages. These spatiotemporal effects, also found earlier for other instabilities, are generic in nature.

Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

PubMed

Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

2012-06-06

Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Endoplasmic reticulum membrane potassium channel dysfunction in high fat diet induced stress in rat hepatocytes

PubMed Central

Khodaee, Naser; Ghasemi, Maedeh; Saghiri, Reza; Eliassi, Afsaneh

2014-01-01

In a previous study we reported the presence of a large conductance K+ channel in the membrane of endoplasmic reticulum (ER) from rat hepatocytes. The channel open probability (Po) appeared voltage dependent and reached to a minimum 0.2 at +50 mV. Channel activity in this case was found to be totally inhibited at ATP concentration 2.5 mM, glibenclamide 100 µM and tolbutamide 400 µM. Existing evidence indicates an impairment of endoplasmic reticulum functions in ER stress condition. Because ER potassium channels have been involved in several ER functions including cytoprotection, apoptosis and calcium homeostasis, a study was carried out to consider whether the ER potassium channel function is altered in a high fat diet model of ER stress. Male Wistar rats were made ER stress for 2 weeks with a high fat diet. Ion channel incorporation of ER stress model into the bilayer lipid membrane allowed the characterization of K+ channel. Our results indicate that the channel Po was significantly increased at voltages above +30 mV. Interestingly, addition of ATP 7.5 mM, glibenclamide 400 µM and tolbutamide 2400 µM totally inhibited the channel activities, 3-fold, 4-fold and 6-fold higher than that in the control groups, respectively. Our results thus demonstrate a modification in the ER K+ channel gating properties and decreased sensitivity to drugs in membrane preparations coming from ER high fat model of ER stress, an effect potentially linked to a change in ER K+ channel subunits in ER stress condition. Our results may provide new insights into the cellular mechanisms underlying ER dysfunctions in ER stress. PMID:26417322

An Empirical Model for Estimating the Probability of Electrical Short Circuits from Tin Whiskers-Part I

NASA Technical Reports Server (NTRS)

Courey, Karim; Wright, Clara; Asfour, Shihab; Bayliss, Jon; Ludwig, Larry

2008-01-01

Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that has a currently unknown probability associated with it. Due to contact resistance, electrical shorts may not occur at lower voltage levels. In this experiment, we study the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From this data, we can estimate the probability of an electrical short, as a function of voltage, given that a free tin whisker has bridged two adjacent exposed electrical conductors. In addition, three tin whiskers grown from the same Space Shuttle Orbiter card guide used in the aforementioned experiment were cross sectioned and studied using a focused ion beam (FIB).

Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family

PubMed Central

2013-01-01

Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829

Cryo-EM structure of the polycystic kidney disease-like channel PKD2L1.

PubMed

Su, Qiang; Hu, Feizhuo; Liu, Yuxia; Ge, Xiaofei; Mei, Changlin; Yu, Shengqiang; Shen, Aiwen; Zhou, Qiang; Yan, Chuangye; Lei, Jianlin; Zhang, Yanqing; Liu, Xiaodong; Wang, Tingliang

2018-03-22

PKD2L1, also termed TRPP3 from the TRPP subfamily (polycystic TRP channels), is involved in the sour sensation and other pH-dependent processes. PKD2L1 is believed to be a nonselective cation channel that can be regulated by voltage, protons, and calcium. Despite its considerable importance, the molecular mechanisms underlying PKD2L1 regulations are largely unknown. Here, we determine the PKD2L1 atomic structure at 3.38 Å resolution by cryo-electron microscopy, whereby side chains of nearly all residues are assigned. Unlike its ortholog PKD2, the pore helix (PH) and transmembrane segment 6 (S6) of PKD2L1, which are involved in upper and lower-gate opening, adopt an open conformation. Structural comparisons of PKD2L1 with a PKD2-based homologous model indicate that the pore domain dilation is coupled to conformational changes of voltage-sensing domains (VSDs) via a series of π-π interactions, suggesting a potential PKD2L1 gating mechanism.

Effects of the charge-transfer reorganization energy on the open-circuit voltage in small-molecular bilayer organic photovoltaic devices: comparison of the influence of deposition rates of the donor.

PubMed

Lee, Chih-Chien; Su, Wei-Cheng; Chang, Wen-Chang

2016-05-14

The theoretical maximum of open-circuit voltage (VOC) of organic photovoltaic (OPV) devices has yet to be determined, and its origin remains debated. Here, we demonstrate that VOC of small-molecule OPV devices can be improved by controlling the deposition rate of a donor without changing the interfacial energy gap at the donor/acceptor interface. The measurement of external quantum efficiency and electroluminescence spectra facilitates the observation of the existence of charge transfer (CT) states. A simplified approach by reusing the reciprocity relationship for obtaining the properties of the CT states is proposed without introducing complex techniques. We compare experimental and fitting results and propose that reorganization energy is the primary factor in determining VOC instead of either the CT energy or electronic coupling term in bilayer OPV devices. Atomic force microscopy images indicate a weak molecular aggregation when a higher deposition rate is used. The results of temperature-dependent measurements suggest the importance of molecular stacking for the CT properties.

Theory of noise equivalent power of a high-temperature superconductor far-infrared bolometer in a photo-thermoelectrical mode of operation

NASA Astrophysics Data System (ADS)

Kaila, M. M.; Russell, G. J.

2000-12-01

We present a theory of noise equivalent power (NEP) and related parameters for a high-temperature superconductor (HTSC) bolometer in which temperature and resistance are the noise sources for open circuit operation and phonon and resistance are the noise sources for voltage-biased operation of the bolometer. The bolometer is designed to use a photo-thermoelectrical mode of operation. A mathematical formulation for the open circuit operation is first presented followed by an analysis of the heterodyne case with a bias applied in constant voltage mode. For the first time electrothermal (ET) and thermoelectrical (TE) feedback are treated in the heat balance equation simultaneously. A parallel resistance geometry consisting of thermoelectric and HTSC material legs has been chosen for the device. Computations for the ET-TE feedback show that the response time improves by three orders of magnitude and the responsivity becomes double for the same TE feedback. In the heat balance equation we have included among the heat transfer processes the temperature dependence of the thermal conductance at the bolometer-substrate interface for the dynamic state.

Fluctuation relation for heat exchange in Markovian open quantum systems

NASA Astrophysics Data System (ADS)

Ramezani, M.; Golshani, M.; Rezakhani, A. T.

2018-04-01

A fluctuation relation for the heat exchange of an open quantum system under a thermalizing Markovian dynamics is derived. We show that the probability that the system absorbs an amount of heat from its bath, at a given time interval, divided by the probability of the reverse process (releasing the same amount of heat to the bath) is given by an exponential factor which depends on the amount of heat and the difference between the temperatures of the system and the bath. Interestingly, this relation is akin to the standard form of the fluctuation relation (for forward-backward dynamics). We also argue that the probability of the violation of the second law of thermodynamics in the form of the Clausius statement (i.e., net heat transfer from a cold system to its hot bath) drops exponentially with both the amount of heat and the temperature differences of the baths.

Fluctuation relation for heat exchange in Markovian open quantum systems.

PubMed

Ramezani, M; Golshani, M; Rezakhani, A T

2018-04-01

A fluctuation relation for the heat exchange of an open quantum system under a thermalizing Markovian dynamics is derived. We show that the probability that the system absorbs an amount of heat from its bath, at a given time interval, divided by the probability of the reverse process (releasing the same amount of heat to the bath) is given by an exponential factor which depends on the amount of heat and the difference between the temperatures of the system and the bath. Interestingly, this relation is akin to the standard form of the fluctuation relation (for forward-backward dynamics). We also argue that the probability of the violation of the second law of thermodynamics in the form of the Clausius statement (i.e., net heat transfer from a cold system to its hot bath) drops exponentially with both the amount of heat and the temperature differences of the baths.

The Voltage Boost Enabled by Luminescence Extraction in Solar Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganapati, Vidya; Steiner, Myles A.; Yablonovitch, Eli

A new physical principle has emerged to produce record voltages and efficiencies in photovoltaic cells, 'luminescence extraction.' This is exemplified by the mantra 'a good solar cell should also be a good LED.' Luminescence extraction is the escape of internal photons out of the front surface of a solar cell. Basic thermodynamics says that the voltage boost should be related to concentration ratio, C, of a resource by ..delta..V=(kT/q)ln{C}. In light trapping, (i.e. when the solar cell is textured and has a perfect back mirror) the concentration ratio of photons C={4n2}, so one would expect a voltage boost of ..delta..V=kTmore » ln{4n2} over a solar cell with no texture and zero back reflectivity, where n is the refractive index. Nevertheless, there has been ambiguity over the voltage benefit to be expected from perfect luminescence extraction. Do we gain an open circuit voltage boost of ..delta..V=(kT/q)ln{n2}, ..delta..V=(kT/q)ln{2n2}, or ..delta..V=(kT/q)ln{4n2}? What is responsible for this voltage ambiguity ..delta..V=(kT/q)ln{4}=36mVolts? We show that different results come about, depending on whether the photovoltaic cell is optically thin or thick to its internal luminescence. In realistic intermediate cases of optical thickness the voltage boost falls in between; ln{n2}q..delta..V/kT)<;ln{4n2}.« less

Restricted ADP movement in cardiomyocytes: Cytosolic diffusion obstacles are complemented with a small number of open mitochondrial voltage-dependent anion channels.

PubMed

Simson, Päivo; Jepihhina, Natalja; Laasmaa, Martin; Peterson, Pearu; Birkedal, Rikke; Vendelin, Marko

2016-08-01

Adequate intracellular energy transfer is crucial for proper cardiac function. In energy starved failing hearts, partial restoration of energy transfer can rescue mechanical performance. There are two types of diffusion obstacles that interfere with energy transfer from mitochondria to ATPases: mitochondrial outer membrane (MOM) with voltage-dependent anion channel (VDAC) permeable to small hydrophilic molecules and cytoplasmatic diffusion barriers grouping ATP-producers and -consumers. So far, there is no method developed to clearly distinguish the contributions of cytoplasmatic barriers and MOM to the overall diffusion restriction. Furthermore, the number of open VDACs in vivo remains unknown. The aim of this work was to establish the partitioning of intracellular diffusion obstacles in cardiomyocytes. We studied the response of mitochondrial oxidative phosphorylation of permeabilized rat cardiomyocytes to changes in extracellular ADP by recording 3D image stacks of NADH autofluorescence. Using cell-specific mathematical models, we determined the permeability of MOM and cytoplasmatic barriers. We found that only ~2% of VDACs are accessible to cytosolic ADP and cytoplasmatic diffusion barriers reduce the apparent diffusion coefficient by 6-10×. In cardiomyocytes, diffusion barriers in the cytoplasm and by the MOM restrict ADP/ATP diffusion to similar extents suggesting a major role of both barriers in energy transfer and other intracellular processes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Closed-state inactivation involving an internal gate in Kv4.1 channels modulates pore blockade by intracellular quaternary ammonium ions

PubMed Central

Fineberg, Jeffrey D.; Szanto, Tibor G.; Panyi, Gyorgy; Covarrubias, Manuel

2016-01-01

Voltage-gated K+ (Kv) channel activation depends on interactions between voltage sensors and an intracellular activation gate that controls access to a central pore cavity. Here, we hypothesize that this gate is additionally responsible for closed-state inactivation (CSI) in Kv4.x channels. These Kv channels undergo CSI by a mechanism that is still poorly understood. To test the hypothesis, we deduced the state of the Kv4.1 channel intracellular gate by exploiting the trap-door paradigm of pore blockade by internally applied quaternary ammonium (QA) ions exhibiting slow blocking kinetics and high-affinity for a blocking site. We found that inactivation gating seemingly traps benzyl-tributylammonium (bTBuA) when it enters the central pore cavity in the open state. However, bTBuA fails to block inactivated Kv4.1 channels, suggesting gated access involving an internal gate. In contrast, bTBuA blockade of a Shaker Kv channel that undergoes open-state P/C-type inactivation exhibits fast onset and recovery inconsistent with bTBuA trapping. Furthermore, the inactivated Shaker Kv channel is readily blocked by bTBuA. We conclude that Kv4.1 closed-state inactivation modulates pore blockade by QA ions in a manner that depends on the state of the internal activation gate. PMID:27502553

Nonfullerene Tandem Organic Solar Cells with High Open-Circuit Voltage of 1.97 V.

PubMed

Liu, Wenqing; Li, Shuixing; Huang, Jiang; Yang, Shida; Chen, Jiehuan; Zuo, Lijian; Shi, Minmin; Zhan, Xiaowei; Li, Chang-Zhi; Chen, Hongzheng

2016-11-01

Small-molecule nonfullerene-based tandem organic solar cells (OSCs) are fabricated for the first time by utilizing P3HT:SF(DPPB) 4 and PTB7-Th:IEIC bulk heterojunctions as the front and back subcells, respectively. A power conversion efficiency of 8.48% is achieved with an ultrahigh open-circuit voltage of 1.97 V, which is the highest voltage value reported to date among efficient tandem OSCs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Measurements and Modeling of III-V Solar Cells at High Temperatures up to 400 $${}^{\\circ}$$ C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perl, Emmett E.; Simon, John; Geisz, John F.

2016-09-01

In this paper, we study the performance of 2.0 eV Al0.12Ga0.39In0.49P and 1.4 eV GaAs solar cells over a temperature range of 25-400 degrees C. The temperature-dependent J01 and J02 dark currents are extracted by fitting current-voltage measurements to a two-diode model. We find that the intrinsic carrier concentration ni dominates the temperature dependence of the dark currents, open-circuit voltage, and cell efficiency. To study the impact of temperature on the photocurrent and bandgap of the solar cells, we measure the quantum efficiency and illuminated current-voltage characteristics of the devices up to 400 degrees C. As the temperature is increased,more » we observe no degradation to the internal quantum efficiency and a decrease in the bandgap. These two factors drive an increase in the short-circuit current density at high temperatures. Finally, we measure the devices at concentrations ranging from ~30 to 1500 suns and observe n = 1 recombination characteristics across the entire temperature range. These findings should be a valuable guide to the design of any system that requires high-temperature solar cell operation.« less

Two Components of Voltage-Dependent Inactivation in Cav1.2 Channels Revealed by Its Gating Currents

PubMed Central

Ferreira, Gonzalo; Ríos, Eduardo; Reyes, Nicolás

2003-01-01

Voltage-dependent inactivation (VDI) was studied through its effects on the voltage sensor in Cav1.2 channels expressed in tsA 201 cells. Two kinetically distinct phases of VDI in onset and recovery suggest the presence of dual VDI processes. Upon increasing duration of conditioning depolarizations, the half-distribution potential (V1/2) of intramembranous mobile charge was negatively shifted as a sum of two exponential terms, with time constants 0.5 s and 4 s, and relative amplitudes near 50% each. This kinetics behavior was consistent with that of increment of maximal charge related to inactivation (Qn). Recovery from inactivation was also accompanied by a reduction of Qn that varied with recovery time as a sum of two exponentials. The amplitudes of corresponding exponential terms were strongly correlated in onset and recovery, indicating that channels recover rapidly from fast VDI and slowly from slow VDI. Similar to charge “immobilization,” the charge moved in the repolarization (OFF) transient became slower during onset of fast VDI. Slow VDI had, instead, hallmarks of interconversion of charge. Confirming the mechanistic duality, fast VDI virtually disappeared when Li+ carried the current. A nine-state model with parallel fast and slow inactivation pathways from the open state reproduces most of the observations. PMID:12770874

Molecular and kinetic determinants of local anaesthetic action on sodium channels.

PubMed

French, R J; Zamponi, G W; Sierralta, I E

1998-11-23

(1) Local anaesthetics (LA) rely for their clinical actions on state-dependent inhibition of voltage-dependent sodium channels. (2) Single, batrachoxin-modified sodium channels in planar lipid bilayers allow direct observation of drug-channel interactions. Two modes of inhibition of single-channel current are observed: fast block of the open channels and prolongation of a long-lived closed state, some of whose properties resemble those of the inactivated state of unmodified channels. (3) Analogues of different parts of the LA molecule separately mimic each blocking mode: amines--fast block, and water-soluble aromatics--closed state prolongation. (4) Interaction between a mu-conotoxin derivative and diethylammonium indicate an intrapore site of fast, open-state block. (5) Site-directed mutagenesis studies suggest that hydrophobic residues in transmembrane segment 6 of repeat domain 4 of sodium channels are critical for both LA binding and stabilization of the inactivated state.

Characterization of the cardiac Na+/K+ pump by development of a comprehensive and mechanistic model.

PubMed

Oka, Chiaki; Cha, Chae Young; Noma, Akinori

2010-07-07

A large amount of experimental data on the characteristics of the cardiac Na(+)/K(+) pump have been accumulated, but it remains difficult to predict the quantitative contribution of the pump in an intact cell because most measurements have been made under non-physiological conditions. To extrapolate the experimental findings to intact cells, we have developed a comprehensive Na(+)/K(+) pump model based on the thermodynamic framework (Smith and Crampin, 2004) of the Post-Albers reaction cycle combined with access channel mechanisms. The new model explains a variety of experimental results for the Na(+)/K(+) pump current (I(NaK)), including the dependency on the concentrations of Na(+) and K(+), the membrane potential and the free energy of ATP hydrolysis. The model demonstrates that both the apparent affinity and the slope of the substrate-I(NaK) relationship measured experimentally are affected by the composition of ions in the extra- and intracellular solutions, indirectly through alteration in the probability distribution of individual enzyme intermediates. By considering the voltage dependence in the Na(+)- and K(+)-binding steps, the experimental voltage-I(NaK) relationship could be reconstructed with application of experimental ionic compositions in the model, and the view of voltage-dependent K(+) binding was supported. Re-evaluation of charge movements accompanying Na(+) and K(+) translocations gave a reasonable number for the site density of the Na(+)/K(+) pump on the membrane. The new model is relevant for simulation of cellular functions under various interventions, such as depression of energy metabolism. (c) 2010 Elsevier Ltd. All rights reserved.

Ternary Kv4.2 channels recapitulate voltage-dependent inactivation kinetics of A-type K+ channels in cerebellar granule neurons.

PubMed

Amarillo, Yimy; De Santiago-Castillo, Jose A; Dougherty, Kevin; Maffie, Jonathon; Kwon, Elaine; Covarrubias, Manuel; Rudy, Bernardo

2008-04-15

Kv4 channels mediate most of the somatodendritic subthreshold operating A-type current (I(SA)) in neurons. This current plays essential roles in the regulation of spike timing, repetitive firing, dendritic integration and plasticity. Neuronal Kv4 channels are thought to be ternary complexes of Kv4 pore-forming subunits and two types of accessory proteins, Kv channel interacting proteins (KChIPs) and the dipeptidyl-peptidase-like proteins (DPPLs) DPPX (DPP6) and DPP10. In heterologous cells, ternary Kv4 channels exhibit inactivation that slows down with increasing depolarization. Here, we compared the voltage dependence of the inactivation rate of channels expressed in heterologous mammalian cells by Kv4.2 proteins with that of channels containing Kv4.2 and KChIP1, Kv4.2 and DPPX-S, or Kv4.2, KChIP1 and DPPX-S, and found that the relation between inactivation rate and membrane potential is distinct for these four conditions. Moreover, recordings from native neurons showed that the inactivation kinetics of the I(SA) in cerebellar granule neurons has voltage dependence that is remarkably similar to that of ternary Kv4 channels containing KChIP1 and DPPX-S proteins in heterologous cells. The fact that this complex and unique behaviour (among A-type K(+) currents) is observed in both the native current and the current expressed in heterologous cells by the ternary complex containing Kv4, DPPX and KChIP proteins supports the hypothesis that somatically recorded native Kv4 channels in neurons include both types of accessory protein. Furthermore, quantitative global kinetic modelling showed that preferential closed-state inactivation and a weakly voltage-dependent opening step can explain the slowing of the inactivation rate with increasing depolarization. Therefore, it is likely that preferential closed-state inactivation is the physiological mechanism that regulates the activity of both ternary Kv4 channel complexes and native I(SA)-mediating channels.

Simultaneous determination of built-in voltage and charge carrier mobility in organic diodes from light intensity dependent current-voltage characteristics

NASA Astrophysics Data System (ADS)

Huang, Fobao; Peng, Yingquan; Xu, Kun; Lv, Wenli; Xu, Sunan; Wang, Ying; Tang, Ying; Wei, Yi; Yang, Yuhuan; Liu, Guohan

2017-05-01

Built-in voltage (V bi) and charge carrier mobility are essential parameters of organic diodes, such as organic photodiodes, organic light-emitting diodes and organic solar cells. The existing methods for charge carrier mobility measurement require either expensive equipment, or stringent sample preparation. We demonstrate a method that simultaneously determines the V bi and charge carrier mobility in organic photodiodes and solar cells from incident light intensity dependent current-voltage characteristics. The V bi is determined from the saturation open-circuit voltage, while the charge carrier mobility from the space-charge limited photocurrent. The V bi for organic diodes, ‘ITO/copper phthalocyanine (CuPc)/2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline (BCP)/Al’, ‘ITO/ lead phthalocyanine (PbPc)/BCP/Al’, ‘ITO/CuPc/C60/BCP/Al’, and ‘ITO/PbPc/C60/BCP/Al’, were measured to be 0.583  ±  0.019, 0.458  ±  0.002, 0.605  ±  0.009 and 0.538  ±  0.004 V, respectively; the hole mobility of CuPc and PbPc thin films were measured to be (1.383  ±  0.367)  ×  10-6 cm2 V-1 s-1 and (3.675  ±  0.887)  ×  10-6 cm2 V-1 s-1, respectively. The measured values for V bi and carrier mobility coincide with related experimental results reported in other literature.

Electron-conformational transformations govern the temperature dependence of the cardiac ryanodine receptor gating

NASA Astrophysics Data System (ADS)

Moskvin, A. S.; Iaparov, B. I.; Ryvkin, A. M.; Solovyova, O. E.; Markhasin, V. S.

2015-07-01

Temperature influences many aspects of cardiac excitation-contraction coupling, in particular, hypothermia increases the open probability ( P open) of cardiac sarcoplasmic reticulum (SR) Ca2+-release channels (ryanodine-sensitive RyR channels) rising the SR Ca2+ load in mammalian myocytes. However, to the best of our knowledge, no theoretical models are available for that effect. Traditional Markov chain models do not provide a reasonable molecular mechanistic insight on the origin of the temperature effects. Here in the paper we address a simple physically clear electron-conformational model to describe the RyR gating and argue that a synergetic effect of external thermal fluctuation forces (Gaussian-Markovian noise) and internal friction via the temperature stimulation/suppression of the open-close RyR tunneling probability can be considered as a main contributor to temperature effects on the RyR gating. Results of the computer modeling allowed us to successfully reproduce all the temperature effects observed for an isolated RyR gating in vitro under reducing the temperature: increase in P open and mean open time without any significant effect on mean closed

Three methionine residues located within the regulator of conductance for K+ (RCK) domains confer oxidative sensitivity to large-conductance Ca2+-activated K+ channels

PubMed Central

Santarelli, Lindsey Ciali; Wassef, Ramez; Heinemann, Stefan H; Hoshi, Toshinori

2006-01-01

Methionine-directed oxidation of the human Slo1 potassium channel (hSlo1) shifts the half-activation voltage by −30 mV and markedly slows channel deactivation at low concentrations of intracellular Ca2+ ([Ca2+]i). We demonstrate here that the contemporaneous mutation of M536, M712 and M739 to leucine renders the channel functionally insensitive to methionine oxidation caused by the oxidant chloramine-T (Ch-T) without altering other functional characteristics. Coexpression with the auxiliary β1 subunit fails to restore the full oxidative sensitivity to this triple mutant channel. The Ch-T effect is mediated specifically by M536, M712 and M739 because even small changes in this residue combination interfere with the ability to remove the oxidant sensitivity following mutation. Replacement of M712 or M739, but not M536, with the hydrophilic residue glutamate largely mimics oxidation of the channel and essentially removes the Ch-T sensitivity, suggesting that M712 and M739 may be part of a hydrophobic pocket disrupted by oxidation of non-polar methionine to the more hydrophilic methionine sulfoxide. The increase in wild-type hSlo1 open probability caused by methionine oxidation disappears at high [Ca2+]i and biophysical modelling of the Ch-T effect on steady-state activation implicates a decrease in the allosteric coupling between Ca2+ binding and the pore. The dramatic increase in open probability at low [Ca2+]i especially within the physiological voltage range suggests that oxidation of M536, M712 or M739 may enhance the Slo1 BK activity during conditions of oxidative stress, such as those associated with ischaemia-reperfusion and neurodegenerative disease, or in response to metabolic cues. PMID:16396928

Insulin and IGF-1 activate Kir4.1/5.1 channels in cortical collecting duct principal cells to control basolateral membrane voltage.

PubMed

Zaika, Oleg; Palygin, Oleg; Tomilin, Viktor; Mamenko, Mykola; Staruschenko, Alexander; Pochynyuk, Oleh

2016-02-15

Potassium Kir4.1/5.1 channels are abundantly expressed at the basolateral membrane of principal cells in the cortical collecting duct (CCD), where they are thought to modulate transport rates by controlling transepithelial voltage. Insulin and insulin-like growth factor-1 (IGF-1) stimulate apically localized epithelial sodium channels (ENaC) to augment sodium reabsorption in the CCD. However, little is known about their actions on potassium channels localized at the basolateral membrane. In this study, we implemented patch-clamp analysis in freshly isolated murine CCD to assess the effect of these hormones on Kir4.1/5.1 at both single channel and cellular levels. We demonstrated that K(+)-selective conductance via Kir4.1/5.1 is the major contributor to the macroscopic current recorded from the basolateral side in principal cells. Acute treatment with 10 μM amiloride (ENaC blocker), 100 nM tertiapin-Q (TPNQ; ROMK inhibitor), and 100 μM ouabain (Na(+)-K(+)-ATPase blocker) failed to produce a measurable effect on the macroscopic current. In contrast, Kir4.1 inhibitor nortriptyline (100 μM), but not fluoxetine (100 μM), virtually abolished whole cell K(+)-selective conductance. Insulin (100 nM) markedly increased the open probability of Kir4.1/5.1 and nortriptyline-sensitive whole cell current, leading to significant hyperpolarization of the basolateral membrane. Inhibition of the phosphatidylinositol 3-kinase cascade with LY294002 (20 μM) abolished action of insulin on Kir4.1/5.1. IGF-1 had similar stimulatory actions on Kir4.1/5.1-mediated conductance only when applied at a higher (500 nM) concentration and was ineffective at 100 nM. We concluded that both insulin and, to a lesser extent, IGF-1 activate Kir4.1/5.1 channel activity and open probability to hyperpolarize the basolateral membrane, thereby facilitating Na(+) reabsorption in the CCD. Copyright © 2016 the American Physiological Society.

Ultrasteep Voltage Dependence in a Membrane Channel

NASA Astrophysics Data System (ADS)

Mangan, Patrick S.; Colombini, Marco

1987-07-01

A mechanism for regulating voltage-gated channels is presented. The treatment amplifies the effect of the applied membrane potential resulting in a dramatic increase in the channel's voltage dependence. Addition of a large polyvalent anion to the medium bathing a phospholipid bilayer containing the voltage-dependent channel from the mitochondrial outer membrane, VDAC, induced up to a 12-fold increase in the channel's voltage sensitivity. The highest polyvalent anion concentration tested resulted in an e-fold conductance change for a 0.36-mV change in membrane potential. On the low end, a concentration of 2 μ M resulted in a 50% increase in VDAC voltage dependence. A mechanism based on polyvalent anion accumulation in the access resistance region at the mouth of the pore is consistent with all findings. Perhaps the voltage dependence of voltage-gated channels is amplified in vivo by polyvalent ions. If so, the control of excitable phenomena may be under much finer regulation than that provided by membrane potential alone.

Universal single point liquid level sensor

DOEpatents

Kronberg, J.W.

1992-10-27

A liquid level detector comprises a thermistor and circuitry for determining electrically if the thermistor is wet or dry and additionally, and continuously, if the thermistor is open or shorted. The voltage across the thermistor is filtered to remove low frequency electrical noise, then compared with a reference low voltage to determine if shorted and to a transition voltage chosen to be between the thermistor's normal wet and dry voltages to determine if the thermistor is wet or dry. The voltage is also compared to the supply voltage using a CMOS gate circuit element to determine if the thermistor is open. The gate passes both faults on to an LED to signal that a fault condition exists or indicates by another LED the wet or dry condition of the thermistor. A pump may be activated through a relay if the thermistor tests wet or dry, as desired. 1 figure.

Universal single point liquid level sensor

DOEpatents

Kronberg, James W.

1992-01-01

A liquid level detector comprises a thermistor and circuitry for determining electrically if the thermistor is wet or dry and additionally, and continuously, if the thermistor is open or shorted. The voltage across the thermistor is filtered to remove low frequency electrical noise, then compared with a reference low voltage to determine if shorted and to a transition voltage chosen to be between the thermistor's normal wet and dry voltages to determine if the thermistor is wet or dry. The voltage is also compared to the supply voltage using a CMOS gate circuit element to determine if the thermistor is open. The gate passes both faults on to an LED to signal that a fault condition exists or indicates by another LED the wet or dry condition of the thermistor. A pump may be activated through a relay if the thermistor tests wet or dry, as desired.

Fast activation of dihydropyridine-sensitive calcium channels of skeletal muscle. Multiple pathways of channel gating

PubMed Central

1996-01-01

Dihydropyridine (DHP) receptors of the transverse tubule membrane play two roles in excitation-contraction coupling in skeletal muscle: (a) they function as the voltage sensor which undergoes fast transition to control release of calcium from sarcoplasmic reticulum, and (b) they provide the conducting unit of a slowly activating L-type calcium channel. To understand this dual function of the DHP receptor, we studied the effect of depolarizing conditioning pulse on the activation kinetics of the skeletal muscle DHP-sensitive calcium channels reconstituted into lipid bilayer membranes. Activation of the incorporated calcium channel was imposed by depolarizing test pulses from a holding potential of -80 mV. The gating kinetics of the channel was studied with ensemble averages of repeated episodes. Based on a first latency analysis, two distinct classes of channel openings occurred after depolarization: most had delayed latencies, distributed with a mode of 70 ms (slow gating); a small number of openings had short first latencies, < 12 ms (fast gating). A depolarizing conditioning pulse to +20 mV placed 200 ms before the test pulse (-10 mV), led to a significant increase in the activation rate of the ensemble averaged-current; the time constant of activation went from tau m = 110 ms (reference) to tau m = 45 ms after conditioning. This enhanced activation by the conditioning pulse was due to the increase in frequency of fast open events, which was a steep function of the intermediate voltage and the interval between the conditioning pulse and the test pulse. Additional analysis demonstrated that fast gating is the property of the same individual channels that normally gate slowly and that the channels adopt this property after a sojourn in the open state. The rapid secondary activation seen after depolarizing prepulses is not compatible with a linear activation model for the calcium channel, but is highly consistent with a cyclical model. A six- state cyclical model is proposed for the DHP-sensitive Ca channel, which pictures the normal pathway of activation of the calcium channel as two voltage-dependent steps in sequence, plus a voltage-independent step which is rate limiting. The model reproduced well the fast and slow gating models of the calcium channel, and the effects of conditioning pulses. It is possible that the voltage-sensitive gating transitions of the DHP receptor, which occur early in the calcium channel activation sequence, could underlie the role of the voltage sensor and yield the rapid excitation-contraction coupling in skeletal muscle, through either electrostatic or allosteric linkage to the ryanodine receptors/calcium release channels. PMID:8882865

Computing rates of Markov models of voltage-gated ion channels by inverting partial differential equations governing the probability density functions of the conducting and non-conducting states.

PubMed

Tveito, Aslak; Lines, Glenn T; Edwards, Andrew G; McCulloch, Andrew

2016-07-01

Markov models are ubiquitously used to represent the function of single ion channels. However, solving the inverse problem to construct a Markov model of single channel dynamics from bilayer or patch-clamp recordings remains challenging, particularly for channels involving complex gating processes. Methods for solving the inverse problem are generally based on data from voltage clamp measurements. Here, we describe an alternative approach to this problem based on measurements of voltage traces. The voltage traces define probability density functions of the functional states of an ion channel. These probability density functions can also be computed by solving a deterministic system of partial differential equations. The inversion is based on tuning the rates of the Markov models used in the deterministic system of partial differential equations such that the solution mimics the properties of the probability density function gathered from (pseudo) experimental data as well as possible. The optimization is done by defining a cost function to measure the difference between the deterministic solution and the solution based on experimental data. By evoking the properties of this function, it is possible to infer whether the rates of the Markov model are identifiable by our method. We present applications to Markov model well-known from the literature. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Effects of acidic pH on voltage-gated ion channels in rat trigeminal mesencephalic nucleus neurons.

PubMed

Han, Jin-Eon; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung

2017-03-01

The effects of acidic pH on several voltage-dependent ion channels, such as voltage-dependent K + and Ca 2+ channels, and hyperpolarization-gated and cyclic nucleotide-activated cation (HCN) channels, were examined using a whole-cell patch clamp technique on mechanically isolated rat mesencephalic trigeminal nucleus neurons. The application of a pH 6.5 solution had no effect on the peak amplitude of voltage-dependent K + currents. A pH 6.0 solution slightly, but significantly inhibited the peak amplitude of voltage-dependent K + currents. The pH 6.0 also shifted both the current-voltage and conductance-voltage relationships to the depolarization range. The application of a pH 6.5 solution scarcely affected the peak amplitude of membrane currents mediated by HCN channels, which were profoundly inhibited by the general HCN channel blocker Cs + (1 mM). However, the pH 6.0 solution slightly, but significantly inhibited the peak amplitude of HCN-mediated currents. Although the pH 6.0 solution showed complex modulation of the current-voltage and conductance-voltage relationships, the midpoint voltages for the activation of HCN channels were not changed by acidic pH. On the other hand, voltage-dependent Ca 2+ channels were significantly inhibited by an acidic pH. The application of an acidic pH solution significantly shifted the current-voltage and conductance-voltage relationships to the depolarization range. The modulation of several voltage-dependent ion channels by an acidic pH might affect the excitability of mesencephalic trigeminal nucleus neurons, and thus physiological functions mediated by the mesencephalic trigeminal nucleus could be affected in acidic pH conditions.

InGaAs/InAlAs single photon avalanche diode for 1550 nm photons.

PubMed

Meng, Xiao; Xie, Shiyu; Zhou, Xinxin; Calandri, Niccolò; Sanzaro, Mirko; Tosi, Alberto; Tan, Chee Hing; Ng, Jo Shien

2016-03-01

A single photon avalanche diode (SPAD) with an InGaAs absorption region, and an InAlAs avalanche region was designed and demonstrated to detect 1550 nm wavelength photons. The characterization included leakage current, dark count rate and single photon detection efficiency as functions of temperature from 210 to 294 K. The SPAD exhibited good temperature stability, with breakdown voltage dependence of approximately 45 mV K(-1). Operating at 210 K and in a gated mode, the SPAD achieved a photon detection probability of 26% at 1550 nm with a dark count rate of 1 × 10(8) Hz. The time response of the SPAD showed decreasing timing jitter (full width at half maximum) with increasing overbias voltage, with 70 ps being the smallest timing jitter measured.

InGaAs/InAlAs single photon avalanche diode for 1550 nm photons

PubMed Central

Xie, Shiyu; Zhou, Xinxin; Calandri, Niccolò; Sanzaro, Mirko; Tosi, Alberto; Tan, Chee Hing; Ng, Jo Shien

2016-01-01

A single photon avalanche diode (SPAD) with an InGaAs absorption region, and an InAlAs avalanche region was designed and demonstrated to detect 1550 nm wavelength photons. The characterization included leakage current, dark count rate and single photon detection efficiency as functions of temperature from 210 to 294 K. The SPAD exhibited good temperature stability, with breakdown voltage dependence of approximately 45 mV K−1. Operating at 210 K and in a gated mode, the SPAD achieved a photon detection probability of 26% at 1550 nm with a dark count rate of 1 × 108 Hz. The time response of the SPAD showed decreasing timing jitter (full width at half maximum) with increasing overbias voltage, with 70 ps being the smallest timing jitter measured. PMID:27069647

Improved Short-Circuit Protection for Power Cells in Series

NASA Technical Reports Server (NTRS)

Davies, Francis

2008-01-01

A scheme for protection against short circuits has been devised for series strings of lithium electrochemical cells that contain built-in short-circuit protection devices, which go into a high-resistance, current-limiting state when heated by excessive current. If cells are simply connected in a long series string to obtain a high voltage and a short circuit occurs, whichever short-circuit protection device trips first is exposed to nearly the full string voltage, which, typically, is large enough to damage the device. Depending on the specific cell design, the damage can defeat the protective function, cause a dangerous internal short circuit in the affected cell, and/or cascade to other cells. In the present scheme, reverse diodes rated at a suitably high current are connected across short series sub-strings, the lengths of which are chosen so that when a short-circuit protection device is tripped, the voltage across it does not exceed its rated voltage. This scheme preserves the resetting properties of the protective devices. It provides for bypassing of cells that fail open and limits cell reversal, though not as well as does the more-expensive scheme of connecting a diode across every cell.

Development and investigation of silicon converter beta radiation 63Ni isotope

NASA Astrophysics Data System (ADS)

Krasnov, A. A.; Legotin, S. A.; Murashev, V. N.; Didenko, S. I.; Rabinovich, O. I.; Yurchuk, S. Yu; Omelchenko, Yu K.; Yakimov, E. B.; Starkov, V. V.

2016-02-01

In this paper the results of the creation and researching characteristics of, experimental betavoltaic converters (BVC), based on silicon are discussed. It was presented the features of structural and technological performance of planar 2 D- structure of BVC. To study the parameters of the converter stream the beta particles of the radioisotope was simulated by 63Ni electron flux from scanning electron microscope. It was investigated the dependence of the collecting electrons efficiency from the beam energy current-voltage characteristic was measured when irradiated by an electron beam, from which the value of the short-circuit current density equal to 126 nA / cm2 and the value of the open circuit voltage of 150 mV were obtained. The maximum power density at 70 mV is 9.5 nW / cm2, and the conversion efficiency is 2.1%. It was presented the results of experimental studies of the current-voltage characteristics of samples by irradiating a film 63Ni. The values of load voltage 111 mV and short circuit current density of 27 nA / cm2 were obtained. Maximum power density was 1.52 nW / cm2.

Analysis of Solar Cell Efficiency for Venus Atmosphere and Surface Missions

NASA Technical Reports Server (NTRS)

Landis, Geoffrey A.; Haag, Emily

2013-01-01

A simplified model of solar power in the Venus environment is developed, in which the solar intensity, solar spectrum, and temperature as a function of altitude is applied to a model of photovoltaic performance, incorporating the temperature and intensity dependence of the open-circuit voltage and the temperature dependence of the bandgap and spectral response of the cell. We use this model to estimate the performance of solar cells for both the surface of Venus and for atmospheric probes at altitudes from the surface up to 60 km. The model shows that photovoltaic cells will produce power even at the surface of Venus.

Electrical system for measurement of breakdown voltage of vacuum and gas-filled tubes using a dynamic method

NASA Astrophysics Data System (ADS)

Pejović, Milić M.; Milosavljević, Čedomir S.; Pejović, Momčilo M.

2003-06-01

This article describes an electrical system aimed at measuring and data acquisition of breakdown voltages of vacuum and gas-filled tubes. The measurements were performed using a nitrogen-filled tube at 4 mbar pressure. Based on the measured breakdown voltage data as a function of the applied voltage increase rate, a static breakdown voltage is estimated for the applied voltage gradient ranging from 0.1 to 1 V s-1 and from 1 to 10 V s-1. The histograms of breakdown voltages versus applied voltage increase rates from 0.1 and 0.5 V s-1 are approximated by the probability density functions using a fitting procedure.

Release from the cone ribbon synapse under bright light conditions can be controlled by the opening of only a few Ca2+ channels

PubMed Central

Bartoletti, Theodore M.; Jackman, Skyler L.; Babai, Norbert; Mercer, Aaron J.; Kramer, Richard H.

2011-01-01

Light hyperpolarizes cone photoreceptors, causing synaptic voltage-gated Ca2+ channels to open infrequently. To understand neurotransmission under these conditions, we determined the number of L-type Ca2+ channel openings necessary for vesicle fusion at the cone ribbon synapse. Ca2+ currents (ICa) were activated in voltage-clamped cones, and excitatory postsynaptic currents (EPSCs) were recorded from horizontal cells in the salamander retina slice preparation. Ca2+ channel number and single-channel current amplitude were calculated by mean-variance analysis of ICa. Two different comparisons—one comparing average numbers of release events to average ICa amplitude and the other involving deconvolution of both EPSCs and simultaneously recorded cone ICa—suggested that fewer than three Ca2+ channel openings accompanied fusion of each vesicle at the peak of release during the first few milliseconds of stimulation. Opening fewer Ca2+ channels did not enhance fusion efficiency, suggesting that few unnecessary channel openings occurred during strong depolarization. We simulated release at the cone synapse, using empirically determined synaptic dimensions, vesicle pool size, Ca2+ dependence of release, Ca2+ channel number, and Ca2+ channel properties. The model replicated observations when a barrier was added to slow Ca2+ diffusion. Consistent with the presence of a diffusion barrier, dialyzing cones with diffusible Ca2+ buffers did not affect release efficiency. The tight clustering of Ca2+ channels, along with a high-Ca2+ affinity release mechanism and diffusion barrier, promotes a linear coupling between Ca2+ influx and vesicle fusion. This may improve detection of small light decrements when cones are hyperpolarized by bright light. PMID:21880934

Release from the cone ribbon synapse under bright light conditions can be controlled by the opening of only a few Ca(2+) channels.

PubMed

Bartoletti, Theodore M; Jackman, Skyler L; Babai, Norbert; Mercer, Aaron J; Kramer, Richard H; Thoreson, Wallace B

2011-12-01

Light hyperpolarizes cone photoreceptors, causing synaptic voltage-gated Ca(2+) channels to open infrequently. To understand neurotransmission under these conditions, we determined the number of L-type Ca(2+) channel openings necessary for vesicle fusion at the cone ribbon synapse. Ca(2+) currents (I(Ca)) were activated in voltage-clamped cones, and excitatory postsynaptic currents (EPSCs) were recorded from horizontal cells in the salamander retina slice preparation. Ca(2+) channel number and single-channel current amplitude were calculated by mean-variance analysis of I(Ca). Two different comparisons-one comparing average numbers of release events to average I(Ca) amplitude and the other involving deconvolution of both EPSCs and simultaneously recorded cone I(Ca)-suggested that fewer than three Ca(2+) channel openings accompanied fusion of each vesicle at the peak of release during the first few milliseconds of stimulation. Opening fewer Ca(2+) channels did not enhance fusion efficiency, suggesting that few unnecessary channel openings occurred during strong depolarization. We simulated release at the cone synapse, using empirically determined synaptic dimensions, vesicle pool size, Ca(2+) dependence of release, Ca(2+) channel number, and Ca(2+) channel properties. The model replicated observations when a barrier was added to slow Ca(2+) diffusion. Consistent with the presence of a diffusion barrier, dialyzing cones with diffusible Ca(2+) buffers did not affect release efficiency. The tight clustering of Ca(2+) channels, along with a high-Ca(2+) affinity release mechanism and diffusion barrier, promotes a linear coupling between Ca(2+) influx and vesicle fusion. This may improve detection of small light decrements when cones are hyperpolarized by bright light.

The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

PubMed

Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

2017-08-01

Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

Functional diversity of potassium channel voltage-sensing domains.

PubMed

Islas, León D

2016-01-01

Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology.

Functional diversity of potassium channel voltage-sensing domains

PubMed Central

Islas, León D.

2016-01-01

Abstract Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology. PMID:26794852

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

PubMed

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

The calcium-permeable non-selective cation channel TRPM2 is modulated by cellular acidification

PubMed Central

Starkus, John G; Fleig, Andrea; Penner, Reinhold

2010-01-01

TRPM2 is a calcium-permeable non-selective cation channel expressed in the plasma membrane and in lysosomes that is critically involved in aggravating reactive oxygen species (ROS)-induced inflammatory processes and has been implicated in cell death. TRPM2 is gated by ADP-ribose (ADPR) and modulated by physiological processes that produce peroxide, cyclic ADP-ribose (cADPR), nicotinamide adenine dinucleotide phosphate (NAADP) and Ca2+. We investigated the role of extra- and intracellular acidification on heterologously expressed TRPM2 in HEK293 cells. Our results show that TRPM2 is inhibited by external acidification with an IC50 of pH 6.5 and is completely suppressed by internal pH of 6. Current inhibition requires channel opening and is strongly voltage dependent, being most effective at negative potentials. In addition, increased cytosolic pH buffering capacity or elevated [Ca2+]i reduces the rate of current inactivation elicited by extracellular acidification, and Na+ and Ca2+ influence the efficacy of proton-induced inactivation. Together, these results suggest that external protons permeate TRPM2 channels to gain access to an intracellular site that regulates channel activity. Consistent with this notion, single-channel measurements in HEK293 cells reveal that internal protons induce channel closure without affecting single-channel conductance, whereas external protons affect channel open probability as well as single-channel conductance of native TRPM2 in neutrophils. We conclude that protons compete with Na+ and Ca2+ for channel permeation and channel closure results from a competitive antagonism of protons at an intracellular Ca2+ binding site. PMID:20194125

The calcium-permeable non-selective cation channel TRPM2 is modulated by cellular acidification.

PubMed

Starkus, John G; Fleig, Andrea; Penner, Reinhold

2010-04-15

TRPM2 is a calcium-permeable non-selective cation channel expressed in the plasma membrane and in lysosomes that is critically involved in aggravating reactive oxygen species (ROS)-induced inflammatory processes and has been implicated in cell death. TRPM2 is gated by ADP-ribose (ADPR) and modulated by physiological processes that produce peroxide, cyclic ADP-ribose (cADPR), nicotinamide adenine dinucleotide phosphate (NAADP) and Ca(2+). We investigated the role of extra- and intracellular acidification on heterologously expressed TRPM2 in HEK293 cells. Our results show that TRPM2 is inhibited by external acidification with an IC(50) of pH 6.5 and is completely suppressed by internal pH of 6. Current inhibition requires channel opening and is strongly voltage dependent, being most effective at negative potentials. In addition, increased cytosolic pH buffering capacity or elevated [Ca(2+)](i) reduces the rate of current inactivation elicited by extracellular acidification, and Na(+) and Ca(2+) influence the efficacy of proton-induced inactivation. Together, these results suggest that external protons permeate TRPM2 channels to gain access to an intracellular site that regulates channel activity. Consistent with this notion, single-channel measurements in HEK293 cells reveal that internal protons induce channel closure without affecting single-channel conductance, whereas external protons affect channel open probability as well as single-channel conductance of native TRPM2 in neutrophils. We conclude that protons compete with Na(+) and Ca(2+) for channel permeation and channel closure results from a competitive antagonism of protons at an intracellular Ca(2+) binding site.

Dropout rates in medical students at one school before and after the installation of admission tests in Austria.

PubMed

Reibnegger, Gilbert; Caluba, Hans-Christian; Ithaler, Daniel; Manhal, Simone; Neges, Heide Maria; Smolle, Josef

2011-08-01

Admission to medical studies in Austria since academic year 2005-2006 has been regulated by admission tests. At the Medical University of Graz, an admission test focusing on secondary-school-level knowledge in natural sciences has been used for this purpose. The impact of this important change on dropout rates of female versus male students and older versus younger students is reported. All 2,860 students admitted to the human medicine diploma program at the Medical University of Graz from academic years 2002-2003 to 2008-2009 were included. Nonparametric and semiparametric survival analysis techniques were employed to compare cumulative probability of dropout between demographic groups. Cumulative probability of dropout was significantly reduced in students selected by active admission procedure versus those admitted openly (P < .0001). Relative hazard ratio of selected versus openly admitted students was only 0.145 (95% CI, 0.106-0.198). Among openly admitted students, but not for selected ones, the cumulative probabilities for dropout were higher for females (P < .0001) and for older students (P < .0001). Generally, dropout hazard is highest during the second year of study. The introduction of admission testing significantly decreased the cumulative probability for dropout. In openly admitted students a significantly higher risk for dropout was found in female students and in older students, whereas no such effects can be detected after admission testing. Future research should focus on the sex dependence, with the aim of improving success rates among female applicants on the admission tests.

Voltage Gated Ion Channel Function: Gating, Conduction, and the Role of Water and Protons

PubMed Central

Kariev, Alisher M.; Green, Michael E.

2012-01-01

Ion channels, which are found in every biological cell, regulate the concentration of electrolytes, and are responsible for multiple biological functions, including in particular the propagation of nerve impulses. The channels with the latter function are gated (opened) by a voltage signal, which allows Na+ into the cell and K+ out. These channels have several positively charged amino acids on a transmembrane domain of their voltage sensor, and it is generally considered, based primarily on two lines of experimental evidence, that these charges move with respect to the membrane to open the channel. At least three forms of motion, with greatly differing extents and mechanisms of motion, have been proposed. There is a “gating current”, a capacitative current preceding the channel opening, that corresponds to several charges (for one class of channel typically 12–13) crossing the membrane field, which may not require protein physically crossing a large fraction of the membrane. The coupling to the opening of the channel would in these models depend on the motion. The conduction itself is usually assumed to require the “gate” of the channel to be pulled apart to allow ions to enter as a section of the protein partially crosses the membrane, and a selectivity filter at the opposite end of the channel determines the ion which is allowed to pass through. We will here primarily consider K+ channels, although Na+ channels are similar. We propose that the mechanism of gating differs from that which is generally accepted, in that the positively charged residues need not move (there may be some motion, but not as gating current). Instead, protons may constitute the gating current, causing the gate to open; opening consists of only increasing the diameter at the gate from approximately 6 Å to approximately 12 Å. We propose in addition that the gate oscillates rather than simply opens, and the ion experiences a barrier to its motion across the channel that is tuned by the water present within the channel. Our own quantum calculations as well as numerous experiments of others are interpreted in terms of this hypothesis. It is also shown that the evidence that supports the motion of the sensor as the gating current can also be consistent with the hypothesis we present. PMID:22408417

Interdigitated back contact solar cells with polycrystalline silicon on oxide passivating contacts for both polarities

NASA Astrophysics Data System (ADS)

Haase, Felix; Kiefer, Fabian; Schäfer, Sören; Kruse, Christian; Krügener, Jan; Brendel, Rolf; Peibst, Robby

2017-08-01

We demonstrate an independently confirmed 25.0%-efficient interdigitated back contact silicon solar cell with passivating polycrystalline silicon (poly-Si) on oxide (POLO) contacts that enable a high open circuit voltage of 723 mV. We use n-type POLO contacts with a measured saturation current density of J 0n = 4 fA cm-2 and p-type POLO contacts with J 0p = 10 fA cm-2. The textured front side and the gaps between the POLO contacts on the rear are passivated by aluminum oxide (AlO x ) with J 0AlO x = 6 fA cm-2 as measured after deposition. We analyze the recombination characteristics of our solar cells at different process steps using spatially resolved injection-dependent carrier lifetimes measured by infrared lifetime mapping. The implied pseudo-efficiency of the unmasked cell, i.e., cell and perimeter region are illuminated during measurement, is 26.2% before contact opening, 26.0% after contact opening and 25.7% for the finished cell. This reduction is due to an increase in the saturation current density of the AlO x passivation during chemical etching of the contact openings and of the rear side metallization. The difference between the implied pseudo-efficiency and the actual efficiency of 25.0% as determined by designated-area light current-voltage (I-V) measurements is due to series resistance and diffusion of excess carriers into the non-illuminated perimeter region.

Voltage Sensor Inactivation in Potassium Channels

PubMed Central

Bähring, Robert; Barghaan, Jan; Westermeier, Regina; Wollberg, Jessica

2012-01-01

In voltage-gated potassium (Kv) channels membrane depolarization causes movement of a voltage sensor domain. This conformational change of the protein is transmitted to the pore domain and eventually leads to pore opening. However, the voltage sensor domain may interact with two distinct gates in the pore domain: the activation gate (A-gate), involving the cytoplasmic S6 bundle crossing, and the pore gate (P-gate), located externally in the selectivity filter. How the voltage sensor moves and how tightly it interacts with these two gates on its way to adopt a relaxed conformation when the membrane is depolarized may critically determine the mode of Kv channel inactivation. In certain Kv channels, voltage sensor movement leads to a tight interaction with the P-gate, which may cause conformational changes that render the selectivity filter non-conductive (“P/C-type inactivation”). Other Kv channels may preferably undergo inactivation from pre-open closed-states during voltage sensor movement, because the voltage sensor temporarily uncouples from the A-gate. For this behavior, known as “preferential” closed-state inactivation, we introduce the term “A/C-type inactivation”. Mechanistically, P/C- and A/C-type inactivation represent two forms of “voltage sensor inactivation.” PMID:22654758

Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin

PubMed Central

Wahle, Christopher W.; Martini, K. Michael; Hollenbeck, Dawn M.; Langner, Andreas; Ross, David S.; Hamilton, John F.; Thurston, George M.

2018-01-01

We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γ B) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54 × 54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γB charge pairs. We model intrinsic pK values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of pK values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic pK values for isolated γB molecules and we calculate the probabilities of leading proton occupancy configurations, for 4 < pH < 8 and Debye screening lengths from 6 to 20 Å. We select the interior dielectric value to model γB titration data. At pH 7.1 and Debye length 6.0 Å, on a given γB molecule the predicted top occupancy pattern is present nearly 20% of the time, and 90% of the time one or another of the first 100 patterns will be present. Many of these occupancy patterns differ in net charge sign as well as in surface voltage profile. We illustrate how charge pattern probabilities deviate from the multinomial distribution that would result from use of effective pK values alone and estimate the extents to which γB charge pattern distributions broaden at lower pH and narrow as ionic strength is lowered. These results suggest that for accurate modeling of orientation-dependent γB-γB interactions, consideration of numerous pairs of proton occupancy patterns will be needed. PMID:29346981

Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin.

PubMed

Wahle, Christopher W; Martini, K Michael; Hollenbeck, Dawn M; Langner, Andreas; Ross, David S; Hamilton, John F; Thurston, George M

2017-09-01

We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γB) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54×54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γB charge pairs. We model intrinsic pK values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of pK values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic pK values for isolated γB molecules and we calculate the probabilities of leading proton occupancy configurations, for 4

Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin

NASA Astrophysics Data System (ADS)

Wahle, Christopher W.; Martini, K. Michael; Hollenbeck, Dawn M.; Langner, Andreas; Ross, David S.; Hamilton, John F.; Thurston, George M.

2017-09-01

We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γ B ) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54 ×54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γ B charge pairs. We model intrinsic p K values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of p K values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic p K values for isolated γ B molecules and we calculate the probabilities of leading proton occupancy configurations, for 4

Minimized open-circuit voltage reduction in GaAs/InGaAs quantum well solar cells with bandgap-engineered graded quantum well depths

NASA Astrophysics Data System (ADS)

Li, Xiaohan; Dasika, Vaishno D.; Li, Ping-Chun; Ji, Li; Bank, Seth R.; Yu, Edward T.

2014-09-01

The use of InGaAs quantum wells with composition graded across the intrinsic region to increase open-circuit voltage in p-i-n GaAs/InGaAs quantum well solar cells is demonstrated and analyzed. By engineering the band-edge energy profile to reduce photo-generated carrier concentration in the quantum wells at high forward bias, simultaneous increases in both open-circuit voltage and short-circuit current density are achieved, compared to those for a structure with the same average In concentration, but constant rather than graded quantum well composition across the intrinsic region. This approach is combined with light trapping to further increase short-circuit current density.

Demonstration of a High Open-Circuit Voltage GaN Betavoltaic Microbattery

NASA Astrophysics Data System (ADS)

Cheng, Zai-Jun; San, Hai-Sheng; Chen, Xu-Yuan; Liu, Bo; Feng, Zhi-Hong

2011-07-01

A high open-circuit voltage betavoltaic microbattery based on a GaN p-i-n diode is demonstrated. Under the irradiation of a 4×4 mm2 planar solid 63Ni source with an activity of 2 mCi, the open-circuit voltage Voc of the fabricated single 2×2mm2 cell reaches as high as 1.62 V, the short-circuit current density Jsc is measured to be 16nA/cm2. The microbattery has a fill factor of 55%, and the energy conversion efficiency of beta radiation into electricity reaches to 1.13%. The results suggest that GaN is a highly promising potential candidate for long-life betavoltaic microbatteries used as power supplies for microelectromechanical system devices.

The syndromic deafness mutation G12R impairs fast and slow gating in Cx26 hemichannels.

PubMed

García, Isaac E; Villanelo, Felipe; Contreras, Gustavo F; Pupo, Amaury; Pinto, Bernardo I; Contreras, Jorge E; Pérez-Acle, Tomás; Alvarez, Osvaldo; Latorre, Ramon; Martínez, Agustín D; González, Carlos

2018-05-07

Mutations in connexin 26 (Cx26) hemichannels can lead to syndromic deafness that affects the cochlea and skin. These mutations lead to gain-of-function hemichannel phenotypes by unknown molecular mechanisms. In this study, we investigate the biophysical properties of the syndromic mutant Cx26G12R (G12R). Unlike wild-type Cx26, G12R macroscopic hemichannel currents do not saturate upon depolarization, and deactivation is faster during hyperpolarization, suggesting that these channels have impaired fast and slow gating. Single G12R hemichannels show a large increase in open probability, and transitions to the subconductance state are rare and short-lived, demonstrating an inoperative fast gating mechanism. Molecular dynamics simulations indicate that G12R causes a displacement of the N terminus toward the cytoplasm, favoring an interaction between R12 in the N terminus and R99 in the intracellular loop. Disruption of this interaction recovers the fast and slow voltage-dependent gating mechanisms. These results suggest that the mechanisms of fast and slow gating in connexin hemichannels are coupled and provide a molecular mechanism for the gain-of-function phenotype displayed by the syndromic G12R mutation. © 2018 García et al.

Single channel analysis of the blocking actions of BIDN and fipronil on a Drosophila melanogaster GABA receptor (RDL) stably expressed in a Drosophila cell line

PubMed Central

Grolleau, Françoise; Sattelle, David B

2000-01-01

Single channel recordings were obtained from a Drosophila S2 cell line stably expressing the wild-type RDLac Drosophila melanogaster homomer-forming ionotropic GABA receptor subunit, a product of the resistance to dieldrin gene, Rdl. GABA (50 μM) was applied by pressure ejection to outside-out patches from S2-RDL cells at a holding potential of −60 mV. The resulting inward current was completely blocked by 100 μM picrotoxin (PTX). The unitary current-voltage relationship was linear at negative potentials but showed slight inward rectification at potentials more positive than 0 mV. The reversal potential of the current (EGABA=−1.4 mV) was close to the calculated chloride equilibrium potential. The single channel conductance elicited by GABA was 36 pS. A 71 pS conductance channel was also observed when the duration of the pulse, used to eject GABA, was longer than 80 ms. The mean open time distribution of the unitary events was fitted best by two exponential functions suggesting two open channel states. When either 1 μM fipronil or 1 μM BIDN was present in the external saline, the GABA-gated channels were completely blocked. When BIDN or fipronil was applied at a concentration close to the IC50 value for suppression of open probability (281 nM, BIDN; 240 nM, fipronil), the duration of channel openings was shortened. In addition, the blocking action of BIDN resulted in the appearance of a novel channel conductance (17 pS). The effects of co-application of BIDN and fipronil were examined. Co-application of BIDN (300 nM) with various concentrations (100–1000 nM) of fipronil resulted in an additional BIDN-induced dose-dependent reduction of the maximum Po value. Thus both BIDN and fipronil shorten the duration of wild-type RDLac GABA receptor channel openings but appear to act at distinct sites. PMID:10952672

Increases in intracellular pH facilitate endocytosis and decrease availability of voltage-gated proton channels in osteoclasts and microglia

PubMed Central

Sakai, Hiromu; Li, Guangshuai; Hino, Yoshiko; Moriura, Yoshie; Kawawaki, Junko; Sawada, Makoto; Kuno, Miyuki

2013-01-01

Voltage-gated proton channels (H+ channels) are highly proton-selective transmembrane pathways. Although the primary determinants for activation are the pH and voltage gradients across the membrane, the current amplitudes fluctuate often when these gradients are constant. The aim of this study was to investigate the role of the intracellular pH (pHi) in regulating the availability of H+ channels in osteoclasts and microglia. In whole-cell clamp recordings, the pHi was elevated after exposure to NH4Cl and returned to the control level after washout. However, the H+ channel conductance did not recover fully when the exposure was prolonged (>5 min). Similar results were observed in osteoclasts and microglia, but not in COS7 cells expressing a murine H+ channel gene (mVSOP). As other electrophysiological properties, like the gating kinetics and voltage dependence for activation, were unchanged, the decreases in the H+ channel conductance were probably due to the decreases in H+ channels available at the plasma membrane. The decreases in the H+ channel conductances were accompanied by reductions in the cell capacitance. Exposure to NH4Cl increased the uptake of the endocytosis marker FM1-43, substantiating the idea that pHi increases facilitated endocytosis. In osteoclasts, whose plasma membrane expresses V-ATPases and H+ channels, pHi increases by these H+-transferring molecules in part facilitated endocytosis. The endocytosis and decreases in the H+ channel conductance were reduced by dynasore, a dynamin blocker. These results suggest that pHi increases in osteoclasts and microglia decrease the numbers of H+ channels available at the plasma membrane through facilitation of dynamin-dependent endocytosis. PMID:24081153

Timing and efficacy of Ca2+ channel activation in hippocampal mossy fiber boutons.

PubMed

Bischofberger, Josef; Geiger, Jörg R P; Jonas, Peter

2002-12-15

The presynaptic Ca2+ signal is a key determinant of transmitter release at chemical synapses. In cortical synaptic terminals, however, little is known about the kinetic properties of the presynaptic Ca2+ channels. To investigate the timing and magnitude of the presynaptic Ca2+ inflow, we performed whole-cell patch-clamp recordings from mossy fiber boutons (MFBs) in rat hippocampus. MFBs showed large high-voltage-activated Ca(2+) currents, with a maximal amplitude of approximately 100 pA at a membrane potential of 0 mV. Both activation and deactivation were fast, with time constants in the submillisecond range at a temperature of approximately 23 degrees C. An MFB action potential (AP) applied as a voltage-clamp command evoked a transient Ca2+ current with an average amplitude of approximately 170 pA and a half-duration of 580 microsec. A prepulse to +40 mV had only minimal effects on the AP-evoked Ca2+ current, indicating that presynaptic APs open the voltage-gated Ca2+ channels very effectively. On the basis of the experimental data, we developed a kinetic model with four closed states and one open state, linked by voltage-dependent rate constants. Simulations of the Ca2+ current could reproduce the experimental data, including the large amplitude and rapid time course of the current evoked by MFB APs. Furthermore, the simulations indicate that the shape of the presynaptic AP and the gating kinetics of the Ca2+ channels are tuned to produce a maximal Ca2+ influx during a minimal period of time. The precise timing and high efficacy of Ca2+ channel activation at this cortical glutamatergic synapse may be important for synchronous transmitter release and temporal information processing.

Genotype–phenotype correlations in neonatal epilepsies caused by mutations in the voltage sensor of Kv7.2 potassium channel subunits

PubMed Central

Miceli, Francesco; Soldovieri, Maria Virginia; Ambrosino, Paolo; Barrese, Vincenzo; Migliore, Michele; Cilio, Maria Roberta; Taglialatela, Maurizio

2013-01-01

Mutations in the KV7.2 gene encoding for voltage-dependent K+ channel subunits cause neonatal epilepsies with wide phenotypic heterogeneity. Two mutations affecting the same positively charged residue in the S4 domain of KV7.2 have been found in children affected with benign familial neonatal seizures (R213W mutation) or with neonatal epileptic encephalopathy with severe pharmacoresistant seizures and neurocognitive delay, suppression-burst pattern at EEG, and distinct neuroradiological features (R213Q mutation). To examine the molecular basis for this strikingly different phenotype, we studied the functional characteristics of mutant channels by using electrophysiological techniques, computational modeling, and homology modeling. Functional studies revealed that, in homomeric or heteromeric configuration with KV7.2 and/or KV7.3 subunits, both mutations markedly destabilized the open state, causing a dramatic decrease in channel voltage sensitivity. These functional changes were (i) more pronounced for channels incorporating R213Q- than R213W-carrying KV7.2 subunits; (ii) proportional to the number of mutant subunits incorporated; and (iii) fully restored by the neuronal Kv7 activator retigabine. Homology modeling confirmed a critical role for the R213 residue in stabilizing the activated voltage sensor configuration. Modeling experiments in CA1 hippocampal pyramidal cells revealed that both mutations increased cell firing frequency, with the R213Q mutation prompting more dramatic functional changes compared with the R213W mutation. These results suggest that the clinical disease severity may be related to the extent of the mutation-induced functional K+ channel impairment, and set the preclinical basis for the potential use of Kv7 openers as a targeted anticonvulsant therapy to improve developmental outcome in neonates with KV7.2 encephalopathy. PMID:23440208

Charged Residues at the First Transmembrane Region Contribute to the Voltage Dependence of the Slow Gate of Connexins.

PubMed

Pinto, Bernardo I; García, Isaac E; Pupo, Amaury; Retamal, Mauricio A; Martínez, Agustín D; Latorre, Ramón; González, Carlos

2016-07-22

Connexins (Cxs) are a family of membrane-spanning proteins that form gap junction channels and hemichannels. Connexin-based channels exhibit two distinct voltage-dependent gating mechanisms termed slow and fast gating. Residues located at the C terminus of the first transmembrane segment (TM-1) are important structural components of the slow gate. Here, we determined the role of the charged residues at the end of TM-1 in voltage sensing in Cx26, Cx46, and Cx50. Conductance/voltage curves obtained from tail currents together with kinetics analysis reveal that the fast and slow gates of Cx26 involves the movement of two and four charges across the electric field, respectively. Primary sequence alignment of different Cxs shows the presence of well conserved glutamate residues in the C terminus of TM-1; only Cx26 contains a lysine in that position (lysine 41). Neutralization of lysine 41 in Cx26 increases the voltage dependence of the slow gate. Swapping of lysine 41 with glutamate 42 maintains the voltage dependence. In Cx46, neutralization of negative charges or addition of a positive charge in the Cx26 equivalent region reduced the slow gate voltage dependence. In Cx50, the addition of a glutamate in the same region decreased the voltage dependence, and the neutralization of a negative charge increased it. These results indicate that the charges at the end of TM-1 are part of the slow gate voltage sensor in Cxs. The fact that Cx42, which has no charge in this region, still presents voltage-dependent slow gating suggests that charges still unidentified also contribute to the slow gate voltage sensitivity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Charged Residues at the First Transmembrane Region Contribute to the Voltage Dependence of the Slow Gate of Connexins*

PubMed Central

Pinto, Bernardo I.; García, Isaac E.; Pupo, Amaury; Retamal, Mauricio A.; Martínez, Agustín D.; Latorre, Ramón; González, Carlos

2016-01-01

Connexins (Cxs) are a family of membrane-spanning proteins that form gap junction channels and hemichannels. Connexin-based channels exhibit two distinct voltage-dependent gating mechanisms termed slow and fast gating. Residues located at the C terminus of the first transmembrane segment (TM-1) are important structural components of the slow gate. Here, we determined the role of the charged residues at the end of TM-1 in voltage sensing in Cx26, Cx46, and Cx50. Conductance/voltage curves obtained from tail currents together with kinetics analysis reveal that the fast and slow gates of Cx26 involves the movement of two and four charges across the electric field, respectively. Primary sequence alignment of different Cxs shows the presence of well conserved glutamate residues in the C terminus of TM-1; only Cx26 contains a lysine in that position (lysine 41). Neutralization of lysine 41 in Cx26 increases the voltage dependence of the slow gate. Swapping of lysine 41 with glutamate 42 maintains the voltage dependence. In Cx46, neutralization of negative charges or addition of a positive charge in the Cx26 equivalent region reduced the slow gate voltage dependence. In Cx50, the addition of a glutamate in the same region decreased the voltage dependence, and the neutralization of a negative charge increased it. These results indicate that the charges at the end of TM-1 are part of the slow gate voltage sensor in Cxs. The fact that Cx42, which has no charge in this region, still presents voltage-dependent slow gating suggests that charges still unidentified also contribute to the slow gate voltage sensitivity. PMID:27143357

Pulsed corona generation using a diode-based pulsed power generator

NASA Astrophysics Data System (ADS)

Pemen, A. J. M.; Grekhov, I. V.; van Heesch, E. J. M.; Yan, K.; Nair, S. A.; Korotkov, S. V.

2003-10-01

Pulsed plasma techniques serve a wide range of unconventional processes, such as gas and water processing, hydrogen production, and nanotechnology. Extending research on promising applications, such as pulsed corona processing, depends to a great extent on the availability of reliable, efficient and repetitive high-voltage pulsed power technology. Heavy-duty opening switches are the most critical components in high-voltage pulsed power systems with inductive energy storage. At the Ioffe Institute, an unconventional switching mechanism has been found, based on the fast recovery process in a diode. This article discusses the application of such a "drift-step-recovery-diode" for pulsed corona plasma generation. The principle of the diode-based nanosecond high-voltage generator will be discussed. The generator will be coupled to a corona reactor via a transmission-line transformer. The advantages of this concept, such as easy voltage transformation, load matching, switch protection and easy coupling with a dc bias voltage, will be discussed. The developed circuit is tested at both a resistive load and various corona reactors. Methods to optimize the energy transfer to a corona reactor have been evaluated. The impedance matching between the pulse generator and corona reactor can be significantly improved by using a dc bias voltage. At good matching, the corona energy increases and less energy reflects back to the generator. Matching can also be slightly improved by increasing the temperature in the corona reactor. More effective is to reduce the reactor pressure.

Anomalous transport in fluid field with random waiting time depending on the preceding jump length

NASA Astrophysics Data System (ADS)

Zhang, Hong; Li, Guo-Hua

2016-11-01

Anomalous (or non-Fickian) transport behaviors of particles have been widely observed in complex porous media. To capture the energy-dependent characteristics of non-Fickian transport of a particle in flow fields, in the present paper a generalized continuous time random walk model whose waiting time probability distribution depends on the preceding jump length is introduced, and the corresponding master equation in Fourier-Laplace space for the distribution of particles is derived. As examples, two generalized advection-dispersion equations for Gaussian distribution and lévy flight with the probability density function of waiting time being quadratic dependent on the preceding jump length are obtained by applying the derived master equation. Project supported by the Foundation for Young Key Teachers of Chengdu University of Technology, China (Grant No. KYGG201414) and the Opening Foundation of Geomathematics Key Laboratory of Sichuan Province, China (Grant No. scsxdz2013009).

The Voltage Boost Enabled by Luminescence Extraction in Solar Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganapati, Vidya; Steiner, Myles A.; Yablonovitch, Eli

Over the past few years, the application of the physical principle, i.e., 'luminescence extraction,' has produced record voltages and efficiencies in photovoltaic cells. Luminescence extraction is the use of optical design, such as a back mirror or textured surfaces, to help internal photons escape out of the front surface of a solar cell. The principle of luminescence extraction is exemplified by the mantra 'a good solar cell should also be a good LED.' Basic thermodynamics says that the voltage boost should be related to concentration ratio C of a resource by ΔV = (kT/q) ln{C}. In light trapping (i.e., when the solar cell is textured and has a perfect back mirror), the concentration ratio of photons C = {4n 2}; therefore, one would expect a voltage boost of ΔV = (kT/q) ln{4n 2} over a solar cell with no texture and zero back reflectivity, where n is the refractive index. Nevertheless, there has been ambiguity over the voltage benefit to be expected from perfect luminescence extraction. Do we gain an open-circuit voltage boost of ΔV = (kT/q) ln{n 2}, ΔV = (kT/q) ln{2 n 2}, or ΔV = (kT/q) ln{4 n 2}? What is responsible for this voltage ambiguity ΔV = (kT/q) ln{4}more » $${\\asymp}$$ 36 mV? Finally, we show that different results come about, depending on whether the photovoltaic cell is optically thin or thick to its internal luminescence. In realistic intermediate cases of optical thickness, the voltage boost falls in between: ln{n 2} < (qΔV/kT) < ln{4n 2}.« less

A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

PubMed

Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

2017-05-01

Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore

PubMed Central

Fernández-Trillo, Jorge; Bharill, Shashank; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y.

2017-01-01

Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4–S5 linker). However, our recent work on channels disrupted in the S4–S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of KV10.1 revealed that the S4–S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use “split” channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in KV10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4–S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4–S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. PMID:28360219

The Voltage Boost Enabled by Luminescence Extraction in Solar Cells

DOE PAGES

Ganapati, Vidya; Steiner, Myles A.; Yablonovitch, Eli

2016-07-01

Over the past few years, the application of the physical principle, i.e., 'luminescence extraction,' has produced record voltages and efficiencies in photovoltaic cells. Luminescence extraction is the use of optical design, such as a back mirror or textured surfaces, to help internal photons escape out of the front surface of a solar cell. The principle of luminescence extraction is exemplified by the mantra 'a good solar cell should also be a good LED.' Basic thermodynamics says that the voltage boost should be related to concentration ratio C of a resource by ΔV = (kT/q) ln{C}. In light trapping (i.e., when the solar cell is textured and has a perfect back mirror), the concentration ratio of photons C = {4n 2}; therefore, one would expect a voltage boost of ΔV = (kT/q) ln{4n 2} over a solar cell with no texture and zero back reflectivity, where n is the refractive index. Nevertheless, there has been ambiguity over the voltage benefit to be expected from perfect luminescence extraction. Do we gain an open-circuit voltage boost of ΔV = (kT/q) ln{n 2}, ΔV = (kT/q) ln{2 n 2}, or ΔV = (kT/q) ln{4 n 2}? What is responsible for this voltage ambiguity ΔV = (kT/q) ln{4}more » $${\\asymp}$$ 36 mV? Finally, we show that different results come about, depending on whether the photovoltaic cell is optically thin or thick to its internal luminescence. In realistic intermediate cases of optical thickness, the voltage boost falls in between: ln{n 2} < (qΔV/kT) < ln{4n 2}.« less

Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions.

PubMed

Kang, Bok Eum; Baker, Bradley J

2016-04-04

An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response.

Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions

PubMed Central

Kang, Bok Eum; Baker, Bradley J.

2016-01-01

An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response. PMID:27040905

Rapid relief of block by mecamylamine of neuronal nicotinic acetylcholine receptors of rat chromaffin cells in vitro: an electrophysiological and modeling study.

PubMed

Giniatullin, R A; Sokolova, E M; Di Angelantonio, S; Skorinkin, A; Talantova, M V; Nistri, A

2000-10-01

The mechanism responsible for the blocking action of mecamylamine on neuronal nicotinic acetylcholine receptors (nAChRs) was studied on rat isolated chromaffin cells recorded under whole-cell patch clamp. Mecamylamine strongly depressed (IC(50) = 0.34 microM) inward currents elicited by short pulses of nicotine, an effect slowly reversible on wash. The mecamylamine block was voltage-dependent and promptly relieved by a protocol combining membrane depolarization with a nicotine pulse. Either depolarization or nicotine pulses were insufficient per se to elicit block relief. Block relief was transient; response depression returned in a use-dependent manner. Exposure to mecamylamine failed to block nAChRs if they were not activated by nicotine or if they were activated at positive membrane potentials. These data suggest that mecamylamine could not interact with receptors either at rest or at depolarized level. Other nicotinic antagonists like dihydro-beta-erythroidine or tubocurarine did not share this action of mecamylamine although proadifen partly mimicked it. Mecamylamine is suggested to penetrate and block open nAChRs that would subsequently close and trap this antagonist. Computer modeling indicated that the mechanism of mecamylamine blocking action could be described by assuming that 1) mecamylamine-blocked receptors possessed a much slower, voltage-dependent isomerization rate, 2) the rate constant for mecamylamine unbinding was large and poorly voltage dependent. Hence, channel reopening plus depolarization allowed mecamylamine escape and block relief. In the presence of mecamylamine, therefore, nAChRs acquire the new property of operating as coincidence detectors for concomitant changes in membrane potential and receptor occupancy.

A limited 4 Å radial displacement of the S4-S5 linker is sufficient for internal gate closing in Kv channels.

PubMed

Faure, Élise; Starek, Greg; McGuire, Hugo; Bernèche, Simon; Blunck, Rikard

2012-11-16

Voltage-gated ion channels are responsible for the generation of action potentials in our nervous system. Conformational rearrangements in their voltage sensor domains in response to changes of the membrane potential control pore opening and thus ion conduction. Crystal structures of the open channel in combination with a wealth of biophysical data and molecular dynamics simulations led to a consensus on the voltage sensor movement. However, the coupling between voltage sensor movement and pore opening, the electromechanical coupling, occurs at the cytosolic face of the channel, from where no structural information is available yet. In particular, the question how far the cytosolic pore gate has to close to prevent ion conduction remains controversial. In cells, spectroscopic methods are hindered because labeling of internal sites remains difficult, whereas liposomes or detergent solutions containing purified ion channels lack voltage control. Here, to overcome these problems, we controlled the state of the channel by varying the lipid environment. This way, we directly measured the position of the S4-S5 linker in both the open and the closed state of a prokaryotic Kv channel (KvAP) in a lipid environment using Lanthanide-based resonance energy transfer. We were able to reconstruct the movement of the covalent link between the voltage sensor and the pore domain and used this information as restraints for molecular dynamics simulations of the closed state structure. We found that a small decrease of the pore radius of about 3-4 Å is sufficient to prevent ion permeation through the pore.

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

PubMed Central

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-01-01

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

PubMed

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-07-05

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

Components of gating charge movement and S4 voltage-sensor exposure during activation of hERG channels.

PubMed

Wang, Zhuren; Dou, Ying; Goodchild, Samuel J; Es-Salah-Lamoureux, Zeineb; Fedida, David

2013-04-01

The human ether-á-go-go-related gene (hERG) K(+) channel encodes the pore-forming α subunit of the rapid delayed rectifier current, IKr, and has unique activation gating kinetics, in that the α subunit of the channel activates and deactivates very slowly, which focuses the role of IKr current to a critical period during action potential repolarization in the heart. Despite its physiological importance, fundamental mechanistic properties of hERG channel activation gating remain unclear, including how voltage-sensor movement rate limits pore opening. Here, we study this directly by recording voltage-sensor domain currents in mammalian cells for the first time and measuring the rates of voltage-sensor modification by [2-(trimethylammonium)ethyl] methanethiosulfonate chloride (MTSET). Gating currents recorded from hERG channels expressed in mammalian tsA201 cells using low resistance pipettes show two charge systems, defined as Q(1) and Q(2), with V(1/2)'s of -55.7 (equivalent charge, z = 1.60) and -54.2 mV (z = 1.30), respectively, with the Q(2) charge system carrying approximately two thirds of the overall gating charge. The time constants for charge movement at 0 mV were 2.5 and 36.2 ms for Q(1) and Q(2), decreasing to 4.3 ms for Q(2) at +60 mV, an order of magnitude faster than the time constants of ionic current appearance at these potentials. The voltage and time dependence of Q2 movement closely correlated with the rate of MTSET modification of I521C in the outermost region of the S4 segment, which had a V(1/2) of -64 mV and time constants of 36 ± 8.5 ms and 11.6 ± 6.3 ms at 0 and +60 mV, respectively. Modeling of Q(1) and Q(2) charge systems showed that a minimal scheme of three transitions is sufficient to account for the experimental findings. These data point to activation steps further downstream of voltage-sensor movement that provide the major delays to pore opening in hERG channels.

Voltage and power relationships in lithium-containing solar cells.

NASA Technical Reports Server (NTRS)

Faith, T. J.

1972-01-01

Photovoltaic characteristics have been measured on a large number of crucible-grown lithium-containing solar cells irradiated by 1-MeV electrons to fluences ranging from 3 x 10 to the 13th power to 3 x 10 to the 15th power electrons per sq cm. These measurements have established empirical relationships between cell photovoltaic parameters and lithium donor density gradient. Short-circuit current and maximum power measured immediately after irradiation decrease logarithmically with lithium gradient. Open-circuit voltage increases logarithmically with lithium gradient both immediately after irradiation and after recovery, the degree of recovery being strongly gradient-dependent at high fluence. As a result, the maximum power and the power at 0.43 V after recovery from 3 x 10 to the 15th power electrons per sq cm increase with increasing lithium gradient.

Estimating the Probability of Electrical Short Circuits from Tin Whiskers. Part 2

NASA Technical Reports Server (NTRS)

Courey, Karim J.; Asfour, Shihab S.; Onar, Arzu; Bayliss, Jon A.; Ludwig, Larry L.; Wright, Maria C.

2009-01-01

To comply with lead-free legislation, many manufacturers have converted from tin-lead to pure tin finishes of electronic components. However, pure tin finishes have a greater propensity to grow tin whiskers than tin-lead finishes. Since tin whiskers present an electrical short circuit hazard in electronic components, simulations have been developed to quantify the risk of said short circuits occurring. Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that had an unknown probability associated with it. Note however that due to contact resistance electrical shorts may not occur at lower voltage levels. In our first article we developed an empirical probability model for tin whisker shorting. In this paper, we develop a more comprehensive empirical model using a refined experiment with a larger sample size, in which we studied the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From the resulting data we estimated the probability distribution of an electrical short, as a function of voltage.

Disparity between online and offline tests in accelerated aging tests of LED lamps under electric stress.

PubMed

Wang, Yao; Jing, Lei; Ke, Hong-Liang; Hao, Jian; Gao, Qun; Wang, Xiao-Xun; Sun, Qiang; Xu, Zhi-Jun

2016-09-20

The accelerated aging tests under electric stress for one type of LED lamp are conducted, and the differences between online and offline tests of the degradation of luminous flux are studied in this paper. The transformation of the two test modes is achieved with an adjustable AC voltage stabilized power source. Experimental results show that the exponential fitting of the luminous flux degradation in online tests possesses a higher fitting degree for most lamps, and the degradation rate of the luminous flux by online tests is always lower than that by offline tests. Bayes estimation and Weibull distribution are used to calculate the failure probabilities under the accelerated voltages, and then the reliability of the lamps under rated voltage of 220 V is estimated by use of the inverse power law model. Results show that the relative error of the lifetime estimation by offline tests increases as the failure probability decreases, and it cannot be neglected when the failure probability is less than 1%. The relative errors of lifetime estimation are 7.9%, 5.8%, 4.2%, and 3.5%, at the failure probabilities of 0.1%, 1%, 5%, and 10%, respectively.

Modafinil inhibits K(Ca)3.1 currents and muscle contraction via a cAMP-dependent mechanism.

PubMed

Choi, Shinkyu; Kim, Moon Young; Joo, Ka Young; Park, Seonghee; Kim, Ji Aee; Jung, Jae-Chul; Oh, Seikwan; Suh, Suk Hyo

2012-07-01

Modafinil has been used as a psychostimulant for the treatment of narcolepsy. However, its primary mechanism of action remains elusive. Therefore, we examined the effects of modafinil on K(Ca)3.1 channels and vascular smooth muscle contraction. K(Ca)3.1 currents and channel activity were measured using a voltage-clamp technique and inside-out patches in mouse embryonic fibroblast cell line, NIH-3T3 fibroblasts. Intracellular adenosine 3',5'-cyclic monophosphate (cAMP) concentration was measured, and the phosphorylation of K(Ca)3.1 channel protein was examined using western blotting in NIH-3T3 fibroblasts and/or primary cultured mouse aortic smooth muscle cells (SMCs). Muscle contractions were recorded from mouse aorta and rat pulmonary artery by using a myograph developed in-house. Modafinil was found to inhibit K(Ca)3.1 currents in a concentration-dependent manner, and the half-maximal inhibition (IC(50)) of modafinil for the current inhibition was 6.8 ± 0.7 nM. The protein kinase A (PKA) activator forskolin also inhibited K(Ca)3.1 currents. The inhibitory effects of modafinil and forskolin on K(Ca)3.1 currents were blocked by the PKA inhibitors PKI(14-22) or H-89. In addition, modafinil relaxed blood vessels (mouse aorta and rat pulmonary artery) in a concentration-dependent manner. Modafinil increased cAMP concentrations in NIH-3T3 fibroblasts or primary cultured mouse aortic SMCs and phosphorylated K(Ca)3.1 channel protein in NIH-3T3 fibroblasts. However, open probability and single-channel current amplitudes of K(Ca)3.1 channels were not changed by modafinil. From these results, we conclude that modafinil inhibits K(Ca)3.1 channels and vascular smooth muscle contraction by cAMP-dependent phosphorylation, suggesting that modafinil can be used as a cAMP-dependent K(Ca)3.1 channel blocker and vasodilator. Copyright © 2012 Elsevier Ltd. All rights reserved.

Relationship of Open-Circuit Voltage to CdTe Hole Concentration and Lifetime

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duenow, Joel N.; Burst, James M.; Albin, David S.

We investigate the correlation of bulk CdTe and CdZnTe material properties with experimental open-circuit voltage (Voc) through fabrication and characterization of diverse single-crystal solar cells with different dopants. Several distinct crystal types reach Voc >900 mV. Correlations are in general agreement with Voc limits modeled from bulk minority-carrier lifetime and hole concentration.

A bursting potassium channel in isolated cholinergic synaptosomes of Torpedo electric organ.

PubMed Central

Edry-Schiller, J; Ginsburg, S; Rahamimoff, R

1991-01-01

1. Pinched-off cholinergic nerve terminals (synaptosomes) prepared from the electric organ of Torpedo ocelata were fused into large structures (greater than 20 microns) using dimethyl sulphoxide and polyethylene glycol 1500, as previously described for synaptic vesicles from the same organ. 2. The giant fused synaptosomes were easily amenable to the patch clamp technique and 293 seals with a resistance greater than 4 G omega were obtained in the 'cell-attached' configuration. In a large fraction of the experiments, an 'inside-out' patch configuration was achieved. 3. Several types of unitary ionic currents were observed. This study describes the most frequently observed single-channel activity which was found in 247 out of the 293 membrane patches (84.3%). 4. The single-channel current-voltage relation was linear between -60 and 20 mV and showed a slope conductance of 23.8 +/- 1.3 pS when the pipette contained 350-390 mM-Na+ and the bath facing the inside of the synaptosomal membrane contained 390 mM-K+. 5. From extrapolated reversal potential measurements, it was concluded that this channel has a large selectivity for K+ over Na+ (70.4 +/- 11.5, mean +/- S.E.M.). Chloride ions are not transported significantly through this potassium channel. 6. This potassium channel has a low probability of opening. The probability of being in the open state increases upon depolarization and reaches about 1% when the inside of the patch is 20 mV positive compared to the pipette side. 7. The mean channel open time increases with depolarization; thus the product current x time (= charge) also increases upon depolarization, showing properties of an outward rectifier. 8. The potassium channel in the giant synaptosome membrane has a bursting behaviour. Open-time distribution, closed-time distribution and a Poisson analysis indicate that the minimal kinetic scheme requires one open state and three closed states. PMID:1654418

The eGo grid model: An open source approach towards a model of German high and extra-high voltage power grids

NASA Astrophysics Data System (ADS)

Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen

2018-02-01

There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.

Guanidinium: A Route to Enhanced Carrier Lifetime and Open-Circuit Voltage in Hybrid Perovskite Solar Cells.

PubMed

De Marco, Nicholas; Zhou, Huanping; Chen, Qi; Sun, Pengyu; Liu, Zonghao; Meng, Lei; Yao, En-Ping; Liu, Yongsheng; Schiffer, Andy; Yang, Yang

2016-02-10

Hybrid perovskites have shown astonishing power conversion efficiencies owed to their remarkable absorber characteristics including long carrier lifetimes, and a relatively substantial defect tolerance for solution-processed polycrystalline films. However, nonradiative charge carrier recombination at grain boundaries limits open circuit voltages and consequent performance improvements of perovskite solar cells. Here we address such recombination pathways and demonstrate a passivation effect through guanidinium-based additives to achieve extraordinarily enhanced carrier lifetimes and higher obtainable open circuit voltages. Time-resolved photoluminescence measurements yield carrier lifetimes in guanidinium-based films an order of magnitude greater than pure-methylammonium counterparts, giving rise to higher device open circuit voltages and power conversion efficiencies exceeding 17%. A reduction in defect activation energy of over 30% calculated via admittance spectroscopy and confocal fluorescence intensity mapping indicates successful passivation of recombination/trap centers at grain boundaries. We speculate that guanidinium ions serve to suppress formation of iodide vacancies and passivate under-coordinated iodine species at grain boundaries and within the bulk through their hydrogen bonding capability. These results present a simple method for suppressing nonradiative carrier loss in hybrid perovskites to further improve performances toward highly efficient solar cells.

Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

PubMed

Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

2014-07-01

Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

The Studies of a Vacuum Gap Breakdown after High-Current Arc Interruption with Increasing the Voltage

NASA Astrophysics Data System (ADS)

Schneider, A. V.; Popov, S. A.; Batrakov, A. V.; Dubrovskaya, E. L.; Lavrinovich, V. A.

2017-12-01

Vacuum-gap breakdown has been studied after high-current arc interruption with a subsequent increase in the transient recovery voltage across a gap. The effects of factors, such as the rate of the rise in the transient voltage, the potential of the shield that surrounds a discharge gap, and the arc burning time, have been determined. It has been revealed that opening the contacts earlier leads to the formation of an anode spot, which is the source of electrode material vapors into the discharge gap after current zero moment. Under the conditions of increasing voltage, this fact results in the breakdown. Too late opening leads to the breakdown of a short gap due to the high electric fields.

Synergistic interplay of Gβγ and phosphatidylinositol 4,5-bisphosphate dictates Kv7.4 channel activity.

PubMed

Povstyan, Oleksandr V; Barrese, Vincenzo; Stott, Jennifer B; Greenwood, Iain A

2017-02-01

Kv7.4 channels are key determinants of arterial contractility and cochlear mechanosensation that, like all Kv7 channels, have an obligatory requirement for phosphatidylinositol 4,5-bisphosphate (PIP 2 ). βγ G proteins (Gβγ) have been identified as novel positive regulators of Kv7.4. The present study ascertained whether Gβγ increased Kv7.4 open probability through an increased sensitivity to PIP 2 . In HEK cells stably expressing Kv7.4, PIP 2 or Gβγ increased open probability in a concentration dependent manner. Depleting PIP 2 prevented any Gβγ-mediated stimulation whilst an array of Gβγ inhibitors prohibited any PIP 2 -induced current enhancement. A combination of PIP 2 and Gβγ at sub-efficacious concentrations increased channel open probability considerably. The stimulatory effects of three Kv7.2-7.5 channel activators were also lost by PIP 2 depletion or Gβγ inhibitors. This study alters substantially our understanding of the fundamental processes that dictate Kv7.4 activity, revealing a more complex and subtle paradigm where the reliance on local phosphoinositide is dictated by interaction with Gβγ.

Developmental Expression of Kv Potassium Channels at the Axon Initial Segment of Cultured Hippocampal Neurons

PubMed Central

Sánchez-Ponce, Diana; DeFelipe, Javier; Garrido, Juan José; Muñoz, Alberto

2012-01-01

Axonal outgrowth and the formation of the axon initial segment (AIS) are early events in the acquisition of neuronal polarity. The AIS is characterized by a high concentration of voltage-dependent sodium and potassium channels. However, the specific ion channel subunits present and their precise localization in this axonal subdomain vary both during development and among the types of neurons, probably determining their firing characteristics in response to stimulation. Here, we characterize the developmental expression of different subfamilies of voltage-gated potassium channels in the AISs of cultured mouse hippocampal neurons, including subunits Kv1.2, Kv2.2 and Kv7.2. In contrast to the early appearance of voltage-gated sodium channels and the Kv7.2 subunit at the AIS, Kv1.2 and Kv2.2 subunits were tethered at the AIS only after 10 days in vitro. Interestingly, we observed different patterns of Kv1.2 and Kv2.2 subunit expression, with each confined to distinct neuronal populations. The accumulation of Kv1.2 and Kv2.2 subunits at the AIS was dependent on ankyrin G tethering, it was not affected by disruption of the actin cytoskeleton and it was resistant to detergent extraction, as described previously for other AIS proteins. This distribution of potassium channels in the AIS further emphasizes the heterogeneity of this structure in different neuronal populations, as proposed previously, and suggests corresponding differences in action potential regulation. PMID:23119056

The temperature dependence of the characteristics of crystalline-silicon-based heterojunction solar cells

NASA Astrophysics Data System (ADS)

Sachenko, A. V.; Kryuchenko, Yu. V.; Kostylyov, V. P.; Korkishko, R. M.; Sokolovskyi, I. O.; Abramov, A. S.; Abolmasov, S. N.; Andronikov, D. A.; Bobyl', A. V.; Panaiotti, I. E.; Terukov, E. I.; Titov, A. S.; Shvarts, M. Z.

2016-03-01

Temperature dependences of the photovoltaic characteristics of ( p)a-Si/( i)a-Si:H/( n)c-Si singlecrystalline- silicon based heterojunction-with-intrinsic-thin-layer (HIT) solar cells have been measured in a temperature range of 80-420 K. The open-circuit voltage ( V OC), fill factor ( FF) of the current-voltage ( I-U) characteristic, and maximum output power ( P max) reach limiting values in the interval of 200-250 K on the background of monotonic growth in the short-circuit current ( I SC) in a temperature range of 80-400 K. At temperatures below this interval, the V OC, FF, and P max values exhibit a decrease. It is theoretically justified that a decrease in the photovoltaic energy conversion characteristics of solar cells observed on heating from 250 to 400 K is related to exponential growth in the intrinsic conductivity. At temperatures below 200 K, the I-U curve shape exhibits a change that is accompanied by a drop in V OC. Possible factors that account for the decrease in V OC, FF, and P max are considered.

Application of hierarchical equations of motion (HEOM) to time dependent quantum transport at zero and finite temperatures

NASA Astrophysics Data System (ADS)

Tian, Heng; Chen, GuanHua

2013-10-01

Going beyond the limitations of our earlier works [X. Zheng, F. Wang, C.Y. Yam, Y. Mo, G.H. Chen, Phys. Rev. B 75, 195127 (2007); X. Zheng, G.H. Chen, Y. Mo, S.K. Koo, H. Tian, C.Y. Yam, Y.J. Yan, J. Chem. Phys. 133, 114101 (2010)], we propose, in this manuscript, a new alternative approach to simulate time-dependent quantum transport phenomenon from first-principles. This new practical approach, still retaining the formal exactness of HEOM framework, does not rely on any intractable parametrization scheme and the pole structure of Fermi distribution function, thus, can seamlessly incorporated into first-principles simulation and treat transient response of an open electronic systems to an external bias voltage at both zero and finite temperatures on the equal footing. The salient feature of this approach is surveyed, and its time complexity is analysed. As a proof-of-principle of this approach, simulation of the transient current of one dimensional tight-binding chain, driven by some direct external voltages, is demonstrated.

State-dependent block of CNG channels by dequalinium.

PubMed

Rosenbaum, Tamara; Gordon-Shaag, Ariela; Islas, León D; Cooper, Jeremy; Munari, Mika; Gordon, Sharona E

2004-03-01

Cyclic nucleotide-gated (CNG) ion channels are nonselective cation channels with a high permeability for Ca(2+). Not surprisingly, they are blocked by a number of Ca(2+) channel blockers including tetracaine, pimozide, and diltiazem. We studied the effects of dequalinium, an extracellular blocker of the small conductance Ca(2+)-activated K(+) channel. We previously noted that dequalinium is a high-affinity blocker of CNGA1 channels from the intracellular side, with little or no state dependence at 0 mV. Here we examined block by dequalinium at a broad range of voltages in both CNGA1 and CNGA2 channels. We found that dequalinium block was mildly state dependent for both channels, with the affinity for closed channels 3-5 times higher than that for open channels. Mutations in the S4-S5 linker did not alter the affinity of open channels for dequalinium, but increased the affinity of closed channels by 10-20-fold. The state-specific effect of these mutations raises the question of whether/how the S4-S5 linker alters the binding of a blocker within the ion permeation pathway.

Aluminium alloyed iron-silicide/silicon solar cells: A simple approach for low cost environmental-friendly photovoltaic technology.

PubMed

Kumar Dalapati, Goutam; Masudy-Panah, Saeid; Kumar, Avishek; Cheh Tan, Cheng; Ru Tan, Hui; Chi, Dongzhi

2015-12-03

This work demonstrates the fabrication of silicide/silicon based solar cell towards the development of low cost and environmental friendly photovoltaic technology. A heterostructure solar cells using metallic alpha phase (α-phase) aluminum alloyed iron silicide (FeSi(Al)) on n-type silicon is fabricated with an efficiency of 0.8%. The fabricated device has an open circuit voltage and fill-factor of 240 mV and 60%, respectively. Performance of the device was improved by about 7 fold to 5.1% through the interface engineering. The α-phase FeSi(Al)/silicon solar cell devices have promising photovoltaic characteristic with an open circuit voltage, short-circuit current and a fill factor (FF) of 425 mV, 18.5 mA/cm(2), and 64%, respectively. The significant improvement of α-phase FeSi(Al)/n-Si solar cells is due to the formation p(+-)n homojunction through the formation of re-grown crystalline silicon layer (~5-10 nm) at the silicide/silicon interface. Thickness of the regrown silicon layer is crucial for the silicide/silicon based photovoltaic devices. Performance of the α-FeSi(Al)/n-Si solar cells significantly depends on the thickness of α-FeSi(Al) layer and process temperature during the device fabrication. This study will open up new opportunities for the Si based photovoltaic technology using a simple, sustainable, and los cost method.

Electrolyte Concentration Effect of a Photoelectrochemical Cell Consisting of TiO 2 Nanotube Anode

DOE PAGES

Ren, Kai; Gan, Yong X.; Nikolaidis, Efstratios; ...

2013-01-01

The photoelectrochemical responses of a TiO 2 nanotube anode in ethylene glycol (EG), glycerol, ammonia, ethanol, urea, and Na 2 S electrolytes with different concentrations were investigated. The TiO 2 nanotube anode was highly efficient in photoelectrocatalysis in these solutions under UV light illumination. The photocurrent density is obviously affected by the concentration change. Na 2 S generated the highest photocurrent density at 0, 1, and 2 V bias voltages, but its concentration does not significantly affect the photocurrent density. Urea shows high open circuit voltage at proper concentration and low photocurrent at different concentrations. Externally applied bias voltage is alsomore » an important factor that changes the photoelectrochemical reaction process. In view of the open circuit voltage, EG, ammonia, and ethanol fuel cells show the trend that the open circuit voltage (OCV) increases with the increase of the concentration of the solutions. Glycerol has the highest OCV compared with others, and it deceases with the increase in the concentration because of the high viscosity. The OCV of the urea and Na 2 S solutions did not show obvious concentration effect.« less

The pH sensor of the plant K+-uptake channel KAT1 is built from a sensory cloud rather than from single key amino acids.

PubMed

González, Wendy; Riedelsberger, Janin; Morales-Navarro, Samuel E; Caballero, Julio; Alzate-Morales, Jans H; González-Nilo, Fernando D; Dreyer, Ingo

2012-02-15

The uptake of potassium ions (K+) accompanied by an acidification of the apoplasm is a prerequisite for stomatal opening. The acidification (approximately 2-2.5 pH units) is perceived by voltage-gated inward potassium channels (K(in)) that then can open their pores with lower energy cost. The sensory units for extracellular pH in stomatal K(in) channels are proposed to be histidines exposed to the apoplasm. However, in the Arabidopsis thaliana stomatal K(in) channel KAT1, mutations in the unique histidine exposed to the solvent (His267) do not affect the pH dependency. We demonstrate in the present study that His267 of the KAT1 channel cannot sense pH changes since the neighbouring residue Phe266 shifts its pKa to undetectable values through a cation-π interaction. Instead, we show that Glu240 placed in the extracellular loop between transmembrane segments S5 and S6 is involved in the extracellular acid activation mechanism. Based on structural models we propose that this region may serve as a molecular link between the pH- and the voltage-sensor. Like Glu240, several other titratable residues could contribute to the pH-sensor of KAT1, interact with each other and even connect such residues far away from the voltage-sensor with the gating machinery of the channel.

Increasing the open-circuit voltage of photoprotein-based photoelectrochemical cells by manipulation of the vacuum potential of the electrolytes.

PubMed

Tan, Swee Ching; Crouch, Lucy I; Mahajan, Sumeet; Jones, Michael R; Welland, Mark E

2012-10-23

The innately highly efficient light-powered separation of charge that underpins natural photosynthesis can be exploited for applications in photoelectrochemistry by coupling nanoscale protein photoreaction centers to man-made electrodes. Planar photoelectrochemical cells employing purple bacterial reaction centers have been constructed that produce a direct current under continuous illumination and an alternating current in response to discontinuous illumination. The present work explored the basis of the open-circuit voltage (V(OC)) produced by such cells with reaction center/antenna (RC-LH1) proteins as the photovoltaic component. It was established that an up to ~30-fold increase in V(OC) could be achieved by simple manipulation of the electrolyte connecting the protein to the counter electrode, with an approximately linear relationship being observed between the vacuum potential of the electrolyte and the resulting V(OC). We conclude that the V(OC) of such a cell is dependent on the potential difference between the electrolyte and the photo-oxidized bacteriochlorophylls in the reaction center. The steady-state short-circuit current (J(SC)) obtained under continuous illumination also varied with different electrolytes by a factor of ~6-fold. The findings demonstrate a simple way to boost the voltage output of such protein-based cells into the hundreds of millivolts range typical of dye-sensitized and polymer-blend solar cells, while maintaining or improving the J(SC). Possible strategies for further increasing the V(OC) of such protein-based photoelectrochemical cells through protein engineering are discussed.

Isolation and Characterization of a High Affinity Peptide Inhibitor of ClC-2 Chloride Channels*

PubMed Central

Thompson, Christopher H.; Olivetti, Pedro R.; Fuller, Matthew D.; Freeman, Cody S.; McMaster, Denis; French, Robert J.; Pohl, Jan; Kubanek, Julia; McCarty, Nael A.

2009-01-01

The ClC protein family includes voltage-gated chloride channels and chloride/proton exchangers. In eukaryotes, ClC proteins regulate membrane potential of excitable cells, contribute to epithelial transport, and aid in lysosomal acidification. Although structure/function studies of ClC proteins have been aided greatly by the available crystal structures of a bacterial ClC chloride/proton exchanger, the availability of useful pharmacological tools, such as peptide toxin inhibitors, has lagged far behind that of their cation channel counterparts. Here we report the isolation, from Leiurus quinquestriatus hebraeus venom, of a peptide toxin inhibitor of the ClC-2 chloride channel. This toxin, GaTx2, inhibits ClC-2 channels with a voltage-dependent apparent KD of ∼20 pm, making it the highest affinity inhibitor of any chloride channel. GaTx2 slows ClC-2 activation by increasing the latency to first opening by nearly 8-fold but is unable to inhibit open channels, suggesting that this toxin inhibits channel activation gating. Finally, GaTx2 specifically inhibits ClC-2 channels, showing no inhibitory effect on a battery of other major classes of chloride channels and voltage-gated potassium channels. GaTx2 is the first peptide toxin inhibitor of any ClC protein. The high affinity and specificity displayed by this toxin will make it a very powerful pharmacological tool to probe ClC-2 structure/function. PMID:19574231

Amorphous-silicon module intercell corrosion

NASA Astrophysics Data System (ADS)

Mon, G. R.; Ross, R. G.

1987-06-01

Three non-electrochemical, moisture-induced a-Si module degradation modes have been observed and their mechanisms studied: (1) the formation and growth of pinholes in the thin-film layers; (2) the directional interfusion of pinholes along process scribe lines to form metallization-free regions that tend to open-circuit the module; and (3) worm-like filiform corrosion in the aluminum layer. The dependency on time-of-exposure to moist environments of the amount of material erosion in the module intercell zone has been quantified by two methods—directly by EDS analysis, and indirectly by sheet resistivity measurements on fully aluminized back surface modules. In addition, changes in maximum power output, series resistance, and open circuit voltage have been documented. Consequences for fielded modules are discussed.

Magnon Mode Selective Spin Transport in Compensated Ferrimagnets.

PubMed

Cramer, Joel; Guo, Er-Jia; Geprägs, Stephan; Kehlberger, Andreas; Ivanov, Yurii P; Ganzhorn, Kathrin; Della Coletta, Francesco; Althammer, Matthias; Huebl, Hans; Gross, Rudolf; Kosel, Jürgen; Kläui, Mathias; Goennenwein, Sebastian T B

2017-06-14

We investigate the generation of magnonic thermal spin currents and their mode selective spin transport across interfaces in insulating, compensated ferrimagnet/normal metal bilayer systems. The spin Seebeck effect signal exhibits a nonmonotonic temperature dependence with two sign changes of the detected voltage signals. Using different ferrimagnetic garnets, we demonstrate the universality of the observed complex temperature dependence of the spin Seebeck effect. To understand its origin, we systematically vary the interface between the ferrimagnetic garnet and the metallic layer, and by using different metal layers we establish that interface effects play a dominating role. They do not only modify the magnitude of the spin Seebeck effect signal but in particular also alter its temperature dependence. By varying the temperature, we can select the dominating magnon mode and we analyze our results to reveal the mode selective interface transmission probabilities for different magnon modes and interfaces. The comparison of selected systems reveals semiquantitative details of the interfacial coupling depending on the materials involved, supported by the obtained field dependence of the signal.

A high open-circuit voltage gallium nitride betavoltaic microbattery

NASA Astrophysics Data System (ADS)

Cheng, Zaijun; Chen, Xuyuan; San, Haisheng; Feng, Zhihong; Liu, Bo

2012-07-01

A high open-circuit voltage betavoltaic microbattery based on a gallium nitride (GaN) p-i-n homojunction is demonstrated. As a beta-absorbing layer, the low electron concentration of the n-type GaN layer is achieved by the process of Fe compensation doping. Under the irradiation of a planar solid 63Ni source with activity of 0.5 mCi, the open-circuit voltage of the fabricated microbattery with 2 × 2 mm2 area reaches as much as 1.64 V, which is the record value reported for betavoltaic batteries with 63Ni source, the short-circuit current was measured as 568 pA and the conversion effective of 0.98% was obtained. The experimental results suggest that GaN is a high-potential candidate for developing the betavoltaic microbattery.

Study program to improve the open-circuit voltage of low resistivity single crystal silicon solar cells

NASA Technical Reports Server (NTRS)

Minnucci, J. A.; Matthei, K. W.

1980-01-01

The results of a 14 month program to improve the open circuit voltage of low resistivity silicon solar cells are described. The approach was based on ion implantation in 0.1- to 10.0-ohm-cm float-zone silicon. As a result of the contract effort, open circuit voltages as high as 645 mV (AMO 25 C) were attained by high dose phosphorus implantation followed by furnace annealing and simultaneous SiO2 growth. One key element was to investigate the effects of bandgap narrowing caused by high doping concentrations in the junction layer. Considerable effort was applied to optimization of implant parameters, selection of furnace annealing techniques, and utilization of pulsed electron beam annealing to minimize thermal process-induced defects in the completed solar cells.

Influence of MoOx interlayer on the maximum achievable open-circuit voltage in organic photovoltaic cells

NASA Astrophysics Data System (ADS)

Zou, Yunlong; Holmes, Russell

2013-03-01

Transition metal oxides including molybdenum oxide (MoOx) are characterized by large work functions and deep energy levels relative to the organic semiconductors used in photovoltaic cells (OPVs). These materials have been used in OPVs as interlayers between the indium-tin-oxide anode and the active layers to increase the open-circuit voltage (VOC) and power conversion efficiency. We examine the role of MoOx in determining the maximum achievable VOC in planar heterojunction OPVs based on the donor-acceptor pairing of boron subphthalocyanine chloride (SubPc) and C60. While causing minor changes in VOC at room temperature, the inclusion of MoOx significantly changes the temperature dependence of VOC. Devices containing no interlayer show a maximum VOC\\ of 1.2 V, while devices containing MoOx show no saturation in VOC, reaching a value of >1.4 V at 110 K. We propose that the MoOx-SubPc interface forms a dissociating Schottky junction that provides an additional contribution to VOC at low temperature. Separate measurements of photoluminescence confirm that excitons in SubPc can be quenched by MoOx. Charge transfer at this interface is by hole extraction from SubPc to MoOx, and this mechanism favors donors with a deep highest occupied molecular orbital (HOMO) energy level. Consistent with this expectation, the temperature dependence of VOC for devices constructed using a donor with a shallower HOMO level, e.g. copper phthalocyanine, is independent of the presence of MoOx.

A pacemaker powered by an implantable biofuel cell operating under conditions mimicking the human blood circulatory system--battery not included.

PubMed

Southcott, Mark; MacVittie, Kevin; Halámek, Jan; Halámková, Lenka; Jemison, William D; Lobel, Robert; Katz, Evgeny

2013-05-07

Biocatalytic electrodes made of buckypaper were modified with PQQ-dependent glucose dehydrogenase on the anode and with laccase on the cathode and were assembled in a flow biofuel cell filled with serum solution mimicking the human blood circulatory system. The biofuel cell generated an open circuitry voltage, Voc, of ca. 470 mV and a short circuitry current, Isc, of ca. 5 mA (a current density of 0.83 mA cm(-2)). The power generated by the implantable biofuel cell was used to activate a pacemaker connected to the cell via a charge pump and a DC-DC converter interface circuit to adjust the voltage produced by the biofuel cell to the value required by the pacemaker. The voltage-current dependencies were analyzed for the biofuel cell connected to an Ohmic load and to the electronic loads composed of the interface circuit, or the power converter, and the pacemaker to study their operation. The correct pacemaker operation was confirmed using a medical device - an implantable loop recorder. Sustainable operation of the pacemaker was achieved with the system closely mimicking human physiological conditions using a single biofuel cell. This first demonstration of the pacemaker activated by the physiologically produced electrical energy shows promise for future electronic implantable medical devices powered by electricity harvested from the human body.

Histidine168 is crucial for ΔpH-dependent gating of the human voltage-gated proton channel, hHV1.

PubMed

Cherny, Vladimir V; Morgan, Deri; Thomas, Sarah; Smith, Susan M E; DeCoursey, Thomas E

2018-05-09

We recently identified a voltage-gated proton channel gene in the snail Helisoma trivolvis , HtH V 1, and determined its electrophysiological properties. Consistent with early studies of proton currents in snail neurons, HtH V 1 opens rapidly, but it unexpectedly exhibits uniquely defective sensitivity to intracellular pH (pH i ). The H + conductance ( g H )- V relationship in the voltage-gated proton channel (H V 1) from other species shifts 40 mV when either pH i or pH o (extracellular pH) is changed by 1 unit. This property, called ΔpH-dependent gating, is crucial to the functions of H V 1 in many species and in numerous human tissues. The HtH V 1 channel exhibits normal pH o dependence but anomalously weak pH i dependence. In this study, we show that a single point mutation in human hH V 1-changing His 168 to Gln 168 , the corresponding residue in HtH V 1-compromises the pH i dependence of gating in the human channel so that it recapitulates the HtH V 1 response. This location was previously identified as a contributor to the rapid gating kinetics of H V 1 in Strongylocentrotus purpuratus His 168 mutation in human H V 1 accelerates activation but accounts for only a fraction of the species difference. H168Q, H168S, or H168T mutants exhibit normal pH o dependence, but changing pH i shifts the g H - V relationship on average by <20 mV/unit. Thus, His 168 is critical to pH i sensing in hH V 1. His 168 , located at the inner end of the pore on the S3 transmembrane helix, is the first residue identified in H V 1 that significantly impairs pH sensing when mutated. Because pH o dependence remains intact, the selective erosion of pH i dependence supports the idea that there are distinct internal and external pH sensors. Although His 168 may itself be a pH i sensor, the converse mutation, Q229H, does not normalize the pH i sensitivity of the HtH V 1 channel. We hypothesize that the imidazole group of His 168 interacts with nearby Phe 165 or other parts of hH V 1 to transduce pH i into shifts of voltage-dependent gating. © 2018 Cherny et al.

Role of CoFeB thickness in electric field controlled sub-100 nm sized magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Lourembam, James; Huang, Jiancheng; Lim, Sze Ter; Gerard, Ernult Franck

2018-05-01

We report a comprehensive study on the role of the free layer thickness (tF) in electric-field controlled nanoscale perpendicular magnetic tunnel junctions (MTJs), comprising of free layer structure Ta/Co40Fe40B20/MgO, by using dc magnetoresistance and ultra-short magnetization switching measurements. Focusing on MTJs that exhibits positive effective device anisotropy (Keff), we observe that both the voltage-controlled magnetic anisotropy (ξ) and voltage modulation of coercivity show strong dependence on tF. We found that ξ varies dramatically and unexpectedly from ˜-3 fJ/V-m to ˜-41 fJ/V-m with increasing tF. We discuss the possibilities of electric-field tuning of the effective surface anisotropy term, KS as well as an additional interfacial magnetoelastic anisotropy term, K3 that scales with 1 /tF2. Voltage pulse induced 180° magnetization reversal is also demonstrated in our MTJs. Unipolar switching and oscillatory function of switching probability vs. pulse duration can be observed at higher tF, and agrees well with the two key device parameters — Keff and ξ.

Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis.

PubMed

Thomas, Sarah; Cherny, Vladimir V; Morgan, Deri; Artinian, Liana R; Rehder, Vincent; Smith, Susan M E; DeCoursey, Thomas E

2018-06-04

Voltage-gated proton channels, H V 1, were first reported in Helix aspersa snail neurons. These H + channels open very rapidly, two to three orders of magnitude faster than mammalian H V 1. Here we identify an H V 1 gene in the snail Helisoma trivolvis and verify protein level expression by Western blotting of H. trivolvis brain lysate. Expressed in mammalian cells, HtH V 1 currents in most respects resemble those described in other snails, including rapid activation, 476 times faster than hH V 1 (human) at pH o 7, between 50 and 90 mV. In contrast to most H V 1, activation of HtH V 1 is exponential, suggesting first-order kinetics. However, the large gating charge of ∼5.5 e 0 suggests that HtH V 1 functions as a dimer, evidently with highly cooperative gating. HtH V 1 opening is exquisitely sensitive to pH o , whereas closing is nearly independent of pH o Zn 2+ and Cd 2+ inhibit HtH V 1 currents in the micromolar range, slowing activation, shifting the proton conductance-voltage ( g H - V ) relationship to more positive potentials, and lowering the maximum conductance. This is consistent with HtH V 1 possessing three of the four amino acids that coordinate Zn 2+ in mammalian H V 1. All known H V 1 exhibit ΔpH-dependent gating that results in a 40-mV shift of the g H - V relationship for a unit change in either pH o or pH i This property is crucial for all the functions of H V 1 in many species and numerous human cells. The HtH V 1 channel exhibits normal or supernormal pH o dependence, but weak pH i dependence. Under favorable conditions, this might result in the HtH V 1 channel conducting inward currents and perhaps mediating a proton action potential. The anomalous ΔpH-dependent gating of HtH V 1 channels suggests a structural basis for this important property, which is further explored in this issue (Cherny et al. 2018. J. Gen. Physiol. https://doi.org/10.1085/jgp.201711968). © 2018 Thomas et al.

Uniform California earthquake rupture forecast, version 2 (UCERF 2)

USGS Publications Warehouse

Field, E.H.; Dawson, T.E.; Felzer, K.R.; Frankel, A.D.; Gupta, V.; Jordan, T.H.; Parsons, T.; Petersen, M.D.; Stein, R.S.; Weldon, R.J.; Wills, C.J.

2009-01-01

The 2007 Working Group on California Earthquake Probabilities (WGCEP, 2007) presents the Uniform California Earthquake Rupture Forecast, Version 2 (UCERF 2). This model comprises a time-independent (Poisson-process) earthquake rate model, developed jointly with the National Seismic Hazard Mapping Program and a time-dependent earthquake-probability model, based on recent earthquake rates and stress-renewal statistics conditioned on the date of last event. The models were developed from updated statewide earthquake catalogs and fault deformation databases using a uniform methodology across all regions and implemented in the modular, extensible Open Seismic Hazard Analysis framework. The rate model satisfies integrating measures of deformation across the plate-boundary zone and is consistent with historical seismicity data. An overprediction of earthquake rates found at intermediate magnitudes (6.5 ??? M ???7.0) in previous models has been reduced to within the 95% confidence bounds of the historical earthquake catalog. A logic tree with 480 branches represents the epistemic uncertainties of the full time-dependent model. The mean UCERF 2 time-dependent probability of one or more M ???6.7 earthquakes in the California region during the next 30 yr is 99.7%; this probability decreases to 46% for M ???7.5 and to 4.5% for M ???8.0. These probabilities do not include the Cascadia subduction zone, largely north of California, for which the estimated 30 yr, M ???8.0 time-dependent probability is 10%. The M ???6.7 probabilities on major strike-slip faults are consistent with the WGCEP (2003) study in the San Francisco Bay Area and the WGCEP (1995) study in southern California, except for significantly lower estimates along the San Jacinto and Elsinore faults, owing to provisions for larger multisegment ruptures. Important model limitations are discussed.

Design of a high voltage input - output ratio dc-dc converter dedicated to small power fuel cell systems

NASA Astrophysics Data System (ADS)

Béthoux, O.; Cathelin, J.

2010-12-01

Consuming chemical energy, fuel cells produce simultaneously heat, water and useful electrical power [J.M. Andújar, F. Segura, Renew. Sust. Energy Rev. 13, 2309 (2009)], [J. Larminie, A. Dicks, Fuel Cell Systems Explained, 2nd edn. (John Wiley & Sons, 2003)]. As a matter of fact, the voltage generated by a fuel cell strongly depends on both the load power demand and the operating conditions. Besides, as a result of many design aspects, fuel cells are low voltage and high current electric generators. On the contrary, electric loads are commonly designed for small voltage swing and a high V/I ratio in order to minimize Joule losses. Therefore, electric loads supplied by fuel cells are typically fed by means of an intermediate power voltage regulator. The specifications of such a power converter are to be able to step up the input voltage with a high ratio (a ratio of 10 is a classic situation) and also to work with an excellent efficiency (in order to minimize its size, its weight and its losses) [A. Shahin, B. Huang, J.P. Martin, S. Pierfederici, B. Davat, Energy Conv. Manag. 51, 56 (2010)]. This paper deals with the design of this essential ancillary device. It intends to bring out the best structure for fulfilling this function. Several dc-dc converters with large voltage step-up ratios are introduced. A topology based on a coupled inductor or tapped inductor is closely studied. A detailed modelling is performed with the purpose of providing designing rules. This model is validated with both simulation and implementation. The experimental prototype is based on the following specifications: the fuel cell output voltage ranges from a 50 V open-voltage to a 25 V rated voltage while the load requires a constant 250 V voltage. The studied coupled inductor converter is compared with a classic boost converter commonly used in this voltage elevating application. Even though the voltage regulator faces severe FC specifications, the measured efficiency reaches 96% at the rated power whereas conventional boost efficiency barely achieves 91.5% in the same operating conditions.

On the main photoelectric characteristics of three-junction InGaP/InGaAs/Ge solar cells in a broad temperature range (–197°C ≤ T ≤ +85°C)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andreev, V. M.; Malevskiy, D. A.; Pokrovskiy, P. V.

2016-10-15

This study is aimed at investigating the main photoelectric characteristics of three-cascade InGaP/InGaAs/Ge photoelectric converters in a broad temperature range (–197°C ≤ T ≤ +85°C). On account of analysis of photosensitivity spectra and optical current–voltage characteristics, such temperature dependences as the open-circuit voltage (V{sub oc}), filling factor of the current–voltage characteristic (FF), and the photoelectric conversion efficiency of solar radiation are determined. Investigations are performed at illumination intensities corresponding to operation under concentrated radiation. Decreased temperatures facilitate the selection of samples with the minimal “parasitic” potential barriers. The influence of excitationtransfer processes from a cascade into a cascade is estimatedmore » by means of secondary luminescent radiation. The highest photoelectric conversion efficiency of 52% is measured at a concentration multiplicity of 100 “suns” and a temperature of–160°C.« less

Voltage-dependent K+ channels improve the energy efficiency of signalling in blowfly photoreceptors

PubMed Central

2017-01-01

Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K+ conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings. PMID:28381642

Voltage-dependent K+ channels improve the energy efficiency of signalling in blowfly photoreceptors.

PubMed

Heras, Francisco J H; Anderson, John; Laughlin, Simon B; Niven, Jeremy E

2017-04-01

Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K + conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings. © 2017 The Author(s).

Performance degradation of grid-tied photovoltaic modules in a hot-dry climatic condition

NASA Astrophysics Data System (ADS)

Suleske, Adam; Singh, Jaspreet; Kuitche, Joseph; Tamizh-Mani, Govindasamy

2011-09-01

The crystalline silicon photovoltaic (PV) modules under open circuit conditions typically degrade at a rate of about 0.5% per year. However, it is suspected that the modules in an array level may degrade, depending on equipment/frame grounding and array grounding, at higher rates because of higher string voltage and increased module mismatch over the years of operation in the field. This paper compares and analyzes the degradation rates of grid-tied photovoltaic modules operating over 10-17 years in a desert climatic condition of Arizona. The nameplate open-circuit voltages of the arrays ranged between 400 and 450 V. Six different types/models of crystalline silicon modules with glass/glass and glass/polymer constructions were evaluated. About 1865 modules were inspected using an extended visual inspection checklist and infrared (IR) scanning. The visual inspection checklist included encapsulant discoloration, cell/interconnect cracks, delamination and corrosion. Based on the visual inspection and IR studies, a large fraction of these modules were identified as allegedly healthy and unhealthy modules and they were electrically isolated from the system for currentvoltage (I-V) measurements of individual modules. The annual degradation rate for each module type is determined based on the I-V measurements.

Crystalline orientation dependent photoresponse and heterogeneous behaviors of grain boundaries in perovskite solar cells

NASA Astrophysics Data System (ADS)

Jiang, Chuanpeng; Zhang, Pengpeng

2018-02-01

Using photoconductive atomic force microscopy and Kelvin probe force microscopy, we characterize the local electrical properties of grains and grain boundaries of organic-inorganic hybrid perovskite (CH3NH3PbI3) thin films on top of a poly(3,4-ethylenedioxythiophene)-polystyrene sulfonate (PEDOT:PSS)/ITO substrate. Three discrete photoconductivity levels are identified among perovskite grains, likely corresponding to the crystal orientation of each grain. Local J-V curves recorded on these grains further suggest an anti-correlation behavior between the short circuit current (JSC) and open circuit voltage (VOC). This phenomenon can be attributed to diffusion-limited surface recombination at the non-selective perovskite-tip contact, where a higher carrier mobility established in the perovskite grain results in an enhanced surface recombination and thus a lower VOC. In addition, the photoresponse of perovskite films displays a pronounced heterogeneity across the grain boundaries, with the boundaries formed between grains of the same photoconductivity level displaying even enhanced photocurrent and open circuit voltage compared to those of the adjacent grain interiors. These observations highlight the significance of controlling the microstructure of perovskite thin films, which will be a necessary route for further improving the efficiency of perovskite solar cells.

Manifestation of counteracting photovoltaic effect on IV characteristics in multi-junction solar cells

NASA Astrophysics Data System (ADS)

Mintairov, M. A.; Evstropov, V. V.; Mintairov, S. A.; Shvarts, M. Z.; Kozhukhovskaia, S. A.; Kalyuzhnyy, N. A.

2017-11-01

The existence within monolithic double- and triple-junction solar cells of a photoelectric source, which counteracts the basic photovoltaic p-n junctions, is proved. The paper presents a detailed analysis of the shape of the light IV-characteristics, as well as the dependence Voc-Jsc (open circuit voltage - short-circuit current). It is established that the counteracting source is tunnel p+-n+ junction. The photoelectric characteristics of samples with different tunnel diode peak current values were investigated, including the case of a zero value. When the tunnel p+-n+ junction is photoactive, the Voc-Jsc dependence has a dropping part, including a sharp jump. This undesirable effect decreases with increasing peak current.

Bio-wave change photo-voltages of the solar cells at same changed rate by probability effect of spacetime structure

NASA Astrophysics Data System (ADS)

Cao, Dayong

In our experiment, when light (of ``lamp LED'' 3W, 20cm away from the solar cells) simultaneous radiated on four solar cells, they would produce their photo-voltages which are called as background photo-voltages. And then, the author used thought wave to remotely (wireless) act on the four solar cells and increase four background photo-voltages at the same rates which is about 64%. After that, Adding the other light (of ``lamp CFL'') to simultaneous radiate on the four solar cells to changed their background photo-voltages. But there are different changed rates which will appear in the general experiments because the luminous sensitivities of the solar cell are different and the photo-voltages is a nonlinear function. The probability effects of the spacetime structure (of Confined Structural non-Newtonian Fluids) of brain wave (because the wave is spacetime) to change a balance structure between Electron Clouds and electron holes of P-N Junction, and change the background photo-voltages of the solar cells. In the experiments, the consciousness effect, and the relationship between brain wave and consciousness effect will be considered. After the decade of the brain research and the ``BRAIN'' Initiative, a decade of the consciousness need be taken. http://meetings.aps.org/Meeting/APR16/Session/M13.8 AEEA.

Deletion of cytosolic gating ring decreases gate and voltage sensor coupling in BK channels.

PubMed

Zhang, Guohui; Geng, Yanyan; Jin, Yakang; Shi, Jingyi; McFarland, Kelli; Magleby, Karl L; Salkoff, Lawrence; Cui, Jianmin

2017-03-06

Large conductance Ca 2+ -activated K + channels (BK channels) gate open in response to both membrane voltage and intracellular Ca 2+ The channel is formed by a central pore-gate domain (PGD), which spans the membrane, plus transmembrane voltage sensors and a cytoplasmic gating ring that acts as a Ca 2+ sensor. How these voltage and Ca 2+ sensors influence the common activation gate, and interact with each other, is unclear. A previous study showed that a BK channel core lacking the entire cytoplasmic gating ring (Core-MT) was devoid of Ca 2+ activation but retained voltage sensitivity (Budelli et al. 2013. Proc. Natl. Acad. Sci. USA http://dx.doi.org/10.1073/pnas.1313433110). In this study, we measure voltage sensor activation and pore opening in this Core-MT channel over a wide range of voltages. We record gating currents and find that voltage sensor activation in this truncated channel is similar to WT but that the coupling between voltage sensor activation and gating of the pore is reduced. These results suggest that the gating ring, in addition to being the Ca 2+ sensor, enhances the effective coupling between voltage sensors and the PGD. We also find that removal of the gating ring alters modulation of the channels by the BK channel's β1 and β2 subunits. © 2017 Zhang et al.

Deletion of cytosolic gating ring decreases gate and voltage sensor coupling in BK channels

PubMed Central

Zhang, Guohui; Shi, Jingyi; McFarland, Kelli; Magleby, Karl L.; Salkoff, Lawrence

2017-01-01

Large conductance Ca2+-activated K+ channels (BK channels) gate open in response to both membrane voltage and intracellular Ca2+. The channel is formed by a central pore-gate domain (PGD), which spans the membrane, plus transmembrane voltage sensors and a cytoplasmic gating ring that acts as a Ca2+ sensor. How these voltage and Ca2+ sensors influence the common activation gate, and interact with each other, is unclear. A previous study showed that a BK channel core lacking the entire cytoplasmic gating ring (Core-MT) was devoid of Ca2+ activation but retained voltage sensitivity (Budelli et al. 2013. Proc. Natl. Acad. Sci. USA. http://dx.doi.org/10.1073/pnas.1313433110). In this study, we measure voltage sensor activation and pore opening in this Core-MT channel over a wide range of voltages. We record gating currents and find that voltage sensor activation in this truncated channel is similar to WT but that the coupling between voltage sensor activation and gating of the pore is reduced. These results suggest that the gating ring, in addition to being the Ca2+ sensor, enhances the effective coupling between voltage sensors and the PGD. We also find that removal of the gating ring alters modulation of the channels by the BK channel’s β1 and β2 subunits. PMID:28196879

Effect of secondary electron emission on subnanosecond breakdown in high-voltage pulse discharge

NASA Astrophysics Data System (ADS)

Schweigert, I. V.; Alexandrov, A. L.; Gugin, P.; Lavrukhin, M.; Bokhan, P. A.; Zakrevsky, Dm E.

2017-11-01

The subnanosecond breakdown in open discharge may be applied for producing superfast high power switches. Such fast breakdown in high-voltage pulse discharge in helium was explored both in experiment and in kinetic simulations. The kinetic model of electron avalanche development was developed using PIC-MCC technique. The model simulates motion of electrons, ions and fast helium atoms, appearing due to ions scattering. It was shown that the mechanism responsible for ultra-fast breakdown development is the electron emission from cathode. The photoemission and emission by ions or fast atoms impact is the main reason of current growth at the early stage of breakdown, but at the final stage, when the voltage on discharge gap drops, the secondary electron emission (SEE) is responsible for subnanosecond time scale of current growth. It was also found that the characteristic time of the current growth τS depends on the SEE yield of the cathode material. Three types of cathode material (titanium, SiC, and CuAlMg-alloy) were tested. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time as small as τS = 0.4 ns, for the pulse voltage amplitude of 5- 12 kV..

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chilese, Francis C.; Torczynski, John R.; Garcia, Rudy

An apparatus for use with extreme ultraviolet (EUV) light comprising A) a duct having a first end opening, a second end opening and an intermediate opening intermediate the first end opening the second end opening, B) an optical component disposed to receive EUV light from the second end opening or to send light through the second end opening, and C) a source of low pressure gas at a first pressure to flow through the duct, the gas having a high transmission of EUV light, fluidly coupled to the intermediate opening. In addition to or rather than gas flow the apparatusmore » may have A) a low pressure gas with a heat control unit thermally coupled to at least one of the duct and the optical component and/or B) a voltage device to generate voltage between a first portion and a second portion of the duet with a grounded insulative portion therebetween.« less

Mechanism of voltage-gated channel formation in lipid membranes.

PubMed

Guidelli, Rolando; Becucci, Lucia

2016-04-01

Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

The electrostatics of VDAC: implications for selectivity and gating.

PubMed

Choudhary, Om P; Ujwal, Rachna; Kowallis, William; Coalson, Rob; Abramson, Jeff; Grabe, Michael

2010-02-26

The voltage-dependent anion channel (VDAC) is the major pathway mediating the transfer of metabolites and ions across the mitochondrial outer membrane. Two hallmarks of the channel in the open state are high metabolite flux and anion selectivity, while the partially closed state blocks metabolites and is cation selective. Here we report the results from electrostatics calculations carried out on the recently determined high-resolution structure of murine VDAC1 (mVDAC1). Poisson-Boltzmann calculations show that the ion transfer free energy through the channel is favorable for anions, suggesting that mVDAC1 represents the open state. This claim is buttressed by Poisson-Nernst-Planck calculations that predict a high single-channel conductance indicative of the open state and an anion selectivity of 1.75--nearly a twofold selectivity for anions over cations. These calculations were repeated on mutant channels and gave selectivity changes in accord with experimental observations. We were then able to engineer an in silico mutant channel with three point mutations that converted mVDAC1 into a channel with a preference for cations. Finally, we investigated two proposals for how the channel gates between the open and the closed state. Both models involve the movement of the N-terminal helix, but neither motion produced the observed voltage sensitivity, nor did either model result in a cation-selective channel, which is observed experimentally. Thus, we were able to rule out certain models for channel gating, but the true motion has yet to be determined. Copyright (c) 2009. Elsevier Ltd. All rights reserved.

Fast-responding short circuit protection system with self-reset for use in circuit supplied by DC power

NASA Technical Reports Server (NTRS)

Burns, Bradley M. (Inventor); Blalock, Norman N. (Inventor)

2011-01-01

A short circuit protection system includes an inductor, a switch, a voltage sensing circuit, and a controller. The switch and inductor are electrically coupled to be in series with one another. A voltage sensing circuit is coupled across the switch and the inductor. A controller, coupled to the voltage sensing circuit and the switch, opens the switch when a voltage at the output terminal of the inductor transitions from above a threshold voltage to below the threshold voltage. The controller closes the switch when the voltage at the output terminal of the inductor transitions from below the threshold voltage to above the threshold voltage.

A Monte Carlo Simulation of Vesicle Exocytosis in the Buffered Diffusion of Calcium Channel Currents

NASA Astrophysics Data System (ADS)

Dimcovic, Z.; Eagan, T. P.; Brown, R. W.; Petschek, R. G.; Eppell, S. J.; Yunker, A. M. R.; Sharp, A. H.; McEnery, M. W.

2001-04-01

The voltage-dependent opening of calcium channels results in an influx of calcium ions that leads to the fusion of synaptic vesicles with the cell membrane, resulting in the release of neurotransmitters. This allows nerve impulses to be transmitted from one neuron to another. A Monte Carlo model of the three-dimensional diffusion of calcium following a channel opening is employed to estimate the space and time dependence of the calcium density. The effects of fixed and mobile calcium buffers are included, and a tethered nearby vesicle is considered. The importance of the size and location of the vesicle is studied. When the vesicle is ignored, these results are compared with the analytical calculations of Naraghi and Neher and the Monte Carlo calculations of Bennett et al. The finite-vesicle-size analysis offers new insights into the process of neurosecretion. Support: NIH MH55747, AHA 96001250, NSF 0086643, and CWRU Presidential Research Initiative grants.

Theoretical and material studies of thin-film electroluminescent devices

NASA Technical Reports Server (NTRS)

Summers, C. J.

1989-01-01

Thin-film electroluminescent (TFEL) devices are studied for a possible means of achieving a high resolution, light weight, compact video display panel for computer terminals or television screens. The performance of TFEL devices depends upon the probability of an electron impact exciting a luminescent center which in turn depends upon the density of centers present in the semiconductor layer, the possibility of an electron achieving the impact excitation threshold energy, and the collision cross section itself. Efficiency of such a device is presently very poor. It can best be improved by increasing the number of hot electrons capable of impact exciting a center. Hot electron distributions and a method for increasing the efficiency and brightness of TFEL devices (with the additional advantage of low voltage direct current operation) are investigated.

Novel mechanism of hydrogen sulfide-induced guinea pig urinary bladder smooth muscle contraction: role of BK channels and cholinergic neurotransmission

PubMed Central

Fernandes, Vítor S.; Xin, Wenkuan

2015-01-01

Hydrogen sulfide (H2S) is a key signaling molecule regulating important physiological processes, including smooth muscle function. However, the mechanisms underlying H2S-induced detrusor smooth muscle (DSM) contractions are not well understood. This study investigates the cellular and tissue mechanisms by which H2S regulates DSM contractility, excitatory neurotransmission, and large-conductance voltage- and Ca2+-activated K+ (BK) channels in freshly isolated guinea pig DSM. We used a multidisciplinary experimental approach including isometric DSM tension recordings, colorimetric ACh measurement, Ca2+ imaging, and patch-clamp electrophysiology. In isolated DSM strips, the novel slow release H2S donor, P-(4-methoxyphenyl)-p-4-morpholinylphosphinodithioic acid morpholine salt (GYY4137), significantly increased the spontaneous phasic and nerve-evoked DSM contractions. The blockade of neuronal voltage-gated Na+ channels or muscarinic ACh receptors with tetrodotoxin or atropine, respectively, reduced the stimulatory effect of GYY4137 on DSM contractility. GYY4137 increased ACh release from bladder nerves, which was inhibited upon blockade of L-type voltage-gated Ca2+ channels with nifedipine. Furthermore, GYY4137 increased the amplitude of the Ca2+ transients and basal Ca2+ levels in isolated DSM strips. GYY4137 reduced the DSM relaxation induced by the BK channel opener, NS11021. In freshly isolated DSM cells, GYY4137 decreased the amplitude and frequency of transient BK currents recorded in a perforated whole cell configuration and reduced the single BK channel open probability measured in excised inside-out patches. GYY4137 inhibited spontaneous transient hyperpolarizations and depolarized the DSM cell membrane potential. Our results reveal the novel findings that H2S increases spontaneous phasic and nerve-evoked DSM contractions by activating ACh release from bladder nerves in combination with a direct inhibition of DSM BK channels. PMID:25948731

Numerical simulations of piecewise deterministic Markov processes with an application to the stochastic Hodgkin-Huxley model.

PubMed

Ding, Shaojie; Qian, Min; Qian, Hong; Zhang, Xuejuan

2016-12-28

The stochastic Hodgkin-Huxley model is one of the best-known examples of piecewise deterministic Markov processes (PDMPs), in which the electrical potential across a cell membrane, V(t), is coupled with a mesoscopic Markov jump process representing the stochastic opening and closing of ion channels embedded in the membrane. The rates of the channel kinetics, in turn, are voltage-dependent. Due to this interdependence, an accurate and efficient sampling of the time evolution of the hybrid stochastic systems has been challenging. The current exact simulation methods require solving a voltage-dependent hitting time problem for multiple path-dependent intensity functions with random thresholds. This paper proposes a simulation algorithm that approximates an alternative representation of the exact solution by fitting the log-survival function of the inter-jump dwell time, H(t), with a piecewise linear one. The latter uses interpolation points that are chosen according to the time evolution of the H(t), as the numerical solution to the coupled ordinary differential equations of V(t) and H(t). This computational method can be applied to all PDMPs. Pathwise convergence of the approximated sample trajectories to the exact solution is proven, and error estimates are provided. Comparison with a previous algorithm that is based on piecewise constant approximation is also presented.

Inhibition of cardiac sodium currents by toluene exposure

PubMed Central

Cruz, Silvia L; Orta-Salazar, Gerardo; Gauthereau, Marcia Y; Millan-Perez Peña, Lourdes; Salinas-Stefanón, Eduardo M

2003-01-01

Toluene is an industrial solvent widely used as a drug of abuse, which can produce sudden sniffing death due to cardiac arrhythmias. In this paper, we tested the hypothesis that toluene inhibits cardiac sodium channels in Xenopus laevis oocytes transfected with Nav1.5 cDNA and in isolated rat ventricular myocytes. In oocytes, toluene inhibited sodium currents (INa+) in a concentration-dependent manner, with an IC50 of 274 μM (confidence limits: 141–407μM). The inhibition was complete, voltage-independent, and slowly reversible. Toluene had no effect on: (i) the shape of the I–V curves; (ii) the reversal potential of Na+; and (iii) the steady-state inactivation. The slow recovery time constant from inactivation of INa+ decreased with toluene exposure, while the fast recovery time constant remained unchanged. Block of INa+ by toluene was use- and frequency-dependent. In rat cardiac myocytes, 300 μM toluene inhibited the sodium current (INa+) by 62%; this inhibition was voltage independent. These results suggest that toluene binds to cardiac Na+ channels in the open state and unbinds either when channels move between inactivated states or from an inactivated to a closed state. The use- and frequency-dependent block of INa+ by toluene might be responsible, at least in part, for its arrhythmogenic effect. PMID:14534149

Dependence of Initial Oxygen Concentration on Ozone Yield Using Inductive Energy Storage System Pulsed Power Generator

NASA Astrophysics Data System (ADS)

Go, Tomio; Tanaka, Yasushi; Yamazaki, Nobuyuki; Mukaigawa, Seiji; Takaki, Koichi; Fujiwara, Tamiya

Dependence of initial oxygen concentration on ozone yield using streamer discharge reactor driven by an inductive energy storage system pulsed power generator is described in this paper. Fast recovery type diodes were employed as semiconductor opening switch to interrupt a circuit current within 100 ns. This rapid current change produced high-voltage short pulse between a secondary energy storage inductor. The repetitive high-voltage short pulse was applied to a 1 mm diameter center wire electrode placed in a cylindrical pulse corona reactor. The streamer discharge successfully occurred between the center wire electrode and an outer cylinder ground electrode of 2 cm inner diameter. The ozone was produced with the streamer discharge and increased with increasing pulse repetition rate. The ozone yield changed in proportion to initial oxygen concentration contained in the injected gas mixture at 800 ns forward pumping time of the current. However, the decrease of the ozone yield by decreasing oxygen concentration in the gas mixture at 180 ns forward pumping time of the current was lower than the decrease at 800 ns forward pumping time of the current. This dependence of the initial oxygen concentration on ozone yield at 180 ns forward pumping time is similar to that of dielectric barrier discharge reactor.

Unraveling the Voltage-Fade Mechanism in High-Energy-Density Lithium-Ion Batteries: Origin of the Tetrahedral Cations for Spinel Conversion

DOE PAGES

Mohanty, Debasish; Li, Jianlin; Abraham, Daniel P.; ...

2014-09-30

Discovery of high-voltage layered lithium-and manganese-rich (LMR) composite oxide electrode has dramatically enhanced the energy density of current Li-ion energy storage systems. However, practical usage of these materials is currently not viable because of their inability to maintain a consistent voltage profile (voltage fading) during subsequent charge-discharge cycles. This report rationalizes the cause of this voltage fade by providing the evidence of layer to spinel-like (LSL) structural evolution pathways in the host Li 1.2Mn 0.55Ni 0.15Co 0.1O 2 LMR composite oxide. By employing neutron powder diffraction, and temperature dependent magnetic susceptibility, we show that LSL structural rearrangement in LMR oxidemore » occurs through a tetrahedral cation intermediate via: i) diffusion of lithium atoms from octahedral to tetrahedral sites of the lithium layer [(Li Lioct →Li Litet] which is followed by the dispersal of the lithium ions from the adjacent octahedral site of the metal layer to the tetrahedral sites of lithium layer [Li TM oct → Li Litet]; and ii) migration of Mn from the octahedral sites of the transition metal layer to the permanent octahedral site of lithium layer via tetrahedral site of lithium layer [Mn TMoct Mn Litet Mn Lioct)]. The findings opens the door to the potential routes to mitigate this atomic restructuring in the high-voltage LMR composite oxide cathodes by manipulating the composition/structure for practical use in high-energy-density lithium-ion batteries.« less

Long-term stability of microcrystalline silicon p-i-n solar cells exposed to sun light

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanguino, P.; Koynov, S.; Schwarz, R.

1999-07-01

The performance of an entirely microcrystalline p-i-n solar cell was monitored during a long-term outdoor test in Lisbon starting in September 1998. A small decrease of the short circuit current was observed after 5 months of operation. The open-circuit voltage remained stable around 400 mV. From the analysis of the I-V characteristic in dark and under illumination they could identify the weak points of the test structure, like large series resistance, high recombination rate, and intensity-dependent collection efficiency.

Inverted organic photovoltaic device with a new electron transport layer

NASA Astrophysics Data System (ADS)

Kim, Hyeong Pil; Yusoff, Abd Rashid bin Mohd; Kim, Hyo Min; Lee, Hee Jae; Seo, Gi Jun; Jang, Jin

2014-03-01

We demonstrate that there is a new solution-processed electron transport layer, lithium-doped zinc oxide (LZO), with high-performance inverted organic photovoltaic device. The device exhibits a fill factor of 68.58%, an open circuit voltage of 0.86 V, a short-circuit current density of -9.35 cm/mA2 along with 5.49% power conversion efficiency. In addition, we studied the performance of blend ratio dependence on inverted organic photovoltaics. Our device also demonstrates a long stability shelf life over 4 weeks in air.

Low Light Diagnostics in Thin-Film Photovoltaics

NASA Astrophysics Data System (ADS)

Shvydka, Diana; Karpov, Victor; Compaan, Alvin

2003-03-01

We study statistics of the major photovoltaic (PV) parameters such as open circuit voltage, short circuit current and fill factor vs. light intensity on a set of nominally identical CdTe/CdS solar cells. We found the most probable parameter values to change with the light intensity as predicted by the standard diode model, while their relative fluctuations increase dramatically under low light. The crossover light intensity is found below which the relative fluctuations of the PV parameters diverge inversely proportional to the square root of the light intensity. We propose a model where the observed fluctuations are due to lateral nonuniformities in the device structure. In particular, the crossover is attributed to the lateral nonuniformity screening length exceeding the device size. >From the practical standpoint, our study introduces a simple uniformity diagnostic technique.

Reliability of Radioisotope Stirling Convertor Linear Alternator

NASA Technical Reports Server (NTRS)

Shah, Ashwin; Korovaichuk, Igor; Geng, Steven M.; Schreiber, Jeffrey G.

2006-01-01

Onboard radioisotope power systems being developed and planned for NASA s deep-space missions would require reliable design lifetimes of up to 14 years. Critical components and materials of Stirling convertors have been undergoing extensive testing and evaluation in support of a reliable performance for the specified life span. Of significant importance to the successful development of the Stirling convertor is the design of a lightweight and highly efficient linear alternator. Alternator performance could vary due to small deviations in the permanent magnet properties, operating temperature, and component geometries. Durability prediction and reliability of the alternator may be affected by these deviations from nominal design conditions. Therefore, it is important to evaluate the effect of these uncertainties in predicting the reliability of the linear alternator performance. This paper presents a study in which a reliability-based methodology is used to assess alternator performance. The response surface characterizing the induced open-circuit voltage performance is constructed using 3-D finite element magnetic analysis. Fast probability integration method is used to determine the probability of the desired performance and its sensitivity to the alternator design parameters.

Coordinated Control Method of Voltage and Reactive Power for Active Distribution Networks Based on Soft Open Point

DOE PAGES

Li, Peng; Ji, Haoran; Wang, Chengshan; ...

2017-03-22

The increasing penetration of distributed generators (DGs) exacerbates the risk of voltage violations in active distribution networks (ADNs). The conventional voltage regulation devices limited by the physical constraints are difficult to meet the requirement of real-time voltage and VAR control (VVC) with high precision when DGs fluctuate frequently. But, soft open point (SOP), a flexible power electronic device, can be used as the continuous reactive power source to realize the fast voltage regulation. Considering the cooperation of SOP and multiple regulation devices, this paper proposes a coordinated VVC method based on SOP for ADNs. Firstly, a time-series model of coordi-natedmore » VVC is developed to minimize operation costs and eliminate voltage violations of ADNs. Then, by applying the linearization and conic relaxation, the original nonconvex mixed-integer non-linear optimization model is converted into a mixed-integer second-order cone programming (MISOCP) model which can be efficiently solved to meet the requirement of voltage regulation rapidity. Here, we carried out some case studies on the IEEE 33-node system and IEEE 123-node system to illustrate the effectiveness of the proposed method.« less

Coordinated Control Method of Voltage and Reactive Power for Active Distribution Networks Based on Soft Open Point

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Peng; Ji, Haoran; Wang, Chengshan

The increasing penetration of distributed generators (DGs) exacerbates the risk of voltage violations in active distribution networks (ADNs). The conventional voltage regulation devices limited by the physical constraints are difficult to meet the requirement of real-time voltage and VAR control (VVC) with high precision when DGs fluctuate frequently. But, soft open point (SOP), a flexible power electronic device, can be used as the continuous reactive power source to realize the fast voltage regulation. Considering the cooperation of SOP and multiple regulation devices, this paper proposes a coordinated VVC method based on SOP for ADNs. Firstly, a time-series model of coordi-natedmore » VVC is developed to minimize operation costs and eliminate voltage violations of ADNs. Then, by applying the linearization and conic relaxation, the original nonconvex mixed-integer non-linear optimization model is converted into a mixed-integer second-order cone programming (MISOCP) model which can be efficiently solved to meet the requirement of voltage regulation rapidity. Here, we carried out some case studies on the IEEE 33-node system and IEEE 123-node system to illustrate the effectiveness of the proposed method.« less

Open channel block of A-type, kv4.3, and delayed rectifier K+ channels, Kv1.3 and Kv3.1, by sibutramine.

PubMed

Kim, Sung Eun; Ahn, Hye Sook; Choi, Bok Hee; Jang, Hyun-Jong; Kim, Myung-Jun; Rhie, Duck-Joo; Yoon, Shin-Hee; Jo, Yang-Hyeok; Kim, Myung-Suk; Sung, Ki-Wug; Hahn, Sang June

2007-05-01

The effects of sibutramine on voltage-gated K+ channel (Kv)4.3, Kv1.3, and Kv3.1, stably expressed in Chinese hamster ovary cells, were investigated using the whole-cell patch-clamp technique. Sibutramine did not significantly decrease the peak Kv4.3 currents, but it accelerated the rate of decay of current inactivation in a concentration-dependent manner. This phenomenon was effectively characterized by integrating the total current over the duration of a depolarizing pulse to +40 mV. The IC50 value for the sibutramine block of Kv4.3 was 17.3 microM. Under control conditions, the inactivation of Kv4.3 currents could be fit to a biexponential function, and the time constants for the fast and slow components were significantly decreased after the application of sibutramine. The association (k+1) and dissociation (k-1) rate constants for the sibutramine block of Kv 4.3 were 1.51 microM-1s-1 and 27.35 s-1, respectively. The theoretical KD value, derived from k-1/k+1, yielded a value of 18.11 microM. The block of Kv4.3 by sibutramine displayed a weak voltage dependence, increasing at more positive potentials, and it was use-dependent at 2 Hz. Sibutramine did not affect the time course for the deactivating tail currents. Neither steady-state activation and inactivation nor the recovery from inactivation was affected by sibutramine. Sibutramine caused the concentration-dependent block of the Kv1.3 and Kv3.1 currents with an IC50 value of 3.7 and 32.7 microM, respectively. In addition, sibutramine reduced the tail current amplitude and slowed the deactivation of the tail currents of Kv1.3 and Kv3.1, resulting in a crossover phenomenon. These results indicate that sibutramine acts on Kv4.3, Kv1.3, and Kv3.1 as an open channel blocker.

Matrix product representation of the stationary state of the open zero range process

NASA Astrophysics Data System (ADS)

Bertin, Eric; Vanicat, Matthieu

2018-06-01

Many one-dimensional lattice particle models with open boundaries, like the paradigmatic asymmetric simple exclusion process (ASEP), have their stationary states represented in the form of a matrix product, with matrices that do not explicitly depend on the lattice site. In contrast, the stationary state of the open 1D zero-range process (ZRP) takes an inhomogeneous factorized form, with site-dependent probability weights. We show that in spite of the absence of correlations, the stationary state of the open ZRP can also be represented in a matrix product form, where the matrices are site-independent, non-commuting and determined from algebraic relations resulting from the master equation. We recover the known distribution of the open ZRP in two different ways: first, using an explicit representation of the matrices and boundary vectors; second, from the sole knowledge of the algebraic relations satisfied by these matrices and vectors. Finally, an interpretation of the relation between the matrix product form and the inhomogeneous factorized form is proposed within the framework of hidden Markov chains.

Proton channel models

PubMed Central

Pupo, Amaury; Baez-Nieto, David; Martínez, Agustín; Latorre, Ramón; González, Carlos

2014-01-01

Voltage-gated proton channels are integral membrane proteins with the capacity to permeate elementary particles in a voltage and pH dependent manner. These proteins have been found in several species and are involved in various physiological processes. Although their primary topology is known, lack of details regarding their structures in the open conformation has limited analyses toward a deeper understanding of the molecular determinants of their function and regulation. Consequently, the function-structure relationships have been inferred based on homology models. In the present work, we review the existing proton channel models, their assumptions, predictions and the experimental facts that support them. Modeling proton channels is not a trivial task due to the lack of a close homolog template. Hence, there are important differences between published models. This work attempts to critically review existing proton channel models toward the aim of contributing to a better understanding of the structural features of these proteins. PMID:24755912

A numerical model for charge transport and energy conversion of perovskite solar cells.

PubMed

Zhou, Yecheng; Gray-Weale, Angus

2016-02-14

Based on the continuity equations and Poisson's equation, we developed a numerical model for perovskite solar cells. Due to different working mechanisms, the model for perovskite solar cells differs from that of silicon solar cells and Dye Sensitized Solar Cells. The output voltage and current are calculated differently, and in a manner suited in particular to perovskite organohalides. We report a test of our equations against experiment with good agreement. Using this numerical model, it was found that performances of solar cells increase with charge carrier's lifetimes, mobilities and diffusion lengths. The open circuit voltage (Voc) of a solar cell is dependent on light intensities, and charge carrier lifetimes. Diffusion length and light intensity determine the saturated current (Jsc). Additionally, three possible guidelines for the design and fabrication of perovskite solar cells are suggested by our calculations. Lastly, we argue that concentrator perovskite solar cells are promising.

Effects of Nb doping level on the electronic transport, photoelectric effect and magnetoresistance across La0.5Ca0.5MnO3/Nb:SrTiO3 junctions

NASA Astrophysics Data System (ADS)

Wang, J. F.; Jiang, Y. C.; Chen, M. G.; Gao, J.

2013-12-01

Heterojunctions composed of La0.5Ca0.5MnO3 and Nb doped SrTiO3 were fabricated, and the effects of the Nb doping level on their electronic transport, photoelectric effect, and magnetoresistance were investigated. A lower doping concentration of Nb led to better rectifying properties and higher open circuit voltages. The I-V curves for La0.5Ca0.5MnO3/0.7 wt. % Nb-SrTiO3 showed a negligible response to magnetic fields for all temperatures, whereas La0.5Ca0.5MnO3/0.05 wt. % Nb-SrTiO3 exhibited distinct magnetoresistance, which depended on both the bias voltage and temperature. These results are discussed with the assistance of conventional semiconductor theories.

Fingerprints of exceptional points in the survival probability of resonances in atomic spectra

NASA Astrophysics Data System (ADS)

Cartarius, Holger; Moiseyev, Nimrod

2011-07-01

The unique time signature of the survival probability exactly at the exceptional point parameters is studied here for the hydrogen atom in strong static magnetic and electric fields. We show that indeed the survival probability S(t)=|<ψ(0)|ψ(t)>|2 decays exactly as |1-at|2e-ΓEPt/ℏ, where ΓEP is associated with the decay rate at the exceptional point and a is a complex constant depending solely on the initial wave packet that populates exclusively the two almost degenerate states of the non-Hermitian Hamiltonian. This may open the possibility for a first experimental detection of exceptional points in a quantum system.

C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

PubMed

Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

2013-09-01

Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

Thermally-induced voltage alteration for integrated circuit analysis

DOEpatents

Cole, Jr., Edward I.

2000-01-01

A thermally-induced voltage alteration (TIVA) apparatus and method are disclosed for analyzing an integrated circuit (IC) either from a device side of the IC or through the IC substrate to locate any open-circuit or short-circuit defects therein. The TIVA apparatus uses constant-current biasing of the IC while scanning a focused laser beam over electrical conductors (i.e. a patterned metallization) in the IC to produce localized heating of the conductors. This localized heating produces a thermoelectric potential due to the Seebeck effect in any conductors with open-circuit defects and a resistance change in any conductors with short-circuit defects, both of which alter the power demand by the IC and thereby change the voltage of a source or power supply providing the constant-current biasing. By measuring the change in the supply voltage and the position of the focused and scanned laser beam over time, any open-circuit or short-circuit defects in the IC can be located and imaged. The TIVA apparatus can be formed in part from a scanning optical microscope, and has applications for qualification testing or failure analysis of ICs.

A Smart Voltage and Current Monitoring System for Three Phase Inverters Using an Android Smartphone Application

PubMed Central

Mnati, Mohannad Jabbar; Van den Bossche, Alex; Chisab, Raad Farhood

2017-01-01

In this paper, a new smart voltage and current monitoring system (SVCMS) technique is proposed. It monitors a three phase electrical system using an Arduino platform as a microcontroller to read the voltage and current from sensors and then wirelessly send the measured data to monitor the results using a new Android application. The integrated SVCMS design uses an Arduino Nano V3.0 as the microcontroller to measure the results from three voltage and three current sensors and then send this data, after calculation, to the Android smartphone device of an end user using Bluetooth HC-05. The Arduino Nano V3.0 controller and Bluetooth HC-05 are a cheap microcontroller and wireless device, respectively. The new Android smartphone application that monitors the voltage and current measurements uses the open source MIT App Inventor 2 software. It allows for monitoring some elementary fundamental voltage power quality properties. An effort has been made to investigate what is possible using available off-the-shelf components and open source software. PMID:28420132

A Smart Voltage and Current Monitoring System for Three Phase Inverters Using an Android Smartphone Application.

PubMed

Mnati, Mohannad Jabbar; Van den Bossche, Alex; Chisab, Raad Farhood

2017-04-15

In this paper, a new smart voltage and current monitoring system (SVCMS) technique is proposed. It monitors a three phase electrical system using an Arduino platform as a microcontroller to read the voltage and current from sensors and then wirelessly send the measured data to monitor the results using a new Android application. The integrated SVCMS design uses an Arduino Nano V3.0 as the microcontroller to measure the results from three voltage and three current sensors and then send this data, after calculation, to the Android smartphone device of an end user using Bluetooth HC-05. The Arduino Nano V3.0 controller and Bluetooth HC-05 are a cheap microcontroller and wireless device, respectively. The new Android smartphone application that monitors the voltage and current measurements uses the open source MIT App Inventor 2 software. It allows for monitoring some elementary fundamental voltage power quality properties. An effort has been made to investigate what is possible using available off-the-shelf components and open source software.

Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

NASA Astrophysics Data System (ADS)

Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

2014-11-01

The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

Dynamic regulation of mechanosensitive channels: capacitance used to monitor patch tension in real time

NASA Astrophysics Data System (ADS)

Suchyna, Thomas M.; Besch, Steven R.; Sachs, Frederick

2004-03-01

All cells, from bacteria to human, are mechanically sensitive. The most rapid of these membrane protein transducers are mechanosensitive ion channels, ionic pores in the membrane that open and close in response to membrane tension. In specific sensory organs, these channels serve the senses of touch and hearing, and inform the central nervous system about the filling of hollow organs such as the bladder. Non-specialized cells use these channels to report on changes in cell volume and local strain. To preserve dynamic sensitivity, sensory receptors adapt to steady-state stimuli. Here we show that in rat astrocytes, the most abundant cells in the brain, this apparent adaptation to the stimulus is actually an inactivation. We have been able to track the time course of local strain by measuring attofarad changes in membrane capacitance and show that it is not correlated with loss of channel activity. The reduction in current with time is caused by an increased occupancy of low conductance states, and a reduction in the probability of opening, not a relaxation of local stress. The occupancy of these substates depends on the integrity of the cell's cytoplasm. However, while disruption of the cytoskeleton leads to a loss of inactivation, it leaves activation unaffected. The activation process is voltage-insensitive, closely correlated with changes in capacitance, and seems to arise solely from stress in the bilayer. The inactivation rate decreases with depolarization, and kinetic analysis suggests that the process involves multiple cytoplasmic ligands. Surprisingly, multivalent ions such as Gd+3 and Ca+2 that bind to the lipids and affect channel gating, do not affect the strain-induced increase in membrane capacitance; contrary to expectations, membrane elasticity is unchanged.

Melatonin mediates vasodilation through both direct and indirect activation of BKCa channels.

PubMed

Zhao, T; Zhang, H; Jin, C; Qiu, F; Wu, Y; Shi, L

2017-10-01

Melatonin, synthesized primarily by the pineal gland, is a neuroendocrine hormone with high membrane permeability. The vascular effects of melatonin, including vasoconstriction and vasodilation, have been demonstrated in numerous studies. However, the mechanisms underlying these effects are not fully understood. Large-conductance Ca 2+ -activated K + (BK Ca ) channels are expressed broadly on smooth muscle cells and play an important role in vascular tone regulation. This study explored the mechanisms of myocyte BK Ca channels and endothelial factors underlying the action of melatonin on the mesenteric arteries (MAs). Vascular contractility and patch-clamp studies were performed on myocytes of MAs from Wistar rats. Melatonin induced significant vasodilation on MAs. In the presence of N ω -nitro-l-arginine methyl ester (l-NAME), a potent endothelial oxide synthase (eNOS) inhibitor, melatonin elicited concentration-dependent relaxation, with lowered pIC 50 The effect of melatonin was significantly attenuated in the presence of BK Ca channel blocker iberiotoxin or MT1/MT2 receptor antagonist luzindole in both (+) l-NAME and (-) l-NAME groups. In the (+) l-NAME group, iberiotoxin caused a parallel rightward shift of the melatonin concentration-relaxation curve, with pIC 50 lower than that of luzindole. Both inside-out and cell-attached patch-clamp recordings showed that melatonin significantly increased the open probability, mean open time and voltage sensitivity of BK Ca channels. In a cell-attached patch-clamp configuration, the melatonin-induced enhancement of BK Ca channel activity was significantly suppressed by luzindole. These findings indicate that in addition to the activation of eNOS, melatonin-induced vasorelaxation of MAs is partially attributable to its direct (passing through the cell membrane) and indirect (via MT1/MT2 receptors) activation of the BK Ca channels on mesenteric arterial myocytes. © 2017 Society for Endocrinology.

Temperature dependence of conductivity measurement for conducting polymer

NASA Astrophysics Data System (ADS)

Gutierrez, Leandro; Duran, Jesus; Isah, Anne; Albers, Patrick; McDougall, Michael; Wang, Weining

2014-03-01

Conducting polymer-based solar cells are the newest generation solar cells. While research on this area has been progressing, the efficiency is still low because certain important parameters of the solar cell are still not well understood. It is of interest to study the temperature dependence of the solar cell parameters, such as conductivity of the polymer, open circuit voltage, and reverse saturation current to gain a better understanding on the solar cells. In this work, we report our temperature dependence of conductivity measurement using our in-house temperature-varying apparatus. In this project, we designed and built a temperature varying apparatus using a thermoelectric cooler module which gives enough temperature range as we need and costs much less than a cryostat. The set-up of the apparatus will be discussed. Temperature dependence of conductivity measurements for PEDOT:PSS films with different room-temperature conductivity will be compared and discussed. NJSGC-NASA Fellowship grant

Bupivacaine inhibits large conductance, voltage- and Ca2+- activated K+ channels in human umbilical artery smooth muscle cells

PubMed Central

Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica

2012-01-01

Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134

Tin Whisker Electrical Short Circuit Characteristics Part 2

NASA Technical Reports Server (NTRS)

Courey, Karim J.; Asfour, Shihab S.; Bayliss, Jon A.; Ludwib, Lawrence L.; Zapata, Maria C.

2007-01-01

Existing risk simulations make the assumption that when a free tin whisker has bridged two adjacent exposed electrical conductors, the result is an electrical short circuit. This conservative assumption is made because shorting is a random event that has a currently unknown probability associated with it. Due to contact resistance electrical shorts may not occur at lower voltage levels. In this experiment, we study the effect of varying voltage on the breakdown of the contact resistance which leads to a short circuit. From this data we can estimate the probability of an electrical short, as a function of voltage, given that a free tin whisker has bridged two adjacent exposed electrical conductors. In addition, three tin whiskers grown from the same Space Shuttle Orbiter card guide used in the aforementioned experiment were cross-sectioned and studied using a focused ion beam (FIB).

Differential inhibition of N and P/Q Ca2+ currents by 5-HT1A and 5-HT1D receptors in spinal neurons of Xenopus larvae

PubMed Central

Sun, Qian-Quan; Dale, Nicholas

1998-01-01

In whole-cell patch clamp recordings made from non-sensory neurons acutely isolated from the spinal cord of Xenopus (stage 40–42) larvae, two forms of inhibition of the high voltage-activated (HVA) Ca2+ currents were produced by 5-HT. One was voltage dependent and associated with both slowing of the activation kinetics and shifting of the voltage dependence of the HVA currents. This inhibition was relieved by strong depolarizing prepulses. A second form of inhibition was neither associated with slowing of the activation kinetics nor relieved by depolarizing prepulses and was thus voltage independent. In all neurons examined, 5-HT (1 μM) reversibly reduced 34 ± 1.6 % (n = 102) of the HVA Ca2+ currents. In about 40 % of neurons, the inhibition was totally voltage independent. In another 5 %, the inhibition was totally voltage dependent. In the remaining neurons, inhibition was only partially (by around 40 %) relieved by a large depolarizing prepulse, suggesting that in these, the inhibition consisted of both voltage-dependent and -independent components. By using selective channel blockers, we found that 5-HT acted on both N- and P/Q-type channels. However, whereas the inhibition of P/Q-type currents was only voltage independent, the inhibition of N-type currents had both voltage-dependent and -independent components. The effects of 5-HT on HVA Ca2+ currents were mediated by 5-HT1A and 5-HT1D receptors. The 5-HT1A receptors not only preferentially caused voltage-independent inhibition, but did so by acting mainly on the ω-agatoxin-IVA-sensitive Ca2+ channels. In contrast, the 5-HT1D receptor produced both voltage-dependent and -independent inhibition and was preferentially coupled to ω-conotoxin-GVIA sensitive channels. This complexity of modulation may allow fine tuning of transmitter release and calcium signalling in the spinal circuitry of Xenopus larvae. PMID:9625870

Cluster membership probability: polarimetric approach

NASA Astrophysics Data System (ADS)

Medhi, Biman J.; Tamura, Motohide

2013-04-01

Interstellar polarimetric data of the six open clusters Hogg 15, NGC 6611, NGC 5606, NGC 6231, NGC 5749 and NGC 6250 have been used to estimate the membership probability for the stars within them. For proper-motion member stars, the membership probability estimated using the polarimetric data is in good agreement with the proper-motion cluster membership probability. However, for proper-motion non-member stars, the membership probability estimated by the polarimetric method is in total disagreement with the proper-motion cluster membership probability. The inconsistencies in the determined memberships may be because of the fundamental differences between the two methods of determination: one is based on stellar proper motion in space and the other is based on selective extinction of the stellar output by the asymmetric aligned dust grains present in the interstellar medium. The results and analysis suggest that the scatter of the Stokes vectors q (per cent) and u (per cent) for the proper-motion member stars depends on the interstellar and intracluster differential reddening in the open cluster. It is found that this method could be used to estimate the cluster membership probability if we have additional polarimetric and photometric information for a star to identify it as a probable member/non-member of a particular cluster, such as the maximum wavelength value (λmax), the unit weight error of the fit (σ1), the dispersion in the polarimetric position angles (overline{ɛ }), reddening (E(B - V)) or the differential intracluster reddening (ΔE(B - V)). This method could also be used to estimate the membership probability of known member stars having no membership probability as well as to resolve disagreements about membership among different proper-motion surveys.

Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

PubMed

Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

2018-03-24

Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to further protocols: a series of traditional square step voltage clamps, and also a novel voltage clamp comprising a collection of physiologically relevant action potentials. We demonstrate that we can make predictive cell-specific models that outperform the use of averaged data from a number of different cells, and thereby examine which changes in gating are responsible for cell-cell variability in current kinetics. Our technique allows rapid collection of consistent and high quality data, from single cells, and produces more predictive mathematical ion channel models than traditional approaches. © 2018 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

Influence of Wire Electrical Discharge Machining (WEDM) process parameters on surface roughness

NASA Astrophysics Data System (ADS)

Yeakub Ali, Mohammad; Banu, Asfana; Abu Bakar, Mazilah

2018-01-01

In obtaining the best quality of engineering components, the quality of machined parts surface plays an important role. It improves the fatigue strength, wear resistance, and corrosion of workpiece. This paper investigates the effects of wire electrical discharge machining (WEDM) process parameters on surface roughness of stainless steel using distilled water as dielectric fluid and brass wire as tool electrode. The parameters selected are voltage open, wire speed, wire tension, voltage gap, and off time. Empirical model was developed for the estimation of surface roughness. The analysis revealed that off time has a major influence on surface roughness. The optimum machining parameters for minimum surface roughness were found to be at a 10 V open voltage, 2.84 μs off time, 12 m/min wire speed, 6.3 N wire tension, and 54.91 V voltage gap.

[Study of microorganism sterilization by instant microwave and electromagnetic pulse].

PubMed

Lu, Zhiyuan; Shi, Pinpin; Zhu, Manzuo; Sun, Wenquan; Ding, Hua; Hou, Jianqiang

2008-08-01

The sterilization effects of constant electromagnetic wave and instant pulse on foods and traditional Chinese medical pills are introduced in this paper. From the velum's voltage variation caused by the outward electric filed,the dielectric properties of membranaceous ion and the pass rate of the membranaceous ion, we could analyze the biological heating effect and the biological non-heating effect. The sterilization effect of constant electromagnetic wave is based on the biological heating effect, while the instant electromagnetic pulse is based on the biological non-heating effect. With the applied electronic field, the voltage of membrane could increase, which results in the gates of K+ open, and the flowing out of K+. And the variation of the membranaceous voltage makes the gates of Ca2+ open. The Ca2+ of large consistency could come into the cell by the gradient of voltage. It could induce the death of the cells. The greater the variation of membranaceous voltage becomes, the higher will be the death rate of the cells.

Commutation circuit for an HVDC circuit breaker

DOEpatents

Premerlani, William J.

1981-01-01

A commutation circuit for a high voltage DC circuit breaker incorporates a resistor capacitor combination and a charging circuit connected to the main breaker, such that a commutating capacitor is discharged in opposition to the load current to force the current in an arc after breaker opening to zero to facilitate arc interruption. In a particular embodiment, a normally open commutating circuit is connected across the contacts of a main DC circuit breaker to absorb the inductive system energy trapped by breaker opening and to limit recovery voltages to a level tolerable by the commutating circuit components.

Commutation circuit for an HVDC circuit breaker

DOEpatents

Premerlani, W.J.

1981-11-10

A commutation circuit for a high voltage DC circuit breaker incorporates a resistor capacitor combination and a charging circuit connected to the main breaker, such that a commutating capacitor is discharged in opposition to the load current to force the current in an arc after breaker opening to zero to facilitate arc interruption. In a particular embodiment, a normally open commutating circuit is connected across the contacts of a main DC circuit breaker to absorb the inductive system energy trapped by breaker opening and to limit recovery voltages to a level tolerable by the commutating circuit components. 13 figs.

Report on Contract W911NF-05-1-0339 (Clarkson University)

DTIC Science & Technology

2012-11-30

voltammetry and impedance spectroscopy: voltage dependent parameters of a silicon solar cell under controlled illumination and temperature, Energy...voltammetry for quantitative evaluation of temperature and voltage dependent parameters of a silicon solar cell , Solar Energy, (11 2011): 0. doi: 10.1016...characterization of silicon solar cells in the electro-analytical approach: Combined measurements of temperature and voltage dependent electrical

Voltage-dependent formation of gramicidin channels in lipid bilayers.

PubMed Central

Sandblom, J; Galvanovskis, J; Jilderos, B

2001-01-01

The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628

Mechanisms limiting the performance of large grain polycrystalline silicon solar cells

NASA Technical Reports Server (NTRS)

Culik, J. S.; Alexander, P.; Dumas, K. A.; Wohlgemuth, J. W.

1984-01-01

The open-circuit voltage and short-circuit current of large-grain (1 to 10 mm grain diameter) polycrystalline silicon solar cells is determined by the minority-carrier diffusion length within the bulk of the grains. This was demonstrated by irradiating polycrystalline and single-crystal (Czochralski) silicon solar cells with 1 MeV electrons to reduce their bulk lifetime. The variation of short-circuit current with minority-carrier diffusion length for the polycrystalline solar cells is identical to that of the single-crystal solar cells. The open-circuit voltage versus short-circuit current characteristic of the polycrystalline solar cells for reduced diffusion lengths is also identical to that of the single-crystal solar cells. The open-circuit voltage of the polycrystalline solar cells is a strong function of quasi-neutral (bulk) recombination, and is reduced only slightly, if at all, by grain-boundary recombination.

The cooperative voltage sensor motion that gates a potassium channel.

PubMed

Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

2005-01-01

The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.

The Cooperative Voltage Sensor Motion that Gates a Potassium Channel

PubMed Central

Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

2005-01-01

The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close. PMID:15623895

Distinct subunit contributions to the activation of M-type potassium channels by PI(4,5)P2

PubMed Central

Telezhkin, Vsevolod; Brown, David A.

2012-01-01

Low-threshold voltage-gated M-type potassium channels (M channels) are tetraheteromers, commonly of two Kv7.2 and two Kv7.3 subunits. Though gated by voltage, the channels have an absolute requirement for binding of the membrane phospholipid phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2) to open. We have investigated the quantitative relation between the concentration of a water-soluble PI(4,5)P2 analog, dioctanoyl-PI(4,5)P2 (DiC8-PI(4,5)P2), and channel open probability (Popen) by fast application of increasing concentrations of DiC8-PI(4,5)P2 to the inside face of membrane patches excised from Chinese hamster ovary cells expressing M channels as heteromeric Kv7.2/7.3 subunits. The rationale for the experiments is that this will mimic the effect of changes in membrane PI(4,5)P2 concentration. Single-channel conductances from channel current–voltage relations in cell-attached mode were 9.2 ± 0.1 pS with a 2.5-mM pipette [K+]. Plots of Popen against DiC8-PI(4,5)P2 concentration were best fitted using a two-component concentration–Popen relationship with high and low affinity, half-maximal effective concentration (EC50) values of 1.3 ± 0.14 and 75.5 ± 2.5 µM, respectively, and Hill slopes of 1.4 ± 0.06. In contrast, homomeric channels from cells expressing only Kv7.2 or Kv7.3 constructs yielded single-component curves with EC50 values of 76.2 ± 19.9 or 3.6 ± 1.0 µM, respectively. When wild-type (WT) Kv7.2 was coexpressed with a mutated Kv7.3 subunit with >100-fold reduced sensitivity to PI(4,5)P2, the high-affinity component of the activation curve was lost. Fitting the data for WT and mutant channels to an activation mechanism with independent PI(4,5)P2 binding to two Kv7.2 and two Kv7.3 subunits suggests that the two components of the M-channel activation curve correspond to the interaction of PI(4,5)P2 with the Kv7.3 and Kv7.2 subunits, respectively, that channels can open when only the two Kv7.3 subunits have bound DiC8-PI(4,5)P2, and that maximum channel opening requires binding to all four subunits. PMID:22689829

Low-Voltage Bypass Device

NASA Technical Reports Server (NTRS)

Wilson, J. P.

1994-01-01

Improved bypass device provides low-resistance current shunt around low-voltage power cell when cell fails in open-circuit condition during operation. In comparison with older bypass devices for same application, this one weighs less, generates less heat, and has lower voltage drop (less resistance). Bypass device connected in parallel with power cell. Draws very little current during normal operation of cell.

Aluminium alloyed iron-silicide/silicon solar cells: A simple approach for low cost environmental-friendly photovoltaic technology

PubMed Central

Kumar Dalapati, Goutam; Masudy-Panah, Saeid; Kumar, Avishek; Cheh Tan, Cheng; Ru Tan, Hui; Chi, Dongzhi

2015-01-01

This work demonstrates the fabrication of silicide/silicon based solar cell towards the development of low cost and environmental friendly photovoltaic technology. A heterostructure solar cells using metallic alpha phase (α-phase) aluminum alloyed iron silicide (FeSi(Al)) on n-type silicon is fabricated with an efficiency of 0.8%. The fabricated device has an open circuit voltage and fill-factor of 240 mV and 60%, respectively. Performance of the device was improved by about 7 fold to 5.1% through the interface engineering. The α-phase FeSi(Al)/silicon solar cell devices have promising photovoltaic characteristic with an open circuit voltage, short-circuit current and a fill factor (FF) of 425 mV, 18.5 mA/cm2, and 64%, respectively. The significant improvement of α-phase FeSi(Al)/n-Si solar cells is due to the formation p+−n homojunction through the formation of re-grown crystalline silicon layer (~5–10 nm) at the silicide/silicon interface. Thickness of the regrown silicon layer is crucial for the silicide/silicon based photovoltaic devices. Performance of the α-FeSi(Al)/n-Si solar cells significantly depends on the thickness of α-FeSi(Al) layer and process temperature during the device fabrication. This study will open up new opportunities for the Si based photovoltaic technology using a simple, sustainable, and los cost method. PMID:26632759

On the role of endogenous G-protein βγ subunits in N-type Ca2+ current inhibition by neurotransmitters in rat sympathetic neurones

PubMed Central

Delmas, Patrick; Brown, David A; Dayrell, Mariza; Abogadie, Fe C; Caulfield, Malcolm P; Buckley, Noel J

1998-01-01

Using whole-cell and perforated-patch recordings, we have examined the part played by endogenous G-protein βγ subunits in neurotransmitter-mediated inhibition of N-type Ca2+ channel current ICa) in dissociated rat superior cervical sympathetic neurones. Expression of the C-terminus domain of β-adrenergic receptor kinase 1 (βARK1), which contains the consensus motif (QXXER) for binding Gβγ, reduced the fast (pertussis toxin (PTX)-sensitive) and voltage-dependent inhibition of ICa by noradrenaline and somatostatin, but not the slow (PTX-insensitive) and voltage-independent inhibition induced by angiotensin II. βARK1 peptide reduced GTP-γ-S-induced voltage-dependent and PTX-sensitive inhibition of ICa but not GTP-γ-S-mediated voltage-independent inhibition. Overexpression of Gβ1γ2, which mimicked the voltage-dependent inhibition by reducing ICa density and enhancing basal facilitation, occluded the voltage-dependent noradrenaline- and somatostatin-mediated inhibitions but not the inhibition mediated by angiotensin II. Co-expression of the C-terminus of βARK1 with β1 and γ2 subunits prevented the effects of Gβγ dimers on basal Ca2+ channel behaviour in a manner consistent with the sequestering of Gβγ. The expression of the C-terminus of βARK1 slowed down reinhibition kinetics of ICa following conditioning depolarizations and induced long-lasting facilitation by cumulatively sequestering βγ subunits. Our findings identify endogenous Gβγ as the mediator of the voltage-dependent, PTX-sensitive inhibition of ICa induced by both noradrenaline and somatostatin but not the voltage-independent, PTX-insensitive inhibition by angiotensin II. They also support the view that voltage-dependent inhibition results from a direct Gβγ-Ca2+ channel interaction. PMID:9490860

Temperature- and Intensity-Dependent Photovoltaic Measurements to Identify Dominant Recombination Pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brandt, Riley E.; Mangan, Niall M.; Li, Jian V.

2016-11-21

In novel photovoltaic absorbers, it is often difficult to assess the root causes of low open-circuit voltages, which may be due to bulk recombination or sub-optimal contacts. In the present work, we discuss the role of temperature- and illumination-dependent device electrical measurements in quantifying and distinguishing these performance losses - in particular, for determining bounds on interface recombination velocities, band alignment, and minority carrier lifetime. We assess the accuracy of this approach by direct comparison to photoelectron spectroscopy. Then, we demonstrate how more computationally intensive model parameter fitting approaches can draw more insights from this broad measurement space. We applymore » this measurement and modeling approach to high-performance III-V and thin-film chalcogenide devices.« less

Direct block of hERG potassium channels by the protein kinase C inhibitor bisindolylmaleimide I (GF109203X).

PubMed

Thomas, Dierk; Hammerling, Bettina C; Wimmer, Anna-Britt; Wu, Kezhong; Ficker, Eckhard; Kuryshev, Yuri A; Scherer, Daniel; Kiehn, Johann; Katus, Hugo A; Schoels, Wolfgang; Karle, Christoph A

2004-12-01

The human ether-a-go-go-related gene (hERG) encodes the rapid component of the cardiac repolarizing delayed rectifier potassium current, I(Kr). The direct interaction of the commonly used protein kinase C (PKC) inhibitor bisindolylmaleimide I (BIM I) with hERG, KvLQT1/minK, and I(Kr) currents was investigated in this study. hERG and KvLQT1/minK channels were heterologously expressed in Xenopus laevis oocytes, and currents were measured using the two-microelectrode voltage clamp technique. In addition, hERG currents in stably transfected human embryonic kidney (HEK 293) cells, native I(Kr) currents and action potentials in isolated guinea pig ventricular cardiomyocytes were recorded using whole-cell patch clamp electrophysiology. Bisindolylmaleimide I blocked hERG currents in HEK 293 cells and Xenopus oocytes in a concentration-dependent manner with IC(50) values of 1.0 and 13.2 muM, respectively. hERG channels were primarily blocked in the open state in a frequency-independent manner. Analysis of the voltage-dependence of block revealed a reduction of inhibition at positive membrane potentials. BIM I caused a shift of -20.3 mV in the voltage-dependence of inactivation. The point mutations tyrosine 652 alanine (Y652A) and phenylalanine 656 alanine (F656A) attenuated hERG current blockade, indicating that BIM I binds to a common drug receptor within the pore region. KvLQT1/minK currents were not significantly altered by BIM I. Finally, 1 muM BIM I reduced native I(Kr) currents by 69.2% and lead to action potential prolongation. In summary, PKC-independent effects have to be carefully considered when using BIM I as PKC inhibitor in experimental models involving hERG channels and I(Kr) currents.

Block of nicotinic acetylcholine receptors by philanthotoxins is strongly dependent on their subunit composition

PubMed Central

Kachel, Hamid S.; Patel, Rohit N.; Franzyk, Henrik; Mellor, Ian R.

2016-01-01

Philanthotoxin-433 (PhTX-433) is an active component of the venom from the Egyptian digger wasp, Philanthus triangulum. PhTX-433 inhibits several excitatory ligand-gated ion channels, and to improve selectivity two synthetic analogues, PhTX-343 and PhTX-12, were developed. Previous work showed a 22-fold selectivity of PhTX-12 over PhTX-343 for embryonic muscle-type nicotinic acetylcholine receptors (nAChRs) in TE671 cells. We investigated their inhibition of different neuronal nAChR subunit combinations as well as of embryonic muscle receptors expressed in Xenopus oocytes. Whole-cell currents in response to application of acetylcholine alone or co-applied with PhTX analogue were studied by using two-electrode voltage-clamp. α3β4 nAChRs were most sensitive to PhTX-343 (IC50 = 12 nM at −80 mV) with α4β4, α4β2, α3β2, α7 and α1β1γδ being 5, 26, 114, 422 and 992 times less sensitive. In contrast α1β1γδ was most sensitive to PhTX-12 along with α3β4 (IC50 values of 100 nM) with α4β4, α4β2, α3β2 and α7 being 3, 3, 26 and 49 times less sensitive. PhTX-343 inhibition was strongly voltage-dependent for all subunit combinations except α7, whereas this was not the case for PhTX-12 for which weak voltage dependence was observed. We conclude that PhTX-343 mainly acts as an open-channel blocker of nAChRs with strong subtype selectivity. PMID:27901080

Direct activation of Ca2+ and voltage-gated potassium channels of large conductance by anandamide in endothelial cells does not support the presence of endothelial atypical cannabinoid receptor.

PubMed

Bondarenko, Alexander I; Panasiuk, Olga; Okhai, Iryna; Montecucco, Fabrizio; Brandt, Karim J; Mach, Francois

2017-06-15

Endocannabinoid anandamide induces endothelium-dependent relaxation commonly attributed to stimulation of the G-protein coupled endothelial anandamide receptor. The study addressed the receptor-independent effect of anandamide on large conductance Ca 2+ -dependent K + channels expressed in endothelial cell line EA.hy926. Under resting conditions, 10µM anandamide did not significantly influence the resting membrane potential. In a Ca 2+ -free solution the cells were depolarized by ~10mV. Further administration of 10µM anandamide hyperpolarized the cells by ~8mV. In voltage-clamp mode, anandamide elicited the outwardly rectifying whole-cell current sensitive to paxilline but insensitive to GDPβS, a G-protein inhibitor. Administration of 70µM Mn 2+ , an agent used to promote integrin clustering, reversibly stimulated whole-cell current, but failed to further facilitate the anandamide-stimulated current. In an inside-out configuration, anandamide (0.1-30µM) facilitated single BK Ca channel activity in a concentration-dependent manner within a physiological Ca 2+ range and a wide range of voltages, mainly by reducing mean closed time. The effect is essentially eliminated following chelation of Ca 2+ from the cytosolic face and pre-exposure to cholesterol-reducing agent methyl-β-cyclodextrin. O-1918 (3µM), a cannabidiol analog used as a selective antagonist of endothelial anandamide receptor, reduced BK Ca channel activity in inside-out patches. These results do not support the existence of endothelial cannabinoid receptor and indicate that anandamide acts as a direct BK Ca opener. The action does not require cell integrity or integrins and is caused by direct modification of BK Ca channel activity. Copyright © 2017 Elsevier B.V. All rights reserved.

XE991 and Linopirdine Are State-Dependent Inhibitors for Kv7/KCNQ Channels that Favor Activated Single Subunits.

PubMed

Greene, Derek L; Kang, Seungwoo; Hoshi, Naoto

2017-07-01

M-channel inhibitors, especially XE991, are being used increasingly in animal experiments; however, insufficient characterization of XE991 at times confounds the interpretation of results when using this compound. Here, we demonstrate that XE991 and linopirdine are state-dependent inhibitors that favor the activated-subunit of neuronal Kv7/KCNQ channels. We performed patch-clamp experiments on homomeric Kv7.2 or heteromeric Kv7.2/3 channels expressed in Chinese hamster ovary cells to characterize XE991 and linopirdine. Neither inhibitor was efficacious around the resting membrane potential of cells in physiologic conditions. Inhibition of Kv7.2 and Kv7.2/3 channels by XE991 was closely related with channel activation. When the voltage dependence of activation was left-shifted by retigabine or right-shifted by the mutation, Kv7.2(R214D), the shift in half-activation voltage proportionally coincided with the shift in the half-effective potential for XE991 inhibition. Inhibition kinetics during XE991 wash-in was facilitated at depolarized potentials. Ten-minute washout of XE991 resulted in ∼30% current recovery, most of which was attributed to surface transport of Kv7.2 channels. Linopirdine also exhibited similar inhibition characteristics, with the exception of near- complete current recovery after washout at depolarized potentials. Inhibition kinetics of both XE991 and linopirdine was not as sensitive to changes in voltage as would be predicted by open- channel inhibition. Instead, they were well explained by binding to a single activated subunit. The characteristics of XE991 and linopirdine should be taken into account when these M-channel inhibitors are used in experiments. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Improved open-circuit voltage in polymer/oxide-nanoarray hybrid solar cells by formation of homogeneous metal oxide core/shell structures.

PubMed

Wu, Fan; Cui, Qi; Qiu, Zeliang; Liu, Changwen; Zhang, Hui; Shen, Wei; Wang, Mingtai

2013-04-24

Incorporation of vertically aligned nanorod/nanowire arrays of metal oxide (oxide-NAs) with a polymer can produce efficient hybrid solar cells with an ideal bulk-heterojunction architecture. However, polymer/oxide-NAs solar cells still suffer from a rather low (normally, < 0.4 V) open-circuit voltage (Voc). Here we demonstrate, for the first time, a novel strategy to improve the Voc in polymer/oxide-NAs solar cells by formation of homogeneous core/shell structures and reveal the intrinsic principles involved therein. A feasible hydrothermal-solvothermal combined method is developed for preparing homogeneous core/shell nanoarrays of metal oxides with a single-crystalline nanorod as core and the aggregation layer of corresponding metal oxide quantum dots (QDs) as shell, and the shell thickness (L) is easily controlled by the solvothermal reaction time for growing QDs on the nanorod. The core/shell formation dramatically improves the device Voc up to ca. 0.7-0.8 V depending on L. Based on steady-state and dynamic measurements, as well as modeling by space-charge-limited current method, it is found that the improved Voc originates from the up-shifted conduction band edge in the core by the interfacial dipole field resulting from the decreased mobility difference between photogenerated electrons and holes after the shell growth, which increases the energy difference between the quasi-Fermi levels of photogenerated electrons in the core and holes in the polymer for a higher Voc. Our results indicate that increasing Voc by the core/shell strategy seems not to be dependent on the kinds of metal oxides.

De Novo Mutation in the SCN5A Gene Associated with Brugada Syndrome.

PubMed

Wang, Lumin; Meng, Xiangyun; Yuchi, Zhiguang; Zhao, Zhenghang; Xu, Dehui; Fedida, David; Wang, Zhuren; Huang, Chen

2015-01-01

Brugada syndrome (BrS) is a genetically determined cardiac electrical disorder, characterized by typical electrocardiography (ECG) alterations, and it is an arrhythmogenic syndrome that may lead to sudden cardiac death. The most common genotype found among BrS patients is caused by mutations in the SCN5A gene, which lead to a loss of function of the cardiac sodium (Na(+)) channel (Nav1.5) by different mechanisms. The assay of confocal laser microscopy and western blot were used to identify the expression and location of L812Q at the cell surface. Characterization of Nav1.5 L812Q mutant Na(+) channels was text by patch-clamp recordings, and the PHYRE2 server was used to build a model for human Nav1.5 channel. Here, we report that a novel missense SCN5A mutation, L812Q, localized in the DII-S4 transmembrane region of the Nav1.5 channel protein, was identified in an index patient who showed a typical BrS type-1 ECG phenotype. The mutation was absent in the patient's parents and brother. Heterologous expression of the wild-type (WT) and L812Q mutant Nav1.5 channels in human embryonic kidney cells (HEK293 cells) reveals that the mutation results in a reduction of Na(+) current density as well as ∼20 mV hyperpolarizing shift of the voltage dependence of inactivation. The voltage dependence of activation and the time course for recovery from inactivation are not affected by the mutation. The hyperpolarizing shift of the voltage dependence of inactivation caused a reduction of the Na(+) window current as well. In addition, western blot and confocal laser microscopy imaging experiments showed that the mutation causes fewer channel to be expressed at the membrane than WT channel. A large proportion of the mutant channels are retained in the cytoplasm, probably in the endoplasmic reticulum. The decrease of channel expression, hyperpolarizing shift of voltage dependence of inactivation, and a decline of Na(+) window current caused by L812Q mutation lead to a reduction of Na(+) current during the upstroke and the repolarization phases of cardiac action potential, which contribute to the development of BrS. © 2015 S. Karger AG, Basel.

Laboratory demonstration of lightning strike pattern on different roof tops installed with Franklin Rods

NASA Astrophysics Data System (ADS)

Ullah, Irshad; Baharom, MNR; Ahmed, H.; Luqman, HM.; Zainal, Zainab

2017-11-01

Protection against lightning is always a challenging job for the researcher. The consequences due to lightning on different building shapes needs a comprehensive knowledge in order to provide the information to the common man. This paper is mainly concern with lightning pattern when it strikes on the building with different shape. The work is based on the practical experimental work in high voltage laboratory. Different shapes of the scaled structures have been selected in order to investigate the equal distribution of lightning voltage. The equal distribution of lightning voltage will provide the maximum probability of lightning strike on air terminal of the selected shapes. Building shapes have a very important role in lightning protection. The shapes of the roof tops have different geometry and the Franklin rod installation is also varies with changing the shape of the roof top. According to the ambient weather condition of Malaysia high voltage impulse is applied on the lightning rod installed on different geometrical shape. The equal distribution of high voltage impulse is obtained as the geometry of the scaled structure is identical and the air gap for all the tested object is kept the same. This equal distribution of the lightning voltage also proves that the probability of lightning strike is on the corner and the edges of the building structure.

Action Potential Dynamics in Fine Axons Probed with an Axonally Targeted Optical Voltage Sensor.

PubMed

Ma, Yihe; Bayguinov, Peter O; Jackson, Meyer B

2017-01-01

The complex and malleable conduction properties of axons determine how action potentials propagate through extensive axonal arbors to reach synaptic terminals. The excitability of axonal membranes plays a major role in neural circuit function, but because most axons are too thin for conventional electrical recording, their properties remain largely unexplored. To overcome this obstacle, we used a genetically encoded hybrid voltage sensor (hVOS) harboring an axonal targeting motif. Expressing this probe in transgenic mice enabled us to monitor voltage changes optically in two populations of axons in hippocampal slices, the large axons of dentate granule cells (mossy fibers) in the stratum lucidum of the CA3 region and the much finer axons of hilar mossy cells in the inner molecular layer of the dentate gyrus. Action potentials propagated with distinct velocities in each type of axon. Repetitive firing broadened action potentials in both populations, but at an intermediate frequency the degree of broadening differed. Repetitive firing also attenuated action potential amplitudes in both mossy cell and granule cell axons. These results indicate that the features of use-dependent action potential broadening, and possible failure, observed previously in large nerve terminals also appear in much finer unmyelinated axons. Subtle differences in the frequency dependences could influence the propagation of activity through different pathways to excite different populations of neurons. The axonally targeted hVOS probe used here opens up the diverse repertoire of neuronal processes to detailed biophysical study.

Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

PubMed

Carvalho-de-Souza, Joao L; Bezanilla, Francisco

2018-02-05

Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018 Carvalho-de-Souza and Bezanilla.

Open star clusters in the Milky Way. Comparison of photometric and trigonometric distance scales based on Gaia TGAS data

NASA Astrophysics Data System (ADS)

Kovaleva, Dana A.; Piskunov, Anatoly E.; Kharchenko, Nina V.; Röser, Siegfried; Schilbach, Elena; Scholz, Ralf-Dieter; Reffert, Sabine; Yen, Steffi X.

2017-10-01

Context. The global survey of star clusters in the Milky Way (MWSC) is a comprehensive list of 3061 objects that provides, among other parameters, distances to clusters based on isochrone fitting. The Tycho-Gaia Astrometric Solution (TGAS) catalogue, which is a part of Gaia data release 1 (Gaia DR1), delivers accurate trigonometric parallax measurements for more than 2 million stars, including those in star clusters. Aims: We compare the open cluster photometric distance scale with the measurements given by the trigonometric parallaxes from TGAS to evaluate the consistency between these values. Methods: The average parallaxes of probable cluster members available in TGAS provide the trigonometric distance scale of open clusters, while the photometric scale is given by the distances published in the MWSC. Sixty-four clusters are suited for comparison as they have more than 16 probable members with parallax measurements in TGAS. We computed the average parallaxes of the probable members and compared these to the photometric parallaxes derived within the MWSC. Results: We find a good agreement between the trigonometric TGAS-based and the photometric MWSC-based distance scales of open clusters, which for distances less than 2.3 kpc coincide at a level of about 0.1 mas with no dependence on the distance. If at all, there is a slight systematic offset along the Galactic equator between 30° and 160° galactic longitude.

Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

NASA Astrophysics Data System (ADS)

Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

2018-04-01

In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.