[Genetic Characteristics of Type 2 Vaccine-derived Poliovirus in Shanxi Province (China) in 2014].

PubMed

Yan, Dongrei; Li, Xiaolei; Zhang, Yong; Yang, Jianfang; Zhu, Shuangli; Wang, Dongyan; Zhang, Chuangye; Zhu, Hui; Xu, Wenbo

2015-03-01

The World Health Organization redefined the type 2 vaccine-derived poliovirus (VDPV) in 2010. To study the genetic characteristics and evolution of type 2 VDPV under this new definition, we conducted genome sequencing and analyses of type 2 VDPVs isolated from one patient with acute flaccid paralysis in Shanxi province (China) in 2014. Nucleotide sequencing revealed that the full-length of type 2 VDPV is 7439 bases encoding 2207 amino acids with no insertion or deletion of nucleotides compared with Sabin2. One nucleotide substitution identified as a key determinant of the attenuated phenotype of the Sabin 2 strain (A-G reversion at nucleotide nt 481 in the 5-end of the untranslated region) had reverted in the Shanxi type 2 VDPV. The other known key determinant of the attenuated phenotype of the Sabin 2 strain (U-->C reversion at nt2909 in the VP1 coding region that caused a Ile143Thr substitution in VP1) had not reverted in the Shanxi VDPV. The Shanxi type 2 VDPV was S2/S1 recombinant, the crossover site of which mapped to the 3-end of the 3D region (between nt 6247 and nt 6281). A phylogentic tree based on the VP1 coding region showed that evolution of the Shanxi type 2 VDPV was independent of other type 2 VDPVs detected worldwide. We estimated that the strain circulated for approximately = 11 months in the population according to the known evolution rate. The present study confirmed that the Chinese Polio Laboratory Network could discover the VDPV promptly and that it played an important part in maintenance of a polio-free China.

Nucleotide variation in Sabin type 3 poliovirus from an Albanian infant with agammaglobulinemia and vaccine associated poliomyelitis.

PubMed

Foiadelli, Thomas; Savasta, Salvatore; Battistone, Andrea; Kota, Majlinda; Passera, Carolina; Fiore, Stefano; Bino, Silvia; Amato, Concetta; Lozza, Alessandro; Marseglia, Gian Luigi; Fiore, Lucia

2016-06-10

Vaccine-associated paralytic poliomyelitis (VAPP) and immunodeficient long-term polio excretors constitute a significant public health burden and are a major concern for the WHO global polio eradication endgame. Poliovirus type 3 characterized as Sabin-like was isolated from a 5-month-old Albanian child with X-linked agammaglobulinemia and VAPP after oral polio vaccine administration. Diagnostic workup and treatment were performed in Italy. Poliovirus replicated in the gut for 7 months. The 5' non coding region (NCR), VP1, VP3 capsid proteins and the 3D polymerase genomic regions of sequential isolates were sequenced. Increasing accumulation of nucleotide mutations in the VP1 region was detected over time, reaching 1.0 % of genome variation with respect to the Sabin reference strain, which is the threshold that defines a vaccine-derived poliovirus (VDPV). We identified mutations in the 5'NCR and VP3 regions that are associated with reversion to neurovirulence. Despite this, all isolates were characterized as Sabin-like. Several amino acid mutations were identified in the VP1 region, probably involved in growth adaptation and viral persistence in the human gut. Intertypic recombination with Sabin type 2 polio in the 3D polymerase region, possibly associated with increased virus transmissibility, was found in all isolates. Gamma-globulin replacement therapy led to viral clearance and neurological improvement, preventing the occurrence of persistent immunodeficiency-related VDPV. This is the first case of VAPP in an immunodeficient child detected in Albania through the Acute Flaccid Paralysis surveillance system and the first investigated case of vaccine associated poliomyelitis in Italy since the introduction of an all-Salk schedule in 2002. We discuss over the biological and clinical implications in the context of the Global Polio Eradication Program and emphasize on the importance of the Acute Flaccid Paralysis surveillance.

A Viscoelastic-Plastic Constitutive Model with a Finite Element Solution Methodology

DTIC Science & Technology

1978-06-01

where - r3 K f BT D B dv (4-15) • ,re E,,rae v ’,vp ,vp w F BT dv (4-17)A -vp -Vp 84 ii T In the above, K is the global viscoelastic stiffness matrix anl ...Code C4AA Port Hueneme. CA NAVSE ASYSCOM Code OOC (LT R. MacDougisl). Washington DC NAVSEC Code 6034 1 Library). Washington DC NAVSEC61RLACT PWO. Torni...ESEARCH CO LA HABRA, CA iBROOKSi 0ONCRFE It Il FCH-NoIOGY CORP. TACOMA. ’A At( ANL )ESONi ((tNRAI) ASSOC. Van NuNs CA iA. Luisonit I)RA Vt COR(P I’muitt

Genetic relatedness among human rotavirus genes coding for VP7, a major neutralization protein, and its application to serotype identification.

PubMed Central

Midthun, K; Flores, J; Taniguchi, K; Urasawa, S; Kapikian, A Z; Chanock, R M

1987-01-01

Antigenic characterization of human rotaviruses by plaque reduction neutralization assay has revealed four distinct serotypes. The outer capsid protein VP7, coded for by gene 8 or 9, is a major neutralization protein; however, studies of rotaviruses derived from genetic reassortment between two strains have confirmed that another outer capsid protein, VP3, is in some cases equally important in neutralization. In this study, the genetic relatedness of the genes coding for VP7 of human rotaviruses belonging to serotypes 1 through 4 was examined by hybridization of their denatured double-stranded genomic RNAs to labeled single-stranded mRNA probes derived from human-animal rotavirus reassortants containing only the VP7 gene of their human rotavirus parent. A high degree of homology was demonstrated between the VP7 genes of strain D and other serotype 1 human rotaviruses, strain DS-1 and other serotype 2 human rotaviruses, strain P and other serotype 3 human rotaviruses, and strain ST3 and other serotype 4 human rotaviruses. Hybrid bands could not be demonstrated between the VP7 gene of D, DS-1, P, or ST3 and the corresponding gene of human rotaviruses belonging to a different serotype. RNA specimens extracted from the stools of 15 Venezuelan children hospitalized with rotavirus diarrhea were hybridized to each of the reassortant probes representing the four human serotypes. All five viruses with short RNA patterns showed homology with the DS-1 strain VP7 gene; two of these were previously adapted to tissue culture and shown to be serotype 2 strains by tissue culture neutralization. Of the remaining 10 viruses with long RNA patterns, 2 hybridized only to the D strain VP7 gene, 6 hybridized only to the P strain VP7 gene, and 2 hybridized only to the ST3 strain VP7 gene. Hybridization using single human rotavirus gene substitution reassortants as probes may provide an alternative method for identifying the VP7 serotype of field isolates that would circumvent the need for tissue culture adaptation. Images PMID:3038948

Bioinformatic analysis suggests that the Orbivirus VP6 cistron encodes an overlapping gene

PubMed Central

Firth, Andrew E

2008-01-01

Background The genus Orbivirus includes several species that infect livestock – including Bluetongue virus (BTV) and African horse sickness virus (AHSV). These viruses have linear dsRNA genomes divided into ten segments, all of which have previously been assumed to be monocistronic. Results Bioinformatic evidence is presented for a short overlapping coding sequence (CDS) in the Orbivirus genome segment 9, overlapping the VP6 cistron in the +1 reading frame. In BTV, a 77–79 codon AUG-initiated open reading frame (hereafter ORFX) is present in all 48 segment 9 sequences analysed. The pattern of base variations across the 48-sequence alignment indicates that ORFX is subject to functional constraints at the amino acid level (even when the constraints due to coding in the overlapping VP6 reading frame are taken into account; MLOGD software). In fact the translated ORFX shows greater amino acid conservation than the overlapping region of VP6. The ORFX AUG codon has a strong Kozak context in all 48 sequences. Each has only one or two upstream AUG codons, always in the VP6 reading frame, and (with a single exception) always with weak or medium Kozak context. Thus, in BTV, ORFX may be translated via leaky scanning. A long (83–169 codon) ORF is present in a corresponding location and reading frame in all other Orbivirus species analysed except Saint Croix River virus (SCRV; the most divergent). Again, the pattern of base variations across sequence alignments indicates multiple coding in the VP6 and ORFX reading frames. Conclusion At ~9.5 kDa, the putative ORFX product in BTV is too small to appear on most published protein gels. Nonetheless, a review of past literature reveals a number of possible detections. We hope that presentation of this bioinformatic analysis will stimulate an attempt to experimentally verify the expression and functional role of ORFX, and hence lead to a greater understanding of the molecular biology of these important pathogens. PMID:18489030

The Acheta domesticus Densovirus, Isolated from the European House Cricket, Has Evolved an Expression Strategy Unique among Parvoviruses▿†

PubMed Central

Liu, Kaiyu; Li, Yi; Jousset, Françoise-Xavière; Zadori, Zoltan; Szelei, Jozsef; Yu, Qian; Pham, Hanh Thi; Lépine, François; Bergoin, Max; Tijssen, Peter

2011-01-01

The Acheta domesticus densovirus (AdDNV), isolated from crickets, has been endemic in Europe for at least 35 years. Severe epizootics have also been observed in American commercial rearings since 2009 and 2010. The AdDNV genome was cloned and sequenced for this study. The transcription map showed that splicing occurred in both the nonstructural (NS) and capsid protein (VP) multicistronic RNAs. The splicing pattern of NS mRNA predicted 3 nonstructural proteins (NS1 [576 codons], NS2 [286 codons], and NS3 [213 codons]). The VP gene cassette contained two VP open reading frames (ORFs), of 597 (ORF-A) and 268 (ORF-B) codons. The VP2 sequence was shown by N-terminal Edman degradation and mass spectrometry to correspond with ORF-A. Mass spectrometry, sequencing, and Western blotting of baculovirus-expressed VPs versus native structural proteins demonstrated that the VP1 structural protein was generated by joining ORF-A and -B via splicing (splice II), eliminating the N terminus of VP2. This splice resulted in a nested set of VP1 (816 codons), VP3 (467 codons), and VP4 (429 codons) structural proteins. In contrast, the two splices within ORF-B (Ia and Ib) removed the donor site of intron II and resulted in VP2, VP3, and VP4 expression. ORF-B may also code for several nonstructural proteins, of 268, 233, and 158 codons. The small ORF-B contains the coding sequence for a phospholipase A2 motif found in VP1, which was shown previously to be critical for cellular uptake of the virus. These splicing features are unique among parvoviruses and define a new genus of ambisense densoviruses. PMID:21775445

Unique BK virus non-coding control region (NCCR) variants in hematopoietic stem cell transplant recipients with and without hemorrhagic cystitis.

PubMed

Carr, Michael J; McCormack, Grace P; Mutton, Ken J; Crowley, Brendan

2006-04-01

Hematopoietic stem cell transplant recipients frequently develop BK virus (BKV)-associated hemorrhagic cystitis, which coincides with BK viruria. However, the precise role of BKV in the etiology of hemorrhagic cystitis in hematopoietic stem cell transplant recipients remains unclear, since approximately 50% of all such adult transplant recipients excrete BKV, yet do not develop this clinical condition. In the present study, BKV were analyzed to determine if mutations in the non-coding control region (NCCR), and specific BKV sub-types defined by sequence analysis of major capsid protein VP1, were associated with development of hemorrhagic cystitis in hematopoietic stem cell transplant recipients. The regions encoding VP1 and NCCRs of BKV in urine samples collected from 15 hematopoietic stem cell transplant recipients with hemorrhagic cystitis and 20 without this illness were amplified and sequenced. Sequence variations in the NCCRs of BKV were identified in urine samples from those with and without hemorrhagic cystitis. Furthermore, five unique sequence variations within transcription factor binding sites in the canonical NCCR, O-P-Q-R-S, were identified, representing new BKV variants from a population of cloned quasi-species obtained from patients with and without hemorrhagic cystitis. Thirty-five BKV VP1 sequences were analyzed by phylogenetic analysis but no specific BKV sub-type was associated with hemorrhagic cystitis. Five previously unrecognized naturally occurring variants of the BKV are described which involve amplifications, deletions, and rearrangements of the archetypal BKV NCCRs in individuals with and without hemorrhagic cystitis. Architectural rearrangements in the NCCRs of BKV did not appear to be a prerequisite for development of hemorrhagic cystitis in hematopoietic stem cell transplant recipients. Copyright 2006 Wiley-Liss, Inc.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

An overview of new video coding tools under consideration for VP10: the successor to VP9

NASA Astrophysics Data System (ADS)

Mukherjee, Debargha; Su, Hui; Bankoski, James; Converse, Alex; Han, Jingning; Liu, Zoe; Xu, Yaowu

2015-09-01

Google started an opensource project, entitled the WebM Project, in 2010 to develop royaltyfree video codecs for the web. The present generation codec developed in the WebM project called VP9 was finalized in mid2013 and is currently being served extensively by YouTube, resulting in billions of views per day. Even though adoption of VP9 outside Google is still in its infancy, the WebM project has already embarked on an ambitious project to develop a next edition codec VP10 that achieves at least a generational bitrate reduction over the current generation codec VP9. Although the project is still in early stages, a set of new experimental coding tools have already been added to baseline VP9 to achieve modest coding gains over a large enough test set. This paper provides a technical overview of these coding tools.

Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs.

PubMed

Lohse, Louise; Jackson, Terry; Bøtner, Anette; Belsham, Graham J

2012-05-24

The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus.In the present study we compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region.Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected with the O1K/O-UKG chimera or the field strain (O-UKG/34/2001) developed fulminant disease. Furthermore, 3 of 4 in-contact pigs exposed to the O1K/O-UKG virus died in the acute phase of infection, likely from myocardial infection. However, in the group exposed to the O1K/A-TUR chimeric virus, only 1 pig showed symptoms of disease within the time frame of the experiment (10 days). All pigs that developed clinical disease showed a high level of viral RNA in serum and infected pigs that survived the acute phase of infection developed a serotype specific antibody response. It is concluded that the capsid coding sequences are determinants of FMDV pathogenicity in pigs.

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

Intrinsically-disordered N-termini in human parechovirus 1 capsid proteins bind encapsidated RNA.

PubMed

Shakeel, Shabih; Evans, James D; Hazelbaker, Mark; Kao, C Cheng; Vaughan, Robert C; Butcher, Sarah J

2018-04-11

Human parechoviruses (HPeV) are picornaviruses with a highly-ordered RNA genome contained within icosahedrally-symmetric capsids. Ordered RNA structures have recently been shown to interact with capsid proteins VP1 and VP3 and facilitate virus assembly in HPeV1. Using an assay that combines reversible cross-linking, RNA affinity purification and peptide mass fingerprinting (RCAP), we mapped the RNA-interacting regions of the capsid proteins from the whole HPeV1 virion in solution. The intrinsically-disordered N-termini of capsid proteins VP1 and VP3, and unexpectedly, VP0, were identified to interact with RNA. Comparing these results to those obtained using recombinantly-expressed VP0 and VP1 confirmed the virion binding regions, and revealed unique RNA binding regions in the isolated VP0 not previously observed in the crystal structure of HPeV1. We used RNA fluorescence anisotropy to confirm the RNA-binding competency of each of the capsid proteins' N-termini. These findings suggests that dynamic interactions between the viral RNA and the capsid proteins modulate virus assembly, and suggest a novel role for VP0.

Comparative assessment of H.265/MPEG-HEVC, VP9, and H.264/MPEG-AVC encoders for low-delay video applications

NASA Astrophysics Data System (ADS)

Grois, Dan; Marpe, Detlev; Nguyen, Tung; Hadar, Ofer

2014-09-01

The popularity of low-delay video applications dramatically increased over the last years due to a rising demand for realtime video content (such as video conferencing or video surveillance), and also due to the increasing availability of relatively inexpensive heterogeneous devices (such as smartphones and tablets). To this end, this work presents a comparative assessment of the two latest video coding standards: H.265/MPEG-HEVC (High-Efficiency Video Coding), H.264/MPEG-AVC (Advanced Video Coding), and also of the VP9 proprietary video coding scheme. For evaluating H.264/MPEG-AVC, an open-source x264 encoder was selected, which has a multi-pass encoding mode, similarly to VP9. According to experimental results, which were obtained by using similar low-delay configurations for all three examined representative encoders, it was observed that H.265/MPEG-HEVC provides significant average bit-rate savings of 32.5%, and 40.8%, relative to VP9 and x264 for the 1-pass encoding, and average bit-rate savings of 32.6%, and 42.2% for the 2-pass encoding, respectively. On the other hand, compared to the x264 encoder, typical low-delay encoding times of the VP9 encoder, are about 2,000 times higher for the 1-pass encoding, and are about 400 times higher for the 2-pass encoding.

Molecular docking and simulation studies of 3-(1-chloropiperidin-4-yl)-6-fluoro benzisoxazole 2 against VP26 and VP28 proteins of white spot syndrome virus.

PubMed

Sudharsana, S; Rajashekar Reddy, C B; Dinesh, S; Rajasekhara Reddy, S; Mohanapriya, A; Itami, T; Sudhakaran, R

2016-10-01

White spot syndrome virus (WSSV), an aquatic virus infecting shrimps and other crustaceans, is widely distributed in Asian subcontinents including India. The infection has led to a serious economic loss in shrimp farming. The WSSV genome is approximately 300 kb and codes for several proteins mediating the infection. The envelope proteins VP26 and VP28 play a major role in infection process and also in the interaction with the host cells. A comprehensive study on the viral proteins leading to the development of safe and potent antiviral therapeutic is of adverse need. The novel synthesized compound 3-(1-chloropiperidin-4-yl)-6-fluoro benzisoxazole 2 is proved to have potent antiviral activity against WSSV. The compound antiviral activity is validated in freshwater crabs (Paratelphusa hydrodomous). An in silico molecular docking and simulation analysis of the envelope proteins VP26 and VP28 with the ligand 3-(1-chloropiperidin-4-yl)-6-fluoro benzisoxazole 2 are carried out. The docking analysis reveals that the polar amino acids in the pore region of the envelope proteins were involved in the ligand binding. The influence of the ligand binding on the proteins is validated by the molecular dynamics and simulation study. These in silico approaches together demonstrate the ligand's efficiency in preventing the trimers from exhibiting their physiological function. © 2016 John Wiley & Sons Ltd.

Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

PubMed

Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

2017-02-01

Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].

PubMed

Lin, Xiaojuan; Liu, Yao; Wang, Suting; Zhang Xiao; Song, Lizhi; Tao, Zexin; Ji, Feng; Xiong, Ping; Xu, Aiqiang

2015-09-01

To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.

Molecular typing of enteroviruses associated with viral meningitis in Cyprus, 2000-2002.

PubMed

Richter, Jan; Koptides, Dana; Tryfonos, Christina; Christodoulou, Christina

2006-08-01

Human enteroviruses are responsible for a wide spectrum of clinical diseases affecting many different organ systems. Although infection is usually asymptomatic, infections of the central nervous system manifested as meningitis or encephalitis can pose a serious public health problem, especially during outbreaks. In this study, samples from 218 patients diagnosed with enteroviral meningitis between January 2000 and December 2002 were analysed in order to assess the epidemiology of human enteroviruses as a cause of viral meningitis in Cyprus. A new typing strategy, based on partial sequencing of the 5' non-coding region (5'NCR), prediction of type, and selection of type-specific primers for sensitive VP1 PCR amplification, was developed. As clustering in the 5'NCR was concordant with clustering in the VP1 region, quick and reliable typing by VP1 sequencing was achieved without virus isolation in cell culture. The most frequent enterovirus serotypes identified were Human echovirus 30 (55.5%), Human echovirus 13 (15.1%), Human echovirus 6 (13.8%) and Human echovirus 9 (8.3%). Human coxsackieviruses B2, B1 and B5, Human echovirus 4, Human enterovirus 71 and Human coxsackievirus A6 represented rather rare serotypes. This is the first molecular epidemiological study of enterovirus meningitis in Cyprus. Serotype distribution corresponded basically with observations in other European countries, suggesting the spread of enteroviruses by tourism.

Retrospective Characterization of a Vaccine-Derived Poliovirus Type 1 Isolate from Sewage in Greece▿

PubMed Central

Dedepsidis, Evaggelos; Kyriakopoulou, Zaharoula; Pliaka, Vaia; Kottaridi, Christine; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Komiotis, Dimitri; Markoulatos, Panayotis

2007-01-01

Retrospective molecular and phenotypic characterization of a vaccine-derived poliovirus (VDPV) type 1 isolate (7/b/97) isolated from sewage in Athens, Greece, in 1997 is reported. VP1 sequencing of this isolate revealed 1.87% divergence from the VP1 region of reference strain Sabin 1, while further genomic characterization of isolate 7/b/97 revealed a recombination event in the nonstructural part of the genome between a vaccine strain and a nonvaccine strain probably belonging to Enterovirus species C. Amino acid substitutions commonly found in previous studies were identified in the capsid coding region of the isolate, while most of the attenuation and temperature sensitivity determinants were reverted. The ultimate source of isolate 7/b/97 is unknown. The recovery of such a highly divergent derivative of a vaccine strain emphasizes the need for urgent implementation of environmental surveillance as a supportive procedure in the polio surveillance system even in countries with high rates of OPV coverage in order to prevent cases or even outbreaks of poliomyelitis that otherwise would be inevitable. PMID:17827314

Retrospective characterization of a vaccine-derived poliovirus type 1 isolate from sewage in Greece.

PubMed

Dedepsidis, Evaggelos; Kyriakopoulou, Zaharoula; Pliaka, Vaia; Kottaridi, Christine; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Komiotis, Dimitri; Markoulatos, Panayotis

2007-11-01

Retrospective molecular and phenotypic characterization of a vaccine-derived poliovirus (VDPV) type 1 isolate (7/b/97) isolated from sewage in Athens, Greece, in 1997 is reported. VP1 sequencing of this isolate revealed 1.87% divergence from the VP1 region of reference strain Sabin 1, while further genomic characterization of isolate 7/b/97 revealed a recombination event in the nonstructural part of the genome between a vaccine strain and a nonvaccine strain probably belonging to Enterovirus species C. Amino acid substitutions commonly found in previous studies were identified in the capsid coding region of the isolate, while most of the attenuation and temperature sensitivity determinants were reverted. The ultimate source of isolate 7/b/97 is unknown. The recovery of such a highly divergent derivative of a vaccine strain emphasizes the need for urgent implementation of environmental surveillance as a supportive procedure in the polio surveillance system even in countries with high rates of OPV coverage in order to prevent cases or even outbreaks of poliomyelitis that otherwise would be inevitable.

Molecular characterization of wild-type polioviruses isolated in Greece during the 1996 outbreak in Albania.

PubMed

Kyriakopoulou, Zaharoula; Kottaridi, Christine; Dedepsidis, Evaggelos; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Markoulatos, Panayotis

2006-03-01

During the present study three type 1 poliovirus strains isolated in Greece during the 1996 poliomyelitis outbreak in Albania were retrospectively investigated and determination of their relationship with other epidemic strains isolated in Albania or elsewhere during previous epidemics was attempted. SimPlot analysis revealed that the three Greek strains are the result of a recombination event in the VP2 coding region.

Characterization of the DNA binding properties of polyomavirus capsid protein

NASA Technical Reports Server (NTRS)

Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

Joint innversion of seismic and magnetotelluric data in the Parkfield Region of California using the normalized cross-gradient constraint

USGS Publications Warehouse

Bennington, Ninfa L.; Zhang, Haijiang; Thurber, Cliff; Bedrosian, Paul A.

2015-01-01

We present jointly inverted models of P-wave velocity (Vp) and electrical resistivity for a two-dimensional profile centered on the San Andreas Fault Observatory at Depth (SAFOD). Significant structural similarity between main features of the separately inverted Vp and resistivity models is exploited by carrying out a joint inversion of the two datasets using the normalized cross-gradient constraint. This constraint favors structurally similar Vp and resistivity images that adequately fit the seismic and magnetotelluric (MT) datasets. The new inversion code, tomoDDMT, merges the seismic inversion code tomoDD and the forward modeling and sensitivity kernel subroutines of the MT inversion code OCCAM2DMT. TomoDDMT is tested on a synthetic dataset and demonstrates the code’s ability to more accurately resolve features of the input synthetic structure relative to the separately inverted resistivity and velocity models. Using tomoDDMT, we are able to resolve a number of key issues raised during drilling at SAFOD. We are able to infer the distribution of several geologic units including the Salinian granitoids, the Great Valley sequence, and the Franciscan Formation. The distribution and transport of fluids at both shallow and great depths is also examined. Low values of velocity/resistivity attributed to a feature known as the Eastern Conductor (EC) can be explained in two ways: the EC is a brine-filled, high porosity region, or this region is composed largely of clay-rich shales of the Franciscan. The Eastern Wall, which lies immediately adjacent to the EC, is unlikely to be a fluid pathway into the San Andreas Fault’s seismogenic zone due to its observed higher resistivity and velocity values.

Determining the Epitope Dominance on the Capsid of a Serotype SAT2 Foot-and-Mouth Disease Virus by Mutational Analyses

PubMed Central

Opperman, Pamela A.; Rotherham, Lia S.; Esterhuysen, Jan; Charleston, Bryan; Juleff, Nicholas; Capozzo, Alejandra V.; Theron, Jacques

2014-01-01

ABSTRACT Monoclonal-antibody (MAb)-resistant mutants were used to map antigenic sites on foot-and-mouth disease virus (FMDV), which resulted in the identification of neutralizing epitopes in the flexible βG-βH loop in VP1. For FMDV SAT2 viruses, studies have shown that at least two antigenic sites exist. By use of an infectious SAT2 cDNA clone, 10 structurally exposed and highly variable loops were identified as putative antigenic sites on the VP1, VP2, and VP3 capsid proteins of SAT2/Zimbabwe (ZIM)/7/83 (topotype II) and replaced with the corresponding regions of SAT2/Kruger National Park (KNP)/19/89 (topotype I). Virus neutralization assays using convalescent-phase antisera raised against the parental virus, SAT2/ZIM/7/83, indicated that the mutant virus containing the TQQS-to-ETPV mutation in the N-terminal part of the βG-βH loop of VP1 showed not only a significant increase in the neutralization titer but also an increase in the index of avidity to the convalescent-phase antisera. Furthermore, antigenic profiling of the epitope-replaced and parental viruses with nonneutralizing SAT2-specific MAbs led to the identification of two nonneutralizing antigenic regions. Both regions were mapped to incorporate residues 71 to 72 of VP2 as the major contact point. The binding footprint of one of the antigenic regions encompasses residues 71 to 72 and 133 to 134 of VP2 and residues 48 to 50 of VP1, and the second antigenic region encompasses residues 71 to 72 and 133 to 134 of VP2 and residues 84 to 86 and 109 to 11 of VP1. This is the first time that antigenic regions encompassing residues 71 to 72 of VP2 have been identified on the capsid of a SAT2 FMDV. IMPORTANCE Monoclonal-antibody-resistant mutants have traditionally been used to map antigenic sites on foot-and-mouth disease virus (FMDV). However, for SAT2-type viruses, which are responsible for most of the FMD outbreaks in Africa and are the most varied of all seven serotypes, only two antigenic sites have been identified. We have followed a unique approach using an infectious SAT2 cDNA genome-length clone. Ten structurally surface-exposed, highly varied loops were identified as putative antigenic sites on the VP1, VP2, and VP3 capsid proteins of the SAT2/ZIM/7/83 virus. These regions were replaced with the corresponding regions of an antigenically disparate virus, SAT2/KNP/19/89. Antigenic profiling of the epitope-replaced and parental viruses with SAT2-specific MAbs led to the identification of two unique antibody-binding footprints on the SAT2 capsid. In this report, evidence for the structural engineering of antigenic sites of a SAT2 capsid to broaden cross-reactivity with antisera is provided. PMID:24829347

Genome sequencing and analysis of a highly virulent Vibrio parahaemolyticus strain isolated from the marine environment

NASA Astrophysics Data System (ADS)

Parks, M. C.; Moreno, E.

2016-02-01

Vibrio parahaemolyticus [Vp] is a Gram-negative bacterium and a natural inhabitant of coastal marine ecosystems worldwide. Vp is also a coincidental pathogen of humans. Virulent strains are commonly identified by the presence of the thermostable direct (tdh) or tdh-related (trh) hemolysin genes. However, virulence is multifaceted and many clinical Vp isolates do not carry tdh or trh. In this study, we sequenced and assembled the draft genome of a tdh- and trh-negative environmental isolate (805) shown previously to be highly virulent in zebrafish. To investigate potential mechanisms of virulence, we compared 805 to the clinical V. parahaemolyticus type strain (RIMD2210633). Pairwise comparison revealed the presence of multiple genomic regions including an IncF conjugative pilus (1.3 Kb) and a colicin V plasmid (1.49 Kb). These features are homologous to genomic regions present in clinical V. vulnificus and V. cholerae strains. Genome comparison also revealed the presence of five toxin-antitoxin systems. Isolate 805 likely attained these new features through the lateral acquisition of mobile genomic material - a hypothesis supported by the aberrant GC content of these regions. Colicin V plasmids are a diverse group of IncF plasmids found in invasive bacterial strains. Similarly, an abundance of toxin-antitoxin systems have been linked to virulence in Gram-negative bacteria. Current efforts are focused on characterizing 142 coding features present in 805 but absent from the type strain.

A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

PubMed

Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

2010-02-01

A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

Molecular Cloning, Expression Analysis, and Functional Characterization of the H(+)-Pyrophosphatase from Jatropha curcas.

PubMed

Yang, Yumei; Luo, Zhu; Zhang, Mengru; Liu, Chang; Gong, Ming; Zou, Zhurong

2016-04-01

H(+)-pyrophosphatase (H(+)-PPase) is a primary pyrophosphate (PPi)-energized proton pump to generate electrochemical H(+) gradient for ATP production and substance translocations across membranes. It plays an important role in stress adaptation that was intensively substantiated by numerous transgenic plants overexpressing H(+)-PPases yet devoid of any correlated studies pointing to the elite energy plant, Jatropha curcas. Herein, we cloned the full length of J. curcas H(+)-PPase (JcVP1) complementary DNA (cDNA) by reverse transcription PCR, based on the assembled sequence of its ESTs highly matched to Hevea brasiliensis H(+)-PPase. This gene encodes a polypeptide of 765 amino acids that was predicted as a K(+)-dependent H(+)-PPase evolutionarily closest to those of other Euphorbiaceae plants. Many cis-regulatory elements relevant to environmental stresses, molecular signals, or tissue-specificity were identified by promoter prediction within the 1.5-kb region upstream of JcVP1 coding sequence. Meanwhile, the responses of JcVP1 expression to several common abiotic stresses (salt, drought, heat, cold) were characterized with a considerable accordance with the inherent stress tolerance of J. curcas. Moreover, we found that the heterologous expression of JcVP1 could significantly improve the salt tolerance in both recombinant Escherichia coli and Saccharomyces cerevisiae, and this effect could be further fortified in yeast by N-terminal addition of a vacuole-targeting signal peptide from the H(+)-PPase of Trypanosoma cruzi.

Lloviu virus VP24 and VP35 proteins function as innate immune antagonists in human and bat cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feagins, Alicia R.; Basler, Christopher F., E-mail: chris.basler@mssm.edu

Lloviu virus (LLOV) is a new member of the filovirus family that also includes Ebola virus (EBOV) and Marburg virus (MARV). LLOV has not been cultured; however, its genomic RNA sequence indicates the coding capacity to produce homologs of the EBOV and MARV VP24, VP35, and VP40 proteins. EBOV and MARV VP35 proteins inhibit interferon (IFN)-alpha/beta production and EBOV VP35 blocks activation of the antiviral kinase PKR. The EBOV VP24 and MARV VP40 proteins inhibit IFN signaling, albeit by different mechanisms. Here we demonstrate that LLOV VP35 suppresses Sendai virus induced IFN regulatory factor 3 (IRF3) phosphorylation, IFN-α/β production, andmore » PKR phosphorylation. Additionally, LLOV VP24 blocks tyrosine phosphorylated STAT1 binding to karyopherin alpha 5 (KPNA5), STAT1 nuclear accumulation, and IFN-induced gene expression. LLOV VP40 lacks detectable IFN antagonist function. These activities parallel EBOV IFN inhibitory functions. EBOV and LLOV VP35 and VP24 proteins also inhibit IFN responses in bat cells. These data suggest that LLOV infection will block innate immune responses in a manner similar to EBOV. - Highlights: • Lloviu virus (LLOV) is a new member of the filovirus family. • LLOV VP35 blocks IRF3 phosphorylation, IFN-α/β production and PKR phosphorylation. • LLOV VP24 inhibits IFN responses by targeting phospho-STAT1 KPNA interaction. • Infection by LLOV may block innate immune responses in a manner similar to EBOV.« less

Cleavage sites within the poliovirus capsid protein precursors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, G.R.; Anderson, C.W.; Dorner, A.J.

1982-01-01

Partial amino-terminal sequence analysis was performed on radiolabeled poliovirus capsid proteins VP1, VP2, and VP3. A computer-assisted comparison of the amino acid sequences obtained with that predicted by the nucleotide sequence of the poliovirus genome allows assignment of the amino terminus of each capsid protein to a unique position within the virus polyprotein. Sequence analysis of trypsin-digested VP4, which has a blocked amino terminus, demonstrates that VP4 is encoded at or very near to the amino terminus of the polyprotein. The gene order of the capsid proteins is VP4-VP2-VP3-VP1. Cleavage of VP0 to VP4 and VP2 is shown to occurmore » between asparagine and serine, whereas the cleavages that separate VP2/VP3 and VP3/VP1 occur between glutamine and glycine residues. This finding supports the hypothesis that the cleavage of VP0, which occurs during virion morphogenesis, is distinct from the cleavages that separate functional regions of the polyprotein.« less

Raman spectroscopy insight into Norovirus encapsulation in Bombyx mori cypovirus cubic microcrystals.

PubMed

Mori, Hajime; Oda, Naoki; Abe, Satoshi; Ueno, Takafumi; Zhu, Wenliang; Pernstich, Chris; Pezzotti, Giuseppe

2018-05-16

Protein and amino acid structures of Norovirus-like particles (NoVLP) have been investigated by Raman spectroscopy before and after encapsulation into Bombyx mori cypovirus (BmCPV) cubic microcrystals, which are usually referred to as cubes or polyhedra. Two different types of tag were used in co-expression, namely VP3 and H1 tags. VP3 tag is derived from a capsid protein VP4 from BmCPV and H1 tag is N-terminal α-helix of BmCPV polyhedrin, respectively. A major capsid protein VP1 of NoVLP G11.4 was fused with H1 or VP3 tags, and then encapsulated into BmCPV polyhedra. Analyses of the spectroscopic data permitted the assignment of conformation-sensitive Raman bands to viral amino acid constituents and the observation of structural similarities or differences between differently tagged samples. Three separate Raman zones were attentioned, namely, the ring-mode structure region (1000-1500 cm -1 ), the CO and CC double-bond region and its surroundings (1500-1750 cm -1 ), and the high-frequency CH stretching region (2800-3100 cm -1 ). Structural fingerprints could be found in specific spectral zones for differently co-expressed samples. One clear characteristic of the H1-tagged VP1 polyhedra was the increase in tyrosine fraction, which played a critical role in binding neighboring strands through its unpaired negatively charged COO - sites. This feature could consistently be detected in different regions, but it was best represented by Raman signals associated with negatively charged COO - sites and H1 helices in the double-bond region. Such peculiar chemical features were revealed by two relatively broad bands at 1570 and 1630 cm -1 , which were assigned to COO - anti-symmetric stretching and amide I in 3 10 -helix extensions to α-helices at N-termini, respectively. These specific features did not display in the spectrum of the VP3-tagged VP1 polyhedra. Concurrently, a strong reduction of CH bond Raman signal was noticed in the high frequency stretching region of the Raman spectrum upon H1-tagged VP1 polyhedra. The Raman activity most strikingly also represented fingerprints of tagged NoVLP VP1 after its encapsulation into BmCPV polyhedra, opening thus the possibility to in situ advanced experiments in the fields of drug delivery and regenerative medicine. Copyright © 2018 Elsevier B.V. All rights reserved.

Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification.

PubMed

Krasota, Alexandr; Loginovskih, Natalia; Ivanova, Olga; Lipskaya, Galina

2016-01-06

Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF) from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1%) patients compared with 75 (47.2%), 53 (33.3%) and 31 (19.5%) achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14), E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71) in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF.

Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification

PubMed Central

Krasota, Alexandr; Loginovskih, Natalia; Ivanova, Olga; Lipskaya, Galina

2016-01-01

Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF) from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1%) patients compared with 75 (47.2%), 53 (33.3%) and 31 (19.5%) achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14), E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71) in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF. PMID:26751470

Effects of Human Parvovirus B19 and Bocavirus VP1 Unique Region on Tight Junction of Human Airway Epithelial A549 Cells

PubMed Central

Chiu, Chun-Ching; Shi, Ya-Fang; Yang, Jiann-Jou; Hsiao, Yuan-Chao; Tzang, Bor-Show; Hsu, Tsai-Ching

2014-01-01

As is widely recognized, human parvovirus B19 (B19) and human bocavirus (HBoV) are important human pathogens. Obviously, both VP1 unique region (VP1u) of B19 and HBoV exhibit the secreted phospholipase A2 (sPLA2)-like enzymatic activity and are recognized to participate in the pathogenesis of lower respiratory tract illnesses. However, exactly how, both VP1u from B19 and HBoV affect tight junction has seldom been addressed. Therefore, this study investigates how B19-VP1u and HBoV-VP1u may affect the tight junction of the airway epithelial A549 cells by examining phospholipase A2 activity and transepithelial electrical resistance (TEER) as well as performing immunoblotting analyses. Experimental results indicate that TEER is more significantly decreased in A549 cells by treatment with TNF-α (10 ng), two dosages of B19-VP1u and BoV-VP1u (400 ng and 4000 ng) or bee venom PLA2 (10 ng) than that of the control. Accordingly, more significantly increased claudin-1 and decreased occludin are detected in A549 cells by treatment with TNF-α or both dosages of HBoV-VP1u than that of the control. Additionally, more significantly decreased Na+/K+ ATPase is observed in A549 cells by treatment with TNF-α, high dosage of B19-VP1u or both dosages of BoV-VP1u than that of the control. Above findings suggest that HBoV-VP1u rather than B19 VP1u likely plays more important roles in the disruption of tight junction in the airway tract. Meanwhile, this discrepancy appears not to be associated with the secreted phospholipase A2 (sPLA2)-like enzymatic activity. PMID:25268969

Expression, purification and crystallization of two major envelope proteins from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Xuhua; Hew, Choy Leong, E-mail: dbshewcl@nus.edu.sg

2007-07-01

The crystallization of the N-terminal transmembrane region-truncated VP26 and VP28 of white spot syndrome virus is described. White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapour-diffusion method. Crystals ofmore » SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 M sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 Å resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 Å. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 Å, and diffracts to 2.0 Å resolution.« less

Modeling and Analysis of Wrinkled Membranes: An Overview

NASA Technical Reports Server (NTRS)

Yang, B.; Ding, H.; Lou, M.; Fang, H.; Broduer, Steve (Technical Monitor)

2001-01-01

Thin-film membranes are basic elements of a variety of space inflatable/deployable structures. Wrinkling degrades the performance and reliability of these membrane structures, and hence has been a topic of continued interest. Wrinkling analysis of membranes for general geometry and arbitrary boundary conditions is quite challenging. The objective of this presentation is two-fold. Firstly, the existing models of wrinkled membranes and related numerical solution methods are reviewed. The important issues to be discussed are the capability of a membrane model to characterize taut, wrinkled and slack states of membranes in a consistent and physically reasonable manner; the ability of a wrinkling analysis method to predict the formation and growth of wrinkled regions, and to determine out-of-plane deformation and wrinkled waves; the convergence of a numerical solution method for wrinkling analysis; and the compatibility of a wrinkling analysis with general-purpose finite element codes. According to this review, several opening issues in modeling and analysis of wrinkled membranes that are to be addressed in future research are summarized, The second objective of this presentation is to discuss a newly developed membrane model of two viable parameters (2-VP model) and associated parametric finite element method (PFEM) for wrinkling analysis are introduced. The innovations and advantages of the proposed membrane model and PFEM-based wrinkling analysis are: (1) Via a unified stress-strain relation; the 2-VP model treat the taut, wrinkled, and slack states of membranes consistently; (2) The PFEM-based wrinkling analysis has guaranteed convergence; (3) The 2-VP model along with PFEM is capable of predicting membrane out-of-plane deformations; and (4) The PFEM can be integrated into any existing finite element code. Preliminary numerical examples are also included in this presentation to demonstrate the 2-VP model and PFEM-based wrinkling analysis approach.

Interactions between the two surface proteins of rotavirus may alter the receptor-binding specificity of the virus.

PubMed Central

Méndez, E; Arias, C F; López, S

1996-01-01

The infection of target cells by most animal rotavirus strains requires the presence of sialic acids (SAs) on the cell surface. We recently isolated variants from simian rotavirus RRV whose infectivity is no longer dependent on SAs and showed that the mutant phenotype segregates with the gene coding for VP4, one of the two surface proteins of rotaviruses (the other one being VP7). The nucleotide sequence of the VP4 gene of four independently isolated variants showed three amino acid changes, at positions 37 (Leu to Pro), 187 (Lys to Arg), and 267 (Tyr to Cys), in all mutant VP4 proteins compared with RRV VP4. The characterization of revertant viruses from two independent mutants showed that the arginine residue at position 187 changed back to lysine, indicating that this amino acid is involved in the determination of the mutant phenotype. Surprisingly, sequence analysis of reassortant virus DS1XRRV, which depends on SAs to infect the cell, showed that its VP4 gene is identical to the VP4 gene of the variants. Since the only difference between DS1XRRV and the RRV variants is the parental origin of the VP7 gene (human rotavirus DS1 in the reassortant), these findings suggest that the receptor-binding specificity of rotaviruses, via VP4, may be influenced by the associated VP7 protein. PMID:8551583

A core functional region of the RFP1 promoter from Chinese wild grapevine is activated by powdery mildew pathogen and heat stress.

PubMed

Yu, Yihe; Xu, Weirong; Wang, Jie; Wang, Lei; Yao, Wenkong; Xu, Yan; Ding, Jiahua; Wang, Yuejin

2013-01-01

RING-finger proteins (RFP) function as ubiquitin ligases and play key roles in plant responses to biotic and abiotic stresses. However, little information is available on the regulation of RFP expression. Here, we isolate and characterize the RFP promoter sequence from the disease-resistant Chinese wild grape Vitis pseudoreticulata accession Baihe-35-1. Promoter-GUS fusion assays revealed that defense signaling molecules, powdery mildew infection, and heat stress induce VpRFP1 promoter activity. By contrast, the RFP1 promoter isolated from Vitis vinifera was only slightly induced by pathogen infection and heat treatment. By promoter deletion analysis, we found that the -148 bp region of the VpRFP1 promoter was the core functional promoter region. We also found that, in Arabidopsis, VpRFP1 expressed under its own promoter activated defense-related gene expression and improved disease resistance, but the same construct using the VvRFP1 promoter slightly improve disease resistance. Our results demonstrated that the -148 bp region of the VpRFP1 promoter plays a key role in response to pathogen and heat stress, and suggested that expression differences between VpRFP1 and VvRFP1 may be key for the differing disease resistance phenotypes of the two Vitis genotypes.

Differential expression of VGLUT1 or VGLUT2 in the trigeminothalamic or trigeminocerebellar projection neurons in the rat.

PubMed

Ge, Shun-Nan; Li, Zhi-Hong; Tang, Jun; Ma, Yunfei; Hioki, Hiroyuki; Zhang, Ting; Lu, Ya-Cheng; Zhang, Fu-Xing; Mizuno, Noboru; Kaneko, Takeshi; Liu, Ying-Ying; Lung, Mandy Siu Yu; Gao, Guo-Dong; Li, Jin-Lian

2014-01-01

The vesicular glutamate transporters, VGLUT1 and VGLUT2, reportedly display complementary distribution in the rat brain. However, co-expression of them in single neurons has been reported in some brain areas. We previously found co-expression of VGLUT1 and VGLUT2 mRNAs in a number of single neurons in the principal sensory trigeminal nucleus (Vp) of the adult rat; the majority of these neurons sent their axons to the thalamic regions around the posteromedial ventral nucleus (VPM) and the posterior nuclei (Po). It is well known that trigeminothalamic (T-T) projection fibers arise not only from the Vp but also from the spinal trigeminal nucleus (Vsp), and that trigeminocerebellar (T-C) projection fibers take their origins from both of the Vp and Vsp. Thus, in the present study, we examined the expression of VGLUT1 and VGLUT2 in Vp and Vsp neurons that sent their axons to the VPM/Po regions or the cortical regions of the cerebellum. For this purpose, we combined fluorescence in situ hybridization (FISH) histochemistry with retrograde tract-tracing; immunofluorescence histochemistry was also combined with anterograde tract-tracing. The results indicate that glutamatergic Vsp neurons sending their axons to the cerebellar cortical regions mainly express VGLUT1, whereas glutamatergic Vsp neurons sending their axons to the thalamic regions express VGLUT2. The present data, in combination with those of our previous study, indicate that glutamatergic Vp neurons projecting to the cerebellar cortical regions express mainly VGLUT1, whereas the majority of glutamatergic Vp neurons projecting to the thalamus co-express VGLUT1 and VGLUT2.

Synthetic transcripts of double-stranded Birnavirus genome are infectious.

PubMed Central

Mundt, E; Vakharia, V N

1996-01-01

We have developed a system for generation of infectious bursal disease virus (IBDV), a segmented double-stranded RNA virus of the Birnaviridae family, with the use of synthetic transcripts derived from cloned cDNA. Independent full-length cDNA clones were constructed that contained the entire coding and noncoding regions of RNA segments A and B of two distinguishable IBDV strains of serotype I. Segment A encodes all of the structural (VP2, VP4, and VP3) and nonstructural (VP5) proteins, whereas segment B encodes the RNA-dependent RNA polymerase (VP1). Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated infectious virus as early as 36 hr after transfection. The infectivity and specificity of the recovered chimeric virus was ascertained by the appearance of cytopathic effect in chicken embryo cells, by immunofluorescence staining of infected Vero cells with rabbit anti-IBDV serum, and by nucleotide sequence analysis of the recovered virus, respectively. In addition, transfectant viruses containing genetically tagged sequences in either segment A or segment B of IBDV were generated to confirm the feasibility of this system. The development of a reverse genetics system for double-stranded RNA viruses will greatly facilitate studies of the regulation of viral gene expression, pathogenesis, and design of a new generation of live vaccines. Images Fig. 2 Fig. 3 Fig. 4 PMID:8855321

Bioinformatics analysis and genetic diversity of the poliovirus.

PubMed

Liu, Yanhan; Ma, Tengfei; Liu, Jianzhu; Zhao, Xiaona; Cheng, Ziqiang; Guo, Huijun; Wang, Shujing; Xu, Ruixue

2014-12-01

Poliomyelitis, a disease which can manifest as muscle paralysis, is caused by the poliovirus, which is a human enterovirus and member of the family Picornaviridae that usually transmits by the faecal-oral route. The viruses of the OPV (oral poliovirus attenuated-live vaccine) strains can mutate in the human intestine during replication and some of these mutations can lead to the recovery of serious neurovirulence. Informatics research of the poliovirus genome can be used to explain further the characteristics of this virus. In this study, sequences from 100 poliovirus isolates were acquired from GenBank. To determine the evolutionary relationship between the strains, we compared and analysed the sequences of the complete poliovirus genome and the VP1 region. The reconstructed phylogenetic trees for the complete sequences and the VP1 sequences were both divided into two branches, indicating that the genetic relationships of the whole poliovirus genome and the VP1 sequences are very similar. This branching indicates that the virulence and pathogenicity of poliomyelitis may be associated with the VP1 region. Sequence alignment of the VP1 region revealed numerous mutation sites in which mutation rates of >30 % were detected. In a group of strains recorded in the USA, mutation sites and mutation types were the same and this may be associated with their distribution in the evolutionary tree and their genetic relationship. In conclusion, the genetic evolutionary relationships of poliovirus isolate sequences are determined to a great extent by the VP1 protein, and poliovirus strains located on the same branch of the phylogenetic tree contain the same mutation spots and mutation types. Hence, the genetic characteristics of the VP1 region in the poliovirus genome should be analysed to identify the transmission route of poliovirus and provide the basis of viral immunity development. © 2014 The Authors.

Autocatalytic Activity of the Ubiquitin-Specific Protease Domain of Herpes Simplex Virus 1 VP1-2▿†

PubMed Central

Bolstad, M.; Abaitua, F.; Crump, C. M.; O'Hare, P.

2011-01-01

The herpes simplex virus (HSV) tegument protein VP1-2 is essential for virus entry and assembly. VP1-2 also contains a highly conserved ubiquitin-specific protease (USP) domain within its N-terminal region. Despite conservation of the USP and the demonstration that it can act on artificial substrates such as polyubiquitin chains, identification of the relevance of the USP in vivo to levels or function of any substrate remains limited. Here we show that HSV VP1-2 USP can act on itself and is important for stability. VP1-2 N-terminal variants encompassing the core USP domain itself were not affected by mutation of the catalytic cysteine residue (C65). However, extending the N-terminal region resulted in protein species requiring USP activity for accumulation. In this context, C65A mutation resulted in a drastic reduction in protein levels which could be stabilized by proteosomal inhibition or by the presence of normal C65. The functional USP domain could increase abundance of unstable variants, indicating action at least in part, in trans. Interestingly, full-length variants containing the inactive USP, although unstable when expressed in isolation, were stabilized by virus infection. The catalytically inactive VP1-2 retained complementation activity of a VP1-2-negative virus. Furthermore, a recombinant virus expressing a C65A mutant VP1-2 exhibited little difference in single-step growth curves and the kinetics and abundance of VP1-2 or a number of test proteins. Despite the absence of a phenotype for these replication parameters, the USP activity of VP1-2 may be required for function, including its own stability, under certain circumstances. PMID:21715485

Formation of Covalently Modified Folding Intermediates of Simian Virus 40 Vp1 in Large T Antigen-Expressing Cells

PubMed Central

Watanabe, Marika; Phamduong, Ellen; Huang, Chu-Han; Itoh, Noriko; Bernal, Janie; Nakanishi, Akira; Rundell, Kathleen; Gjoerup, Ole

2013-01-01

The folding and pentamer assembly of the simian virus 40 (SV40) major capsid protein Vp1, which take place in the infected cytoplasm, have been shown to progress through disulfide-bonded Vp1 folding intermediates. In this report, we further demonstrate the existence of another category of Vp1 folding or assembly intermediates: the nonreducible, covalently modified mdVp1s. These species were present in COS-7 cells that expressed a recombinant SV40 Vp1, Vp1ΔC, through plasmid transfection. The mdVp1s persisted under cell and lysate treatment and SDS-PAGE conditions that are expected to have suppressed the formation of artifactual disulfide cross-links. As shown through a pulse-chase analysis, the mdVp1s were derived from the newly synthesized Vp1ΔC in the same time frame as Vp1's folding and oligomerization. The apparent covalent modifications occurred in the cytoplasm within the core region of Vp1 and depended on the coexpression of the SV40 large T antigen (LT) in the cells. Analogous covalently modified species were found with the expression of recombinant polyomavirus Vp1s and human papillomavirus L1s in COS-7 cells. Furthermore, the mdVp1s formed multiprotein complexes with LT, Hsp70, and Hsp40, and a fraction of the largest mdVp1, md4, was disulfide linked to the unmodified Vp1ΔC. Both mdVp1 formation and most of the multiprotein complex formation were blocked by a Vp1 folding mutation, C87A-C254A. Our observations are consistent with a role for LT in facilitating the folding process of SV40 Vp1 by stimulating certain covalent modifications of Vp1 or by recruiting certain cellular proteins. PMID:23427157

Application of bluetongue Disabled Infectious Single Animal (DISA) vaccine for different serotypes by VP2 exchange or incorporation of chimeric VP2.

PubMed

Feenstra, Femke; Pap, Janny S; van Rijn, Piet A

2015-02-04

Bluetongue is a disease of ruminants caused by the bluetongue virus (BTV). Bluetongue outbreaks can be controlled by vaccination, however, currently available vaccines have several drawbacks. Further, there are at least 26 BTV serotypes, with low cross protection. A next-generation vaccine based on live-attenuated BTV without expression of non-structural proteins NS3/NS3a, named Disabled Infectious Single Animal (DISA) vaccine, was recently developed for serotype 8 by exchange of the serotype determining outer capsid protein VP2. DISA vaccines are replicating vaccines but do not cause detectable viremia, and induce serotype specific protection. Here, we exchanged VP2 of laboratory strain BTV1 for VP2 of European serotypes 2, 4, 8 and 9 using reverse genetics, without observing large effects on virus growth. Exchange of VP2 from serotype 16 and 25 was however not possible. Therefore, chimeric VP2 proteins of BTV1 containing possible immunogenic regions of these serotypes were studied. BTV1, expressing 1/16 chimeric VP2 proteins was functional in virus replication in vitro and contained neutralizing epitopes of both serotype 1 and 16. For serotype 25 this approach failed. We combined VP2 exchange with the NS3/NS3a negative phenotype in BTV1 as previously described for serotype 8 DISA vaccine. DISA vaccine with 1/16 chimeric VP2 containing amino acid region 249-398 of serotype 16 raised antibodies in sheep neutralizing both BTV1 and BTV16. This suggests that DISA vaccine could be protective for both parental serotypes present in chimeric VP2. We here demonstrate the application of the BT DISA vaccine platform for several serotypes and further extend the application for serotypes that are unsuccessful in single VP2 exchange. Copyright © 2014 Elsevier Ltd. All rights reserved.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Hepatitis A Virus Capsid Protein VP1 Has a Heterogeneous C Terminus

PubMed Central

Graff, Judith; Richards, Oliver C.; Swiderek, Kristine M.; Davis, Michael T.; Rusnak, Felicia; Harmon, Shirley A.; Jia, Xi-Yu; Summers, Donald F.; Ehrenfeld, Ellie

1999-01-01

Hepatitis A virus (HAV) encodes a single polyprotein which is posttranslationally processed into the functional structural and nonstructural proteins. Only one protease, viral protease 3C, has been implicated in the nine protein scissions. Processing of the capsid protein precursor region generates a unique intermediate, PX (VP1-2A), which accumulates in infected cells and is assumed to serve as precursor to VP1 found in virions, although the details of this reaction have not been determined. Coexpression in transfected cells of a variety of P1 precursor proteins with viral protease 3C demonstrated efficient production of PX, as well as VP0 and VP3; however, no mature VP1 protein was detected. To identify the C-terminal amino acid residue of HAV VP1, we performed peptide sequence analysis by protease-catalyzed [18O]H2O incorporation followed by liquid chromatography ion-trap microspray tandem mass spectrometry of HAV VP1 isolated from purified virions. Two different cell culture-adapted isolates of HAV, strains HM175pE and HM175p35, were used for these analyses. VP1 preparations from both virus isolates contained heterogeneous C termini. The predominant C-terminal amino acid in both virus preparations was VP1-Ser274, which is located N terminal to a methionine residue in VP1-2A. In addition, the analysis of HM175pE recovered smaller amounts of amino acids VP1-Glu273 and VP1-Thr272. In the case of HM175p35, which contains valine at amino acid position VP1-273, VP1-Thr272 was found in addition to VP1-Ser274. The data suggest that HAV 3C is not the protease responsible for generation of the VP1 C terminus. We propose the involvement of host cell protease(s) in the production of HAV VP1. PMID:10364353

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Seismic tomography of the Canterbury Plains and the geometry and evolution of seismicity of the Greendale fault system, New Zealand

NASA Astrophysics Data System (ADS)

Syracuse, E. M.; Thurber, C. H.; Savage, M. K.

2012-12-01

The previously unknown Greendale fault produced the September 4, 2010 M 7.1 Darfield earthquake and later triggered the destructive February 22, 2011 M 6.3 Christchurch earthquake, as well as later M>5 aftershocks east of Christchurch. Surface rupture from the Darfield earthquake indicates up to 5 m of strike-slip motion along the main portion of the Greendale fault, while various geodetic and seismic models also indicate reverse faulting on surrounding smaller faults. We combine seismic data from a variety of sources (permanent network seismometers and strong motion instruments, temporary intermediate to broadband seismometers) to understand the geometry of these various sections of faults and the evolution of seismicity along them for the first four months of aftershocks from the Darfield earthquake. We identify 4 to 5 fault segments that were likely active in the Darfield earthquake and an additional 5 to 6 segments that were active during the study period, prior to the Christchurch earthquake. While relocating hypocenters, we also jointly invert for 3D Vp, Vs, and Vp/Vs in the Canterbury region using an extended version of the double-difference tomography code tomoDD (Zhang et al., 2009). In the area of the Greendale and associated faults, Vp, Vs, and Vp/Vs are generally reduced from the top 8 km of the average velocity model for the Canterbury region of New Zealand. from the surface to ~8 km depth, below which the resolution begins to decline. Beneath Christchurch and areas immediately to the south and west, Vp and Vs are elevated and Vp/Vs is reduced from the surface to ~8 km depth, corresponding to the location of a negative Bouguer gravity anomaly and an increase in depth to basement (Hicks, 1989). In the northwest portion of the model, Vp and Vs increase when approaching the foothills of the Southern Alps. There are no clearly defined features in the velocity model that cross or are offset by the Greendale fault and no apparent contrast in velocities across the fault, preventing us from conjecturing about the age or total offset along the fault over its lifespan based on the velocity models alone.

Seismic imaging of the geothermal area in Tarutung (Sumatra, Indonesia): Comparison of local earthquake and ambient noise tomography

NASA Astrophysics Data System (ADS)

Muksin, Muksin; Bauer, Klaus; Haberland, Christian; Ryberg, Trond

2013-04-01

A joint German-Indonesian research initiative is conducted to support the geothermal energy development in Indonesia, where one important aspect is exploration technology. An almost unexplored region located in northern Sumatra (Indonesia) was chosen to develop and demonstrate an integrated exploration strategy which includes structural geology, active seismics, passive seismology, and magnetotelluric investigations. The geothermal potential at this site is mainly determined by the Sumatran fault system and its interplay with young volcanism associated with subduction zone processes. Within the passive seismology study, a temporary network of 42 stations was installed around the city of Tarutung running over a period of 10 month from May 2011 until February 2012. The Sumatran fault was covered at the center of the network, and stations were distributed within a radius of 20 km with spacings of about 5 km on average. The collected data allow for the 3D imaging of seismic velocities and intrinsic attenuation, high resolution relocalisation of seismicity, determination of fault plane solutions, and analysis of ambient noise generated surface waves. The general objective is to integrate the final results with other geoscientific data and interpretations and to develop a conceptual model for the geothermal system of the target region. In the presentation we will focuss on a comparison of local earthquake tomography and ambient noise surface wave inversion. We applied HYPO71 to locate events and found 2,586 events within the network and relocate 809 events having gap angle less than 180 degrees by using VELEST and determined the 1D Vp and Vp/Vs models forming the starting models of the subsequent 3D inversion. SIMUL2000 code was used to invert for Vp and Vp/Vs as well as the intrinsic attenuation for P waves (Qp). For the ambient noise tomography we cross-correlated the daily vertical component recordings for all available station pairs in the 40 station array. Surface wave travel times were picked and inverted using the Fast Marching Surface-wave Tomography (FMST) method. The Vp structure images the geometry of the basins while high Vp/Vs and low Qp are associated with hot fluid pathway originated below the Sumatran fault. We examine the comparison of the results of the Vp/Vs and Qp with the ambient noise tomography to investigate the potential for combining both approach to study geothermal systems.

Classic Nuclear Localization Signals and a Novel Nuclear Localization Motif Are Required for Nuclear Transport of Porcine Parvovirus Capsid Proteins

PubMed Central

Boisvert, Maude; Bouchard-Lévesque, Véronique; Fernandes, Sandra

2014-01-01

ABSTRACT Nuclear targeting of capsid proteins (VPs) is important for genome delivery and precedes assembly in the replication cycle of porcine parvovirus (PPV). Clusters of basic amino acids, corresponding to potential nuclear localization signals (NLS), were found only in the unique region of VP1 (VP1up, for VP1 unique part). Of the five identified basic regions (BR), three were important for nuclear localization of VP1up: BR1 was a classic Pat7 NLS, and the combination of BR4 and BR5 was a classic bipartite NLS. These NLS were essential for viral replication. VP2, the major capsid protein, lacked these NLS and contained no region with more than two basic amino acids in proximity. However, three regions of basic clusters were identified in the folded protein, assembled into a trimeric structure. Mutagenesis experiments showed that only one of these three regions was involved in VP2 transport to the nucleus. This structural NLS, termed the nuclear localization motif (NLM), is located inside the assembled capsid and thus can be used to transport trimers to the nucleus in late steps of infection but not for virions in initial infection steps. The two NLS of VP1up are located in the N-terminal part of the protein, externalized from the capsid during endosomal transit, exposing them for nuclear targeting during early steps of infection. Globally, the determinants of nuclear transport of structural proteins of PPV were different from those of closely related parvoviruses. IMPORTANCE Most DNA viruses use the nucleus for their replication cycle. Thus, structural proteins need to be targeted to this cellular compartment at two distinct steps of the infection: in early steps to deliver viral genomes to the nucleus and in late steps to assemble new viruses. Nuclear targeting of proteins depends on the recognition of a stretch of basic amino acids by cellular transport proteins. This study reports the identification of two classic nuclear localization signals in the minor capsid protein (VP1) of porcine parvovirus. The major protein (VP2) nuclear localization was shown to depend on a complex structural motif. This motif can be used as a strategy by the virus to avoid transport of incorrectly folded proteins and to selectively import assembled trimers into the nucleus. Structural nuclear localization motifs can also be important for nuclear proteins without a classic basic amino acid stretch, including multimeric cellular proteins. PMID:25078698

Characteristics of an Environmentally Monitored Prolonged Type 2 Vaccine Derived Poliovirus Shedding Episode that Stopped without Intervention

PubMed Central

Hovi, Tapani; Paananen, Anja; Blomqvist, Soile; Savolainen-Kopra, Carita; Al-Hello, Haider; Smura, Teemu; Shimizu, Hiroyuki; Nadova, Katarina; Sobotova, Zdenka; Gavrilin, Eugene; Roivainen, Merja

2013-01-01

Vaccine derived poliovirus (VDPV) type 2 strains strongly divergent from the corresponding vaccine strain, Sabin 2, were repeatedly isolated from sewage in Slovakia over a period of 22 months in 2003–2005. Cell cultures of stool specimens from known immune deficient patients and from an identified putative source population of 500 people failed to identify the potential excretor(s) of the virus. The occurrence of VDPV in sewage stopped without any intervention. No paralytic cases were reported in Slovakia during the episode. According to a GenBank search and similarity plotting-analysis, the closest known relative of the first isolate PV2/03/SVK/E783 through all main sections of the genome was the type 2 poliovirus Sabin strain, with nucleotide identities in 5′UTR, P1, P2, P3, and 3′UTR parts of the genome of 88.6, 85.9, 87.3, 88.5, and 94.0 percent, respectively. Phenotypic properties of selected Slovakian aVDPV strains resembled those of VDPV strains isolated from immune deficient individuals with prolonged PV infection (iVDPV), including antigenic changes and moderate neurovirulence in the transgenic mouse model. One hundred and two unique VP1 coding sequences were determined from VDPV strains isolated from 34 sewage specimens. Nucleotide differences from Sabin 2 in the VP1 coding region ranged from 12.5 to 15.6 percent, and reached a maximum of 9.6 percent between the VDPV strains under study. Most of the nucleotide substitutions were synonymous but as many as 93 amino acid positions out of 301 in VP1 showed substitutions. We conclude that (1) individuals with prolonged poliovirus infection are not as rare as suggested by the studies on immune deficient patients known to the health care systems and (2) genetic divergence of VDPV strains may remain extensive during years long replication in humans. PMID:23935826

Crustal Fracturing Field and Presence of Fluid as Revealed by Seismic Anisotropy

NASA Astrophysics Data System (ADS)

Pastori, M.; Piccinini, D.; de Gori, P.; Margheriti, L.; Barchi, M. R.; di Bucci, D.

2010-12-01

In the last three years, we developed, tested and improved an automatic analysis code (Anisomat+) to calculate the shear wave splitting parameters, fast polarization direction (φ) and delay time (∂t). The code is a set of MatLab scripts able to retrieve crustal anisotropy parameters from three-component seismic recording of local earthquakes using horizontal component cross-correlation method. The analysis procedure consists in choosing an appropriate frequency range, that better highlights the signal containing the shear waves, and a length of time window on the seismogram centered on the S arrival (the temporal window contains at least one cycle of S wave). The code was compared to other two automatic analysis code (SPY and SHEBA) and tested on three Italian areas (Val d’Agri, Tiber Valley and L’Aquila surrounding) along the Apennine mountains. For each region we used the anisotropic parameters resulting from the automatic computation as a tool to determine the fracture field geometries connected with the active stress field. We compare the temporal variations of anisotropic parameters to the evolution of vp/vs ratio for the same seismicity. The anisotropic fast directions are used to define the active stress field (EDA model), finding a general consistence between fast direction and main stress indicators (focal mechanism and borehole break-out). The magnitude of delay time is used to define the fracture field intensity finding higher value in the volume where micro-seismicity occurs. Furthermore we studied temporal variations of anisotropic parameters and vp/vs ratio in order to explain if fluids play an important role in the earthquake generation process. The close association of anisotropic and vp/vs parameters variations and seismicity rate changes supports the hypothesis that the background seismicity is influenced by the fluctuation of pore fluid pressure in the rocks.

Expression and characterization of highly antigenic domains of chicken anemia virus viral VP2 and VP3 subunit proteins in a recombinant E. coli for sero-diagnostic applications

PubMed Central

2013-01-01

Background Chicken anemia virus (CAV) is an important viral pathogen that causes anemia and severe immunodeficiency syndrome in chickens worldwide. Generally, CAV infection occurs via vertical transmission in young chicks that are less than two weeks old, which are very susceptible to the disease. Therefore, epidemiological investigations of CAV infection and/or the evaluation of the immunization status of chickens is necessary for disease control. Up to the present, systematically assessing viral protein antigenicity and/or determining the immunorelevant domain(s) of viral proteins during serological testing for CAV infection has never been performed. The expression, production and antigenic characterization of CAV viral proteins such as VP1, VP2 and VP3, and their use in the development of diagnostic kit would be useful for CAV infection prevention. Results Three CAV viral proteins VP1, VP2 and VP3 was separately cloned and expressed in recombinant E. coli. The purified recombinant CAV VP1, VP2 and VP3 proteins were then used as antigens in order to evaluate their reactivity against chicken sera using indirect ELISA. The results indicated that VP2 and VP3 show good immunoreactivity with CAV-positive chicken sera, whereas VP1 was found to show less immunoreactivity than VP2 and VP3. To carry out the further antigenic characterization of the immunorelevant domains of the VP2 and VP3 proteins, five recombinant VP2 subunit proteins (VP2-435N, VP2-396N, VP2-345N, VP2-171C and VP2-318C) and three recombinant VP3 subunit proteins (VP3-123N, VP3-246M, VP3-366C), spanning the defined regions of VP2 and VP3 were separately produced by an E. coli expression system. These peptides were then used as antigens in indirect ELISAs against chicken sera. The results of these ELISAs using truncated recombinant VP2 and VP3 subunit proteins as coating antigen showed that VP2-345N, VP2-396N and VP3-246M gave good immunoreactivity with CAV-positive chicken sera compared to the other subunit proteins. Moreover, the VP2-396N and VP2-345 based ELISAs had better sensitivity (97.5%) and excellent specificity (100%) during serodiagnosis testing using a mean plus three standard deviations cut-off. The VP3-246M based ELISA showed a sensitivity of 85% and a specificity of 100% at the same cut-off value. Conclusions This is the first report to systematically assess the antigenic characteristics of CAV viral proteins for sero-diagnosis purposes. Purified recombinant VP2-396N and VP2-345N subunit proteins, which span defined regions of VP2, were demonstrated to have good antigenicity and higher sensitivities than VP3-246M and were able to recognize CAV-positive chicken serum using an ELISA assay. The defined antigenicity potential of these chimeric subunit proteins produced by expression in E. coli seem to have potential and could be useful in the future for the development of the CAV diagnostic tests based on a subunit protein ELISA system. PMID:23937712

Development of an Efficient Entire-Capsid-Coding-Region Amplification Method for Direct Detection of Poliovirus from Stool Extracts

PubMed Central

Kilpatrick, David R.; Nakamura, Tomofumi; Burns, Cara C.; Bukbuk, David; Oderinde, Soji B.; Oberste, M. Steven; Kew, Olen M.; Pallansch, Mark A.; Shimizu, Hiroyuki

2014-01-01

Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. PMID:25339406

Novel inter and intra prediction tools under consideration for the emerging AV1 video codec

NASA Astrophysics Data System (ADS)

Joshi, Urvang; Mukherjee, Debargha; Han, Jingning; Chen, Yue; Parker, Sarah; Su, Hui; Chiang, Angie; Xu, Yaowu; Liu, Zoe; Wang, Yunqing; Bankoski, Jim; Wang, Chen; Keyder, Emil

2017-09-01

Google started the WebM Project in 2010 to develop open source, royalty- free video codecs designed specifically for media on the Web. The second generation codec released by the WebM project, VP9, is currently served by YouTube, and enjoys billions of views per day. Realizing the need for even greater compression efficiency to cope with the growing demand for video on the web, the WebM team embarked on an ambitious project to develop a next edition codec AV1, in a consortium of major tech companies called the Alliance for Open Media, that achieves at least a generational improvement in coding efficiency over VP9. In this paper, we focus primarily on new tools in AV1 that improve the prediction of pixel blocks before transforms, quantization and entropy coding are invoked. Specifically, we describe tools and coding modes that improve intra, inter and combined inter-intra prediction. Results are presented on standard test sets.

Concentration of acrylamide in a polyacrylamide gel affects VP4 gene coding assignment of group A equine rotavirus strains with P[12] specificity

PubMed Central

2010-01-01

Background It is universally acknowledged that genome segment 4 of group A rotavirus, the major etiologic agent of severe diarrhea in infants and neonatal farm animals, encodes outer capsid neutralization and protective antigen VP4. Results To determine which genome segment of three group A equine rotavirus strains (H-2, FI-14 and FI-23) with P[12] specificity encodes the VP4, we analyzed dsRNAs of strains H-2, FI-14 and FI-23 as well as their reassortants by polyacrylamide gel electrophoresis (PAGE) at varying concentrations of acrylamide. The relative position of the VP4 gene of the three equine P[12] strains varied (either genome segment 3 or 4) depending upon the concentration of acrylamide. The VP4 gene bearing P[3], P[4], P[6], P[7], P[8] or P[18] specificity did not exhibit this phenomenon when the PAGE running conditions were varied. Conclusions The concentration of acrylamide in a PAGE gel affected VP4 gene coding assignment of equine rotavirus strains bearing P[12] specificity. PMID:20573245

Imaging of 3-D seismic velocity structure of Southern Sumatra region using double difference tomographic method

NASA Astrophysics Data System (ADS)

Lestari, Titik; Nugraha, Andri Dian

2015-04-01

Southern Sumatra region has a high level of seismicity due to the influence of the subduction system, Sumatra fault, Mentawai fault and stretching zone activities. The seismic activities of Southern Sumatra region are recorded by Meteorological Climatological and Geophysical Agency (MCGA's) Seismograph network. In this study, we used earthquake data catalog compiled by MCGA for 3013 events from 10 seismic stations around Southern Sumatra region for time periods of April 2009 - April 2014 in order to invert for the 3-D seismic velocities structure (Vp, Vs, and Vp/Vs ratio). We applied double-difference seismic tomography method (tomoDD) to determine Vp, Vs and Vp/Vs ratio with hypocenter adjustment. For the inversion procedure, we started from the initial 1-D seismic velocity model of AK135 and constant Vp/Vs of 1.73. The synthetic travel time from source to receiver was calculated using ray pseudo-bending technique, while the main tomographic inversion was applied using LSQR method. The resolution model was evaluated using checkerboard test and Derivative Weigh Sum (DWS). Our preliminary results show low Vp and Vs anomalies region along Bukit Barisan which is may be associated with weak zone of Sumatran fault and migration of partial melted material. Low velocity anomalies at 30-50 km depth in the fore arc region may indicated the hydrous material circulation because the slab dehydration. We detected low seismic seismicity in the fore arc region that may be indicated as seismic gap. It is coincides contact zone of high and low velocity anomalies. And two large earthquakes (Jambi and Mentawai) also occurred at the contact of contrast velocity.

Imaging of 3-D seismic velocity structure of Southern Sumatra region using double difference tomographic method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lestari, Titik, E-mail: t2klestari@gmail.com; Faculty of Earth Science and Technology, Bandung Institute of Technology, Jalan Ganesa No.10, Bandung 40132; Nugraha, Andri Dian, E-mail: nugraha@gf.itb.ac.id

2015-04-24

Southern Sumatra region has a high level of seismicity due to the influence of the subduction system, Sumatra fault, Mentawai fault and stretching zone activities. The seismic activities of Southern Sumatra region are recorded by Meteorological Climatological and Geophysical Agency (MCGA’s) Seismograph network. In this study, we used earthquake data catalog compiled by MCGA for 3013 events from 10 seismic stations around Southern Sumatra region for time periods of April 2009 – April 2014 in order to invert for the 3-D seismic velocities structure (Vp, Vs, and Vp/Vs ratio). We applied double-difference seismic tomography method (tomoDD) to determine Vp, Vsmore » and Vp/Vs ratio with hypocenter adjustment. For the inversion procedure, we started from the initial 1-D seismic velocity model of AK135 and constant Vp/Vs of 1.73. The synthetic travel time from source to receiver was calculated using ray pseudo-bending technique, while the main tomographic inversion was applied using LSQR method. The resolution model was evaluated using checkerboard test and Derivative Weigh Sum (DWS). Our preliminary results show low Vp and Vs anomalies region along Bukit Barisan which is may be associated with weak zone of Sumatran fault and migration of partial melted material. Low velocity anomalies at 30-50 km depth in the fore arc region may indicated the hydrous material circulation because the slab dehydration. We detected low seismic seismicity in the fore arc region that may be indicated as seismic gap. It is coincides contact zone of high and low velocity anomalies. And two large earthquakes (Jambi and Mentawai) also occurred at the contact of contrast velocity.« less

Characterization of Nora Virus Structural Proteins via Western Blot Analysis.

PubMed

Ericson, Brad L; Carlson, Darby J; Carlson, Kimberly A

2016-01-01

Nora virus is a single stranded RNA picorna-like virus with four open reading frames (ORFs). The coding potentials of the ORFs are not fully characterized, but ORF3 and ORF4 are believed to encode the capsid proteins (VP3, VP4a, VP4b, and VP4c) comprising the virion. To determine the polypeptide composition of Nora virus virions, polypeptides from purified virus were compared to polypeptides detected in Nora virus infected Drosophila melanogaster. Nora virus was purified from infected flies and used to challenge mice for the production of antisera. ORF3, ORF4a, ORF4b, and ORF4c were individually cloned and expressed in E. coli; resultant recombinant proteins purified and were used to make monospecific antisera. Antisera were evaluated via Western blot against whole virus particles and Nora virus infected fly lysates. Viral purification yielded two particle types with densities of ~1.31 g/mL (empty particles) and ~1.33 g/mL (complete virions). Comparison of purified virus polypeptide composition to Nora virus infected D. melanogaster lysate showed the number of proteins in infected cell lysates is less than purified virus. Our results suggest the virion is composed of 6 polypeptides, VP3, VP4a, two forms of VP4b, and two forms of VP4c. This polypeptide composition is similar to other small RNA insect viruses.

Characterization of Nora Virus Structural Proteins via Western Blot Analysis

PubMed Central

Ericson, Brad L.; Carlson, Darby J.

2016-01-01

Nora virus is a single stranded RNA picorna-like virus with four open reading frames (ORFs). The coding potentials of the ORFs are not fully characterized, but ORF3 and ORF4 are believed to encode the capsid proteins (VP3, VP4a, VP4b, and VP4c) comprising the virion. To determine the polypeptide composition of Nora virus virions, polypeptides from purified virus were compared to polypeptides detected in Nora virus infected Drosophila melanogaster. Nora virus was purified from infected flies and used to challenge mice for the production of antisera. ORF3, ORF4a, ORF4b, and ORF4c were individually cloned and expressed in E. coli; resultant recombinant proteins purified and were used to make monospecific antisera. Antisera were evaluated via Western blot against whole virus particles and Nora virus infected fly lysates. Viral purification yielded two particle types with densities of ~1.31 g/mL (empty particles) and ~1.33 g/mL (complete virions). Comparison of purified virus polypeptide composition to Nora virus infected D. melanogaster lysate showed the number of proteins in infected cell lysates is less than purified virus. Our results suggest the virion is composed of 6 polypeptides, VP3, VP4a, two forms of VP4b, and two forms of VP4c. This polypeptide composition is similar to other small RNA insect viruses. PMID:27298753

The Receptor-Binding Domain in the VP1u Region of Parvovirus B19.

PubMed

Leisi, Remo; Di Tommaso, Chiarina; Kempf, Christoph; Ros, Carlos

2016-02-24

Parvovirus B19 (B19V) is known as the human pathogen causing the mild childhood disease erythema infectiosum. B19V shows an extraordinary narrow tissue tropism for erythroid progenitor cells in the bone marrow, which is determined by a highly restricted uptake. We have previously shown that the specific internalization is mediated by the interaction of the viral protein 1 unique region (VP1u) with a yet unknown cellular receptor. To locate the receptor-binding domain (RBD) within the VP1u, we analyzed the effect of truncations and mutations on the internalization capacity of the recombinant protein into UT7/Epo cells. Here we report that the N-terminal amino acids 5-80 of the VP1u are necessary and sufficient for cellular binding and internalization; thus, this N-terminal region represents the RBD required for B19V uptake. Using site-directed mutagenesis, we further identified a cluster of important amino acids playing a critical role in VP1u internalization. In silico predictions and experimental results suggest that the RBD is structured as a rigid fold of three α-helices. Finally, we found that dimerization of the VP1u leads to a considerably enhanced cellular binding and internalization. Taken together, we identified the RBD that mediates B19V uptake and mapped functional and structural motifs within this sequence. The findings reveal insights into the uptake process of B19V, which contribute to understand the pathogenesis of the infection and the neutralization of the virus by the immune system.

The Receptor-Binding Domain in the VP1u Region of Parvovirus B19

PubMed Central

Leisi, Remo; Di Tommaso, Chiarina; Kempf, Christoph; Ros, Carlos

2016-01-01

Parvovirus B19 (B19V) is known as the human pathogen causing the mild childhood disease erythema infectiosum. B19V shows an extraordinary narrow tissue tropism for erythroid progenitor cells in the bone marrow, which is determined by a highly restricted uptake. We have previously shown that the specific internalization is mediated by the interaction of the viral protein 1 unique region (VP1u) with a yet unknown cellular receptor. To locate the receptor-binding domain (RBD) within the VP1u, we analyzed the effect of truncations and mutations on the internalization capacity of the recombinant protein into UT7/Epo cells. Here we report that the N-terminal amino acids 5–80 of the VP1u are necessary and sufficient for cellular binding and internalization; thus, this N-terminal region represents the RBD required for B19V uptake. Using site-directed mutagenesis, we further identified a cluster of important amino acids playing a critical role in VP1u internalization. In silico predictions and experimental results suggest that the RBD is structured as a rigid fold of three α-helices. Finally, we found that dimerization of the VP1u leads to a considerably enhanced cellular binding and internalization. Taken together, we identified the RBD that mediates B19V uptake and mapped functional and structural motifs within this sequence. The findings reveal insights into the uptake process of B19V, which contribute to understand the pathogenesis of the infection and the neutralization of the virus by the immune system. PMID:26927158

Molecular Evolution and Genetic Analysis of the Major Capsid Protein VP1 of Duck Hepatitis A Viruses: Implications for Antigenic Stability

PubMed Central

Ma, Xiuli; Sheng, Zizhang; Huang, Bing; Qi, Lihong; Li, Yufeng; Yu, Kexiang; Liu, Cunxia; Qin, Zhuoming; Wang, Dan; Song, Minxun; Li, Feng

2015-01-01

The duck hepatitis A virus (DHAV), a member of the family Picornaviridae, is the major cause of outbreaks with high mortality rates in young ducklings. It has three distinctive serotypes and among them, serotypes 1 (DHAV-1) and 3 (DHAV-3) were recognized in China. To investigate evolutionary and antigenic properties of the major capsid protein VP1 of these two serotypes, a primary target of neutralizing antibodies, we determined the VP1 coding sequences of 19 DHAV-1 (spanning 2000-2012) and 11 DHAV-3 isolates (spanning 2008-2014) associated with disease outbreaks. By bioinformatics analysis of VP1 sequences of these isolates and other DHAV strains reported previously, we demonstrated that DHAV-1 viruses evolved into two genetic lineages, while DHAV-3 viruses exhibited three distinct lineages. The rate of nucleotide substitution for DHAV-1 VP1 genes was estimated to be 5.57 x 10-4 per site per year, which was about one-third times slower than that for DHAV-3 VP1 genes. The population dynamics analysis showed an upward trend for infection of DHAV-1 viruses over time with little change observed for DHAV-3 viruses. Antigenic study of representative DHAV-1 and DHAV-3 strains covering all observed major lineages revealed no detectable changes in viral neutralization properties within the serotype, despite the lack of cross-neutralization between serotypes 1 and 3 strains. Structural analysis identified VP1 mutations in DHAV-1 and DHAV-3 viruses that underpin the observed antigenic phenotypes. Results of our experiments described here shall give novel insights into evolution and antigenicity of duck picornaviruses. PMID:26173145

Molecular characterization of rotavirus isolated from alpaca (Vicugna pacos) crias with diarrhea in the Andean Region of Cusco, Peru.

PubMed

Garmendia, Antonio E; Lopez, Wellington; Ortega, Nastassja; Chamorro, Marycris J

2015-10-22

Alpacas (Vicugna pacos), a species of South American camelids (SAC), suffer high morbidity and mortality from infectious diseases. Diarrhea is one of the leading causes of alpaca cria mortality in Peru and elsewhere. In order to develop appropriate control and/or treatment, it is necessary to identify infectious pathogens that cause diarrhea in crias. Rotavirus was isolated in cell culture from feces collected from crias with acute diarrhea that tested positive to rotaviral antigen by rapid immunochromatographic methods in an earlier study. The isolates were identified as rotaviruses by RT-PCR run with specific primers for human rotavirus VP7 coding sequences using total RNA extracted from cells displaying cytopathic effects as template. These alpaca isolates were further identified as group A rotaviruses by means of a VP6-specific PCR and were designated as ALRVA-K'ayra/Perú/3368-10 and ALRVA-K'ayra/Perú/3386-10. Molecular G and P typing, placed the former as G3/P11 and the latter as G3/P?. Sequence analysis of two genome segments (coding for VP4 and VP7) from the alpaca isolates revealed partial homologies to swine and human rotaviruses, respectively. These results demonstrate that rotaviruses are associated with a proportion of cases of diarrhea in crias, although prevalence and impact remain to be determined. The isolation of rotaviruses from alpaca crias with diarrhea will contribute positively to further understand the pathogen and its role in the diarrhea complex. Copyright © 2015 Elsevier B.V. All rights reserved.

Mutations in the putative calcium-binding domain of polyomavirus VP1 affect capsid assembly

NASA Technical Reports Server (NTRS)

Haynes, J. I. 2nd; Chang, D.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

Calcium ions appear to play a major role in maintaining the structural integrity of the polyomavirus and are likely involved in the processes of viral uncoating and assembly. Previous studies demonstrated that a VP1 fragment extending from Pro-232 to Asp-364 has calcium-binding capabilities. This fragment contains an amino acid stretch from Asp-266 to Glu-277 which is quite similar in sequence to the amino acids that make up the calcium-binding EF hand structures found in many proteins. To assess the contribution of this domain to polyomavirus structural integrity, the effects of mutations in this region were examined by transfecting mutated viral DNA into susceptible cells. Immunofluorescence studies indicated that although viral protein synthesis occurred normally, infective viral progeny were not produced in cells transfected with polyomavirus genomes encoding either a VP1 molecule lacking amino acids Thr-262 through Gly-276 or a VP1 molecule containing a mutation of Asp-266 to Ala. VP1 molecules containing the deletion mutation were unable to bind 45Ca in an in vitro assay. Upon expression in Escherichia coli and purification by immunoaffinity chromatography, wild-type VP1 was isolated as pentameric, capsomere-like structures which could be induced to form capsid-like structures upon addition of CaCl2, consistent with previous studies. However, although VP1 containing the point mutation was isolated as pentamers which were indistinguishable from wild-type VP1 pentamers, addition of CaCl2 did not result in their assembly into capsid-like structures. Immunogold labeling and electron microscopy studies of transfected mammalian cells provided in vivo evidence that a mutation in this region affects the process of viral assembly.

In Vitro Evolution and Affinity-Maturation with Coliphage Qβ Display

PubMed Central

Skamel, Claudia; Aller, Stephen G.; Bopda Waffo, Alain

2014-01-01

The Escherichia coli bacteriophage, Qβ (Coliphage Qβ), offers a favorable alternative to M13 for in vitro evolution of displayed peptides and proteins due to high mutagenesis rates in Qβ RNA replication that better simulate the affinity maturation processes of the immune response. We describe a benchtop in vitro evolution system using Qβ display of the VP1 G-H loop peptide of foot-and-mouth disease virus (FMDV). DNA encoding the G-H loop was fused to the A1 minor coat protein of Qβ resulting in a replication-competent hybrid phage that efficiently displayed the FMDV peptide. The surface-localized FMDV VP1 G-H loop cross-reacted with the anti-FMDV monoclonal antibody (mAb) SD6 and was found to decorate the corners of the Qβ icosahedral shell by electron microscopy. Evolution of Qβ-displayed peptides, starting from fully degenerate coding sequences corresponding to the immunodominant region of VP1, allowed rapid in vitro affinity maturation to SD6 mAb. Qβ selected under evolutionary pressure revealed a non-canonical, but essential epitope for mAb SD6 recognition consisting of an Arg-Gly tandem pair. Finally, the selected hybrid phages induced polyclonal antibodies in guinea pigs with good affinity to both FMDV and hybrid Qβ-G-H loop, validating the requirement of the tandem pair epitope. Qβ-display emerges as a novel framework for rapid in vitro evolution with affinity-maturation to molecular targets. PMID:25393763

Foot-and-mouth disease virus serotype SAT1 in cattle, Nigeria.

PubMed

Ehizibolo, D O; Haegeman, A; De Vleeschauwer, A R; Umoh, J U; Kazeem, H M; Okolocha, E C; Van Borm, S; De Clercq, K

2017-06-01

The knowledge of foot-and-mouth disease virus (FMDV) dynamics and epidemiology in Nigeria and the West Africa subregion is important to support local and regional control plans and international risk assessment. Foot-and-mouth disease virus serotype South African territories (SAT)1 was isolated, identified and characterized from an FMD outbreak in cattle in Nigeria in 2015, 35 years after the last report of FMDV SAT1 in West Africa. The VP1 coding sequence of the Nigerian 2015 SAT1 isolates diverges from reported SAT1 topotypes resulting in a separate topotype. The reporting of a novel FMDV SAT1 strain in the virus pool 5 (West and Central Africa) highlights the dynamic and complex nature of FMDV in this region of Africa. Sustained surveillance is needed to understand the origin, the extent and distribution of this novel SAT1 topotype in the region as well as to detect and monitor the occurrence of (re-)emerging FMDV strains. © 2017 Blackwell Verlag GmbH.

Human parvovirus B19 VP1u Protein as inflammatory mediators induces liver injury in naïve mice.

PubMed

Hsu, Tsai-Ching; Chiu, Chun-Ching; Chang, Shun-Chih; Chan, Hsu-Chin; Shi, Ya-Fang; Chen, Tzy-Yen; Tzang, Bor-Show

2016-01-01

Human parvovirus B19 (B19V) is a human pathogen known to be associated with many non-erythroid diseases, including hepatitis. Although B19V VP1-unique region (B19-VP1u) has crucial roles in the pathogenesis of B19V infection, the influence of B19-VP1u proteins on hepatic injury is still obscure. This study investigated the effect and possible inflammatory signaling of B19-VP1u in livers from BALB/c mice that were subcutaneously inoculated with VP1u-expressing COS-7 cells. The in vivo effects of B19-VP1u were analyzed by using live animal imaging system (IVIS), Haematoxylin-Eosin staining, gel zymography, and immunoblotting after inoculation. Markedly hepatocyte disarray and lymphocyte infiltration, enhanced matrix metalloproteinase (MMP)-9 activity and increased phosphorylation of p38, ERK, IKK-α, IκB and NF-κB (p-p65) proteins were observed in livers from BALB/c mice receiving COS-7 cells expressing B19-VP1u as well as the significantly increased CRP, IL-1β and IL-6. Notably, IFN-γ and phosphorylated STAT1, but not STAT3, were also significantly increased in the livers of BALB/c mice that were subcutaneously inoculated with VP1u-expressing COS-7 cells. These findings revealed the effects of B19-VP1u on liver injury and suggested that B19-VP1u may have a role as mediators of inflammation in B19V infection.

Control of Ebola hemorrhagic fever: vaccine development and our Ebola project in Sierra Leone.

PubMed

Watanabe, Tokiko; Kawaoka, Yoshihiro

2016-01-01

Since December 2013, West Africa has experienced the worst Ebola virus outbreak in recorded history. Of the 28,639 cases reported to the World Health Organization as of March 2016, nearly half (14,124) occurred in Sierra Leone. With a case fatality rate of approximately 40%, this outbreak has claimed the lives of 11,316 individuals. No FDA-approved vaccines or drugs are available to prevent or treat Ebola virus infection. Experimental vaccines and therapies are being developed; however, their safety and efficacy are still being evaluated. Therefore, there is an urgent need to develop control measures to prevent or limit future Ebola virus outbreaks.Previously, we developed a replication-defective Ebola virus that lacks the coding region for the essential viral transcription activator VP30 (Ebola ΔVP30 virus). Here, we evaluated the vaccine efficacy of Ebola ΔVP30 virus in a non-human primate model and describe our collaborative Ebola project in Sierra Leone.

The role of nuclear localization signal in parvovirus life cycle.

PubMed

Liu, Peng; Chen, Shun; Wang, Mingshu; Cheng, Anchun

2017-04-14

Parvoviruses are small, non-enveloped viruses with an approximately 5.0 kb, single-stranded DNA genome. Usually, the parvovirus capsid gene contains one or more nuclear localization signals (NLSs), which are required for guiding the virus particle into the nucleus through the nuclear pore. However, several classical NLSs (cNLSs) and non-classical NLSs (ncNLSs) have been identified in non-structural genes, and the ncNLSs can also target non-structural proteins into the nucleus. In this review, we have summarized recent research findings on parvovirus NLSs. The capsid protein of the adeno-associated virus has four potential nuclear localization sequences, named basic region 1 (BR), BR2, BR3 and BR4. BR3 was identified as an NLS by fusing it with green fluorescent protein. Moreover, BR3 and BR4 are required for infectivity and virion assembly. In Protoparvovirus, the canine parvovirus has a common cNLS located in the VP1 unique region, similar to parvovirus minute virus of mice (MVM) and porcine parvovirus. Moreover, an ncNLS is found in the C-terminal region of MVM VP1/2. Parvovirus B19 also contains an ncNLS in the C-terminal region of VP1/2, which is essential for the nuclear transport of VP1/VP2. Approximately 1 or 2 cNLSs and 1 ncNLS have been reported in the non-structural protein of bocaviruses. Understanding the role of the NLS in the process of parvovirus infection and its mechanism of nuclear transport will contribute to the development of therapeutic vaccines and novel antiviral medicines.

Prediction and characterization of novel epitopes of serotype A foot-and-mouth disease viruses circulating in East Africa using site-directed mutagenesis

PubMed Central

Bari, Fufa Dawo; Parida, Satya; Asfor, Amin S.; Haydon, Daniel T.; Reeve, Richard; Paton, David J.

2015-01-01

Epitopes on the surface of the foot-and-mouth disease virus (FMDV) capsid have been identified by monoclonal antibody (mAb) escape mutant studies leading to the designation of four antigenic sites in serotype A FMDV. Previous work focused on viruses isolated mainly from Asia, Europe and Latin America. In this study we report on the prediction of epitopes in African serotype A FMDVs and testing of selected epitopes using reverse genetics. Twenty-four capsid amino acid residues were predicted to be of antigenic significance by analysing the capsid sequences (n = 56) using in silico methods, and six residues by correlating capsid sequence with serum–virus neutralization data. The predicted residues were distributed on the surface-exposed capsid regions, VP1–VP3. The significance of residue changes at eight of the predicted epitopes was tested by site-directed mutagenesis using a cDNA clone resulting in the generation of 12 mutant viruses involving seven sites. The effect of the amino acid substitutions on the antigenic nature of the virus was assessed by virus neutralization (VN) test. Mutations at four different positions, namely VP1-43, VP1-45, VP2-191 and VP3-132, led to significant reduction in VN titre (P value = 0.05, 0.05, 0.001 and 0.05, respectively). This is the first time, to our knowledge, that the antigenic regions encompassing amino acids VP1-43 to -45 (equivalent to antigenic site 3 in serotype O), VP2-191 and VP3-132 have been predicted as epitopes and evaluated serologically for serotype A FMDVs. This identifies novel capsid epitopes of recently circulating serotype A FMDVs in East Africa. PMID:25614587

Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

PubMed Central

Kirkegaard, K; Nelsen, B

1990-01-01

Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

Picornavirus proteins share antigenic determinants with heat shock proteins 60/65.

PubMed

Härkönen, T; Puolakkainen, M; Sarvas, M; Airaksinen, U; Hovi, T; Roivainen, M

2000-11-01

Immunological cross-reactions between enteroviruses and islet cell autoantigens have been suggested to play a role in the etiopathogenesis of insulin dependent diabetes mellitus (IDDM). In the nonobese diabetic mouse, an autoimmune model of IDDM, one of the reactive beta cell autoantigens is the heat shock protein 60 (HSP60). These studies were prompted by sequence homology discovered between the immunogenic region in HSP60 and two regions in enterovirus capsid proteins, one in the VP1 protein and the other in the VP0, the precursor of VP2 and VP4 proteins. Possible immunological cross-reactions between enterovirus proteins and heat shock proteins were studied by EIA and immunoblotting by using purified virus preparations, viral expression proteins VP1 and VP0, and recombinant HSP60/65 proteins, and corresponding polyclonal antisera. The HSP60/65 family of proteins is highly conserved and there is a striking degree of homology between bacterial and human heat shock proteins. Rabbit antibodies to HSP65 of Mycobacterium bovis that reacted with human HSP60 were also found to recognise capsid protein VP1 of coxsackievirus A9, VP1, and/or VP2 of coxsackievirus B4. Both viruses were also recognised by antisera raised against HSP60 of Chlamydia pneumoniae. In addition to the capsid proteins derived from native virions, antisera to both bacterial HSP proteins recognised expression protein VP1 of coxsackievirus A9. The cross-reactivity was also demonstrated the other way around; antisera to purified virus particles reacted with the HSP 60/65 proteins to some extent. These results suggest that apart from the well-documented sequence homology between the 2C protein of coxsackieviruses and the beta-cell autoantigen glutamic acid decarboxylase, there are other motifs in picornavirus proteins homologous to islet cell autoantigens, which might induce cross-reacting immune responses during picornavirus infections.

Prevalence, genetic diversity and recombination of species G enteroviruses infecting pigs in Vietnam

PubMed Central

Van Dung, Nguyen; Anh, Pham Hong; Van Cuong, Nguyen; Hoa, Ngo Thi; Carrique-Mas, Juan; Hien, Vo Be; Campbell, James; Baker, Stephen; Farrar, Jeremy; Woolhouse, Mark E.; Bryant, Juliet E.

2014-01-01

Picornaviruses infecting pigs, described for many years as ‘porcine enteroviruses’, have recently been recognized as distinct viruses within three distinct genera (Teschovirus, Sapelovirus and Enterovirus). To better characterize the epidemiology and genetic diversity of members of the Enterovirus genus, faecal samples from pigs from four provinces in Vietnam were screened by PCR using conserved enterovirus (EV)-specific primers from the 5′ untranslated region (5′ UTR). High rates of infection were recorded in pigs on all farms, with detection frequencies of approximately 90 % in recently weaned pigs but declining to 40 % in those aged over 1 year. No differences in EV detection rates were observed between pigs with and without diarrhoea [74 % (n = 70) compared with 72 % (n = 128)]. Genetic analysis of consensus VP4/VP2 and VP1 sequences amplified from a subset of EV-infected pigs identified species G EVs in all samples. Among these, VP1 sequence comparisons identified six type 1 and seven type 6 variants, while four further VP1 sequences failed to group with any previously identified EV-G types. These have now been formally assigned as EV-G types 8–11 by the Picornavirus Study Group. Comparison of VP1, VP4/VP2, 3Dpol and 5′ UTRs of study samples and those available on public databases showed frequent, bootstrap-supported differences in their phylogenies indicative of extensive within-species recombination between genome regions. In summary, we identified extremely high frequencies of infection with EV-G in pigs in Vietnam, substantial genetic diversity and recombination within the species, and evidence for a much larger number of circulating EV-G types than currently described. PMID:24323635

Oral immunization with recombinant enterovirus 71 VP1 formulated with chitosan protects mice against lethal challenge

PubMed Central

2014-01-01

Background Enterovirus 71 (EV71) is the etiologic agent of hand-foot-and-mouth disease (HFMD) in the Asia-Pacific region, Many strategies have been applied to develop EV71 vaccines but no vaccines are currently available. Mucosal immunization of the VP1, a major immunogenic capsid protein of EV71, may be an alternative way to prevent EV71 infection. Results In this study, mucosal immunogenicity and protect function of recombinant VP1 protein (rVP1) in formulation with chitosan were tested and assessed in female ICR mouse model. The results showed that the oral immunization with rVP1 induced VP1-specific IgA antibodies in intestine, feces, vagina, and the respiratory tract and serum-specific IgG and neutralization antibodies in vaccinated mice. Splenocytes from rVP1-immunized mice induced high levels of Th1 (cytokine IFN-γ), Th2 (cytokine IL-4) and Th3 (cytokine TGF-β) type immune responses after stimulation. Moreover, rVP1-immunized mother mice conferred protection (survival rate up to 30%) on neonatal mice against a lethal challenge of 103 plaque-forming units (PFU) EV71. Conclusions These data indicated that oral immunization with rVP1 in formulation with chitosan was effective in inducing broad-spectrum immune responses and might be a promising subunit vaccine candidate for preventing EV71 infection. PMID:24885121

Tomographic models and seismotectonics of the Reggio Emilia region, Italy

NASA Astrophysics Data System (ADS)

Ciaccio, M. G.; Chiarabba, C.

2002-02-01

The aim of this study is to define the Vp and Vp/Vs structure of the fault zone ruptured by the M L 5.1 earthquake of October 15, 1996 which occurred near Reggio Emilia (central-northern Italy). A 1-month-long seismic sequence followed the mainshock and occurred in a small region along the outer border of the northern Apenninic belt, at depth ranging between 10 and 17 km. P- and S-wave arrival times from 304 aftershocks recorded by two local dense seismic arrays installed in the epicentral region have been inverted to obtain one- and three-dimensional velocity models by using state of the art local earthquake tomographic techniques. Velocity models and aftershock relocation help us to infer the seismotectonic of the region. Earthquakes originated along a NW-dipping backthrust of a NE-trending main thrust, composing the western part of the broad Ferrara Arc. A main high Vp and high Vp/Vs region delineates a pop-up structure in the center of the area. The high Vp/Vs within the pop-up structure supports the presence of a zone with increased pore pressure. The hypocentral depth of both mainshock and aftershocks is greater than those usually found for the main seismogenic regions of the Apenninic belt. P-wave velocity values in the seismogenic area, obtained by tomography, are compatible with rocks of the Mesozoic cover and suggest that seismicity occurred within the Mesozoic units stack at present by compressional tectonics.

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

Tandem truncated rotavirus VP8* subunit protein with T cell epitope as non-replicating parenteral vaccine is highly immunogenic.

PubMed

Wen, Xiaobo; Cao, Dianjun; Jones, Ronald W; Hoshino, Yasutaka; Yuan, Lijuan

2015-01-01

The two currently available live oral rotavirus vaccines, Rotarix(®) and RotaTeq(®), are highly efficacious in the developed countries. However, the efficacy of such vaccines in resource deprived countries in Africa and Southeast Asia is low. We reported previously that a bacterially-expressed rotavirus P2-P[8] ΔVP8* subunit vaccine candidate administered intramuscularly elicited high-titers of neutralizing antibodies in guinea pigs and mice and significantly shortened the duration of diarrhea in neonatal gnotobiotic pigs upon oral challenge with virulent human rotavirus Wa strain. To further improve its vaccine potential and provide wider coverage against rotavirus strains of global and regional epidemiologic importance, we constructed 2 tandem recombinant VP8* proteins, P2-P[8] ΔVP8*-P[8] ΔVP8* and P2-P[8] ΔVP8*-P[6] ΔVP8* based on Escherichia coli expression system. The two resulting recombinant tandem proteins were highly soluble and P2-P[8] ΔVP8*-P[8] ΔVP8* was generated with high yield. Moreover, guinea pigs immunized intramuscularly by 3 doses of the P2-P[8] ΔVP8*-P[8] ΔVP8* or P2-P[8] ΔVP8*-P[6] ΔVP8* vaccine with aluminum phosphate adjuvant developed high titers of homotypic and heterotypic neutralizing antibodies against human rotaviruses bearing G1-G4, G8, G9 and G12 with P[8], P[4] or P[6] combination. The results suggest that these 2 subunit vaccines in monovalent or bivalent formulation can provide antigenic coverage to almost all the rotavirus G (VP7) types and major P (VP4) types of global as well as regional epidemiologic importance.

Structural insights into the multifunctional protein VP3 of birnaviruses.

PubMed

Casañas, Arnau; Navarro, Aitor; Ferrer-Orta, Cristina; González, Dolores; Rodríguez, José F; Verdaguer, Núria

2008-01-01

Infectious bursal disease virus (IBDV), a member of the Birnaviridae family, is the causative agent of one of the most harmful poultry diseases. The IBDV genome encodes five mature proteins; of these, the multifunctional protein VP3 plays an essential role in virus morphogenesis. This protein, which interacts with the structural protein VP2, with the double-stranded RNA genome, and with the virus-encoded, RNA-dependent RNA polymerase, VP1, is involved not only in the formation of the viral capsid, but also in the recruitment of VP1 into the capsid and in the encapsidation of the viral genome. Here, we report the X-ray structure of the central region of VP3, residues 92-220, consisting of two alpha-helical domains connected by a long and flexible hinge that are organized as a dimer. Unexpectedly, the overall fold of the second VP3 domain shows significant structural similarities with different transcription regulation factors.

Coexpression of VGLUT1 and VGLUT2 in trigeminothalamic projection neurons in the principal sensory trigeminal nucleus of the rat.

PubMed

Ge, Shun-Nan; Ma, Yun-Fei; Hioki, Hiroyuki; Wei, Yan-Yan; Kaneko, Takeshi; Mizuno, Noboru; Gao, Guo-Dong; Li, Jin-Lian

2010-08-01

VGLUT1 and VGLUT2 have been reported to show complementary distributions in most brain regions and have been assumed to define distinct functional elements. In the present study, we first investigated the expression of VGLUT1 and VGLUT2 in the trigeminal sensory nuclear complex of the rat by dual-fluorescence in situ hybridization. Although VGLUT1 and/or VGLUT2 mRNA signals were detected in all the nuclei, colocalization was found only in the principal sensory trigeminal nucleus (Vp). About 64% of glutamatergic Vp neurons coexpressed VGLUT1 and VGLUT2, and the others expressed either VGLUT1 or VGLUT2, indicating that Vp neurons might be divided into three groups. We then injected retrograde tracer into the thalamic regions, including the posteromedial ventral nucleus (VPM) and posterior nuclei (Po), and observed that the majority of both VGLUT1- and VGLUT2-expressing Vp neurons were retrogradely labeled with the tracer. We further performed anterograde labeling of Vp neurons and observed immunoreactivies for anterograde tracer, VGLUT1, and VGLUT2 in the VPM and Po. Most anterogradely labeled axon terminals showed immunoreactivities for both VGLUT1 and VGLUT2 in the VPM and made asymmetric synapses with dendritic profiles of VPM neurons. On the other hand, in the Po, only a few axon terminals were labeled with anterograde tracer, and they were positive only for VGLUT2. The results indicated that Vp neurons expressing VGLUT1 and VGLUT2 project to the VPM, but not to the Po, although the functional differences of three distinct populations of Vp neurons, VGLUT1-, VGLUT2-, and VGLUT1/VGLUT2-expressing ones, remain unsettled. (c) 2010 Wiley-Liss, Inc.

Canarypox virus expressing infectious bursal disease VP2 protein as immunogen for chickens

PubMed Central

Zanetti, Flavia Adriana; Grand, María Daniela Conte; Mitarotonda, Romina Cristina; Taboga, Oscar Alberto; Calamante, Gabriela

2014-01-01

Canarypox viruses (CNPV) carrying the coding sequence of VP2 protein from infectious bursal disease virus (IBDV) were obtained. These viruses were able to express VP2 protein in vitro and to induce IBDV-neutralizing antibodies when inoculated in specific pathogen-free chickens demonstrating that CNPV platform is usefulness to develop immunogens for chickens. PMID:24948937

Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia.

PubMed

Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee

2016-01-01

Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5' and 3' non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63-81% among themselves and 63-96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection.

Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia

PubMed Central

Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee

2016-01-01

Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5′ and 3′ non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63–81% among themselves and 63–96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection. PMID:27199901

Expression, Purification, Crystallization of Two Major Envelope Proteins from White Spot Syndrome Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang,X.; Hew, C.

2007-01-01

White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapor-diffusion method. Crystals of SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 Mmore » sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 {angstrom} resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 {angstrom}. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 {angstrom}, and diffracts to 2.0 {angstrom} resolution.« less

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

Antigenicity analysis of human parvovirus B19-VP1u protein in the induction of anti-phospholipid syndrome.

PubMed

Lin, Chun-Yu; Chiu, Chun-Ching; Cheng, Ju; Lin, Chia-Yun; Shi, Ya-Fang; Tsai, Chun-Chou; Tzang, Bor-Show; Hsu, Tsai-Ching

2018-01-01

Mounting evidence suggests a connection between human parvovirus B19 (B19) and autoimmune diseases, and especially an association between the B19-VP1 unique region (VP1u) and anti-phospholipid syndrome (APS). However, little is known about the antigenicity of B19-VP1u in the induction of APS-like syndrome. To elucidate the antigenicity of B19-VP1u in the induction of APS, N-terminal truncated B19-VP1u (tVP1u) proteins were prepared to immunize Balb/c mice to generate antibodies against B19-tVP1u proteins. The secreted phospholipase A2 (sPLA2) activities and binding specificity of mice anti-B19-tVP1u antibodies with cardiolipin (CL) and beta-2-glycoprotein I (β2GPI) were evaluated by performing immunoblot, ELISA and absorption experiments. A mice model of passively induced APS was adopted. Although sPLA2 activities were identified in all B19-tVP1u proteins, only amino acid residues 61-227 B19-tVP1u exhibited a higher sPLA2 activity. Autoantibodies against CL and β2GPI exhibited binding activities with all B19-tVP1u proteins. IgG that was purified from mice that had been immunized with amino acid residues 21-227 to 121-227 B19-tVP1u proteins exhibited significantly higher binding activity with CL. IgG that was purified from mice that had been immunized with amino acid residues 21-227, 31-227, 82-227 and 91-227 B19-tVP1u proteins exhibited significantly higher binding activity with β2GPI. Accordingly, significantly higher binding inhibition of CL was detected in the presence of amino acid residues 61-227 and 101-227 B19-tVP1u. Significantly higher binding inhibition of β2GPI was detected in the presence of amino acid residues 21-227, 31-227, 82-227 and 91-227 B19-tVP1u. The mice that received amino acid residues 31-227 or 61-227 anti-tB19-VP1u IgG revealed significant thrombocytopenia and those that received amino acid residues 21-227, 31-227, 61-227, 71-227, 82-227, 91-227, 101-227 or 114-227 anti-tB19-VP1u IgG exhibited significantly prolonged aPTT. These findings provide further information concerning the role of B19-VP1u antigenicity in APS-like autoimmunity.

Development of an efficient entire-capsid-coding-region amplification method for direct detection of poliovirus from stool extracts.

PubMed

Arita, Minetaro; Kilpatrick, David R; Nakamura, Tomofumi; Burns, Cara C; Bukbuk, David; Oderinde, Soji B; Oberste, M Steven; Kew, Olen M; Pallansch, Mark A; Shimizu, Hiroyuki

2015-01-01

Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Performance evaluation of the intra compression in the video coding standards

NASA Astrophysics Data System (ADS)

Abramowski, Andrzej

2015-09-01

The article presents a comparison of the Intra prediction algorithms in the current state-of-the-art video coding standards, including MJPEG 2000, VP8, VP9, H.264/AVC and H.265/HEVC. The effectiveness of techniques employed by each standard is evaluated in terms of compression efficiency and average encoding time. The compression efficiency is measured using BD-PSNR and BD-RATE metrics with H.265/HEVC results as an anchor. Tests are performed on a set of video sequences, composed of sequences gathered by Joint Collaborative Team on Video Coding during the development of the H.265/HEVC standard and 4K sequences provided by Ultra Video Group. According to results, H.265/HEVC provides significant bit-rate savings at the expense of computational complexity, while VP9 may be regarded as a compromise between the efficiency and required encoding time.

Development of a One-Step Duplex RT-PCR Method for the Simultaneous Detection of VP3/VP1 and VP1/P2B Regions of the Hepatitis A Virus.

PubMed

Kim, Mi-Ju; Lee, Shin-Young; Kim, Hyun-Joong; Lee, Jeong Su; Joo, In Sun; Kwak, Hyo Sun; Kim, Hae-Yeong

2016-08-28

The simultaneous detection and accurate identification of hepatitis A virus (HAV) is critical in food safety and epidemiological studies to prevent the spread of HAV outbreaks. Towards this goal, a one-step duplex reverse-transcription (RT)-PCR method was developed targeting the VP1/P2B and VP3/VP1 regions of the HAV genome for the qualitative detection of HAV. An HAV RT-qPCR standard curve was produced for the quantification of HAV RNA. The detection limit of the duplex RT-PCR method was 2.8 × 10(1) copies of HAV. The PCR products enabled HAV genotyping analysis through DNA sequencing, which can be applied for epidemiological investigations. The ability of this duplex RT-PCR method to detect HAV was evaluated with HAV-spiked samples of fresh lettuce, frozen strawberries, and oysters. The limit of detection of the one-step duplex RT-PCR for each food model was 9.4 × 10(2) copies/20 g fresh lettuce, 9.7 × 10(3) copies/20 g frozen strawberries, and 4.1 × 10(3) copies/1.5 g oysters. Use of a one-step duplex RT-PCR method has advantages such as shorter time, decreased cost, and decreased labor owing to the single amplification reaction instead of four amplifications necessary for nested RT-PCR.

[Genetic characterization of echovirus 6 isolated from meningitis and encephalitis cases in Shandong Province, China].

PubMed

Lin, Xiao-Juan; Tao, Ze-Xin; Liu, Gui-Fang; Wang, Min; Song, Li-Zhi; Wang, Su-Ting; Ji, Feng; Wang, Hai-Yan; Xu, Ai-Qiang

2014-03-01

To analyze the genetic characteristics of echovirus 6 (E6) isolated from meningitis and encephalitis cases in Shandong Province, China, we collected cerebrospinal fluid samples from meningitis and encephalitis cases in Shandong Province from 2007 to 2012 for virus isolation. Viral RNAs were extracted from positive isolates, and complete VP1 coding regions were amplified by RT-PCR and sequenced. Homology comparison and phylogenetic analysis were performed. Six isolates were identified as E6 by microneutralization assay and molecular typing. The homology analysis showed that the six isolates had 78. 6%-99. 8% nucleotide and 95. 5%-100. 0% amino acid identities with each other, as well as 76. 9%-78. 4% nucleotide and 92. 3%-95. 1% amino acid identities with the prototype strain (D' Amori). The phylogenetic analysis based on the integrated VP1 sequences indicated that all Shandong E6 isolates could be separated into four clusters, designated as A, B, C, and D. The six E6 isolates belonged to clusters A, B, and D. Our study reveals high genetic differences between Shandong E6 isolates and suggests different transmission lineages of E6 co-circulated in Shandong Province.

Seismicity, faulting, and structure of the Koyna-Warna seismic region, Western India from local earthquake tomography and hypocenter locations

NASA Astrophysics Data System (ADS)

Dixit, Madan M.; Kumar, Sanjay; Catchings, R. D.; Suman, K.; Sarkar, Dipankar; Sen, M. K.

2014-08-01

Although seismicity near Koyna Reservoir (India) has persisted for ~50 years and includes the largest induced earthquake (M 6.3) reported worldwide, the seismotectonic framework of the area is not well understood. We recorded ~1800 earthquakes from 6 January 2010 to 28 May 2010 and located a subset of 343 of the highest-quality earthquakes using the tomoDD code of Zhang and Thurber (2003) to better understand the framework. We also inverted first arrivals for 3-D Vp, Vs, and Vp/Vs and Poisson's ratio tomography models of the upper 12 km of the crust. Epicenters for the recorded earthquakes are located south of the Koyna River, including a high-density cluster that coincides with a shallow depth (<1.5 km) zone of relatively high Vp and low Vs (also high Vp/Vs and Poisson's ratios) near Warna Reservoir. This anomalous zone, which extends near vertically to at least 8 km depth and laterally northward at least 15 km, is likely a water-saturated zone of faults under high pore pressures. Because many of the earthquakes occur on the periphery of the fault zone, rather than near its center, the observed seismicity-velocity correlations are consistent with the concept that many of the earthquakes nucleate in fractures adjacent to the main fault zone due to high pore pressure. We interpret our velocity images as showing a series of northwest trending faults locally near the central part of Warna Reservoir and a major northward trending fault zone north of Warna Reservoir.

Mapping the hemagglutination domain of rotaviruses.

PubMed Central

Fuentes-Pananá, E M; López, S; Gorziglia, M; Arias, C F

1995-01-01

Most strains of animal rotaviruses are able to agglutinate erythrocytes, and the surface protein VP4 is the virus hemagglutinin. To map the hemagglutination domain on VP4 while preserving the conformation of the protein, we constructed full-length chimeras between the VP4 genes of hemagglutinating (YM) and nonhemagglutinating (KU) rotavirus strains. The parental and chimeric genes were expressed in insect cells, and the recombinant VP4 proteins were evaluated for their capacity to agglutinate human type O erythrocytes. Three chimeric genes, encoding amino acids 1 to 208 (QKU), 93 to 208 (QC), and 93 to 776 (QYM) of the YM VP4 protein in a KU VP4 background, were constructed. YM VP4 and chimeras QKU and QC were shown to specifically hemagglutinate, indicating that the region between amino acids 93 and 208 of YM VP4 is sufficient to determine the hemagglutination activity of the protein. PMID:7884915

VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones✰

PubMed Central

Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Venermo, Maria S Söderlund; Young, Neal S.; Brown, Kevin E.

2008-01-01

Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus. PMID:18252260

VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones.

PubMed

Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Söderlund-Venermo, Maria; Young, Neal S; Brown, Kevin E

2008-05-10

Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus.

Complete genomic sequence of an infectious pancreatic necrosis virus isolated from rainbow trout (Oncorhynchus mykiss) in China.

PubMed

Ji, Feng; Zhao, Jing-Zhuang; Liu, Miao; Lu, Tong-Yan; Liu, Hong-Bai; Yin, Jiasheng; Xu, Li-Ming

2017-04-01

Infectious pancreatic necrosis (IPN) is a significant disease of farmed salmonids resulting in direct economic losses due to high mortality in China. However, no gene sequence of any Chinese infectious pancreatic necrosis virus (IPNV) isolates was available. In the study, moribund rainbow trout fry samples were collected during an outbreak of IPN in Yunnan province of southwest China in 2013. An IPNV was isolated and tentatively named ChRtm213. We determined the full genome sequence of the IPNV ChRtm213 and compared it with previously identified IPNV sequences worldwide. The sequences of different structural and non-structural protein genes were compared to those of other aquatic birnaviruses sequenced to date. The results indicated that the complete genome sequence of ChRtm213 strain contains a segment A (3099 nucleotides) coding a polyprotein VP2-VP4-VP3, and a segment B (2789 nucleotides) coding a RNA-dependent RNA polymerase VP1. The phylogenetic analyses showed that ChRtm213 strain fell within genogroup 1, serotype A9 (Jasper), having similarities of 96.3% (segment A) and 97.3% (segment B) with the IPNV strain AM98 from Japan. The results suggest that the Chinese IPNV isolate has relative closer relationship with Japanese IPNV strains. The sequence of ChRtm213 was the first gene sequence of IPNV isolates in China. This study provided a robust reference for diagnosis and/or control of IPNV prevalent in China.

Antigenic and Genomic Diversity of Human Rotavirus VP4 in Two Consecutive Epidemic Seasons in Mexico

PubMed Central

Padilla-Noriega, Luis; Méndez-Toss, Martha; Menchaca, Griselda; Contreras, Juan F.; Romero-Guido, Pedro; Puerto, Fernando I.; Guiscafré, Héctor; Mota, Felipe; Herrera, Ismael; Cedillo, Roberto; Muñoz, Onofre; Calva, Juan; Guerrero, María de Lourdes; Coulson, Barbara S.; Greenberg, Harry B.; López, Susana; Arias, Carlos F.

1998-01-01

In the present investigation we characterized the antigenic diversity of the VP4 and VP7 proteins in 309 and 261 human rotavirus strains isolated during two consecutive epidemic seasons, respectively, in three different regions of Mexico. G3 was found to be the prevalent VP7 serotype during the first year, being superseded by serotype G1 strains during the second season. To antigenically characterize the VP4 protein of the strains isolated, we used five neutralizing monoclonal antibodies (MAbs) which showed specificity for VP4 serotypes P1A, P1B, and P2 in earlier studies. Eight different patterns of reactivity with these MAbs were found, and the prevalence of three of these patterns varied from one season to the next. The P genotype of a subset of 52 samples was determined by PCR. Among the strains characterized as genotype P[4] and P[8] there were three and five different VP4 MAb reactivity patterns, respectively, indicating that the diversity of neutralization epitopes in VP4 is greater than that previously appreciated by the genomic typing methods. PMID:9620401

Termination and read-through proteins encoded by genome segment 9 of Colorado tick fever virus.

PubMed

Mohd Jaafar, Fauziah; Attoui, Houssam; De Micco, Philippe; De Lamballerie, Xavier

2004-08-01

Genome segment 9 (Seg-9) of Colorado tick fever virus (CTFV) is 1884 bp long and contains a large open reading frame (ORF; 1845 nt in length overall), although a single in-frame stop codon (at nt 1052-1054) reduces the ORF coding capacity by approximately 40 %. However, analyses of highly conserved RNA sequences in the vicinity of the stop codon indicate that it belongs to a class of 'leaky terminators'. The third nucleotide positions in codons situated both before and after the stop codon, shows the highest variability, suggesting that both regions are translated during virus replication. This also suggests that the stop signal is functionally leaky, allowing read-through translation to occur. Indeed, both the truncated 'termination' protein and the full-length 'read-through' protein (VP9 and VP9', respectively) were detected in CTFV-infected cells, in cells transfected with a plasmid expressing only Seg-9 protein products, and in the in vitro translation products from undenatured Seg-9 ssRNA. The ratios of full-length and truncated proteins generated suggest that read-through may be down-regulated by other viral proteins. Western blot analysis of infected cells and purified CTFV showed that VP9 is a structural component of the virion, while VP9' is a non-structural protein.

Local Earthquakes Tomography in the Southern Tyrrhenian Region (Italy): Geophysical and Petrological Inferences on Subducting Lithosphere

NASA Astrophysics Data System (ADS)

Calo, M.; Dorbath, C.; Luzio, D.; Rotolo, S. G.; D'Anna, G.

2007-12-01

The Calabrian Arc, Southern Italy, is characterised by the subduction of the Ionian lithosphere -since Middle Miocene- beneath the Tyrrhenian basin. The related Benioff zone is seismically active to a depth > 500 km. The tomoDD code [Zhang and Thurber, 2003] was adopted to perform the tomography, using a set of 2463 earthquakes located in the window 14°30' E - 17°E and 37°N - 41°N, and recorded by seismic networks of the INGV in the period 1981-2005. Several inversions were performed using different selections of absolute and differential data obtained varying the maximum RMS and the threshold of the inter-event distance. Various synthetic and experimental tests were executed to evaluate the resolution and stability of the tomographic inversion. The inversions carried out for the synthetic and the restoration-resolution test [Zhao et al., 1992] were repeated several times with the same procedure used in the inversion of experimental data. The lack of bias in the models, related to the different grid- node positions, was tested performing inversions rotating, translating and deforming the original grid. To evaluate the dependence on the initial model, several inversions were also done using different 1D and 3D models simulating slab features. Finally, 35 models resulting from the inversions were synthesized in an average model obtained by interpolating each velocity model into a fixed grid. Each velocity value interpolated was weighted with a corresponding DWS (Derivative Weight Sum) resulting thus a Weighted Average Velocity model. The highly resolved sections through the average Vp, Vs and Vp/Vs models allowed us to image several relevant features of the structure of the subducting Ionian slab and of the Southern Tyrrhenian mantle: -the hypocenters are localized in the NW dipping fast area (Vp>8.2 km/s), 50-60 km thick, most likely composed litospheric mantle. Just below, an aseismic low Vp zone (6.6 - 7.7 km/s) 20-25 km thick, is assigned to the partially hydrated (serpentinized) harzburgite. The relation between the decrease of Vp with increasing serpentinization in peridotites [Christensen, 2004] suggests that a Vp of 7.0 km/s can be achieved with a 30-40 vol % of serpentinization. The serpentinized harzburgite, which should coincide with the inner (i.e. colder) portion of the suducting slab, disappears at a depth of 230-250 km, closely corresponding to the experimentally determined maximum pressure stability of antigorite-chlorite assemblages in hydrous peridotites [ca. 8.0 GPa, Schmidt and Poli, 1998; Fumagalli and Poli, 2005]. The vanishing of the low-velocity region with increasing depth could thus be ascribed to the dehydration of the peridotite-serpentinite to less hydrous high pressure phases (e.g. the phase A) , whose seismic characteristics are akin to anhydrous lherzolite [Hacker et al., 2003]. Some other interesting features imaged in the tomography are instead related to the roots of the volcanism of the area (Aeolian islands): two vertically elongated low-velocity areas (Vp ≤ 7.0 km/s) and high Vp/Vs ratios (>1.85) characterize the mantle domains beneath Stromboli and Marsili volcanoes, reaching a maximum depth of 180 km. We relate these low-Vp, Vs and high Vp/Vs bodies to accumulation of significant amounts of mantle partial melts.

Processing of the VP1/2A junction is not necessary for production of foot-and-mouth disease virus empty capsids and infectious viruses: characterization of "self-tagged" particles.

PubMed

Gullberg, Maria; Polacek, Charlotta; Bøtner, Anette; Belsham, Graham J

2013-11-01

The foot-and-mouth disease virus (FMDV) capsid protein precursor, P1-2A, is cleaved by 3C(pro) to generate VP0, VP3, VP1, and the peptide 2A. The capsid proteins self-assemble into empty capsid particles or viruses which do not contain 2A. In a cell culture-adapted strain of FMDV (O1 Manisa [Lindholm]), three different amino acid substitutions (E83K, S134C, and K210E) were identified within the VP1 region of the P1-2A precursor compared to the field strain (wild type [wt]). Expression of the O1 Manisa P1-2A (wt or with the S134C substitution in VP1) plus 3C(pro), using a transient expression system, resulted in efficient capsid protein production and self-assembly of empty capsid particles. Removal of the 2A peptide from the capsid protein precursor had no effect on capsid protein processing or particle assembly. However, modification of E83K alone abrogated particle assembly with no apparent effect on protein processing. Interestingly, the K210E substitution, close to the VP1/2A junction, completely blocked processing by 3C(pro) at this cleavage site, but efficient assembly of "self-tagged" empty capsid particles, containing the uncleaved VP1-2A, was observed. These self-tagged particles behaved like the unmodified empty capsids in antigen enzyme-linked immunosorbent assays and integrin receptor binding assays. Furthermore, mutant viruses with uncleaved VP1-2A could be rescued in cells from full-length FMDV RNA transcripts encoding the K210E substitution in VP1. Thus, cleavage of the VP1/2A junction is not essential for virus viability. The production of such engineered self-tagged empty capsid particles may facilitate their purification for use as diagnostic reagents and vaccines.

A Sabin 3-Derived Poliovirus Recombinant Contained a Sequence Homologous with Indigenous Human Enterovirus Species C in the Viral Polymerase Coding Region†

PubMed Central

Arita, Minetaro; Zhu, Shuang-Li; Yoshida, Hiromu; Yoneyama, Tetsuo; Miyamura, Tatsuo; Shimizu, Hiroyuki

2005-01-01

Outbreaks of poliomyelitis caused by circulating vaccine-derived polioviruses (cVDPVs) have been reported in areas where indigenous wild polioviruses (PVs) were eliminated by vaccination. Most of these cVDPVs contained unidentified sequences in the nonstructural protein coding region which were considered to be derived from human enterovirus species C (HEV-C) by recombination. In this study, we report isolation of a Sabin 3-derived PV recombinant (Cambodia-02) from an acute flaccid paralysis (AFP) case in Cambodia in 2002. We attempted to identify the putative recombination counterpart of Cambodia-02 by sequence analysis of nonpolio enterovirus isolates from AFP cases in Cambodia from 1999 to 2003. Based on the previously estimated evolution rates of PVs, the recombination event resulting in Cambodia-02 was estimated to have occurred within 6 months after the administration of oral PV vaccine (99.3% nucleotide identity in VP1 region). The 2BC and the 3Dpol coding regions of Cambodia-02 were grouped into the genetic cluster of indigenous coxsackie A virus type 17 (CAV17) (the highest [87.1%] nucleotide identity) and the cluster of indigenous CAV13-CAV18 (the highest [94.9%] nucleotide identity) by the phylogenic analysis of the HEV-C isolates in 2002, respectively. CAV13-CAV18 and CAV17 were the dominant HEV-C serotypes in 2002 but not in 2001 and in 2003. We found a putative recombination between CAV13-CAV18 and CAV17 in the 3CDpro coding region of a CAV17 isolate. These results suggested that a part of the 3Dpol coding region of PV3(Cambodia-02) was derived from a HEV-C strain genetically related to indigenous CAV13-CAV18 strains in 2002 in Cambodia. PMID:16188967

SU-E-I-37: Eye Lens Dose Reduction From CT Scan Using Organ Based Tube Current Modulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, H; Rensselaer Polytechnic Inst., Troy, NY; Liu, T

Purpose: To investigate the eye lens dose reduction by CT scan with organ based tube current modulation (OBTCM) using GPU Monte Carlo code ARCHER-CT. Methods: 36 X-ray sources and bowtie filters were placed around the patient head with the projection angle interval of 10° for one rotation of CT scan, each projection was simulated respectively. The voxel eye models with high resolution(0.1mm*0.1mm*0.1mm) were used in the simulation and different tube voltage including 80kVp, 100kVp, 120kVp and 140kVp were taken into consideration. Results: The radiation doses to the eye lens increased with the tube voltage raised from 80kVp to 140kVp, andmore » the dose results from 0° (AP) direction are much higher than those from 180° (PA) direction for all the 4 different tube voltage investigated. This 360° projection dose characteristic enables organ based TCM, which can reduce the eye lens dose by more than 55%. Conclusion: As the eye lens belongs to superficial tissues, its radiation dose to external exposure like CT is direction sensitive, and this characteristic feature makes organ based TCM to be an effective way to reduce the eye lens dose, so more clinical use of this technique were recommended. National Nature Science Foundation of China(No.11475047)« less

The Evolution of Vp1 Gene in Enterovirus C Species Sub-Group That Contains Types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99

PubMed Central

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific ‘signature’ amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific ‘signature’ amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared. PMID:24695547

The evolution of Vp1 gene in enterovirus C species sub-group that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99.

PubMed

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific 'signature' amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific 'signature' amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared.

Direct identification of non-polio enteroviruses in residual paralysis cases by analysis of VP1 sequences.

PubMed

Rahimi, Pooneh; Tabatabaie, H; Gouya, Mohammad M; Mahmudi, M; Musavi, T; Rad, K Samimi; Azad, T Mokhtari; Nategh, R

2009-06-01

The 66 serotypes of human enteroviruses (EVs) are classified into four species A-D, based on phylogenetic relationships in multiple genome regions. Partial VP(1) amplification and sequence analysis are reliable methods for identifying non-polio enterovirus serotypes, especially in negative cell culture specimens from patients with residual paralysis. In Iran during the years 2000-2002, there were 29 residual paralysis cases with negative cell (RD, HEp(2) and L(20)B) culture results. The genomic RNA was extracted from stool specimens from cases of residual paralysis and detected by amplification of the 5'-nontranslated region using RT-PCR with Pan-EV primers. Partial VP(1) amplification by semi-nested RT-PCR (snRT-PCR) and sequence analysis were done. Specimens from the 29 culture-negative cases contained echoviruses of six different serotypes. The global eradication of wild polioviruses is near and study of non-polio enteroviruses, which can cause poliomyelitis, is increasingly important to understand their pathogenesis. The VP(1) sequences, derived from the snRT-PCR products, allowed rapid molecular analysis of these non-polio strains.

Genetic characterization of the complete genome of a mutant canine parvovirus isolated in China.

PubMed

Li, Chuanfeng; Tang, Jingyu; Chen, Zongyan; Li, Qi; Huang, Zhenhua; Wang, Quan; Meng, Chunchun; Wang, Yong; Liu, Guangqing

2018-02-01

A field canine parvovirus (CPV) strain, CPV-SH14, was previously isolated from an outbreak of severe gastroenteritis in Shanghai in 2014. The complete genome of CPV-SH14 was determined by using PCR with modified primers. When compared to other CPV-2 strains, several insertions, deletions, and point mutations were identified in the 5' and 3' UTR, with key amino acid (aa) mutations (K19R, E572K in NS1 and F267Y, Y324I and T440A in VP2) also being observed in the coding regions of CPV-SH14. These results indicated that significant and unique genetic variations have occurred at key sites or residues in the genome of CPV-SH14, suggesting the presence of a novel genetic variant of new CPV-2a. Phylogenetic analysis of the VP2 gene revealed that CPV-SH14 may have the potential to spread worldwide. In conclusion, CPV-SH14 may be a novel genetic variant of new CPV-2a, potentially with a selective advantage over other strains.

Effects of Debris Entrainment and Multi-Phase Flow on Plug Loading in an MX Trench.

DTIC Science & Technology

1978-09-15

gas stream of density (pg) and velocity (Vg) is: -., * -) - * 2~ TD FD Pg (V P V) Vp-Vg I CD( TD ) (A.1) 4 where the drag coefficient (CD) is defined by...ATTN: FCPR ATTN: Code L53 , J. Forrest Field Command Naval Facilities Engineering Command Defense Nuclear Agency ATTN: Code 09M22C Livermore Division

Molecular characterization of two rare human G8P[14] rotavirus strains, detected in Italy in 2012.

PubMed

Delogu, Roberto; Ianiro, Giovanni; Morea, Anna; Chironna, Maria; Fiore, Lucia; Ruggeri, Franco M

2016-10-01

Since 2007, the Italian Rotavirus Surveillance Program (RotaNet-Italy) has monitored the diversity and distribution of genotypes identified in children hospitalized with rotavirus acute gastroenteritis. We report the genomic characterization of two rare human G8P[14] rotavirus strains, identified in two children hospitalized with acute gastroenteritis in the southern Italian region of Apulia during rotavirus strain surveillance in 2012. Both strains showed a G8-P[14]-I2-R2-C2-M2-A11-N2-T6-E2-H3 genomic constellation (DS-1-like genomic background). Phylogenetic analysis of each genome segment revealed a mixed configuration of genes of animal and zoonotic human origin, indicating that genetic reassortment events generated these unusual human strains. Eight out of 11 genes (VP1, VP2, VP3, VP6, VP7, NSP3, NSP4 and NSP5) of the Italian G8P[14] strains exhibited close identity with a Spanish sheep strain, whereas the remaining genes (VP4, NSP1 and NSP2) were more closely related to human strains. The amino acid sequences of the antigenic regions of outer capsid proteins VP4 and VP7 were compared with vaccine and field strains, showing high conservation between the amino acid sequences of Apulia G8P[14] strains and human and animal strains bearing G8 and/or P[14] proteins, and revealing many substitutions with respect to the RotaTeq™ and Rotarix™ vaccine strains. Conversely, the amino acid analysis of the four antigenic sites of VP6 revealed a high degree of conservation between the two Apulia strains and the human and animal strains analyzed. These results reinforce the potential role of interspecies transmission and reassortment in generating novel rotavirus strains that might not be fully contrasted by current vaccines. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular characterization of infectious pancreatic necrosis virus strains isolated from the three types of salmonids farmed in Chile.

PubMed

Manríquez, René A; Vera, Tamara; Villalba, Melina V; Mancilla, Alejandra; Vakharia, Vikram N; Yañez, Alejandro J; Cárcamo, Juan G

2017-01-31

The infectious pancreatic necrosis virus (IPNV) causes significant economic losses in Chilean salmon farming. For effective sanitary management, the IPNV strains present in Chile need to be fully studied, characterized, and constantly updated at the molecular level. In this study, 36 Chilean IPNV isolates collected over 6 years (2006-2011) from Salmo salar, Oncorhynchus mykiss, and Oncorhynchus kisutch were genotypically characterized. Salmonid samples were obtained from freshwater, estuary, and seawater sources from central, southern, and the extreme-south of Chile (35° to 53°S). Sequence analysis of the VP2 gene classified 10 IPNV isolates as genogroup 1 and 26 as genogroup 5. Analyses indicated a preferential, but not obligate, relationship between genogroup 5 isolates and S. salar infection. Fifteen genogroup 5 and nine genogroup 1 isolates presented VP2 gene residues associated with high virulence (i.e. Thr, Ala, and Thr at positions 217, 221, and 247, respectively). Four genogroup 5 isolates presented an oddly long VP5 deduced amino acid sequence (29.6 kDa). Analysis of the VP2 amino acid motifs associated with clinical and subclinical infections identified the clinical fingerprint in only genogroup 5 isolates; in contrast, the genogroup 1 isolates presented sequences predominantly associated with the subclinical fingerprint. Predictive analysis of VP5 showed an absence of transmembrane domains and plasma membrane tropism signals. WebLogo analysis of the VP5 BH domains revealed high identities with the marine birnavirus Y-6 and Japanese IPNV strain E1-S. Sequence analysis for putative 25 kDa proteins, coded by the ORF between VP2 and VP4, exhibited three putative nuclear localization sequences and signals of mitochondrial tropism in two isolates. This study provides important advances in updating the characterizations of IPNV strains present in Chile. The results from this study will help in identifying epidemiological links and generating specific biotechnological tools for controlling IPNV outbreaks in Chilean salmon farming.

Identification of binding domains in the herpes simplex virus type 1 small capsid protein pUL35 (VP26).

PubMed

Apcarian, Arin; Cunningham, Anthony L; Diefenbach, Russell J

2010-11-01

In this study, fragments of the small capsid protein pUL35 (VP26) from herpes simplex virus type 1 (HSV-1) were generated to identify binding domains for a number of known ligands. Analysis of the binding of dynein light chain subunits, DYNLT1 and DYNLT3, as well the HSV-1 structural proteins pUL19 (VP5) and pUL37 was then undertaken using the LexA yeast two-hybrid assay. The N-terminal half of pUL35, in particular residues 30-43, was identified as a common region for the binding of DYNLT1 and DYNLT3. Additional distinct regions in the C terminus of pUL35 also contribute to the binding of DYNLT1 and DYNLT3. In contrast, only the C-terminal half of pUL35 was found to mediate the binding of pUL19 and pUL37 through distinct regions. The relevance of this information to the role of pUL35 in viral transport and assembly is discussed.

Fluid-filled porosity of magmatic underplates from joint inversion of P and S receiver functions

NASA Astrophysics Data System (ADS)

Vinnik, Lev; Oreshin, Sergey; Makeyeva, Larissa; Dündar, Süleyman

2017-05-01

Vp/Vs ratio where Vp and Vs are P- and S-wave velocities is an indicator of rock composition, but estimates of Vp/Vs for the lower continental crust remain sparse. We present estimates of Vs, Vp and Vp/Vs in the crust of the Archean-Paleoproterozoic Siberian craton that are obtained by simultaneous inversion of P and S receiver functions from GSN seismograph stations NRIL, YAK and TIXI. These stations are located in the region of the Siberian traps (NRIL), close to the Laptev Sea Rift (TIXI) and the Viluy rift system (YAK). The most conspicuous result of our analysis is a high Vp/Vs ratio (≥2.0) at depths from 20-30 to 40 km. A very high Vp in this layer (from 7 to 8 km s-1) is indicative of magmatic underplating. We find broadly similar data in the western Mediterranean and in India. In a dry lower crust the Vp/Vs ratio is ∼1.8, which is hard to reconcile with the estimates >2.0. A coincidence in depths of zones of high electric conductivity and of anomalously high Vp/Vs in Siberia suggests that both may have the same origin: fluid-filled porosity. The porosity which is required by our seismic observations is on the order of 1 per cent. Origins of the fluids may be linked with processes of magmatic underplating.

Towards a next generation open-source video codec

NASA Astrophysics Data System (ADS)

Bankoski, Jim; Bultje, Ronald S.; Grange, Adrian; Gu, Qunshan; Han, Jingning; Koleszar, John; Mukherjee, Debargha; Wilkins, Paul; Xu, Yaowu

2013-02-01

Google has recently been developing a next generation opensource video codec called VP9, as part of the experimental branch of the libvpx repository included in the WebM project (http://www.webmproject.org/). Starting from the VP8 video codec released by Google in 2010 as the baseline, a number of enhancements and new tools have been added to improve the coding efficiency. This paper provides a technical overview of the current status of this project along with comparisons and other stateoftheart video codecs H. 264/AVC and HEVC. The new tools that have been added so far include: larger prediction block sizes up to 64x64, various forms of compound INTER prediction, more modes for INTRA prediction, ⅛pel motion vectors and 8tap switchable subpel interpolation filters, improved motion reference generation and motion vector coding, improved entropy coding and framelevel entropy adaptation for various symbols, improved loop filtering, incorporation of Asymmetric Discrete Sine Transforms and larger 16x16 and 32x32 DCTs, frame level segmentation to group similar areas together, etc. Other tools and various bitstream features are being actively worked on as well. The VP9 bitstream is expected to be finalized by earlyto mid2013. Results show VP9 to be quite competitive in performance with mainstream stateoftheart codecs.

The Kinase STK3 Interacts with the Viral Structural Protein VP1 and Inhibits Foot-and-Mouth Disease Virus Replication

PubMed Central

Xue, Qiao

2017-01-01

Foot-and-mouth disease virus (FMDV) is the etiological agent of FMD, which affects domestic and wild cloven-hoofed animals. The structural protein VP1 plays an important role in FMDV pathogenesis. However, the interacting partners of VP1 in host cells and the effects of these interactions in FMDV replication remain incompletely elucidated. Here, we identified a porcine cell protein, serine/threonine kinase 3 (STK3), which interacts with FMDV VP1 using the yeast two-hybrid system. The VP1-STK3 interaction was further confirmed by coimmunoprecipitation experiments in human embryonic kidney 293T and porcine kidney 15 (PK-15) cells. The carboxyl-terminal region (amino acids 180–214) of VP1 was essential for its interaction with STK3. The effects of overexpression and underexpressing of STK3 in PK-15 cells were assessed, and the results indicated that STK3 significantly inhibited FMDV replication. Our data expand the role of STK3 during viral infection, provide new information regarding the host cell kinases that are involved in viral replication, and identify potential targets for future antiviral strategies. PMID:29226127

Simultaneous Determination of Vinpocetine and its Major Active Metabolite Apovincaminic Acid in Rats by UPLC-MS/MS and its Application to the Brain Tissue Distribution Study.

PubMed

Wang, Manman; Wang, Lijuan; Sun, Jinghan; Zhang, Lili; Zhao, Longshan; Xiong, Zhili

2018-03-01

A specific, rapid and sensitive ultra-performance liquid chromatography-tandem mass spectrometric (UPLC-MS/MS) method was developed for simultaneous determination of vinpocetine (VP) and its active metabolite, apovincaminic acid (AVA) in rat brain regions, such as hypothalamus, striatum, cortex, cerebellum and hippocampus. Phenacetin was used as internal standard (IS). Brain tissue samples were precipitated protein by using 500 μL methanol. The separation was achieved on a Waters ACQUITY UPLC BEH C18 column (100 mm × 2.1 mm, 1.7 μm), using a methanol-water gradient elution at the flow rate of 0.20 mL/min. The detection was performed on a triple quadrupole tandem mass spectrometer in multiple reaction monitoring (MRM) mode via positive electrospray ionization source (ESI). The quantification was operated using the transitions of m/z 351 → m/z 280 for VP, m/z 323 → m/z 280 for AVA and m/z 180 → m/z 110 for IS, respectively. The calibration curve was linear in concentration range from 0.100 to 60.0 ng/mL for VP and 0.103 to 6.18 ng/mL for AVA. The intra-day and inter-day precision (relative standard deviation, RSD) values were within 11.8%, the accuracy (relative error, RE) was from -1.7% to 3.0% for VP and 2.7% to 9.5% for AVA at all the three concentration levels of quality-control (QC) samples. The improved UPLC-MS/MS method was specific, rapid and sensitive, which was further successfully applied to simultaneous determination of VP and AVA in different rat brain regions after intragastric administration of 4 mg/kg VP. It was indicated that VP could be eliminated quickly in brain, while the elimination of AVA was slow and it could be maintained for more than 12 h in brain. Moreover, it was found that the contents of VP and AVA were much higher in the hypothalamus, striatum and cortex than those in the cerebellum and hippocampus, which verified the distribution characteristics of VP and AVA in different brain regions from the point of quantitation in rats.

Seismicity, faulting, and structure of the Koyna-Warna seismic region, Western India from local earthquake tomography and hypocenter locations

USGS Publications Warehouse

Dixit, Madan M.; Kumar, Sanjay; Catchings, Rufus D.; Suman, K.; Sarkar, Dipankar; Sen, M.K.

2014-01-01

Although seismicity near Koyna Reservoir (India) has persisted for ~50 years and includes the largest induced earthquake (M 6.3) reported worldwide, the seismotectonic framework of the area is not well understood. We recorded ~1800 earthquakes from 6 January 2010 to 28 May 2010 and located a subset of 343 of the highest-quality earthquakes using the tomoDD code of Zhang and Thurber (2003) to better understand the framework. We also inverted first arrivals for 3-D Vp, Vs, and Vp/Vs and Poisson's ratio tomography models of the upper 12 km of the crust. Epicenters for the recorded earthquakes are located south of the Koyna River, including a high-density cluster that coincides with a shallow depth (<1.5 km) zone of relatively high Vp and low Vs (also high Vp/Vs and Poisson's ratios) near Warna Reservoir. This anomalous zone, which extends near vertically to at least 8 km depth and laterally northward at least 15 km, is likely a water-saturated zone of faults under high pore pressures. Because many of the earthquakes occur on the periphery of the fault zone, rather than near its center, the observed seismicity-velocity correlations are consistent with the concept that many of the earthquakes nucleate in fractures adjacent to the main fault zone due to high pore pressure. We interpret our velocity images as showing a series of northwest trending faults locally near the central part of Warna Reservoir and a major northward trending fault zone north of Warna Reservoir.

Evolution of foot-and-mouth disease virus serotype A capsid coding (P1) region on a timescale of three decades in an endemic context.

PubMed

Das, Biswajit; Mohapatra, Jajati K; Pande, Veena; Subramaniam, Saravanan; Sanyal, Aniket

2016-07-01

Three decades-long (1977-2013) evolutionary trend of the capsid coding (P1) region of foot-and-mouth disease virus (FMDV) serotype A isolated in India was analysed. The exclusive presence of genotype 18 since 2001 and the dominance of the VP3(59)-deletion group of genotype 18 was evident in the recent years. Clade 18c was found to be currently the only active one among the three clades (18a, 18b and 18c) identified in the deletion group. The rate of evolution of the Indian isolates at the capsid region was found to be 4.96×10(-3)substitutions/site/year. The timescale analysis predicted the most recent common ancestor to have existed during 1962 for Indian FMDV serotype A and around 1998 for the deletion group. The evolutionary pattern of serotype A in India appears to be homogeneous as no spatial or temporal structure was observed. Bayesian skyline plots indicate a sharp decline in the effective number of infections after 2008, which might be a result of mass vaccination or inherent loss of virus fitness. Analyses of variability at 38 known antigenically critical positions in a countrywide longitudinal data set suggested that the substitutions neither followed any specific trend nor remained fixed for a long period since frequent reversions and convergence was noticed. A maximum of 6 different amino acid residues was seen in the gene pool at any antigenically critical site over the decades, suggesting a limited combination of residues being responsible for the observed antigenic variation. Evidence of positive selection at some of the antigenically critical residues and the structurally proximal positions suggest a possible role of pre-existing immunity in the host population in driving evolution. The VP1 C-terminus neither revealed variability nor positive selection, suggesting the possibility that this stretch does not contribute to the antigenic variation and adaptation under immune selection. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation and characterization of two VpYABBY genes from wild Chinese Vitis pseudoreticulata.

PubMed

Xiang, J; Liu, R Q; Li, T M; Han, L J; Zou, Y; Xu, T F; Wei, J Y; Wang, Y J; Xu, Y

2013-12-01

The establishment of abaxial-adaxial polarity is an important feature of the development of lateral organs in plants. Members of the YABBY gene family may be specific to seed-plant-specific transcriptional regulators that play critical roles in promoting abaxial cell fate in the model eudicot, Arabidopsis thaliana. However, recent study has shown that the roles of YABBY genes are not conserved in the development of angiosperms. The establishment of abaxial-adaxial polarity has not been studied in perennial fruit crops. Grapes are an important fruit crop in many regions of the world. Investigating YABBY genes in grapevines should help us to discover more about the key genetic and molecular pathways in grapevine development. To understand the characterization of YABBY genes in grapevines, two YABBY genes, VpYABBY1 (GenBank accession No. KC139089) and VpYABBY2 (GenBank accession No. KC139090), were isolated from the wild Chinese species Vitis pseudoreticulata. Both of these encode YABBY proteins. Sequence characterization and phylogenetic analyses show that VpYABBY1 is group classified into the FIL subfamily while VpYABBY2 is a member of the YAB2 subfamily of Arabidopsis thaliana. Subcellular localization analysis indicates that VpYABBY1 and VpYABBY2 proteins are localized in the nucleus. Tissue specific expressional analysis reveals that VpYABBY1 is expressed strongly in young leaves of grape but only weakly in the mature leaves. Meanwhile, VpYABBY2 is expressed in grape stems, flowers, tendrils, and leaves. Transgenic Arabidopsis plants ectopically expressing VpYABBY1 caused the partial abaxialization of the adaxial epidermises of leaves, behaving similarly to those over-expressing FIL or YAB3 with abaxialized lateral organs. By contrast, ectopic expression of VpYABBY2 in Arabidopsis did not cause any alteration in the adaxial-abaxial polarity. Sequence characterization and phylogenetic analysis revealed that VpYABBY1 and VpYABBY2 are group-classified into two different subfamilies. They have diverged functionally in the control of lateral organ development. VpYABBY1 may have a function in leaf development, while VpYABBY2 may play a specific role in carpel development and grape berry morphogenesis. It is further possible that during the evolution of different species, YABBY family members have preserved different expression regulatory systems and functions.

Trypsin activation pathway of rotavirus infectivity.

PubMed Central

Arias, C F; Romero, P; Alvarez, V; López, S

1996-01-01

The infectivity of rotaviruses is increased by and most probably is dependent on trypsin treatment of the virus. This proteolytic treatment specifically cleaves VP4, the protein that forms the spikes on the surface of the virions, to polypeptides VP5 and VP8. This cleavage has been reported to occur in rotavirus SA114fM at two conserved, closely spaced arginine residues located at VP4 amino acids 241 and 247. In this work, we have characterized the VP4 cleavage products of rotavirus SA114S generated by in vitro treatment of the virus with increasing concentrations of trypsin and with proteases AspN and alpha-chymotrypsin. The VP8 and VP5 polypeptides were analyzed by gel electrophoresis and by Western blotting (immunoblotting) with antibodies raised to synthetic peptides that mimic the terminal regions of VP4 generated by the trypsin cleavage. It was shown that in addition to arginine residues 241 and 247, VP4 is cleaved at arginine residue 231. These three sites were found to have different susceptibilities to trypsin, Arg-241 > Arg-231 > Arg-247, with the enhancement of infectivity correlating with cleavage at Arg-247 rather than at Arg-231 or Arg-241. Proteases AspN and alpha-chymotrypsin cleaved VP4 at Asp-242 and Tyr-246, respectively, with no significant enhancement of infectivity, although this enhancement could be achieved by further treatment of the virus with trypsin. The VP4 end products of trypsin treatment were a homogeneous VP8 polypeptide comprising VP4 amino acids 1 to 231 and a heterogeneous VP5, which is formed by two polypeptide species (present at a ratio of approximately 1:5) as a result of cleavage at either Arg-241 or Arg-247. A pathway for the trypsin activation of rotavirus infectivity is proposed. PMID:8709201

ATLAS event display: Virtual Point-1 visualization software

NASA Astrophysics Data System (ADS)

Seeley, Kaelyn; Dimond, David; Bianchi, R. M.; Boudreau, Joseph; Hong, Tae Min; Atlas Collaboration

2017-01-01

Virtual Point-1 (VP1) is an event display visualization software for the ATLAS Experiment. VP1 is a software framework that makes use of ATHENA, the ATLAS software infrastructure, to access the complete detector geometry. This information is used to draw graphics representing the components of the detector at any scale. Two new features are added to VP1. The first is a traditional ``lego'' plot, displaying the calorimeter energy deposits in eta-phi space. The second is another lego plot focusing on the forward endcap region, displaying the energy deposits in r-phi space. Currently, these new additions display the energy deposits based on the granularity of the middle layer of the liquid-Argon electromagnetic calorimeter. Since VP1 accesses the complete detector geometry and all experimental data, future developments are outlined for a more detailed display involving multiple layers of the calorimeter along with their distinct granularities.

Crustal structure beneath northeast India inferred from receiver function modeling

NASA Astrophysics Data System (ADS)

Borah, Kajaljyoti; Bora, Dipok K.; Goyal, Ayush; Kumar, Raju

2016-09-01

We estimated crustal shear velocity structure beneath ten broadband seismic stations of northeast India, by using H-Vp/Vs stacking method and a non-linear direct search approach, Neighbourhood Algorithm (NA) technique followed by joint inversion of Rayleigh wave group velocity and receiver function, calculated from teleseismic earthquakes data. Results show significant variations of thickness, shear velocities (Vs) and Vp/Vs ratio in the crust of the study region. The inverted shear wave velocity models show crustal thickness variations of 32-36 km in Shillong Plateau (North), 36-40 in Assam Valley and ∼44 km in Lesser Himalaya (South). Average Vp/Vs ratio in Shillong Plateau is less (1.73-1.77) compared to Assam Valley and Lesser Himalaya (∼1.80). Average crustal shear velocity beneath the study region varies from 3.4 to 3.5 km/s. Sediment structure beneath Shillong Plateau and Assam Valley shows 1-2 km thick sediment layer with low Vs (2.5-2.9 km/s) and high Vp/Vs ratio (1.8-2.1), while it is observed to be of greater thickness (4 km) with similar Vs and high Vp/Vs (∼2.5) in RUP (Lesser Himalaya). Both Shillong Plateau and Assam Valley show thick upper and middle crust (10-20 km), and thin (4-9 km) lower crust. Average Vp/Vs ratio in Assam Valley and Shillong Plateau suggest that the crust is felsic-to-intermediate and intermediate-to-mafic beneath Shillong Plateau and Assam Valley, respectively. Results show that lower crust rocks beneath the Shillong Plateau and Assam Valley lies between mafic granulite and mafic garnet granulite.

A Simple and Reliable Strategy for BK Virus Subtyping and Subgrouping

PubMed Central

Morel, Virginie; Martin, Elodie; François, Catherine; Helle, François; Faucher, Justine; Mourez, Thomas; Choukroun, Gabriel; Duverlie, Gilles; Castelain, Sandrine

2017-01-01

ABSTRACT BK virus (BKV)-associated diseases in transplant recipients are an emerging issue. However, identification of the various BK virus subtypes/subgroups is a long and delicate process on the basis of currently available data. Therefore, we wanted to define a simple and effective one-step strategy for characterizing all BK virus strains from the VP1 gene sequence. Based on the analysis of 199 available complete DNA VP1 sequences, phylogenetic trees, alignments, and isolated polymorphisms were used to define an effective strategy for distinguishing the 12 different BK virus subtypes/subgroups. Based on the 12 subtypes identified from the 199 complete BKV VP1 sequences (1,089 bp), 60 mutations that can be used to differentiate these various subtypes/subgroups were identified. Some genomic areas were more variable and comprised mutational hot spots. From a subregion of only 100 bp in the VP1 region (1977 through 2076), we therefore constructed an algorithm that enabled rapid determination of all BKV subtypes/subgroups with 99% agreement (197/199) relative to the complete VP1 sequence. We called this domain of the BK viral genome the BK typing and grouping region (BKTGR). Finally, we validated our viral subtype identification process in a population of 100 transplant recipients with 100% efficiency. The new simpler method of BKV subtyping/subgrouping reported here constitutes a useful tool for future studies that will help us to more clearly understand the impact of BKV subtypes/subgroups on diagnosis, infection, and BK virus-associated diseases. PMID:28151406

Wild poliovirus circulation among healthy children immunized with oral polio vaccine in Antananarivo, Madagascar.

PubMed

Andrianarivelo, M R; Rabarijaona, L; Boisier, P; Chezzi, C; Zeller, H G

1999-01-01

From July 1995 to December 1996, 3185 stool specimens from healthy children aged 6-59 months attending 6 dispensaries in the Antananarivo area were examined for poliovirus. The children had been routinely immunized according to the Expanded Programme on Immunization (EPI) schedule and received the last dose of oral polio vaccine (OPV) more than 1 month before stool collection. 99.4% of the children were immunized with at least 3 doses of OPV. HEp-2 cell culture revealed virus infections in 192 stools (6.0%), including 9 poliovirus (0.3%) and 183 nonpolio enterovirus isolates (5.7%). Infections occurred throughout the year, but incidence was higher during the hot and rainy season (P=0.01). Using a neutralization test with monoclonal antibodies and PCR-RFLP in two genomic regions coding for the VP1 capsid and RNA polymerase, 4 wild polioviruses (3 type 1 and 1 type 3) and 5 vaccine-related polioviruses (2 Sabin 1-like variants, 1 Sabin 2-like and 2 Sabin 3-like) strains were identified. The wild polioviruses were isolated at the beginning and the end of the dry season. Similar RFLP patterns were observed for the 3 wild type 1 polioviruses. Comparison of partial genomic sequences in the VP1/2 A region of 1 of the wild type 1 isolates with 2 wild type strains isolated in Antananarivo in 1992 and 1993 showed a divergence of at least 10% between the strains, suggesting at least two different pathways of transmission during this period. Our findings demonstrate that immunization with 3 doses of OPV did not prevent intestinal carriage of wild poliovirus strains, and that there is a risk of wild poliovirus transmission to susceptible children in the area. Multiple strategies are required to improve immunization coverage in Madagascar.

Constraint on the magma sources in Luzon Island Philippines by using P and S wave local seismic tomography

NASA Astrophysics Data System (ADS)

Nghia, N. C.; Huang, B. S.; Chen, P. F.

2017-12-01

The subduction of South China Sea beneath the Luzon Island has caused a complex setting of seismicity and magmatism because of the proposed ridge subduction and slab tearing. To constrain the validity of slab tearing induced by ridge subduction and their effect, we performed a P and S wave seismic tomography travel time inversion using LOTOS code. The dataset has been retrieved from International Seismological Centre from 1960 to 2008. A 1D velocity inverted by using VELEST with a Vp/Vs ratio of 1.74 is used as the starting input velocity for tomographic inversion. Total of 20905 P readings and 8126 S readings from 2355 earthquakes events were used to invert for velocity structure beneath Luzon Island. The horizontal tomographic results show low-velocity, high Vp/Vs regions at the shallow depth less than 50 km which are interpreted as the magmatic chambers of the volcanic system in Luzon. At the suspected region of slab tearing at 16oN to 18oN, two sources of magma have been indentified: slab window magma at shallow depth (< 50 km) and magma induced by mantle wedge partial melting from higher depth. This slab melting may have changed the composition of magmatic to become more silicic with high viscosity, which explains the volcanic gap in this region. At the region of 14oN to 15oN, large magma chambers under active volcanos are identified which explain the active volcanism in this region. Contrast to the region of slab tearing, in this region, the magma chambers are fed by only magma from partial melting of mantle wedge from the depth higher than 100 km. These observations are consistent with previous work on the slab tearing of South China Sea and the activities of volcanism in the Luzon Island.

SU-F-P-59: Detection of Missing Surgical Needles with Intraoperative Mobile X-Ray

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, L; Berger, B

Purpose: To determine the minimal detectable size of a surgical needle using intraoperative mobile x-ray imaging. Also, varying techniques such as low kVp and high tube current were tested to investigate whether this improved the detection of the various needle sizes. Methods: Seven surgical needle sizes, 6.5, 8, 11, 13, 16, 17 and 19 mm, were positioned on three regions (thoracic, abdominal and pelvic) of an adult size anthropomorphic RANDO phantom. The phantom represents an average size adult. The phantom, in front of detector, was imaged with 44” x-ray tube to detector distance. For the thoracic region, each needle sizemore » was imaged 4 times using the following technique (81 kVp at 32 mAs and 200 mAs; then 100 kVp at 32 mAs and 200 mAs. This was repeated for the abdominal and pelvic regions of the phantom. The images were reviewed by a board certified diagnostic radiologist. Results: The surgical needles sized 13 mm and above were visible at all three body regions using all four kVp and mAs combinations. For surgical needle sizes 8 and 11 mm, the visibility of needle was ambiguous in thoracic region and barely visible abdominal and pelvic regions. Surgical needles, with size smaller than 8 mm, could not be visualized on x-ray with unassisted eyesight. The detectability of the smaller sized needles was not improved with increasing mAs or decreasing kVp. Conclusion: Surgical needle sizes less that 13 mm were not visualized with intraoperative mobile x-ray imaging using various mAs and kVp combinations. Intraoperative mobile x-ray is not recommended to locate surgical needle sizes less than 13 mm for the following reasons: (1) it prevents unnecessary radiation exposure to patient, (2) it avoids the delay time with wound closure and completion of the operative procedure, and (3) it saves radiologist reading time.« less

Fluid-filled porosity of magmatic underplates from joint inversion of P and S receiver functions

NASA Astrophysics Data System (ADS)

Vinnik, Lev; Oreshin, Sergey; Makeyeva, Larissa; Dündar, Süleyman

2017-04-01

Vp/Vs ratio where Vp and Vs are P- and S-wave velocities is an indicator of rock composition, but estimates of Vp/Vs for the lower continental crust remain sparse. We present estimates of Vs, Vp and Vp/Vs in the crust of the Archean-Paleoproterozoic Siberian craton that are obtained by simultaneous inversion of P and S receiver functions from GSN seismograph stations NRIL, YAK and TIXI. These stations are located in the region of the Siberian traps (NRIL), close to the Laptev Sea Rift (TIXI) and the Viluy rift system (YAK). The most conspicuous result of our analysis is a high Vp/Vs ratio (≥2.0) at depths from 20-30 km to 40 km. A very high Vp in this layer (from 7 to 8 km/s) is indicative of magmatic underplating. We find broadly similar data in the western Mediterranean and in India. In a dry lower crust the Vp/Vs ratio is 1.8, which is hard to reconcile with the estimates > 2.0. A coincidence in depths of zones of high electric conductivity and of anomalously high Vp/Vs in Siberia suggests that both may have the same origin: fluid-filled porosity. The porosity which is required by our seismic observations is on the order of 1%. Origins of the fluids may be linked with processes of magmatic underplating.

Qualitative and quantitative evaluation of rigid and deformable motion correction algorithms using dual-energy CT images in view of application to CT perfusion measurements in abdominal organs affected by breathing motion

PubMed Central

Skornitzke, S; Fritz, F; Klauss, M; Pahn, G; Hansen, J; Hirsch, J; Grenacher, L; Kauczor, H-U

2015-01-01

Objective: To compare six different scenarios for correcting for breathing motion in abdominal dual-energy CT (DECT) perfusion measurements. Methods: Rigid [RRComm(80 kVp)] and non-rigid [NRComm(80 kVp)] registration of commercially available CT perfusion software, custom non-rigid registration [NRCustom(80 kVp], demons algorithm) and a control group [CG(80 kVp)] without motion correction were evaluated using 80 kVp images. Additionally, NRCustom was applied to dual-energy (DE)-blended [NRCustom(DE)] and virtual non-contrast [NRCustom(VNC)] images, yielding six evaluated scenarios. After motion correction, perfusion maps were calculated using a combined maximum slope/Patlak model. For qualitative evaluation, three blinded radiologists independently rated motion correction quality and resulting perfusion maps on a four-point scale (4 = best, 1 = worst). For quantitative evaluation, relative changes in metric values, R2 and residuals of perfusion model fits were calculated. Results: For motion-corrected images, mean ratings differed significantly [NRCustom(80 kVp) and NRCustom(DE), 3.3; NRComm(80 kVp), 3.1; NRCustom(VNC), 2.9; RRComm(80 kVp), 2.7; CG(80 kVp), 2.7; all p < 0.05], except when comparing NRCustom(80 kVp) with NRCustom(DE) and RRComm(80 kVp) with CG(80 kVp). NRCustom(80 kVp) and NRCustom(DE) achieved the highest reduction in metric values [NRCustom(80 kVp), 48.5%; NRCustom(DE), 45.6%; NRComm(80 kVp), 29.2%; NRCustom(VNC), 22.8%; RRComm(80 kVp), 0.6%; CG(80 kVp), 0%]. Regarding perfusion maps, NRCustom(80 kVp) and NRCustom(DE) were rated highest [NRCustom(80 kVp), 3.1; NRCustom(DE), 3.0; NRComm(80 kVp), 2.8; NRCustom(VNC), 2.6; CG(80 kVp), 2.5; RRComm(80 kVp), 2.4] and had significantly higher R2 and lower residuals. Correlation between qualitative and quantitative evaluation was low to moderate. Conclusion: Non-rigid motion correction improves spatial alignment of the target region and fit of CT perfusion models. Using DE-blended and DE-VNC images for deformable registration offers no significant improvement. Advances in knowledge: Non-rigid algorithms improve the quality of abdominal CT perfusion measurements but do not benefit from DECT post processing. PMID:25465353

RNA binding specificity of Ebola virus transcription factor VP30.

PubMed

Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K

2016-09-01

The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

Genomic Surveillance Elucidates Persistent Wild Poliovirus Transmission During 2013-2015 in Major Reservoir Areas of Pakistan.

PubMed

Alam, Muhammad Masroor; Sharif, Salmaan; Shaukat, Shahzad; Angez, Mehar; Khurshid, Adnan; Rehman, Lubna; Zaidi, Syed Sohail Zahoor

2016-01-15

Despite tremendous efforts in the fight against polio, Pakistan bears the highest proportion of poliomyelitis cases among the 3 endemic countries including Afghanistan and Nigeria. Apart from insecurity and inaccessibility challenges, the substantial shift of unimmunized children from North Waziristan due to recent military operations was presumed to favor the widespread poliovirus infection in Pakistan. To better understand the current epidemiological situation, we analyzed the virologic data of wild poliovirus type 1 (WPV1) strains detected in Pakistan during 2013-2015. Five genetic clusters (A-E) were identified with at least 5% nucleotide divergence in the viral protein 1 (VP1) coding region. Peshawar, Quetta, and Karachi were found to be the major endemic foci where multiple discrete genetic lineages of WPV1 were detected. Phylogenetic analysis suggests that wild poliovirus strains from endemic regions were genetically distant (with 5%-15% VP1 nucleotide divergence) from those detected in North Waziristan cases, excluding the possibility of a recent progenitor of WPV1 instigating single-source transmission across the country. Orphan lineages detected in Rawalpindi, Lahore, Hyderabad, Sukkur, and Jacobabad revealed silent transmission and the need for vigilant surveillance. Sustenance of analogous genetic lineages over a period of 3 years highlights multiple unimmunized foci present to maintain viral genetic diversity. Our findings are inconsistent with the hypothesis that impoverished populations from North Waziristan serve as a possible determinant of widespread poliomyelitis infection in Pakistan and further emphasize the need to scale-up clinical and environmental surveillance as well as immunization activities. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Group A Human Rotavirus Genomics: Evidence that Gene Constellations Are Influenced by Viral Protein Interactions▿ †

PubMed Central

Heiman, Erica M.; McDonald, Sarah M.; Barro, Mario; Taraporewala, Zenobia F.; Bar-Magen, Tamara; Patton, John T.

2008-01-01

Group A human rotaviruses (HRVs) are the major cause of severe viral gastroenteritis in infants and young children. To gain insight into the level of genetic variation among HRVs, we determined the genome sequences for 10 strains belonging to different VP7 serotypes (G types). The HRVs chosen for this study, D, DS-1, P, ST3, IAL28, Se584, 69M, WI61, A64, and L26, were isolated from infected persons and adapted to cell culture to use as serotype references. Our sequencing results revealed that most of the individual proteins from each HRV belong to one of three genotypes (1, 2, or 3) based on their similarities to proteins of genogroup strains (Wa, DS-1, or AU-1, respectively). Strains D, P, ST3, IAL28, and WI61 encode genotype 1 (Wa-like) proteins, whereas strains DS-1 and 69M encode genotype 2 (DS-1-like) proteins. Of the 10 HRVs sequenced, 3 of them (Se584, A64, and L26) encode proteins belonging to more than one genotype, indicating that they are intergenogroup reassortants. We used amino acid sequence alignments to identify residues that distinguish proteins belonging to HRV genotype 1, 2, or 3. These genotype-specific changes cluster in definitive regions within each viral protein, many of which are sites of known protein-protein interactions. For the intermediate viral capsid protein (VP6), the changes map onto the atomic structure at the VP2-VP6, VP4-VP6, and VP7-VP6 interfaces. The results of this study provide evidence that group A HRV gene constellations exist and may be influenced by interactions among viral proteins during replication. PMID:18786998

The color tuning of PS-b-P2VP lamellar films with changing the alkyl chain length of 1-iodoalkanes.

PubMed

Shin, Sung-Eui; Kim, Su-Young; Shin, Dong-Myung

2011-05-01

Photonic crystals with tunability in the visible or near-infrared region have drawn increasing attention for controlling and processing light for the active components of future display. We prepared polystyrene-b-poly(2-vinyl pyridine) (PS-b-P2VP) lamellar films which is hydrophobic block-hydrophilic polyelectrolyte block polymer of 57 kg/mol-b-57 kg/mol. The lamellar stacks, which is alternating layer of hydrophilic and hydrophobic moiety of PS-b-P2VP, are obtained by exposing the spin coated film under chloroform vapor. The band gaps of the lamellar films interestingly varied after immersion into the quaternizing solvents containing 5 wt% of iodomethane, iodoethane, 1-iodobutane, 1-iodopentane, 1-iodohexane and 1-iodooctane solubilized in n-hexane. The iodoalkanes reacted with pyridine groups in PS-b-P2VP and generated the alkyl pyridinium salts readily. The degree of quaternization, alkyl chain length of iodoalkane and the salt water concentration affects the spacing of layer structure of PS-b-P2VP. The iodomethane and iodohexane produced similar band gaps and salt concentration dependence. These results are very much dependent on the hydrophobic-hydrophilic characters of PS-b-P2VP lamellar surface.

C Terminus of Infectious Bursal Disease Virus Major Capsid Protein VP2 Is Involved in Definition of the T Number for Capsid Assembly

PubMed Central

Castón, José R.; Martínez-Torrecuadrada, Jorge L.; Maraver, Antonio; Lombardo, Eleuterio; Rodríguez, José F.; Casal, J. Ignacio; Carrascosa, José L.

2001-01-01

Infectious bursal disease virus (IBDV), a member of the Birnaviridae family, is a double-stranded RNA virus. The IBDV capsid is formed by two major structural proteins, VP2 and VP3, which assemble to form a T=13 markedly nonspherical capsid. During viral infection, VP2 is initially synthesized as a precursor, called VPX, whose C end is proteolytically processed to the mature form during capsid assembly. We have computed three-dimensional maps of IBDV capsid and virus-like particles built up by VP2 alone by using electron cryomicroscopy and image-processing techniques. The IBDV single-shelled capsid is characterized by the presence of 260 protruding trimers on the outer surface. Five classes of trimers can be distinguished according to their different local environments. When VP2 is expressed alone in insect cells, dodecahedral particles form spontaneously; these may be assembled into larger, fragile icosahedral capsids built up by 12 dodecahedral capsids. Each dodecahedral capsid is an empty T=1 shell composed of 20 trimeric clusters of VP2. Structural comparison between IBDV capsids and capsids consisting of VP2 alone allowed the determination of the major capsid protein locations and the interactions between them. Whereas VP2 forms the outer protruding trimers, VP3 is found as trimers on the inner surface and may be responsible for stabilizing functions. Since elimination of the C-terminal region of VPX is correlated with the assembly of T=1 capsids, this domain might be involved (either alone or in cooperation with VP3) in the induction of different conformations of VP2 during capsid morphogenesis. PMID:11602723

Complete coding regions of the prototypes enterovirus B93 and C95: phylogenetic analyses of the P1 and P3 regions of EV-B and EV-C strains.

PubMed

Junttila, N; Lévêque, N; Magnius, L O; Kabue, J P; Muyembe-Tamfum, J J; Maslin, J; Lina, B; Norder, H

2015-03-01

Complete coding regions were sequenced for two new enterovirus genomes: EV-B93 previously identified by VP1 sequencing, derived from a child with acute flaccid paralysis in the Democratic Republic of Congo; and EV-C95 from a French soldier with acute gastroenteritis in Djibouti. The EV-B93 P1 had more than 30% nucleotide divergence from other EV-B types, with highest similarity to E-15 and EV-B80. The P1 nucleotide sequence of EV-C95 was most similar, 71%, to CV-A21. Complete coding regions for the new enteroviruses were compared with those of 135 EV-B and 176 EV-C strains representing all types available in GenBank. When strains from the same outbreak or strains isolated during the same year in the same geographical region were excluded, 27 of the 58 EV-B, and 16 of the 23 EV-C types were represented by more than one sequence. However, for EV-B the P3 sequences formed three clades mainly according to origin or time of isolation, irrespective of type, while for EV-C the P3 sequences segregated mainly according to disease manifestation, with most strains causing paralysis, including polioviruses, forming one clade, and strains causing respiratory illness forming another. There was no intermixing of types between these two clades, apart from two EV-C96 strains. The EV-B P3 sequences had lower inter-clade and higher intra-clade variability as compared to the EV-C sequences, which may explain why inter-clade recombinations are more frequent in EV-B. Further analysis of more isolates may shed light on the role of recombinations in the evolution of EV-B in geographical context. © 2014 Wiley Periodicals, Inc.

Genetic characterization of enterovirus strains identified in Hand, Foot and Mouth Disease (HFMD): Emergence of B1c, C1 subgenotypes, E2 sublineage of CVA16, EV71 and CVA6 strains in India.

PubMed

Ganorkar, Nital N; Patil, Pooja R; Tikute, Sanjay S; Gopalkrishna, Varanasi

2017-10-01

Hand, Foot and Mouth disease (HFMD) is a common childhood disease and caused due to Enterovirus-A (EV-A), EV-B and EV-C species worldwide. Cases of HFMD were reported from, Ahmedabad (Gujarat, 2012) and Pune (Maharashtra, 2013-2014) in India. The present study highlights the identification of EV strains (CVA16, CVA6, CVA4 and Echo12), characterization of subgenotypes of CVA16, CVA6 strains during 2012-14 and CVA16, CVA6, EV71 strains reported from the earlier study (2009-10) in HFMD cases from India. A total 158 clinical specimens collected from 64 HFMD cases (2012-2014) were included in the study. EV detection was carried out by 5'NCR based RT-PCR, molecular typing and subgenotyping was by VP1/2A junction or VP1, full VP1 gene amplification respectively followed by phylogenetic analysis. The present study reports 63.92% (101/158) EV positivity by RT-PCR. Ninety four of the 101 (93.06%) EV positive strains were amplified by VP1/2A junction or VP1 regions. Sequence analysis revealed the presence of CVA16 (61.7%), CVA6 (34.04%), CVA4 and Echo12 (4.3%). A total of 114 EV positive strains were genotyped using full and partial VP1 region. All CVA16 Indian strains (n=70) clustered with rarely reported B1c subgenotype, CVA6 (n=43) and EV71 (n=1) strains clustered with sub-lineage E2 and C1 subgenotypes respectively. In summary, the study reports genetic characterization of CVA16, CVA6, CVA4 and Echo12 strains in HFMD cases from India. Circulation of B1c subgenotype of CVA16, E2 sub-lineage of CVA6 and C1 subgenotype of EV 71 strains in HFMD cases were reported for the first time from India. This study helps to understand the genotype distribution, genetic diversity of EV strains associated with HFMD from Eastern, Western and Southern regions in India. Copyright © 2017 Elsevier B.V. All rights reserved.

Method for measuring the focal spot size of an x-ray tube using a coded aperture mask and a digital detector.

PubMed

Russo, Paolo; Mettivier, Giovanni

2011-04-01

The goal of this study is to evaluate a new method based on a coded aperture mask combined with a digital x-ray imaging detector for measurements of the focal spot sizes of diagnostic x-ray tubes. Common techniques for focal spot size measurements employ a pinhole camera, a slit camera, or a star resolution pattern. The coded aperture mask is a radiation collimator consisting of a large number of apertures disposed on a predetermined grid in an array, through which the radiation source is imaged onto a digital x-ray detector. The method of the coded mask camera allows one to obtain a one-shot accurate and direct measurement of the two dimensions of the focal spot (like that for a pinhole camera) but at a low tube loading (like that for a slit camera). A large number of small apertures in the coded mask operate as a "multipinhole" with greater efficiency than a single pinhole, but keeping the resolution of a single pinhole. X-ray images result from the multiplexed output on the detector image plane of such a multiple aperture array, and the image of the source is digitally reconstructed with a deconvolution algorithm. Images of the focal spot of a laboratory x-ray tube (W anode: 35-80 kVp; focal spot size of 0.04 mm) were acquired at different geometrical magnifications with two different types of digital detector (a photon counting hybrid silicon pixel detector with 0.055 mm pitch and a flat panel CMOS digital detector with 0.05 mm pitch) using a high resolution coded mask (type no-two-holes-touching modified uniformly redundant array) with 480 0.07 mm apertures, designed for imaging at energies below 35 keV. Measurements with a slit camera were performed for comparison. A test with a pinhole camera and with the coded mask on a computed radiography mammography unit with 0.3 mm focal spot was also carried out. The full width at half maximum focal spot sizes were obtained from the line profiles of the decoded images, showing a focal spot of 0.120 mm x 0.105 mm at 35 kVp and M = 6.1, with a detector entrance exposure as low as 1.82 mR (0.125 mA s tube load). The slit camera indicated a focal spot of 0.112 mm x 0.104 mm at 35 kVp and M = 3.15, with an exposure at the detector of 72 mR. Focal spot measurements with the coded mask could be performed up to 80 kVp. Tolerance to angular misalignment with the reference beam up to 7 degrees in in-plane rotations and 1 degrees deg in out-of-plane rotations was observed. The axial distance of the focal spot from the coded mask could also be determined. It is possible to determine the beam intensity via measurement of the intensity of the decoded image of the focal spot and via a calibration procedure. Coded aperture masks coupled to a digital area detector produce precise determinations of the focal spot of an x-ray tube with reduced tube loading and measurement time, coupled to a large tolerance in the alignment of the mask.

Disoxaril mutants of Coxsackievirus B1: phenotypic characteristics and analysis of the target VP1 gene.

PubMed

Nikolova, Ivanka; Galabov, Angel S; Petkova, Rumena; Chakarov, Stoyan; Atanasov, Boris

2011-01-01

Disoxaril inhibits enterovirus replication by binding to the hydrophobic pocket within the VP1 coat protein, thus stabilizing the virion and blocking its uncoating. Disoxaril-resistant (RES) mutants of the Coxsackievirus B1 (CVB1/RES) were derived from the wild disoxaril-sensitive (SOF) strain (CVB1/SOF) using a selection approach. A disoxaril-dependent (DEP) mutant (CVB1/DEP) was obtained following nine consecutive passages of the disoxaril-resistant mutant in the presence of disoxaril. Phenotypic characteristics of the disoxaril mutants were investigated. A timing-of-addition study of the CVB1/DEP replication demonstrated that in the absence of disoxaril the virus particle assembly stopped. VP1 RNA sequences of disoxaril mutants were compared with the existing Gen Bank CVB1 reference structure. The amino acid sequence of a large VP1 196-258 peptide (disoxaril-binding region) of CVB1/RES was significantly different from that of the CVB1/SOF. Crucially important changes in CVB1/RES were two point mutations, M213H and F237L, both in the ligand-binding pocket. The sequence analysis of the CVB1/DEP showed some reversion to CVB1/SOF. The amino acid sequences of the three VP1 proteins are presented.

Isolation of sabin-like polioviruses from wastewater in a country using inactivated polio vaccine.

PubMed

Zurbriggen, Sebastian; Tobler, Kurt; Abril, Carlos; Diedrich, Sabine; Ackermann, Mathias; Pallansch, Mark A; Metzler, Alfred

2008-09-01

From 2001 to 2004, Switzerland switched from routine vaccination with oral polio vaccine (OPV) to inactivated polio vaccine (IPV), using both vaccines in the intervening period. Since IPV is less effective at inducing mucosal immunity than OPV, this change might allow imported poliovirus to circulate undetected more easily in an increasingly IPV-immunized population. Environmental monitoring is a recognized tool for identifying polioviruses in a community. To look for evidence of poliovirus circulation following cessation of OPV use, two sewage treatment plants located in the Zurich area were sampled from 2004 to 2006. Following virus isolation using either RD or L20B cells, enteroviruses and polioviruses were identified by reverse transcription-PCR. A total of 20 out of 174 wastewater samples were positive for 62 Sabin-like isolates. One isolate from each poliovirus-positive sample was analyzed in more detail. Sequencing the complete viral protein 1 (VP1) capsid coding region, as well as intratypic differentiation (ITD), identified 3 Sabin type 1, 13 Sabin type 2, and 4 Sabin type 3 strains. One serotype 1 strain showed a discordant result in the ITD. Three-quarters of the strains showed mutations within the 5' untranslated region and VP1, known to be associated with reversion to virulence. Moreover, three strains showed heterotypic recombination (S2/S1 and S3/S2/S3). The low number of synonymous mutations and the partial temperature sensitivity are not consistent with extended circulation of these Sabin virus strains. Nevertheless, the continuous introduction of polioviruses into the community emphasizes the necessity for uninterrupted child vaccination to maintain high herd immunity.

Diversity in VP3, NSP3, and NSP4 of rotavirus B detected from Japanese cattle.

PubMed

Hayashi-Miyamoto, Michiko; Murakami, Toshiaki; Minami-Fukuda, Fujiko; Tsuchiaka, Shinobu; Kishimoto, Mai; Sano, Kaori; Naoi, Yuki; Asano, Keigo; Ichimaru, Toru; Haga, Kei; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Aoki, Hiroshi; Shirai, Junsuke; Ishida, Motohiko; Katayama, Kazuhiko; Mizutani, Tetsuya; Nagai, Makoto

2017-04-01

Bovine rotavirus B (RVB) is an etiological agent of diarrhea mostly in adult cattle. Currently, a few sequences of viral protein (VP)1, 2, 4, 6, and 7 and nonstructural protein (NSP)1, 2, and 5 of bovine RVB are available in the DDBJ/EMBL/GenBank databases, and none have been reported for VP3, NSP3, and NSP4. In order to fill this gap in the genetic characterization of bovine RVB strains, we used a metagenomics approach and sequenced and analyzed the complete coding sequences (CDS) of VP3, NSP3, and NSP4 genes, as well as the partial or complete CDS of other genes of RVBs detected from Japanese cattle. VP3, NSP3, and NSP4 of bovine RVBs shared low nucleotide sequence identities (63.3-64.9% for VP3, 65.9-68.2% for NSP3, and 52.6-56.2% for NSP4) with those of murine, human, and porcine RVBs, suggesting that bovine RVBs belong to a novel genotype. Furthermore, significantly low amino acid sequence identities were observed for NSP4 (36.1-39.3%) between bovine RVBs and the RVBs of other species. In contrast, hydrophobic plot analysis of NSP4 revealed profiles similar to those of RVBs of other species and rotavirus A (RVA) strains. Phylogenetic analyses of all gene segments revealed that bovine RVB strains formed a cluster that branched distantly from other RVBs. These results suggest that bovine RVBs have evolved independently from other RVBs but in a similar manner to other rotaviruses. These findings provide insights into the evolution and diversity of RVB strains. Copyright © 2017 Elsevier B.V. All rights reserved.

Lithospheric Structure and Shape of Subducting Nazca Plate in the Pampean Flat Slab Region of Argentina

NASA Astrophysics Data System (ADS)

Linkimer, L.; Beck, S. L.; Zandt, G.; Alvarado, P. M.; Anderson, M. L.; Gilbert, H. J.; Zhang, H.

2011-12-01

We obtain earthquake locations and a detailed three-dimensional model of the subduction zone velocity structure in west-central Argentina by applying a regional-scale double-difference tomography algorithm to earthquake data recorded by the SIEMBRA (2007-2009) and ESP (2008-2010) broadband seismic networks. In this region, the flat subduction of the Nazca Plate including the Juan Fernandez Ridge is spatially correlated in the overriding South America Plate with a gap in the arc volcanism and the thick-skinned, basement-cored uplifts of the Sierras Pampeanas. Our model shows the subducting Nazca Plate as a mostly continuous band of increased (2-6%) P- and S- wave velocities (Vp and Vs). The lithospheric mantle of the South America Plate appears to be heterogeneous but mostly characterized by Vp of 8.0-8.2 km/s, Vs of 4.5-4.7 km/s, and Vp/Vs ratio of 1.75-1.78, which is consistent with either a depleted lherzolite or harzburgite. We observe a region of higher Vp/Vs ratio (1.78-1.80) that we correlated with up to 10% hydration of mantle peridotites above the flat slab. In addition, we observe localized regions of lower Vp/Vs ratio (1.71-1.73) in the mantle above the westernmost part of the flat slab, suggesting orthopyroxene enrichment. Our velocity observations are consistent with the presence of Paleozoic carbonate rocks in the Precordillera and the differences in composition for the Sierras Pampeanas basement: a more mafic composition for Cuyania Terrane in the west and a more felsic composition for the Pampia Terrane in the east. Additionally, we present new contours for the Wadati-Benioff Zone (WBZ). The top of the WBZ of the Nazca Plate is nearly flat at ~100 km depth approximately within the region of latitude 28-32°S and longitude 70-68.5°W. We determined that WBZ is a single layer of seismicity with thickness of 10-15 km, which may correspond to the dehydration of the subducting oceanic mantle. We found that the flat slab region is wider (~240 km) than the Juan Fernandez Ridge offshore (~100 km), and together with the shape of the slab contours may reflect the response of the geometry of the slab to the southward migration of the buoyant ridge. The non-uniform spatial distribution of the slab seismicity may reflect the variability in the hydration state of the subducting Nazca Plate with greater release of water from the subducted ridge region.

Shape of Subducting Nazca Plate and Lithospheric Structure in the Pampean Flat Slab Region of Argentina

NASA Astrophysics Data System (ADS)

Linkimer, L.; Beck, S. L.; Zandt, G.; Alvarado, P. M.; Anderson, M. L.; Gilbert, H. J.; Zhang, H.

2013-05-01

We obtain earthquake locations and a detailed three-dimensional model of the subduction zone velocity structure in west-central Argentina by applying a regional-scale double-difference tomography algorithm to earthquake data recorded by the SIEMBRA (2007-2009) and ESP (2008-2010) broadband seismic networks. In this region, the flat subduction of the Nazca Plate including the Juan Fernandez Ridge is spatially correlated in the overriding South America Plate with a gap in the arc volcanism and the thick-skinned, basement-cored uplifts of the Sierras Pampeanas. Our model shows the subducting Nazca Plate as a mostly continuous band of increased (2-6%) P- and S- wave velocities (Vp and Vs). The lithospheric mantle of the South America Plate appears to be heterogeneous but mostly characterized by Vp of 8.0-8.2 km/s, Vs of 4.5-4.7 km/s, and Vp/Vs ratio of 1.75-1.78, which is consistent with either a depleted lherzolite or harzburgite. We observe a region of higher Vp/Vs ratio (1.78-1.80) that we correlated with up to 10% hydration of mantle peridotites above the flat slab. In addition, we observe localized regions of lower Vp/Vs ratio (1.71-1.73) in the mantle above the westernmost part of the flat slab, suggesting orthopyroxene enrichment. Our velocity observations are consistent with the presence of Paleozoic carbonate rocks in the Precordillera and the differences in composition for the Sierras Pampeanas basement: a more mafic composition for Cuyania Terrane in the west and a more felsic composition for the Pampia Terrane in the east. Additionally, we present new contours for the Wadati-Benioff Zone (WBZ). The top of the WBZ of the Nazca Plate is nearly flat at ~100 km depth approximately within the region of latitude 28-32°S and longitude 70-68.5°W. We determined that WBZ is a single layer of seismicity with thickness of 10-15 km, which may correspond to the dehydration of the subducting oceanic mantle. We found that the flat slab region is wider (~240 km) than the Juan Fernandez Ridge offshore (~100 km), and together with the shape of the slab contours may reflect the response of the geometry of the slab to the southward migration of the buoyant ridge. The non-uniform spatial distribution of the slab seismicity may reflect the variability in the hydration state of the subducting Nazca Plate with greater release of water from the subducted ridge region.

Abrogation of Microsatellite-instable Tumors Using a Highly Selective Suicide Gene/Prodrug Combination

PubMed Central

Ferrás, Cristina; Oude Vrielink, Joachim AF; Verspuy, Johan WA; te Riele, Hein; Tsaalbi-Shtylik, Anastasia; de Wind, Niels

2009-01-01

A substantial fraction of sporadic and inherited colorectal and endometrial cancers in humans is deficient in DNA mismatch repair (MMR). These cancers are characterized by length alterations in ubiquitous simple sequence repeats, a phenotype called microsatellite instability. Here we have exploited this phenotype by developing a novel approach for the highly selective gene therapy of MMR-deficient tumors. To achieve this selectivity, we mutated the VP22FCU1 suicide gene by inserting an out-of-frame microsatellite within its coding region. We show that in a significant fraction of microsatellite-instable (MSI) cells carrying the mutated suicide gene, full-length protein becomes expressed within a few cell doublings, presumably resulting from a reverting frameshift within the inserted microsatellite. Treatment of these cells with the innocuous prodrug 5-fluorocytosine (5-FC) induces strong cytotoxicity and we demonstrate that this owes to multiple bystander effects conferred by the suicide gene/prodrug combination. In a mouse model, MMR-deficient tumors that contained the out-of-frame VP22FCU1 gene displayed strong remission after treatment with 5-FC, without any obvious adverse systemic effects to the mouse. By virtue of its high selectivity and potency, this conditional enzyme/prodrug combination may hold promise for the treatment or prevention of MMR-deficient cancer in humans. PMID:19471249

Identification of a linear neutralization domain in the protein VP2 of African horse sickness virus.

PubMed

Martínez-Torrecuadrada, J L; Casal, J I

1995-07-10

Overlapping fragments of the outermost capsid protein VP2 of African horse sickness virus serotype 4 (AHSV-4) have been expressed in Escherichia coli. Horse sera from infected and vaccinated animals, rabbit sera, and mice monoclonal antibodies specific for AHSV were used to screen these fragments for antigenic regions. The screening revealed that the major antigenic domain of the AHSV-4 VP2 is localized in a central region (amino acids 200 to 413) and that both the N-terminal region (aa 1-159) and the half C-terminal region (aa 414-1060) are not immunogenic. All the fragments containing a region between amino acids 253 and 413 (fragment H) were able to elicit consistently high titers of neutralizing antibodies. The ability of several subfragments of this region to evoke neutralizing antibodies indicates the presence of several sites inside this domain. However, neutralizing antibodies in sera of horse infected or vaccinated with attenuated viruses were not absorbed by fragment H, indicating that this domain is not immunodominant in AHSV. This information might be useful in designing a subunit vaccine against AHSV infection.

Crystal Structures of Yellowtail Ascites Virus VP4 Protease

PubMed Central

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-01-01

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

PubMed

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-05-03

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.

Role of ventral pallidal D2 dopamine receptors in the consolidation of spatial memory.

PubMed

Péczely, László; Ollmann, Tamás; László, Kristóf; Kovács, Anita; Gálosi, Rita; Kertes, Erika; Zagorácz, Olga; Kállai, Veronika; Karádi, Zoltán; Lénárd, László

2016-10-15

The role of dopamine (DA) receptors in spatial memory consolidation has been demonstrated in numerous brain regions, among others in the nucleus accumbens which innervates the ventral pallidum (VP). The VP contains both D1 and D2 DA receptors. We have recently shown that the VP D1 DA receptor activation facilitates consolidation of spatial memory in Morris water maze test. In the present study, the role of VP D2 DA receptors was investigated in the same paradigm. In the first experiment, the D2 DA receptor agonist quinpirole was administered into the VP of male Wistar rats in three doses (0.1, 1.0 or 5.0μg, respectively in 0.4μl physiological saline). In the second experiment, the D2 DA receptor antagonist sulpiride was applied to elucidate whether it can antagonise the effects of quinpirole. The antagonist (4.0μg, dissolved in 0.4μl physiological saline) was microinjected into the VP either by itself or prior to 1.0μg agonist treatment. Control animals received saline in both experiments. The two higher doses (1.0 and 5.0μg) of the agonist accelerated memory consolidation relative to controls and increased the stability of the consolidated memory against extinction. Sulpiride pretreatment antagonised the effects of quinpirole. In addition, the antagonist microinjected into the VP immediately after the second conditioning trial impaired learning functions. The present data provide evidences for the important role of VP D2 DA receptors in the consolidation and stabilization of spatial memory. Copyright © 2016 Elsevier B.V. All rights reserved.

Controlled conformational transitions in the MVM virion expose the VP1 N-terminus and viral genome without particle disassembly.

PubMed

Cotmore, S F; D'abramo, A M; Ticknor, C M; Tattersall, P

1999-02-01

Antisera were raised against peptides corresponding to the N-termini of capsid proteins VP1 and VP2 from the parvovirus minute virus of mice. Epitopes in the 142-amino-acid VP1-specific region were not accessible in the great majority of newly released viral particles, and sera directed against them failed to neutralize virus directly or deplete stocks of infectious virions. However, brief exposure to temperatures of 45 degreesC or more induced a conformational transition in a population of full virions, but not in empty viral particles, in which VP1-specific sequences became externally accessible. In contrast, the VP2 N-terminus was antibody-accessible in all full, but not empty, particles without prior treatment. An electrophoretic mobility shift assay, in which particles were heat-treated and/or preincubated with antibodies prior to electrophoresis, confirmed this pattern of epitope accessibility, showing that the heat-induced conformational transition produces a retarded form of virion that can be supershifted by incubation with VP1-specific sera. The proportion of virions undergoing transition increased with temperature, but at all temperatures up to 70 degreesC viral particles retained structure-specific antigenic determinants and remained essentially intact, without shedding individual polypeptide species or subunits. However, despite the apparent integrity of its protective coat, the genome became accessible to externally applied enzymes in an increasing proportion of virions through this temperature range, suggesting that the conformational transitions that expose VP1 likely also allow access to the genome. Heating particles to 80 degreesC or above finally induced disassembly to polypeptide monomers. Copyright 1999 Academic Press.

VP40 of the Ebola Virus as a Target for EboV Therapy: Comprehensive Conformational and Inhibitor Binding Landscape from Accelerated Molecular Dynamics.

PubMed

Balmith, Marissa; Soliman, Mahmoud E S

2017-03-01

The first account of the dynamic features of the loop region of VP40 of the Ebola virus was studied using accelerated molecular dynamics simulations and reported herein. Among the proteins of the Ebola virus, the matrix protein (VP40) plays a significant role in the virus lifecycle thereby making it a promising therapeutic target. Of interest is the newly elucidated N-terminal domain loop region of VP40 comprising residues K127, T129, and N130 which when mutated to alanine have demonstrated an unrecognized role for N-terminal domain-plasma membrane interaction for efficient VP40-plasma membrane localization, oligomerization, matrix assembly, and egress. The molecular understanding of the conformational features of VP40 in complex with a known inhibitor still remains elusive. Using accelerated molecular dynamics approaches, we conducted a comparative study on VP40 apo and bound systems to understand the conformational features of VP40 at the molecular level and to determine the effect of inhibitor binding with the aid of a number of post-dynamic analytical tools. Significant features were seen in the presence of an inhibitor as per molecular mechanics/generalized born surface area binding free energy calculations. Results revealed that inhibitor binding to VP40 reduces the flexibility and mobility of the protein as supported by root mean square fluctuation and root mean square deviation calculations. The study revealed a characteristic "twisting" motion and coiling of the loop region of VP40 accompanied by conformational changes in the dimer interface upon inhibitor binding. We believe that results presented in this study will ultimately provide useful insight into the binding landscape of VP40 which could assist researchers in the discovery of potent Ebola virus inhibitors for anti-Ebola therapies.

Calculation of spherical harmonics and Wigner d functions by FFT. Applications to fast rotational matching in molecular replacement and implementation into AMoRe.

PubMed

Trapani, Stefano; Navaza, Jorge

2006-07-01

The FFT calculation of spherical harmonics, Wigner D matrices and rotation function has been extended to all angular variables in the AMoRe molecular replacement software. The resulting code avoids singularity issues arising from recursive formulas, performs faster and produces results with at least the same accuracy as the original code. The new code aims at permitting accurate and more rapid computations at high angular resolution of the rotation function of large particles. Test calculations on the icosahedral IBDV VP2 subviral particle showed that the new code performs on the average 1.5 times faster than the original code.

Effect of lipophilicity modulation on inhibition of human rhinovirus capsid binders.

PubMed

Morley, Andrew; Tomkinson, Nicholas; Cook, Andrew; MacDonald, Catherine; Weaver, Richard; King, Sarah; Jenkinson, Lesley; Unitt, John; McCrae, Christopher; Phillips, Tim

2011-10-15

To try and generate broad spectrum human rhinovirus VP1 inhibitors with more attractive physicochemical, DMPK and safety profiles, we explored the current SAR of known VP1 compounds. This lead to the identification of specific structural regions where reduction in polarity can be achieved, so guiding chemistry to analogues with significantly superior profiles to previously reported inhibitors. Copyright © 2011 Elsevier Ltd. All rights reserved.

Adenovirus-vectored shRNAs targeted to the highly conserved regions of VP1 and 2B in tandem inhibits replication of foot-and-mouth disease virus both in vitro and in vivo.

PubMed

Xu, Yan-Fang; Shen, Hai-Yan; Zhao, Ming-Qiu; Chen, Li-Jun; Li, Yin-Guang; Liao, Ming; Jia, Jun-Tao; Lv, Ying-Ran; Yi, Lin; Chen, Jin-Ding

2012-04-01

Foot-and-mouth disease is a highly contagious and economically important disease of cloven-hoofed animals. RNA interference (RNAi) can be used as a rapid and specific antiviral approach. It was shown that treatment with recombinant adenovirus (Ad(VP1-2B)) carrying shRNAs targeted to the VP1 and 2B genes of FMDV expressed in tandem had marked antiviral effects against FMDV both in IBRS-2 cells and guinea pigs. Treatment with Ad(VP1-2B) both before and after FMDV infection was most effective in IBRS-2 cells, as the FMDV RNA transcripts could not be detected within 48 h post-challenge (hpc), and the viral RNA copy number at 72 hpc was only 0.02% of that in the positive control group. Delivery of Ad(VP1-2B) reduced significantly the susceptibility of guinea pigs to FMDV infection. All guinea pigs were protected within 3 days post challenge (dpc) when they were injected twice with the same dose of Ad(VP1-2B), and a third treatment with the same dose of Ad(VP1-2B) at 3 dpc was necessary to confer longer lasting protection (up to 6 dpc). In conclusion, application of such a adenovirus vector to inhibit more than one viral gene may be an advantageous method for prevention and therapy of FMDV infection. Copyright © 2012 Elsevier B.V. All rights reserved.

Phylogenetic analysis of VP2 gene of canine parvovirus and comparison with Indian and world isolates.

PubMed

Kaur, G; Chandra, M; Dwivedi, P N

2016-03-01

Canine parvovirus (CPV) causes hemorrhagic enteritis, especially in young dogs, leading to high morbidity and mortality. It has four main antigenic types CPV-2, CPV-2a, CPV-2b and CPV-2c. Virus protein 2 (VP2) is the main capsid protein and mutations affecting VP2 gene are responsible for the evolution of various antigenic types of CPV. Full length VP2 gene from field isolates was amplified and cloned for sequence analysis. The sequences were submitted to the GenBank and were assigned Acc. Nos., viz. KP406928.1 for P12, KP406927.1 for P15, KP406930.1 for P32, KP406926.1 for Megavac-6 and KP406929.1 for NobivacDHPPi. Phylogenetic analysis indicated that the samples were forming a separate clad with vaccine strains. When the samples were compared with the world and Indian isolates, it was observed that samples formed a separate node indicating regional genetic variation in CPV.

Isolation and in silico analysis of a novel H+-pyrophosphatase gene orthologue from the halophytic grass Leptochloa fusca

NASA Astrophysics Data System (ADS)

Rauf, Muhammad; Saeed, Nasir A.; Habib, Imran; Ahmed, Moddassir; Shahzad, Khurram; Mansoor, Shahid; Ali, Rashid

2017-02-01

Structure prediction can provide information about function and active sites of protein which helps to design new functional proteins. H+-pyrophosphatase is transmembrane protein involved in establishing proton motive force for active transport of Na+ across membrane by Na+/H+ antiporters. A full length novel H+-pyrophosphatase gene was isolated from halophytic grass Leptochloa fusca using RT-PCR and RACE method. Full length LfVP1 gene sequence of 2292 nucleotides encodes protein of 764 amino acids. DNA and protein sequences were used for characterization using bioinformatics tools. Various important potential sites were predicted by PROSITE webserver. Primary structural analysis showed LfVP1 as stable protein and Grand average hydropathy (GRAVY) indicated that LfVP1 protein has good hydrosolubility. Secondary structure analysis showed that LfVP1 protein sequence contains significant proportion of alpha helix and random coil. Protein membrane topology suggested the presence of 14 transmembrane domains and presence of catalytic domain in TM3. Three dimensional structure from LfVP1 protein sequence also indicated the presence of 14 transmembrane domains and hydrophobicity surface model showed amino acid hydrophobicity. Ramachandran plot showed that 98% amino acid residues were predicted in the favored region.

Clinical polyomavirus BK variants with agnogene deletion are non-functional but rescued by trans-complementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myhre, Marit Renee; Olsen, Gunn-Hege; Gosert, Rainer

High-level replication of polyomavirus BK (BKV) in kidney transplant recipients is associated with the emergence of BKV variants with rearranged (rr) non-coding control region (NCCR) increasing viral early gene expression and cytopathology. Cloning and sequencing revealed the presence of a BKV quasispecies which included non-functional variants when assayed in a recombinant virus assay. Here we report that the rr-NCCR of BKV variants RH-3 and RH-12, both bearing a NCCR deletion including the 5' end of the agnoprotein coding sequence, mediated early and late viral reporter gene expression in kidney cells. However, in a recombinant virus they failed to produce infectiousmore » progeny despite large T-antigen and VP1 expression and the formation of nuclear virus-like particles. Infectious progeny was generated when the agnogene was reconstructed in cis or agnoprotein provided in trans from a co-existing BKV rr-NCCR variant. We conclude that complementation can rescue non-functional BKV variants in vitro and possibly in vivo.« less

Non-active site mutations disturb the loop dynamics, dimerization, viral budding and egress of VP40 of the Ebola virus.

PubMed

Balmith, Marissa; Soliman, Mahmoud E S

2017-02-28

The first account of the dynamic features of the loop region of VP40 of the Ebola virus (EboV) using accelerated molecular dynamics (aMD) simulations is reported herein. Due to its major role in the Ebola life cycle, VP40 is considered a promising therapeutic target. The available experimental data on the N-terminal domain (NTD) loop indicates that mutations K127A, T129A and N130A demonstrate an unrecognized role for NTD-plasma membrane (PM) interaction for efficient VP40-PM localization, oligomerization, matrix assembly and egress. Despite experimental results, the molecular description of VP40 and the information it can provide still remain vague. Therefore, to gain further molecular insight into the effect of mutations on the loop region of VP40 and its effects on the overall protein conformation and VP40 dimerization, aMD simulations and post-dynamic analyses were employed for wildtype (WT) and mutant systems. The results showed significant variations in the presence of mutations as per RMSF, RMSD, R g , PCA and distance calculations in comparison to the WT. These results could provide researchers with insight with regards to the conformational aspects concerning VP40 and its close relation to the experimental data. We believe that the results presented in this study will ultimately provide a useful understanding of the structural landscape of the loop region of VP40, which would contribute towards the discovery of novel EboV inhibitors.

Epidemiological features and genetic characterization of virus strains in rotavirus associated gastroenteritis in children of Odisha in Eastern India.

PubMed

Mohanty, Eileena; Dwibedi, Bhagirathi; Kar, S K; Acharya, A S

2017-09-01

We have studied the clinical characteristics, severity and seasonality of rotavirus infection and prevalent genotypes in 652 non-rota vaccinated children in Odisha in eastern India. P genotypes were analysed for their association with host blood group antigens. P type of the virus is determined by the VP8* gene, and specific recognition of A - type of Histo - blood group antigen by P[14]VP8* has been reported. VP4, VP7 and VP6 genes of commonly identified G1P[8] strain were compared with genes of the same strain isolated from other parts of India, elsewhere and strains used for Rotarix and Rotateq vaccines. In 54.75% of children with gastroenteritis, rota virus was found. 9.65% of children had moderate, 78.07% severe, and 12.28% very severe disease as assessed using the Vesikari scoring system. The incidence of infection was highest during winter months. There was no association between any blood group and specific P genotypes. G1P[8] was the commonest cause of gastroenteritis, followed by G1P[11], G3P[8], G9P[8], G2P[4], G2P[6], G9P[4], G9P[11] and G1P[6]. Predominant G genotypes identified were G1 (72.9%), G9 (10.81%), G2 (8.10%) and G3 (8.10%). Sequence analysis of the VP7 gene, placed the G1P[8] strain in lineage 1 and of VP6 gene placed nine G1P[8] strains in subgroup II and one in subgroup I. The VP7 gene segment of two Odisha G1P[8] strains were found to cluster relatively close to the VP7 sequences of Rotarix vaccine. Antigenic differences were found with vaccine strains. Ten G1P[8] strains sequenced for the VP4 gene had 91-93% nucleotide and 92-96% amino acid identity with Rotateq vaccine P[8]). Rotarix vaccine VP4 had 89-91% nucleotide and 90-92% amino acid identity. Our findings indicate genetic variability of rotavirus strains circulating in the region and are significant, given the introduction of rota vaccination in the State. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of compression efficiency between HEVC/H.265 and VP9 based on subjective assessments

NASA Astrophysics Data System (ADS)

Řeřábek, Martin; Ebrahimi, Touradj

2014-09-01

Current increasing effort of broadcast providers to transmit UHD (Ultra High Definition) content is likely to increase demand for ultra high definition televisions (UHDTVs). To compress UHDTV content, several alternative encoding mechanisms exist. In addition to internationally recognized standards, open access proprietary options, such as VP9 video encoding scheme, have recently appeared and are gaining popularity. One of the main goals of these encoders is to efficiently compress video sequences beyond HDTV resolution for various scenarios, such as broadcasting or internet streaming. In this paper, a broadcast scenario rate-distortion performance analysis and mutual comparison of one of the latest video coding standards H.265/HEVC with recently released proprietary video coding scheme VP9 is presented. Also, currently one of the most popular and widely spread encoder H.264/AVC has been included into the evaluation to serve as a comparison baseline. The comparison is performed by means of subjective evaluations showing actual differences between encoding algorithms in terms of perceived quality. The results indicate a general dominance of HEVC based encoding algorithm in comparison to other alternatives, while VP9 and AVC showing similar performance.

Joint Inversion of Vp, Vs, and Resistivity at SAFOD

NASA Astrophysics Data System (ADS)

Bennington, N. L.; Zhang, H.; Thurber, C. H.; Bedrosian, P. A.

2010-12-01

Seismic and resistivity models at SAFOD have been derived from separate inversions that show significant spatial similarity between the main model features. Previous work [Zhang et al., 2009] used cluster analysis to make lithologic inferences from trends in the seismic and resistivity models. We have taken this one step further by developing a joint inversion scheme that uses the cross-gradient penalty function to achieve structurally similar Vp, Vs, and resistivity images that adequately fit the seismic and magnetotelluric MT data without forcing model similarity where none exists. The new inversion code, tomoDDMT, merges the seismic inversion code tomoDD [Zhang and Thurber, 2003] and the MT inversion code Occam2DMT [Constable et al., 1987; deGroot-Hedlin and Constable, 1990]. We are exploring the utility of the cross-gradients penalty function in improving models of fault-zone structure at SAFOD on the San Andreas Fault in the Parkfield, California area. Two different sets of end-member starting models are being tested. One set is the separately inverted Vp, Vs, and resistivity models. The other set consists of simple, geologically based block models developed from borehole information at the SAFOD drill site and a simplified version of features seen in geophysical models at Parkfield. For both starting models, our preliminary results indicate that the inversion produces a converging solution with resistivity, seismic, and cross-gradient misfits decreasing over successive iterations. We also compare the jointly inverted Vp, Vs, and resistivity models to borehole information from SAFOD to provide a "ground truth" comparison.

Formal integration of controlled-source and passive seismic data: Utilization of the CD-ROM experiment

NASA Astrophysics Data System (ADS)

Rumpfhuber, E.; Keller, G. R.; Velasco, A. A.

2005-12-01

Many large-scale experiments conduct both controlled-source and passive deployments to investigate the lithospheric structure of a targeted region. Many of these studies utilize each data set independently, resulting in different images of the Earth depending on the data set investigated. In general, formal integration of these data sets, such as joint inversions, with other data has not been performed. The CD-ROM experiment, which included both 2-D controlled-source and passive recording along a profile extending from southern Wyoming to northern New Mexico serves as an excellent data set to develop a formal integration strategy between both controlled source and passive experiments. These data are ideal to develop this strategy because: 1) the analysis of refraction/wide-angle reflection data yields Vp structure, and sometimes Vs structure, of the crust and uppermost mantle; 2) analysis of the PmP phase (Moho reflection) yields estimates of the average Vp of the crust for the crust; and 3) receiver functions contain full-crustal reverberations and yield the Vp/Vs ratio, but do not constrain the absolute P and S velocity. Thus, a simple form of integration involves using the Vp/Vs ratio from receiver functions and the average Vp from refraction measurements, to solve for the average Vs of the crust. When refraction/ wide-angle reflection data and several receiver functions nearby are available, an integrated 2-D model can be derived. In receiver functions, the PS conversion gives the S-wave travel-time (ts) through the crust along the raypath traveled from the Moho to the surface. Since the receiver function crustal reverberation gives the Vp/Vs ratio, it is also possible to use the arrival time of the converted phase, PS, to solve for the travel time of the direct teleseismic P-wave through the crust along the ray path. Raytracing can yield the point where the teleseismic wave intersects the Moho. In this approach, the conversion point is essentially a pseudo-shotpoint, thus the converted arrival at the surface can be jointly modeled with refraction data using a 3-D inversion code. Employing the combined CD-ROM data sets, we will be investigating the joint inversion results of controlled source data and receiver functions.

Mechanism of Cell Culture Adaptation of an Enteric Calicivirus, the Porcine Sapovirus Cowden Strain.

PubMed

Lu, Zhongyan; Yokoyama, Masaru; Chen, Ning; Oka, Tomoichiro; Jung, Kwonil; Chang, Kyeong-Ok; Annamalai, Thavamathi; Wang, Qiuhong; Saif, Linda J

2016-02-01

The porcine sapovirus (SaV) (PoSaV) Cowden strain is one of only a few culturable enteric caliciviruses. Compared to the wild-type (WT) PoSaV Cowden strain, tissue culture-adapted (TC) PoSaV has two conserved amino acid substitutions in the RNA-dependent RNA polymerase (RdRp) and six in the capsid protein (VP1). By using the reverse-genetics system, we identified that 4 amino acid substitutions in VP1 (residues 178, 289, 324, and 328), but not the substitutions in the RdRp region, were critical for the cell culture adaptation of the PoSaV Cowden strain. The other two substitutions in VP1 (residues 291 and 295) reduced virus replication in vitro. Three-dimensional (3D) structural analysis of VP1 showed that residue 178 was located near the dimer-dimer interface, which may affect VP1 assembly and oligomerization; residues 289, 291, 324, and 328 were located at protruding subdomain 2 (P2) of VP1, which may influence virus binding to cellular receptors; and residue 295 was located at the interface of two monomeric VP1 proteins, which may influence VP1 dimerization. Although reversion of the mutation at residue 291 or 295 from that of the TC strain to that of the WT reduced virus replication in vitro, it enhanced virus replication in vivo, and the revertants induced higher-level serum and mucosal antibody responses than those induced by the TC PoSaV Cowden strain. Our findings reveal the molecular basis for PoSaV adaptation to cell culture. These findings may provide new, critical information for the cell culture adaptation of other PoSaV strains and human SaVs or noroviruses. The tissue culture-adapted porcine sapovirus Cowden strain is one of only a few culturable enteric caliciviruses. We discovered that 4 amino acid substitutions in VP1 (residues 178, 289, 324, and 328) were critical for its adaptation to LLC-PK cells. Two substitutions in VP1 (residues 291 and 295) reduced virus replication in vitro but enhanced virus replication and induced higher-level serum and mucosal antibody responses in gnotobiotic pigs than those induced by the tissue culture-adapted strain. Structural modeling analysis of VP1 suggested that residue 178 may affect VP1 assembly and oligomerization; residues 289, 291, 324, and 328 may influence virus binding to cellular receptors; and residue 295 may influence VP1 dimerization. Our findings will provide new information for the cell culture adaptation of other sapoviruses and possibly noroviruses. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

EFFECTS OF ELF (EXTREMELY LOW FREQUENCY) (1-120 HZ) AND MODULATED (50 HZ) RF (RADIO FREQUENCY) FIELDS ON THE EFFLUX OF CALCIUM IONS FROM BRAIN TISSUE IN VITRO

EPA Science Inventory

The authors have previously shown that 16-Hz, sinusoidal electromagnetic fields can cause enhanced efflux of calcium ions from chick brain tissue, in vitro, in two intensity regions centered on 6 and 40 Vp-p/m. Alternatively, 1-Hz and 30-Hz fields at 40Vp-p/m did not cause enhanc...

Identification of Site-Specific Adaptations Conferring Increased Neural Cell Tropism during Human Enterovirus 71 Infection

PubMed Central

Schibler, Manuel; Martinez, Yannick; Gerlach, Daniel; van Belle, Sandra; Turin, Lara; Zdobnov, Evgeny; Kaiser, Laurent; Tapparel, Caroline

2012-01-01

Enterovirus 71 (EV71) is one of the most virulent enteroviruses, but the specific molecular features that enhance its ability to disseminate in humans remain unknown. We analyzed the genomic features of EV71 in an immunocompromised host with disseminated disease according to the different sites of infection. Comparison of five full-length genomes sequenced directly from respiratory, gastrointestinal, nervous system, and blood specimens revealed three nucleotide changes that occurred within a five-day period: a non-conservative amino acid change in VP1 located within the BC loop (L97R), a region considered as an immunogenic site and possibly important in poliovirus host adaptation; a conservative amino acid substitution in protein 2B (A38V); and a silent mutation in protein 3D (L175). Infectious clones were constructed using both BrCr (lineage A) and the clinical strain (lineage C) backgrounds containing either one or both non-synonymous mutations. In vitro cell tropism and competition assays revealed that the VP197 Leu to Arg substitution within the BC loop conferred a replicative advantage in SH-SY5Y cells of neuroblastoma origin. Interestingly, this mutation was frequently associated in vitro with a second non-conservative mutation (E167G or E167A) in the VP1 EF loop in neuroblastoma cells. Comparative models of these EV71 VP1 variants were built to determine how the substitutions might affect VP1 structure and/or interactions with host cells and suggest that, while no significant structural changes were observed, the substitutions may alter interactions with host cell receptors. Taken together, our results show that the VP1 BC loop region of EV71 plays a critical role in cell tropism independent of EV71 lineage and, thus, may have contributed to dissemination and neurotropism in the immunocompromised patient. PMID:22910880

Expression and purification of recombinant polyomavirus VP2 protein and its interactions with polyomavirus proteins

NASA Technical Reports Server (NTRS)

Cai, X.; Chang, D.; Rottinghaus, S.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1994-01-01

Recombinant polyomavirus VP2 protein was expressed in Escherichia coli (RK1448), using the recombinant expression system pFPYV2. Recombinant VP2 was purified to near homogeneity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electroelution, and Extracti-Gel chromatography. Polyclonal serum to this protein which reacted specifically with recombinant VP2 as well as polyomavirus virion VP2 and VP3 on Western blots (immunoblots) was produced. Purified VP2 was used to establish an in vitro protein-protein interaction assay with polyomavirus structural proteins and purified recombinant VP1. Recombinant VP2 interacted with recombinant VP1, virion VP1, and the four virion histones. Recombinant VP1 coimmunoprecipitated with recombinant VP2 or truncated VP2 (delta C12VP2), which lacked the carboxy-terminal 12 amino acids. These experiments confirmed the interaction between VP1 and VP2 and revealed that the carboxyterminal 12 amino acids of VP2 and VP3 were not necessary for formation of this interaction. In vivo VP1-VP2 interaction study accomplished by cotransfection of COS-7 cells with VP2 and truncated VP1 (delta N11VP1) lacking the nuclear localization signal demonstrated that VP2 was capable of translocating delta N11VP1 into the nucleus. These studies suggest that complexes of VP1 and VP2 may be formed in the cytoplasm and cotransported to the nucleus for virion assembly to occur.

Virtual patient design: exploring what works and why. A grounded theory study.

PubMed

Bateman, James; Allen, Maggie; Samani, Dipti; Kidd, Jane; Davies, David

2013-06-01

Virtual patients (VPs) are online representations of clinical cases used in medical education. Widely adopted, they are well placed to teach clinical reasoning skills. International technology standards mean VPs can be created, shared and repurposed between institutions. A systematic review has highlighted the lack of evidence to support which of the numerous VP designs may be effective, and why. We set out to research the influence of VP design on medical undergraduates. This is a grounded theory study into the influence of VP design on undergraduate medical students. Following a review of the literature and publicly available VP cases, we identified important design properties. We integrated them into two substantial VPs produced for this research. Using purposeful iterative sampling, 46 medical undergraduates were recruited to participate in six focus groups. Participants completed both VPs, an evaluation and a 1-hour focus group discussion. These were digitally recorded, transcribed and analysed using grounded theory, supported by computer-assisted analysis. Following open, axial and selective coding, we produced a theoretical model describing how students learn from VPs. We identified a central core phenomenon designated 'learning from the VP'. This had four categories: VP Construction; External Preconditions; Student-VP Interaction, and Consequences. From these, we constructed a three-layer model describing the interactions of students with VPs. The inner layer consists of the student's cognitive and behavioural preconditions prior to sitting a case. The middle layer considers the VP as an 'encoded object', an e-learning artefact and as a 'constructed activity', with associated pedagogic and organisational elements. The outer layer describes cognitive and behavioural change. This is the first grounded theory study to explore VP design. This original research has produced a model which enhances understanding of how and why the delivery and design of VPs influence learning. The model may be of practical use to authors, institutions and researchers. © 2013 John Wiley & Sons Ltd.

Multiple capsid-stabilizing interactions revealed in a high-resolution structure of an emerging picornavirus causing neonatal sepsis

NASA Astrophysics Data System (ADS)

Shakeel, Shabih; Westerhuis, Brenda M.; Domanska, Ausra; Koning, Roman I.; Matadeen, Rishi; Koster, Abraham J.; Bakker, Arjen Q.; Beaumont, Tim; Wolthers, Katja C.; Butcher, Sarah J.

2016-07-01

The poorly studied picornavirus, human parechovirus 3 (HPeV3) causes neonatal sepsis with no therapies available. Our 4.3-Å resolution structure of HPeV3 on its own and at 15 Å resolution in complex with human monoclonal antibody Fabs demonstrates the expected picornavirus capsid structure with three distinct features. First, 25% of the HPeV3 RNA genome in 60 sites is highly ordered as confirmed by asymmetric reconstruction, and interacts with conserved regions of the capsid proteins VP1 and VP3. Second, the VP0 N terminus stabilizes the capsid inner surface, in contrast to other picornaviruses where on expulsion as VP4, it forms an RNA translocation channel. Last, VP1's hydrophobic pocket, the binding site for the antipicornaviral drug, pleconaril, is blocked and thus inappropriate for antiviral development. Together, these results suggest a direction for development of neutralizing antibodies, antiviral drugs based on targeting the RNA-protein interactions and dissection of virus assembly on the basis of RNA nucleation.

Velocity Gradient Across the San Andreas Fault and Changes in Slip Behavior as Outlined by Full non Linear Tomography

NASA Astrophysics Data System (ADS)

Chiarabba, C.; Giacomuzzi, G.; Piana Agostinetti, N.

2017-12-01

The San Andreas Fault (SAF) near Parkfield is the best known fault section which exhibit a clear transition in slip behavior from stable to unstable. Intensive monitoring and decades of studies permit to identify details of these processes with a good definition of fault structure and subsurface models. Tomographic models computed so far revealed the existence of large velocity contrasts, yielding physical insight on fault rheology. In this study, we applied a recently developed full non-linear tomography method to compute Vp and Vs models which focus on the section of the fault that exhibit fault slip transition. The new tomographic code allows not to impose a vertical seismic discontinuity at the fault position, as routinely done in linearized codes. Any lateral velocity contrast found is directly dictated by the data themselves and not imposed by subjective choices. The use of the same dataset of previous tomographic studies allows a proper comparison of results. We use a total of 861 earthquakes, 72 blasts and 82 shots and the overall arrival time dataset consists of 43948 P- and 29158 S-wave arrival times, accurately selected to take care of seismic anisotropy. Computed Vp and Vp/Vs models, which by-pass the main problems related to linarized LET algorithms, excellently match independent available constraints and show crustal heterogeneities with a high resolution. The high resolution obtained in the fault surroundings permits to infer lateral changes of Vp and Vp/Vs across the fault (velocity gradient). We observe that stable and unstable sliding sections of the SAF have different velocity gradients, small and negligible in the stable slip segment, but larger than 15 % in the unstable slip segment. Our results suggest that Vp and Vp/Vs gradients across the fault control fault rheology and the attitude of fault slip behavior.

Molecular identification of enteroviruses including two new types (EV-98 and EV-107) isolated from Japanese travellers from Asian countries.

PubMed

Yamashita, Teruo; Ito, Miyabi; Tsuzuki, Hideaki; Sakae, Kenji; Minagawa, Hiroko

2010-04-01

Of 58 enterovirus strains isolated from Japanese travellers returning from Asian countries, eight were non-serotypable with existing antisera. By sequencing a part of the VP1 region, six of these strains were typed as echovirus 9, enterovirus (EV)-73, EV-79 or EV-97. The nucleotide identity of the VP1 region of isolate T92-1499 to all enterovirus prototypes was <70 %. The VP1 sequence of isolate TN94-0349 was closely related to coxsackievirus (CV)-A9 (73.3 % nucleotide identity), but the virus could not be neutralized with a serum raised against the prototype CV-A9 strain. On the basis of complete molecular comparisons, T92-1499 and TN94-0349 were identified as EV-98 and EV-107, respectively, by the ICTV Picornavirus Study Group. Serum neutralization tests of Japanese individuals revealed a seroprevalence rate of 11 % for EV-73, and even lower seroprevalence rates, 1.0-3.8 %, were found for the other new enteroviruses, suggesting that prior circulation of these viruses in Japan was unlikely.

Recombinant vaccine for canine parvovirus in dogs.

PubMed

López de Turiso, J A; Cortés, E; Martínez, C; Ruiz de Ybáñez, R; Simarro, I; Vela, C; Casal, I

1992-05-01

VP2 is the major component of canine parvovirus (CPV) capsids. The VP2-coding gene was engineered to be expressed by a recombinant baculovirus under the control of the polyhedrin promoter. A transfer vector that contains the lacZ gene under the control of the p10 promoter was used in order to facilitate the selection of recombinants. The expressed VP2 was found to be structurally and immunologically indistinguishable from authentic VP2. The recombinant VP2 shows also the capability to self-assemble, forming viruslike particles similar in size and appearance to CPV virions. These viruslike particles have been used to immunize dogs in different doses and combinations of adjuvants, and the anti-CPV responses have been measured by enzyme-linked immunosorbent assay, monolayer protection assays, and an assay for the inhibition of hemagglutination. A dose of ca. 10 micrograms of VP2 was able to elicit a good protective response, higher than that obtained with a commercially available, inactivated vaccine. The results indicate that these viruslike particles can be used to protect dogs from CPV infection.

Recombinant vaccine for canine parvovirus in dogs.

PubMed Central

López de Turiso, J A; Cortés, E; Martínez, C; Ruiz de Ybáñez, R; Simarro, I; Vela, C; Casal, I

1992-01-01

VP2 is the major component of canine parvovirus (CPV) capsids. The VP2-coding gene was engineered to be expressed by a recombinant baculovirus under the control of the polyhedrin promoter. A transfer vector that contains the lacZ gene under the control of the p10 promoter was used in order to facilitate the selection of recombinants. The expressed VP2 was found to be structurally and immunologically indistinguishable from authentic VP2. The recombinant VP2 shows also the capability to self-assemble, forming viruslike particles similar in size and appearance to CPV virions. These viruslike particles have been used to immunize dogs in different doses and combinations of adjuvants, and the anti-CPV responses have been measured by enzyme-linked immunosorbent assay, monolayer protection assays, and an assay for the inhibition of hemagglutination. A dose of ca. 10 micrograms of VP2 was able to elicit a good protective response, higher than that obtained with a commercially available, inactivated vaccine. The results indicate that these viruslike particles can be used to protect dogs from CPV infection. Images PMID:1313899

Ebolavirus Classification Based on Natural Vectors

PubMed Central

Zheng, Hui; Yin, Changchuan; Hoang, Tung; He, Rong Lucy; Yang, Jie

2015-01-01

According to the WHO, ebolaviruses have resulted in 8818 human deaths in West Africa as of January 2015. To better understand the evolutionary relationship of the ebolaviruses and infer virulence from the relationship, we applied the alignment-free natural vector method to classify the newest ebolaviruses. The dataset includes three new Guinea viruses as well as 99 viruses from Sierra Leone. For the viruses of the family of Filoviridae, both genus label classification and species label classification achieve an accuracy rate of 100%. We represented the relationships among Filoviridae viruses by Unweighted Pair Group Method with Arithmetic Mean (UPGMA) phylogenetic trees and found that the filoviruses can be separated well by three genera. We performed the phylogenetic analysis on the relationship among different species of Ebolavirus by their coding-complete genomes and seven viral protein genes (glycoprotein [GP], nucleoprotein [NP], VP24, VP30, VP35, VP40, and RNA polymerase [L]). The topology of the phylogenetic tree by the viral protein VP24 shows consistency with the variations of virulence of ebolaviruses. The result suggests that VP24 be a pharmaceutical target for treating or preventing ebolaviruses. PMID:25803489

Antigenic profile of African horse sickness virus serotype 4 VP5 and identification of a neutralizing epitope shared with bluetongue virus and epizootic hemorrhagic disease virus.

PubMed

Martínez-Torrecuadrada, J L; Langeveld, J P; Venteo, A; Sanz, A; Dalsgaard, K; Hamilton, W D; Meloen, R H; Casal, J I

1999-05-10

African horse sickness virus (AHSV) causes a fatal disease in horses. The virus capsid is composed of a double protein layer, the outermost of which is formed by two proteins: VP2 and VP5. VP2 is known to determine the serotype of the virus and to contain the neutralizing epitopes. The biological function of VP5, the other component of the capsid, is unknown. In this report, AHSV VP5, expressed in insect cells alone or together with VP2, was able to induce AHSV-specific neutralizing antibodies. Moreover, two VP5-specific monoclonal antibodies (MAbs) that were able to neutralize the virus in a plaque reduction assay were generated. To dissect the antigenic structure of AHSV VP5, the protein was cloned in Escherichia coli using the pET3 system. The immunoreactivity of both MAbs, and horse and rabbit polyclonal antisera, with 17 overlapping fragments from VP5 was analyzed. The most immunodominant region was found in the N-terminal 330 residues of VP5, defining two antigenic regions, I (residues 151-200) and II (residues 83-120). The epitopes were further defined by PEPSCAN analysis with 12mer peptides, which determined eight antigenic sites in the N-terminal half of the molecule. Neutralizing epitopes were defined at positions 85-92 (PDPLSPGE) for MAb 10AE12 and at 179-185 (EEDLRTR) for MAb 10AC6. Epitope 10AE12 is highly conserved between the different orbiviruses. MAb 10AE12 was able to recognize bluetongue virus VP5 and epizootic hemorrhagic disease virus VP5 by several techniques. These data will be especially useful for vaccine development and diagnostic purposes. Copyright 1999 Academic Press.

Ebola VP40 in Exosomes Can Cause Immune Cell Dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pleet, Michelle L.; Mathiesen, Allison; DeMarino, Catherine

Ebola virus (EBOV) is an enveloped, ssRNA virus from the family Filoviridae capable of causing severe hemorrhagic fever with up to 80–90% mortality rates. The most recent outbreak of EBOV in West Africa starting in 2014 resulted in over 11,300 deaths; however, long-lasting persistence and recurrence in survivors has been documented, potentially leading to further transmission of the virus. We have previously shown that exosomes from cells infected with HIV-1, HTLV-1 and Rift Valley Fever virus are able to transfer viral proteins and non-coding RNAs to naïve recipient cells, resulting in an altered cellular activity. In the current manuscript, wemore » examined the effect of Ebola structural proteins VP40, GP, NP and VLPs on recipient immune cells, as well as the effect of exosomes containing these proteins on naïve immune cells. We found that VP40-transfected cells packaged VP40 into exosomes, and that these exosomes were capable of inducing apoptosis in recipient immune cells. In addition, we show that presence of VP40 within parental cells or in exosomes delivered to naïve cells could result in the regulation of RNAi machinery including Dicer, Drosha, and Ago 1, which may play a role in the induction of cell death in recipient immune cells. Exosome biogenesis was regulated by VP40 in transfected cells by increasing levels of ESCRT-II proteins EAP20 and EAP45, and exosomal marker proteins CD63 and Alix. VP40 was phosphorylated by Cdk2/Cyclin complexes at Serine 233 which could be reversed with r-Roscovitine treatment. The level of VP40-containing exosomes could also be regulated by treated cells with FDA-approved Oxytetracycline. Additionally, we utilized novel nanoparticles to safely capture VP40 and other viral proteins from Ebola VLPs spiked into human samples using SDS/reducing agents, thus minimizing the need for BSL-4 conditions for most downstream assays. Collectively, our data indicates that VP40 packaged into exosomes may be responsible for the deregulation and eventual destruction of the T-cell and myeloid arms of the immune system (bystander lymphocyte apoptosis), allowing the virus to replicate to high titers in the immunocompromised host. Moreover, our results suggest that the use of drugs such as Oxytetracycline to modulate the levels of exosomes exiting EBOV-infected cells may be able to prevent the devastation of the adaptive immune system and allow for an improved rate of survival.« less

Ebola VP40 in Exosomes Can Cause Immune Cell Dysfunction

DOE PAGES

Pleet, Michelle L.; Mathiesen, Allison; DeMarino, Catherine; ...

2016-11-07

Ebola virus (EBOV) is an enveloped, ssRNA virus from the family Filoviridae capable of causing severe hemorrhagic fever with up to 80–90% mortality rates. The most recent outbreak of EBOV in West Africa starting in 2014 resulted in over 11,300 deaths; however, long-lasting persistence and recurrence in survivors has been documented, potentially leading to further transmission of the virus. We have previously shown that exosomes from cells infected with HIV-1, HTLV-1 and Rift Valley Fever virus are able to transfer viral proteins and non-coding RNAs to naïve recipient cells, resulting in an altered cellular activity. In the current manuscript, wemore » examined the effect of Ebola structural proteins VP40, GP, NP and VLPs on recipient immune cells, as well as the effect of exosomes containing these proteins on naïve immune cells. We found that VP40-transfected cells packaged VP40 into exosomes, and that these exosomes were capable of inducing apoptosis in recipient immune cells. In addition, we show that presence of VP40 within parental cells or in exosomes delivered to naïve cells could result in the regulation of RNAi machinery including Dicer, Drosha, and Ago 1, which may play a role in the induction of cell death in recipient immune cells. Exosome biogenesis was regulated by VP40 in transfected cells by increasing levels of ESCRT-II proteins EAP20 and EAP45, and exosomal marker proteins CD63 and Alix. VP40 was phosphorylated by Cdk2/Cyclin complexes at Serine 233 which could be reversed with r-Roscovitine treatment. The level of VP40-containing exosomes could also be regulated by treated cells with FDA-approved Oxytetracycline. Additionally, we utilized novel nanoparticles to safely capture VP40 and other viral proteins from Ebola VLPs spiked into human samples using SDS/reducing agents, thus minimizing the need for BSL-4 conditions for most downstream assays. Collectively, our data indicates that VP40 packaged into exosomes may be responsible for the deregulation and eventual destruction of the T-cell and myeloid arms of the immune system (bystander lymphocyte apoptosis), allowing the virus to replicate to high titers in the immunocompromised host. Moreover, our results suggest that the use of drugs such as Oxytetracycline to modulate the levels of exosomes exiting EBOV-infected cells may be able to prevent the devastation of the adaptive immune system and allow for an improved rate of survival.« less

Ebola VP40 in Exosomes Can Cause Immune Cell Dysfunction.

PubMed

Pleet, Michelle L; Mathiesen, Allison; DeMarino, Catherine; Akpamagbo, Yao A; Barclay, Robert A; Schwab, Angela; Iordanskiy, Sergey; Sampey, Gavin C; Lepene, Benjamin; Nekhai, Sergei; Aman, M J; Kashanchi, Fatah

2016-01-01

Ebola virus (EBOV) is an enveloped, ssRNA virus from the family Filoviridae capable of causing severe hemorrhagic fever with up to 80-90% mortality rates. The most recent outbreak of EBOV in West Africa starting in 2014 resulted in over 11,300 deaths; however, long-lasting persistence and recurrence in survivors has been documented, potentially leading to further transmission of the virus. We have previously shown that exosomes from cells infected with HIV-1, HTLV-1 and Rift Valley Fever virus are able to transfer viral proteins and non-coding RNAs to naïve recipient cells, resulting in an altered cellular activity. In the current manuscript, we examined the effect of Ebola structural proteins VP40, GP, NP and VLPs on recipient immune cells, as well as the effect of exosomes containing these proteins on naïve immune cells. We found that VP40-transfected cells packaged VP40 into exosomes, and that these exosomes were capable of inducing apoptosis in recipient immune cells. Additionally, we show that presence of VP40 within parental cells or in exosomes delivered to naïve cells could result in the regulation of RNAi machinery including Dicer, Drosha, and Ago 1, which may play a role in the induction of cell death in recipient immune cells. Exosome biogenesis was regulated by VP40 in transfected cells by increasing levels of ESCRT-II proteins EAP20 and EAP45, and exosomal marker proteins CD63 and Alix. VP40 was phosphorylated by Cdk2/Cyclin complexes at Serine 233 which could be reversed with r-Roscovitine treatment. The level of VP40-containing exosomes could also be regulated by treated cells with FDA-approved Oxytetracycline. Additionally, we utilized novel nanoparticles to safely capture VP40 and other viral proteins from Ebola VLPs spiked into human samples using SDS/reducing agents, thus minimizing the need for BSL-4 conditions for most downstream assays. Collectively, our data indicates that VP40 packaged into exosomes may be responsible for the deregulation and eventual destruction of the T-cell and myeloid arms of the immune system (bystander lymphocyte apoptosis), allowing the virus to replicate to high titers in the immunocompromised host. Moreover, our results suggest that the use of drugs such as Oxytetracycline to modulate the levels of exosomes exiting EBOV-infected cells may be able to prevent the devastation of the adaptive immune system and allow for an improved rate of survival.

Isolation and molecular cloning of a fast-growing strain of human hepatitis A virus from its double-stranded replicative form.

PubMed Central

Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M

1985-01-01

A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478

Zooanthroponotic transmission of rotavirus in Haryana State of Northern India.

PubMed

Choudhary, P; Minakshi, P; Ranjan, K; Basanti, B

Rotaviruses are the major cause of severe gastroenteritis and mortality in young children and animals. Due to segmented nature of dsRNA genome and wide host range, vast genetic and antigenic diversity exists amongst different isolates of rotaviruses. A total of 230 fecal ovine and caprine samples collected from organized farms and villages in Haryana were screened for rotavirus detection. Samples were screened by latex agglutination test and RNA-PAGE followed by RT-PCR and nucleic acid sequencing. The latex agglutination test showed 25 newborn lamb and 4 kid fecal samples positive for rotavirus. However, RNA-PAGE showed only 9 lamb fecal samples positive for rotavirus. All the samples were subjected to RT-PCR employing vp4 and vp7 gene specific primers of group A rotavirus of ovine, bovine and human origin. Only two samples from lamb (Sheep18/Hisar/2013 and Sheep22/Hisar/2013) showed vp4 and vp7 gene specific amplification with human group A rotavirus (GAR) specific primer. However, they did not show any amplification with ovine and bovine rotavirus specific primers. The nucleotide as well as deduced amino acid sequence analysis of vp4 gene of these isolates showed >98/97% and vp7 gene >95/94% nt/aa identity with human GAR from different regions of the world. Based on nucleotide similarity search, Sheep18/Hisar/2013 and Sheep22/Hisar/2013 isolates were genotyped as G1P[8] and G1P[4]. Phylogenetic analysis also confirmed that these isolates were clustered closely with human rotaviruses from different regions of the world. Earlier, higher prevalence of human rotaviruses was reported from the sample collecting area. The amplification of ovine samples with human rotavirus gene specific primers, sequence identity and phylogenetic analysis strongly suggests the zoonotic transmission of human GAR to sheep.

Immunogenicity of T7 bacteriophage nanoparticles displaying G-H loop of foot-and-mouth disease virus (FMDV).

PubMed

Xu, Hai; Bao, Xi; Lu, Yu; Liu, Yamei; Deng, Bihua; Wang, Yiwei; Xu, Yue; Hou, Jibo

2017-06-01

Foot-and-mouth disease (FMD) is a highly contagious disease of cloven-hoofed animals that causes severe economic losses worldwide. The G-H loop of the FMDV VP1 structural protein is the major neutralizing antigenic site. However, a fully protective G-H loop peptide vaccine requires the addition of promiscuous Th sites from a source outside VP1. Thus, we demonstrated the potential of T7 bacteriophage based nanoparticles displaying a genetically fused G-H loop peptide (T7-GH) as a FMDV vaccine candidate. Recombinant T7-GH phage was constructed by inserting the G-H loop coding region into the T7 Select 415-1b vector. Purified T7-GH phage nanoparticles were analyzed by SDS-PAGE, Western blot and Dot-ELISA. Pigs seronegative for FMDV exposure were immunized with T7-GH nanoparticles along with the adjuvant Montanide ISA206, and two commercially available FMDV vaccines (InactVac and PepVac). Humoral and cellular immune responses, as well as protection against virulent homologous virus challenge were assessed following single dose immunization. Pigs immunized T7-GH developed comparable anti-VP1 antibody titers to PepVac, although lower LPBE titers than was induced by InactVac. Antigen specific lymphocyte proliferation was detected in T7-GH group similar to that of PepVac group, however, weaker than InactVac group. Pigs immunized with T7-GH developed a neutralizing antibody response stronger than PepVac, but weaker than InactVac. Furthermore, 80% (4/5) of T7-GH immunized pigs were protected from challenge with virulent homologous virus. These findings demonstrate that the T7-GH phage nanoparticles were effective in eliciting antigen specific immune responses in pigs, highlighting the value of such an approach in the research and development of FMDV vaccines. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of a G1P[8] rotavirus causing an outbreak of gastroenteritis in the Northern Territory, Australia, in the vaccine era.

PubMed

Donato, Celeste M; Cowley, Daniel; Snelling, Thomas L; Akopov, Asmik; Kirkness, Ewen F; Kirkwood, Carl D

2014-07-01

In 2010, a large outbreak of rotavirus gastroenteritis occurred in the Alice Springs region of the Northern Territory, Australia. The outbreak occurred 43 months after the introduction of the G1P[8] rotavirus vaccine Rotarix(®). Forty-three infants were hospitalized during the outbreak and analysis of fecal samples from each infant revealed a G1P[8] rotavirus strain. The outbreak strain was adapted to cell culture and neutralization assays were performed using VP7 and VP4 neutralizing monoclonal antibodies. The outbreak strain exhibited a distinct neutralization resistance pattern compared to the Rotarix(®) vaccine strain. Whole genome sequencing of the 2010 outbreak virus strain demonstrated numerous amino acid differences compared to the Rotarix(®) vaccine strain in the characterized neutralization epitopes of the VP7 and VP4 proteins. Phylogenetic analysis of the outbreak strain revealed a close genetic relationship to global strains, in particular RVA/Human-wt/BEL/BE0098/2009/G1P[8] and RVA/Human-wt/BEL/BE00038/2008/G1P[8] for numerous genes. The 2010 outbreak strain was likely introduced from a globally circulating population of strains rather than evolving from an endemic Australian strain. The outbreak strain possessed antigenic differences in the VP7 and VP4 proteins compared to the Rotarix(®) vaccine strain. The outbreak was associated with moderate vaccine coverage and possibly low vaccine take in the population.

Slab and Plume Morphology in the Transition Zone and Below: a Comparison of Images From Recent P and S Velocity Models

NASA Astrophysics Data System (ADS)

Salmi, L. M.; French, S. W.; Romanowicz, B. A.

2014-12-01

Resolving subduction zones in the shallow upper mantle using global shear velocity tomography has long been a challenge, likely due to the rather narrow signature of the slabs down to ~400 km depth compared to the wavelength of fundamental mode and overtone surface waves, on which resolution of Vs at these depths often relies. On the other hand, models based on P wave travel times exhibit higher resolution in subduction zone regions, owing to both the higher frequencies of the P waves as well as an optimal illumination geometry. Conversely, the global Vs models typically have better resolution near the CMB, because of constraints provided by Sdiff and multiple ScS phases. Here we compare the morphology of subducted slabs throughout the mantle, as imaged by both a recent Vp model (GAP_P4, Fukao and Obayashi, 2013) and a new Vs model (SEMUCB-WM1, French and Romanowicz, GJI, in revision). The latter model was developed by inverting body (to 32s) and fundamental and overtone surface (to 60s) waveforms, with the forward seismic wavefield computed using the spectral element method. While the S velocity model is still "fuzzier" than the Vp model, it tracks the behavior of slabs trapped in the transition zone, and those ponding around 1000 km depth. We quantify the high correlation of the region of fast Vp and Vs anomalies, and thus derive a robust estimate of the R=dlnVs/dlnVp ratio as a function of depth in regions of faster than average velocity. We compare these results with estimates obtained with other combinations of available P and S models, as well as theoretical values from mineral physical calculations. Estimating R in slow velocity regions is more difficult, as resolution varies more among models. Here we compare slow velocity images in SEMUCB-WM1 with those of other recent Vs and Vp models and attempt to estimate R in those regions as well. Interestingly, we note that, in the SEMUCB-WM1 model, some of the columnar, lower than average velocity regions "rising" from the CMB through the lower mantle appear to be deflected horizontally at ~1000 km depth. This observation suggests that whatever mechanism causes the resistance to downward flow in subduction zones at this depth may also affect upwellings.

How a joint interpretation of seismic scattering, velocity, and attenuation models explains the nature of the Campi Flegrei (Italy).

NASA Astrophysics Data System (ADS)

Calo, M.; Tramelli, A.

2017-12-01

Seismic P and S velocity models (and their ratio Vp/Vs) help illuminating the geometrical structure of the bodies and give insight on the presence of water, molten or gas saturated regions. Seismic attenuation represents the anelastic behavior of the medium. Due to its dependence on temperature, fluid contents and cracks presence, this parameter is also largely used to characterize the structures of volcanoes and geothermal areas. Scattering attenuation is related, in the upper crust, to the amount, size and organization of the fractures giving complementary information on the state of the medium.Therefore a joint interpretation of these models provides an exhaustive view of the elastic parameters in volcanic regions. Campi Flegrei is an active Caldera marked by strong vertical deformations of the ground called bradyseisms and several models have been proposed to describe the nature and the geometry of the bodies responsible of the bradyseisms. Here we show Vp, Vp/Vs, Qp and scattering models carried out by applying an enhanced seismic tomography method that combines de double difference approach (Zhang and Thurber, 2003) and the Weigthed Average Method (Calò et al., 2009, Calò et al., 2011, 2013). The data used are the earthquakes recorded during the largest bradyseism crisis of the 80's. Our method allowed to image structures with linear dimension of 0.5-1.2km, resulting in an improvement of the resolving power at least two times of the other published models (e.g. Priolo et al., 2012). The joint interpretation of seismic models allowed to discern small anomalous bodies at shallow depth (0.5-2.0 km) marked by relatively low Vp, high Vp/Vs ratio and low Qp values associated with the presence of shallow geothermal water saturated reservoir from regions with low Vp, low Vp/Vs and low Qp related to the gas saturated part of the reservoir. At deeper depth (2-3.5 km) bodies with high Vp and Vp/Vs and low Qp are associated with magmatic intrusions. The Scattering model highlights the highly fractured part of the caldera suggesting the main paths of the fluid/heath transportation. This work was supported by UNAM-PAPIIT:IA100416.

Accuracy of CT-based attenuation correction in PET/CT bone imaging

NASA Astrophysics Data System (ADS)

Abella, Monica; Alessio, Adam M.; Mankoff, David A.; MacDonald, Lawrence R.; Vaquero, Juan Jose; Desco, Manuel; Kinahan, Paul E.

2012-05-01

We evaluate the accuracy of scaling CT images for attenuation correction of PET data measured for bone. While the standard tri-linear approach has been well tested for soft tissues, the impact of CT-based attenuation correction on the accuracy of tracer uptake in bone has not been reported in detail. We measured the accuracy of attenuation coefficients of bovine femur segments and patient data using a tri-linear method applied to CT images obtained at different kVp settings. Attenuation values at 511 keV obtained with a 68Ga/68Ge transmission scan were used as a reference standard. The impact of inaccurate attenuation images on PET standardized uptake values (SUVs) was then evaluated using simulated emission images and emission images from five patients with elevated levels of FDG uptake in bone at disease sites. The CT-based linear attenuation images of the bovine femur segments underestimated the true values by 2.9 ± 0.3% for cancellous bone regardless of kVp. For compact bone the underestimation ranged from 1.3% at 140 kVp to 14.1% at 80 kVp. In the patient scans at 140 kVp the underestimation was approximately 2% averaged over all bony regions. The sensitivity analysis indicated that errors in PET SUVs in bone are approximately proportional to errors in the estimated attenuation coefficients for the same regions. The variability in SUV bias also increased approximately linearly with the error in linear attenuation coefficients. These results suggest that bias in bone uptake SUVs of PET tracers ranges from 2.4% to 5.9% when using CT scans at 140 and 120 kVp for attenuation correction. Lower kVp scans have the potential for considerably more error in dense bone. This bias is present in any PET tracer with bone uptake but may be clinically insignificant for many imaging tasks. However, errors from CT-based attenuation correction methods should be carefully evaluated if quantitation of tracer uptake in bone is important.

Cluster analysis of quantitative parametric maps from DCE-MRI: application in evaluating heterogeneity of tumor response to antiangiogenic treatment.

PubMed

Longo, Dario Livio; Dastrù, Walter; Consolino, Lorena; Espak, Miklos; Arigoni, Maddalena; Cavallo, Federica; Aime, Silvio

2015-07-01

The objective of this study was to compare a clustering approach to conventional analysis methods for assessing changes in pharmacokinetic parameters obtained from dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) during antiangiogenic treatment in a breast cancer model. BALB/c mice bearing established transplantable her2+ tumors were treated with a DNA-based antiangiogenic vaccine or with an empty plasmid (untreated group). DCE-MRI was carried out by administering a dose of 0.05 mmol/kg of Gadocoletic acid trisodium salt, a Gd-based blood pool contrast agent (CA) at 1T. Changes in pharmacokinetic estimates (K(trans) and vp) in a nine-day interval were compared between treated and untreated groups on a voxel-by-voxel analysis. The tumor response to therapy was assessed by a clustering approach and compared with conventional summary statistics, with sub-regions analysis and with histogram analysis. Both the K(trans) and vp estimates, following blood-pool CA injection, showed marked and spatial heterogeneous changes with antiangiogenic treatment. Averaged values for the whole tumor region, as well as from the rim/core sub-regions analysis were unable to assess the antiangiogenic response. Histogram analysis resulted in significant changes only in the vp estimates (p<0.05). The proposed clustering approach depicted marked changes in both the K(trans) and vp estimates, with significant spatial heterogeneity in vp maps in response to treatment (p<0.05), provided that DCE-MRI data are properly clustered in three or four sub-regions. This study demonstrated the value of cluster analysis applied to pharmacokinetic DCE-MRI parametric maps for assessing tumor response to antiangiogenic therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

A California statewide three-dimensional seismic velocity model from both absolute and differential times

USGS Publications Warehouse

Lin, G.; Thurber, C.H.; Zhang, H.; Hauksson, E.; Shearer, P.M.; Waldhauser, F.; Brocher, T.M.; Hardebeck, J.

2010-01-01

We obtain a seismic velocity model of the California crust and uppermost mantle using a regional-scale double-difference tomography algorithm. We begin by using absolute arrival-time picks to solve for a coarse three-dimensional (3D) P velocity (VP) model with a uniform 30 km horizontal node spacing, which we then use as the starting model for a finer-scale inversion using double-difference tomography applied to absolute and differential pick times. For computational reasons, we split the state into 5 subregions with a grid spacing of 10 to 20 km and assemble our final statewide VP model by stitching together these local models. We also solve for a statewide S-wave model using S picks from both the Southern California Seismic Network and USArray, assuming a starting model based on the VP results and a VP=VS ratio of 1.732. Our new model has improved areal coverage compared with previous models, extending 570 km in the SW-NE directionand 1320 km in the NW-SE direction. It also extends to greater depth due to the inclusion of substantial data at large epicentral distances. Our VP model generally agrees with previous separate regional models for northern and southern California, but we also observe some new features, such as high-velocity anomalies at shallow depths in the Klamath Mountains and Mount Shasta area, somewhat slow velocities in the northern Coast Ranges, and slow anomalies beneath the Sierra Nevada at midcrustal and greater depths. This model can be applied to a variety of regional-scale studies in California, such as developing a unified statewide earthquake location catalog and performing regional waveform modeling.

Hydration of marginal basins and compositional variations within the continental lithospheric mantle inferred from a new global model of shear and compressional velocity

NASA Astrophysics Data System (ADS)

Tesoniero, Andrea; Auer, Ludwig; Boschi, Lapo; Cammarano, Fabio

2015-11-01

We present a new global model of shear and compressional wave speeds for the entire mantle, partly based on the data set employed for the shear velocity model savani. We invert Rayleigh and Love surface waves up to the sixth overtone in combination with major P and S body wave phases. Mineral physics data on the isotropic δlnVS/δlnVP ratio are taken into account in the form of a regularization constraint. The relationship between VP and VS that we observe in the top 300 km of the mantle has important thermochemical implications. Back-arc basins in the Western Pacific are characterized by large VP/VS and not extremely low VS at ˜150 km depth, consistently with presence of water. Most pronounced anomalies are located in the Sea of Japan, in the back-arc region of the Philippine Sea, and in the South China Sea. Our results indicate the effectiveness of slab-related processes to hydrate the mantle and suggest an important role of Pacific plate subduction also for the evolution of the South China Sea. We detect lateral variations in composition within the continental lithospheric mantle. Regions that have been subjected to rifting, collisions, and flood basalt events are underlain by relatively large VP/VS ratio compared to undeformed Precambrian regions, consistently with a lower degree of chemical depletion. Compositional variations are also observed in deep lithosphere. At ˜200 km depth, mantle beneath Australia and African cratons has comparable positive VS anomalies with other continental regions, but VP is ˜1% higher.

A Temperature-Sensitive Lesion in the N-Terminal Domain of the Rotavirus Polymerase Affects Its Intracellular Localization and Enzymatic Activity

PubMed Central

McKell, Allison O.; LaConte, Leslie E. W.

2017-01-01

ABSTRACT Temperature-sensitive (ts) mutants of simian rotavirus (RV) strain SA11 have been previously created to investigate the functions of viral proteins during replication. One mutant, SA11-tsC, has a mutation that maps to the gene encoding the VP1 polymerase and shows diminished growth and RNA synthesis at 39°C compared to that at 31°C. In the present study, we sequenced all 11 genes of SA11-tsC, confirming the presence of an L138P mutation in the VP1 N-terminal domain and identifying 52 additional mutations in four other viral proteins (VP4, VP7, NSP1, and NSP2). To investigate whether the L138P mutation induces a ts phenotype in VP1 outside the SA11-tsC genetic context, we employed ectopic expression systems. Specifically, we tested whether the L138P mutation affects the ability of VP1 to localize to viroplasms, which are the sites of RV RNA synthesis, by expressing the mutant form as a green fluorescent protein (GFP) fusion protein (VP1L138P-GFP) (i) in wild-type SA11-infected cells or (ii) in uninfected cells along with viroplasm-forming proteins NSP2 and NSP5. We found that VP1L138P-GFP localized to viroplasms and interacted with NSP2 and/or NSP5 at 31°C but not at 39°C. Next, we tested the enzymatic activity of a recombinant mutant polymerase (rVP1L138P) in vitro and found that it synthesized less RNA at 39°C than at 31°C, as well as less RNA than the control at all temperatures. Together, these results provide a mechanistic basis for the ts phenotype of SA11-tsC and raise important questions about the role of leucine 138 in supporting key protein interactions and the catalytic function of the VP1 polymerase. IMPORTANCE RVs cause diarrhea in the young of many animal species, including humans. Despite their medical and economic importance, gaps in knowledge exist about how these viruses replicate inside host cells. Previously, a mutant simian RV (SA11-tsC) that replicates worse at higher temperatures was identified. This virus has an amino acid mutation in VP1, which is the enzyme responsible for copying the viral RNA genome. The mutation is located in a poorly understood region of the polymerase called the N-terminal domain. In this study, we determined that the mutation reduces the ability of VP1 to properly localize within infected cells at high temperatures, as well as reduced the ability of the enzyme to copy viral RNA in a test tube. The results of this study explain the temperature sensitivity of SA11-tsC and shed new light on functional protein-protein interaction sites of VP1. PMID:28100623

Human parvovirus B19 antibodies induce altered membrane protein expression and apoptosis of BeWo trophoblasts.

PubMed

Tzang, Bor-Show; Chiang, Szu-Yi; Chan, Hsu-Chin; Liu, Chung-Hsien; Hsu, Tsai-Ching

2016-11-01

Human parvovirus B19 (B19) is harmful during pregnancy since it can be vertically transmitted to the developing fetus. In addition, the anti‑B19 antibodies induced by B19 infection are believed to have a cytopathic role in B19 transmission; however, knowledge regarding the effects of anti‑B19 antibodies during pregnancy is limited. To investigate the possible roles of anti‑B19 antibodies during pregnancy, the present study examined the effects of anti‑B19‑VP1 unique region (VP1u), anti‑B19‑VP2 and anti‑B19‑nonstructural protein 1 (NS1) immunoglobulin G (IgG) antibodies on BeWo trophoblasts. Briefly, BeWo trophoblasts were incubated with purified IgG against B19‑VP1u, B19‑VP2 and B19‑NS1. Subsequently, the expression of surface proteins and apoptotic molecules were assessed in BeWo trophoblasts using flow cytometry, ELISA and western blotting. The expression levels of human leukocyte antigen (HLA)‑G were significantly increased on BeWo trophoblasts treated with rabbit anti‑B19‑VP1u IgG, and were unchanged in those treated with rabbit anti‑B19‑NS1 and anti‑B19‑VP2 IgG, as compared with the control group. Furthermore, the expression levels of globoside (P blood group antigen) and cluster of differentiation (CD)29 (β1 integrin) were significantly increased in BeWo trophoblasts treated with rabbit anti‑B19‑NS1 and anti‑B19‑VP2 IgG, whereas only CD29 was also significantly increased in cells treated with anti‑B19‑VP1u IgG. In addition, the number of cells at sub‑G1 phase; caspase‑3 activity; and the expression of intrinsic and extrinsic apoptotic molecules, including Fas‑associated death domain protein, activated caspase‑8, activated caspase‑3, B‑cell lymphoma 2‑associated X protein, cytochrome c, apoptotic peptidase activating factor 1 and activated caspase‑9, were significantly increased in BeWo trophoblasts treated with anti‑B19‑VP1u and anti‑B19‑NS1 IgG. In conclusion, the present study demonstrated that antibodies against B19 may have a crucial role in pathological processes during pregnancy. These findings may help to elucidate the mechanisms underlying transmission of the B19 virus during pregnancy.

Recombinant Marburg viruses containing mutations in the IID region of VP35 prevent inhibition of Host immune responses.

PubMed

Albariño, César G; Wiggleton Guerrero, Lisa; Spengler, Jessica R; Uebelhoer, Luke S; Chakrabarti, Ayan K; Nichol, Stuart T; Towner, Jonathan S

2015-02-01

Previous in vitro studies have demonstrated that Ebola and Marburg virus (EBOV and MARV) VP35 antagonize the host cell immune response. Moreover, specific mutations in the IFN inhibitory domain (IID) of EBOV and MARV VP35 that abrogate their interaction with virus-derived dsRNA, lack the ability to inhibit the host immune response. To investigate the role of MARV VP35 in the context of infectious virus, we used our reverse genetics system to generate two recombinant MARVs carrying specific mutations in the IID region of VP35. Our data show that wild-type and mutant viruses grow to similar titers in interferon deficient cells, but exhibit attenuated growth in interferon-competent cells. Furthermore, in contrast to wild-type virus, both MARV mutants were unable to inhibit expression of various antiviral genes. The MARV VP35 mutants exhibit similar phenotypes to those previously described for EBOV, suggesting the existence of a shared immune-modulatory strategy between filoviruses. Published by Elsevier Inc.

Characterization and protective efficacy in an animal model of a novel truncated rotavirus VP8 subunit parenteral vaccine candidate.

PubMed

Xue, Miaoge; Yu, Linqi; Che, Yaojian; Lin, Haijun; Zeng, Yuanjun; Fang, Mujin; Li, Tingdong; Ge, Shengxiang; Xia, Ningshao

2015-05-21

The cell-attachment protein VP8* of rotavirus is a potential candidate parenteral vaccine. However, the yield of full-length VP8 protein (VP8*, residues 1-231) expressed in Escherichia coli was low, and a truncated VP8 protein (ΔVP8*, residues 65-231) cannot elicit efficient protective immunity in a mouse model. In this study, tow novel truncated VP8 proteins, VP8-1 (residues 26-231) and VP8-2 (residues 51-231), were expressed in E. coli and evaluated for immunogenicity and protective efficacy, compared with VP8* and ΔVP8*. As well as ΔVP8*, the protein VP8-1 and VP8-2 were successfully expressed in high yield and purified in homogeneous dimeric forms, while the protein VP8* was expressed with lower yield and prone to aggregation and degradation in solution. Although the immunogenicity of the protein VP8*, VP8-1, VP8-2 and ΔVP8* was comparable, immunization of VP8* and VP8-1 elicited significantly higher neutralizing antibody titers than that of VP8-2 and ΔVP8* in mice. Furthermore, when assessed using a mouse maternal antibody model, the efficacy of VP8-1 to protect against rotavirus-induced diarrhea in pups was comparable to that of VP8*, both were dramatically higher than that of VP8-2 and ΔVP8*. Taken together, the novel truncated protein VP8-1, with increased yield, improved homogeneity and high protective efficacy, is a viable candidate for further development of a parenterally administrated prophylactic vaccine against rotavirus infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of human G9P[8] rotavirus strains circulating in Jiangsu, China between 2010 and 2016.

PubMed

Xu, Cheng; Fu, Jianguang; Ai, Jing; Zhang, Jun; Liu, Cheng; Huo, Xiang; Bao, Changjun; Zhu, Yefei

2018-05-02

Rotavirus A (RVA) is the leading cause of acute viral gastroenteritis in children under 5 years of age worldwide. G9P[8] is a common RVA genotype that has been persistently prevalent in Jiangsu, China. To determine the genetic diversity of G9P[8] RVAs, 7 representative G9P[8] strains collected from Suzhou Children's Hospital between 2010 and 2016 (named JS2010-JS2016) were analyzed through whole-genome sequencing. All evaluated strains showed the Wa-like constellation G9-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. Furthermore, phylogenetic analysis revealed that the VP7 genes of all strains clustered into lineage G9-III and G9-VI. With the exception of strain JS2012 (P[8]-4), the VP4 sequences of all strains belonged to the P[8]-3 lineage. Sequencing further revealed that amino acid substitutions were present in the antigenic regions of the VP7 and VP4 genes of all strains. Moreover, there were multiple substitutions in antigenic sites I and II of the nonstructural protein 4 (NSP4) genes, whereas the other NSP genes were relatively conserved. In conclusion, our phylogenetic analysis of these 7 G9P[8] strains suggests that RVA varied across regions and time. Therefore, our findings suggest that continued surveillance is necessary to explore the molecular evolutionary characteristics of RVA for better prevention and treatment of acute viral gastroenteritis. © 2018 Wiley Periodicals, Inc.

Low-Q structure related to partially saturated pores within the reservoir beneath The Geysers area in the northern California

NASA Astrophysics Data System (ADS)

Matsubara, M.

2011-12-01

A large reservoir is located beneath The Geysers geothermal area, northern California. Seismic tomography revealed high-velocity (high-V) and low-Vp/Vs zones in the reservoir (Julian et al., 1996) and a decrease of Vp/Vs from 1991 to 1998 (Guasekera et al., 2003) owing to withdrawal of steam from the reservoir. I perform attenuation tomography in this region to investigate the state of vapor and liquid within the reservoir. The target region, 38.5-39.0°N and 122.5-123°W, covers The Geysers area. I use seismograms of 1,231 events whose focal mechanism are determined among 65,810 events recorded by the Northern California Earthquake Data Center from 2002 to 2008 in the target region. The band-pass filtered seismograms are analyzed for collecting the maximum amplitude data. There are 26 stations that have a three-component seismometer among 47 seismic stations. I use the P- and S-wave maximum amplitudes during the two seconds after the arrival of those waves in order to avoid coda effects. A total of 8,545 P- and 1,168 S-wave amplitude data for 949 earthquakes recorded at 47 stations are available for the analysis using the attenuation tomographic method derived from the velocity tomographic method (Matsubara et al., 2005, 2008) in which spatial velocity correlation and station corrections are introduced to the original code of Zhao et al. (1992). I use 3-D velocity structure obtained by Thurber et al. (2009). The initial Q value is set to 150, corresponding to the average Q of the northern California (Ford et al., 2010). At sea level, low-Q zones are found extending from the middle of the steam reservoir within the main greywacke to the south part of the reservoir. At a depth of 1 km below sea level, a low-Q zone is located solely in the southern part of the reservoir. However, at a depth of 2 km a low-Q zone is located beneath the northern part of the reservoir. At depths of 1 to 3 km a felsite batholith in the deeper portions of the reservoir, and it corresponds with a high-Q zone. A vertical cross section shows the low-Q zone is consistent with the reservoir as it extends through the main greywacke and into the uppermost part of the felsite. Most of the felsite has high-Q, however, the portion of the reservoir that extends into the felsite has low-Q. The Geysers geothermal area is bounded by Collayomi fault zone to the northeast and the Mercuryville fault zone to the southwest. The Geysers Peak fault runs from northwest to southeast about 3 km southwest of the Mercuryville fault. The Mercuryville fault dips to northeast and the Geysers Peak fault dips to southwest. High-Q zone is located between these faults and the width of this zone broadens as the depth increases corresponding to the fault geometry. The presence of liquid water introduces high-Vp/Vs, however, steam rich zones become low-Vp/Vs. Near the transition zone between the water and steam, laboratory experiments indicate that the amplitude becomes extremely small (Ito et al., 1979). A partially saturated zone has lower Q than a fully saturated zone, and a dry zone has high-Q. A low-Q zone with low-Vp/Vs corresponding to the reservoir indicates that the reservoir is partially saturated with steam and water near transition zone.

Virtual patient design: exploring what works and why. A grounded theory study

PubMed Central

Bateman, James; Allen, Maggie; Samani, Dipti; Kidd, Jane; Davies, David

2013-01-01

Objectives Virtual patients (VPs) are online representations of clinical cases used in medical education. Widely adopted, they are well placed to teach clinical reasoning skills. International technology standards mean VPs can be created, shared and repurposed between institutions. A systematic review has highlighted the lack of evidence to support which of the numerous VP designs may be effective, and why. We set out to research the influence of VP design on medical undergraduates. Methods This is a grounded theory study into the influence of VP design on undergraduate medical students. Following a review of the literature and publicly available VP cases, we identified important design properties. We integrated them into two substantial VPs produced for this research. Using purposeful iterative sampling, 46 medical undergraduates were recruited to participate in six focus groups. Participants completed both VPs, an evaluation and a 1-hour focus group discussion. These were digitally recorded, transcribed and analysed using grounded theory, supported by computer-assisted analysis. Following open, axial and selective coding, we produced a theoretical model describing how students learn from VPs. Results We identified a central core phenomenon designated ‘learning from the VP’. This had four categories: VP Construction; External Preconditions; Student–VP Interaction, and Consequences. From these, we constructed a three-layer model describing the interactions of students with VPs. The inner layer consists of the student's cognitive and behavioural preconditions prior to sitting a case. The middle layer considers the VP as an ‘encoded object’, an e-learning artefact and as a ‘constructed activity’, with associated pedagogic and organisational elements. The outer layer describes cognitive and behavioural change. Conclusions This is the first grounded theory study to explore VP design. This original research has produced a model which enhances understanding of how and why the delivery and design of VPs influence learning. The model may be of practical use to authors, institutions and researchers. PMID:23662877

Synthetic peptides for the immunodiagnosis of hepatitis A virus infection.

PubMed

Gauna, A; Losada, S; Lorenzo, M; Bermúdez, H; Toledo, M; Pérez, H; Chacón, E; Noya, O

2015-12-01

VP1, VP2 and VP3 molecules of hepatitis A virus are exposed capsid proteins that have shown to be antigenic and are used for diagnosis in recombinant-antigen commercial kits. In this study, we developed a sequence analysis in order to predict diagnostic peptide epitopes, followed by their spot synthesis on functionalized cellulose paper (Pepscan). This paper with synthetic peptides was tested against a sera pool of hepatitis A patients. Two peptide sequences, that have shown an antigenic recognition, were selected for greater scale synthesis on resin. A dimeric form of one of these peptides (IMT-1996), located in the C-Terminus region of protein VP1, was antigenic with a recognition frequency of 87-100% of anti-IgG antibodies and 100% of anti-IgM antibodies employing the immunological assays MABA and ELISA. We propose peptide IMT-1996, with less than twenty residues, as a cheaper alternative for prevalence studies and diagnosis of hepatitis A infection. Copyright © 2015 Elsevier B.V. All rights reserved.

Crustal structure of north Peru from analysis of teleseismic receiver functions

NASA Astrophysics Data System (ADS)

Condori, Cristobal; França, George S.; Tavera, Hernando J.; Albuquerque, Diogo F.; Bishop, Brandon T.; Beck, Susan L.

2017-07-01

In this study, we present results from teleseismic receiver functions, in order to investigate the crustal thickness and Vp/Vs ratio beneath northern Peru. A total number of 981 receiver functions were analyzed, from data recorded by 28 broadband seismic stations from the Peruvian permanent seismic network, the regional temporary SisNort network and one CTBTO station. The Moho depth and average crustal Vp/Vs ratio were determined at each station using the H-k stacking technique to identify the arrival times of primary P to S conversion and crustal reverberations (PpPms, PpSs + PsPms). The results show that the Moho depth correlates well with the surface topography and varies significantly from west to east, showing a shallow depth of around 25 km near the coast, a maximum depth of 55-60 km beneath the Andean Cordillera, and a depth of 35-40 km further to the east in the Amazonian Basin. The bulk crustal Vp/Vs ratio ranges between 1.60 and 1.88 with the mean of 1.75. Higher values between 1.75 and 1.88 are found beneath the Eastern and Western Cordilleras, consistent with a mafic composition in the lower crust. In contrast values vary from 1.60 to 1.75 in the extreme flanks of the Eastern and Western Cordillera indicating a felsic composition. We find a positive relationship between crustal thickness, Vp/Vs ratio, the Bouguer anomaly, and topography. These results are consistent with previous studies in other parts of Peru (central and southern regions) and provide the first crustal thickness estimates for the high cordillera in northern Peru.

Improving Shipboard Applications of Non-Intrusive Load Monitoring

DTIC Science & Technology

2008-06-01

EVENTS_LIST (EventNum) .EVENTCODE) case 0 %Unclassifiable case 1 %VP On STATE.VP.ON = STATE.VP.ON + 1; STATE.VP.START = true; PICTURES.RUNNING.VP.SHOW...true; case 2 %VP Off STATE.VP.STOP = true; PICTURES. RUNNING.VP. SHOW false; case 3 %DP On 149 STATE.DP.ON = STATE.DP.ON + 1; STATE.DP.START = true...PICTURES.RUNNING.DP.SHOW true; case 4 %DP Off STATE.DP.STOP = true; PICTURES.RUNNING.DP.SHOW = false; case 5 %VP On (Clogged) STATE.VP.ON = STATE.VP.ON

Nucleic acid immunization protects dogs against challenge with virulent canine parvovirus.

PubMed

Jiang, W; Baker, H J; Swango, L J; Schorr, J; Self, M J; Smith, B F

1998-04-01

Nucleic acid vaccines (NAVs) use expression vectors encoding one or more antigen genes to transfect host cells inducing both humoral and cellular immunity against the expressed antigen. NAV offers major advantages over conventional vaccines for the protection of humans and animals. This study shows that a plasmid DNA (pGT36VP1) encoding the full length VP1 region of canine parvovirus (CPV) induces immunity that protects dogs against challenge with virulent virus. Five dogs without anti-CPV antibodies were injected at 9 months of age with increasing doses of pGT36VP1 or saline. NAV vaccinated dogs showed an increase of serum IgG titer starting 1 week post-injection which peaked at week 2 and remained detectable for at least 14 weeks. A second dose of NAV resulted in an anamnestic response within 1 week. IgG titers peaked at week 3 and 4 after the second injection. All pGT36VP1 vaccinated dogs were protected against infection after virulent CPV challenge regardless of dose and the unvaccinated control dog was fully susceptible. This study demonstrated for the first time that a NAV can protect dogs against an infectious disease.

Crystal Structures of Major Envelope Proteins VP26 and VP28 from White Spot Syndrome Virus Shed Light on Their Evolutionary Relationship

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang,X.; Wu, J.; Sivaraman, J.

2007-01-01

White spot syndrome virus (WSSV) is a virulent pathogen known to infect various crustaceans. It has bacilliform morphology with a tail-like appendage at one end. The envelope consists of four major proteins. Envelope structural proteins play a crucial role in viral infection and are believed to be the first molecules to interact with the host. Here, we report the localization and crystal structure of major envelope proteins VP26 and VP28 from WSSV at resolutions of 2.2 and 2.0 {angstrom}, respectively. These two proteins alone account for approximately 60% of the envelope, and their structures represent the first two structural envelopemore » proteins of WSSV. Structural comparisons among VP26, VP28, and other viral proteins reveal an evolutionary relationship between WSSV envelope proteins and structural proteins from other viruses. Both proteins adopt {beta}-barrel architecture with a protruding N-terminal region. We have investigated the localization of VP26 and VP28 using immunoelectron microscopy. This study suggests that VP26 and VP28 are located on the outer surface of the virus and are observed as a surface protrusion in the WSSV envelope, and this is the first convincing observation for VP26. Based on our studies combined with the literature, we speculate that the predicted N-terminal transmembrane region of VP26 and VP28 may anchor on the viral envelope membrane, making the core {beta}-barrel protrude outside the envelope, possibly to interact with the host receptor or to fuse with the host cell membrane for effective transfer of the viral infection. Furthermore, it is tempting to extend this host interaction mode to other structural viral proteins of similar structures. Our finding has the potential to extend further toward drug and vaccine development against WSSV.« less

A Temperature-Sensitive Lesion in the N-Terminal Domain of the Rotavirus Polymerase Affects Its Intracellular Localization and Enzymatic Activity.

PubMed

McKell, Allison O; LaConte, Leslie E W; McDonald, Sarah M

2017-04-01

Temperature-sensitive ( ts ) mutants of simian rotavirus (RV) strain SA11 have been previously created to investigate the functions of viral proteins during replication. One mutant, SA11- ts C, has a mutation that maps to the gene encoding the VP1 polymerase and shows diminished growth and RNA synthesis at 39°C compared to that at 31°C. In the present study, we sequenced all 11 genes of SA11- ts C, confirming the presence of an L138P mutation in the VP1 N-terminal domain and identifying 52 additional mutations in four other viral proteins (VP4, VP7, NSP1, and NSP2). To investigate whether the L138P mutation induces a ts phenotype in VP1 outside the SA11- ts C genetic context, we employed ectopic expression systems. Specifically, we tested whether the L138P mutation affects the ability of VP1 to localize to viroplasms, which are the sites of RV RNA synthesis, by expressing the mutant form as a green fluorescent protein (GFP) fusion protein (VP1 L138P -GFP) (i) in wild-type SA11-infected cells or (ii) in uninfected cells along with viroplasm-forming proteins NSP2 and NSP5. We found that VP1 L138P -GFP localized to viroplasms and interacted with NSP2 and/or NSP5 at 31°C but not at 39°C. Next, we tested the enzymatic activity of a recombinant mutant polymerase (rVP1 L138P ) in vitro and found that it synthesized less RNA at 39°C than at 31°C, as well as less RNA than the control at all temperatures. Together, these results provide a mechanistic basis for the ts phenotype of SA11- ts C and raise important questions about the role of leucine 138 in supporting key protein interactions and the catalytic function of the VP1 polymerase. IMPORTANCE RVs cause diarrhea in the young of many animal species, including humans. Despite their medical and economic importance, gaps in knowledge exist about how these viruses replicate inside host cells. Previously, a mutant simian RV (SA11- ts C) that replicates worse at higher temperatures was identified. This virus has an amino acid mutation in VP1, which is the enzyme responsible for copying the viral RNA genome. The mutation is located in a poorly understood region of the polymerase called the N-terminal domain. In this study, we determined that the mutation reduces the ability of VP1 to properly localize within infected cells at high temperatures, as well as reduced the ability of the enzyme to copy viral RNA in a test tube. The results of this study explain the temperature sensitivity of SA11- ts C and shed new light on functional protein-protein interaction sites of VP1. Copyright © 2017 American Society for Microbiology.

A traditional evolutionary history of foot-and-mouth disease viruses in Southeast Asia challenged by analyses of non-structural protein coding sequences

USDA-ARS?s Scientific Manuscript database

Molecular epidemiology and evolution of foot-and-mouth disease virus (FMDV) are widely studied using genomic sequences encoding VP1, the capsid protein containing the most relevant antigenic domains. Although sequencing of the full viral genome is not used as a routine diagnostic or surveillance too...

VP1 amino acid residue 145 of enterovirus 71 is a key residue for its receptor attachment and resistance to neutralizing antibody during cynomolgus monkey infection.

PubMed

Fujii, Ken; Sudaka, Yui; Takashino, Ayako; Kobayashi, Kyousuke; Kataoka, Chikako; Suzuki, Tadaki; Iwata-Yoshikawa, Naoko; Kotani, Osamu; Ami, Yasushi; Shimizu, Hiroyuki; Nagata, Noriyo; Mizuta, Katsumi; Matsuzaki, Yoko; Koike, Satoshi

2018-05-30

Enterovirus 71 (EV71) is a causative agent of hand, foot, and mouth disease and sometimes causes severe or fatal neurological complications. The amino acid at VP1-145 determines virological characteristics of EV71. Viruses with glutamic acid (E) at VP1-145 (VP1-145E) are virulent in neonatal mice and transgenic mice expressing human scavenger receptor B2, whereas those with glutamine (Q) or glycine (G) are not. However, the contribution of this variation to pathogenesis in humans is not fully understood. We compared the virulence of VP1-145E and VP1-145G viruses of Isehara and C7/Osaka backgrounds in cynomolgus monkeys. VP1-145E, but not VP1-145G, viruses induced neurological symptoms. VP1-145E viruses were frequently detected in the tissues of infected monkeys. VP1-145G viruses were detected less frequently and disappeared quickly. Instead, mutants that had a G to E mutation at VP1-145 emerged, suggesting that VP1-145E viruses have a replication advantage in the monkeys. This is consistent with our hypothesis proposed in the accompanying paper that the VP1-145G virus is attenuated due to its adsorption by heparan sulfate. Monkeys infected with both viruses produced neutralizing antibodies before the onset of the disease. Interestingly, VP1-145E viruses were more resistant to neutralizing antibodies than VP1-145G viruses in vitro A small amount of neutralizing antibody raised in the early phase of infection may not be sufficient to block the dissemination of VP1-145E viruses. The different resistance of the VP1-145 variants to neutralizing antibodies may be one of the reasons for the difference in virulence. IMPORTANCE The contribution of VP1-145 variants in humans is not fully understood. In some reports, VP1-145G/Q viruses were more frequently isolated from severely affected than from mildly affected patients, suggesting that VP1-145G/Q viruses are more virulent. In the accompanying paper, we showed that VP1-145E viruses are more virulent than VP1-145G viruses in human SCARB2 transgenic mice. Heparan sulfate acts as a decoy to specifically trap the VP1-145G viruses and leads to abortive infection. Here, we demonstrated that VP1-145G was attenuated in cynomolgus monkeys, suggesting that this hypothesis is also true in a non-human primate model. VP1-145E viruses, but not VP1-145G viruses, were highly resistant to neutralizing antibodies. We propose the difference in resistance against neutralizing antibodies as another mechanism of EV71 virulence. In summary, VP1-145 contributes to virulence determination by controlling attachment receptor usage and antibody sensitivity. Copyright © 2018 American Society for Microbiology.

CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

PubMed

Zhou, Carol L Ecale

2015-01-01

In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

Optimization of dual-energy xenon-computed tomography for quantitative assessment of regional pulmonary ventilation.

PubMed

Fuld, Matthew K; Halaweish, Ahmed F; Newell, John D; Krauss, Bernhard; Hoffman, Eric A

2013-09-01

Dual-energy x-ray computed tomography (DECT) offers visualization of the airways and quantitation of regional pulmonary ventilation using a single breath of inhaled xenon gas. In this study, we sought to optimize scanning protocols for DECT xenon gas ventilation imaging of the airways and lung parenchyma and to characterize the quantitative nature of the developed protocols through a series of test-object and animal studies. The Institutional Animal Care and Use Committee approved all animal studies reported here. A range of xenon/oxygen gas mixtures (0%, 20%, 25%, 33%, 50%, 66%, 100%; balance oxygen) were scanned in syringes and balloon test-objects to optimize the delivered gas mixture for assessment of regional ventilation while allowing for the development of improved 3-material decomposition calibration parameters. In addition, to alleviate gravitational effects on xenon gas distribution, we replaced a portion of the oxygen in the xenon/oxygen gas mixture with helium and compared gas distributions in a rapid-prototyped human central-airway test-object. Additional syringe tests were performed to determine if the introduction of helium had any effect on xenon quantitation. Xenon gas mixtures were delivered to anesthetized swine to assess airway and lung parenchymal opacification while evaluating various DECT scan acquisition settings. Attenuation curves for xenon were obtained from the syringe test-objects and were used to develop improved 3-material decomposition parameters (Hounsfield unit enhancement per percentage xenon: within the chest phantom, 2.25 at 80 kVp, 1.7 at 100 kVp, and 0.76 at 140 kVp with tin filtration; in open air, 2.5 at 80 kVp, 1.95 at 100 kVp, and 0.81 at 140 kVp with tin filtration). The addition of helium improved the distribution of xenon gas to the gravitationally nondependent portion of the airway tree test-object, while not affecting the quantitation of xenon in the 3-material decomposition DECT. The mixture 40% Xe/40% He/20% O2 provided good signal-to-noise ratio (SNR), greater than the Rose criterion (SNR > 5), while avoiding gravitational effects of similar concentrations of xenon in a 60% O2 mixture. Compared with 100/140 Sn kVp, 80/140 Sn kVp (Sn = tin filtered) provided improved SNR in a swine with an equivalent thoracic transverse density to a human subject with a body mass index of 33 kg/m. Airways were brighter in the 80/140 Sn kVp scan (80/140 Sn, 31.6%; 100/140 Sn, 25.1%) with considerably lower noise (80/140 Sn, coefficient of variation of 0.140; 100/140 Sn, coefficient of variation of 0.216). To provide a truly quantitative measure of regional lung function with xenon-DECT, the basic protocols and parameter calibrations need to be better understood and quantified. It is critically important to understand the fundamentals of new techniques to allow for proper implementation and interpretation of their results before widespread usage. With the use of an in-house derived xenon calibration curve for 3-material decomposition rather than the scanner supplied calibration and a xenon/helium/oxygen mixture, we demonstrate highly accurate quantitation of xenon gas volumes and avoid gravitational effects on gas distribution. This study provides a foundation for other researchers to use and test these methods with the goal of clinical translation.

Optimization of Dual-Energy Xenon-CT for Quantitative Assessment of Regional Pulmonary Ventilation

PubMed Central

Fuld, Matthew K.; Halaweish, Ahmed; Newell, John D.; Krauss, Bernhard; Hoffman, Eric A.

2013-01-01

Objective Dual-energy X-ray computed tomography (DECT) offers visualization of the airways and quantitation of regional pulmonary ventilation using a single breath of inhaled xenon gas. In this study we seek to optimize scanning protocols for DECT xenon gas ventilation imaging of the airways and lung parenchyma and to characterize the quantitative nature of the developed protocols through a series of test-object and animal studies. Materials and Methods The Institutional Animal Care and Use Committee approved all animal studies reported here. A range of xenon-oxygen gas mixtures (0, 20, 25, 33, 50, 66, 100%; balance oxygen) were scanned in syringes and balloon test-objects to optimize the delivered gas mixture for assessment of regional ventilation while allowing for the development of improved three-material decomposition calibration parameters. Additionally, to alleviate gravitational effects on xenon gas distribution, we replaced a portion of the oxygen in the xenon/oxygen gas mixture with helium and compared gas distributions in a rapid-prototyped human central-airway test-object. Additional syringe tests were performed to determine if the introduction of helium had any effect on xenon quantitation. Xenon gas mixtures were delivered to anesthetized swine in order to assess airway and lung parenchymal opacification while evaluating various DECT scan acquisition settings. Results Attenuation curves for xenon were obtained from the syringe test objects and were used to develop improved three-material decomposition parameters (HU enhancement per percent xenon: Within the chest phantom: 2.25 at 80kVp, 1.7 at 100 kVp, and 0.76 at 140 kVp with tin filtration; In open air: 2.5 at 80kVp, 1.95 at 100 kVp, and 0.81 at 140 kVp with tin filtration). The addition of helium improved the distribution of xenon gas to the gravitationally non-dependent portion of the airway tree test-object, while not affecting quantitation of xenon in the three-material decomposition DECT. 40%Xe/40%He/20%O2 provided good signal-to-noise, greater than the Rose Criterion (SNR > 5), while avoiding gravitational effects of similar concentrations of xenon in a 60%O2 mixture. 80/140-kVp (tin-filtered) provided improved SNR compared with 100/140-kVp in a swine with an equivalent thoracic transverse density to a human subject with body mass index of 33. Airways were brighter in the 80/140 kVp scan (80/140Sn, 31.6%; 100/140Sn, 25.1%) with considerably lower noise (80/140Sn, CV of 0.140; 100/140Sn, CV of 0.216). Conclusion In order to provide a truly quantitative measure of regional lung function with xenon-DECT, the basic protocols and parameter calibrations needed to be better understood and quantified. It is critically important to understand the fundamentals of new techniques in order to allow for proper implementation and interpretation of their results prior to wide spread usage. With the use of an in house derived xenon calibration curve for three-material decomposition rather than the scanner supplied calibration and a xenon/helium/oxygen mixture we demonstrate highly accurate quantitation of xenon gas volumes and avoid gravitational effects on gas distribution. This study provides a foundation for other researchers to use and test these methods with the goal of clinical translation. PMID:23571834

Vasopressin and oxytocin receptor systems in the brain: sex differences and sex-specific regulation of social behavior

PubMed Central

Dumais, Kelly M.; Veenema, Alexa H.

2015-01-01

The neuropeptides vasopressin (VP) and oxytocin (OT) and their receptors in the brain are involved in the regulation of various social behaviors and have emerged as drug targets for the treatment of social dysfunction in several sex-biased neuropsychiatric disorders. Sex differences in the VP and OT systems may therefore be implicated in sex-specific regulation of healthy as well as impaired social behaviors. We begin this review by highlighting the sex differences, or lack of sex differences, in VP and OT synthesis in the brain. We then discuss the evidence showing the presence or absence of sex differences in VP and OT receptors in rodents and humans, as well as showing new data of sexually dimorphic V1a receptor binding in the rat brain. Importantly, we find that there is lack of comprehensive analysis of sex differences in these systems in common laboratory species, and we find that, when sex differences are present, they are highly brain region- and species- specific. Interestingly, VP system parameters (VP and V1aR) are typically higher in males, while sex differences in the OT system are not always in the same direction, often showing higher OT expression in females, but higher OT receptor expression in males. Furthermore, VP and OT receptor systems show distinct and largely non-overlapping expression in the rodent brain, which may cause these receptors to have either complementary or opposing functional roles in the sex-specific regulation of social behavior. Though still in need of further research, we close by discussing how manipulations of the VP and OT systems have given important insights into the involvement of these neuropeptide systems in the sex-specific regulation of social behavior in rodents and humans. PMID:25951955

Vasopressin and oxytocin receptor systems in the brain: Sex differences and sex-specific regulation of social behavior.

PubMed

Dumais, Kelly M; Veenema, Alexa H

2016-01-01

The neuropeptides vasopressin (VP) and oxytocin (OT) and their receptors in the brain are involved in the regulation of various social behaviors and have emerged as drug targets for the treatment of social dysfunction in several sex-biased neuropsychiatric disorders. Sex differences in the VP and OT systems may therefore be implicated in sex-specific regulation of healthy as well as impaired social behaviors. We begin this review by highlighting the sex differences, or lack of sex differences, in VP and OT synthesis in the brain. We then discuss the evidence showing the presence or absence of sex differences in VP and OT receptors in rodents and humans, as well as showing new data of sexually dimorphic V1a receptor binding in the rat brain. Importantly, we find that there is lack of comprehensive analysis of sex differences in these systems in common laboratory species, and we find that, when sex differences are present, they are highly brain region- and species-specific. Interestingly, VP system parameters (VP and V1aR) are typically higher in males, while sex differences in the OT system are not always in the same direction, often showing higher OT expression in females, but higher OT receptor expression in males. Furthermore, VP and OT receptor systems show distinct and largely non-overlapping expression in the rodent brain, which may cause these receptors to have either complementary or opposing functional roles in the sex-specific regulation of social behavior. Though still in need of further research, we close by discussing how manipulations of the VP and OT systems have given important insights into the involvement of these neuropeptide systems in the sex-specific regulation of social behavior in rodents and humans. Copyright © 2015 Elsevier Inc. All rights reserved.

Structure of Rotavirus Outer-Layer Protein VP7 Bound with a Neutralizing Fab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Scott T.; Settembre, Ethan C.; Trask, Shane D.

2009-06-17

Rotavirus outer-layer protein VP7 is a principal target of protective antibodies. Removal of free calcium ions (Ca{sup 2+}) dissociates VP7 trimers into monomers, releasing VP7 from the virion, and initiates penetration-inducing conformational changes in the other outer-layer protein, VP4. We report the crystal structure at 3.4 angstrom resolution of VP7 bound with the Fab fragment of a neutralizing monoclonal antibody. The Fab binds across the outer surface of the intersubunit contact, which contains two Ca{sup 2+} sites. Mutations that escape neutralization by other antibodies suggest that the same region bears the epitopes of most neutralizing antibodies. The monovalent Fab ismore » sufficient to neutralize infectivity. We propose that neutralizing antibodies against VP7 act by stabilizing the trimer, thereby inhibiting the uncoating trigger for VP4 rearrangement. A disulfide-linked trimer is a potential subunit immunogen.« less

Pre-harvest sprouting resistance and haplotype variation of ThVp-1 gene in the collection of wheat-wheatgrass hybrids

PubMed Central

Kocheshkova, A. A.; Kroupin, P. Yu.; Bazhenov, M. S.; Karlov, G. I.; Pochtovyy, A. A.; Upelniek, V. P.; Belov, V. I.

2017-01-01

The germplasm collection of 87 wheat-wheatgrass hybrids developed in Tsitisin Main Botanical Garden (Russia, Moscow) was evaluated for resistance to pre-harvest sprouting (PHS) by spike sprouting (SS) and germination index (GI) assays as well as for spike and grain features. The PHS resistance variation and haplotype polymorphism of the wheatgrass ThVp-1 and wheat TaVp-1B genes orthologues of Vp-1 was revealed in the studied collection. Four haplotypes of ThVp-1 were revealed: ThVp-1a (41% of the entries), ThVp-1b (13%), ThVp-1c (29%), and ThVp-1d (15%). The association between the allelic state of ThVp-1 and PHS resistance in the wheat-wheatgrass hybrids was shown: haplotype ThVp-1d of the wheatgrass Vp-1 gene is significantly associated with reduced PHS in the wheat-wheatgrass hybrids (mean SS 0.33, mean GI 0.64). The resistant entries may be perspective as a source of PHS resistance in the development of commercial cultivars of perennial wheat. PMID:29131854

Detection, differentiation, and VP1 sequencing of duck hepatitis A virus type 1 and type 3 by a 1-step duplex reverse-transcription PCR assay.

PubMed

Wen, X J; Cheng, A C; Wang, M S; Jia, R Y; Zhu, D K; Chen, S; Liu, M F; Liu, F; Chen, X Y

2014-09-01

Duck hepatitis A virus (DHAV) is an infectious pathogen causing fatal duck viral hepatitis in ducklings. Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the duck industry in China and South Korea. For rapid detection, differentiation, and epidemic investigation of DHAV in China, a genotype-specific 1-step duplex reverse-transcription (RT) PCR assay was established in this study. The sensitivity and specificity of the developed RT-PCR assay was evaluated with nucleic acids extracted from 2 DHAV reference strains, and 9 other infectious viruses and bacteria. The genotype-specific primers amplified different size DNA fragments encompassing the complete VP1 gene of the DHAV-1 or DHAV-3. The assay detected the liver samples collected from experimentally infected ducklings and dead ducklings collected from different regions of China. Sequence analysis of these DNA fragments indicated that VP1 sequences of DHAV-1 can be used to distinguish wild type and vaccine strains. The phylogenetic analysis of VP1 sequences indicated that the developed RT-PCR assay can be used for epidemic investigation of DHAV-1 and DHAV-3. The developed RT-PCR assay can be used as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV. © 2014 Poultry Science Association Inc.

Seismic structure of the Slave craton crust

NASA Astrophysics Data System (ADS)

Barantseva, O.; Vinnik, L. P.; Farra, V.; van der Hilst, R. D.; Artemieva, I. M.; Montagner, J. P.

2017-12-01

We present P- and S-receiver functions for 20 stations along a 200-km-long NNW-SSE seismological profile across the Slave craton, and estimate the average crustal Vp/Vs ratio which is indicative of rock composition. We observe high Vp/Vs ratio ( 1.85-2.00) for the bulk crust and elevated Vp values at a depth range from 20-30 km to 40 km. High Vp values (>7.0 km/s) suggest mafic composition of the lower crust. In case of dry lower crustal rocks, the Vp/Vs ratio is expected to range from 1.6 to 1.8, which is lower than the observed values of 1.9-2.0. Laboratory studies show that Vp/Vs 1.9-2.0 can be explained by the presence of numerous cracks saturated with an incompressible fluid. Our results are at odds with the structure of the cratonic crust in many regions worldwide, and may suggest a unique geodynamic evolution of the Slave crust. Possible explanations for the observed crustal structure include the presence of an underplated mafic material, possibly related to intraplate magmatism or paleosubduction. Receiver functions are highly sensitive to the change of acoustic impedance and S-wave velocities, but do not resolve the internal seismic structure with a high precision. We extend our study of the crustal structure by using ambient noise tomography (ANT). We measure Rayleigh wave dispersion from Green's functions that are estimated from one-year noise cross-correlation (NCF). The phase velocity maps are inverted for 1D wave speed profiles which are then combined to form 2D and 3D models of the crust of the Slave Province. The combined results of RF analyses and ANT are interpreted in terms of crustal structure, composition, and evolution.

Identification of antigenic regions on VP2 of African horsesickness virus serotype 3 by using phage-displayed epitope libraries.

PubMed

Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H

2000-04-01

VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.

An experimental and computational evolution-based method to study a mode of co-evolution of overlapping open reading frames in the AAV2 viral genome.

PubMed

Kawano, Yasuhiro; Neeley, Shane; Adachi, Kei; Nakai, Hiroyuki

2013-01-01

Overlapping open reading frames (ORFs) in viral genomes undergo co-evolution; however, how individual amino acids coded by overlapping ORFs are structurally, functionally, and co-evolutionarily constrained remains difficult to address by conventional homologous sequence alignment approaches. We report here a new experimental and computational evolution-based methodology to address this question and report its preliminary application to elucidating a mode of co-evolution of the frame-shifted overlapping ORFs in the adeno-associated virus (AAV) serotype 2 viral genome. These ORFs encode both capsid VP protein and non-structural assembly-activating protein (AAP). To show proof of principle of the new method, we focused on the evolutionarily conserved QVKEVTQ and KSKRSRR motifs, a pair of overlapping heptapeptides in VP and AAP, respectively. In the new method, we first identified a large number of capsid-forming VP3 mutants and functionally competent AAP mutants of these motifs from mutant libraries by experimental directed evolution under no co-evolutionary constraints. We used Illumina sequencing to obtain a large dataset and then statistically assessed the viability of VP and AAP heptapeptide mutants. The obtained heptapeptide information was then integrated into an evolutionary algorithm, with which VP and AAP were co-evolved from random or native nucleotide sequences in silico. As a result, we demonstrate that these two heptapeptide motifs could exhibit high degeneracy if coded by separate nucleotide sequences, and elucidate how overlap-evoked co-evolutionary constraints play a role in making the VP and AAP heptapeptide sequences into the present shape. Specifically, we demonstrate that two valine (V) residues and β-strand propensity in QVKEVTQ are structurally important, the strongly negative and hydrophilic nature of KSKRSRR is functionally important, and overlap-evoked co-evolution imposes strong constraints on serine (S) residues in KSKRSRR, despite high degeneracy of the motifs in the absence of co-evolutionary constraints.

Impact of a vaccination programme in children vaccinated with ProQuad, and ProQuad-specific effectiveness against varicella in the Veneto region of Italy.

PubMed

Giaquinto, Carlo; Gabutti, Giovanni; Baldo, Vincenzo; Villa, Marco; Tramontan, Lara; Raccanello, Nadia; Russo, Francesca; Poma, Chiara; Scamarcia, Antonio; Cantarutti, Luigi; Lundin, Rebecca; Perinetti, Emilia; Cornen, Xavier; Thomas, Stéphane; Ballandras, Céline; Souverain, Audrey; Hartwig, Susanne

2018-03-05

Monovalent varicella vaccines have been available in the Veneto Region of Italy since 2004. In 2006, a single vaccine dose was added to the immunisation calendar for children aged 14 months. ProQuad®, a quadrivalent measles-mumps-rubella-varicella vaccine, was introduced in May 2007 and used, among other varicella vaccines, until October 2008. This study aimed to evaluate the effectiveness of a single dose of ProQuad, and the population impact of a vaccination program (VP) against varicella of any severity in children who received a first dose of ProQuad at 14 months of age in the Veneto Region, METHODS: All children born in 2006/2007, i.e., eligible for varicella vaccination after ProQuad was introduced, were retrospectively followed through individual-level data linkage between the Pedianet database (varicella cases) and the Regional Immunization Database (vaccination status). The direct effectiveness of ProQuad was estimated as the incidence rate of varicella in ProQuad-vaccinated children aged < 6 years compared to children with no varicella vaccination from the same birth cohort. The impact of the VP on varicella was measured by comparing children eligible for the VP to an unvaccinated historical cohort from 1997/1998. The vaccine impact measures were: total effect (the combined effect of ProQuad vaccination and being covered by the Veneto VP); indirect effect (the effect of the VP on unvaccinated individuals); and overall effect (the effect of the VP on varicella in the entire population of the Veneto Region, regardless of their vaccination status). The adjusted direct effectiveness of ProQuad was 94%. The vaccine impact measures total, indirect, and overall effect were 97%, 43%, and 90%, respectively. These are the first results on the effectiveness and impact of ProQuad against varicella; data confirmed its high effectiveness, based on immunological correlates for protection. Direct effectiveness is our only ProQuad-specific measure; all impact measures refer at least partially to the VP and should be interpreted in the context of high vaccine coverage and the use of various varicella vaccines in this region. The Veneto Region offered a unique opportunity for this study due to an individual data linkage between Pedianet and the Regional Immunization database.

Generation of Recombinant Porcine Parvovirus Virus-Like Particles in Saccharomyces cerevisiae and Development of Virus-Specific Monoclonal Antibodies

PubMed Central

Tamošiūnas, Paulius Lukas; Petraitytė-Burneikienė, Rasa; Lasickienė, Rita; Sereika, Vilimas; Lelešius, Raimundas; Žvirblienė, Aurelija; Sasnauskas, Kęstutis

2014-01-01

Porcine parvovirus (PPV) is a widespread infectious virus that causes serious reproductive diseases of swine and death of piglets. The gene coding for the major capsid protein VP2 of PPV was amplified using viral nucleic acid extract from swine serum and inserted into yeast Saccharomyces cerevisiae expression plasmid. Recombinant PPV VP2 protein was efficiently expressed in yeast and purified using density gradient centrifugation. Electron microscopy analysis of purified PPV VP2 protein revealed the self-assembly of virus-like particles (VLPs). Nine monoclonal antibodies (MAbs) against the recombinant PPV VP2 protein were generated. The specificity of the newly generated MAbs was proven by immunofluorescence analysis of PPV-infected cells. Indirect IgG ELISA based on the recombinant VLPs for detection of PPV-specific antibodies in swine sera was developed and evaluated. The sensitivity and specificity of the new assay were found to be 93.4% and 97.4%, respectively. In conclusion, yeast S. cerevisiae represents a promising expression system for generating recombinant PPV VP2 protein VLPs of diagnostic relevance. PMID:25045718

T helper cell-mediated interferon-gamma expression after human parvovirus B19 infection: persisting VP2-specific and transient VP1u-specific activity

PubMed Central

Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K

2005-01-01

Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856

Vaccination with multimeric recombinant VP28 induces high protection against white spot syndrome virus in shrimp.

PubMed

Taengchaiyaphum, Suparat; Nakayama, Hideki; Srisala, Jiraporn; Khiev, Ratny; Aldama-Cano, Diva January; Thitamadee, Siripong; Sritunyalucksana, Kallaya

2017-11-01

To improve the efficacy of WSSV protection, multimeric (tetrameric) recombinant VP28 (4XrVP28) was produced and tested in comparison with those of monomeric VP28 (1XrVP28). In vitro binding of either 1XrVP28 or 4XrVP28 to shrimp hemocyte surface was evident as early as 10 min after protein inoculation. Similar results were obtained in vivo when shrimp were injected with recombinant proteins that the proteins bound to the hemocyte surface could be detected since 5 min after injection. Comparison of the WSSV protection efficiencies of 1XrVP28 or 4XrVP28 were performed by injection the purified 1XrVP28 or 4XrVP28 (22.5 μg/shrimp) and WSSV inoculum (1000 copies/shrimp) into shrimp. At 10 dpi, while shrimp injected with WSSV inoculum reached 100% mortality, shrimp injected with 1XrVP28 + WSSV or 4XrVP28 + WSSV showed relative percent survival (RPS) of 67% and 81%, respectively. PCR quantification revealed high number of WSSV in the moribund shrimp of WSSV- and 1XrVP28+WSSV-injected group. In contrast, lower number of WSSV copies were found in the survivors both from 1XrVP28+WSSV- or 4XrVP28+WSSV- injected groups. Histopathological analysis demonstrated the WSSV infected lesions found in the moribund from WSSV-infected group and 1XrVP28+WSSV-injected group, but less or none in the survivors. ELISA demonstrated that 4XrVP28 exhibited higher affinity binding to rPmRab7, a WSSV binding protein essential for WSSV entry to the cell than 1XrVP28. Taken together, the protection against WSSV in shrimp could be improved by application of multimeric rVP28. Copyright © 2017 Elsevier Ltd. All rights reserved.

Diversity and Relationships of Cocirculating Modern Human Rotaviruses Revealed Using Large-Scale Comparative Genomics

PubMed Central

McKell, Allison O.; Rippinger, Christine M.; McAllen, John K.; Akopov, Asmik; Kirkness, Ewen F.; Payne, Daniel C.; Edwards, Kathryn M.; Chappell, James D.; Patton, John T.

2012-01-01

Group A rotaviruses (RVs) are 11-segmented, double-stranded RNA viruses and are primary causes of gastroenteritis in young children. Despite their medical relevance, the genetic diversity of modern human RVs is poorly understood, and the impact of vaccine use on circulating strains remains unknown. In this study, we report the complete genome sequence analysis of 58 RVs isolated from children with severe diarrhea and/or vomiting at Vanderbilt University Medical Center (VUMC) in Nashville, TN, during the years spanning community vaccine implementation (2005 to 2009). The RVs analyzed include 36 G1P[8], 18 G3P[8], and 4 G12P[8] Wa-like genogroup 1 strains with VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6 genotype constellations of I1-R1-C1-M1-A1-N1-T1-E1-H1. By constructing phylogenetic trees, we identified 2 to 5 subgenotype alleles for each gene. The results show evidence of intragenogroup gene reassortment among the cocirculating strains. However, several isolates from different seasons maintained identical allele constellations, consistent with the notion that certain RV clades persisted in the community. By comparing the genes of VUMC RVs to those of other archival and contemporary RV strains for which sequences are available, we defined phylogenetic lineages and verified that the diversity of the strains analyzed in this study reflects that seen in other regions of the world. Importantly, the VP4 and VP7 proteins encoded by VUMC RVs and other contemporary strains show amino acid changes in or near neutralization domains, which might reflect antigenic drift of the virus. Thus, this large-scale, comparative genomic study of modern human RVs provides significant insight into how this pathogen evolves during its spread in the community. PMID:22696651

Identification of Recombinant Human Rhinovirus A and C in Circulating Strains from Upper and Lower Respiratory Infections

PubMed Central

Kim, Hak; Kim, Kisoon; Kim, Dae-Won; Jung, Hee-Dong; Min Cheong, Hyang; Kim, Ki Hwan; Soo Kim, Dong; Kim, You-Jin

2013-01-01

Human rhinoviruses (HRVs), in the Enterovirus genus within the family Picornaviridae, are a highly prevalent cause of acute respiratory infection (ARI). Enteroviruses are genetically highly variable, and recombination between serotypes is known to be a major contribution to their diversity. Recently it was reported that recombination events in HRVs cause the diversity of HRV-C. This study analyzed parts of the viral genes spanning the 5′ non- coding region (NCR) through to the viral protein (VP) encoding sequences of 105 HRV field isolates from 51 outpatient cases of Acute Respiratory Infectious Network (ARINET) and 54 inpatient cases of severe lower respiratory infection (SLRI) surveillance, in order to identify recombination in field samples. When analyzing parts of the 5′NCR and VP4/VP2 encoding sequences, we found intra- and interspecies recombinants in field strains of HRV-A and -C. Nineteen cases of recombination events (18.1%) were found among 105 field strains. For HRV-A, there were five cases (4.8%) of intraspecies recombination events and three cases (2.8%) of interspecies recombination events. For HRV-C, there were four cases (3.8%) of intraspecies recombination events and seven cases (6.7%) of interspecies recombination events. Recombination events were significantly more frequently observed in the ARINET samples (18 cases) than in the SLRI samples (1 case; P< 0.0001). The recombination breakpoints were located in nucleotides (nt) 472–554, which comprise stem-loop 5 in the internal ribosomal entry site (IRES), based on the HRV-B 35 sequence (accession no. FJ445187). Our findings regarding genomic recombination in circulating HRV-A and -C strains suggest that recombination might play a role in HRV fitness and could be a possible determinant of disease severity caused by various HRV infections in patients with ARI. PMID:23826363

In vitro dose measurements in a human cadaver with abdomen/pelvis CT scans.

PubMed

Zhang, Da; Padole, Atul; Li, Xinhua; Singh, Sarabjeet; Khawaja, Ranish Deedar Ali; Lira, Diego; Liu, Tianyu; Shi, Jim Q; Otrakji, Alexi; Kalra, Mannudeep K; Xu, X George; Liu, Bob

2014-09-01

To present a study of radiation dose measurements with a human cadaver scanned on a clinical CT scanner. Multiple point dose measurements were obtained with high-accuracy Thimble ionization chambers placed inside the stomach, liver, paravertebral gutter, ascending colon, left kidney, and urinary bladder of a human cadaver (183 cm in height and 67.5 kg in weight) whose abdomen/pelvis region was scanned repeatedly with a multidetector row CT. The flat energy response and precision of the dosimeters were verified, and the slight differences in each dosimeter's response were evaluated and corrected to attain high accuracy. In addition, skin doses were measured for radiosensitive organs outside the scanned region with OSL dosimeters: the right eye, thyroid, both nipples, and the right testicle. Three scan protocols were used, which shared most scan parameters but had different kVp and mA settings: 120-kVp automA, 120-kVp 300 mA, and 100-kVp 300 mA. For each protocol three repeated scans were performed. The tube starting angle (TSA) was found to randomly vary around two major conditions, which caused large fluctuations in the repeated point dose measurements: for the 120-kVp 300 mA protocol this angle changed from approximately 110° to 290°, and caused 8%-25% difference in the point dose measured at the stomach, liver, colon, and urinary bladder. When the fluctuations of the TSA were small (within 5°), the maximum coefficient of variance was approximately 3.3%. The soft tissue absorbed doses averaged from four locations near the center of the scanned region were 27.2±3.3 and 16.5±2.7 mGy for the 120 and 100-kVp fixed-mA scans, respectively. These values were consistent with the corresponding size specific dose estimates within 4%. The comparison of the per-100-mAs tissue doses from the three protocols revealed that: (1) dose levels at nonsuperficial locations in the TCM scans could not be accurately deduced by simply scaling the fix-mA doses with local mA values; (2) the general power law relationship between dose and kVp varied from location to location, with the power index ranged between 2.7 and 3.5. The averaged dose measurements at both nipples, which were about 0.6 cm outside the prescribed scan region, ranged from 23 to 27 mGy at the left nipple, and varied from 3 to 20 mGy at the right nipple over the three scan protocols. Large fluctuations over repeated scans were also observed, as a combined result of helical scans of large pitch (1.375) and small active areas of the skin dosimeters. In addition, the averaged skin dose fell off drastically with the distance to the nearest boundary of the scanned region. This study revealed the complexity of CT dose fluctuation and variation with a human cadaver.

Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

PubMed

Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

2016-11-01

Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Overexpression of VpEIFP1, a novel F-box/Kelch-repeat protein from wild Chinese Vitis pseudoreticulata, confers higher tolerance to powdery mildew by inducing thioredoxin z proteolysis.

PubMed

Wang, Jie; Yao, Wenkong; Wang, Lei; Ma, Fuli; Tong, Weihuo; Wang, Chen; Bao, Rui; Jiang, Changyue; Yang, Yazhou; Zhang, Jianxia; Xu, Yan; Wang, Xiping; Zhang, Chaohong; Wang, Yuejin

2017-10-01

An F-box protein (VpEIFP1) induced by Erysiphe necator was isolated from Vitis pseudoreticulata, a wild Chinese grapevine species naturally resistant to powdery mildew (PM). It contains an F-box domain and two Kelch-repeat motifs. Expression profiles indicate the VpEIFP1 is strongly induced at both transcriptional and translational levels by PM infection. A subcellular localisation assay showed that VpEIFP1 is predominantly located in the nucleus and cytoplasm. Overexpression of VpEIFP1 accelerated the accumulation of hydrogen peroxide (H 2 O 2 ) and up-regulated the expressions of ICS2, NPR1 and PR1 involved in defence responses, resulting in suppression of PM germination and growth. As an F-box protein, VpEIFP1 interacts with thioredoxin z (VpTrxz) in the yeast-two-hybrid (Y2H) assay and in the bimolecular fluorescence complementation (BiFC) assay. Decreased amounts of VpTrxz protein in transgenic grapevine leaves overexpressing VpEIFP1 were restored by proteasome inhibitor MG132, implying that VpEIFP1 mediated VpTrxz for degradation through the SCF VpEIFP1 (Skp1-Cullin-F-box) E3 ubiquitin ligase complex. The RNA interference line of VpTrxz showed increased H 2 O 2 accumulation following PM inoculation. We propose VpEIFP1 positively modulates the grapevine defence response to PM by inducing the degradation of VpTrxz via the ubiquitin/26S proteasome system. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of the complete genome segments from BmCPV-SZ, a novel Bombyx mori cypovirus 1 isolate.

PubMed

Cao, Guangli; Meng, Xiangkun; Xue, Renyu; Zhu, Yuexiong; Zhang, Xiaorong; Pan, Zhonghua; Zheng, Xiaojian; Gong, Chengliang

2012-07-01

A novel Bombyx mori cypovirus 1 isolated from infected silkworm larvae and tentatively assigned as Bombyx mori cypovirus 1 isolate Suzhou (BmCPV-SZ). The complete nucleotide sequences of genomic segments S1-S10 from BmCPV-SZ were determined. All segments possessed a single open reading frame; however, bioinformatic evidence suggested a short overlapping coding sequence in S1. Each BmCPV-SZ segment possessed the conserved terminal sequences AGUAA and GUUAGCC at the 5' and 3' ends, respectively. The conserved A/G at the -3 position in relation to the AUG codon could be found in the BmCPV-SZ genome, and it was postulated that this conserved A/G may be the most important nucleotide for efficient translation initiation in cypoviruses (CPVs). Examination of the putative amino acid sequences encoded by BmCPV-SZ revealed some characteristic motifs. Homology searches showed that viral structural proteins VP1, VP3, and VP4 had localized homologies with proteins of Rice ragged stunt virus , a member of the genus Oryzavirus within the family Reoviridae. A phylogenetic tree based on RNA-dependent RNA polymerase sequences demonstrated that CPV is more closely related to Rice ragged stunt virus and Aedes pseudoscutellaris reovirus than to other members of Reoviridae, suggesting that they may have originated from common ancestors.

Species-Specific and Cross-Reactive IgG1 Antibody Binding to Viral Capsid Protein 1 (VP1) Antigens of Human Rhinovirus Species A, B and C

PubMed Central

Iwasaki, Jua; Smith, Wendy-Anne; Stone, Shane R.; Thomas, Wayne R.; Hales, Belinda J.

2013-01-01

Background Human rhinoviruses (HRV) are associated with upper and lower respiratory illnesses, including severe infections causing hospitalization in both children and adults. Although the clinical significance of HRV infections is now well established, no detailed investigation of the immune response against HRV has been performed. The purpose of this study was to assess the IgG1 antibody response to the three known HRV species, HRV-A, -B and -C in healthy subjects. Methods Recombinant polypeptides of viral capsid protein 1 (VP1) from two genotypes of HRV-A, -B and -C were expressed as glutathione S-transferase (GST) fusion proteins and purified by affinity and then size exclusion chromatography. The presence of secondary structures similar to the natural antigens was verified by circular dichroism analysis. Total and species-specific IgG1 measurements were quantitated by immunoassays and immunoabsorption using sera from 63 healthy adults. Results Most adult sera reacted with the HRV VP1 antigens, at high titres. As expected, strong cross-reactivity between HRV genotypes of the same species was found. A high degree of cross-reactivity between different HRV species was also evident, particularly between HRV-A and HRV-C. Immunoabsorption studies revealed HRV-C specific titres were markedly and significantly lower than the HRV-A and HRV-B specific titres (P<0.0001). A truncated construct of HRV-C VP1 showed greater specificity in detecting anti-HRV-C antibodies. Conclusions High titres of IgG1 antibody were bound by the VP1 capsid proteins of HRV-A, -B and -C, but for the majority of people, a large proportion of the antibody to HRV-C was cross-reactive, especially to HRV-A. The improved specificity found for the truncated HRV-C VP1 indicates species-specific and cross-reactive regions could be defined. PMID:23950960

Human parechovirus-3 infection in children, South Korea.

PubMed

Han, Tae-Hee; Chung, Ju-Young; You, Su Jeong; Youn, Jeong-Lim; Shim, Gyu-Hong

2013-09-01

Human parechoviruses (HPeVs) have recently been recognized as important viral pathogens causing sepsis-like illness and meningitis in children, but the data on these infections in Korea is limited. Klassevirus is emerging as a novel etiologic agent of acute gastroenteritis, but its role in meningitis remains unclear. To understand the epidemiology of HPeVs and klassevirus in sepsis-like illness and meningitis through the detection and typing of the virus in cerebrospinal fluid (CSF) samples. One hundred and eighty-three CSF samples collected from 183 patients ranging in the age group 1 day to 15 years were tested by using a RT-PCR assay for HPeV, EV and klassevirus. Amplification products of the VP3/VP1 and 3D region of the HPeV, and VP1 region of the EV were sequenced to identify the type. A total of 12 HPeV positive samples (6.5%) were detected from 183 CSF samples and all the samples were typed as HPeV-3. EVs were detected in 39 patients (21.3%) in which echovirus 25 and CVA6 were frequently detected, but mixed infection of HPeV-3 and EV was not observed. Klassevirus was not detected in the study population. Most of the HPeV-3 positive patients were under 3 months of age. HPeV-3 infection was detected mostly in the summer season. The VP3/VP1 gene of the 12 Korean strains clustered most closely to the Japan strain (AB759192) and the 3D gene of the Korean strains also clustered to the Japan strain, which showed no evidence of recombination. To our knowledge, this is the first report on the detection of HPeV-3 from CSF samples in Korea, which suggests the necessity of routine screening for this virus in young infants with sepsis-like illness and meningitis. Copyright © 2013 Elsevier B.V. All rights reserved.

Seismotectonics of the Loma Prieta, California, region determined from three-dimensional Vp, Vp/Vs, and seismicity

USGS Publications Warehouse

Eberhart-Phillips, D.; Michael, A.J.

1998-01-01

Three-dimensional Vp and Vp/Vs velocity models for the Loma Prieta region were developed from the inversion of local travel time data (21,925 P arrivals and 1,116 S arrivals) from earthquakes, refraction shots, and blasts recorded on 1700 stations from the Northern California Seismic Network and numerous portable seismograph deployments. The velocity and density models and microearthquake hypocenters reveal a complex structure that includes a San Andreas fault extending to the base of the seismogenic layer. A body with high Vp extends the length of the rupture and fills the 5 km wide volume between the Loma Prieta mainshock rupture and the San Andreas and Sargent faults. We suggest that this body controls both the pattern of background seismicity on the San Andreas and Sargent faults and the extent of rupture during the mainshock, thus explaining how the background seismicity outlined the along-strike and depth extent of the mainshock rupture on a different fault plane 5 km away. New aftershock focal mechanisms, based on three-dimensional ray tracing through the velocity model, support a heterogeneous postseismic stress field and can not resolve a uniform fault normal compression. The subvertical (or steeply dipping) San Andreas fault and the fault surfaces that ruptured in the 1989 Loma Prieta earthquake are both parts of the San Andreas fault zone and this section of the fault zone does not have a single type of characteristic event.

Joint 3-D tomographic imaging of Vp, Vs and Vp/Vs and hypocenter relocation at Sinabung volcano, Indonesia from November to December 2013

USGS Publications Warehouse

Nugraha, Andri Dian; Indrastuti, Novianti; Kusnandar, Ridwan; Gunawan, Hendra; McCausland, Wendy A.; Aulia, Atin Nur; Harlianti, Ulvienin

2018-01-01

We conducted travel time tomography using P- and S-wave arrival times of volcanic-tectonic (VT) events that occurred between November and December 2013 to determine the three-dimensional (3D) seismic velocity structure (Vp, Vs, and Vp/Vs) beneath Sinabung volcano, Indonesia in order to delineate geological subsurface structure and to enhance our understanding of the volcanism itself. This was a time period when phreatic explosions became phreatomagmatic and then magma migrated to the surface forming a summit lava dome. We used 4846 VT events with 16,138 P- and 16,138 S-wave arrival time phases recorded by 6 stations for the tomographic inversion. The relocated VTs collapse into three clusters at depths from the surface to sea level, from 2 to 4 km below sea level, and from 5 to 8.5 km below sea level. The tomographic inversion results show three prominent regions of high Vp/Vs (~ 1.8) beneath Sinabung volcano at depths consistent with the relocated earthquake clusters. We interpret these anomalies as intrusives associated with previous eruptions and possibly surrounding the magma conduit, which we cannot resolve with this study. One anomalous region might contain partial melt, at sea level and below the eventual eruption site at the summit. Our results are important for the interpretation of a conceptual model of the “plumbing system” of this hazardous volcano.

Biochemical and Functional Characterization of the Ebola Virus VP24 Protein: Implications for a Role in Virus Assembly and Budding

PubMed Central

Han, Ziying; Boshra, Hani; Sunyer, J. Oriol; Zwiers, Susan H.; Paragas, Jason; Harty, Ronald N.

2003-01-01

The VP24 protein of Ebola virus is believed to be a secondary matrix protein and minor component of virions. In contrast, the VP40 protein of Ebola virus is the primary matrix protein and the most abundant virion component. The structure and function of VP40 have been well characterized; however, virtually nothing is known regarding the structure and function of VP24. Wild-type and mutant forms of VP24 were expressed in mammalian cells to gain a better understanding of the biochemical and functional nature of this viral protein. Results from these experiments demonstrated that (i) VP24 localizes to the plasma membrane and perinuclear region in both transfected and Ebola virus-infected cells, (ii) VP24 associates strongly with lipid membranes, (iii) VP24 does not contain N-linked sugars when expressed alone in mammalian cells, (iv) VP24 can oligomerize when expressed alone in mammalian cells, (v) progressive deletions at the N terminus of VP24 resulted in a decrease in oligomer formation and a concomitant increase in the formation of high-molecular-weight aggregates, and (vi) VP24 was present in trypsin-resistant virus like particles released into the media covering VP24-transfected cells. These data indicate that VP24 possesses structural features commonly associated with viral matrix proteins and that VP24 may have a role in virus assembly and budding. PMID:12525613

H+ -pyrophosphatase IbVP1 promotes efficient iron use in sweet potato [Ipomoea batatas (L.) Lam.].

PubMed

Fan, Weijuan; Wang, Hongxia; Wu, Yinliang; Yang, Nan; Yang, Jun; Zhang, Peng

2017-06-01

Iron (Fe) deficiency is one of the most common micronutrient deficiencies limiting crop production globally, especially in arid regions because of decreased availability of iron in alkaline soils. Sweet potato [Ipomoea batatas (L.) Lam.] grows well in arid regions and is tolerant to Fe deficiency. Here, we report that the transcription of type I H + -pyrophosphatase (H + -PPase) gene IbVP1 in sweet potato plants was strongly induced by Fe deficiency and auxin in hydroponics, improving Fe acquisition via increased rhizosphere acidification and auxin regulation. When overexpressed, transgenic plants show higher pyrophosphate hydrolysis and plasma membrane H + -ATPase activity compared with the wild type, leading to increased rhizosphere acidification. The IbVP1-overexpressing plants showed better growth, including enlarged root systems, under Fe-sufficient or Fe-deficient conditions. Increased ferric precipitation and ferric chelate reductase activity in the roots of transgenic lines indicate improved iron uptake, which is also confirmed by increased Fe content and up-regulation of Fe uptake genes, e.g. FRO2, IRT1 and FIT. Carbohydrate metabolism is significantly affected in the transgenic lines, showing increased sugar and starch content associated with the increased expression of AGPase and SUT1 genes and the decrease in β-amylase gene expression. Improved antioxidant capacities were also detected in the transgenic plants, which showed reduced H 2 O 2 accumulation associated with up-regulated ROS-scavenging activity. Therefore, H + -PPase plays a key role in the response to Fe deficiency by sweet potato and effectively improves the Fe acquisition by overexpressing IbVP1 in crops cultivated in micronutrient-deficient soils. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Wide Angle Converted Shear Wave Analysis of North Atlantic Volcanic Rifted Continental Margins

NASA Astrophysics Data System (ADS)

Eccles, J. D.; White, R. S.; Christie, P. A.

2007-12-01

High-quality, wide-angle, ocean bottom seismometer (OBS) data have been acquired with a low frequency (9 Hz) seismic source across the Faroes and Hatton Bank volcanic rifted continental margins in the North Atlantic. In these regions thick Tertiary flood basalt sequences provide a challenge to deep seismic imaging. S-wave arrivals, which are dominantly converted from P- to S-waves at the sediment-top basalt interface, were recorded at 170 4-component OBS locations. Variation in the conversion efficiency was observed along the profiles. Tomographic inversion of over 70,000 converted S-wave crustal diving waves and Moho reflections was performed to produce S-wave velocity models and hence, when combined with pre-existing P-wave velocity models, a measure of the Vp/Vs ratio structure of the crust. Resolution testing shows the structure of the oceanic crust and continent-ocean transition is generally well resolved on both profiles. Lateral and vertical changes in Vp/Vs resolves changing crustal composition within, and between, oceanic and continental crust, including regions in the lower crust at the continent-ocean transition with high P-wave velocities of up to 7.5 km/s and low Vp/Vs ratios of ~ 1.75 associated with intense high-temperature intrusion at the time of break-up. Vp/Vs ratios of 1.75-1.80 at the base of the thickened oceanic crust are also lower than generally reported in normal oceanic crust. The P-wave travel-time tomography revealed a low velocity zone (LVZ) beneath the basalt on the Faroes margin and additional constraint on the Vp/Vs of the LVZ beneath the Fugloy Ridge has been gained by analysing the relative travel-time delays between basalt and basement refractions for P- and S-waves. This approach is less subject to the velocity-depth ambiguity associated with velocity inversions than is the determination of P- or S- wave velocity alone. Comparison of the calculated Vp/Vs ratio and P-wave velocity with measurements from relevant lithologies reveals that the LVZ is likely to contain sill-intruded Paleocene sedimentary rock rather than igneous hyaloclastites similar to those found beneath the basalt in a nearby well. Immediately beneath the LVZ, a unit with Vp/Vs ratios of 1.80-1.85 and P-wave velocities of 5.5-6.0 km/s is interpreted as sill-intruded sedimentary rock of a pre-breakup Mesozoic basin. We thank C.J. Parkin, A.W. Roberts and L.K. Smith for their contributions.

Molecular typing of a novel canine parvovirus type 2a mutant circulating in Italy.

PubMed

Mira, Francesco; Dowgier, Giulia; Purpari, Giuseppa; Vicari, Domenico; Di Bella, Santina; Macaluso, Giusi; Gucciardi, Francesca; Randazzo, Vincenzo; Decaro, Nicola; Guercio, Annalisa

2018-07-01

Canine parvovirus (CPV) is the etiological agent of a severe viral disease of dogs. After its emergence in late 1970s, the CPV original type (CPV-2) was rapidly and totally replaced by three antigenic variants named CPV-2a, CPV-2b and CPV-2c. CPV has an evolutionary rate nearest to those of RNA viruses, with consequences on disease diagnosis and epidemiology. This paper reports the molecular characterization of eight CPV-2a strains collected from dogs in Italy in 2016-2017. Genetic analysis was conducted on a CPV genomic region encompassing both open reading frames (ORFs) encoding for nonstructural (NS1-NS2) and structural proteins (VP1-VP2). Sequence analysis indicates new and unreported sequence changes, mainly affecting the VP2 gene, which included the mutation Tyr324Leu. This study represents the first evidence of a new CPV-2a mutant (VP2 324Leu) and illustrates the importance of a continuous molecular survey in order to obtain more information on effective spread of new CPV mutants. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

PubMed Central

Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

2014-01-01

Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348

Investigations of different kilovoltage x-ray energy for three-dimensional converging stereotactic radiotherapy system: Monte Carlo simulations with CT data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deloar, Hossain M.; Kunieda, Etsuo; Kawase, Takatsugu

2006-12-15

We are investigating three-dimensional converging stereotactic radiotherapy (3DCSRT) with suitable medium-energy x rays as treatment for small lung tumors with better dose homogeneity at the target. A computed tomography (CT) system dedicated for non-coplanar converging radiotherapy was simulated with BEAMnrc (EGS4) Monte-Carlo code for x-ray energy of 147.5, 200, 300, and 500 kilovoltage (kVp). The system was validated by comparing calculated and measured percentage of depth dose in a water phantom for the energy of 120 and 147.5 kVp. A thorax phantom and CT data from lung tumors (<20 cm{sup 3}) were used to compare dose homogeneities of kVp energiesmore » with MV energies of 4, 6, and 10 MV. Three non-coplanar arcs (0 deg. and {+-}25 deg. ) around the center of the target were employed. The Monte Carlo dose data format was converted to the XiO RTP format to compare dose homogeneity, differential, and integral dose volume histograms of kVp and MV energies. In terms of dose homogeneity and DVHs, dose distributions at the target of all kVp energies with the thorax phantom were better than MV energies, with mean dose absorption at the ribs (human data) of 100%, 85%, 50%, 30% for 147.5, 200, 300, and 500 kVp, respectively. Considering dose distributions and reduction of the enhanced dose absorption at the ribs, a minimum of 500 kVp is suitable for the lung kVp 3DCSRT system.« less

Localization of the herpes simplex virus type 1 major capsid protein VP5 to the cell nucleus requires the abundant scaffolding protein VP22a.

PubMed

Nicholson, P; Addison, C; Cross, A M; Kennard, J; Preston, V G; Rixon, F J

1994-05-01

The intracellular distributions of three herpes simplex virus type 1 (HSV-1) capsid proteins, VP23, VP5 and VP22a, were examined using vaccinia virus and plasmid expression systems. During infection of cells with HSV-1 wild-type virus, all three proteins were predominantly located in the nucleus, which is the site of capsid assembly. However, when expressed in the absence of any other HSV-1 proteins, although VP22a was found exclusively in the nucleus as expected, VP5 and VP23 were distributed throughout the cell. Thus nuclear localization is not an intrinsic property of these proteins but must be mediated by one or more HSV-1-induced proteins. Co-expression experiments demonstrated that VP5 was efficiently transported to the nucleus in the presence of VP22a, but the distribution of VP23 was unaffected by the presence of either or both of the other two proteins.

Identification of Continuous Human B-Cell Epitopes in the VP35, VP40, Nucleoprotein and Glycoprotein of Ebola Virus

PubMed Central

Becquart, Pierre; Mahlakõiv, Tanel; Nkoghe, Dieudonné; Leroy, Eric M.

2014-01-01

Ebola virus (EBOV) is a highly virulent human pathogen. Recovery of infected patients is associated with efficient EBOV-specific immunoglobulin G (IgG) responses, whereas fatal outcome is associated with defective humoral immunity. As B-cell epitopes on EBOV are poorly defined, we sought to identify specific epitopes in four EBOV proteins (Glycoprotein (GP), Nucleoprotein (NP), and matrix Viral Protein (VP)40 and VP35). For the first time, we tested EBOV IgG+ sera from asymptomatic individuals and symptomatic Gabonese survivors, collected during the early humoral response (seven days after the end of symptoms) and the late memory phase (7–12 years post-infection). We also tested sera from EBOV-seropositive patients who had never had clinical signs of hemorrhagic fever or who lived in non-epidemic areas (asymptomatic subjects). We found that serum from asymptomatic individuals was more strongly reactive to VP40 peptides than to GP, NP or VP35. Interestingly, anti-EBOV IgG from asymptomatic patients targeted three immunodominant regions of VP40 reported to play a crucial role in virus assembly and budding. In contrast, serum from most survivors of the three outbreaks, collected a few days after the end of symptoms, reacted mainly with GP peptides. However, in asymptomatic subjects the longest immunodominant domains were identified in GP, and analysis of the GP crystal structure revealed that these domains covered a larger surface area of the chalice bowl formed by three GP1 subunits. The B-cell epitopes we identified in the EBOV VP35, VP40, NP and GP proteins may represent important tools for understanding the humoral response to this virus and for developing new antibody-based therapeutics or detection methods. PMID:24914933

Detailed p- and s-wave velocity models along the LARSE II transect, Southern California

USGS Publications Warehouse

Murphy, J.M.; Fuis, G.S.; Ryberg, T.; Lutter, W.J.; Catchings, R.D.; Goldman, M.R.

2010-01-01

Structural details of the crust determined from P-wave velocity models can be improved with S-wave velocity models, and S-wave velocities are needed for model-based predictions of strong ground motion in southern California. We picked P- and S-wave travel times for refracted phases from explosive-source shots of the Los Angeles Region Seismic Experiment, Phase II (LARSE II); we developed refraction velocity models from these picks using two different inversion algorithms. For each inversion technique, we calculated ratios of P- to S-wave velocities (VP/VS) where there is coincident P- and S-wave ray coverage.We compare the two VP inverse velocity models to each other and to results from forward modeling, and we compare the VS inverse models. The VS and VP/VS models differ in structural details from the VP models. In particular, dipping, tabular zones of low VS, or high VP/VS, appear to define two fault zones in the central Transverse Ranges that could be parts of a positive flower structure to the San Andreas fault. These two zones are marginally resolved, but their presence in two independent models lends them some credibility. A plot of VS versus VP differs from recently published plots that are based on direct laboratory or down-hole sonic measurements. The difference in plots is most prominent in the range of VP = 3 to 5 km=s (or VS ~ 1:25 to 2:9 km/s), where our refraction VS is lower by a few tenths of a kilometer per second from VS based on direct measurements. Our new VS - VP curve may be useful for modeling the lower limit of VS from a VP model in calculating strong motions from scenario earthquakes.

Identification of continuous human B-cell epitopes in the VP35, VP40, nucleoprotein and glycoprotein of Ebola virus.

PubMed

Becquart, Pierre; Mahlakõiv, Tanel; Nkoghe, Dieudonné; Leroy, Eric M

2014-01-01

Ebola virus (EBOV) is a highly virulent human pathogen. Recovery of infected patients is associated with efficient EBOV-specific immunoglobulin G (IgG) responses, whereas fatal outcome is associated with defective humoral immunity. As B-cell epitopes on EBOV are poorly defined, we sought to identify specific epitopes in four EBOV proteins (Glycoprotein (GP), Nucleoprotein (NP), and matrix Viral Protein (VP)40 and VP35). For the first time, we tested EBOV IgG+ sera from asymptomatic individuals and symptomatic Gabonese survivors, collected during the early humoral response (seven days after the end of symptoms) and the late memory phase (7-12 years post-infection). We also tested sera from EBOV-seropositive patients who had never had clinical signs of hemorrhagic fever or who lived in non-epidemic areas (asymptomatic subjects). We found that serum from asymptomatic individuals was more strongly reactive to VP40 peptides than to GP, NP or VP35. Interestingly, anti-EBOV IgG from asymptomatic patients targeted three immunodominant regions of VP40 reported to play a crucial role in virus assembly and budding. In contrast, serum from most survivors of the three outbreaks, collected a few days after the end of symptoms, reacted mainly with GP peptides. However, in asymptomatic subjects the longest immunodominant domains were identified in GP, and analysis of the GP crystal structure revealed that these domains covered a larger surface area of the chalice bowl formed by three GP1 subunits. The B-cell epitopes we identified in the EBOV VP35, VP40, NP and GP proteins may represent important tools for understanding the humoral response to this virus and for developing new antibody-based therapeutics or detection methods.

Ensuring very shallow-water sediment properties: case study from Capo Granitola harbour, Sicily (Italy)

NASA Astrophysics Data System (ADS)

Punzo, Michele; Cavuoto, Giuseppe; Tarallo, Daniela; Di Fiore, Vincenzo

2017-09-01

We present high-resolution Vp models of the Capo Granitola harbor, Sicily (Italy) obtained by first arrival traveltime tomography. Seismic data were collected along four hydrophone arrays on the sea-bottom and via a Watergun as seismic source, in order to plan dredging operations in the harbor. Using a hydrophone spacing of 2.5 m and shot spacing of 5 m, very high resolution quality data were recorded. Seismic tomography expands existing knowledge of the harbour subsoil with a penetration of about 20 m, illuminating the Lower Pleistocene bedrock (Marsala calcarenites) that corresponds to high-Vp regions (Vp > 4.5 km/s). Low Vp (1.8-4.5 km/s) deposits belonging to terraced calcarenites (Upper Pleistocene in age) are also well imaged; they are about 8 m thick and lie below loose sand deposits (Vp = 1.5 km/s). The substratum has an articulated morphology; Vp images unravel small steps in the basement probably related to structural discontinuities (e.g., faults). Processing data with 3D techniques enables images of the structure and the thickness of the lithotypes to be reconstructed, thus leading to large-scale, realistic estimates of the total quantity of material to be excavated or dredged. Tomographic profiles permit clear discrimination of the soft sediment above the basement and thus allow the determination of the total volume of sediment above the seismic bedrock, estimated at about 265,000 m3.

Enterovirus 71 viral capsid protein linear epitopes: Identification and characterization

PubMed Central

2012-01-01

Background To characterize the human humoral immune response against enterovirus 71 (EV71) infection and map human epitopes on the viral capsid proteins. Methods A series of 256 peptides spanning the capsid proteins (VP1, VP2, VP3) of BJ08 strain (genomic C4) were synthesized. An indirect enzyme-linked immunosorbent assay (ELISA) was carried out to detect anti-EV71 IgM and IgG in sera of infected children in acute or recovery phase. The partially overlapped peptides contained 12 amino acids and were coated in the plate as antigen (0.1 μg/μl). Sera from rabbits immunized with inactivated BJ08 virus were also used to screen the peptide panel. Results A total of 10 human anti-EV71 IgM epitopes (vp1-14 in VP1; vp2-6, 21, 40 and 50 in VP2 and vp3-10, 12, 15, 24 and 75 in VP3) were identified in acute phase sera. In contrast, only one anti-EV71 IgG epitope in VP1 (vp1-15) was identified in sera of recovery stage. Four rabbit anti-EV71 IgG epitopes (vp1-14, 31, 54 and 71) were identified and mapped to VP1. Conclusion These data suggested that human IgM epitopes were mainly mapped to VP2 and VP3 with multi-epitope responses occurred at acute infection, while the only IgG epitope located on protein VP1 was activated in recovery phase sera. The dynamic changes of humoral immune response at different stages of infection may have public health significance in evaluation of EV71 vaccine immunogenicity and the clinical application of diagnostic reagents. PMID:22264266

High Resolution Vp and Vp/Vs Local Earthquake Tomography of the Val d'Agri Region (Southern Apennines, Italy).

NASA Astrophysics Data System (ADS)

Improta, L.; Bagh, S.; De Gori, P.; Pastori, M.; Piccinini, D.; Valoroso, L.; Anselmi, M.; Buttinelli, M.; Chiarabba, C.

2015-12-01

The Val d'Agri (VA) Quaternary basin in the southern Apennines extensional belt hosts the largest oilfield in onshore Europe and normal-fault systems with high (up to M7) seismogenic potential. Frequent small-magnitude swarms related to both active crustal extension and anthropogenic activity have occurred in the region. Causal factors for induced seismicity are a water impoundment with severe seasonal oscillations and a high-rate wastewater injection well. We analyzed around 1200 earthquakes (ML<3.3) occurred in the VA and surrounding regions between 2001-2014. We integrated waveforms recorded at 46 seismic stations belonging to 3 different networks: a dense temporary network installed by INGV in 2005-2006, the permanent national network of INGV, and the trigger-mode monitoring network managed by the local operator ENI petroleum company. We used local earthquake tomography to investigate static and transient features of the crustal velocity structure and to accurately locate earthquakes. Vp and Vp/Vs models are parameterized by a 3x3x2 km spacing and well resolved down to about 12 km depth. The complex Vp model illuminates broad antiformal structures corresponding to wide ramp-anticlines involving Mesozoic carbonates of the Apulia hydrocarbon reservoir, and NW-SE trending low Vp regions related to thrust-sheet-top clastic basins. The VA basin corresponds to shallow low-Vp region. Focal mechanisms show normal faulting kinematics with minor strike slip solutions in agreement with the local extensional regime. Earthquake locations and focal solutions depict shallow (< 5 km depth) E-dipping extensional structures beneath the artificial lake located in the southern sector of the basin, and along the western margin of the VA. A few swarms define relatively deep transfer structures accommodating the differential extension between main normal faults. The spatio-temporal distribution of around 220 events correlates with wastewater disposal activity, illuminating a NE-dipping fault between 2-5 km depth in the carbonate reservoir. The fault measures 5 km along dip and corresponds to a pre-existing thrust fault favorably oriented with respect to the local extensional field.

Radiation dose reduction using 100-kVp and a sinogram-affirmed iterative reconstruction algorithm in adolescent head CT: Impact on grey-white matter contrast and image noise.

PubMed

Nagayama, Yasunori; Nakaura, Takeshi; Tsuji, Akinori; Urata, Joji; Furusawa, Mitsuhiro; Yuki, Hideaki; Hirarta, Kenichiro; Kidoh, Masafumi; Oda, Seitaro; Utsunomiya, Daisuke; Yamashita, Yasuyuki

2017-07-01

To retrospectively evaluate the image quality and radiation dose of 100-kVp scans with sinogram-affirmed iterative reconstruction (IR) for unenhanced head CT in adolescents. Sixty-nine patients aged 12-17 years underwent head CT under 120- (n = 34) or 100-kVp (n = 35) protocols. The 120-kVp images were reconstructed with filtered back-projection (FBP), 100-kVp images with FBP (100-kVp-F) and sinogram-affirmed IR (100-kVp-S). We compared the effective dose (ED), grey-white matter (GM-WM) contrast, image noise, and contrast-to-noise ratio (CNR) between protocols in supratentorial (ST) and posterior fossa (PS). We also assessed GM-WM contrast, image noise, sharpness, artifacts, and overall image quality on a four-point scale. ED was 46% lower with 100- than 120-kVp (p < 0.001). GM-WM contrast was higher, and image noise was lower, on 100-kVp-S than 120-kVp at ST (p < 0.001). CNR of 100-kVp-S was higher than of 120-kVp (p < 0.001). GM-WM contrast of 100-kVp-S was subjectively rated as better than of 120-kVp (p < 0.001). There were no significant differences in the other criteria between 100-kVp-S and 120-kVp (p = 0.072-0.966). The 100-kVp with sinogram-affirmed IR facilitated dramatic radiation reduction and better GM-WM contrast without increasing image noise in adolescent head CT. • 100-kVp head CT provides 46% radiation dose reduction compared with 120-kVp. • 100-kVp scanning improves subjective and objective GM-WM contrast. • Sinogram-affirmed IR decreases head CT image noise, especially in supratentorial region. • 100-kVp protocol with sinogram-affirmed IR is suited for adolescent head CT.

Maturation of the Hepatitis A Virus Capsid Protein VP1 Is Not Dependent on Processing by the 3Cpro Proteinase

PubMed Central

Martin, Annette; Bénichou, Danièle; Chao, Shih-Fong; Cohen, Lisette M.; Lemon, Stanley M.

1999-01-01

Most details of the processing of the hepatitis A virus (HAV) polyprotein are known. Unique among members of the family Picornaviridae, the primary cleavage of the HAV polyprotein is mediated by 3Cpro, the only proteinase known to be encoded by the virus, at the 2A/2B junction. All other cleavages of the polyprotein have been considered to be due to 3Cpro, although the precise location and mechanism responsible for the VP1/2A cleavage have been controversial. Here we present data that argue strongly against the involvement of the HAV 3Cpro proteinase in the maturation of VP1 from its VP1-2A precursor. Using a heterologous expression system based on recombinant vaccinia viruses directing the expression of full-length or truncated capsid protein precursors, we show that the C terminus of the mature VP1 capsid protein is located near residue 764 of the polyprotein. However, a proteolytically active HAV 3Cpro that was capable of directing both VP0/VP3 and VP3/VP1 cleavages in vaccinia virus-infected cells failed to process the VP1-2A precursor. Using site-directed mutagenesis of an infectious molecular clone of HAV, we modified potential VP1/2A cleavage sites that fit known 3Cpro recognition criteria and found that a substitution that ablates the presumed 3Cpro dipeptide recognition sequence at Glu764-Ser765 abolished neither infectivity nor normal VP1 maturation. Altered electrophoretic mobility of VP1 from a viable mutant virus with an Arg764 substitution indicated that this residue is present in VP1 and that the VP1/2A cleavage occurs downstream of this residue. These data indicate that maturation of the HAV VP1 capsid protein is not dependent on 3Cpro processing and may thus be uniquely dependent on a cellular proteinase. PMID:10400711

Protection of Cattle against Foot-and-Mouth Disease by a Synthetic Peptide

NASA Astrophysics Data System (ADS)

Dimarchi, Richard; Brooke, Gerald; Gale, Charles; Cracknell, Victor; Doel, Timothy; Mowat, Noel

1986-05-01

A chemically synthesized peptide consisting essentially of two separate regions (residues 141 to 158 and 200 to 213) of a virus coat protein (VP1) from the 01 Kaufbeuren strain of foot-and-mouth disease virus was prepared free of any carrier protein. It elicited high levels of neutralizing antibody and protected cattle against intradermolingual challenge by inoculation with infectious virus. Comparative evaluation of this peptide with a single-site peptide (residues 141 to 158) in guinea pigs suggests the importance of the VP1 carboxyl terminal residues in enhancing the protective response.

Local earthquake tomography of the Jalisco, Mexico region

NASA Astrophysics Data System (ADS)

Watkins, W. David; Thurber, Clifford H.; Abbott, Elizabeth R.; Brudzinski, Michael R.

2018-01-01

The states of Jalisco, Colima, and Michoacán in western Mexico overlie the boundary of the subducting Rivera and Cocos plates, presenting an ideal target for seismological inquiry to better understand the resulting mantle flow and regional volcanism. The different dips between the two subducting plates are thought to provide a mantle conduit that has contributed to the Colima Volcanic Complex (CVC), but there is considerable debate on the depth of the Rivera plate and width of the resulting conduit. With data from the Mapping the Rivera Subduction Zone (MARS) and Colima Deep Seismic Experiment (CODEX) networks, two temporary broadband arrays deployed in the region between 2006 and 2008, we inverted for three-dimensional P- and S-wave velocity as well as Vp/Vs structure of the upper 70 km of the crust and mantle in the Jalisco region. Using a newly-developed automatic P- and S-wave picker, we increased P picks by 74% and S picks by more than a factor of four compared to a database of manual picks for the 803 earthquakes used in the inversion. Additional relocated earthquakes extending to the trench are consistent with previous interpretations of the Rivera and Cocos plate interfaces. Areas of high Vp/Vs above both subducting slabs suggest the presence of fluids resulting from dehydration of subducted material. Extensive crustal seismicity occurs near these anomalies. A zone of high Vp/Vs is also present under the CVC. We also compare the results of different methods for obtaining Vp/Vs: a direct inversion for Vp/Vs from S minus P times versus simply dividing the Vp model by the Vs model. We find direct inversions of S minus P times to be more reliable.

Purification of recombinant budgerigar fledgling disease virus VP1 capsid protein and its ability for in vitro capsid assembly

NASA Technical Reports Server (NTRS)

Rodgers, R. E.; Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1994-01-01

A recombinant system for the major capsid VP1 protein of budgerigar fledgling disease virus has been established. The VP1 gene was inserted into a truncated form of the pFlag-1 vector and expressed in Escherichia coli. The budgerigar fledgling disease virus VP1 protein was purified to near homogeneity by immunoaffinity chromatography. Fractions containing highly purified VP1 were pooled and found to constitute 3.3% of the original E. coli-expressed VP1 protein. Electron microscopy revealed that the VP1 protein was isolated as pentameric capsomeres. Electron microscopy also revealed that capsid-like particles were formed in vitro from purified VP1 capsomeres with the addition of Ca2+ ions and the removal of chelating and reducing agents.

The K 0/π- ratio and strangeness supression in v p andbar vp charged current interactions

NASA Astrophysics Data System (ADS)

Jones, G. T.; Kennedy, B. W.; O'Neale, S. W.; Böckmann, K.; Gebel, W.; Geich-Gimbel, C.; Nellen, B.; Cooper-Sarkar, A. M.; Grant, A.; Klein, H.; Morrison, D. R. O.; Schmid, P.; Wachsmuth, H.; Chima, J. S.; Mobayyen, M. M.; Talebzadeh, M.; Villalobos-Baillie, O.; Aderholz, M.; Deck, L.; Schmitz, N.; Wernhard, K. L.; Wittek, W.; Corrigan, G.; Myatt, G.; Radojicic, D.; Saitta, B.; Wells, J.; Towers, S.; Shotton, P.

1985-03-01

Neutral kaon to negative pion production ratios from vp andbar vp charged current interactions in BEBC are presented and compared with LUND fragmentation model predictions. Good agreement is obtained with a strangeness suppression factor λ=0.203±0.014(stat)±0.010(sys). No evidence is seen for an energy dependence of λ in our kinematic region.

Predominance of G9P[8] rotavirus strains throughout France, 2014-2017.

PubMed

Kaplon, J; Grangier, N; Pillet, S; Minoui-Tran, A; Vabret, A; Wilhelm, N; Prieur, N; Lazrek, M; Alain, S; Mekki, Y; Foulongne, V; Guinard, J; Avettand-Fenoel, V; Schnuriger, A; Beby-Defaux, A; Lagathu, G; Pothier, P; de Rougemont, A

2018-06-01

Group A rotavirus is a major cause of acute gastroenteritis in young children worldwide. A prospective surveillance network has been set up in France to investigate rotavirus infections and to detect the emergence of potentially epidemic strains. From 2014 to 2017, rotavirus-positive stool samples were collected from 2394 children under 5 years old attending the paediatric emergency units of 13 large hospitals. Rotaviruses were genotyped by RT-PCR with regard to their outer capsid proteins VP4 and VP7. Genotyping of 2421 rotaviruses showed that after a marked increase in G9P[8] (32.1%) during the 2014-2015 season, G9P[8] became the predominant genotype during the 2015-2016 and 2016-2017 seasons with detection rates of 64.1% and 77.3%, respectively, whereas G1P[8] were detected at low rates of 16.8% and 6.6%, respectively. Phylogenetic analysis of the partial rotavirus VP7 and VP4 coding genes revealed that all of these G9P [8] strains belonged to the lineage III and the P [8]-3 lineage, respectively, and shared the same genetic background (G9-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1) as did most of previously detected G9P[8] strains and particularly the emerging G9P[8] strains from the 2004-2005 season in France. G9P[8] rotaviruses have become the predominant circulating genotype for the first time since their emergence a decade ago. In the absence of rotavirus immunization programmes in France, our data give an insight into the natural fluctuation of rotavirus genotypes in a non-vaccinated population and provide a base line for a better interpretation of data in European countries with routine rotavirus vaccination. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Prevalence and distribution of White Spot Syndrome Virus in cultured shrimp.

PubMed

Hossain, A; Nandi, S P; Siddique, M A; Sanyal, S K; Sultana, M; Hossain, M A

2015-02-01

White Spot Syndrome Virus (WSSV) is a dsDNA virus causing White Spot Syndrome Disease (WSSD) in shrimp with almost 100% morality rate within 3-10 days. In Bangladesh, WSSD is one of the major impediments of shrimp farming. This study first investigated the prevalence and distribution of WSSV in cultured shrimps of the coastal regions in Bangladesh. A total of 60 shrimp samples, collected from the 25 shrimp farms of different coastal regions (Satkhira, Khulna, Bagerhat and Cox's Bazar), were analysed during 2013-2014 by conventional PCR using VP28 and VP664 gene-specific primers; 39 of 60 samples were found WSSV positive. SYBR green real-time PCR using 71-bp amplicon for VP664 gene correlated well with conventional PCR data. The prevalence rates of WSSV among the collected 60 samples were Satkhira 79%, Khulna 50%, Bagerhat 38% and Cox's Bazar 25%. Sequencing of WSSV-positive PCR amplicons of VP28 showed 99% similarity with WSSV NCBI Ref/Seq Sequences. Molecular analysis of the VP28 gene sequences of WSSV revealed that Bangladeshi strains phylogenetically affiliated to the strains belong to India. This work concluded that WSSV infections are widely distributed in the coastal regions cultured shrimp in Bangladesh. © 2014 The Society for Applied Microbiology.

Structural properties of the promiscuous VP16 activation domain.

PubMed

Jonker, Hendrik R A; Wechselberger, Rainer W; Boelens, Rolf; Folkers, Gert E; Kaptein, Rob

2005-01-25

Herpes simplex virion protein 16 (VP16) contains two strong activation regions that can independently and cooperatively activate transcription in vivo. We have identified the regions and residues involved in the interaction with the human transcriptional coactivator positive cofactor 4 (PC4) and the general transcription factor TFIIB. NMR and biochemical experiments revealed that both VP16 activation regions are required for the interaction and undergo a conformational transition from random coil to alpha-helix upon binding to its target PC4. The interaction is strongly electrostatically driven and the binding to PC4 is enhanced by the presence of its amino-terminal domain. We propose models for binding of VP16 to the core domains of PC4 and TFIIB that are based on two independent docking approaches using NMR chemical shift changes observed in titration experiments. The models are consistent with results from site-directed mutagenesis and provide an explanation for the contribution of both acidic and hydrophobic residues for transcriptional activation by VP16. Both intrinsically unstructured activation domains are attracted to their interaction partner by electrostatic interactions, and adopt an alpha-helical conformation around the important hydrophobic residues. The models showed multiple distinct binding surfaces upon interaction with various partners, providing an explanation for the promiscuous properties, cooperativity, and the high activity of this activation domain.

Determining the Upper Mantle Seismic Structure beneath the Northern Transantarctic Mountains from Regional P- and S-wave Tomography

NASA Astrophysics Data System (ADS)

Brenn, G.; Hansen, S. E.; Park, Y.

2016-12-01

Stretching 3500 km across Antarctica, the Transantarctic Mountains (TAMs) are the largest non-compressional mountain range on Earth. It has been suggested that the TAMs may have served as a nucleation point for the large-scale glaciation of Antarctica, and understanding their tectonic history has important implications for ice sheet modeling. However, the origin and uplift mechanism associated with the TAMs is controversial, and multiple models have been proposed. Seismic investigations of the TAM's subsurface structure can provide key constraints to help evaluate these models, but previous studies have been primarily focused on the central TAMs near Ross Island. Using data from the new 15-station Transantarctic Mountain Northern Network as well as data from several smaller networks, this study investigates the upper mantle velocity structure beneath a previously unexplored portion of the northern TAMs through regional body wave tomography. Relative travel-times were calculated for 11,182 P-wave and 8,285 S-wave arrivals from 790 and 581 Mw ≥ 5.5 events, respectively, using multi-channel cross correlation, and these data were then inverted for models of the upper mantle seismic structure. Resulting P- and S-wave tomography images reveal two focused low velocity anomalies beneath Ross Island (RI; δVP= -2.0%; δVS=-1.5% to -4.0%) and Terra Nova Bay (TNB; δVP=-1.5% to -2.0%; δVS= -1.0% to -4.0%) that extend to depths of 200 and 150 km, respectively. The RI and TNB slow anomalies also extend 50-100 km laterally beneath the TAMs front and sharply abut fast velocities beneath the EA craton (δVP=0.5% to 2%; δVS=1.5% to 4.0%). A low velocity region (δVP= -1.5%), centered at 150 km depth beneath the Terror Rift (TR) and primarily constrained within the Victoria Land Basin, connects the RI and TNB anomalies. The focused low velocities are interpreted as regions of partial melt and buoyancy-driven upwelling, connected by a broad region of slow (presumably warm) upper mantle associated with Cenozoic extension along the TR. Dynamic topography estimates based on the imaged S-wave velocity perturbations are consistent with observed surface topography in the central and northern TAMs, thereby providing support for uplift models that advocate for thermal loading and a flexural origin for the mountain range.

Expression and immunogenic analysis of recombinant polypeptides derived from capsid protein VP1 for developing subunit vaccine material against hepatitis A virus.

PubMed

Jang, Kyoung Ok; Park, Jong-Hwa; Lee, Hyun Ho; Chung, Dae Kyun; Kim, Wonyong; Chung, In Sik

2014-08-01

Three recombinant polypeptides, VP1-His, VP1-3N-His, and 3D2-His, were produced by Escherichia coli expression system. Recombinant VP1-His, VP1-3N-His, and 3D2-His were expressed as bands with molecular weights of 32, 38, and 30 kDa, respectively. These were purified by affinity chromatography using Ni-NTA Fast-flow resin and/or ion-exchange chromatography using DEAE-Sepharose Fast-flow resin. Intraperitoneal immunizations of recombinant polypeptides successfully elicited the productions of VP1-His, VP1-3N-His, and 3D2-His specific IgG antibodies (IgG subclass distribution of IgG1>IgG2a>IgG2b>IgG3) in sera and induced the secretions of cytokines IFN-γ and IL-6 in spleen cells. Sera from recombinant VP1-His-, VP1-3N-His-, and 3D2-His-immunized mice neutralized the propagation of HAV. The highest neutralizing activity was shown in sera from recombinant VP1-3N-His-immunized mice. These results suggest that recombinant VP1-3N-His can be a useful source for developing hepatitis A virus (HAV) subunit vaccine candidates. Copyright © 2014 Elsevier Inc. All rights reserved.

Whole genome analysis provides evidence for porcine-to-simian interspecies transmission of rotavirus-A.

PubMed

Navarro, Ryan; Aung, Meiji Soe; Cruz, Katalina; Ketzis, Jennifer; Gallagher, Christa Ann; Beierschmitt, Amy; Malik, Yashpal Singh; Kobayashi, Nobumichi; Ghosh, Souvik

2017-04-01

We report here whole genome analysis of a porcine rotavirus-A (RVA) strain RVA/Pig-wt/KNA/ET8B/2015/G5P[13] detected in a diarrheic piglet, and nearly whole genome (except for VP4 gene) analysis of a simian RVA strain RVA/Simian-wt/KNA/08979/2015/G5P[X] detected in a non-diarrheic African green monkey (AGM) on the island of St. Kitts, Caribbean region. Strain ET8B exhibited a G5-P[13]-I5-R1-C1-M1-A8-N1-T7-E1-H1 genotype constellation that was identical to those of Brazilian porcine RVA G5P[13] strains RVA/Pig-wt/BRA/ROTA01/2013/G5P[13] and RVA/Pig-wt/BRA/ROTA07/2013/G5P[13], the only porcine G5P[13] RVAs that have been analyzed for the whole genome so far. Phylogenetically, all the 11 gene segments of ET8B were closely related to those of porcine and porcine-like human RVAs within the respective genotypes. Although the porcine G5P[13] RVAs exhibited identical genotype constellations, ET8B did not appear to share common evolutionary pathways with the Brazilian porcine G5P[13] RVAs. Interestingly, the VP2, VP3, VP6, VP7, and NSP1-NSP5 genes of simian RVA strain 08979 were closely related to those of porcine and porcine-like human RVA strains, exhibiting 99%-100% nucleotide sequence identities to cognate genes of co-circulating porcine RVA strain ET8B. On the other hand, the VP1 of 08979 appeared to be genetically divergent from porcine and human RVAs within the R1 genotype, and its exact origin could not be ascertained. Taken together, these observations suggested that simian strain 08979 might have been derived from interspecies transmission events involving transmission of ET8B-like RVAs from pigs to AGMs. In St. Kitts, AGMs often stray from the wild into livestock farms. Therefore, it may be possible that the AGM acquired the infection from a pig farm on the island. To our knowledge, this is the first report on detection of porcine-like RVAs in monkeys. Also, the present study is the first to report whole genomic analysis of a porcine RVA strain from the Caribbean region. Copyright © 2016 Elsevier B.V. All rights reserved.

Assessment of polarization effect on aerosol retrievals from MODIS

NASA Astrophysics Data System (ADS)

Korkin, S.; Lyapustin, A.

2010-12-01

Light polarization affects the total intensity of scattered radiation. In this work, we compare aerosol retrievals performed by code MAIAC [1] with and without taking polarization into account. The MAIAC retrievals are based on the look-up tables (LUT). For this work, MAIAC was run using two different LUTs, the first one generated using the scalar code SHARM [2], and the second one generated with the vector code Modified Vector Discrete Ordinates Method (MVDOM). MVDOM is a new code suitable for computations with highly anisotropic phase functions, including cirrus clouds and snow [3]. To this end, the solution of the vector radiative transfer equation (VRTE) is represented as a sum of anisotropic and regular components. The anisotropic component is evaluated in the Small Angle Modification of the Spherical Harmonics Method (MSH) [4]. The MSH is formulated in the frame of reference of the solar beam where z-axis lies along the solar beam direction. In this case, the MSH solution for anisotropic part is nearly symmetric in azimuth, and is computed analytically. In scalar case, this solution coincides with the Goudsmit-Saunderson small-angle approximation [5]. To correct for an analytical separation of the anisotropic part of the signal, the transfer equation for the regular part contains a correction source function term [6]. Several examples of polarization impact on aerosol retrievals over different surface types will be presented. 1. Lyapustin A., Wang Y., Laszlo I., Kahn R., Korkin S., Remer L., Levy R., and Reid J. S. Multi-Angle Implementation of Atmospheric Correction (MAIAC): Part 2. Aerosol Algorithm. J. Geophys. Res., submitted (2010). 2. Lyapustin A., Muldashev T., Wang Y. Code SHARM: fast and accurate radiative transfer over spatially variable anisotropic surfaces. In: Light Scattering Reviews 5. Chichester: Springer, 205 - 247 (2010). 3. Budak, V.P., Korkin S.V. On the solution of a vectorial radiative transfer equation in an arbitrary three-dimensional turbid medium with anisotropic scattering. JQSRT, 109, 220-234 (2008). 4. Budak V.P., Sarmin S.E. Solution of radiative transfer equation by the method of spherical harmonics in the small angle modification. Atmospheric and Oceanic Optics, 3, 898-903 (1990). 5. Goudsmit S., Saunderson J.L. Multiple scattering of electrons. Phys. Rev., 57, 24-29 (1940). 6. Budak V.P, Klyuykov D.A., Korkin S.V. Convergence acceleration of radiative transfer equation solution at strongly anisotropic scattering. In: Light Scattering Reviews 5. Chichester: Springer, 147 - 204 (2010).

Genetic Relatedness among Hepatitis A Virus Strains Associated with Food-Borne Outbreaks

PubMed Central

Vaughan, Gilberto; Xia, Guoliang; Forbi, Joseph C.; Purdy, Michael A.; Rossi, Lívia Maria Gonçalves; Spradling, Philip R.; Khudyakov, Yury E.

2013-01-01

The genetic characterization of hepatitis A virus (HAV) strains is commonly accomplished by sequencing subgenomic regions, such as the VP1/P2B junction. HAV genome is not extensively variable, thus presenting opportunity for sharing sequences of subgenomic regions among genetically unrelated isolates. The degree of misrepresentation of phylogenetic relationships by subgenomic regions is especially important for tracking transmissions. Here, we analyzed whole-genome (WG) sequences of 101 HAV strains identified from 4 major multi-state, food-borne outbreaks of hepatitis A in the Unites States and from 14 non-outbreak-related HAV strains that shared identical VP1/P2B sequences with the outbreak strains. Although HAV strains with an identical VP1/P2B sequence were specific to each outbreak, WG were different, with genetic diversity reaching 0.31% (mean 0.09%). Evaluation of different subgenomic regions did not identify any other section of the HAV genome that could accurately represent phylogenetic relationships observed using WG sequences. The identification of 2–3 dominant HAV strains in 3 out of 4 outbreaks indicates contamination of the implicated food items with a heterogeneous HAV population. However, analysis of intra-host HAV variants from eight patients involved in one outbreak showed that only a single sequence variant established infection in each patient. Four non-outbreak strains were found closely related to strains from 2 outbreaks, whereas ten were genetically different from the outbreak strains. Thus, accurate tracking of HAV strains can be accomplished using HAV WG sequences, while short subgenomic regions are useful for identification of transmissions only among cases with known epidemiological association. PMID:24223112

Localized double-array stacking analysis of PcP: D″ and ULVZ structure beneath the Cocos plate, Mexico, central Pacific, and north Pacific

USGS Publications Warehouse

Hutko, Alexander R.; Lay, Thorne; Revenaugh, Justin

2009-01-01

A large, high quality P-wave data set comprising short-period and broadband signals sampling four separate regions in the lowermost mantle beneath the Cocos plate, Mexico, the central Pacific, and the north Pacific is analyzed using regional one-dimensional double-array stacking and modelling with reflectivity synthetics. A data-screening criterion retains only events with stable PcP energy in the final data stacks used for modelling and interpretation. This significantly improves the signal stacks relative to including unscreened observations, allows confident alignment on the PcP arrival and allows tight bounds to be placed on P-wave velocity structure above the core–mantle boundary (CMB). The PcP reflections under the Cocos plate are well modelled without any ultra-low velocity zone from 5 to 20°N. At latitudes from 15 to 20°N, we find evidence for two P-wave velocity discontinuities in the D″ region. The first is ∼182 km above the CMB with a δln Vp of +1.5%, near the same depth as a weaker discontinuity (<+0.5%) observed from 5 to 15°N in prior work. The other reflector is ∼454 km above the CMB, with a δln Vp of +0.4%; this appears to be a shallower continuation of the joint P- and S-wave discontinuity previously detected south of 15° N, which is presumed to be the perovskite to post-perovskite phase transition. The data stacks for paths bottoming below Mexico have PcP images that are well matched with the simple IASP91 structure, contradicting previous inferences of ULVZ presence in this region. These particular data are not very sensitive to any D″ discontinuities, and simply bound them to be <∼2%, if present. Data sampling the lowermost mantle beneath the central Pacific confirm the presence of a ∼15-km thick ultra-low velocity zone (ULVZ) just above the CMB, with δln Vp and δln Vs of around −3 to −4% and −4 to −8%, respectively. The ULVZ models predict previous S-wave data stacks well. The data for this region indicate laterally varying Vp discontinuities in D″, with one subregion having a δln Vp of 0.5% 140 km above the CMB. Beneath the north Pacific, the PcP arrivals are compatible with only weak ULVZ (δln Vp ∼ 0 to −3%), and there is a weak D″ reflector with δln Vp = 0.5%, near 314 km above the CMB. These results indicate localized occurrence of detectable ULVZ structures rather than ubiquitous ULVZ structure and emphasize the distinctiveness between the large low shear velocity province under the central Pacific and circum-Pacific regions.

The Globoside Receptor Triggers Structural Changes in the B19 Virus Capsid That Facilitate Virus Internalization▿

PubMed Central

Bönsch, Claudia; Zuercher, Christoph; Lieby, Patricia; Kempf, Christoph; Ros, Carlos

2010-01-01

Globoside (Gb4Cer), Ku80 autoantigen, and α5β1 integrin have been identified as cell receptors/coreceptors for human parvovirus B19 (B19V), but their role and mechanism of interaction with the virus are largely unknown. In UT7/Epo cells, expression of Gb4Cer and CD49e (integrin alpha-5) was high, but expression of Ku80 was insignificant. B19V colocalized with Gb4Cer and, to a lesser extent, with CD49e. However, only anti-Gb4Cer antibodies could disturb virus attachment. Only a small proportion of cell-bound viruses were internalized, while the majority became detached from the receptor. When added to uninfected cells, the receptor-detached virus showed superior cell binding capacity and infectivity. Attachment of B19V to cells triggered conformational changes in the capsid leading to the accessibility of the N terminus of VP1 (VP1u) to antibodies, which was maintained in the receptor-detached virus. VP1u became similarly accessible to antibodies following incubation of B19V particles with increasing concentrations of purified Gb4Cer. The receptor-mediated exposure of VP1u is critical for virus internalization, since capsids lacking VP1 could bind to cells but were not internalized. Moreover, an antibody against the N terminus of VP1u disturbed virus internalization, but only when present during and not after virus attachment, indicating the involvement of this region in binding events required for internalization. These results suggest that Gb4Cer is not only the primary receptor for B19V attachment but also the mediator of capsid rearrangements required for subsequent interactions leading to virus internalization. The capacity of the virus to detach and reattach again would enhance the probability of productive infections. PMID:20826697

Marburg Virus VP24 Protein Relieves Suppression of the NF-κB Pathway Through Interaction With Kelch-like ECH-Associated Protein 1.

PubMed

Edwards, Megan R; Basler, Christopher F

2015-10-01

Marburg virus (MARV) is an emerging zoonotic pathogen that causes hemorrhagic fever. MARV VP24 (mVP24) protein interacts with the host cell protein Kelch-like-ECH-associated protein 1 (Keap1). Keap1 interacts with and promotes the degradation of IκB kinase β (IKKβ), a component of the IκB kinase (IKK) complex that regulates nuclear factor-κB (NF-κB) activity. We studied whether mVP24 could relieve Keap1 repression of the NF-κB pathway. Coimmunoprecipitation assays were used to examine the interaction between Keap1 and IKKβ in the presence of wild-type mVP24 and mutants of mVP24 defective for binding to Keap1. Western blotting was used to determine levels of IKKβ expression in the presence of Keap1 and mVP24. NF-κB promoter-luciferase assays were used to determine the effect of mVP24 on Keap1-induced repression of activity. Expression of wild-type mVP24 disrupted the interaction of IKKβ and Keap1, whereas weakly interacting and noninteracting mVP24 mutants did not disrupt the interaction between Keap1 and IKKβ. The interaction of mVP24 with Keap1 enhanced IKKβ levels in the presence of Keap1. The interaction of mVP24 with Keap1 also relieved Keap1 repression of NF-κB reporter activity. mVP24 can relieve Keap1 repression of the NF-κB pathway through its interaction with Keap1. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The study of the intercellular trafficking of the fusion proteins of herpes simplex virus protein VP22.

PubMed

Xue, Xiaodong; Huang, Jianhua; Wang, Huishan

2014-01-01

Genetic modifications can improve the therapeutic efficacy of mesenchymal stem cell (MSC) transplantation in myocardial infarction. However, so far, the efficiency of MSC modification is very low. Seeking for a more efficient way of MSC modification, we investigated the possibility of employing the intercellular trafficking capacity of the herpes simplex virus type-1 tegument protein VP22 on the enhancement of MSC modification. Plasmids pVP22-myc, pVP22-EGFP, pEGFP-VP22, pVP22-hBcl-xL and phBcl-xL-VP22 were constructed for the expressions of the myc-tagged VP22 and the fusion proteins VP22-EGFP, EGFP-VP22, VP22-hBcl-xL and hBcl-xL-VP22. MSCs were isolated from rat bone marrow and the surface markers were identified by Flowcytometry. COS-1 cells were transfected with the above plasmids and co-cultured with untransfected MSCs, the intercellular transportations of the constructed proteins were studied by immunofluorescence. The solubility of VP22-hBcl-xL and hBcl-xL-VP22 was analyzed by Western blot. VP22-myc could be expressed in and spread between COS-1 cells, which indicates the validity of our VP22 expression construct. Flowcytometry analysis revealed that the isolated MSCs were CD29, CD44, and CD90 positive and were negative for the hematopoietic markers, CD34 and CD45. The co-culturing and immunofluorescence assay showed that VP22-myc, VP22-EGFP and EGFP-VP22 could traffic between COS-1 cells and MSCs, while the evidence of intercellular transportation of VP22-hBcl-xL and hBcl-xL-VP22 was not detected. Western blot analysis showed that VP22-hBcl-xL and hBcl-xL-VP22 were both insoluble in the cell lysate suggesting interactions of the fusion proteins with other cellular components. The intercellular trafficking of VP22-myc, VP22-EGFP and EGFP-VP22 between COS-1 cells and MSCs presents an intriguing prospect in the therapeutic application of VP22 as a delivery vehicle which enhances genetic modifications of MSCs. However, VP22-hBcl-xL and hBcl-xL-VP22 failed to spread between cells, which are due to the insolubility of the fusion protein incurred by interactions with other cellular components.

The Study of the Intercellular Trafficking of the Fusion Proteins of Herpes Simplex Virus Protein VP22

PubMed Central

Xue, Xiaodong; Huang, Jianhua; Wang, Huishan

2014-01-01

Background Genetic modifications can improve the therapeutic efficacy of mesenchymal stem cell (MSC) transplantation in myocardial infarction. However, so far, the efficiency of MSC modification is very low. Seeking for a more efficient way of MSC modification, we investigated the possibility of employing the intercellular trafficking capacity of the herpes simplex virus type-1 tegument protein VP22 on the enhancement of MSC modification. Methods Plasmids pVP22-myc, pVP22-EGFP, pEGFP-VP22, pVP22-hBcl-xL and phBcl-xL-VP22 were constructed for the expressions of the myc-tagged VP22 and the fusion proteins VP22-EGFP, EGFP-VP22, VP22-hBcl-xL and hBcl-xL-VP22. MSCs were isolated from rat bone marrow and the surface markers were identified by Flowcytometry. COS-1 cells were transfected with the above plasmids and co-cultured with untransfected MSCs, the intercellular transportations of the constructed proteins were studied by immunofluorescence. The solubility of VP22-hBcl-xL and hBcl-xL-VP22 was analyzed by Western blot. Results VP22-myc could be expressed in and spread between COS-1 cells, which indicates the validity of our VP22 expression construct. Flowcytometry analysis revealed that the isolated MSCs were CD29, CD44, and CD90 positive and were negative for the hematopoietic markers, CD34 and CD45. The co-culturing and immunofluorescence assay showed that VP22-myc, VP22-EGFP and EGFP-VP22 could traffic between COS-1 cells and MSCs, while the evidence of intercellular transportation of VP22-hBcl-xL and hBcl-xL-VP22 was not detected. Western blot analysis showed that VP22-hBcl-xL and hBcl-xL-VP22 were both insoluble in the cell lysate suggesting interactions of the fusion proteins with other cellular components. Conclusions The intercellular trafficking of VP22-myc, VP22-EGFP and EGFP-VP22 between COS-1 cells and MSCs presents an intriguing prospect in the therapeutic application of VP22 as a delivery vehicle which enhances genetic modifications of MSCs. However, VP22-hBcl-xL and hBcl-xL-VP22 failed to spread between cells, which are due to the insolubility of the fusion protein incurred by interactions with other cellular components. PMID:24955582

VP24-Karyopherin Alpha Binding Affinities Differ between Ebolavirus Species, Influencing Interferon Inhibition and VP24 Stability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, Toni M.; Edwards, Megan R.; Diederichs, Audrey

ABSTRACT Zaire ebolavirus(EBOV),Bundibugyo ebolavirus(BDBV), andReston ebolavirus(RESTV) belong to the same genus but exhibit different virulence properties. VP24 protein, a structural protein present in all family members, blocks interferon (IFN) signaling and likely contributes to virulence. Inhibition of IFN signaling by EBOV VP24 (eVP24) involves its interaction with the NPI-1 subfamily of karyopherin alpha (KPNA) nuclear transporters. Here, we evaluated eVP24, BDBV VP24 (bVP24), and RESTV VP24 (rVP24) interactions with three NPI-1 subfamily KPNAs (KPNA1, KPNA5, and KPNA6). Using purified proteins, we demonstrated that each VP24 binds to each of the three NPI-1 KPNAs. bVP24, however, exhibited approximately 10-fold-lower KPNA bindingmore » affinity than either eVP24 or rVP24. Cell-based assays also indicate that bVP24 exhibits decreased KPNA interaction, decreased suppression of IFN induced gene expression, and a decreased half-life in transfected cells compared to eVP24 or rVP24. Amino acid sequence alignments between bVP24 and eVP24 also identified residues within and surrounding the previously defined eVP24-KPNA5 binding interface that decrease eVP24-KPNA affinity or bVP24-KPNA affinity. VP24 mutations that lead to reduced KPNA binding affinity also decrease IFN inhibition and shorten VP24 half-lives. These data identify novel functional differences in VP24-KPNA interaction and reveal a novel impact of the VP24-KPNA interaction on VP24 stability. IMPORTANCEThe interaction of Ebola virus (EBOV) VP24 protein with host karyopherin alpha (KPNA) proteins blocks type I interferon (IFN) signaling, which is a central component of the host innate immune response to viral infection. Here, we quantitatively compared the interactions of VP24 proteins from EBOV and two members of theEbolavirusgenus, Bundibugyo virus (BDBV) and Reston virus (RESTV). The data reveal lower binding affinity of the BDBV VP24 (bVP24) for KPNAs and demonstrate that the interaction with KPNA modulates inhibition of IFN signaling and VP24 stability. The effect of KPNA interaction on VP24 stability is a novel functional consequence of this virus-host interaction, and the differences identified between viral species may contribute to differences in pathogenesis.« less

VP24-Karyopherin Alpha Binding Affinities Differ between Ebolavirus Species, Influencing Interferon Inhibition and VP24 Stability.

PubMed

Schwarz, Toni M; Edwards, Megan R; Diederichs, Audrey; Alinger, Joshua B; Leung, Daisy W; Amarasinghe, Gaya K; Basler, Christopher F

2017-02-15

Zaire ebolavirus (EBOV), Bundibugyo ebolavirus (BDBV), and Reston ebolavirus (RESTV) belong to the same genus but exhibit different virulence properties. VP24 protein, a structural protein present in all family members, blocks interferon (IFN) signaling and likely contributes to virulence. Inhibition of IFN signaling by EBOV VP24 (eVP24) involves its interaction with the NPI-1 subfamily of karyopherin alpha (KPNA) nuclear transporters. Here, we evaluated eVP24, BDBV VP24 (bVP24), and RESTV VP24 (rVP24) interactions with three NPI-1 subfamily KPNAs (KPNA1, KPNA5, and KPNA6). Using purified proteins, we demonstrated that each VP24 binds to each of the three NPI-1 KPNAs. bVP24, however, exhibited approximately 10-fold-lower KPNA binding affinity than either eVP24 or rVP24. Cell-based assays also indicate that bVP24 exhibits decreased KPNA interaction, decreased suppression of IFN induced gene expression, and a decreased half-life in transfected cells compared to eVP24 or rVP24. Amino acid sequence alignments between bVP24 and eVP24 also identified residues within and surrounding the previously defined eVP24-KPNA5 binding interface that decrease eVP24-KPNA affinity or bVP24-KPNA affinity. VP24 mutations that lead to reduced KPNA binding affinity also decrease IFN inhibition and shorten VP24 half-lives. These data identify novel functional differences in VP24-KPNA interaction and reveal a novel impact of the VP24-KPNA interaction on VP24 stability. The interaction of Ebola virus (EBOV) VP24 protein with host karyopherin alpha (KPNA) proteins blocks type I interferon (IFN) signaling, which is a central component of the host innate immune response to viral infection. Here, we quantitatively compared the interactions of VP24 proteins from EBOV and two members of the Ebolavirus genus, Bundibugyo virus (BDBV) and Reston virus (RESTV). The data reveal lower binding affinity of the BDBV VP24 (bVP24) for KPNAs and demonstrate that the interaction with KPNA modulates inhibition of IFN signaling and VP24 stability. The effect of KPNA interaction on VP24 stability is a novel functional consequence of this virus-host interaction, and the differences identified between viral species may contribute to differences in pathogenesis. Copyright © 2017 American Society for Microbiology.

Dependencies of pore pressure on elastic wave velocities and Vp/Vs ratio for thermally cracked gabbro

NASA Astrophysics Data System (ADS)

Nishimura, K.; Uehara, S. I.; Mizoguchi, K.

2015-12-01

Marine seismic refraction have found that there are high Vp/Vs ratio regions in oceanic crusts at subducting oceanic plates (e.g, Cascadia subduction zone (2.0-2.8) (Audet et al., 2009)). Previous studies based on laboratory measurements indicated that Vp/Vs ratio is high when porosity and/or pore pressure is high (Christensen, 1984; Peacock et al., 2011). Although several studies have investigated the relationships between fracture distributions and Vp, Vs (e.g., Wang et al., 2012; Blake et al., 2013), the relationships for rocks (e.g., gabbro and basalt) composing oceanic crust are still unclear. This study reports the results of laboratory measurements of Vp, Vs (transmission method) at controlled confining and pore pressure and estimation of Vp/Vs ratio for thermally cracked gabbro which mimic highly fractured rocks in the high Vp/Vs ratio zone, in order to declare the dependence of fracture distributions on Vp/Vs. For the measurements, we prepared three type specimens; a non-heated intact specimen, specimens heated up to 500 °C and 700 °C for 24 hours. Porosities of intact, 500 °C and 700 °C specimens measured under the atmospheric pressure are 0.5, 3.4 and 3.5%, respectively. Measurements were conducted at a constant confining pressure of 50 MPa, with decreasing pore pressure from 49 to 0.1 MPa and then increasing to 49 MPa. While Vp/Vs for the intact specimen is almost constant at elevated pore pressure, the Vp/Vs values for the thermally cracked ones were 2.0~2.2 when pore pressure was larger than 30 MPa. In future, we will reveal the relationship between the measured elastic wave velocities and the characteristics of the microfracture distribution. This work was supported by JSPS Grant-in-Aid for Scientific Research (Grant Number 26400492).

Ebolavirus VP35 is a multifunctional virulence factor.

PubMed

Leung, Daisy W; Prins, Kathleen C; Basler, Christopher F; Amarasinghe, Gaya K

2010-01-01

Ebola virus (EBOV) is a member of the filoviridae family that causes severe hemorrhagic fever during sporadic outbreaks, and no approved treatments are currently available. The multifunctional EBOV VP35 protein facilitates immune evasion by antagonizing antiviral signaling pathways and is important for viral RNA synthesis. In order to elucidate regulatory mechanisms and to develop countermeasures, we recently solved the structures of the Zaire and Reston EBOV VP35 interferon inhibitory domain (IID) in the free form and of the Zaire EBOV VP35 IID bound to dsRNA. Together with biochemical, cell biological, and virological studies, our structural work revealed that distinct regions within EBOV VP35 IID contribute to virulence through host immune evasion and viral RNA synthesis. Here we summarize our recent structural and functional studies and discuss the potential of multifunctional Ebola VP35 as a therapeutic target.

Inner magnetospheric electron temperature and spacecraft potential estimated from concurrent Polar upper hybrid frequency and relative potential measurements

NASA Astrophysics Data System (ADS)

Boardsen, S. A.; Adrian, M. L.; Pfaff, R.; Menietti, J. D.

2014-10-01

Direct measurement of low < 1 eV electron temperature is difficult to make in the Earth's inner magnetosphere for electron densities (Ne) < 3 × 102 cm-3. We compute these quantities by solving current balance equations in low-density regions. Concurrent measurements from the Polar spacecraft of the relative potential (VS - VP), between the spacecraft body and the electric field probe, and the electron density (Ne), derived from upper hybrid frequency (fUHR), were used in the current balance equations to solve for the electron temperature (Te), Vs, and Vp. Where VP is the probe potential and VS is the spacecraft potential relative to the nearby plasma. The assumption that the bulk plasma electrons are Maxwellian is used in the computations. Our data set covered 1.5 years of measurements when fUHR was detectable (L < 10). The following "averaged" Te versus L relation for 3 < L < 5 was obtained: Te = 0.58 + 0.49 (L - 3) eV. This expression is in reasonable agreement with extrapolations of ionospheric Te measurements by Akebono at lower altitudes. However, the solution is sensitive to the photoemission coefficients, substituting those of Scudder et al. (2000) with those of Escoubet et al. (1997), the Te curve shifted upward by ~1 eV. Also, the solution is sensitive to measurement error of VS - VP, applying a voltage shift of ±0.1 and ±0.2 V to VS - VP, the relative median error for our data set was computed to be 0.27 and 1.04, respectively. We believe that our Te values computed outside the plasmasphere are unrealistically low. We conclude that this method shows promise inside the plasmasphere but should be used with caution. We also quantified the Ne versus VS - VP relationship. The running median Ne versus VS - VP curve shows no significant variation over the 1.5 year period of the data set, suggesting that the photoemission coefficients did not change significantly over this time span. The Scudder et al. (2000) Ne model, based on only one Polar orbit, is in reasonable agreement (within a factor of 2) with our results.

Genetic variation of viral protein 1 genes of field strains of waterfowl parvoviruses and their attenuated derivatives.

PubMed

Tsai, Hsiang-Jung; Tseng, Chun-hsien; Chang, Poa-chun; Mei, Kai; Wang, Shih-Chi

2004-09-01

To understand the genetic variations between the field strains of waterfowl parvoviruses and their attenuated derivatives, we analyzed the complete nucleotide sequences of the viral protein 1 (VP1) genes of nine field strains and two vaccine strains of waterfowl parvoviruses. Sequence comparison of the VP1 proteins showed that these viruses could be divided into goose parvovirus (GPV) related and Muscovy duck parvovirus (MDPV) related groups. The amino acid difference between GPV- and MDPV-related groups ranged from 13.1% to 15.8%, and the most variable region resided in the N terminus of VP2. The vaccine strains of GPV and MDPV exhibited only 1.2% and 0.3% difference in amino acid when compared with their parental field strains, and most of these differences resided in residues 497-575 of VP1, suggesting that these residues might be important for the attenuation of GPV and MDPV. When the GPV strains isolated in 1982 (the strain 82-0308) and in 2001 (the strain 01-1001) were compared, only 0.3% difference in amino acid was found, while MDPV strains isolated in 1990 (the strain 90-0219) and 1997 (the strain 97-0104) showed only 0.4% difference in amino acid. The result indicates that the genome of waterfowl parvovirus had remained highly stable in the field.

A simplified approach to characterizing a kilovoltage source spectrum for accurate dose computation.

PubMed

Poirier, Yannick; Kouznetsov, Alexei; Tambasco, Mauro

2012-06-01

To investigate and validate the clinical feasibility of using half-value layer (HVL) and peak tube potential (kVp) for characterizing a kilovoltage (kV) source spectrum for the purpose of computing kV x-ray dose accrued from imaging procedures. To use this approach to characterize a Varian® On-Board Imager® (OBI) source and perform experimental validation of a novel in-house hybrid dose computation algorithm for kV x-rays. We characterized the spectrum of an imaging kV x-ray source using the HVL and the kVp as the sole beam quality identifiers using third-party freeware Spektr to generate the spectra. We studied the sensitivity of our dose computation algorithm to uncertainties in the beam's HVL and kVp by systematically varying these spectral parameters. To validate our approach experimentally, we characterized the spectrum of a Varian® OBI system by measuring the HVL using a Farmer-type Capintec ion chamber (0.06 cc) in air and compared dose calculations using our computationally validated in-house kV dose calculation code to measured percent depth-dose and transverse dose profiles for 80, 100, and 125 kVp open beams in a homogeneous phantom and a heterogeneous phantom comprising tissue, lung, and bone equivalent materials. The sensitivity analysis of the beam quality parameters (i.e., HVL, kVp, and field size) on dose computation accuracy shows that typical measurement uncertainties in the HVL and kVp (±0.2 mm Al and ±2 kVp, respectively) source characterization parameters lead to dose computation errors of less than 2%. Furthermore, for an open beam with no added filtration, HVL variations affect dose computation accuracy by less than 1% for a 125 kVp beam when field size is varied from 5 × 5 cm(2) to 40 × 40 cm(2). The central axis depth dose calculations and experimental measurements for the 80, 100, and 125 kVp energies agreed within 2% for the homogeneous and heterogeneous block phantoms, and agreement for the transverse dose profiles was within 6%. The HVL and kVp are sufficient for characterizing a kV x-ray source spectrum for accurate dose computation. As these parameters can be easily and accurately measured, they provide for a clinically feasible approach to characterizing a kV energy spectrum to be used for patient specific x-ray dose computations. Furthermore, these results provide experimental validation of our novel hybrid dose computation algorithm. © 2012 American Association of Physicists in Medicine.

Immunogenicity and protective efficacy of rotavirus VP8* fused to cholera toxin B subunit in a mouse model.

PubMed

Xue, Miaoge; Yu, Linqi; Jia, Lianzhi; Li, Yijian; Zeng, Yuanjun; Li, Tingdong; Ge, Shengxiang; Xia, Ningshao

2016-11-01

In attempts to develop recombinant subunit vaccines against rotavirus disease, it was previously shown that the N-terminal truncated VP8* protein, VP8-1 (aa26-231), is a good vaccine candidate when used for immunization in combination with Freund's adjuvant. However, this protein stimulated only weak immune response when aluminum hydroxide was used as an adjuvant. In this study, the nontoxic B subunit of cholera toxin (CTB) was employed as intra-molecular adjuvant to improve the immunogenicity of VP8-1. Both, the N-terminal and C-terminal fusion proteins, were purified to homogeneity, at which stage they formed pentamers, and showed significantly higher immunogenicity and protective efficacy than a VP8-1/aluminum hydroxide mixture in a mouse model. Compared to VP8-1-CTB, CTB-VP8-1 showed higher binding activity to both, GM1 and the conformation sensitive neutralizing monoclonal antibodies specific to VP8. More importantly, CTB-VP8-1 elicited higher titers of neutralizing antibodies and conferred higher protective efficacy than VP8-1-CTB. Therefore, the protein CTB-VP8-1, with enhanced immunogenicity and immunoprotectivity, could be considered as a viable candidate for further development of an alternative, replication-incompetent, parenterally administered vaccine against rotavirus disease.

Definition of neutralizing sites on African horse sickness virus serotype 4 VP2 at the level of peptides.

PubMed

Martínez-Torrecuadrada, J L; Langeveld, J P; Meloen, R H; Casal, J I

2001-10-01

The antigenic structure of African horse sickness virus (AHSV) serotype 4 capsid protein VP2 has been determined at the peptide level by PEPSCAN analysis in combination with a large collection of polyclonal antisera and monoclonal antibodies. VP2, the determinant for the virus serotype and an important target in virus neutralization, was found to contain 15 antigenic sites. A major antigenic region containing 12 of the 15 sites was identified in the region between residues 223 and 400. A second domain between residues 568 and 681 contained the three remaining sites. These sites were used for the synthesis of peptides, which were later tested in rabbits. Of the 15 synthetic peptides, three were able to induce neutralizing antibodies for AHSV-4, defining two neutralizing epitopes, 'a' and 'b', between residues 321 and 339, and 377 and 400, respectively. A combination of peptides representing both sites induced a more effective neutralizing response. Still, the relatively low neutralization titres make the possibility of producing a synthetic vaccine for AHSV unlikely. The complex protein-protein interaction of the outer shell of the viral capsid would probably require the presence of either synthetic peptides in the correct conformation or peptide segments from the different proteins VP2, VP5 and VP7.

In vitro dose measurements in a human cadaver with abdomen/pelvis CT scans

PubMed Central

Zhang, Da; Padole, Atul; Li, Xinhua; Singh, Sarabjeet; Khawaja, Ranish Deedar Ali; Lira, Diego; Liu, Tianyu; Shi, Jim Q.; Otrakji, Alexi; Kalra, Mannudeep K.; Xu, X. George; Liu, Bob

2014-01-01

Purpose: To present a study of radiation dose measurements with a human cadaver scanned on a clinical CT scanner. Methods: Multiple point dose measurements were obtained with high-accuracy Thimble ionization chambers placed inside the stomach, liver, paravertebral gutter, ascending colon, left kidney, and urinary bladder of a human cadaver (183 cm in height and 67.5 kg in weight) whose abdomen/pelvis region was scanned repeatedly with a multidetector row CT. The flat energy response and precision of the dosimeters were verified, and the slight differences in each dosimeter's response were evaluated and corrected to attain high accuracy. In addition, skin doses were measured for radiosensitive organs outside the scanned region with OSL dosimeters: the right eye, thyroid, both nipples, and the right testicle. Three scan protocols were used, which shared most scan parameters but had different kVp and mA settings: 120-kVp automA, 120-kVp 300 mA, and 100-kVp 300 mA. For each protocol three repeated scans were performed. Results: The tube starting angle (TSA) was found to randomly vary around two major conditions, which caused large fluctuations in the repeated point dose measurements: for the 120-kVp 300 mA protocol this angle changed from approximately 110° to 290°, and caused 8% − 25% difference in the point dose measured at the stomach, liver, colon, and urinary bladder. When the fluctuations of the TSA were small (within 5°), the maximum coefficient of variance was approximately 3.3%. The soft tissue absorbed doses averaged from four locations near the center of the scanned region were 27.2 ± 3.3 and 16.5 ± 2.7 mGy for the 120 and 100-kVp fixed-mA scans, respectively. These values were consistent with the corresponding size specific dose estimates within 4%. The comparison of the per-100-mAs tissue doses from the three protocols revealed that: (1) dose levels at nonsuperficial locations in the TCM scans could not be accurately deduced by simply scaling the fix-mA doses with local mA values; (2) the general power law relationship between dose and kVp varied from location to location, with the power index ranged between 2.7 and 3.5. The averaged dose measurements at both nipples, which were about 0.6 cm outside the prescribed scan region, ranged from 23 to 27 mGy at the left nipple, and varied from 3 to 20 mGy at the right nipple over the three scan protocols. Large fluctuations over repeated scans were also observed, as a combined result of helical scans of large pitch (1.375) and small active areas of the skin dosimeters. In addition, the averaged skin dose fell off drastically with the distance to the nearest boundary of the scanned region. Conclusions: This study revealed the complexity of CT dose fluctuation and variation with a human cadaver. PMID:25186398

In vitro dose measurements in a human cadaver with abdomen/pelvis CT scans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Da; Padole, Atul; Li, Xinhua

2014-09-15

Purpose: To present a study of radiation dose measurements with a human cadaver scanned on a clinical CT scanner. Methods: Multiple point dose measurements were obtained with high-accuracy Thimble ionization chambers placed inside the stomach, liver, paravertebral gutter, ascending colon, left kidney, and urinary bladder of a human cadaver (183 cm in height and 67.5 kg in weight) whose abdomen/pelvis region was scanned repeatedly with a multidetector row CT. The flat energy response and precision of the dosimeters were verified, and the slight differences in each dosimeter's response were evaluated and corrected to attain high accuracy. In addition, skin dosesmore » were measured for radiosensitive organs outside the scanned region with OSL dosimeters: the right eye, thyroid, both nipples, and the right testicle. Three scan protocols were used, which shared most scan parameters but had different kVp and mA settings: 120-kVp automA, 120-kVp 300 mA, and 100-kVp 300 mA. For each protocol three repeated scans were performed. Results: The tube starting angle (TSA) was found to randomly vary around two major conditions, which caused large fluctuations in the repeated point dose measurements: for the 120-kVp 300 mA protocol this angle changed from approximately 110° to 290°, and caused 8% − 25% difference in the point dose measured at the stomach, liver, colon, and urinary bladder. When the fluctuations of the TSA were small (within 5°), the maximum coefficient of variance was approximately 3.3%. The soft tissue absorbed doses averaged from four locations near the center of the scanned region were 27.2 ± 3.3 and 16.5 ± 2.7 mGy for the 120 and 100-kVp fixed-mA scans, respectively. These values were consistent with the corresponding size specific dose estimates within 4%. The comparison of the per-100-mAs tissue doses from the three protocols revealed that: (1) dose levels at nonsuperficial locations in the TCM scans could not be accurately deduced by simply scaling the fix-mA doses with local mA values; (2) the general power law relationship between dose and kVp varied from location to location, with the power index ranged between 2.7 and 3.5. The averaged dose measurements at both nipples, which were about 0.6 cm outside the prescribed scan region, ranged from 23 to 27 mGy at the left nipple, and varied from 3 to 20 mGy at the right nipple over the three scan protocols. Large fluctuations over repeated scans were also observed, as a combined result of helical scans of large pitch (1.375) and small active areas of the skin dosimeters. In addition, the averaged skin dose fell off drastically with the distance to the nearest boundary of the scanned region. Conclusions: This study revealed the complexity of CT dose fluctuation and variation with a human cadaver.« less

Cryo-Electron Microscopy Reconstruction Shows Poliovirus 135S Particles Poised for Membrane Interaction and RNA Release

PubMed Central

Butan, Carmen; Filman, David J.

2014-01-01

During infection, binding of mature poliovirus to cell surface receptors induces an irreversible expansion of the capsid, to form an infectious cell-entry intermediate particle that sediments at 135S. In these expanded virions, the major capsid proteins (VP1 to VP3) adopt an altered icosahedral arrangement to open holes in the capsid at 2-fold and quasi-3-fold axes, and internal polypeptides VP4 and the N terminus of VP1, which can bind membranes, become externalized. Cryo-electron microscopy images for 117,330 particles were collected using Leginon and reconstructed using FREALIGN. Improved rigid-body positioning of major capsid proteins established reliably which polypeptide segments become disordered or rearranged. The virus-to-135S transition includes expansion of 4%, rearrangements of the GH loops of VP3 and VP1, and disordering of C-terminal extensions of VP1 and VP2. The N terminus of VP1 rearranges to become externalized near its quasi-3-fold exit, binds to rearranged GH loops of VP3 and VP1, and attaches to the top surface of VP2. These details improve our understanding of subsequent stages of infection, including endocytosis and RNA transfer into the cytoplasm. PMID:24257617

The Ebola Virus VP30-NP Interaction Is a Regulator of Viral RNA Synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirchdoerfer, Robert N.; Moyer, Crystal L.; Abelson, Dafna M.

Filoviruses are capable of causing deadly hemorrhagic fevers. All nonsegmented negative-sense RNA-virus nucleocapsids are composed of a nucleoprotein (NP), a phosphoprotein (VP35) and a polymerase (L). However, the VP30 RNA-synthesis co-factor is unique to the filoviruses. The assembly, structure, and function of the filovirus RNA replication complex remain unclear. Here, we have characterized the interactions of Ebola, Sudan and Marburg virus VP30 with NP using in vitro biochemistry, structural biology and cell-based mini-replicon assays. We have found that the VP30 C-terminal domain interacts with a short peptide in the C-terminal region of NP. Further, we have solved crystal structures ofmore » the VP30-NP complex for both Ebola and Marburg viruses. These structures reveal that a conserved, proline-rich NP peptide binds a shallow hydrophobic cleft on the VP30 C-terminal domain. Structure-guided Ebola virus VP30 mutants have altered affinities for the NP peptide. Correlation of these VP30-NP affinities with the activity for each of these mutants in a cell-based mini-replicon assay suggests that the VP30-NP interaction plays both essential and inhibitory roles in Ebola virus RNA synthesis.« less

Ubiquitin Ligase WWP1 Interacts with Ebola Virus VP40 To Regulate Egress.

PubMed

Han, Ziying; Sagum, Cari A; Takizawa, Fumio; Ruthel, Gordon; Berry, Corbett T; Kong, Jing; Sunyer, J Oriol; Freedman, Bruce D; Bedford, Mark T; Sidhu, Sachdev S; Sudol, Marius; Harty, Ronald N

2017-10-15

Ebola virus (EBOV) is a member of the Filoviridae family and the cause of hemorrhagic fever outbreaks. The EBOV VP40 (eVP40) matrix protein is the main driving force for virion assembly and budding. Indeed, expression of eVP40 alone in mammalian cells results in the formation and budding of virus-like particles (VLPs) which mimic the budding process and morphology of authentic, infectious EBOV. To complete the budding process, eVP40 utilizes its PPXY L-domain motif to recruit a specific subset of host proteins containing one or more modular WW domains that then function to facilitate efficient production and release of eVP40 VLPs. In this report, we identified additional host WW-domain interactors by screening for potential interactions between mammalian proteins possessing one or more WW domains and WT or PPXY mutant peptides of eVP40. We identified the HECT family E3 ubiquitin ligase WWP1 and all four of its WW domains as strong interactors with the PPXY motif of eVP40. The eVP40-WWP1 interaction was confirmed by both peptide pulldown and coimmunoprecipitation assays, which also demonstrated that modular WW domain 1 of WWP1 was most critical for binding to eVP40. Importantly, the eVP40-WWP1 interaction was found to be biologically relevant for VLP budding since (i) small interfering RNA (siRNA) knockdown of endogenous WWP1 resulted in inhibition of eVP40 VLP egress, (ii) coexpression of WWP1 and eVP40 resulted in ubiquitination of eVP40 and a subsequent increase in eVP40 VLP egress, and (iii) an enzymatically inactive mutant of WWP1 (C890A) did not ubiquitinate eVP40 or enhance eVP40 VLP egress. Last, our data show that ubiquitination of eVP40 by WWP1 enhances egress of VLPs and concomitantly decreases cellular levels of higher-molecular-weight oligomers of eVP40. In sum, these findings contribute to our fundamental understanding of the functional interplay between host E3 ligases, ubiquitination, and regulation of EBOV VP40-mediated egress. IMPORTANCE Ebola virus (EBOV) is a high-priority, emerging human pathogen that can cause severe outbreaks of hemorrhagic fever with high mortality rates. As there are currently no approved vaccines or treatments for EBOV, a better understanding of the biology and functions of EBOV-host interactions that promote or inhibit viral budding is warranted. Here, we describe a physical and functional interaction between EBOV VP40 (eVP40) and WWP1, a host E3 ubiquitin ligase that ubiquitinates VP40 and regulates VLP egress. This viral PPXY-host WW domain-mediated interaction represents a potential new target for host-oriented inhibitors of EBOV egress. Copyright © 2017 American Society for Microbiology.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Enhancement of VP6 immunogenicity and protective efficacy against rotavirus by VP2 in a genetic immunization.

PubMed

Lopez-Guerrero, D V; Arias, N; Gutierrez-Xicotencatl, L; Chihu-Amparan, L; González, A; Pedroza-Saavedra, A; Rosas-Salgado, G; Villegas-Garcia, J C; Badillo-Godinez, O; Fernandez, G; Lopez, S; Esquivel-Guadarrama, F

2018-05-24

VP2/VP6 virus like particles (VLPs) are very effective in inducing protection against the rotavirus infection in animal models. Individually, VP6 can also induce protection. However, there is no information about the immunogenicity of VP2. The aim of this work was to evaluate the efficacy of DNA vaccines codifying for VP2 or VP6, alone or combined, to induce protection against the rotavirus infection. Murine rotavirus VP2 and VP6 genes were cloned into the pcDNA3 vector. Adult BALB/c mice were inoculated three times by intramuscular (i.m.) injections with 100 or 200µg of pcDNA3-VP2 or pcDNA3-VP6 alone or co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6. Two weeks after the last inoculation, mice were challenged with the wild type murine rotavirus strain epizootic diarrhea of infant mice (EDIM wt ). We found that both plasmids, pcDNA3-VP2 and pcDNA3-VP6, were able to induce rotavirus-specific serum antibodies, but not intestinal rotavirus-specific IgA; only 200µg of pcDNA3-VP6 induced 35% protection against the infection. A similar level of protection was found when mice were co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:1 ratio). However, the best protection (up to 58%) occurred when mice were inoculated with 10µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:10 ratio). These results indicate that the DNA plasmid expressing VP6 is a better vaccine candidate that the one expressing VP2. However, when co-expressed, VP2 potentiates the immunogenicity and protective efficacy of VP6. Copyright © 2017. Published by Elsevier Ltd.

Recombinant VP1 protein of duck hepatitis virus 1 expressed in Pichia pastoris and its immunogenicity in ducks.

PubMed

Wang, C; Li, X K; Wu, T C; Wang, Y; Zhang, C J; Cheng, X C; Chen, P Y

2014-01-01

The VP1 gene of duck hepatitis virus type 1 (DHV-1) strain VJ09 was amplified by reverse transcription PCR from the liver of a duckling with clinical symptoms of viral hepatitis. The resulting VP1 cDNA was 720 bp in length and encoded a 240-amino-acid protein. In VP1 gene-based phylogenetic analysis, the VJ09 strain grouped with DHV-1 genotype C. The VP1 gene was inserted into the expression vector pPICZαA and expressed in Pichia pastoris. The expressed VP1 protein was purified and identified by western blot analysis. To evaluate the recombinant VP1's immunogenic potential in ducklings, the antibodies raised in the immunized ducklings were titrated by ELISA, and lymphocyte proliferation and virus neutralization assays were performed. The results show that the recombinant VP1 protein induced a significant immune response in ducklings and this could be a candidate for the development of a subunit vaccine against DHV-1 genotype C.

Reservoir Structure and Wastewater-Induced Seismicity at the Val d'Agri Oilfield (Italy) Shown by Three-Dimensional Vp and Vp/Vs Local Earthquake Tomography

NASA Astrophysics Data System (ADS)

Improta, L.; Bagh, S.; De Gori, P.; Valoroso, L.; Pastori, M.; Piccinini, D.; Chiarabba, C.; Anselmi, M.; Buttinelli, M.

2017-11-01

Wastewater injection into a high-rate well in the Val d'Agri oilfield, the largest in onshore Europe, has induced swarm microseismicity since the initiation of disposal in 2006. To investigate the reservoir structure and to track seismicity, we performed a high-spatial resolution local earthquake tomography using 1,281 natural and induced earthquakes recorded by local networks. The properties of the carbonate reservoir (rock fracturing, pore fluid pressure) and inherited faults control the occurrence and spatiotemporal distribution of seismicity. A low-Vp, high-Vp/Vs region under the well represents a fluid saturated fault zone ruptured by induced seismicity. High-Vp, high-Vp/Vs bumps match reservoir culminations indicating saturated liquid-bearing zones, whereas a very low Vp, low Vp/Vs anomaly might represent a strongly fractured and depleted zone of the hydrocarbon reservoir characterized by significant fluid withdrawal. The comprehensive picture of the injection-linked seismicity obtained by integrating reservoir-scale tomography, high-precision earthquake locations, and geophysical and injection data suggests that the driving mechanism is the channeling of pore pressure perturbations through a high permeable fault damage zone within the reservoir. The damage zone surrounds a Pliocene reverse fault optimally oriented in the current extensional stress field. The ruptured damage zone measures 2 km along strike and 3 km along dip and is confined between low permeability ductile formations. Injection pressure is the primary parameter controlling seismicity rate. Our study underlines that local earthquake tomography also using wastewater-induced seismicity can give useful insights into the physical mechanism leading to these earthquakes.

Crustal scale detachment in the Himalayas: a reappraisal

NASA Astrophysics Data System (ADS)

Mukhopadhyay, S.; Sharma, J.

2010-11-01

According to the most popular tectonic model of the Himalayas proposed by a number of scientists the Indian crustal material underthrusts the Himalayas at a low angle and is relatively free of deformation compared to the overlying accreted material that makes up the Himalayan mountain chain. In this work we have carried out local earthquake tomography for the Garwhal-Kumaun Himalayas to estimate P- and S-wave velocity variations (Vp and Vs, respectively) and variation in their ratio (Vp/Vs) that would indicate the structure of the Himalayas and the underlying Indian crust in this part of the Himalayas. The results indicate that there is crustal level folding and faulting in this region indicating that the underlying Indian crustal material has also undergone deformation unlike what was postulated for the entire Himalayas by some workers before. By comparing our tomographic result with that for the eastern Nepal-southern Tibet region, it is concluded that there is variation in mode of deformation along the trend of the Himalayas. This observation matches well with the observed velocity variation in the upper mantle of these two regions reported by others. The area under investigation falls within a region where there is more oblique convergence between India and Eurasia compared to the Nepal Himalayas region. This may explain why such variation in mode of deformation is observed. The ratio Vp/Vs gets affected by strength of material. Presence or absence of fluid filled fractures or molten material affects it most strongly in the crustal region. The variation in Vp/Vs in the study area shows that almost the entire crust here have enough rheological strength such that it can store strain energy that can be released through earthquakes. A zone of low Vp/Vs beginning at the higher Himalayas and dipping towards SW is observed. This zone also has high Vp and Vs and is observed even when inversion is carried out with very high damping value. These observations do not suggest that seismic hazard will be less in the study area.

Live Attenuated Vaccine Based on Duck Enteritis Virus against Duck Hepatitis A Virus Types 1 and 3

PubMed Central

Zou, Zhong; Ma, Ji; Huang, Kun; Chen, Huanchun; Liu, Ziduo; Jin, Meilin

2016-01-01

As causative agents of duck viral hepatitis, duck hepatitis A virus type 1 (DHAV-1) and type 3 (DHAV-3) causes significant economic losses in the duck industry. However, a licensed commercial vaccine that simultaneously controls both pathogens is currently unavailable. Here, we generated duck enteritis virus recombinants (rC-KCE-2VP1) containing both VP1 from DHAV-1 (VP1/DHAV-1) and VP1 from DHAV-3 (VP1/DHAV-3) between UL27 and UL26. A self-cleaving 2A-element of FMDV was inserted between the two different types of VP1, allowing production of both proteins from a single open reading frame. Immunofluorescence and Western blot analysis results demonstrated that both VP1 proteins were robustly expressed in rC-KCE-2VP1-infected chicken embryo fibroblasts. Ducks that received a single dose of rC-KCE-2VP1 showed potent humoral and cellular immune responses and were completely protected against challenges of both pathogenic DHAV-1 and DHAV-3 strains. The protection was rapid, achieved as early as 3 days after vaccination. Moreover, viral replication was fully blocked in vaccinated ducks as early as 1 week post-vaccination. These results demonstrated, for the first time, that recombinant rC-KCE-2VP1 is potential fast-acting vaccine against DHAV-1 and DHAV-3. PMID:27777571

[Indirect ELISA for simultaneous detection of antibodies against duck hepatitis A type 1 and 3 viruses].

PubMed

Zhang, Yuyao; Ma, Xiuli; Huang, Bing; Li, Yufeng; Yu, Kexiang; Li, Jianliang; Liu, Cunxia; Han, Hongyu; Cui, Yanshun

2015-04-04

To simultaneously detect antibodies against Duck hepatitis A type 1 (DHAV-1) and type 3 (DHAV-3) viruses, we developed an indirect enzyme-linked immunosobent assay (ELISA) with bacterially expressed recombinant viral protein as antigen in Escherichia coli. We amplified the full-length VP3 gene of DHAV-1 and the full-length VP1 gene of DHAV-3 through reverse transcription-polymerase chain reaction (RT-PCR) and then cloned them into pET-32a expression vector, designated as pET-1VP3-3VP1. The fusion protein DHAV-1VP3-3VP1 expressed correctly and was subsequently used to develop an indirect ELISA assay. DHAV-1VP3-3VP1 fusion protein expressed in BL21 (DE3) cells following induction by Isopropyl-beta-D-1-thiogalactopyranoside (IPTG). The expressed protein was very antigenic and reactive to virus-specific antibodies in western blot assay. The optimal working concentration for coating antigen was 1.0 microg per well and the working concentration of serum samples was 1:200 dilution and the cut-off value that distinguished the positive from negative serum samples was OD650 > OR = 0.38. The ELISA method based on the prokaryotic expression of VP3 (DHAV-1) and VP1 proteins (DHAV-3) can be used effectively for the clinical detection antibodies against DHAV-1 and DHAV-3.

Thin Crust and High Crustal Vp/Vs beneath the Central Armenia Plateau of the Lesser Caucasus

NASA Astrophysics Data System (ADS)

Tseng, T. L.; Lin, C. M.; Huang, B. S.; Karakhanyan, A.

2017-12-01

Armenia volcanic highland is part of the Lesser Caucasus directly connected with the East Anatolian Plateau to the west and Iranian Plateau to the east. Abundant Quaternary volcanoes in Armenia are the youngest among those associated with post-collision of Arabia-Eurasian since Miocene ( 11 Ma). In this study, teleseismic receiver functions were analyzed from a temporary array to constrain the crustal structures under Armenia and the vicinity. The results show that the Moho depth is shallowest beneath central Armenia where the estimated crustal thickness is 32 km with high averaged crustal Vp/Vs of 1.8-2.0 using H-κ technique. The high crustal Vp/Vs is distributed in a wider area but thin crust is confined more locally around stratovolcano Aragats, whose last eruption was about 0.5 Ma. High crustal Vp/Vs value approaching to 2.1 is found near East of volcano Ghegam complex and NW of volcano Ararat with last dated ages of 0.5 and <0.1 Ma, respectively. Such high Vp/Vs (2.0) cannot be explained without high mafic content and the presence of partial melt in the crust. The 1-D velocity models inverted demonstrate that the partial melt is more likely in the low-velocity layer of the lower crust. To support the unusually thin crust in central Armenia, it requires additional thermal buoyancy in the uppermost mantle which is consistent with regionally low Pn velocity found in previous studies. We propose that the volcanism here is facilitated by the stretches of lithosphere.

The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications.

PubMed

Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan

2013-11-02

Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the other neuronal and neuroendocrine functions exerted by the proteins encoded by these gene families. In pouched lamprey all five visual opsin genes have previously been identified, suggesting that lampreys diverged from the jawed vertebrates after 2R.

Ebolavirus VP35 is a multifunctional virulence factor

PubMed Central

Leung, Daisy W; Prins, Kathleen C; Basler, Christopher F

2010-01-01

Ebola virus (EBOV) is a member of the filoviridae family that causes severe hemorrhagic fever during sporadic outbreaks, and no approved treatments are currently available. The multifunctional EBOV VP35 protein facilitates immune evasion by antagonizing antiviral signaling pathways and is important for viral RNA synthesis. In order to elucidate regulatory mechanisms and to develop countermeasures, we recently solved the structures of the Zaire and Reston EBOV VP35 interferon inhibitory domain (IID) in the free form and of the Zaire EBOV VP35 IID bound to dsRNA. Together with biochemical, cell biological and virological studies, our structural work revealed that distinct regions within EBOV VP35 IID contribute to virulence through host immune evasion and viral RNA synthesis. Here we summarize our recent structural and functional studies and discuss the potential of multifunctional Ebola VP35 as a therapeutic target. PMID:21178490

Ebola virus VP24 interacts with NP to facilitate nucleocapsid assembly and genome packaging.

PubMed

Banadyga, Logan; Hoenen, Thomas; Ambroggio, Xavier; Dunham, Eric; Groseth, Allison; Ebihara, Hideki

2017-08-09

Ebola virus causes devastating hemorrhagic fever outbreaks for which no approved therapeutic exists. The viral nucleocapsid, which is minimally composed of the proteins NP, VP35, and VP24, represents an attractive target for drug development; however, the molecular determinants that govern the interactions and functions of these three proteins are still unknown. Through a series of mutational analyses, in combination with biochemical and bioinformatics approaches, we identified a region on VP24 that was critical for its interaction with NP. Importantly, we demonstrated that the interaction between VP24 and NP was required for both nucleocapsid assembly and genome packaging. Not only does this study underscore the critical role that these proteins play in the viral replication cycle, but it also identifies a key interaction interface on VP24 that may serve as a novel target for antiviral therapeutic intervention.

Interaction of the Mouse Polyomavirus Capsid Proteins with Importins Is Required for Efficient Import of Viral DNA into the Cell Nucleus.

PubMed

Soldatova, Irina; Prilepskaja, Terezie; Abrahamyan, Levon; Forstová, Jitka; Huérfano, Sandra

2018-03-31

The mechanism used by mouse polyomavirus (MPyV) overcomes the crowded cytosol to reach the nucleus has not been fully elucidated. Here, we investigated the involvement of importin α/β1 mediated transport in the delivery of MPyV genomes into the nucleus. Interactions of the virus with importin β1 were studied by co-immunoprecipitation and proximity ligation assay. For infectivity and nucleus delivery assays, the virus and its capsid proteins mutated in the nuclear localization signals (NLSs) were prepared and produced. We found that at early times post infection, virions bound importin β1 in a time dependent manner with a peak of interactions at 6 h post infection. Mutation analysis revealed that only when the NLSs of both VP1 and VP2/3 were disrupted, virus did not bind efficiently to importin β1 and its infectivity remarkably decreased (by 80%). Nuclear targeting of capsid proteins was improved when VP1 and VP2 were co-expressed. VP1 and VP2 were effectively delivered into the nucleus, even when one of the NLS, either VP1 or VP2, was disrupted. Altogether, our results showed that MPyV virions can use VP1 and/or VP2/VP3 NLSs in concert or individually to bind importins to deliver their genomes into the cell nucleus.

Genotyping of enteroviruses isolated in Kenya from pediatric patients using partial VP1 region.

PubMed

Opanda, Silvanos M; Wamunyokoli, Fred; Khamadi, Samoel; Coldren, Rodney; Bulimo, Wallace D

2016-01-01

Enteroviruses (EV) are responsible for a wide range of clinical diseases in humans. Though studied broadly in several regions of the world, the genetic diversity of human enteroviruses (HEV) circulating in the sub-Saharan Africa remains under-documented. In the current study, we molecularly typed 61 HEV strains isolated in Kenya between 2008 and 2011 targeting the 3'-end of the VP1 gene. Viral RNA was extracted from the archived isolates and part of the VP1 gene amplified by RT-PCR, followed by sequence analysis. Twenty-two different EV types were detected. Majority (72.0 %) of these belonged to Enterovirus B species followed by Enterovirus D (21.3 %) and Enterovirus A (6.5 %). The most frequently detected types were Enterovirus-D68 (EV-D68), followed by Coxsackievirus B2 (CV-B2), CV-B1, CV-B4 and CV-B3. Phylogenetic analyses of these viruses revealed that Kenyan CV-B1 isolates were segregated among sequences of global CV-B1 strains. Conversely, the Kenyan CV-B2, CV-B3, CV-B4 and EV-D68 strains generally grouped together with those detected from other countries. Notably, the Kenyan EV-D68 strains largely clustered with sequences of global strains obtained between 2008 and 2010 than those circulating in recent years. Overall, our results indicate that HEV strains belonging to Enterovirus D and Enterovirus B species pre-dominantly circulated and played a significant role in pediatric respiratory infection in Kenya, during the study period. The Kenyan CV-B1 strains were genetically divergent from those circulating in other countries. Phylogenetic clustering of Kenyan EV-D68 strains with sequences of global strains circulating between 2008 and 2010 than those obtained in recent years suggests a high genomic variability associated with the surface protein encoding VP1 gene in these enteroviruses.

Feasibility and accuracy of dual-layer spectral detector computed tomography for quantification of gadolinium: a phantom study.

PubMed

van Hamersvelt, Robbert W; Willemink, Martin J; de Jong, Pim A; Milles, Julien; Vlassenbroek, Alain; Schilham, Arnold M R; Leiner, Tim

2017-09-01

The aim of this study was to evaluate the feasibility and accuracy of dual-layer spectral detector CT (SDCT) for the quantification of clinically encountered gadolinium concentrations. The cardiac chamber of an anthropomorphic thoracic phantom was equipped with 14 tubular inserts containing different gadolinium concentrations, ranging from 0 to 26.3 mg/mL (0.0, 0.1, 0.2, 0.4, 0.5, 1.0, 2.0, 3.0, 4.0, 5.1, 10.6, 15.7, 20.7 and 26.3 mg/mL). Images were acquired using a novel 64-detector row SDCT system at 120 and 140 kVp. Acquisitions were repeated five times to assess reproducibility. Regions of interest (ROIs) were drawn on three slices per insert. A spectral plot was extracted for every ROI and mean attenuation profiles were fitted to known attenuation profiles of water and pure gadolinium using in-house-developed software to calculate gadolinium concentrations. At both 120 and 140 kVp, excellent correlations between scan repetitions and true and measured gadolinium concentrations were found (R > 0.99, P < 0.001; ICCs > 0.99, CI 0.99-1.00). Relative mean measurement errors stayed below 10% down to 2.0 mg/mL true gadolinium concentration at 120 kVp and below 5% down to 1.0 mg/mL true gadolinium concentration at 140 kVp. SDCT allows for accurate quantification of gadolinium at both 120 and 140 kVp. Lowest measurement errors were found for 140 kVp acquisitions. • Gadolinium quantification may be useful in patients with contraindication to iodine. • Dual-layer spectral detector CT allows for overall accurate quantification of gadolinium. • Interscan variability of gadolinium quantification using SDCT material decomposition is excellent.

Peptides from the scorpion Vaejovis punctatus with broad antimicrobial activity.

PubMed

Ramírez-Carreto, Santos; Jiménez-Vargas, Juana María; Rivas-Santiago, Bruno; Corzo, Gerardo; Possani, Lourival D; Becerril, Baltazar; Ortiz, Ernesto

2015-11-01

The antimicrobial potential of two new non-disulfide bound peptides, named VpAmp1.0 (LPFFLLSLIPSAISAIKKI, amidated) and VpAmp2.0 (FWGFLGKLAMKAVPSLIGGNKSSSK) is here reported. These are 19- and 25-aminoacid-long peptides with +2 and +4 net charges, respectively. Their sequences correspond to the predicted mature regions from longer precursors, putatively encoded by cDNAs derived from the venom glands of the Mexican scorpion Vaejovis punctatus. Both peptides were chemically synthesized and assayed against a variety of microorganisms, including pathogenic strains from clinical isolates and strains resistant to conventional antibiotics. Two shorter variants, named VpAmp1.1 (FFLLSLIPSAISAIKKI, amidated) and VpAmp2.1 (FWGFLGKLAMKAVPSLIGGNKK), were also synthesized and tested. The antimicrobial assays revealed that the four synthetic peptides effectively inhibit the growth of both Gram-positive (Staphylococcus aureus and Streptococcus agalactiaea) and Gram-negative (Escherichia coli and Pseudomonas aeruginosa) bacteria, with MICs in the range of 2.5-24.0 μM; yeasts (Candida albicans and Candida glabrata) with MICs of 3.1-50.0 μM; and two clinically isolated strains of Mycobacterium tuberculosis-including a multi-drug resistant one- with MICs in the range of 4.8-30.5 μM. A comparison between the activities of the original peptides and their derivatives gives insight into the structural/functional role of their distinctive residues. Copyright © 2015 Elsevier Inc. All rights reserved.

Molecular Evolution of Enterovirus 68 Detected in the Philippines

PubMed Central

Imamura, Tadatsugu; Suzuki, Akira; Lupisan, Socorro; Okamoto, Michiko; Aniceto, Rapunzel; Egos, Rutchie J.; Daya, Edgardo E.; Tamaki, Raita; Saito, Mariko; Fuji, Naoko; Roy, Chandra Nath; Opinion, Jaime M.; Santo, Arlene V.; Macalalad, Noel G.; Tandoc, Amado; Sombrero, Lydia; Olveda, Remigio; Oshitani, Hitoshi

2013-01-01

Background Detection of Enterovirus 68 (EV68) has recently been increased. However, underlying evolutionary mechanism of this increasing trend is not fully understood. Methods Nasopharyngeal swabs were collected from 5,240 patients with acute respiratory infections in the Philippines from June 2009 to December 2011. EV68 was detected by polymerase chain reaction (PCR) targeting for 5′ untranslated region (5′UTR), viral protein 1 (VP1), and VP4/VP2. Phylogenetic trees were generated using the obtained sequences. Results Of the 5,240 tested samples, 12 EV68 positive cases were detected between August and December in 2011 (detection rate, 0.23%). The detection rate was higher among inpatients than outpatients (p<0.0001). Among VP1 sequences detected from 7 patients in 2011, 5 in lineage 2 were diverged from those detected in the Philippines in 2008, however, 2 in lineage 3 were not diverged from strains detected in the Philippines in 2008 but closely associated with strains detected in the United States. Combined with our previous report, EV68 occurrences were observed twice in the Philippines within the last four years. Conclusions EV68 detections might be occurring in cyclic patterns, and viruses might have been maintained in the community while some strains might have been newly introduced. PMID:24073203

Crystal Structure of the Marburg Virus Nucleoprotein Core Domain Chaperoned by a VP35 Peptide Reveals a Conserved Drug Target for Filovirus.

PubMed

Zhu, Tengfei; Song, Hao; Peng, Ruchao; Shi, Yi; Qi, Jianxun; Gao, George F

2017-09-15

Filovirus nucleoprotein (NP), viral protein 35 (VP35), and polymerase L are essential for viral replication and nucleocapsid formation. Here, we identify a 28-residue peptide (NP binding peptide [NPBP]) from Marburg virus (MARV) VP35 through sequence alignment with previously identified Ebola virus (EBOV) NPBP, which bound to the core region (residues 18 to 344) of the N-terminal portion of MARV NP with high affinity. The crystal structure of the MARV NP core/NPBP complex at a resolution of 2.6 Å revealed that NPBP binds to the C-terminal region of the NP core via electrostatic and nonpolar interactions. Further structural analysis revealed that the MARV and EBOV NP cores hold a conserved binding pocket for NPBP, and this pocket could serve as a promising target for the design of universal drugs against filovirus infection. In addition, cross-binding assays confirmed that the NP core of MARV or EBOV can bind the NPBP from the other virus, although with moderately reduced binding affinities that result from termini that are distinct between the MARV and EBOV NPBPs. IMPORTANCE Historically, Marburg virus (MARV) has caused severe disease with up to 90% lethality. Among the viral proteins produced by MARV, NP and VP35 are both multifunctional proteins that are essential for viral replication. In its relative, Ebola virus (EBOV), an N-terminal peptide from VP35 binds to the NP N-terminal region with high affinity. Whether this is a common mechanism among filoviruses is an unsolved question. Here, we present the crystal structure of a complex that consists of the core domain of MARV NP and the NPBP peptide from VP35. As we compared MARV NPBP with EBOV NPBP, several different features at the termini were identified. Although these differences reduce the affinity of the NP core for NPBPs across genera, a conserved pocket in the C-terminal region of the NP core makes cross-species binding possible. Our results expand our knowledge of filovirus NP-VP35 interactions and provide more details for therapeutic intervention. Copyright © 2017 American Society for Microbiology.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* sialic acid-binding domain of porcine rotavirus strain OSU

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui

2007-02-01

Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less

Seismic tomography of the area of the 2010 Beni-Ilmane earthquake sequence, north-central Algeria.

PubMed

Abacha, Issam; Koulakov, Ivan; Semmane, Fethi; Yelles-Chaouche, Abd Karim

2014-01-01

The region of Beni-Ilmane (District of M'sila, north-central Algeria) was the site of an earthquake sequence that started on 14 May 2010. This sequence, which lasted several months, was triggered by conjugate E-W reverse and N-S dextral faulting. To image the crustal structure of these active faults, we used a set of 1406 well located aftershocks events and applied the local tomography software (LOTOS) algorithm, which includes absolute source location, optimization of the initial 1D velocity model, and iterative tomographic inversion for 3D seismic P- and S-wave velocities (and the Vp/Vs ratio), and source parameters. The patterns of P-wave low-velocity anomalies correspond to the alignments of faults determined from geological evidence, and the P-wave high-velocity anomalies may represent rigid blocks of the upper crust that are not deformed by regional stresses. The S-wave low-velocity anomalies coincide with the aftershock area, where relatively high values of Vp/Vs ratio (1.78) are observed compared with values in the surrounding areas (1.62-1.66). These high values may indicate high fluid contents in the aftershock area. These fluids could have been released from deeper levels by fault movements during earthquakes and migrated rapidly upwards. This hypothesis is supported by vertical sections across the study area show that the major Vp/Vs anomalies are located above the seismicity clusters.

Abscisic acid and stress signals induce Viviparous1 expression in seed and vegetative tissues of maize.

PubMed

Cao, Xueyuan; Costa, Liliana M; Biderre-Petit, Corinne; Kbhaya, Bouchab; Dey, Nrisingha; Perez, Pascual; McCarty, Donald R; Gutierrez-Marcos, Jose F; Becraft, Philip W

2007-02-01

Viviparous1 (Vp1) encodes a B3 domain-containing transcription factor that is a key regulator of seed maturation in maize (Zea mays). However, the mechanisms of Vp1 regulation are not well understood. To examine physiological factors that may regulate Vp1 expression, transcript levels were monitored in maturing embryos placed in culture under different conditions. Expression of Vp1 decreased after culture in hormone-free medium, but was induced by salinity or osmotic stress. Application of exogenous abscisic acid (ABA) also induced transcript levels within 1 h in a dose-dependent manner. The Vp1 promoter fused to beta-glucuronidase or green fluorescent protein reproduced the endogenous Vp1 expression patterns in transgenic maize plants and also revealed previously unknown expression domains of Vp1. The Vp1 promoter is active in the embryo and aleurone cells of developing seeds and, upon drought stress, was also found in phloem cells of vegetative tissues, including cobs, leaves, and stems. Sequence analysis of the Vp1 promoter identified a potential ABA-responsive complex, consisting of an ACGT-containing ABA response element (ABRE) and a coupling element 1-like motif. Electrophoretic mobility shift assay confirmed that the ABRE and putative coupling element 1 components specifically bound proteins in embryo nuclear protein extracts. Treatment of embryos in hormone-free Murashige and Skoog medium blocked the ABRE-protein interaction, whereas exogenous ABA or mannitol treatment restored this interaction. Our data support a model for a VP1-dependent positive feedback mechanism regulating Vp1 expression during seed maturation.

Interactions between Multiple Genetic Determinants in the 5′ UTR and VP1 Capsid Control Pathogenesis of Chronic Post-Viral Myopathy caused by Coxsackievirus B1

PubMed Central

Sandager, Maribeth M.; Nugent, Jaime L.; Schulz, Wade L.; Messner, Ronald P.; Tam, Patricia E.

2008-01-01

Mice infected with coxsackievirus B1 Tucson (CVB1T) develop chronic, post-viral myopathy (PVM) with clinical manifestations of hind limb muscle weakness and myositis. The objective of the current study was to establish the genetic basis of myopathogenicity in CVB1T. Using a reverse genetics approach, full attenuation of PVM could only be achieved by simultaneously mutating four sites located at C706U in the 5′ untranslated region (5′ UTR) and at Y87F, V136A, and T276A in the VP1 capsid. Engineering these four myopathic determinants into an amyopathic CVB1T variant restored the ability to cause PVM. Moreover, these same four determinants controlled PVM expression in a second strain of mice, indicating that the underlying mechanism is operational in mice of different genetic backgrounds. Modeling studies predict that C706U alters both local and long-range pairing in the 5′ UTR, and that VP1 determinants are located on the capsid surface. However, these differences did not affect viral titers, temperature stability, pH stability, or the antibody response to virus. These studies demonstrate that PVM develops from a complex interplay between viral determinants in the 5′ UTR and VP1 capsid and have uncovered intriguing similarities between genetic determinants that cause PVM and those involved in pathogenesis of other enteroviruses. PMID:18029287

Integrated Warfighter Biodefense Program (IWBP)

DTIC Science & Technology

2011-08-01

Distribution. Sincerely, Frank T. Abbott VP of Administration & Finance fta @quantumleap.us cc: Dr. Ganesh Vaidyanathan, Project Manager, Code 34...goals of IWBP. Areas of potential application include health care administration, clinical data analysis and health care research applications

Constraining the Dynamic Rupture Properties with Moment Tensor Derived Vp/Vs Ratios.

NASA Astrophysics Data System (ADS)

Smith-Boughner, L.; Baig, A. M.; Urbancic, T.; Viegas, G. F.

2014-12-01

The goal of hydraulic fracturing is to increase the permeability of rocks to extract hydrocarbons from "tight" formations. This process stimulates fluid-driven fractures which induce microseismic events. Successfully treating the formations, stimulating large volumes of the reservoir, depends on targeting parts of the formation with more "brittleness", a property which is frequently characterized from the mechanical properties of the rock. Typically, these properties are constrained using well-logs, vertical seismic profiles and 3-D seismic surveys. Such tools provide a static view of the reservoir on very large or very small scales. While lithology controls the average rock strength within a unit, the content (gas or fluid filled), the shape of the pore space and the concentration of micro-fractures alters the mechanical properties of the reservoir. Seismic moment tensor inversion of the events generated during these stimulations reveals that they are significantly non-double-couple, and are described by a tensile angle and a Poisson's ratio (or, equivalently, ratio of shear to compressional velocities, Vp/Vs) of the rock-fracture system. Following Vavryčuk (2011), the mechanical properties of the reservoir (i.e. Vp/Vs ratio) are estimated as the hydraulic fracture progresses from an extensive catalog of microseismic events spanning magnitudes of -1.5 to 0.8 in the Horn-River Basin, Canada. Studying several fracture stages in the reservoir reveals temporal and spatial variations in the rock strength within a unit as hydraulic fracturing proceeds. Initially, the estimated values of Vp/Vs are quite close to those determined from 3-D seismic surveys. As the stage progresses, previously fractured regions have lower Vp/Vs values. At the onset of maximum treating pressure, regions have anomalously high Vp/Vs values, which could reflect short-term local concentrations of high pore pressures or other interactions of the treatment with the formation. The relationship between source parameters and variations in Vp/Vs are also examined. This technique has the potential to provide a unique and dynamic view of variations in the reservoir both spatially and temporally.

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Detection of Rare G3P[19] Porcine Rotavirus Strains in Chiang Mai, Thailand, Provides Evidence for Origin of the VP4 Genes of Mc323 and Mc345 Human Rotaviruses▿

PubMed Central

Maneekarn, Niwat; Khamrin, Pattara; Chan-it, Wisoot; Peerakome, Supatra; Sukchai, Sujin; Pringprao, Kidsadagon; Ushijima, Hiroshi

2006-01-01

Among 175 fecal specimens collected from diarrheic piglets during a surveillance of porcine rotavirus (PoRV) strains in Chiang Mai, Thailand, 39 (22.3%) were positive for group A rotaviruses. Of these, 33.3% (13 of 39) belonged to G3P[19], which was a rare P genotype seldom reported. Interestingly, their VP4 nucleotide sequences were most closely related to human P[19] strains (Mc323 and Mc345) isolated in 1989 from the same geographical area where these PoRV strains were isolated. These P[19] PoRV strains were also closely related to another human P[19] strain (RMC321), isolated from India in 1990. The VP4 sequence identities with human P[19] were 95.4% to 97.4%, while those to a porcine P[19] strain (4F) were only 87.6 to 89.1%. Phylogenetic analysis of the VP4 gene revealed that PoRV P[19] strains clustered with human P[19] strains in a monophyletic branch separated from strain 4F. Analysis of the VP7 gene confirmed that these strains belonged to the G3 genotype and shared 97.7% to 98.3% nucleotide identities with other G3 PoRV strains circulating in the regions. This close genetic relationship was also reflected in the phylogenetic analysis of their VP7 genes. Altogether, the findings provided peculiar evidence that supported the porcine origin of VP4 genes of Mc323 and Mc345 human rotaviruses. PMID:16988014

Nuclear MxA proteins form a complex with influenza virus NP and inhibit the transcription of the engineered influenza virus genome

PubMed Central

Turan, Kadir; Mibayashi, Masaki; Sugiyama, Kenji; Saito, Shoko; Numajiri, Akiko; Nagata, Kyosuke

2004-01-01

Mx proteins belong to the dynamin superfamily of high molecular weight GTPases and interfere with multiplication of a wide variety of viruses. Earlier studies show that nuclear mouse Mx1 and human MxA designed to be localized in the nucleus inhibit the transcription step of the influenza virus genome. Here we set a transient influenza virus transcription system using luciferase as a reporter gene and cells expressing the three RNA polymerase subunits, PB1, PB2 and PA, and NP. We used this reporter assay system and nuclear-localized MxA proteins to get clues for elucidating the anti-influenza virus activity of MxA. Nuclear-localized VP16-MxA and MxA-TAg NLS strongly interfered with the influenza virus transcription. Over-expression of PB2 led to a slight resumption of the transcription inhibition by nuclear MxA, whereas over-expression of PB1 and PA did not affect the MxA activity. Of interest is that the inhibitory activity of the nuclear MxA was markedly neutralized by over-expression of NP. An NP devoid of its C-terminal region, but containing the N-terminal RNA binding domain, also neutralized the VP16-MxA activity in a dose-dependent manner, whereas an NP lacking the N-terminal region did not affect the VP16-MxA activity. Further, not only VP16-MxA but also the wild-type MxA was found to interact with NP in influenza virus-infected cells. This indicates that the nuclear MxA suppresses the influenza virus transcription by interacting with not only PB2 but also NP. PMID:14752052

Prevalence and genotypic characterization of human parvovirus B19 in children with hemato-oncological disorders in North India.

PubMed

Jain, Parul; Jain, Amita; Prakash, Shantanu; Khan, Danish N; Singh, Desh D; Kumar, Archana; Moulik, Nirmalya R; Chandra, Tulika

2015-02-01

Human parvovirus B19 (B19V) has been associated with chronic anemia in immuno-compromised patients. In the present study, the prevalence and genotype distribution of B19V in children from North India, suffering with hemato-oncological disorders is reported. Children with aplastic anemia/leukemia/chronic hematological disorders, and healthy blood donors were enrolled in the study. Blood samples from cases and blood donors were analyzed for anti-B19V IgM and anti-B19V IgG antibodies by ELISA and for B19V-DNA by PCR. B19V-DNA positive samples were studied further for determination of viral load in samples and for B19V-DNA sequence (VP1/VP2 overlapping region) analysis. Total 238 cases (103 leukemia, 77 aplastic anemia and 58 chronic hematological disorders) and 350 blood donors were enrolled in the study. Anti-B19V IgM was positive in 16 (6.7%) cases, B19V-DNA was detected in 13 (5.5%) cases and anti-B19V IgG was positive in 127 (53.4%) cases. Total 223 (63.5%) blood donors were positive for anti-B19V IgG, however, anti-B19V IgM and B19V-DNA was not detected in any blood donor. The prevalence of anti-B19V IgG was significantly higher in children > 10 years of age. Viral load of B19V decreased with appearance of specific antibodies. Phylogenetic analysis of the VP1/VP2 overlapping region revealed that genotype 1 predominated in these patients (11/13, 84.6%), followed by genotype 3 (2/13, 15.4%). No genotype 2 was detected. All the genotype 1strains were sub-typed as 1a, except four strains, which matched neither 1a nor 1b and formed a separate cluster. Both the genotype 3 strains were sub-typed as 3b. © 2014 Wiley Periodicals, Inc.

The pH Stability of Foot-and-Mouth Disease Virus Particles Is Modulated by Residues Located at the Pentameric Interface and in the N Terminus of VP1.

PubMed

Caridi, Flavia; Vázquez-Calvo, Angela; Sobrino, Francisco; Martín-Acebes, Miguel A

2015-05-01

The picornavirus foot-and-mouth disease virus (FMDV) is the etiological agent of a highly contagious disease that affects important livestock species. The FMDV capsid is highly acid labile, and viral particles lose infectivity due to their disassembly at pH values slightly below neutrality. This acid sensitivity is related to the mechanism of viral uncoating and genome penetration from endosomes. In this study, we have analyzed the molecular basis of FMDV acid-induced disassembly by isolating and characterizing a panel of novel FMDV mutants differing in acid sensitivity. Amino acid replacements altering virion stability were preferentially distributed in two different regions of the capsid: the N terminus of VP1 and the pentameric interface. Even more, the acid labile phenotype induced by a mutation located at the pentameric interface in VP3 could be compensated by introduction of an amino acid substitution in the N terminus of VP1. These results indicate that the acid sensitivity of FMDV can be considered a multifactorial trait and that virion stability is the fine-tuned product of the interaction between residues from different capsid proteins, in particular those located within the N terminus of VP1 or close to the pentameric interface. The viral capsid protects the viral genome from environmental factors and contributes to virus dissemination and infection. Thus, understanding of the molecular mechanisms that modulate capsid stability is of interest for the basic knowledge of the biology of viruses and as a tool to improve the stability of conventional vaccines based on inactivated virions or empty capsids. Using foot-and-mouth disease virus (FMDV), which displays a capsid with extreme acid sensitivity, we have performed a genetic study to identify the molecular determinants involved in capsid stability. A panel of FMDV mutants with differential sensitivity to acidic pH was generated and characterized, and the results showed that two different regions of FMDV capsid contribute to modulating viral particle stability. These results provide new insights into the molecular mechanisms of acid-mediated FMDV uncoating. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Folding units in calcium vector protein of amphioxus: Structural and functional properties of its amino- and carboxy-terminal halves.

PubMed

Baladi, S; Tsvetkov, P O; Petrova, T V; Takagi, T; Sakamoto, H; Lobachov, V M; Makarov, A A; Cox, J A

2001-04-01

Muscle of amphioxus contains large amounts of a four EF-hand Ca2+-binding protein, CaVP, and its target, CaVPT. To study the domain structure of CaVP and assess the structurally important determinants for its interaction with CaVPT, we expressed CaVP and its amino (N-CaVP) and carboxy-terminal halves (C-CaVP). The interactive properties of recombinant and wild-type CaVP are very similar, despite three post-translational modifications in the wild-type protein. N-CaVP does not bind Ca2+, shows a well-formed hydrophobic core, and melts at 44 degrees C. C-CaVP binds two Ca2+ with intrinsic dissociation constants of 0.22 and 140 microM (i.e., very similar to the entire CaVP). The metal-free domain in CaVP and C-CaVP shows no distinct melting transition, whereas its 1Ca2+ and 2Ca2+) forms melt in the 111 degrees -123 degrees C range, suggesting that C-CaVP and the carboxy- domain of CaVP are natively unfolded in the metal-free state and progressively gain structure upon binding of 1Ca2+ and 2Ca2+. Thermal denaturation studies provide evidence for interdomain interaction: the apo, 1Ca2+ and 2Ca2+ states of the carboxy-domain destabilize to different degrees the amino-domain. Only C-CaVP forms a Ca2+-dependent 1:1 complex with CaVPT. Our results suggest that the carboxy-terminal domain of CaVP interacts with CaVPT and that the amino-terminal lobe modulates this interaction.

Folding units in calcium vector protein of amphioxus: Structural and functional properties of its amino- and carboxy-terminal halves

PubMed Central

Baladi, Sibyl; Tsvetkov, Philipp O.; Petrova, Tatiana V.; Takagi, Takashi; Sakamoto, Hiroshi; Lobachov, Vladimir M.; Makarov, Alexander A.; Cox, Jos A.

2001-01-01

Muscle of amphioxus contains large amounts of a four EF-hand Ca2+-binding protein, CaVP, and its target, CaVPT. To study the domain structure of CaVP and assess the structurally important determinants for its interaction with CaVPT, we expressed CaVP and its amino (N-CaVP) and carboxy-terminal halves (C-CaVP). The interactive properties of recombinant and wild-type CaVP are very similar, despite three post-translational modifications in the wild-type protein. N-CaVP does not bind Ca2+, shows a well-formed hydrophobic core, and melts at 44°C. C-CaVP binds two Ca2+ with intrinsic dissociation constants of 0.22 and 140 μM (i.e., very similar to the entire CaVP). The metal-free domain in CaVP and C-CaVP shows no distinct melting transition, whereas its 1Ca2+ and 2Ca2+ forms melt in the 111°–123°C range, suggesting that C-CaVP and the carboxy- domain of CaVP are natively unfolded in the metal-free state and progressively gain structure upon binding of 1Ca2+ and 2Ca2+. Thermal denaturation studies provide evidence for interdomain interaction: the apo, 1Ca2+ and 2Ca2+ states of the carboxy-domain destabilize to different degrees the amino-domain. Only C-CaVP forms a Ca2+-dependent 1:1 complex with CaVPT. Our results suggest that the carboxy-terminal domain of CaVP interacts with CaVPT and that the amino-terminal lobe modulates this interaction. PMID:11274468

Recombinant VP1 protein as a potential marker for the diagnosis of acute hepatitis A virus infection.

PubMed

da Silva Junior, Haroldo Cid; da Silva, Edimilson Domingos; Lewis-Ximenez de Souza Rodrigues, Lia Laura; Medeiros, Marco Alberto

2017-07-01

Since hepatitis A virus (HAV) production is time-consuming and expensive, the use of recombinant proteins may represent an alternative source of antigens for diagnostic purposes. The present study aimed to express, purify and evaluate the potential of recombinant VP1 protein (rVP1) as a marker for the diagnosis of acute HAV infection. The rVP1 was expressed and purified successfully from Escherichia coli. The purified rVP1 was used to establish an in-house enzyme-linked immunosorbent assay (ELISA-rVP1) for detection of IgM antibodies in sera from HAV-positive patients. For a cut-off point of 0.351, the sensitivity and specificity of ELISA-rVP1 were 100.0% and 95.0%, respectively. These results indicate that rVP1 may be a useful antigen for detection of IgM antibodies against HAV. Copyright © 2017 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reynoso, F; Cho, S

Purpose: To develop and validate a Monte Carlo (MC) model of a Phillips RT-250 orthovoltage unit to test various beam spectrum modulation strategies for in vitro/vivo studies. A model of this type would enable the production of unconventional beams from a typical orthovoltage unit for novel therapeutic applications such as gold nanoparticle-aided radiotherapy. Methods: The MCNP5 code system was used to create a MC model of the head of RT-250 and a 30 × 30 × 30 cm{sup 3} water phantom. For the x-ray machine head, the current model includes the vacuum region, beryllium window, collimators, inherent filters and exteriormore » steel housing. For increased computational efficiency, the primary x-ray spectrum from the target was calculated from a well-validated analytical software package. Calculated percentage-depth-dose (PDD) values and photon spectra were validated against experimental data from film and Compton-scatter spectrum measurements. Results: The model was validated for three common settings of the machine namely, 250 kVp (0.25 mm Cu), 125 kVp (2 mm Al), and 75 kVp (2 mm Al). The MC results for the PDD curves were compared with film measurements and showed good agreement for all depths with a maximum difference of 4 % around dmax and under 2.5 % for all other depths. The primary photon spectra were also measured and compared with the MC results showing reasonable agreement between the two, validating the input spectra and the final spectra as predicted by the current MC model. Conclusion: The current MC model accurately predicted the dosimetric and spectral characteristics of each beam from the RT-250 orthovoltage unit, demonstrating its applicability and reliability for beam spectrum modulation tasks. It accomplished this without the need to model the bremsstrahlung xray production from the target, while significantly improved on computational efficiency by at least two orders of magnitude. Supported by DOD/PCRP grant W81XWH-12-1-0198.« less

Complete Genome Sequence of the Circulatory Foot-and-Mouth Disease Virus Serotype Asia1 in Bangladesh

PubMed Central

Ali, M. Rahmat; Alam, A. S. M. Rubayet Ul; Amin, M. Al; Ullah, Huzzat; Siddique, Mohammad Anwar; Momtaz, Samina; Sultana, Munawar

2017-01-01

ABSTRACT The complete genome sequence of foot-and-mouth disease virus (FMDV) serotype Asia1 isolated from Bangladesh is reported here. Genome analysis revealed amino acid substitutions in the VP1 antigenic region and deletions in both the 5′ and 3′ untranslated regions (UTRs) compared to the genome of the existing vaccine strain (GenBank accession no. AY304994). PMID:29074654

Genetic Analysis of Hepatitis A Virus Strains That Induced Epidemics in Korea during 2007–2009

PubMed Central

Lee, Hyeokjin; Jeong, Hyesook; Yun, Heasun; Kim, Kisang; Kim, Jong-Hyun; Yang, Jai Myung

2012-01-01

Hepatitis A virus is one of the most prominent causes of fecally transmitted acute hepatitis worldwide. In order to characterize the viral agents causing an outbreak in Korea (comprising North and South Korea) from June 2007 to May 2009, we collected specimens and performed genotyping of the VP1/P2A and VP3/VP1 regions of hepatitis A virus. We then used a multiple-alignment algorithm to compare the nucleotide sequences of the 2 regions with those of reference strains. Hepatitis A virus antibodies were detected in 64 patients from 5 reported outbreaks (North Korea, June 2007 [n = 11]; Jeonnam, April 2008 [n = 15]; Daegu, May 2008 [n = 13]; Seoul, May 2009 [n = 22]; and Incheon, May 2009 [n = 3]). We found 100% homology between strains isolated from the Kaesong Industrial Region and Jeonnam. While those strains were classified as genotype IA strains, strains from Seoul and Incheon were identified as genotype IIIA strains and showed 98.9 to 100% homology. Genotype IIIA was also dominant in Daegu, where strains were 95.7 to 100% homologous. All hepatitis A virus strains isolated from the Kaesong Industrial Region, Jeonnam, Seoul, and Incheon belonged to a single cluster. However, strains from Daegu could be classified into 2 clusters, suggesting that the outbreak had multiple sources. This study indicates that hepatitis A virus strains of 2 different genotypes are currently cocirculating in Korea. Moreover, it documents an increasing prevalence of genotype IIIA strains in the country. PMID:22238447

Insights into the homo-oligomerization properties of N-terminal coiled-coil domain of Ebola virus VP35 protein.

PubMed

Ramaswamy, Venkata Krishnan; Di Palma, Francesco; Vargiu, Attilio V; Corona, Angela; Piano, Dario; Ruggerone, Paolo; Zinzula, Luca; Tramontano, Enzo

2018-03-02

The multifunctional Ebola virus (EBOV) VP35 protein is a key determinant of virulence. VP35 is essential for EBOV replication, is a component of the viral RNA polymerase and participates in nucleocapsid formation. Furthermore, VP35 contributes to EBOV evasion of the host innate immune response by suppressing RNA silencing and blocking RIG-I like receptors' pathways that lead to type I interferon (IFN) production. VP35 homo-oligomerization has been reported to be critical for its replicative function and to increase its IFN-antagonism properties. Moreover, homo-oligomerization is mediated by a predicted coiled-coil (CC) domain located within its N-terminal region. Here we report the homo-oligomerization profile of full-length recombinant EBOV VP35 (rVP35) assessed by size-exclusion chromatography and native polyacrylamide gel electrophoresis. Based on our biochemical results and in agreement with previous experimental observations, we have built an in silico 3D model of the so-far structurally unsolved EBOV VP35 CC domain and performed self-assembly homo-oligomerization simulations by means of molecular dynamics. Our model advances the understanding of how VP35 may associate in different homo-oligomeric species, a crucial process for EBOV replication and pathogenicity. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparative evaluation of laboratory developed real-time PCR assays and RealStar(®) BKV PCR Kit for quantitative detection of BK polyomavirus.

PubMed

Hasan, Mohammad R; Tan, Rusung; Al-Rawahi, Ghada; Thomas, Eva; Tilley, Peter

2016-08-01

Quantitative, viral load monitoring for BK virus (BKV) by real-time PCR is an important tool in the management of polyomavirus associated nephropathy in renal transplant patients. However, variability in PCR results has been reported because of polymorphisms in viral genes among different subtypes of BKV, and lack of standardization of the PCR assays among different laboratories. In this study we have compared the performance of several laboratory developed PCR assays that target highly conserved regions of BKV genome with a commercially available, RealStar(®) BKV PCR Kit. Three real-time PCR assays (i) VP1 assay: selected from the literature that targets the major capsid protein (VP1) gene (ii) VP1MOD assay: VP1 assay with a modified probe, and (iii) BKLTA assay: newly designed assay that targets the large T antigen gene were assessed in parallel, using controls and clinical specimens that were previously tested using RealStar(®) BKV PCR Kit (Altona Diagnostics GmbH, Hamburg, Germany). Nucleic acid from all samples were extracted using the QIA symphony virus/bacteria kit on an automated DNA extraction platform QIA symphony SP (Qiagen). Primer and probe concentration, and reaction conditions for laboratory developed assays were optimized and the limit of detection of different assays was determined. Positive control for laboratory developed BK assays was prepared through construction of a plasmid carrying respective amplicon sequences. The 95% detection limit of VP1, VP1MOD and BKLTA assays were 1.8×10(2), 3×10(3) and 3.5×10(2) genomic copies/ml, respectively, as determined by Probit regression analysis of data obtained by testing a dilution series of a titered patient specimen, using RealStar(®) BKV PCR Kit. The inter-assay and intra-assay, coefficient of variations of these assays using calibrated, plasmid standards were <1%. All assays, including the RealStar(®) BKV PCR assay, were highly specific when tested against a panel of external proficiency specimens containing both BK and JC viruses. All assays, except the VP1MOD assay determined BK viral load in proficiency specimens within the same log values. With reference to results obtained by RealStar(®) BKV PCR assay, the sensitivity and specificity of different assays tested in 116 serum specimens submitted for BK viral load assay were 91% and 97% for VP1 assay, 88% and 97% for VP1MOD assay, and 97% and 98% for BKLTA assay, respectively. BK Viral load in positive specimens determined by various assays was highly correlated (R(2)>0.97), based on linear regression analysis. The performance characteristics of the newly designed, BKLTA assay were highly comparable to RealStar(®) BKV PCR assay, and can be used for routine detection and viral load monitoring of BKV in a cost-effective manner. Copyright © 2016 Elsevier B.V. All rights reserved.

A conserved carboxy-terminal domain in the major tegument structural protein VP22 facilitates virion packaging of a chimeric protein during productive herpes simplex virus 1 infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlegel, Elisabeth F.M.; Blaho, John A., E-mail: john.blaho@mssm.ed

2009-05-10

Recombinant virus HSV-1(RF177) was previously generated to examine tegument protein VP22 function by inserting the GFP gene into the gene encoding VP22. During a detailed analysis of this virus, we discovered that RF177 produces a novel fusion protein between the last 15 amino acids of VP22 and GFP, termed GCT-VP22. Thus, the VP22 carboxy-terminal specific antibody 22-3 and two anti-GFP antibodies reacted with an approximately 28 kDa protein from RF177-infected Vero cells. GCT-VP22 was detected at 1 and 3 hpi. Examination of purified virions indicated that GCT-VP22 was incorporated into RF177 virus particles. These observations imply that at least amore » portion of the information required for virion targeting is located in this domain of VP22. Indirect immunofluorescence analyses showed that GCT-VP22 also localized to areas of marginalized chromatin during RF177 infection. These results indicate that the last fifteen amino acids of VP22 participate in virion targeting during HSV-1 infection.« less

Decreased LRIG1 in Human Ovarian Cancer Cell SKOV3 Upregulates MRP-1 and Contributes to the Chemoresistance of VP16.

PubMed

Yang, Hua; Yao, Jun; Yin, Jiangpin; Wei, Xuan

2016-05-01

The leucine-rich repeats and immunoglobulin-like domains (LRIG) are used as tumor suppressors in clinical applications. Although the LRIG has been identified to manipulate the cell proliferation via various oncogenic receptor tyrosine kinases in diverse cancers, its role in multidrug resistance needs to be further elucidated, especially in human ovarian cancer. We herein established that the etoposide (VP16)-resistant SKOV3 human ovarian cancer cell clones (SKOV3/VP16 cells) and mRNA expression of LRIG1 were significantly reduced by the treatment of VP16 in a concentration-dependent manner. Moreover, downregulated LRIG1 in SKOV3 could enhance the colony formation and resist the inhibition of proliferation by VP16, leading to the elevated expression of Bcl-2 and decreased apoptosis of SKOV3. Interestingly, our results uncovered that the multidrug resistance-associated protein 1 (MRP-1) was upregulated for the chemoresistance of VP16. To overcome the chemoresistance of SKOV3, SKOV3/VP16 was ectopically expressed of LRIG1. We found that the inhibition of VP16 on colony formation and proliferation was remarkably enhanced with increased apoptosis in SKOV3/VP16. Furthermore, the expression of MRP-1 and Bcl-2 was also inhibited, suggesting that the LRIG1could negatively control MRP-1 and the apoptosis to improve the sensitivity of VP16-related chemotherapy.

VP24 Is a Chitin-Binding Protein Involved in White Spot Syndrome Virus Infection

PubMed Central

Li, Zaipeng; Han, Yali; Xu, Limei

2015-01-01

ABSTRACT Oral ingestion is the major route of infection for the white spot syndrome virus (WSSV). However, the mechanism by which virus particles in the digestive tract invade host cells is unknown. In the present study, we demonstrate that WSSV virions can bind to chitin through one of the major envelope proteins (VP24). Mutagenesis analysis indicated that amino acids (aa) 186 to 200 in the C terminus of VP24 were required for chitin binding. Moreover, the P-VP24186–200 peptide derived from the VP24 chitin binding region significantly inhibited the VP24-chitin interaction and the WSSV-chitin interaction, implying that VP24 participates in WSSV binding to chitin. Oral inoculation experiments showed that P-VP24186–200 treatment reduced the number of virus particles remaining in the digestive tract during the early stage of infection and greatly hindered WSSV proliferation in shrimp. These data indicate that binding of WSSV to chitin through the viral envelope protein VP24 is essential for WSSV per os infection and provide new ideas for preventing WSSV infection in shrimp farms. IMPORTANCE In this study, we show that WSSV can bind to chitin through the envelope protein VP24. The chitin-binding domain of VP24 maps to amino acids 186 to 200 in the C terminus. Binding of WSSV to chitin through the viral envelope protein VP24 is essential for WSSV per os infection. These findings not only extend our knowledge of WSSV infection but also provide new insights into strategies to prevent WSSV infection in shrimp farms. PMID:26512091

Assembly of the Herpes Simplex Virus Capsid: Preformed Triplexes Bind to the Nascent Capsid

PubMed Central

Spencer, Juliet V.; Newcomb, William W.; Thomsen, Darrell R.; Homa, Fred L.; Brown, Jay C.

1998-01-01

The herpes simplex virus type 1 (HSV-1) capsid is a T=16 icosahedral shell that forms in the nuclei of infected cells. Capsid assembly also occurs in vitro in reaction mixtures created from insect cell extracts containing recombinant baculovirus-expressed HSV-1 capsid proteins. During capsid formation, the major capsid protein, VP5, and the scaffolding protein, pre-VP22a, condense to form structures that are extended into procapsids by addition of the triplex proteins, VP19C and VP23. We investigated whether triplex proteins bind to the major capsid-scaffold protein complexes as separate polypeptides or as preformed triplexes. Assembly products from reactions lacking one triplex protein were immunoprecipitated and examined for the presence of the other. The results showed that neither triplex protein bound unless both were present, suggesting that interaction between VP19C and VP23 is required before either protein can participate in the assembly process. Sucrose density gradient analysis was employed to determine the sedimentation coefficients of VP19C, VP23, and VP19C-VP23 complexes. The results showed that the two proteins formed a complex with a sedimentation coefficient of 7.2S, a value that is consistent with formation of a VP19C-VP232 heterotrimer. Furthermore, VP23 was observed to have a sedimentation coefficient of 4.9S, suggesting that this protein exists as a dimer in solution. Deletion analysis of VP19C revealed two domains that may be required for attachment of the triplex to major capsid-scaffold protein complexes; none of the deletions disrupted interaction of VP19C with VP23. We propose that preformed triplexes (VP19C-VP232 heterotrimers) interact with major capsid-scaffold protein complexes during assembly of the HSV-1 capsid. PMID:9557680

Imaging the crustal structure of Haiti's transpressional fault system using seismicity and tomography

NASA Astrophysics Data System (ADS)

Possee, D.; Keir, D.; Harmon, N.; Rychert, C.; Rolandone, F.; Leroy, S. D.; Stuart, G. W.; Calais, E.; Boisson, D.; Ulysse, S. M. J.; Guerrier, K.; Momplaisir, R.; Prepetit, C.

2017-12-01

Oblique convergence of the Caribbean and North American plates has partitioned strain across an extensive transpressional fault system that bisects Haiti. Most recently the 2010, MW7.0 earthquake ruptured multiple thrust faults in southern Haiti. However, while the rupture mechanism has been well studied, how these faults are segmented and link to deformation across the plate boundary is still debated. Understanding the link between strain accumulation and faulting in Haiti is also key to future modelling of seismic hazards. To assess seismic activity and fault structures we used data from 31 broadband seismic stations deployed on Haiti for 16-months. Local earthquakes were recorded and hypocentre locations determined using a 1D velocity model. A high-quality subset of the data was then inverted using travel-time tomography for relocated hypocentres and 2D images of Vp and Vp/Vs crustal structure. Earthquake locations reveal two clusters of seismic activity, the first delineates faults associated with the 2010 earthquake and the second shows activity 100km further east along a thrust fault north of Lake Enriquillo (Dominican Republic). The velocity models show large variations in seismic properties across the plate boundary; shallow low-velocity zones with a 5-8% decrease in Vp and high Vp/Vs ratios of 1.85-1.95 correspond to sedimentary basins that form the low-lying terrain on Haiti. We also image a region with a 4-5% decrease in Vp and an increased Vp/Vs ratio of 1.80-1.85 dipping south to a depth of 20km beneath southern Haiti. This feature matches the location of a major thrust fault and suggests a substantial damage zone around this fault. Beneath northern Haiti a transition to lower Vp/Vs values of 1.70-1.75 reflects a compositional change from mafic facies such as the Caribbean large igneous province in the south, to arc magmatic facies associated with the Greater Antilles arc in the north. Our seismic images are consistent with the fault system across southern Haiti transitioning from a near vertical strike-slip fault in the west to a major south dipping oblique-slip fault in the east. Seismicity in southern Haiti broadly occurs on the thrust/oblique-slip faults. The results show evidence for significant variations in fault zone structure and kinematics along strike of a major transpressional plate boundary.

Early events of polyoma infection: adsorption, penetration and nuclear transport

NASA Technical Reports Server (NTRS)

Consigli, R. A.; Haynes, J. I. Jr; Chang, D.; Grenz, L.; Richter, D.; Spooner, B. S. (Principal Investigator)

1992-01-01

Polyoma virions have different attachment proteins which are responsible for hemagglutination of erythrocytes and attachment to cultured mouse kidney cells (MKC). Virion binding studies demonstrated that MKC possess specific (productive infection) and nonspecific (nonproductive) receptors. Empty polyoma capsids have hemagglutination activity and bind to non-specific MKC receptors, but they are not capable of competing for specific virion cell receptors or preventing productive infection. Isoelectric focusing of the virion major capsid protein, VP1, separated this protein into six species (A through F). These species had identical amino acid sequences, but differed in degree of modification (phosphorylation, acetylation, sulfation and hydroxylation). Evidence based upon precipitation with specific antisera supports the view that VP1 species E is required for specific adsorption and that D and F are required for hemagglutination. The virion attachment domain has been localized to an 18 kilodalton fragment of the C-terminal region of VP1. Monopinocytotic vesicles containing 125I-labeled polyoma virions were isolated from infected MKC. A crosslinker was used to bind the MKC cell receptor(s) covalently to VP1 attachment protein, and a new 120 kilodalton band was identified by SDS-PAGE. An anti-idiotype antibody prepared against a neutralizing polyoma monoclonal antiody was used to identify a putative 50 kilodalton receptor protein from a detergent extract of MKC, as well as from MKC membrane preparation.

Regional Vp, Vs, Vp/Vs, and Poisson's ratios across earthquake source zones from Memphis, Tennessee, to St. Louis, Missouri

USGS Publications Warehouse

Catchings, R.D.

1999-01-01

Models of P- and S-wave velocity, Vp/Vs ratios, Poisson's ratios, and density for the crust and upper mantle are presented along a 400-km-long profile trending from Memphis, Tennessee, to St. Louis, Missouri. The profile crosses the New Madrid seismic zone and reveals distinct regional variations in the crustal velocity structure north and south of the latitude of New Madrid. In the south near Memphis, the upper few kilometers of the crust are dominated by upper crustal sedimentary basins or graben with P-wave velocities less than 5 km/sec and S-wave velocities of about 2 km/sec. P-wave velocities of the upper and middle crust range from 6.0 to 6.5 km/sec at depths above 25 km, and corresponding S-wave velocities range from 3.5 to 3.7 km/sec. The lower crust consists of a high-velocity layer (Vp = 7.4 km/sec; Vs ~4.2 km/sec) that is up to 20-km thick at the latitude of New Madrid but thins to about 15 km near Memphis. To the north, beneath the western-most Illinois basin, low-velocity (Vp < 5 km/sec; Vs < 2.3 km/sec) sedimentary basins are less than 1-km deep. The average velocities (Vp = 6.0 km/sec; Vs = 3.5 km/sec) of the underlying, near-surface rocks argue against large thickness of unconsolidated noncarbonate sediments within 50 km of the western edge of the Illinois basin. Most of the crust beneath the Illinois basin is modeled as one layer, with velocities up to 6.8 km/sec (Vs = 3.7 km/sec) at 37-km depth. The thick, high-velocity (Vp = 7.4 km/sec; Vs ~4.2 km/sec) lower crustal layer thins from about 20 km near New Madrid to about 6 km beneath the western Illinois basin. Refractions from the Moho and upper mantle occur as first arrivals over distances as a great as 160 km and reveal upper mantle layering to 60 km depth. Upper mantle layers with P-wave velocities of 8.2 km/sec (Vs = 4.5 km/sec) and 8.4 km/sec (Vs = 4.7 km/sec) are modeled at 43 and 60 km depth, respectively. Crustal Vp/Vs ratios range between 1.74 and 1.83, and upper mantle Vp/V s ratios range from 1.78 to 1.84. Poisson's ratios range from about 0.26 to 0.33 in the crust and from about 0.27 to 0.29 in the upper mantle. Modeled average densities range from about 2.55 in the sedimentary basins to 3.43 in the upper mantle. Geophysical characteristics of the crust and upper mantle within the New Madrid seismic zone are consistent with other continental rifts, but the crustal structure of the Illinois basin is not characteristics of most continental rift settings. Seismic and gravity data suggest a buried horst near the middle of Reelfoot rift, beneath which is a vertical zone of seismicity and velocity anomalies. The relative depth of the Reelfoot rift north and south of the Reelfoot graben suggests that the rift and its bounding faults may extend eastward beneath the city of Memphis.

Purification of full-length VP22 from cells infected with HSV-1: A two-pronged approach for the solubilization and purification of viral proteins for use in biochemical studies

PubMed Central

Dewberry, Ebony J.; Dunkerley, Eric; Duffy, Carol

2012-01-01

Summary VP22, encoded by the UL49 gene, is one of the most abundant proteins of the herpes simplex virus type 1 (HSV-1) tegument and has been shown to be important for virus replication and spread. However, the exact role(s) played by VP22 in the HSV-1 replication cycle have yet to be delineated. The lack of a procedure to purify full-length VP22 has limited molecular studies on VP22 function. A procedure was developed for the purification of soluble, full-length VP22 from cells infected with HSV-1. A recombinant virus encoding His-tagged VP22 was generated and found to express VP22 at levels comparable to the wild type virus upon infection of Vero cells. By experimenting with a wide variety of cell lysis buffer conditions, several buffers that promote the solubility of full-length VP22 were identified. Buffers that gave the highest levels of solubility were then used in immobilized metal ion affinity chromatography experiments to identify conditions that provided the greatest level of VP22 binding and recovery from cobalt and nickel affinity resins. Using this strategy soluble, full-length VP22 was purified from cells infected with HSV-1. PMID:22569534

Seismic image of a CO2 reservoir beneath a seismically active volcano

USGS Publications Warehouse

Julian, B.R.; Pitt, A.M.; Foulger, G.R.

1998-01-01

Mammoth Mountain is a seismically active volcano 200 000 to 50 000 years old, situated on the southwestern rim of Long Valley caldera, California. Since 1989 it has shown evidence of unrest in the form of earthquake swarms (Hill et al. 1990), volcanic 'long-period' earthquakes (Pitt and Hill 1994), increased output of magmatic 3He (Sorey et al. 1993) and the emission of about 500 tonnes day-1 of CO2 (Farrar et al. 1995; Hill 1996; M. Sorey, personal communication, 1997) which has killed trees and poses a threat to human safety. Local-earthquake tomography shows that in mid-1989 areas of subsequent tree-kill were underlain by extensive regions where the ratio of the compressional and shear elastic-wave speeds Vp/VS was about 9% lower than in the surrounding rocks. Theory (Mavko and Mukerji 1995), experiment (Ito, DeVilbiss and Nur 1979) and experience at other geothermal/volcanic areas (Julian et al. 1996) and at petroleum reservoirs (Harris et al. 1996) indicate that Vp/VS is sensitive to pore-fluid compressibility, through its effect on Vp. The observed Vp/VS anomaly is probably caused directly by CO2, and seismic Vp/VS tomography is thus a promising tool for monitoring gas concentration and movement in volcanoes, which may in turn be related to volcanic activity.

Evidence for partial melt in the crust beneath Mt. Paektu (Changbaishan), Democratic People’s Republic of Korea and China

USGS Publications Warehouse

Kyong-Song, Ri; Hammond, James O. S.; Chol-Nam, Ko; Hyok, Kim; Yong-Gun, Yun; Gil-Jong, Pak; Chong-Song, Ri; Oppenheimer, Clive; Liu, Kosima W.; Iacovino, Kayla D.; Kum-Ran, Ryu

2016-01-01

Mt. Paektu (also known as Changbaishan) is an enigmatic volcano on the border between the Democratic People’s Republic of Korea (DPRK) and China. Despite being responsible for one of the largest eruptions in history, comparatively little is known about its magmatic evolution, geochronology, or underlying structure. We present receiver function results from an unprecedented seismic deployment in the DPRK. These are the first estimates of the crustal structure on the DPRK side of the volcano and, indeed, for anywhere beneath the DPRK. The crust 60 km from the volcano has a thickness of 35 km and a bulk VP/VS of 1.76, similar to that of the Sino-Korean craton. The VP/VS ratio increases ~20 km from the volcano, rising to >1.87 directly beneath the volcano. This shows that a large region of the crust has been modified by magmatism associated with the volcanism. Such high values of VP/VS suggest that partial melt is present in the crust beneath Mt. Paektu. This region of melt represents a potential source for magmas erupted in the last few thousand years and may be associated with an episode of volcanic unrest observed between 2002 and 2005.

Intratumor distribution and test-retest comparisons of physiological parameters quantified by dynamic contrast-enhanced MRI in rat U251 glioma.

PubMed

Aryal, Madhava P; Nagaraja, Tavarekere N; Brown, Stephen L; Lu, Mei; Bagher-Ebadian, Hassan; Ding, Guangliang; Panda, Swayamprava; Keenan, Kelly; Cabral, Glauber; Mikkelsen, Tom; Ewing, James R

2014-10-01

The distribution of dynamic contrast-enhanced MRI (DCE-MRI) parametric estimates in a rat U251 glioma model was analyzed. Using Magnevist as contrast agent (CA), 17 nude rats implanted with U251 cerebral glioma were studied by DCE-MRI twice in a 24 h interval. A data-driven analysis selected one of three models to estimate either (1) plasma volume (vp), (2) vp and forward volume transfer constant (K(trans)) or (3) vp, K(trans) and interstitial volume fraction (ve), constituting Models 1, 2 and 3, respectively. CA distribution volume (VD) was estimated in Model 3 regions by Logan plots. Regions of interest (ROIs) were selected by model. In the Model 3 ROI, descriptors of parameter distributions--mean, median, variance and skewness--were calculated and compared between the two time points for repeatability. All distributions of parametric estimates in Model 3 ROIs were positively skewed. Test-retest differences between population summaries for any parameter were not significant (p ≥ 0.10; Wilcoxon signed-rank and paired t tests). These and similar measures of parametric distribution and test-retest variance from other tumor models can be used to inform the choice of biomarkers that best summarize tumor status and treatment effects. Copyright © 2014 John Wiley & Sons, Ltd.

Novel evolutionary lineages of the invertebrate oxytocin/vasopressin superfamily peptides and their receptors in the common octopus (Octopus vulgaris)

PubMed Central

Kanda, Atsuhiro; Satake, Honoo; Kawada, Tsuyoshi; Minakata, Hiroyuki

2004-01-01

The common octopus, Octopus vulgaris, is the first invertebrate species that was shown to possess two oxytocin/vasopressin (OT/VP) superfamily peptides, octopressin (OP) and cephalotocin (CT). Previously, we cloned a GPCR (G-protein-coupled receptor) specific to CT [CTR1 (CT receptor 1)]. In the present study, we have identified an additional CTR, CTR2, and a novel OP receptor, OPR. Both CTR2 and OPR include domains and motifs typical of GPCRs, and the intron– exon structures are in accord with those of OT/VP receptor genes. CTR2 and OPR expressed in Xenopus oocytes induced calcium-mediated inward chloride current in a CT- and OP-specific manner respectively. Several regions and residues, which are requisite for binding of the vertebrate OT/VP receptor family with their ligands, are highly conserved in CTRs, but not in OPR. These different sequences between CTRs and OPR, as well as the amino acid residues of OP and CT at positions 2–5, were presumed to play crucial roles in the binding selectivity to their receptors, whereas the difference in the polarity of OT/VP family peptide residues at position 8 confers OT and VP with the binding specificity in vertebrates. CTR2 mRNA was present in various peripheral tissues, and OPR mRNA was detected in both the nervous system and peripheral tissues. Our findings suggest that the CT and OP genes, similar to the OT/VP family, evolved through duplication, but the ligand–receptor selectivity were established through different evolutionary lineages from those of their vertebrate counterparts. PMID:15504101

The use of additive and subtractive approaches to examine the nuclear localization sequence of the polyomavirus major capsid protein VP1

NASA Technical Reports Server (NTRS)

Chang, D.; Haynes, J. I. 2nd; Brady, J. N.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1992-01-01

A nuclear localization signal (NLS) has been identified in the N-terminal (Ala1-Pro-Lys-Arg-Lys-Ser-Gly-Val-Ser-Lys-Cys11) amino acid sequence of the polyomavirus major capsid protein VP1. The importance of this amino acid sequence for nuclear transport of VP1 protein was demonstrated by a genetic "subtractive" study using the constructs pSG5VP1 (full-length VP1) and pSG5 delta 5'VP1 (truncated VP1, lacking amino acids Ala1-Cys11). These constructs were used to transfect COS-7 cells, and expression and intracellular localization of the VP1 protein was visualized by indirect immunofluorescence. These studies revealed that the full-length VP1 was expressed and localized in the nucleus, while the truncated VP1 protein was localized in the cytoplasm and not transported to the nucleus. These findings were substantiated by an "additive" approach using FITC-labeled conjugates of synthetic peptides homologous to the NLS of VP1 cross-linked to bovine serum albumin or immunoglobulin G. Both conjugates localized in the nucleus after microinjection into the cytoplasm of 3T6 cells. The importance of individual amino acids found in the basic sequence (Lys3-Arg-Lys5) of the NLS was also investigated. This was accomplished by synthesizing three additional peptides in which lysine-3 was substituted with threonine, arginine-4 was substituted with threonine, or lysine-5 was substituted with threonine. It was found that lysine-3 was crucial for nuclear transport, since substitution of this amino acid with threonine prevented nuclear localization of the microinjected, FITC-labeled conjugate.

Determining the upper mantle seismic structure beneath the northern Transantarctic Mountains, Antarctica, from regional P- and S-wave tomography

NASA Astrophysics Data System (ADS)

Brenn, Gregory Randall

Stretching 3,500 km across Antarctica, with peak elevations up to 4,500 m, the Transantarctic Mountains (TAMs) are the largest non-compressional continental mountain range on Earth and represent a tectonic boundary between the East Antarctica (EA) craton and the West Antarctic Rift System. The origin and uplift mechanism associated with the TAMs is controversial, and multiple models have been proposed. Seismic investigations of the TAM's subsurface structure can provide key constraints to help evaluate these models, but previous studies have been primarily focused only on the central TAMs near Ross Island. Using data from the new 15-station Transantarctic Mountain Northern Network as well as data from several smaller networks, this study investigates the upper mantle velocity structure beneath a previously unexplored portion of the northern TAMs through regional body wave tomography. Relative travel-times were calculated for 11,182 P-wave and 8,285 S-wave arrivals from 790 and 581 Mw ≥ 5.5 events, respectively, using multi-channel cross correlation, and these data were then inverted for models of the upper mantle seismic structure. Resulting P- and S-wave tomography images reveal two focused low velocity anomalies beneath Ross Island (RI; deltaVP ≈ -2.0%; deltaV S ≈ -1.5% to -4.0%) and Terra Nova Bay (TNB; deltaVP ≈ -1.5% to -2.0%; deltaVS ≈ -1.0% to -4.0%) that extend to depths of 200 and 150 km, respectively. The RI and TNB slow anomalies also extend 50-100 km laterally beneath the TAMs front and sharply abut fast velocities beneath the EA craton (deltaVP ≈ 0.5% to 2%; deltaV S ≈ 1.5% to 4.0%). A low velocity region (deltaVP ≈ -1.5%), centered at 150 km depth beneath the Terror Rift (TR) and primarily constrained within the Victoria Land Basin, connects the RI and TNB anomalies. The focused low velocities are interpreted as regions of partial melt and buoyancy-driven upwelling, connected by a broad region of slow (presumably warm) upper mantle associated with Cenozoic extension along the TR. Dynamic topography estimates based on the imaged S-wave velocity perturbations are consistent with observed surface topography in the central and northern TAMs, thereby providing support for uplift models that advocate for thermal loading and a flexural origin for the mountain range.

Fine mapping of canine parvovirus B cell epitopes.

PubMed

López de Turiso, J A; Cortés, E; Ranz, A; García, J; Sanz, A; Vela, C; Casal, J I

1991-10-01

In this report we describe the topological mapping of neutralizing domains of canine parvovirus (CPV). We obtained 11 CPV-specific monoclonal antibodies (MAbs), six of which are neutralizing. The reactivities were as determined by ELISA and Western blot (immunoblot) analysis. VP2, the most abundant protein of the CPV capsid, seemed to contain all the neutralization sites. Also, an almost full-length genomic clone of CPV was constructed in the bacterial plasmid pUC18 to enable expression of CPV proteins. All the neutralizing MAbs recognized recombinant VP2 when it was expressed as a free protein in Escherichia coli but not when expressed as a fusion protein with glutathione-S-transferase. When two large fragments containing about 85% and 67% of the C terminus of VP2 were expressed, no neutralization sites were detected. When fusion proteins containing the N terminus were expressed, two linear determinants were mapped, one between residues 1 to 10 of VP2, and the other between amino acids 11 and 23. The peptide 11 GQPAVRNERATGS 23, recognized by MAb 3C9, was synthesized chemically and checked for immunogenicity, not being able to induce neutralizing activity. Although the antibody response in rabbits to all the fusion proteins was uniformly high, the anti-CPV response was very variable. Protein from pCPVEx11, which contains a T cell epitope (peptide PKIFINLAKKKKAG) present in the VP1-specific region as well as the B cell epitopes, seemed to be the most effective in inducing virus neutralization.

Halon Replacement Program for Aviation, Aircraft Engine Nacelle Application Phase II - Operational Comparison of Selected Extinguishants

DTIC Science & Technology

1997-05-01

Control Butterfly Hi-Pressure High Flow Control Butterfly Ejector Primary Clycol Control Valve Scrubber Fan Pressure Control Butterfly 8" Venturi ...the scrubber . 20 ■ SCRUBBER FAN BLOWER INLET VALVE VP-2 VP-3 VP-4 VP-5 VP-6 VP-7 VP-8 VP-9 VP-10 SV-1 SV-2 DESCRIPTION Atmospheric...Blower Bypass Butterfly 24" Venturi Control Butterfly 24" Test Section Exit Butterfly Ejector 10’ Secondary Inlet-Butterfly Hi-pressure Low Flow

Recombinant VP1, an Akt Inhibitor, Suppresses Progression of Hepatocellular Carcinoma by Inducing Apoptosis and Modulation of CCL2 Production

PubMed Central

Chen, Tai-An; Wang, Jui-Ling; Hung, Shao-Wen; Chu, Chiao-Li; Cheng, Yung-Chih; Liang, Shu-Mei

2011-01-01

Background The application of viral elements in tumor therapy is one facet of cancer research. Recombinant capsid protein VP1 (rVP1) of foot-and-mouth disease virus has previously been demonstrated to induce apoptosis in cancer cell lines. Here, we aim to further investigate its apoptotic mechanism and possible anti-metastatic effect in murine models of hepatocellular carcinoma (HCC), one of the most common human cancers worldwide. Methodology/Principal Findings Treatment with rVP1 inhibited cell proliferation in two murine HCC cell lines, BNL and Hepa1-6, with IC50 values in the range of 0.1–0.2 µM. rVP1 also induced apoptosis in these cells, which was mediated by Akt deactivation and dissociation of Ku70-Bax, and resulted in conformational changes and mitochondrial translocation of Bax, leading to the activation of caspases-9, -3 and -7. Treatment with 0.025 µM rVP1, which did not affect the viability of normal hepatocytes, suppressed cell migration and invasion via attenuating CCL2 production. The production of CCL2 was modulated by Akt-dependent NF-κB activation that was decreased after rVP1 treatment. The in vivo antitumor effects of rVP1 were assessed in both subcutaneous and orthotopic mouse models of HCC in immune-competent BALB/c mice. Intratumoral delivery of rVP1 inhibited subcutaneous tumor growth as a result of increased apoptosis. Intravenous administration of rVP1 in an orthotopic HCC model suppressed tumor growth, inhibited intra-hepatic metastasis, and prolonged survival. Furthermore, a decrease in the serum level of CCL2 was observed in rVP1-treated mice. Conclusions/Significance The data presented herein suggest that, via inhibiting Akt phosphorylation, rVP1 suppresses the growth, migration, and invasion of murine HCC cells by inducing apoptosis and attenuating CCL2 production both in vitro and in vivo. Recombinant protein VP1 thus has the potential to be developed as a new therapeutic agent for HCC. PMID:21826248

Pros and cons of VP1-specific maternal IgG for the protection of Enterovirus 71 infection.

PubMed

Kim, Young-In; Song, Jae-Hyoung; Kwon, Bo-Eun; Kim, Ha-Neul; Seo, Min-Duk; Park, KwiSung; Lee, SangWon; Yeo, Sang-Gu; Kweon, Mi-Na; Ko, Hyun-Jeong; Chang, Sun-Young

2015-11-27

Enterovirus 71 (EV71) causes hand, foot, and mouth diseases and can result in severe neurological disorders when it infects the central nervous system. Thus, there is a need for the development of effective vaccines against EV71 infection. Here we report that viral capsid protein 1 (VP1), one of the main capsid proteins of EV71, efficiently elicited VP1-specific immunoglobulin G (IgG) in the serum of mice immunized with recombinant VP1. The VP1-specific IgG produced in female mice was efficiently transferred to their offspring, conferring protection against EV71 infection immediately after birth. VP1-specific antibody can neutralize EV71 infection and protect host cells. VP1-specific maternal IgG in offspring was maintained for over 6 months. However, the pre-existence of VP1-specific maternal IgG interfered with the production of VP1-specific IgG antibody secreting cells by active immunization in offspring. Therefore, although our results showed the potential for VP1-specific maternal IgG protection against EV71 in neonatal mice, other strategies must be developed to overcome the hindrance of maternal IgG in active immunization. In this study, we developed an effective and feasible animal model to evaluate the protective efficacy of humoral immunity against EV71 infection using a maternal immunity concept. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of Recent Serotype O Foot-and-Mouth Disease Viruses from Livestock in Kenya: Evidence of Four Independently Evolving Lineages.

PubMed

Wekesa, S N; Muwanika, V B; Siegismund, H R; Sangula, A K; Namatovu, A; Dhikusooka, M T; Tjørnehøj, K; Balinda, S N; Wadsworth, J; Knowles, N J; Belsham, G J

2015-06-01

Foot-and-mouth disease (FMD) is endemic in Kenya where four serotypes (O, A, SAT 1 and SAT 2) of the virus are currently in circulation. Within 2010 and 2011, the National Laboratory recorded an increase in the number of FMD outbreaks caused by serotype O virus. The characteristics of these viruses were determined to ascertain whether these were independent outbreaks or one single strain spreading throughout the country. The sequences of the complete VP1-coding region were analysed from viruses sampled within different areas of Kenya during 2010 and 2011. The results indicated that the 2010 to 2011 outbreaks in Kenya were caused by four independent strains. By comparison with earlier type O isolates from Eastern Africa, it was apparent that the outbreaks were caused by viruses from three different lineages of topotype EA-2 and a fourth virus strain belonging to topotype EA-4. The topotypes EA-1 and EA-3 were not detected from these outbreaks. Implications of these results for FMD control in Eastern Africa are discussed. © 2013 Blackwell Verlag GmbH.

The immunogenicity of recombinant vaccines based on modified Vaccinia Ankara (MVA) viruses expressing African horse sickness virus VP2 antigens depends on the levels of expressed VP2 protein delivered to the host.

PubMed

Calvo-Pinilla, Eva; Gubbins, Simon; Mertens, Peter; Ortego, Javier; Castillo-Olivares, Javier

2018-06-01

African horse sickness (AHS) is a lethal equine disease transmitted by Culicoides biting midges and caused by African horse sickness virus (AHSV). AHS is endemic to sub-Saharan Africa, but devastating outbreaks have been recorded periodically outside this region. The perceived risk of an AHS outbreak occurring in Europe has increased following the frequent epidemics caused in ruminants by bluetongue virus, closely related to AHSV. Attenuated vaccines for AHS are considered unsuitable for use in non-endemic countries due bio-safety concerns. Further, attenuated and inactivated vaccines are not compatible with DIVA (differentiate infected from vaccinated animals) strategies. All these factors stimulated the development of novel AHS vaccines that are safer, more efficacious and DIVA compatible. We showed previously that recombinant modified Vaccinia Ankara virus (MVA) vaccines encoding the outer capsid protein of AHSV (AHSV-VP2) induced virus neutralising antibodies (VNAb) and protection against AHSV in a mouse model and also in the horse. Passive immunisation studies demonstrated that immunity induced by MVA-VP2 was associated with pre-challenge VNAb titres in the vaccinates. Analyses of the inoculum of these MVA-VP2 experimental vaccines showed that they contained pre-formed AHSV-VP2. We continued studying the influence of pre-formed AHSV-VP2, present in the inoculum of MVA-VP2 vaccines, in the immunogenicity of MVA-VP2 vaccines. Thus, we compared correlates of immunity in challenged mice that were previously vaccinated with: a) MVA-VP2 (live); b) MVA-VP2 (live and sucrose gradient purified); c) MVA-VP2 (UV light inactivated); d) MVA-VP2 (UV light inactivated and diluted); e) MVA-VP2 (heat inactivated); f) MVA-VP2 (UV inactivated) + MVA-VP2 (purified); g) MVA-VP2 (heat inactivated) + MVA-VP2 (purified); and h) wild type-MVA (no insert). The results of these experiments showed that protection was maximal using MVA-VP2 (live) vaccine and that the protection conferred by all other vaccines correlated strongly with the levels of pre-formed AHSV-VP2 in the vaccine inoculum. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.

PubMed

Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan

2011-09-01

The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.

Immunogenicity of a recombinant fusion protein of tandem repeat epitopes of foot-and-mouth disease virus type Asia 1 for guinea pigs.

PubMed

Zhang, Q; Yang, Y Q; Zhang, Z Y; Li, L; Yan, W Y; Jiang, W J; Xin, A G; Lei, C X; Zheng, Z X

2002-01-01

In this study, the sequences of capsid protein VPI regions of YNAs1.1 and YNAs1.2 isolates of foot-and-mouth disease virus (FMDV) were analyzed and a peptide containing amino acids (aa) 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia I was assumed to contain B and T cell epitopes, because it is hypervariable and includes a cell attachment site RGD located in the G-H loop. The DNA fragments encoding aa 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia 1 were chemically synthesized and ligated into a tandem repeat of aa 133-158-20 approximately 34-133-158. In order to enhance its immunogenicity, the tandem repeat was inserted downstream of the beta-galactosidase gene in the expression vector pWR590. This insertion yielded a recombinant expression vector pAS1 encoding the fusion protein. The latter reacted with sera from FMDV type Asia 1-infected animals in vitro and elicited high levels of neutralizing antibodies in guinea pigs. The T cell proliferation in immunized animals increased following stimulation with the fusion protein. It is reported for the first time that a recombinant fusion protein vaccine was produced using B and T cell epitopes of FMDV type Asia 1 and that this fusion protein was immunogenic. The fusion protein reported here can serve as a candidate of fusion epitopes for design of a vaccine against FMDV type Asia 1.

High-yield production of the VP1 structural protein epitope from serotype O foot-and-mouth disease virus in Escherichia coli.

PubMed

Jung, Joon-Goo; Lee, Yong Jae; Velmurugan, Natarajan; Ko, Young-Joon; Lee, Hyang-Sim; Jeong, Ki Jun

2013-07-01

For effective control of foot-and-mouth disease (FMD), the development of rapid diagnostic systems and vaccines are required against its etiological agent, FMD virus (FMDV). To accomplish this, efficient large-scale expression of the FMDV VP1 protein, with high solubility, needs to be optimized. We attempted to produce high levels of a serotype O FMDV VP1 epitope in Escherichia coli. We identified the subtype-independent serotype O FMDV VP1 epitope sequence and used it to construct a glutathione S-transferase (GST) fusion protein. For efficient production of the FMDV VP1 epitope fused to GST (VP1e-GST), four E. coli strains and three temperatures were examined. The conditions yielding the greatest level of VP1e-GST with highest solubility were achieved with E. coli BL21(DE3) at 25 °C. For high-level production, fed-batch cultures were conducted in 5-l bioreactors. When cells were induced at a high density and complex feeding solutions were supplied, approximately 11 g of VP1e-GST was obtained from a 2.9-l culture. Following purification, the VP1 epitope was used to immunize rabbits, and we confirmed that it induced an immune response.

Anatomy of a caldera: seismic velocity and attenuation models of the Campi Flegrei (Italy).

NASA Astrophysics Data System (ADS)

Calò, Marco; Tramelli, Anna

2017-04-01

Campi Flegrei is an active Caldera marked by strong vertical deformations of the soil called bradyseisms. The mechanisms proposed to explain this phenomenon are essentially three i) the presence of a shallow magmatic chamber that pushes the lid and consequently producing periodic variation of the soil level, ii) a thermic expansion of the geothermal aquifer due to the periodic increase of heat flux coming from a near magmatic chamber or deep fluids or iii) a combination of both phenomena. To solve the paradox, several models have been proposed to describe the nature and the geometry of the bodies responsible of the bradyseisms. Seismological tools allowed a rough description of the main features in terms of seismic velocities and attenuation parameters and till now were not able to resolve the smallest structures (<1.5-2km) located at shallow depth (0-4 km) and believed to be responsible of the soil deformations. Here we show Vp, Vp/Vs and Qp models carried out by applying an enhanced seismic tomography method combining the double difference approach (Zhang and Thurber, 2003) and the Weighted Average Method (Calò et al., 2009, Calò et al., 2011, 2013). The data used are the earthquakes recorded during the largest bradyseism crisis of the 80's. Our method allowed to image seismic velocity and attenuation structures with linear dimension of 0.5-1.2km, resulting in an improvement of the resolving power at least two times of the other published models (e.g. Priolo et al., 2012). The joint interpretation of seismic velocities and attenuation models allowed to discern small anomalous bodies at shallow depth (0.5-2.0 km) marked by relatively low Vp, high Vp/Vs ratio and low Qp values explainable with the presence of shallow geothermal water saturated reservoir from regions with low Vp, low Vp/Vs and low Qp possibly related to the gas saturated part of the reservoir. At deeper depth (2-3.5 km) bodies with high Vp and Vp/Vs and low Qp can be associated with magmatic intrusions. The results of this project have been obtained in the framework of the PIPIIT program (IA100416).

Identification of a novel NLS of herpes simplex virus type 1 (HSV-1) VP19C and its nuclear localization is required for efficient production of HSV-1.

PubMed

Li, You; Zhao, Lei; Wang, Shuai; Xing, Junji; Zheng, Chunfu

2012-09-01

Herpes simplex virus type 1 (HSV-1) triplex is a complex of three protein subunits, consisting of two copies of VP23 and one copy of VP19C. Here, we identified a non-classical NLS of VP19C between aa 50 and 61, and the nuclear import of VP19C was mediated by RanGTP and importin β1-, but not importin α5-, dependent pathway. Additionally, recombinant virus harbouring this NLS mutation (NLSm) replicates less efficiently as wild-type. These data strongly suggested that the nuclear import of VP19C is required for efficient HSV-1 production.

Heat Shock Protein 70 Enhances Mucosal Immunity against Human Norovirus When Coexpressed from a Vesicular Stomatitis Virus Vector

PubMed Central

Ma, Yuanmei; Duan, Yue; Wei, Yongwei; Liang, Xueya; Niewiesk, Stefan; Oglesbee, Michael

2014-01-01

ABSTRACT Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942–2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 × 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 × 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine. IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is uncultivable. Thus, a live vector-based vaccine may provide an alternative vaccine strategy. In this study, we developed a vesicular stomatitis virus (VSV)-based human NoV vaccine candidate. We constructed rVSV-HSP70-VP1, coexpressing heat shock protein (HSP70) and capsid (VP1) genes of human NoV, and rVSV-Luc-VP1, coexpressing firefly luciferase (Luc) and VP1 genes. We found that VSVs with a double gene insertion were significantly more attenuated than VSV with a single VP1 insertion (rVSV-VP1). Furthermore, we found that coexpression or coadministration of HSP70 from VSV vector significantly enhanced human NoV-specific mucosal immunity. Collectively, we developed an improved live vectored vaccine candidate for human NoV which will be useful for future clinical studies. PMID:24574391

Molecular Tectonic Model of Virus Structural Transitions: the Putative Cell Entry States of Poliovirus

PubMed Central

Belnap, David M.; Filman, David J.; Trus, Benes L.; Cheng, Naiqian; Booy, Frank P.; Conway, James F.; Curry, Stephen; Hiremath, Chaitanya N.; Tsang, Simon K.; Steven, Alasdair C.; Hogle, James M.

2000-01-01

Upon interacting with its receptor, poliovirus undergoes conformational changes that are implicated in cell entry, including the externalization of the viral protein VP4 and the N terminus of VP1. We have determined the structures of native virions and of two putative cell entry intermediates, the 135S and 80S particles, at ∼22-Å resolution by cryo-electron microscopy. The 135S and 80S particles are both ∼4% larger than the virion. Pseudoatomic models were constructed by adjusting the beta-barrel domains of the three capsid proteins VP1, VP2, and VP3 from their known positions in the virion to fit the 135S and 80S reconstructions. Domain movements of up to 9 Å were detected, analogous to the shifting of tectonic plates. These movements create gaps between adjacent subunits. The gaps at the sites where VP1, VP2, and VP3 subunits meet are plausible candidates for the emergence of VP4 and the N terminus of VP1. The implications of these observations are discussed for models in which the externalized components form a transmembrane pore through which viral RNA enters the infected cell. PMID:10627545

Molecular tectonic model of virus structural transitions: the putative cell entry states of poliovirus.

PubMed

Belnap, D M; Filman, D J; Trus, B L; Cheng, N; Booy, F P; Conway, J F; Curry, S; Hiremath, C N; Tsang, S K; Steven, A C; Hogle, J M

2000-02-01

Upon interacting with its receptor, poliovirus undergoes conformational changes that are implicated in cell entry, including the externalization of the viral protein VP4 and the N terminus of VP1. We have determined the structures of native virions and of two putative cell entry intermediates, the 135S and 80S particles, at approximately 22-A resolution by cryo-electron microscopy. The 135S and 80S particles are both approximately 4% larger than the virion. Pseudoatomic models were constructed by adjusting the beta-barrel domains of the three capsid proteins VP1, VP2, and VP3 from their known positions in the virion to fit the 135S and 80S reconstructions. Domain movements of up to 9 A were detected, analogous to the shifting of tectonic plates. These movements create gaps between adjacent subunits. The gaps at the sites where VP1, VP2, and VP3 subunits meet are plausible candidates for the emergence of VP4 and the N terminus of VP1. The implications of these observations are discussed for models in which the externalized components form a transmembrane pore through which viral RNA enters the infected cell.

Ab initio elastic properties of talc from 0 to 12 GPa: Interpretation of seismic velocities at mantle pressures and prediction of auxetic behaviour at low pressure

NASA Astrophysics Data System (ADS)

Mainprice, David; Le Page, Yvon; Rodgers, John; Jouanna, Paul

2008-10-01

Talc is a hydrous magnesium rich layered silicate that is widely disseminated in the Earth from the seafloor to over 100 km depth, in ultra-high pressure metamorphism of oceanic crust. In this paper we determine the single crystal elastic constants at pressures from 0 to 12 GPa of talc triclinic ( C 1¯) and monoclinic (C2/ c) polytypes using ab initio methods. We find that talc has an extraordinarily high elastic anisotropy at zero pressure that reduces with increasing pressure. The exceptional anisotropy is complemented by a negative Poisson's ratio for many directions in crystal space. Calculations show that talc is not only one of very few common minerals to exhibit auxetic behaviour, but the magnitude of this effect may be the largest reported so far for a mineral. The compression (Vp) and shear (Vs) wave velocity anisotropy is 80% and 85% for the triclinic polytype. At pressures where talc is known be stable in the Earth (up to 5 GPa) the Vp and Vs anisotropy is reduced to about 40% for both velocities, which is still a very high value. Vp is slow parallel to the c-axis and fast perpendicular to it. This remains unchanged with increasing pressure and is observed in both polytypes. The shear wave splitting (difference between fast and slow S-wave velocities) at low pressure has high values in the plane normal to the c-axis, with a maximum near the a*-axis in the triclinic and the b-axis in the monoclinic polytype. The c-axis is the direction of minimum splitting. The pattern of shear wave splitting does not change significantly with pressure. The volume fraction of talc varies between 11 and 41% for hydrated mantle rocks, but the lack of data on the crystallographic preferred orientation (CPO) precludes a detailed analysis of the impact of talc on seismic anisotropy in subduction zones. However, it is highly likely that CPO can easily develop in zones of deformation due to the platy habit of talc crystals. For random aggregates of talc, the isotropic Vp, Vs and Vp/Vs ratio have significantly lower values than those of antigorite and may explain low-velocity regions in the mantle wedge. Vp/Vs ratios are more complex in anisotropic media because there are fast and slow S-waves, resulting in Vp/Vs1 and Vp/Vs2 ratios for every propagation direction, making interpretation difficult in deformed polycrystalline talc with a CPO. Talc on the subduction plate boundary can strongly influence guided wave velocity as CPO would develop in this region of intense shearing. The very low coefficient of friction (< 0.1) of talc above 100 °C could also explain silent earthquakes at shallow depths ( ca 30 km) along the subduction plate boundaries, frequently responsible for tsunami.

Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region

PubMed Central

Dolz, Roser; Valle, Rosa; Perera, Carmen L.; Bertran, Kateri; Frías, Maria T.; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J.

2013-01-01

Background Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Methodology/Principal Findings Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. Conclusions/Significance To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide. PMID:23805195

Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

PubMed

Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J

2013-01-01

Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

Sporadic isolation of sabin-like polioviruses and high-level detection of non-polio enteroviruses during sewage surveillance in seven Italian cities, after several years of inactivated poliovirus vaccination.

PubMed

Battistone, A; Buttinelli, G; Fiore, S; Amato, C; Bonomo, P; Patti, A M; Vulcano, A; Barbi, M; Binda, S; Pellegrinelli, L; Tanzi, M L; Affanni, P; Castiglia, P; Germinario, C; Mercurio, P; Cicala, A; Triassi, M; Pennino, F; Fiore, L

2014-08-01

Sewage surveillance in seven Italian cities between 2005 and 2008, after the introduction of inactivated poliovirus vaccination (IPV) in 2002, showed rare polioviruses, none that were wild-type or circulating vaccine-derived poliovirus (cVDPV), and many other enteroviruses among 1,392 samples analyzed. Two of five polioviruses (PV) detected were Sabin-like PV2 and three PV3, based on enzyme-linked immunosorbent assay (ELISA) and PCR results. Neurovirulence-related mutations were found in the 5'noncoding region (5'NCR) of all strains and, for a PV2, also in VP1 region 143 (Ile>Thr). Intertypic recombination in the 3D region was detected in a second PV2 (Sabin 2/Sabin 1) and a PV3 (Sabin 3/Sabin 2). The low mutation rate in VP1 for all PVs suggests limited interhuman virus passages, consistent with efficient polio immunization in Italy. Nonetheless, these findings highlight the risk of wild or Sabin poliovirus reintroduction from abroad. Non-polio enteroviruses (NPEVs) were detected, 448 of which were coxsackievirus B (CVB) and 294 of which were echoviruses (Echo). Fifty-six NPEVs failing serological typing were characterized by sequencing the VP1 region (nucleotides [nt] 2628 to 2976). A total of 448 CVB and 294 Echo strains were identified; among those strains, CVB2, CVB5, and Echo 11 predominated. Environmental CVB5 and CVB2 strains from this study showed high sequence identity with GenBank global strains. The high similarity between environmental NPEVs and clinical strains from the same areas of Italy and the same periods indicates that environmental strains reflect the viruses circulating in the population and highlights the potential risk of inefficient wastewater treatments. This study confirmed that sewage surveillance can be more sensitive than acute flaccid paralysis (AFP) surveillance in monitoring silent poliovirus circulation in the population as well as the suitability of molecular approaches to enterovirus typing.

Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China.

PubMed

Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo

2014-04-01

Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection of lipid-induced structural changes of the Marburg virus matrix protein VP40 using hydrogen/deuterium exchange-mass spectrometry

PubMed Central

Wijesinghe, Kaveesha J.; Urata, Sarah; Bhattarai, Nisha; Kooijman, Edgar E.; Gerstman, Bernard S.; Chapagain, Prem P.; Li, Sheng; Stahelin, Robert V.

2017-01-01

Marburg virus (MARV) is a lipid-enveloped virus from the Filoviridae family containing a negative sense RNA genome. One of the seven MARV genes encodes the matrix protein VP40, which forms a matrix layer beneath the plasma membrane inner leaflet to facilitate budding from the host cell. MARV VP40 (mVP40) has been shown to be a dimeric peripheral protein with a broad and flat basic surface that can associate with anionic phospholipids such as phosphatidylserine. Although a number of mVP40 cationic residues have been shown to facilitate binding to membranes containing anionic lipids, much less is known on how mVP40 assembles to form the matrix layer following membrane binding. Here we have used hydrogen/deuterium exchange (HDX) mass spectrometry to determine the solvent accessibility of mVP40 residues in the absence and presence of phosphatidylserine and phosphatidylinositol 4,5-bisphosphate. HDX analysis demonstrates that two basic loops in the mVP40 C-terminal domain make important contributions to anionic membrane binding and also reveals a potential oligomerization interface in the C-terminal domain as well as a conserved oligomerization interface in the mVP40 N-terminal domain. Lipid binding assays confirm the role of the two basic patches elucidated with HD/X measurements, whereas molecular dynamics simulations and membrane insertion measurements complement these studies to demonstrate that mVP40 does not appreciably insert into the hydrocarbon region of anionic membranes in contrast to the matrix protein from Ebola virus. Taken together, we propose a model by which association of the mVP40 dimer with the anionic plasma membrane facilitates assembly of mVP40 oligomers. PMID:28167534

Detection of lipid-induced structural changes of the Marburg virus matrix protein VP40 using hydrogen/deuterium exchange-mass spectrometry.

PubMed

Wijesinghe, Kaveesha J; Urata, Sarah; Bhattarai, Nisha; Kooijman, Edgar E; Gerstman, Bernard S; Chapagain, Prem P; Li, Sheng; Stahelin, Robert V

2017-04-14

Marburg virus (MARV) is a lipid-enveloped virus from the Filoviridae family containing a negative sense RNA genome. One of the seven MARV genes encodes the matrix protein VP40, which forms a matrix layer beneath the plasma membrane inner leaflet to facilitate budding from the host cell. MARV VP40 (mVP40) has been shown to be a dimeric peripheral protein with a broad and flat basic surface that can associate with anionic phospholipids such as phosphatidylserine. Although a number of mVP40 cationic residues have been shown to facilitate binding to membranes containing anionic lipids, much less is known on how mVP40 assembles to form the matrix layer following membrane binding. Here we have used hydrogen/deuterium exchange (HDX) mass spectrometry to determine the solvent accessibility of mVP40 residues in the absence and presence of phosphatidylserine and phosphatidylinositol 4,5-bisphosphate. HDX analysis demonstrates that two basic loops in the mVP40 C-terminal domain make important contributions to anionic membrane binding and also reveals a potential oligomerization interface in the C-terminal domain as well as a conserved oligomerization interface in the mVP40 N-terminal domain. Lipid binding assays confirm the role of the two basic patches elucidated with HD/X measurements, whereas molecular dynamics simulations and membrane insertion measurements complement these studies to demonstrate that mVP40 does not appreciably insert into the hydrocarbon region of anionic membranes in contrast to the matrix protein from Ebola virus. Taken together, we propose a model by which association of the mVP40 dimer with the anionic plasma membrane facilitates assembly of mVP40 oligomers. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular characterization of serotype Asia-1 foot-and-mouth disease viruses in Pakistan and Afghanistan; emergence of a new genetic Group and evidence for a novel recombinant virus.

PubMed

Jamal, Syed M; Ferrari, Giancarlo; Ahmed, Safia; Normann, Preben; Belsham, Graham J

2011-12-01

Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate appropriate vaccine selection and tracing of outbreaks. The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998-2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1 have circulated in Pakistan during this time. These are Group-II, -VI and, recently, a novel Group (designated here as Group-VII). This new Group has not been detected in neighbouring Afghanistan during the study period but viruses from Groups I and -II are in circulation there. Using near complete genome sequences, from FMD viruses of serotypes Asia-1 and A that are currently circulating in Pakistan, we have identified an interserotypic recombinant virus, which has the VP2-VP3-VP1-2A coding sequences derived from a Group-VII Asia-1 virus and the remainder of the genome from a serotype A virus of the A-Iran05(AFG-07) sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

Increased Expression of Laminin Subunit Alpha 1 Chain by dCas9-VP160.

PubMed

Perrin, Arnaud; Rousseau, Joël; Tremblay, Jacques P

2017-03-17

Laminin-111 protein complex links the extracellular matrix to integrin α7β1 in sarcolemma, thus replacing in dystrophic muscles links normally insured by the dystrophin complex. Laminin-111 injection in mdx mouse stabilized sarcolemma, restored serum creatine kinase to wild-type levels, and protected muscles from exercised-induced damages. These results suggested that increased laminin-111 is a potential therapy for DMD. Laminin subunit beta 1 and laminin subunit gamma 1 are expressed in adult human muscle, but laminin subunit alpha 1 (LAMA1) gene is expressed only during embryogenesis. We thus developed an alternative method to laminin-111 protein repeated administration by inducing expression of the endogenous mouse Lama1 gene. This was done with the CRSPR/Cas9 system, i.e., by targeting the Lama1 promoter with one or several gRNAs and a dCas9 coupled with the VP160 transcription activation domain. Lama1 mRNA (qRT-PCR) and proteins (immunohistochemistry and western blot) were not detected in the control C2C12 myoblasts and in control muscles. However, significant expression was observed in cells transfected and in mouse muscles electroporated with plasmids coding for dCas9-VP160 and a gRNA. Larger synergic increases were observed by using two or three gRNAs. The increased Lama1 expression did not modify the expression of the α7 and β1 integrins. Increased expression of Lama1 by the CRISPR/Cas9 system will have to be further investigated by systemic delivery of the CRISPR/Cas9 components to verify whether this could be a treatment for several myopathies. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Expression and responses to dehydration and salinity stresses of V-PPase gene members in wheat.

PubMed

Wang, Yuezhi; Xu, Haibin; Zhang, Guangxiang; Zhu, Huilan; Zhang, Lixia; Zhang, Zhengzhi; Zhang, Caiqin; Ma, Zhengqiang

2009-12-01

Vacuolar H(+)-translocating pyrophosphatase (V-PPase) is a key enzyme related to plant growth as well as abiotic stress tolerance. In this work, wheat V-PPase genes TaVP1, TaVP2 and TaVP3 were identified. TaVP1 and TaVP2 are more similar to each other than to TaVP3. Their deduced polypeptide sequences preserve the topological structure and essential residues of V-PPases. Phylogenetic studies suggested that monocot plants, at least monocot grasses, have three VP paralogs. TaVP3 transcripts were only detected in developing seeds, and no TaVP2 transcripts were found in germinating seeds. TaVP2 was mainly expressed in shoot tissues and down-regulated in leaves under dehydration. Its expression was up-regulated in roots under high salinity. TaVP1 was relatively more ubiquitously and evenly expressed than TaVP2. Its expression level in roots was highest among the tissues examined, and was inducible by salinity stress. These results indicated that the V-PPase gene paralogs in wheat are differentially regulated spatially and in response to dehydration and salinity stresses. 2009 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

VP3 is crucial for the stability of Nora virus virions.

PubMed

Sadanandan, Sajna Anand; Ekström, Jens-Ola; Jonna, Venkateswara Rao; Hofer, Anders; Hultmark, Dan

2016-09-02

Nora virus is an enteric virus that causes persistent, non-pathological infection in Drosophila melanogaster. It replicates in the fly gut and is transmitted via the fecal-oral route. Nora virus has a single-stranded positive-sense RNA genome, which is translated in four open reading frames. Reading frame three encodes the VP3 protein, the structure and function of which we have investigated in this work. We have shown that VP3 is a trimer that has an α-helical secondary structure, with a functionally important coiled-coil domain. In order to identify the role of VP3 in the Nora virus life cycle, we constructed VP3-mutants using the cDNA clone of the virus. Our results show that VP3 does not have a role in the actual assembly of the virus particles, but virions that lack VP3 or harbor VP3 with a disrupted coiled coil domain are incapable of transmission via the fecal-oral route. Removing the region downstream of the putative coiled coil appears to have an effect on the fitness of the virus but does not hamper its replication or transmission. We also found that the VP3 protein and particularly the coiled coil domain are crucial for the stability of Nora virus virions when exposed to heat or proteases. Hence, we propose that VP3 is imperative to Nora virus virions as it confers stability to the viral capsid. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Remote sensing measurements of sea surface temperature as an indicator of Vibrio parahaemolyticus in oyster meat and human illnesses.

PubMed

Konrad, Stephanie; Paduraru, Peggy; Romero-Barrios, Pablo; Henderson, Sarah B; Galanis, Eleni

2017-08-31

Vibrio parahaemolyticus (Vp) is a naturally occurring bacterium found in marine environments worldwide. It can cause gastrointestinal illness in humans, primarily through raw oyster consumption. Water temperatures, and potentially other environmental factors, play an important role in the growth and proliferation of Vp in the environment. Quantifying the relationships between environmental variables and indicators or incidence of Vp illness is valuable for public health surveillance to inform and enable suitable preventative measures. This study aimed to assess the relationship between environmental parameters and Vp in British Columbia (BC), Canada. The study used Vp counts in oyster meat from 2002-2015 and laboratory confirmed Vp illnesses from 2011-2015 for the province of BC. The data were matched to environmental parameters from publicly available sources, including remote sensing measurements of nighttime sea surface temperature (SST) obtained from satellite readings at a spatial resolution of 1 km. Using three separate models, this paper assessed the relationship between (1) daily SST and Vp counts in oyster meat, (2) weekly mean Vp counts in oysters and weekly Vp illnesses, and (3) weekly mean SST and weekly Vp illnesses. The effects of salinity and chlorophyll a were also evaluated. Linear regression was used to quantify the relationship between SST and Vp, and piecewise regression was used to identify SST thresholds of concern. A total of 2327 oyster samples and 293 laboratory confirmed illnesses were included. In model 1, both SST and salinity were significant predictors of log(Vp) counts in oyster meat. In model 2, the mean log(Vp) count in oyster meat was a significant predictor of Vp illnesses. In model 3, weekly mean SST was a significant predictor of weekly Vp illnesses. The piecewise regression models identified a SST threshold of approximately 14 o C for both model 1 and 3, indicating increased risk of Vp in oyster meat and Vp illnesses at higher temperatures. Monitoring of SST, particularly through readily accessible remote sensing data, could serve as a warning signal for Vp and help inform the introduction and cessation of preventative or control measures.

VP7: an attachment protein of bluetongue virus for cellular receptors in Culicoides variipennis.

PubMed

Xu, G; Wilson, W; Mecham, J; Murphy, K; Zhou, E M; Tabachnick, W

1997-07-01

The importance of VP7 of bluetongue virus (BTV) in the binding of BTV to membrane proteins of the BTV vector Culicoides variipennis was investigated. Core BTV particles, prepared from whole viruses, lacked outer proteins VP2 and VP5 and had VP7 exposed. More core particles and whole viruses bound to membrane preparations of adults of C. variipennis and KC cells, which were cultured from this vector insect, than to membrane preparations of Manduca sexta larvae. More core particles than whole viruses bound to membrane preparations of adults of C. variipennis and KC cells. Polyclonal anti-idiotypic antibodies (anti-Id), which were made against an antigen-combining region of an anti-BTV-10 VP7 antibody and functionally mimicked VP7, bound more to the membrane preparations of adults of C. variipennis and KC cells, and less to cytosol preparations. In Western overalay analysis, the Culicoides plasma membrane preparation reduced binding of an anti-VP7 monoclonal antibody to VP7. Whole and core BTV particles and the anti-Id bound to a membrane protein with a molecular mass of 23 kDa that was present predominantly in membrane preparations of adults of C. variipennis and KC cells. This protein was present in much lower concentrations in membrane preparations of C6/36 and DM-2 insect cells.

First genetic characterization of rotavirus C in Russia.

PubMed

Zhirakovskaia, Elena; Tikunov, Artem; Klemesheva, Vera; Loginovskikh, Natalia; Netesov, Sergey; Tikunova, Nina

2016-04-01

Rotaviruses C (RVC) cause sporadic cases and outbreaks of diarrhea in humans and animals worldwide. The aim of this study was to monitor RVC during a surveillance study of sporadic cases of viral gastroenteritis in the Novosibirsk and Omsk regions of Russia from 2006 to 2011. A total of 2144 stool samples from children and adults hospitalized with acute gastroenteritis were tested for RVC by RT-PCR. Sixteen RVC-positive stool samples were detected at a rate of 0.6% (13/2037) in children and 2.8% (3/107) in adults. The low detection rate suggested that RVC infection was an uncommon cause of hospitalization in Russia. The complete VP7, VP4, VP6, and NSP4 gene sequences were determined. It was found that RVCs with at least two different genome backgrounds circulated in Siberia. VP4, VP6, and NSP4 gene sequences of most Russian RVC strains clustered with South Asian strains, while the VP7 gene showed a closer relationship to European strains. Meanwhile, only VP4 and NSP4 sequences of the strain Omsk08-386 clustered with South Asian strains, while its VP6 and VP7 sequences clustered with European strains. This is the first genetic characterization of Russian RVC strains and the first report on the prevalence of RVC in the Asian part of Russia. Copyright © 2016 Elsevier B.V. All rights reserved.

Value of 100 kVp scan with sinogram-affirmed iterative reconstruction algorithm on a single-source CT system during whole-body CT for radiation and contrast medium dose reduction: an intra-individual feasibility study.

PubMed

Nagayama, Y; Nakaura, T; Oda, S; Tsuji, A; Urata, J; Furusawa, M; Tanoue, S; Utsunomiya, D; Yamashita, Y

2018-02-01

To perform an intra-individual investigation of the usefulness of a contrast medium (CM) and radiation dose-reduction protocol using single-source computed tomography (CT) combined with 100 kVp and sinogram-affirmed iterative reconstruction (SAFIRE) for whole-body CT (WBCT; chest-abdomen-pelvis CT) in oncology patients. Forty-three oncology patients who had undergone WBCT under both 120 and 100 kVp protocols at different time points (mean interscan intervals: 98 days) were included retrospectively. The CM doses for the 120 and 100 kVp protocols were 600 and 480 mg iodine/kg, respectively; 120 kVp images were reconstructed with filtered back-projection (FBP), whereas 100 kVp images were reconstructed with FBP (100 kVp-F) and the SAFIRE (100 kVp-S). The size-specific dose estimate (SSDE), iodine load and image quality of each protocol were compared. The SSDE and iodine load of 100 kVp protocol were 34% and 21%, respectively, lower than of 120 kVp protocol (SSDE: 10.6±1.1 versus 16.1±1.8 mGy; iodine load: 24.8±4versus 31.5±5.5 g iodine, p<0.01). Contrast enhancement, objective image noise, contrast-to-noise-ratio, and visual score of 100 kVp-S were similar to or better than of 120 kVp protocol. Compared with the 120 kVp protocol, the combined use of 100 kVp and SAFIRE in WBCT for oncology assessment with an SSCT facilitated substantial reduction in the CM and radiation dose while maintaining image quality. Copyright © 2017 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

Coinfection with recombinant vaccinia viruses expressing poliovirus P1 and P3 proteins results in polyprotein processing and formation of empty capsid structures.

PubMed

Ansardi, D C; Porter, D C; Morrow, C D

1991-04-01

The assembly process of poliovirus occurs via an ordered proteolytic processing of the capsid precursor protein, P1, by the virus-encoded proteinase 3CD. To further delineate this process, we have isolated a recombinant vaccinia virus which expresses, upon infection, the poliovirus P1 capsid precursor polyprotein with an authentic carboxy terminus. Coinfection of HeLa cells with the P1-expressing vaccinia virus and with a second recombinant vaccinia virus which expresses the poliovirus proteinase 3CD resulted in the correct processing of P1 to yield the three individual capsid proteins VP0, VP3, and VP1. When extracts from coinfected cells were fractionated on sucrose density gradients, the VP0, VP3, and VP1 capsid proteins were immunoprecipitated with type 1 poliovirus antisera from fractions corresponding to a sedimentation consistent for poliovirus 75S procapsids. Examination of these fractions by electron microscopy revealed structures which lacked electron-dense cores and which corresponded in size and shape to those expected for poliovirus empty capsids. We conclude that the expression of the two poliovirus proteins P1 and 3CD in coinfected cells is sufficient for the correct processing of the capsid precursor to VP0, VP3, and VP1 as well as for the assembly of poliovirus empty capsid-like structures.

Integrin-Using Rotaviruses Bind α2β1 Integrin α2 I Domain via VP4 DGE Sequence and Recognize αXβ2 and αVβ3 by Using VP7 during Cell Entry

PubMed Central

Graham, Kate L.; Halasz, Peter; Tan, Yan; Hewish, Marilyn J.; Takada, Yoshikazu; Mackow, Erich R.; Robinson, Martyn K.; Coulson, Barbara S.

2003-01-01

Integrins α2β1, αXβ2, and αVβ3 have been implicated in rotavirus cell attachment and entry. The virus spike protein VP4 contains the α2β1 ligand sequence DGE at amino acid positions 308 to 310, and the outer capsid protein VP7 contains the αXβ2 ligand sequence GPR. To determine the viral proteins and sequences involved and to define the roles of α2β1, αXβ2, and αVβ3, we analyzed the ability of rotaviruses and their reassortants to use these integrins for cell binding and infection and the effect of peptides DGEA and GPRP on these events. Many laboratory-adapted human, monkey, and bovine viruses used integrins, whereas all porcine viruses were integrin independent. The integrin-using rotavirus strains each interacted with all three integrins. Integrin usage related to VP4 serotype independently of sialic acid usage. Analysis of rotavirus reassortants and assays of virus binding and infectivity in integrin-transfected cells showed that VP4 bound α2β1, and VP7 interacted with αXβ2 and αVβ3 at a postbinding stage. DGEA inhibited rotavirus binding to α2β1 and infectivity, whereas GPRP binding to αXβ2 inhibited infectivity but not binding. The truncated VP5* subunit of VP4, expressed as a glutathione S-transferase fusion protein, bound the expressed α2 I domain. Alanine mutagenesis of D308 and G309 in VP5* eliminated VP5* binding to the α2 I domain. In a novel process, integrin-using viruses bind the α2 I domain of α2β1 via DGE in VP4 and interact with αXβ2 (via GPR) and αVβ3 by using VP7 to facilitate cell entry and infection. PMID:12941907

Receiver function analysis of the Texas Gulf Coast to better understand the Ouachita Orogeny, opening of the Gulf of Mexico, and current state of the southern margin of North America

NASA Astrophysics Data System (ADS)

Knuppel, M.; Pratt, K. W.; Evanzia, D.; Gurrola, H.; Pulliam, J.

2012-12-01

For the past two years, Texas Tech and Baylor universities have been operating 21 broadband seismic stations extending from Matagorda Island, crossing the Gulf Coast plain and Balcones fault, ending in the middle of the Llano Uplift at Johnson City, Texas. The goal of this project is to image the basement to better understand the opening of the Gulf of Mexico (GOM) and the stabilization of the southern lithosphere of North America. In this presentation we will present preliminary results of receiver function analysis of data recorded by our broadband array. Using 18 months' of data we performed common conversion point (CCP) stack imaging of the crust and lithosphere along the profile and have produced a cross section showing receiver function derived Vp/Vs ratios along the profile. The strongest phase on the CCP stack is the Ps phase from the base of a 15 to 20-km-deep (at the shoreline) sedimentary basin that shallows to approximately 1 km deep at the Balcones fault. Vp/Vs analysis shows that this sedimentary unit has Vp/Vs ratios between 1.9 and 2.0. This unusually high Vp/Vs ratio is consistent with the basin being dominated by poorly consolidated, relatively young clastic sediment. This layer pinches out to the northwest. No clear Ps phase is observed from base of the Mesozoic carbonates and Ouachita-related sediments that we believe is several kilometers thick, based on observed Vp/Vs ratios of 1.85 to 1.9 (which is more consistent with carbonate rock than granitic basement). The pattern of Vp/Vs implies near-vertical, crust-wide displacement along the Balcones Fault. The Moho appears to be 15 to 20 km deep near the ocean but descends to more than 40 km beneath the Llano uplift. There is a strong Ps phase from about 70 km depth near the coastline that we interpret as remnant depleted mantle from the rifting of the GOM. The region between this P70s phase and the Moho appear to have a low Vp/Vs ratio (~1.75), which would be consistent with mantle depleted in iron as a result of rifting during the opening of the Gulf of Mexico.

Velocities of Subducted Sediments and Continents

NASA Astrophysics Data System (ADS)

Hacker, B. R.; van Keken, P. E.; Abers, G. A.; Seward, G.

2009-12-01

The growing capability to measure seismic velocities in subduction zones has led to unusual observations. For example, although most minerals have VP/ VS ratios around 1.77, ratios <1.7 and >1.8 have been observed. Here we explore the velocities of subducted sediments and continental crust from trench to sub-arc depths using two methods. (1) Mineralogy was calculated as a function of P & T for a range of subducted sediment compositions using Perple_X, and rock velocities were calculated using the methodology of Hacker & Abers [2004]. Calculated slab-top temperatures have 3 distinct depth intervals with different dP/dT gradients that are determined by how coupling between the slab and mantle wedge is modeled. These three depth intervals show concomitant changes in VP and VS: velocities initially increase with depth, then decrease beyond the modeled decoupling depth where induced flow in the wedge causes rapid heating, and increase again at depth. Subducted limestones, composed chiefly of aragonite, show monotonic increases in VP/ VS from 1.63 to 1.72. Cherts show large jumps in VP/ VS from 1.55-1.65 to 1.75 associated with the quartz-coesite transition. Terrigenous sediments dominated by quartz and mica show similar, but more-subdued, transitions from ~1.67 to 1.78. Pelagic sediments dominated by mica and clinopyroxene show near-monotonic increases in VP/ VS from 1.74 to 1.80. Subducted continental crust that is too dry to transform to high-pressure minerals has a VP/ VS ratio of 1.68-1.70. (2) Velocity anisotropy calculations were made for the same P-T dependent mineralogies using the Christoffel equation and crystal preferred orientations measured via electron-backscatter diffraction for typical constituent phases. The calculated velocity anisotropies range from 5-30%. For quartz-rich rocks, the calculated velocities show a distinct depth dependence because crystal slip systems and CPOs change with temperature. In such rocks, the fast VP direction varies from slab-normal at shallow depths through trench-parallel at moderate depths to down-dip approaching sub-arc depths. Vertically incident waves have VP/ VS of 1.7-1.3 over the same range of depths, waves propagating up dip have VP/ VS of 1.7-1.3, and waves propagating along the slab at constant depth have VP/ VS of 1.7-1.45. These remarkably low VP/ VS ratios are due to the anomalous elastic behavior of quartz. More aluminous lithologies have elevated VP/ VS ratios: 1.85 for slab-normal waves, 1.75 for trench-parallel waves, and 1.65 for down-dip waves. Subducted continental crust that is too dry to transform to high-pressure minerals has relatively ordinary VP/ VS ratio of 1.71-1.75 for vertically incident waves, 1.6-1.7 for waves propagating up dip, and 1.65-1.75 for waves propagating along the slab. Thus, subducted mica-rich sediments can have high VP/ VS ratios, whereas quartzose lithologies generate low VP/ VS ratios.

Genetic variation of the VP1 gene of the virulent duck hepatitis A virus type 1 (DHAV-1) isolates in Shandong province of China.

PubMed

Gao, Jiming; Chen, Junhao; Si, Xingkui; Xie, Zhijing; Zhu, Yanli; Zhang, Xingxiao; Wang, Shujing; Jiang, Shijin

2012-08-01

To investigate the relationship of the variation of virulence and the external capsid proteins of the pandemic duck hepatitis A virus type 1 (DHAV-1) isolates, the virulence, cross neutralization assays and the complete sequence of the virion protein 1 (VP1) gene of nine virulent DHAV-1 strains, which were isolated from infected ducklings with clinical symptoms in Shandong province of China in 2007-2008, were tested. The fifth generation duck embryo allantoic liquids of the 9 isolates were tested on 12-day-old duck embryos and on 7-day-old ducklings for the median embryonal lethal doses (ELD(50)s) and the median lethal doses (LD(50)s), respectively. The results showed that the ELD(50)s of embryonic duck eggs of the 9 DHAV-1 isolates were between 1.9 × 10(6)/mL to 1.44 × 10(7)/mL, while the LD(50)s were 2.39 × 10(5)/mL to 6.15 × 10(6)/mL. Cross-neutralization tests revealed that the 9 DHAV-1 isolates were completely neutralized by the standard serum and the hyperimmune sera against the 9 DHAV-1 isolates, respectively. Compared with other virulent, moderate virulent, attenuated vaccine and mild strains, the VP1 genes of the 9 strains shared 89.8%-99.7% similarity at the nucleotide level and 92.4%-99.6% at amino acid level with other DHAV-1 strains. There were three hypervariable regions at the C-terminus (aa 158-160, 180-193 and 205-219) and other variable points in VP1 protein, but which didn't cause virulence of DHAV-1 change.

Characterization of genome sequences and clinical features of coxsackievirus A6 strains collected in Hyogo, Japan in 1999-2013.

PubMed

Ogi, Miki; Yano, Yoshihiko; Chikahira, Masatsugu; Takai, Denshi; Oshibe, Tomohiro; Arashiro, Takeshi; Hanaoka, Nozomu; Fujimoto, Tsuguto; Hayashi, Yoshitake

2017-08-01

Coxsackievirus A6 (CV-A6) is an enterovirus, which is known to cause herpangina. However, since 2009 it has frequently been isolated from children with hand, foot, and mouth disease (HFMD). In Japan, CV-A6 has been linked to HFMD outbreaks in 2011 and 2013. In this study, the full-length genome sequencing of CV-A6 strains were analyzed to identify the association with clinical manifestations. Five thousand six hundred and twelve children with suspected enterovirus infection (0-17 years old) between 1999 and 2013 in Hyogo Prefecture, Japan, were enrolled. Enterovirus infection was confirmed with reverse transcriptase-PCR in 753 children (791 samples), 127 of whom (133 samples) were positive for CV-A6 based on the direct sequencing of the VP4 region. The complete genomes of CV-A6 from 22 positive patients with different clinical manifestations were investigated. A phylogenetic analysis divided these 22 strains into two clusters based on the VP1 region; cluster I contained strains collected in 1999-2009 and mostly related to herpangina, and cluster II contained strains collected in 2011-2013 and related to HFMD outbreak. Based on the full-length polyprotein analysis, the amino acid differences between the strains in cluster I and II were 97.7 ± 0.28%. Amino acid differences were detected in 17 positions within the polyprotein. Strains collected in 1999-2009 and those in 2011-2013 were separately clustered by phylogenetic analysis based on 5'UTR and 3Dpol region, as well as VP1 region. In conclusion, HFMD outbreaks by CV-A6 were recently frequent in Japan and the accumulation of genomic change might be associated with the clinical course. © 2017 Wiley Periodicals, Inc.

Human Rhinovirus 87 and Enterovirus 68 Represent a Unique Serotype with Rhinovirus and Enterovirus Features

PubMed Central

Blomqvist, Soile; Savolainen, Carita; Råman, Laura; Roivainen, Merja; Hovi, Tapani

2002-01-01

It has recently been reported that all but one of the 102 known serotypes of the genus Rhinovirus segregate into two genetic clusters (C. Savolainen, S. Blomqvist, M. N. Mulders, and T. Hovi, J. Gen. Virol. 83:333-340, 2002). The only exception is human rhinovirus 87 (HRV87). Here we demonstrate that HRV87 is genetically and antigenically highly similar to enterovirus 68 (EV68) and is related to EV70, the other member of human enterovirus group D. The partial nucleotide sequences of the 5′ untranslated region, capsid regions VP4/VP2 and VP1, and the 3D RNA polymerase gene of the HRV87 prototype strain F02-3607 Corn showed 97.3, 97.8, 95.2, and 95.9% identity to the corresponding regions of EV68 prototype strain Fermon. The amino acid identities were 100 and 98.1% for the products of the two capsid regions and 97.9% for 3D RNA polymerase. Antigenic cross-reaction between HRV87 and EV68 was indicated by microneutralization with monotypic antisera. Phylogenetic analysis showed definite clustering of HRV87 and EV68 with EV70 for all sequences examined. Both HRV87 and EV68 were shown to be acid sensitive by two different assays, while EV70 was acid resistant, which is typical of enteroviruses. The cytopathic effect induced by HRV87 or EV68 was inhibited by monoclonal antibodies to the decay-accelerating factor known to be the receptor of EV70. We conclude that HRV87 and EV68 are strains of the same picornavirus serotype presenting features of both rhinoviruses and enteroviruses. PMID:12409401

Identification of three PPV1 VP2 protein-specific B cell linear epitopes using monoclonal antibodies against baculovirus-expressed recombinant VP2 protein.

PubMed

Sun, Jianhui; Huang, Liping; Wei, Yanwu; Wang, Yiping; Chen, Dongjie; Du, Wenjuan; Wu, Hongli; Feng, Li; Liu, Changming

2015-11-01

Porcine parvovirus type 1 (PPV1) is a major causative agent of embryonic and fetal death in swine. The PPV1 VP2 protein is closely associated with viral immunogenicity for eliciting neutralizing antibodies, but its antigenic structures have been largely unknown. We generated three monoclonal antibodies (MAbs) against baculovirus-expressed recombinant PPV1 VP2 protein. A PEPSCAN analysis identified the minimal B cell linear epitopes of PPV1 VP2 based on these MAbs. Three core epitopes, (228)QQITDA(233), (284)RSLGLPPK(291), and (344)FEYSNGGPFLTPI(356), were defined and mapped onto three-dimensional models of the PPV1 virion and VP2 monomer. The epitope (228)QQITDA(233) is exposed on the virion surface, and the other two are located inside the protein. An alignment of the PPV1 VP2 amino acid sequences showed that (284)RSLGLPPK(291) and (344)FEYSNGGPFLTPI(356) are absolutely conserved, whereas (228)QQITDA(233) has a single substitution at residue 233 in some (S → A or T). We developed a VP2 epitope-based indirect enzyme-linked immunosorbent assay (iELISA) to test for anti-PPV1 antibodies. In a comparative analysis with an immunoperoxidase monolayer assay using 135 guinea pig sera, the VP2-epitope-based iELISA had a concordance rate of 85.19 %, sensitivity of 83.33 %, and specificity of 85.47 %. MAb 8H6 was used to monitor VP2 during the PPV1 replication cycle in vitro with an indirect immunofluorescence assay, which indicated that newly encapsulated virions are released from the nucleus at 24 h postinfection and the PPV1 replication cycle takes less than 24 h. This study provides valuable information clarifying the antigenic structure of PPV1 VP2 and lays the foundations for PPV1 serodiagnosis and antigen detection.

Protection against Foot-and-Mouth Disease Virus in Guinea Pigs via Oral Administration of Recombinant Lactobacillus plantarum Expressing VP1

PubMed Central

Wang, Miao; Pan, Li; Zhou, Peng; Lv, Jianliang; Zhang, Zhongwang; Wang, Yonglu; Zhang, Yongguang

2015-01-01

Mucosal vaccination is an effective strategy for generating antigen-specific immune responses against mucosal infections of foot-and-mouth disease virus (FMDV). In this study, Lactobacillus plantarum strains NC8 and WCFS1 were used as oral delivery vehicles containing a pSIP411-VP1 recombinant plasmid to initiate mucosal and systemic immune responses in guinea pigs. Guinea pigs were orally vaccinated (three doses) with NC8-pSIP411, NC8-pSIP411-VP1, WCFS1-pSIP411, WCFS1-pSIP411-VP1 or milk. Animals immunized with NC8-pSIP411-VP1 and WCFS1-pSIP411-VP1 developed high levels of antigen-specific serum IgG, IgA, IgM, mucosal secretory IgA (sIgA) and neutralizing antibodies, and revealed stronger cell-mediated immune responses and enhanced protection against FMDV challenge compared with control groups. The recombinant pSIP411-VP1 effectively improved immunoprotection against FMDV in guinea pigs. PMID:26629822

VpRFP1, a novel C4C4-type RING finger protein gene from Chinese wild Vitis pseudoreticulata, functions as a transcriptional activator in defence response of grapevine

PubMed Central

Yu, Yihe; Xu, Weirong; Wang, Shengyi; Xu, Yan; Li, Hui'e; Wang, Yuejin; Li, Shuxiu

2011-01-01

RING finger proteins comprise a large family and play important roles in regulation of growth and development, hormone signalling, and responses to biotic and abiotic stresses in plants. In this study, the identification and functional characterization of a C4C4-type RING finger protein gene from the Chinese wild grapevine Vitis pseudoreticulata (designated VpRFP1) are reported. VpRFP1 was initially identified as an expressed sequence tag (EST) from a cDNA library constructed from leaves of V. pseudoreticulata inoculated with the grapevine powdery mildew Uncinula necator. Sequence analysis of the deduced VpRFP1 protein based on the full-length cDNA revealed an N-terminal nuclear localization signal (NLS) and a C-terminal C4C4-type RING finger motif with the consensus sequence Cys-X2-Cys-X13-Cys-X1-Cys-X4-Cys-X2-Cys-X10-Cys-X2-Cys. Upon inoculation with U. necator, expression of VpRFP1 was rapidly induced to higher levels in mildew-resistant V. pseudoreticulata plants. In contrast, expression of VpRFP1 was down-regulated in mildew-susceptible V. vinifera plants. Western blotting using an antibody raised against VpRFP1 showed that VpRFP1 was also induced to higher levels in V. pseudoreticulata plants at 12–48 hours post-inoculation (hpi). However, there was only slight increase in VpRFP in V. vinifera plants in the same time frame, even though a more significant increase was observed at 96–144 hpi in these plants. Results from transactivation assays in yeast showed that the RING finger motif of VpRFP1 exhibited some activity of transcriptional activation; however, no activity was seen with the full-length VpRFP1. Overexpression of VpRFP1 in Arabidopsis plants was found to enhance resistance to Arabidopsis powdery mildew Golovinomyces cichoracearum, which seemed to be correlated with increased transcript levels of AtPR1 and AtPR2 in the pathogen-infected tissues. In addition, the Arabidopsis transgenic lines showed enhanced resistance to a virulent bacterial pathogen Pseudomonas syringae pv. tomato DC3000. Taken together, the results suggested that VpRFP1 may be a transcriptional activator of defence-related genes in grapevines. PMID:21862480

Role of protein phosphatase 1 in dephosphorylation of Ebola virus VP30 protein and its targeting for the inhibition of viral transcription.

PubMed

Ilinykh, Philipp A; Tigabu, Bersabeh; Ivanov, Andrey; Ammosova, Tatiana; Obukhov, Yuri; Garron, Tania; Kumari, Namita; Kovalskyy, Dmytro; Platonov, Maxim O; Naumchik, Vasiliy S; Freiberg, Alexander N; Nekhai, Sergei; Bukreyev, Alexander

2014-08-15

The filovirus Ebola (EBOV) causes the most severe hemorrhagic fever known. The EBOV RNA-dependent polymerase complex includes a filovirus-specific VP30, which is critical for the transcriptional but not replication activity of EBOV polymerase; to support transcription, VP30 must be in a dephosphorylated form. Here we show that EBOV VP30 is phosphorylated not only at the N-terminal serine clusters identified previously but also at the threonine residues at positions 143 and 146. We also show that host cell protein phosphatase 1 (PP1) controls VP30 dephosphorylation because expression of a PP1-binding peptide cdNIPP1 increased VP30 phosphorylation. Moreover, targeting PP1 mRNA by shRNA resulted in the overexpression of SIPP1, a cytoplasm-shuttling regulatory subunit of PP1, and increased EBOV transcription, suggesting that cytoplasmic accumulation of PP1 induces EBOV transcription. Furthermore, we developed a small molecule compound, 1E7-03, that targeted a non-catalytic site of PP1 and increased VP30 dephosphorylation. The compound inhibited the transcription but increased replication of the viral genome and completely suppressed replication of EBOV in cultured cells. Finally, mutations of Thr(143) and Thr(146) of VP30 significantly inhibited EBOV transcription and strongly induced VP30 phosphorylation in the N-terminal Ser residues 29-46, suggesting a novel mechanism of regulation of VP30 phosphorylation. Our findings suggest that targeting PP1 with small molecules is a feasible approach to achieve dysregulation of the EBOV polymerase activity. This novel approach may be used for the development of antivirals against EBOV and other filovirus species. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

PubMed

Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

2006-11-17

The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

Vasopressin in reaggregated cell cultures of the developing hypothalamus.

PubMed

Notter, M F; Gash, D M; Sladek, C D; Scharoun, S L

1984-03-01

A microsystem for rotation-mediated aggregate cell culture studies has been devised to examine vasopressin (VP) biosynthesis of developing rat hypothalamus. Trypsin-dispersed hypothalamic tissue was placed into 24 well tissue culture dishes and VP content of culture medium and cells was measured over time by a radioimmunoassay. Reaggregates formed within 4 hr when rotated at 70 rpm in a humid CO2 incubator. Nineteen days post coitus (dpc) hypothalamic reaggregates had 336 pg VP/10(6) cells while the medium showed 260 pg VP/ml after four days. Measurable VP was seen in fetal tissue after ten days while comparable amounts of VP were present in one day neonatal hypothalamus over this same period. Morphological examination of reaggregates indicated the presence of viable cells throughout the cell mass after ten days of culture. Co-cultivation studies with dispersed posterior pituitary indicated that reaggregates from one day neonate hypothalamus had significantly increased VP levels when co-cultured with one day neonatal posterior pituitary; however, this effect was not seen with 19 dpc co-cultures. These data demonstrate that development of neurosecretory activity of discrete regions of the hypothalamus can be examined early in vitro in a reaggregate cell culture system.

Identification of the two rotavirus genes determining neutralization specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Offit, P.A.; Blavat, G.

1986-01-01

Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.

Structural Characterization of H-1 Parvovirus: Comparison of Infectious Virions to Empty Capsids

PubMed Central

Halder, Sujata; Nam, Hyun-Joo; Govindasamy, Lakshmanan; Vogel, Michèle; Dinsart, Christiane; Salomé, Nathalie; McKenna, Robert

2013-01-01

The structure of single-stranded DNA (ssDNA) packaging H-1 parvovirus (H-1PV), which is being developed as an antitumor gene delivery vector, has been determined for wild-type (wt) virions and noninfectious (empty) capsids to 2.7- and 3.2-Å resolution, respectively, using X-ray crystallography. The capsid viral protein (VP) structure consists of an α-helix and an eight-stranded anti-parallel β-barrel with large loop regions between the strands. The β-barrel and loops form the capsid core and surface, respectively. In the wt structure, 600 nucleotides are ordered in an interior DNA binding pocket of the capsid. This accounts for ∼12% of the H-1PV genome. The wt structure is identical to the empty capsid structure, except for side chain conformation variations at the nucleotide binding pocket. Comparison of the H-1PV nucleotides to those observed in canine parvovirus and minute virus of mice, two members of the genus Parvovirus, showed both similarity in structure and analogous interactions. This observation suggests a functional role, such as in capsid stability and/or ssDNA genome recognition for encapsulation. The VP structure differs from those of other parvoviruses in surface loop regions that control receptor binding, tissue tropism, pathogenicity, and antibody recognition, including VP sequences reported to determine tumor cell tropism for oncotropic rodent parvoviruses. These structures of H-1PV provide insight into structural features that dictate capsid stabilization following genome packaging and three-dimensional information applicable for rational design of tumor-targeted recombinant gene delivery vectors. PMID:23449783

Isolation and characterization of a new enterovirus F in yak feces in the Qinghai-Tibetan Plateau.

PubMed

He, Huan; Tang, Cheng; Chen, Xinnuo; Yue, Hua; Ren, Yupeng; Liu, Yan; Zhang, Bin

2017-02-01

An enterovirus (EV) strain, designated as SWUN-AB001, was isolated in the Qinghai-Tibetan Plateau from a yak with severe diarrheal disease. The complete genome of strain SWUN-AB001 was 7,382 bp in length and shared 35.1-68.5% nt identities with bovine EVs belonging to a candidate new type EV-F7. Using the sequence difference values in the VP1 gene as a criterion for demarcating a new serotype/genotype in the Enterovirus genus, strain SWUN-AB001 had only a 71.1% nt and a 79.2% aa identity, in the VP1 region, with the most closely matched EV, further indicating that a new type of EV had been identified. Phylogenetic analysis of the nt sequence of the viral polyprotein and of VP1 genes demonstrated that the virus fell within the EV-F cluster, but was located in a unique lineage. Furthermore, a large-scale surveillance study indicated that the prevalence of this EV in yaks was 31.05% (95% CI = 25.5-37.6%) in 235 animals with diarrhea and 24.13% (95% CI = 17.4-32.4%) in 116 healthy yaks. However, there was no significant difference in virus prevalence between diarrheal and healthy samples. Interestingly, in the Tibet region, diarrheal feces had a higher incidence of EVs than feces of healthy yaks (odd ratios = 6.03, 95% CI = 1.93-18.86), indicating that the incidence of EV was potentially correlated with the clinical symptom of diarrhea in yaks.

Generation of a parvovirus B19 vaccine candidate.

PubMed

Chandramouli, Sumana; Medina-Selby, Angelica; Coit, Doris; Schaefer, Mary; Spencer, Terika; Brito, Luis A; Zhang, Pu; Otten, Gillis; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Settembre, Ethan C

2013-08-20

Parvovirus B19 is the causative agent of fifth disease in children, aplastic crisis in those with blood dyscrasias, and hydrops fetalis. Previous parvovirus B19 virus-like-particle (VLP) vaccine candidates were produced by co-infection of insect cells with two baculoviruses, one expressing wild-type VP1 and the other expressing VP2. In humans, the VLPs were immunogenic but reactogenic. We have developed new VLP-based parvovirus B19 vaccine candidates, produced by co-expressing VP2 and either wild-type VP1 or phospholipase-negative VP1 in a regulated ratio from a single plasmid in Saccharomyces cerevisiae. These VLPs are expressed efficiently, are very homogeneous, and can be highly purified. Although VP2 alone can form VLPs, in mouse immunizations, VP1 and the adjuvant MF59 are required to elicit a neutralizing response. Wild-type VLPs and those with phospholipase-negative VP1 are equivalently potent. The purity, homogeneity, yeast origin, and lack of phospholipase activity of these VLPs address potential causes of previously observed reactogenicity. Copyright © 2013 Elsevier Ltd. All rights reserved.

Essential role of the unordered VP2 n-terminal domain of the parvovirus MVM capsid in nuclear assembly and endosomal enlargement of the virion fivefold channel for cell entry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanchez-Martinez, Cristina; Grueso, Esther; Carroll, Miles

The unordered N-termini of parvovirus capsid proteins (Nt) are translocated through a channel at the icosahedral five-fold axis to serve for virus traffick. Heterologous peptides were genetically inserted at the Nt of MVM to study their functional tolerance to manipulations. Insertion of a 5T4-single-chain antibody at VP2-Nt (2Nt) yielded chimeric capsid subunits failing to enter the nucleus. The VEGFR2-binding peptide (V1) inserted at both 2Nt and VP1-Nt efficiently assembled in virions, but V1 disrupted VP1 and VP2 entry functions. The VP2 defect correlated with restricted externalization of V1-2Nt out of the coat. The specific infectivity of MVM and wtVP-pseudotyped mosaicmore » MVM-V1 virions, upon heating and/or partial 2Nt cleavage, demonstrated that some 2Nt domains become intracellularly translocated out of the virus shell and cleaved to initiate entry. The V1 insertion defines a VP2-driven endosomal enlargement of the channel as an essential structural rearrangement performed by the MVM virion to infect.« less

Proposals for the classification of human rhinovirus species A, B and C into genotypically assigned types

PubMed Central

McIntyre, Chloe L.; Knowles, Nick J.

2013-01-01

Human rhinoviruses (HRVs) frequently cause mild upper respiratory tract infections and more severe disease manifestations such as bronchiolitis and asthma exacerbations. HRV is classified into three species within the genus Enterovirus of the family Picornaviridae. HRV species A and B contain 75 and 25 serotypes identified by cross-neutralization assays, although the use of such assays for routine HRV typing is hampered by the large number of serotypes, replacement of virus isolation by molecular methods in HRV diagnosis and the poor or absent replication of HRV species C in cell culture. To address these problems, we propose an alternative, genotypic classification of HRV-based genetic relatedness analogous to that used for enteroviruses. Nucleotide distances between 384 complete VP1 sequences of currently assigned HRV (sero)types identified divergence thresholds of 13, 12 and 13 % for species A, B and C, respectively, that divided inter- and intra-type comparisons. These were paralleled by 10, 9.5 and 10 % thresholds in the larger dataset of >3800 VP4 region sequences. Assignments based on VP1 sequences led to minor revisions of existing type designations (such as the reclassification of serotype pairs, e.g. A8/A95 and A29/A44, as single serotypes) and the designation of new HRV types A101–106, B101–103 and C34–C51. A protocol for assignment and numbering of new HRV types using VP1 sequences and the restriction of VP4 sequence comparisons to type identification and provisional type assignments is proposed. Genotypic assignment and identification of HRV types will be of considerable value in the future investigation of type-associated differences in disease outcomes, transmission and epidemiology. PMID:23677786

VP and VS structure of the Yellowstone hot spot from teleseismic tomography: Evidence for an upper mantle plume

USGS Publications Warehouse

Waite, Gregory P.; Smith, Robert B.; Allen, Richard M.

2006-01-01

The movement of the lithosphere over a stationary mantle magmatic source, often thought to be a mantle plume, explains key features of the 16 Ma Yellowstone–Snake River Plain volcanic system. However, the seismic signature of a Yellowstone plume has remained elusive because of the lack of adequate data. We employ new teleseismic P and S wave traveltime data to develop tomographic images of the Yellowstone hot spot upper mantle. The teleseismic data were recorded with two temporary seismograph arrays deployed in a 500 km by 600 km area centered on Yellowstone. Additional data from nearby regional seismic networks were incorporated into the data set. The VP and VS models reveal a strong low-velocity anomaly from ∼50 to 200 km directly beneath the Yellowstone caldera and eastern Snake River Plain, as has been imaged in previous studies. Peak anomalies are −2.3% for VP and −5.5% for VS. A weaker, anomaly with a velocity perturbation of up to −1.0% VP and −2.5% VS continues to at least 400 km depth. This anomaly dips 30° from vertical, west-northwest to a location beneath the northern Rocky Mountains. We interpret the low-velocity body as a plume of upwelling hot, and possibly wet rock, from the mantle transition zone that promotes small-scale convection in the upper ∼200 km of the mantle and long-lived volcanism. A high-velocity anomaly, 1.2%VP and 1.9% VS, is located at ∼100 to 250 km depth southeast of Yellowstone and may represent a downwelling of colder, denser mantle material.

Clinical Value of Dual-energy CT in Detection of Pancreatic Adenocarcinoma: Investigation of the Best Pancreatic Tumor Contrast to Noise Ratio.

PubMed

He, Yong-Lan; Zhang, Da-Ming; Xue, Hua-Dan; Jin, Zheng-Yu

2013-01-01

Objective To quantitatively compare and determine the best pancreatic tumor contrast to noise ratio (CNR) in different dual-energy derived datasets. Methods In this retrospective, single center study, 16 patients (9 male, 7 female, average age 59.4±13.2 years) with pathologically diagnosed pancreatic cancer were enrolled. All patients received an abdominal scan using a dual source CT scanner 7 to 31 days before biopsy or surgery. After injection of iodine contrast agent, arterial and pancreatic parenchyma phase were scanned consequently, using a dual-energy scan mode (100 kVp/230 mAs and Sn 140 kVp/178 mAs) in the pancreatic parenchyma phase. A series of derived dual-energy datasets were evaluated including non-liner blending (non-linear blending width 0-500 HU; blending center -500 to 500 HU), mono-energetic (40-190 keV), 100 kVp and 140 kVp. On each datasets, mean CT values of the pancreatic parenchyma and tumor, as well as standard deviation CT values of subcutaneous fat and psoas muscle were measured. Regions of interest of cutaneous fat and major psoas muscle of 100 kVp and 140 kVp images were calculated. Best CNR of subcutaneous fat (CNRF) and CNR of the major psoas muscle (CNRM) of non-liner blending and mono-energetic datasets were calculated with the optimal mono-energetic keV setting and the optimal blending center/width setting for the best CNR. One Way ANOVA test was used for comparison of best CNR between different dual-energy derived datasets. Results The best CNRF (4.48±1.29) was obtained from the non-liner blending datasets at blending center -16.6±103.9 HU and blending width 12.3±10.6 HU. The best CNRF (3.28±0.97) was obtained from the mono-energetic datasets at 73.3±4.3 keV. CNRF in the 100 kVp and 140 kVp were 3.02±0.91 and 1.56±0.56 respectively. Using fat as the noise background, all of these images series showed significant differences (P<0.01) except best CNRF of mono-energetic image sets vs. CNRF of 100 kVp image (P=0.460). Similar results were found using muscle as the noise background (mono-energetic image vs. 100 kVp image: P=0.246; mono-energetic image vs. non-liner blending image: P=0.044; others: P<0.01). Conclusion Compared with mono-energetic datasets and low kVp datasets, non-linear blending image at automatically chosen blending width/window provides better tumor to the pancreas CNR, which might be beneficial for better detection of pancreatic tumors.

An image of P- to S-wave velocity ratios in the forearc of the Central Andean subduction zone

NASA Astrophysics Data System (ADS)

Wasja Bloch, Nikolai; Kummerow, Jörn; Wigger, Peter; Shapiro, Serge

2014-05-01

The ratio of seismic P- to S-wave velocities (the Vp/Vs ratio) of a given rock volume is a sensitive proxy for the detection of fluids and melts. In subduction regimes it has often been inferred from seismic tomography and been used, e.g., to detect pathways of ascending melt above the seismogenic zone, where tomographic methods have their highest resolution. We present Vp/Vs ratios that were computed using only seismic arrival time observations following the approach of Lin and Shearer (2007). This approach has its highest sensitivity in the source volume of a set of nearby seismic events and is hence particularly well suited to directly probe the plate interface. We present data from a temporary local network of short period seismometers that was in operation in the forearc of the Central Andean subduction zone at 21° S between 2005 and 2012. From this database we were able to localize 3253 seismic events (Ml ~0.5--4) with high precision, yielding a detailed image of the seismicity distribution in this region. Seismicity is pervasive within the entire crust of the South American continental plate and exhibits three distinct bands in the subducting slab, the lowermost one being located in the lithospheric mantle of the subducting plate. The highest concentration of seismic events is found in the contact zone between the continental and the oceanic lithosphere at depths between 30 and 50 km. We group seismic events into approximately 100 subsets of nearby events that origin from the same geological structure. For about half of these subsets we are able to extract a reliable local Vp/Vs ratio. In the middle continental crust, Vp/Vs ratios show slightly enhanced values (~1.75). In the lower continental crust towards the plate interface they tend to increase from this value updip and decrease downdip. At the plate interface itself, we observe higher Vp/Vs ratios (>1.8) at shallower depths (between 20 and 40 km). Downdip (40--60 km depth) Vp/Vs ratios decrease to rather typical values (~1.75). The same trend is observed in the lowermost band of mantle seismicity in the subducting slab. Below 80 km depth, where mineral transitions toward the eclogite facies are expected to occur, Vp/Vs ratios tend to be low (<1.75). The consistently high Vp/Vs ratios in the shallow part of the subducting slab hint at the presence of fluids in the porespace of the subducting lithosphere there. In the deeper part, downdip variations of Vp/Vs may be attributed to mineral phase transitions due to the changing P-T-conditions along the subduction pathway.

Herpes simplex virus 2 VP22 phosphorylation induced by cellular and viral kinases does not influence intracellular localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geiss, Brian J.; Cano, Gina L.; Tavis, John E.

2004-12-05

Phosphorylation of the herpes simplex virus (HSV) VP22 protein is regulated by cellular kinases and the UL13 viral kinase, but the sites at which these enzymes induce phosphorylation of HSV-2 VP22 are not known. Using serine-to-alanine mutants to map phosphorylation sites on HSV-2 VP22 in cells, we made three major observations. First, phosphorylation by a cellular kinase mapped to serines 70, 71, and/or 72 within CKII consensus sites analogous to previously identified phosphorylation sites in HSV-1 VP22. Second, we mapped UL13-mediated phosphorylation of HSV-2 VP22 to serines 28 and 34, describing for the first time UL13-dependent phosphorylation sites on VP22.more » Third, previously identified VP22-associated cellular kinase sites in HSV-1 VP22 (serines 292 and 294) were not phosphorylated in HSV-2 VP22 (serines 291 and 293). VP22 expressed alone accumulated in the cytoplasm and to a lesser extent in the nucleus. Phosphorylation by endogenous cellular kinase(s) did not alter the localization of VP22. Co-expression of HSV-2 VP22 with active UL13, but not with enzymatically inactive UL13, resulted in nuclear accumulation of VP22 and altered nuclear morphology. Surprisingly, redistribution of VP22 to the nucleus occurred independently of UL13-induced phosphorylation of VP22. The altered nuclear morphology of UL13-expressing cells was not due to apoptosis. These results demonstrate that phosphorylation of HSV-2 VP22 at multiple serine residues is induced by UL13 and cellular kinase(s), and that the nuclear/cytoplasmic distribution of VP22 is independent of its phosphorylation status but is controlled indirectly by UL13 kinase activity.« less

Detection of sinkholes or anomalies using full seismic wave fields : phase II.

DOT National Transportation Integrated Search

2016-08-01

A new 2-D Full Waveform Inversion (FWI) software code was developed to characterize layering and anomalies beneath the ground surface using seismic testing. The software is capable of assessing the shear and compression wave velocities (Vs and Vp) fo...

Expression and immunogenicity of novel subunit enterovirus 71 VP1 antigens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Juan; Department of Microbiology and Immunology, Nanjing Medical University; Wang, Shixia

Highlights: Black-Right-Pointing-Pointer EV71 is a major emerging infectious disease in many Asian countries. Black-Right-Pointing-Pointer Inactivated EV71 vaccines are in clinical studies but their safety and efficacy are unknown. Black-Right-Pointing-Pointer Developing subunit based EV71 vaccines is significant and novel antigen design is needed. Black-Right-Pointing-Pointer DNA immunization is an efficient tool to test the immunogenicity of VP1 based EV71 vaccines. Black-Right-Pointing-Pointer Multiple VP1 antigens are developed showing immunogenic potential. -- Abstract: Hand, foot, and mouth disease (HFMD) is a common viral illness in young children. HFMD is caused by viruses belonging to the enterovirus genus of the picornavirus family. Recently, enterovirus 71more » (EV71) has emerged as a virulent agent for HFMD with severe clinical outcomes. In the current report, we conducted a pilot antigen engineering study to optimize the expression and immunogenicity of subunit VP1 antigen for the design of EV71 vaccines. DNA immunization was adopted as a simple technical approach to test different designs of VP1 antigens without the need to express VP1 protein in vitro first. Our studies indicated that the expression and immunogenicity of VP1 protein can be improved with alternated VP1 antigen designs. Data presented in the current report revealed novel pathways to optimize the design of VP1 antigen-based EV71 vaccines.« less

Composition of the crust in the Grenville and Appalachian Provinces of North America inferred from VP/VS ratios

USGS Publications Warehouse

Musacchio, G.; Mooney, W.D.; Luetgert, J.H.; Christensen, N.I.

1997-01-01

We use the ratios between P and S wave velocities (VP/VS), derived from seismic refraction data, to infer the composition of the crust in the Grenville and the Appalachian Provinces of North America. The crust exhibits VP/VS increasing with depth from 1.64 to 1.84; there is a clear distinction between the Grenville Province (average VP/VS=1.81) and the Appalachian Province (average VP/VS=1.73) which persists at all depths. The boundary between these provinces is east dipping extending for 100 km east of the Champlain thrust. In the Appalachian Province the increase in VP/VS ratios with depth from 1.67 to 1.74 ?? 0.02 may reflect a normal decrease of silica content in the continental crust. In the Grenville Province beneath the Central Granulite Terrane, an anomalous VP/VS ratio of 1.82 ?? 0.02 is observed extending to a depth of 10 km; this correlates with the abundance of Ca-plagioclase in the Marcy Anorthosite. At greater depth (15-20 km), where seismic lamination and high electrical conductivity is observed, VP/VS is 1-84 ?? 0.02 and correlates with the Tahawus Complex, a layered mafic intrusion. Within the 25-km-thick lower crust of the Grenville Province the VP/VS is 1-84 ?? 0.02 and P-velocity is 7.0 ?? 0.1 km/s, which are typical for plagioclase-bearing rocks (gabbro-norite). The high VP/VS ratio in the Grenville Province has not been reported in crust of any other age. Since the Grenville Province contains 75% of the world's known anorthosites, high VP/VS ratio is related to high plagioclase. We suggest that the composition of the Grenville lower crust was significantly modified by the emplacement of the anorthosites in the mid-Proterozoic. Copyright 1997 by the American Geophysical Union.

Survey of molecular chaperone requirement for the biosynthesis of hamster polyomavirus VP1 protein in Saccharomyces cerevisiae.

PubMed

Valaviciute, Monika; Norkiene, Milda; Goda, Karolis; Slibinskas, Rimantas; Gedvilaite, Alma

2016-07-01

A number of viruses utilize molecular chaperones during various stages of their life cycle. It has been shown that members of the heat-shock protein 70 (Hsp70) chaperone family assist polyomavirus capsids during infection. However, the molecular chaperones that assist the formation of recombinant capsid viral protein 1 (VP1)-derived virus-like particles (VLPs) in yeast remain unclear. A panel of yeast strains with single chaperone gene deletions were used to evaluate the chaperones required for biosynthesis of recombinant hamster polyomavirus capsid protein VP1. The impact of deletion or mild overexpression of chaperone genes was determined in live cells by flow cytometry using enhanced green fluorescent protein (EGFP) fused with VP1. Targeted genetic analysis demonstrated that VP1-EGFP fusion protein levels were significantly higher in yeast strains in which the SSZ1 or ZUO1 genes encoding ribosome-associated complex components were deleted. The results confirmed the participation of cytosolic Hsp70 chaperones and suggested the potential involvement of the Ydj1 and Caj1 co-chaperones and the endoplasmic reticulum chaperones in the biosynthesis of VP1 VLPs in yeast. Likewise, the markedly reduced levels of VP1-EGFP in Δhsc82 and Δhsp82 yeast strains indicated that both Hsp70 and Hsp90 chaperones might assist VP1 VLPs during protein biosynthesis.

[Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

PubMed

Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

2011-01-01

To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.

Imaging the density distributions at the regional scale using full waveform and gravity data inversion - Application to the Pyrenees

NASA Astrophysics Data System (ADS)

Martin, Roland; Chevrot, Sébastien; Wang, Yi; Spangenberg, Hannah; Goubet, Marie; Monteiller, Vadim; Komatitsch, Dimitri; Seoane, Lucia; Dufréchou, Grégory

2017-04-01

We present a hybrid inversion method that allows us to image density distributions at the regional scale using both seismic and gravity data. One main goal is to obtain densities and seismic wave velocities (P and S) in the lithosphere with a fine resolution to get important constraints on the mineralogic composition and thermal state of the lithosphere. In the context of the Pyrenees (located between Spain and France), accurate Vp and Vs seismic velocity models are computed first on a 3D spectral element grid at the scale of the Pyrenees by inverting teleseismic full waveforms. In a second step, Vp velocities are mapped to densities using empirical relations to build an a priori density model. BGI and BRGM Bouguer gravity anomaly data sets are then inverted on the same 3D spectral element grid as the Vp model at a resolution of 1-2 km by using high-order numerical integration formulae. Solutions are compared to those obtained using classical semi-analytical techniques. This procedure opens the possibility to invert both teleseismic and gravity data on the same finite-element grid. It can handle topography of the free surface in the same spectral-element distorted mesh that is used to solve the wave equation, without performing extra interpolations between different grids and models. WGS84 curvature, SRTM or ETOPO1 topographies are used.

Immunogenicity of porcine P[6], P[7]-specific △VP8* rotavirus subunit vaccines with a tetanus toxoid universal T cell epitope.

PubMed

Wen, Xiaobo; Wei, Xiaoman; Ran, Xuhua; Ni, Hongbo; Cao, Si; Zhang, Yao

2015-08-26

Currently, commercial porcine rotavirus vaccines remain varied limitations. The objective of this study is to develop an alternative porcine rotavirus subunit vaccine candidate by parenteral administration, which enables to elicit robust immune responses against most prevalence porcine rotavirus strains. The bacterially-expressed porcine rotavirus P[6]- or P[7]-specific truncated VP8* (aa 64-223) recombinant protein with or without a universal tetanus toxoid CD4(+) T cell epitope P2 was generated. All the recombinant subunit proteins △VP8*s or P2-△VP8*s were of high solubility and high yields. The immunogenicity of each purified △VP8* and P2-△VP8* was evaluated in mice (10 μg/dose) or guinea pigs (20 μg/dose) immunized IM with 600 μg aluminum hydroxide three times at 2-week interval. The introduction of P2T cell epitope to P[7]-△VP8* elicited significantly higher IgG titer in mice than its absence. Comparatively, P2 epitope slightly enhanced the immunogenicity of P[6]-△VP8*. P2-P[7]△VP8* elicited high titer of neutralizing antibody against heterotypic P[7]-specific rotaviruses with varied G type combination. Our data indicated that two subunit vaccines could be plausible bivalent rotavirus vaccine candidate to provide antigenic coverage of porcine rotavirus strains of global or regional importance. Copyright © 2015 Elsevier Ltd. All rights reserved.

The Ebola virus matrix protein penetrates into the plasma membrane: a key step in viral protein 40 (VP40) oligomerization and viral egress.

PubMed

Adu-Gyamfi, Emmanuel; Soni, Smita P; Xue, Yi; Digman, Michelle A; Gratton, Enrico; Stahelin, Robert V

2013-02-22

Ebola, a fatal virus in humans and non-human primates, has no Food and Drug Administration-approved vaccines or therapeutics. The virus from the Filoviridae family causes hemorrhagic fever, which rapidly progresses and in some cases has a fatality rate near 90%. The Ebola genome encodes seven genes, the most abundantly expressed of which is viral protein 40 (VP40), the major Ebola matrix protein that regulates assembly and egress of the virus. It is well established that VP40 assembles on the inner leaflet of the plasma membrane; however, the mechanistic details of plasma membrane association by VP40 are not well understood. In this study, we used an array of biophysical experiments and cellular assays along with mutagenesis of VP40 to investigate the role of membrane penetration in VP40 assembly and egress. Here we demonstrate that VP40 is able to penetrate specifically into the plasma membrane through an interface enriched in hydrophobic residues in its C-terminal domain. Mutagenesis of this hydrophobic region consisting of Leu(213), Ile(293), Leu(295), and Val(298) demonstrated that membrane penetration is critical to plasma membrane localization, VP40 oligomerization, and viral particle egress. Taken together, VP40 membrane penetration is an important step in the plasma membrane localization of the matrix protein where oligomerization and budding are defective in the absence of key hydrophobic interactions with the membrane.

The effect of dose enhancement near metal interfaces on synthetic diamond based X-ray dosimeters

NASA Astrophysics Data System (ADS)

Alamoudi, D.; Lohstroh, A.; Albarakaty, H.

2017-11-01

This study investigates the effects of dose enhancement on the photocurrent performance at metallic interfaces in synthetic diamond detectors based X-ray dosimeters as a function of bias voltages. Monte Carlo (MC) simulations with the BEAMnrc code were carried out to simulate the dose enhancement factor (DEF) and compared against the equivalent photocurrent ratio from experimental investigations. The MC simulation results show that the sensitive region for the absorbed dose distribution covers a few micrometers distances from the interface. Experimentally, two single crystals (SC) and one polycrystalline (PC) synthetic diamond samples were fabricated into detectors with carbon based electrodes by boron and carbon ion implantation. Subsequently; the samples were each mounted inside a tissue equivalent encapsulation to minimize unintended fluence perturbation. Dose enhancement was generated by placing copper, lead or gold near the active volume of the detectors using 50 kVp and 100 kVp X-rays relevant for medical dosimetry. The results show enhancement in the detectors' photocurrent performance when different metals are butted up to the diamond bulk as expected. The variation in the photocurrent measurement depends on the type of diamond samples, their electrodes' fabrication and the applied bias voltages indicating that the dose enhancement near the detector may modify their electronic performance.

First complete genome sequences of genogroup V, genotype 3 porcine sapoviruses: common 5'-terminal genomic feature of sapoviruses.

PubMed

Oka, Tomoichiro; Doan, Yen Hai; Shimoike, Takashi; Haga, Kei; Takizawa, Takenori

2017-12-01

Sapoviruses (SaVs) are enteric viruses and have been detected in various mammals. They are divided into multiple genogroups and genotypes based on the entire major capsid protein (VP1) encoding region sequences. In this study, we determined the first complete genome sequences of two genogroup V, genotype 3 (GV.3) SaV strains detected from swine fecal samples, in combination with Illumina MiSeq sequencing of the libraries prepared from viral RNA and PCR products. The lengths of the viral genome (7494 nucleotides [nt] excluding polyA tail) and short 5'-untranslated region (14 nt) as well as two predicted open reading frames are similar to those of other SaVs. The amino acid differences between the two porcine SaVs are most frequent in the central region of the VP1-encoding region. A stem-loop structure which was predicted in the first 41 nt of the 5'-terminal region of GV.3 SaVs and the other available complete genome sequences of SaVs may have a critical role in viral genome replication. Our study provides complete genome sequences of rarely reported GV.3 SaV strains and highlights the common 5'-terminal genomic feature of SaVs detected from different mammalian species.

Mechanism for Coordinated RNA Packaging and Genome Replication by Rotavirus Polymerase VP1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xiaohui; McDonald, Sarah M.; Tortorici, M. Alejandra

2009-04-08

Rotavirus RNA-dependent RNA polymerase VP1 catalyzes RNA synthesis within a subviral particle. This activity depends on core shell protein VP2. A conserved sequence at the 3' end of plus-strand RNA templates is important for polymerase association and genome replication. We have determined the structure of VP1 at 2.9 {angstrom} resolution, as apoenzyme and in complex with RNA. The cage-like enzyme is similar to reovirus {lambda}3, with four tunnels leading to or from a central, catalytic cavity. A distinguishing characteristic of VP1 is specific recognition, by conserved features of the template-entry channel, of four bases, UGUG, in the conserved 3' sequence.more » Well-defined interactions with these bases position the RNA so that its 3' end overshoots the initiating register, producing a stable but catalytically inactive complex. We propose that specific 3' end recognition selects rotavirus RNA for packaging and that VP2 activates the autoinhibited VP1/RNA complex to coordinate packaging and genome replication.« less

The phylogenetic analysis of VP1 genomic region in foot-and-mouth disease virus serotype O isolates in Sri Lanka reveals the existence of 'Srl-97', a newly named endemic lineage

PubMed Central

Abeyratne, S. A. E.; Amarasekera, S. S. C.; Knowles, N. J.; Wadsworth, J.; Puvanendiran, S.; Kothalawala, H.; Jayathilake, B. K.; Wijithasiri, H. A.; Chandrasena, M. M. P. S. K.

2018-01-01

Foot and mouth disease (FMD) has devastated the cattle industry in Sri Lanka many times in the past. Despite its seriousness, limited attempts have been made to understand the disease to ameliorate its effects–current recommendation for vaccines being based solely on immunological assessments rather than on molecular identification. The general belief is that the cattle population in Sri Lanka acquired the FMD virus (FMDV) strains via introductions from India. However, there could be endemic FMDV lineages circulating in Sri Lanka. To infer the phylogenetic relationships of the FMDV strains in the island, we sequenced the VP1 genomic region of the virus isolates collected during the 2014 outbreak together with a few reported cases in 2012 and 1997 and compared them to VP1 sequences from South Asia. The FMDV strains collected in the 2014 outbreak belonged to the lineage, Ind-2001d, of the topotype, ME-SA. The strains collected in 2012 and 1997 belonged to another lineage called 'unnamed' by the World Reference Laboratory for Foot and Mouth Disease (WRLFMD). Based on the present analysis, we designate the lineage 'unnamed' as Srl-97 which we found endemic to Sri Lanka. The evolutionary rates of Srl-97 and Ind-2001d in Sri Lanka were estimated to be 0.0004 and 0.0046 substitutions/site/year, respectively, suggesting that Srl-97 evolves slowly. PMID:29570746

The phylogenetic analysis of VP1 genomic region in foot-and-mouth disease virus serotype O isolates in Sri Lanka reveals the existence of 'Srl-97', a newly named endemic lineage.

PubMed

Abeyratne, S A E; Amarasekera, S S C; Ranaweera, L T; Salpadoru, T B; Thilakarathne, S M N K; Knowles, N J; Wadsworth, J; Puvanendiran, S; Kothalawala, H; Jayathilake, B K; Wijithasiri, H A; Chandrasena, M M P S K; Sooriyapathirana, S D S S

2018-01-01

Foot and mouth disease (FMD) has devastated the cattle industry in Sri Lanka many times in the past. Despite its seriousness, limited attempts have been made to understand the disease to ameliorate its effects-current recommendation for vaccines being based solely on immunological assessments rather than on molecular identification. The general belief is that the cattle population in Sri Lanka acquired the FMD virus (FMDV) strains via introductions from India. However, there could be endemic FMDV lineages circulating in Sri Lanka. To infer the phylogenetic relationships of the FMDV strains in the island, we sequenced the VP1 genomic region of the virus isolates collected during the 2014 outbreak together with a few reported cases in 2012 and 1997 and compared them to VP1 sequences from South Asia. The FMDV strains collected in the 2014 outbreak belonged to the lineage, Ind-2001d, of the topotype, ME-SA. The strains collected in 2012 and 1997 belonged to another lineage called 'unnamed' by the World Reference Laboratory for Foot and Mouth Disease (WRLFMD). Based on the present analysis, we designate the lineage 'unnamed' as Srl-97 which we found endemic to Sri Lanka. The evolutionary rates of Srl-97 and Ind-2001d in Sri Lanka were estimated to be 0.0004 and 0.0046 substitutions/site/year, respectively, suggesting that Srl-97 evolves slowly.

Organ and effective doses in newborn patients during helical multislice computed tomography examination

NASA Astrophysics Data System (ADS)

Staton, Robert J.; Lee, Choonik; Lee, Choonsik; Williams, Matt D.; Hintenlang, David E.; Arreola, Manuel M.; Williams, Jonathon L.; Bolch, Wesley E.

2006-10-01

In this study, two computational phantoms of the newborn patient were used to assess individual organ doses and effective doses delivered during head, chest, abdomen, pelvis, and torso examinations using the Siemens SOMATOM Sensation 16 helical multi-slice computed tomography (MSCT) scanner. The stylized phantom used to model the patient anatomy was the revised ORNL newborn phantom by Han et al (2006 Health Phys.90 337). The tomographic phantom used in the study was that developed by Nipper et al (2002 Phys. Med. Biol. 47 3143) as recently revised by Staton et al (2006 Med. Phys. 33 3283). The stylized model was implemented within the MCNP5 radiation transport code, while the tomographic phantom was incorporated within the EGSnrc code. In both codes, the x-ray source was modelled as a fan beam originating from the focal spot at a fan angle of 52° and a focal-spot-to-axis distance of 57 cm. The helical path of the source was explicitly modelled based on variations in collimator setting (12 mm or 24 mm), detector pitch and scan length. Tube potentials of 80, 100 and 120 kVp were considered in this study. Beam profile data were acquired using radiological film measurements on a 16 cm PMMA phantom, which yielded effective beam widths of 14.7 mm and 26.8 mm for collimator settings of 12 mm and 24 mm, respectively. Values of absolute organ absorbed dose were determined via the use of normalization factors defined as the ratio of the CTDI100 measured in-phantom and that determined by Monte Carlo simulation of the PMMA phantom and ion chamber. Across various technique factors, effective dose differences between the stylized and tomographic phantoms ranged from +2% to +9% for head exams, -4% to -2% for chest exams, +8% to +24% for abdominal exams, -16% to -12% for pelvic exams and -7% to 0% for chest-abdomen-pelvis (CAP) exams. In many cases, however, relatively close agreement in effective dose was accomplished at the expense of compensating errors in individual organ dose. Per cent differences in organ dose between the stylized and tomographic phantoms at 120 kVp and 12 mm collimator setting ranged from -25% (skin) to +164% (muscle) for head exams, -92% (thyroid) to +98% (ovaries) for chest exams, -144% (uterus) to +112% (ovaries) for abdominal exams, -98% (SI wall) to +20% (thymus) for pelvic exams and -60% (extrathoracic airways) to +13% (ovaries) for CAP exams. Better agreement was seen between the two phantom types for organs entirely within the scan field. In these cases, corresponding per cent differences in organ absorbed dose did not vary more than 17%. For all scans, the effective dose was found to range approximately 1-13 mSv across the scan parameters and scan regions. The largest effective dose occurred for CAP scans at 120 kVp.

Highly efficient Cas9-mediated transcriptional programming

DOE PAGES

Chavez, Alejandro; Scheiman, Jonathan; Vora, Suhani; ...

2015-03-02

The RNA-guided nuclease Cas9 can be reengineered as a programmable transcription factor. However, modest levels of gene activation have limited potential applications. Here we describe an improved transcriptional regulator through the rational design of a tripartite activator, VP64-p65-Rta (VPR), fused to nuclease-null Cas9. Here, we demonstrate its utility in activating endogenous coding and non-coding genes, targeting several genes simultaneously and stimulating neuronal differentiation of human induced pluripotent stem cells (iPSCs).

Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005

PubMed Central

Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Normann, Preben; Afzal, Muhammad; Alexandersen, Soren

2007-01-01

Background According to the World Reference Laboratory for FMD, a new subtype of FMDV serotype A was detected in Iran in 2005. This subtype was designated A/IRN/2005, and rapidly spread throughout Iran and moved westwards into Saudi Arabia and Turkey where it was initially detected from August 2005 and subsequently caused major disease problems in the spring of 2006. The same subtype reached Jordan in 2007. As part of an ongoing project we have also detected this subtype in Pakistan with the first positive samples detected in April 2006. To characterise this subtype in detail, we have sequenced and analysed the complete coding sequence of three subtype A/IRN/2005 isolates collected in Pakistan in 2006, the complete coding sequence of one subtype A/IRN/2005 isolate collected during the first outbreak in Turkey in 2005 and, in addition, the partial 1D coding sequence derived from 4 epithelium samples and 34 swab-samples from Asian buffaloes or cattle subsequently found to be infected with the A/IRN/2005 subtype. Results The phylogenies of the genome regions encoding for the structural proteins, displayed, with the exception of 1A, distinct, serotype-specific clustering and an evolutionary relationship of the A/IRN/2005 sublineage with the A22 sublineage. Potential recombination events have been detected in parts of the genome region coding for the non-structural proteins of FMDV. In addition, amino acid substitutions have been detected in the deduced VP1 protein sequence, potentially related to clinical or subclinical outcome of FMD. Indications of differential susceptibility for developing a subclinical course of disease between Asian buffaloes and cattle have been detected. Furthermore, hitherto unknown insertions of 2 amino acids before the second start codon, as well as sublineage specific amino acids have been detected in the genome region encoding for the leader proteinase of A/IRN/2005 sublineage. Conclusion Our findings indicate that the A/IRN/2005 sublineage has undergone two different paths of evolution for the structural and non-structural genome regions. The structural genome regions have had their evolutionary starting point in the A22 sublineage. It can be assumed that, due to the quasispecies structure of FMDV populations and the error-prone replication process, advantageous mutations in a changed environment have been fixed and lead to the occurrence of the new A/IRN/2005 sublineage. Together with this mechanism, recombination within the non-structural genome regions, potentially modifying the virulence of the virus, may be involved in the success of this new sublineage. The possible origin of this recombinant virus may be a co-infection with Asia1 and a serotype A precursor of the A/IRN/2005 sublineage potentially within Asian Buffaloes, as these appears to relatively easy become infected, but usually without developing clinical disease and consequently showing not a strong acute inflammatory immune response against a second FMDV infection. PMID:18001482

Phosphorylation of the budgerigar fledgling disease virus major capsid protein VP1

NASA Technical Reports Server (NTRS)

Haynes, J. I. 2nd; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1992-01-01

The structural proteins of the budgerigar fledgling disease virus, the first known nonmammalian polyomavirus, were analyzed by isoelectric focusing and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The major capsid protein VP1 was found to be composed of at least five distinct species having isoelectric points ranging from pH 6.45 to 5.85. By analogy with the murine polyomavirus, these species apparently result from different modifications of an initial translation product. Primary chicken embryo cells were infected in the presence of 32Pi to determine whether the virus structural proteins were modified by phosphorylation. SDS-PAGE of the purified virus structural proteins demonstrated that VP1 (along with both minor capsid proteins) was phosphorylated. Two-dimensional analysis of the radiolabeled virus showed phosphorylation of only the two most acidic isoelectric species of VP1, indicating that this posttranslational modification contributes to VP1 species heterogeneity. Phosphoamino acid analysis of 32P-labeled VP1 revealed that phosphoserine is the only phosphoamino acid present in the VP1 protein.

High Z elements in human sarcomata: assessment by multienergy CT and neutron activation analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kan, W.C.; Wiley, A.L. Jr.; Wirtanen, G.W.

1980-07-01

Tumor equivalent phantoms containing inorganic salts (KH/sub 2/PO/sub 4/, CH/sub 3/COOK, NaCl and KI) were scanned on an EMI 5005 body scanner at 140 kVp, 28 mA; 120 kVp, 33 mA; and 81 kVp, 42 mA. Significant signal gain for the detection of higher atomic number elements by multiple energy scanning was noted. Certain sarcomas are known to accumulate high Z elements. Accordingly, excised specimens of various histologies of human sarcomata (chondrosarcoma, liposarcoma, and malignant fibrous histiocytoma) were scanned at 140 kVp and 81 kVp. Using selected areas of interest in the computed tomographic (CT) image to direct the inmore » vitro biopsy of various regions of excised tumors, intersting correlations between the CT number variation and the respective, high Z elemental composition variation, as determined by thermal neutron activation analysis were observed. Further investigation with phantoms and excised sarcomata at 62 kVp and 42 mA suggested that dual energy CT scanning (at 140 kVp and 62 kVp) may be a method of monitoring effective Z and heavy element compositional changes. The authors are also attempting to develop these same low kilovoltage techniques as a method for the noninvasive clinical monitoring of an antisarcoma chemotherapeutic agent, cis-diamminedichloroplatinum (11).« less

Normal pressure hydrocephalus: cerebral hemodynamic, metabolism measurement, discharge score, and long-term outcome.

PubMed

Chen, Ya-Fang; Wang, Yao-Hong; Hsiao, Jong-Kai; Lai, Dar-Ming; Liao, Chun-Chih; Tu, Yong-Kwang; Liu, Hon-Man

2008-12-01

Regional CBF study has been reported effective in the selection of patient with NPH. However, controversial outcome had been reported. We sought to determine if the combination of rCBF measurement, cerebrovascular reactivity, and regional metabolism were positive predictors of shunt responsiveness in NPH syndrome. Twenty-eight patients with clinical diagnosis of NPH were enrolled to study their rCBF in CSWM before and after the ACT challenge test, the regional CSWM metabolism by MRSI, and the clinical grading by the CSRIH defined by the Ministry of Health and Welfare of Japan in 1996. All the patients received VP shunting procedure by the same neurosurgical team. The pre- and postoperative clinical conditions were recorded. A patient was considered as "responder" when the patient's CSRIH total score decreased by one or more points. Patients have been followed for a median duration of 40.6 months (range, 28-67 months) with Karnofsky performance scale. Twenty-three responders had significant improvement after VP shunting in clinical grading; 5 nonresponders were stationary after VP shunting. During the 3 years of follow-up, 5 of the 28 patients died, the other 6 were lost to follow-up (including telephone contact), and 3 had progressive deterioration. The prechallenge rCBF decreased in all the 28 subjects. In the 23 responders, the rCBF after challenge were greater than 20 mL/min per 100 g (P=.008), had a significantly better CRC in the anterior CSWM than the nonresponders (1.40 vs 1.06), and had normal NAA/Cre ratio in the anterior, middle, and posterior CSWM in MRSI study. In those nonresponders, the NAA/Cre ratio was less than 0.8 in at least 2 regions of CSWM, and in 23 patients with symptoms other than ataxia (dementia, incontinence), the NAA/Cre ratio was less than 1.5 at frontal CSWM area. Discharge CSRIH scale was well correlated with CRC (P<.03), the average ACT challenge CBF (P<.005), and the average rCBF (P<.02). There was a statistically significant correlation between discharge CSRIH scale and follow-up performance at 3 months (P=.017), 2 years (P=.018), and 3 years (P=.038). Measurement of cerebrovascular hemodynamic and regional metabolism can be a good predictor of outcome after shunting in patients with NPH. Magnetic resonance spectroscopic imaging at frontal CSWM has good correlation with clinical symptoms. After VP shunting procedure, the discharge CSRIH scale is a good predictor of long-term outcome of patients with NPH.

Essential role of the unordered VP2 n-terminal domain of the parvovirus MVM capsid in nuclear assembly and endosomal enlargement of the virion fivefold channel for cell entry.

PubMed

Sánchez-Martínez, Cristina; Grueso, Esther; Carroll, Miles; Rommelaere, Jean; Almendral, José M

2012-10-10

The unordered N-termini of parvovirus capsid proteins (Nt) are translocated through a channel at the icosahedral five-fold axis to serve for virus traffick. Heterologous peptides were genetically inserted at the Nt of MVM to study their functional tolerance to manipulations. Insertion of a 5T4-single-chain antibody at VP2-Nt (2Nt) yielded chimeric capsid subunits failing to enter the nucleus. The VEGFR2-binding peptide (V1) inserted at both 2Nt and VP1-Nt efficiently assembled in virions, but V1 disrupted VP1 and VP2 entry functions. The VP2 defect correlated with restricted externalization of V1-2Nt out of the coat. The specific infectivity of MVM and wtVP-pseudotyped mosaic MVM-V1 virions, upon heating and/or partial 2Nt cleavage, demonstrated that some 2Nt domains become intracellularly translocated out of the virus shell and cleaved to initiate entry. The V1 insertion defines a VP2-driven endosomal enlargement of the channel as an essential structural rearrangement performed by the MVM virion to infect. Copyright © 2012 Elsevier Inc. All rights reserved.

Different responses of influenza epidemic to weather factors among Shanghai, Hong Kong, and British Columbia.

PubMed

Wang, Xi-Ling; Yang, Lin; He, Dai-Hai; Chiu, Alice Py; Chan, Kwok-Hung; Chan, King-Pan; Zhou, Maigeng; Wong, Chit-Ming; Guo, Qing; Hu, Wenbiao

2017-06-01

Weather factors have long been considered as key sources for regional heterogeneity of influenza seasonal patterns. As influenza peaks coincide with both high and low temperature in subtropical cities, weather factors may nonlinearly or interactively affect influenza activity. This study aims to assess the nonlinear and interactive effects of weather factors with influenza activity and compare the responses of influenza epidemic to weather factors in two subtropical regions of southern China (Shanghai and Hong Kong) and one temperate province of Canada (British Columbia). Weekly data on influenza activity and weather factors (i.e., mean temperature and relative humidity (RH)) were obtained from pertinent government departments for the three regions. Absolute humidity (AH) was measured by vapor pressure (VP), which could be converted from temperature and RH. Generalized additive models were used to assess the exposure-response relationship between weather factors and influenza virus activity. Interactions of weather factors were further assessed by bivariate response models and stratification analyses. The exposure-response curves of temperature and VP, but not RH, were consistent among three regions/cities. Bivariate response model revealed a significant interactive effect between temperature (or VP) and RH (P < 0.05). Influenza peaked at low temperature or high temperature with high RH. Temperature and VP are important weather factors in developing a universal model to explain seasonal outbreaks of influenza. However, further research is needed to assess the association between weather factors and influenza activity in a wider context of social and environmental conditions.

Scaling Properties of Arctic Sea Ice Deformation in a High‐Resolution Viscous‐Plastic Sea Ice Model and in Satellite Observations

PubMed Central

Losch, Martin; Menemenlis, Dimitris

2018-01-01

Abstract Sea ice models with the traditional viscous‐plastic (VP) rheology and very small horizontal grid spacing can resolve leads and deformation rates localized along Linear Kinematic Features (LKF). In a 1 km pan‐Arctic sea ice‐ocean simulation, the small‐scale sea ice deformations are evaluated with a scaling analysis in relation to satellite observations of the Envisat Geophysical Processor System (EGPS) in the Central Arctic. A new coupled scaling analysis for data on Eulerian grids is used to determine the spatial and temporal scaling and the coupling between temporal and spatial scales. The spatial scaling of the modeled sea ice deformation implies multifractality. It is also coupled to temporal scales and varies realistically by region and season. The agreement of the spatial scaling with satellite observations challenges previous results with VP models at coarser resolution, which did not reproduce the observed scaling. The temporal scaling analysis shows that the VP model, as configured in this 1 km simulation, does not fully resolve the intermittency of sea ice deformation that is observed in satellite data. PMID:29576996

Scaling Properties of Arctic Sea Ice Deformation in a High-Resolution Viscous-Plastic Sea Ice Model and in Satellite Observations

NASA Astrophysics Data System (ADS)

Hutter, Nils; Losch, Martin; Menemenlis, Dimitris

2018-01-01

Sea ice models with the traditional viscous-plastic (VP) rheology and very small horizontal grid spacing can resolve leads and deformation rates localized along Linear Kinematic Features (LKF). In a 1 km pan-Arctic sea ice-ocean simulation, the small-scale sea ice deformations are evaluated with a scaling analysis in relation to satellite observations of the Envisat Geophysical Processor System (EGPS) in the Central Arctic. A new coupled scaling analysis for data on Eulerian grids is used to determine the spatial and temporal scaling and the coupling between temporal and spatial scales. The spatial scaling of the modeled sea ice deformation implies multifractality. It is also coupled to temporal scales and varies realistically by region and season. The agreement of the spatial scaling with satellite observations challenges previous results with VP models at coarser resolution, which did not reproduce the observed scaling. The temporal scaling analysis shows that the VP model, as configured in this 1 km simulation, does not fully resolve the intermittency of sea ice deformation that is observed in satellite data.

Scaling Properties of Arctic Sea Ice Deformation in a High-Resolution Viscous-Plastic Sea Ice Model and in Satellite Observations.

PubMed

Hutter, Nils; Losch, Martin; Menemenlis, Dimitris

2018-01-01

Sea ice models with the traditional viscous-plastic (VP) rheology and very small horizontal grid spacing can resolve leads and deformation rates localized along Linear Kinematic Features (LKF). In a 1 km pan-Arctic sea ice-ocean simulation, the small-scale sea ice deformations are evaluated with a scaling analysis in relation to satellite observations of the Envisat Geophysical Processor System (EGPS) in the Central Arctic. A new coupled scaling analysis for data on Eulerian grids is used to determine the spatial and temporal scaling and the coupling between temporal and spatial scales. The spatial scaling of the modeled sea ice deformation implies multifractality. It is also coupled to temporal scales and varies realistically by region and season. The agreement of the spatial scaling with satellite observations challenges previous results with VP models at coarser resolution, which did not reproduce the observed scaling. The temporal scaling analysis shows that the VP model, as configured in this 1 km simulation, does not fully resolve the intermittency of sea ice deformation that is observed in satellite data.

Characterization and evaluation of apoptotic potential of double gene construct pVIVO.VP3.NS1.

PubMed

Saxena, Shikha; Desai, G S; Kumar, G Ravi; Sahoo, A P; Santra, Lakshman; Singh, Lakshya Veer

2015-05-01

Viral gene oncotherapy, targeted killing of cancer cells by viral genes, is an emerging non-infectious therapeutic cancer treatment modality. Chemo and radiotherapy in cancer treatment is limited due to their genotoxic side effects on healthy cells and need of functional p53, which is mutated in most of the cancers. VP3 (apoptin) of chicken infectious anaemia (CIA) and NS1 (Non structural protein 1) of Canine Parvovirus-2 (CPV-2) have been proven to have oncolytic potential in our laboratory. To evaluate oncolytic potential of VP3 and NS1 together these genes needed to be cloned in a bicistronic vector. In this study, both these genes were cloned and characterized for expression of their gene products and its apoptotic potential. The expression of VP3 and NS1 was studied by confocal microscopy and flowcytometry. Expression of VP3 and NS1 in pVIVO.VP3.NS1 transfected HeLa cells in comparison to mock transfected cells indicated that the double gene construct expresses both the products. This was further confirmed by flowcytometry where there was increase in cells expressing VP3 and NS1 in pVIVO.VP3.NS1 transfected group in comparison with the mock control group. The apoptotic inducing potential of this characterized pVIVO.VP3.NS1 was evaluated in human cervical cancer cell line (HeLa) by DNA fragmentation assay, TUNEL assay and Hoechst staning. This double construct was observed to induce apoptosis in HeLa cells.

Type-specific and cross-reactive antibodies and T cell responses in norovirus VLP immunized mice are targeted both to conserved and variable domains of capsid VP1 protein.

PubMed

Malm, Maria; Tamminen, Kirsi; Vesikari, Timo; Blazevic, Vesna

2016-10-01

Norovirus (NoV)-specific antibodies, which block binding of the virus-like particles (VLPs) to the cell receptors are conformation dependent and directed towards the most exposed domain of the NoV capsid VP1 protein, the P2 domain. Limited data are available on the antibodies directed to other domains of the VP1, and even less on the NoV VP1-specific T cell epitopes. In here, BALB/c mice were immunized with six VLPs derived from NoV GII.4-1999, GII.4-2009 (New Orleans), GII.4-2012 (Sydney), GII.12, GI.1, and G1.3. Serum immunoglobulin G binding antibodies, histo-blood group antigen blocking antibodies and T cell responses using type-specific and heterologous NoV VLPs, P-dimers and 76 overlapping synthetic peptides, spanning the entire 539 amino acid sequence of GII.4 VP1, were determined. The results showed that at least half of the total antibody content is directed towards conserved S domain of the VP1. Only a small fraction (<1%) of the VP1 binding antibodies were blocking/neutralizing. With the use of matrix peptide pools and individual peptides, seven CD4 + and CD8 + T cell restricted epitopes were mapped, two located in S domain, four in P2 domain and one in P1 domain of NoV VP1. The epitopes were GII.4 strain-specific but also common GII.4 genotype-specific T cell epitopes were identified. More importantly, the results suggest a 9-amino acids long sequence ( 318 PAPLGTPDF 326 ) in P2 domain of VP1 as a universal NoV genogroup II-specific CD8 + T cell epitope. Distribution of the T cell epitopes alongside the capsid VP1 indicates the need of the complete protein for high immunogenicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gene Trapping Using Gal4 in Zebrafish

PubMed Central

Balciuniene, Jorune; Balciunas, Darius

2013-01-01

Large clutch size and external development of optically transparent embryos make zebrafish an exceptional vertebrate model system for in vivo insertional mutagenesis using fluorescent reporters to tag expression of mutated genes. Several laboratories have constructed and tested enhancer- and gene-trap vectors in zebrafish, using fluorescent proteins, Gal4- and lexA- based transcriptional activators as reporters 1-7. These vectors had two potential drawbacks: suboptimal stringency (e.g. lack of ability to differentiate between enhancer- and gene-trap events) and low mutagenicity (e.g. integrations into genes rarely produced null alleles). Gene Breaking Transposon (GBTs) were developed to address these drawbacks 8-10. We have modified one of the first GBT vectors, GBT-R15, for use with Gal4-VP16 as the primary gene trap reporter and added UAS:eGFP as the secondary reporter for direct detection of gene trap events. Application of Gal4-VP16 as the primary gene trap reporter provides two main advantages. First, it increases sensitivity for genes expressed at low expression levels. Second, it enables researchers to use gene trap lines as Gal4 drivers to direct expression of other transgenes in very specific tissues. This is especially pertinent for genes with non-essential or redundant functions, where gene trap integration may not result in overt phenotypes. The disadvantage of using Gal4-VP16 as the primary gene trap reporter is that genes coding for proteins with N-terminal signal sequences are not amenable to trapping, as the resulting Gal4-VP16 fusion proteins are unlikely to be able to enter the nucleus and activate transcription. Importantly, the use of Gal4-VP16 does not pre-select for nuclear proteins: we recovered gene trap mutations in genes encoding proteins which function in the nucleus, the cytoplasm and the plasma membrane. PMID:24121167

Molecular epidemiology of rotavirus gastroenteritis in Central Kenya before vaccine introduction, 2009-2014.

PubMed

Wandera, Ernest A; Mohammad, Shah; Komoto, Satoshi; Maeno, Yoshimasa; Nyangao, James; Ide, Tomihiko; Kathiiko, Cyrus; Odoyo, Erick; Tsuji, Takao; Taniguchi, Koki; Ichinose, Yoshio

2017-05-01

Between July 2009 and June 2014, a total of 1,546 fecal specimens were collected from children <5 years of age with acute gastroenteritis admitted to Kiambu County Hospital, Central Kenya. The specimens were screened for group A rotavirus (RVA) using ELISA, and RVA-positive specimens were subjected to semi-nested RT-PCR to determine the G and P genotypes. RVA was detected in 429/1,546 (27.5%) fecal specimens. RVA infections occurred in all age groups <59 months, with an early peak at 6-17 months. The infections persisted year-round with distinct seasonal peaks depending on the year. G1P[8] (28%) was the most predominant genotype, followed by G9P[8] (12%), G8P[4] (7%), G1P[4] (5%), G9P[4] (4%), and G12P[6] (3%). In the yearly change of G and P genotypes, a major shift from G9P[8] to G1P[8] was found in 2012. Phylogenetic analysis of the nucleotide sequences of the VP7 and VP4 genes of seven strains with unusual G8 or P[6] showed that the VP7 nucleotide sequences of G8 were clustered in lineage 6 in which African strains are included, and that there are at least two distinct VP4 nucleotide sequences of P[6] strains. These results represent basic data on RVA strains circulating in this region before vaccine introduction. J. Med. Virol. 89:809-817, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Vibrational dynamics of aniline (N2)1 clusters in their first excited singlet state

NASA Astrophysics Data System (ADS)

Hineman, M. F.; Kim, S. K.; Bernstein, E. R.; Kelley, D. F.

1992-04-01

The first excited singlet state S1 vibrational dynamics of aniline(N2)1 clusters are studied and compared to previous results on aniline(CH4)1 and aniline(Ar)1. Intramolecular vibrational energy redistribution (IVR) and vibrational predissociation (VP) rates fall between the two extremes of the CH4 (fast IVR, slow VP) and Ar (slow IVR, fast VP) cluster results as is predicted by a serial IVR/VP model using Fermi's golden rule to describe IVR processes and a restricted Rice-Ramsperger-Kassel-Marcus (RRKM) theory to describe unimolecular VP rates. The density of states is the most important factor determining the rates. Two product states, 00 and 10b1, of bare aniline and one intermediate state ˜(00) in the overall IVR/VP process are observed and time resolved measurements are obtained for the 000 and ˜(000) transitions. The results are modeled with the serial mechanism described above.

Probing the structure of a caldera for geothermal assessment using enhanced passive seismic tomography. The example of the Campi Flregrei (Italy).

NASA Astrophysics Data System (ADS)

Calo, M.; Tramelli, A.; Troise, C.; de Natale, G.

2015-12-01

Campi Flegrei (southern Italy) is one of the most studied calderas of the world due to its geothermal potential that was exploited since Romans' age, and its eruption and seismic risk, affecting a densely populated region. The caldera is marked by strong vertical deformations of the soil called bradyseisms, which are often accompanied by seismic crises. In particular the bradyseismic crises of 1982-84 are remembered for the large number of earthquakes that exceeded 16000 events recorded. Seismicity has been used to model the distribution of the elastic parameters with the aim to study the volcano behavior. However, till now seismic velocity models, calculated with standard tomography, failed in resolving small structures (<1.5-2km) located also at shallow depth, which could be responsible of small eruption as the last one that originated the Monte Nuovo monogenic cone in 1538. Here we show Vp and Vp/Vs models carried out by applying an enhanced seismic tomography that uses the Double Difference method (DD, Zhang and Thurber, 2003) complemented with the Weighted Average Model post-processing (WAM, Calò et al., 2009, Calò et al., 2011, 2013). The 3D models obtained with this procedure benefit of the high resolving power due to DD method, which uses both absolute and differential data, and of the improved reliability offered by WAM, which allows to overcome the drawbacks of the standard inversion methods. Our approach allowed to image structures with linear dimension of 0.5-1.2km, resulting in an improvement of the resolving power at least two times of the other published models (e.g. Priolo et al., 2012). Results show small bodies of high Vp and Vp/Vs at shallow depth (2.5-3.5 km) that could be associated either with magmatic intrusions or fluid saturated rocks, probably responsible of unrest episodes. At shallower depth (0.5-2.0 km), the Vp/Vs model is able to discern between water- and gas- bearing regions giving insight on the assessment of the potential of the geothermal reservoir.

Anomalous Structure of Oceanic Lithosphere in the North Atlantic and Arctic Oceans: A Preliminary Analysis Based on Bathymetry, Gravity and Crustal Structure

NASA Astrophysics Data System (ADS)

Barantsrva, O.

2014-12-01

We present a preliminary analysis of the crustal and upper mantle structure for off-shore regions in the North Atlantic and Arctic oceans. These regions have anomalous oceanic lithosphere: the upper mantle of the North Atlantic ocean is affected by the Iceland plume, while the Arctic ocean has some of the slowest spreading rates. Our specific goal is to constrain the density structure of the upper mantle in order to understand the links between the deep lithosphere dynamics, ocean spreading, ocean floor bathymetry, heat flow and structure of the oceanic lithosphere in the regions where classical models of evolution of the oceanic lithosphere may not be valid. The major focus is on the oceanic lithosphere, but the Arctic shelves with a sufficient data coverage are also included into the analysis. Out major interest is the density structure of the upper mantle, and the analysis is based on the interpretation of GOCE satellite gravity data. To separate gravity anomalies caused by subcrustal anomalous masses, the gravitational effect of water, crust and the deep mantle is removed from the observed gravity field. For bathymetry we use the global NOAA database ETOPO1. The crustal correction to gravity is based on two crustal models: (1) global model CRUST1.0 (Laske, 2013) and, for a comparison, (2) a regional seismic model EUNAseis (Artemieva and Thybo, 2013). The crustal density structure required for the crustal correction is constrained from Vp data. Previous studies have shown that a large range of density values corresponds to any Vp value. To overcome this problem and to reduce uncertainty associated with the velocity-density conversion, we account for regional tectonic variations in the Northern Atlantics as constrained by numerous published seismic profiles and potential-field models across the Norwegian off-shore crust (e.g. Breivik et al., 2005, 2007), and apply different Vp-density conversions for different parts of the region. We present preliminary results, which we use to examine factors that control variations in bathymetry, sedimentary and crustal thicknesses in these anomalous oceanic domains.

The ebola virus interferon antagonist VP24 directly binds STAT1 and has a novel, pyramidal fold.

PubMed

Zhang, Adrianna P P; Bornholdt, Zachary A; Liu, Tong; Abelson, Dafna M; Lee, David E; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

2012-02-01

Ebolaviruses cause hemorrhagic fever with up to 90% lethality and in fatal cases, are characterized by early suppression of the host innate immune system. One of the proteins likely responsible for this effect is VP24. VP24 is known to antagonize interferon signaling by binding host karyopherin α proteins, thereby preventing them from transporting the tyrosine-phosphorylated transcription factor STAT1 to the nucleus. Here, we report that VP24 binds STAT1 directly, suggesting that VP24 can suppress at least two distinct branches of the interferon pathway. Here, we also report the first crystal structures of VP24, derived from different species of ebolavirus that are pathogenic (Sudan) and nonpathogenic to humans (Reston). These structures reveal that VP24 has a novel, pyramidal fold. A site on a particular face of the pyramid exhibits reduced solvent exchange when in complex with STAT1. This site is above two highly conserved pockets in VP24 that contain key residues previously implicated in virulence. These crystal structures and accompanying biochemical analysis map differences between pathogenic and nonpathogenic viruses, offer templates for drug design, and provide the three-dimensional framework necessary for biological dissection of the many functions of VP24 in the virus life cycle.

Evolutionary Analysis of Structural Protein Gene VP1 of Foot-and-Mouth Disease Virus Serotype Asia 1

PubMed Central

Zhang, Qingxun; Liu, Xinsheng; Fang, Yuzhen; Pan, Li; Lv, Jianliang; Zhang, Zhongwang; Zhou, Peng; Ding, Yaozhong; Chen, Haotai; Shao, Junjun; Zhao, Furong; Lin, Tong; Chang, Huiyun; Zhang, Jie; Wang, Yonglu; Zhang, Yongguang

2015-01-01

Foot-and-mouth disease virus (FMDV) serotype Asia 1 was mostly endemic in Asia and then was responsible for economically important viral disease of cloven-hoofed animals, but the study on its selection and evolutionary process is comparatively rare. In this study, we characterized 377 isolates from Asia collected up until 2012, including four vaccine strains. Maximum likelihood analysis suggested that the strains circulating in Asia were classified into 8 different groups (groups I–VIII) or were unclassified (viruses collected before 2000). On the basis of divergence time analyses, we infer that the TMRCA of Asia 1 virus existed approximately 86.29 years ago. The result suggested that the virus had a high mutation rate (5.745 × 10−3 substitutions/site/year) in comparison to the other serotypes of FMDV VP1 gene. Furthermore, the structural protein VP1 was under lower selection pressure and the positive selection occurred at many sites, and four codons (positions 141, 146, 151, and 169) were located in known critical antigenic residues. The remaining sites were not located in known functional regions and were moderately conserved, and the reason for supporting all sites under positive selection remains to be elucidated because the power of these analyses was largely unknown. PMID:25793223

Evaluation of artifacts generated by zirconium implants in cone-beam computed tomography images.

PubMed

Vasconcelos, Taruska Ventorini; Bechara, Boulos B; McMahan, Clyde Alex; Freitas, Deborah Queiroz; Noujeim, Marcel

2017-02-01

To evaluate zirconium implant artifact production in cone beam computed tomography images obtained with different protocols. One zirconium implant was inserted in an edentulous mandible. Twenty scans were acquired with a ProMax 3D unit (Planmeca Oy, Helsinki, Finland), with acquisition settings ranging from 70 to 90 peak kilovoltage (kVp) and voxel sizes of 0.32 and 0.16 mm. A metal artifact reduction (MAR) tool was activated in half of the scans. An axial slice through the middle region of the implant was selected for each dataset. Gray values (mean ± standard deviation) were measured in two regions of interest, one close to and the other distant from the implant (control area). The contrast-to-noise ratio was also calculated. Standard deviation decreased with greater kVp and when the MAR tool was used. The contrast-to-noise ratio was significantly higher when the MAR tool was turned off, except for low resolution with kVp values above 80. Selection of the MAR tool and greater kVp resulted in an overall reduction of artifacts in images acquired with low resolution. Although zirconium implants do produce image artifacts in cone-bean computed tomography scans, the setting that best controlled artifact generation by zirconium implants was 90 kVp at low resolution and with the MAR tool turned on. Copyright © 2016 Elsevier Inc. All rights reserved.

Genetic diversity of G1P[8] rotavirus VP7 and VP8* antigens in Finland over a 20-year period: No evidence for selection pressure by universal mass vaccination with RotaTeq® vaccine.

PubMed

Hemming, Maria; Vesikari, Timo

2013-10-01

Two live-attenuated oral vaccines (Rotarix™ and Rotateq®) against rotavirus gastroenteritis were licensed in 2006 and have been introduced into National Immunization Programs (NIPs) of several countries. Large scale use of rotavirus vaccines might cause antigenic pressure on circulating rotavirus types or lead to selection of new rotaviruses thus decreasing vaccine efficacy. We examined the nucleotide and amino acid sequences of the surface proteins VP7 and VP4 (cleaved to VP8(*) and VP5(*)) of a total of 108 G1P[8] rotavirus strains collected over a 20-year period from 1992, including the years 2006-2009 when rotavirus vaccine (mainly Rotarix™) was available, and the years 2009-2012 after implementation of RotaTeq® vaccine into the NIP of Finland. In G1 VP7 no changes at amino acid level were observed. In VP8(*) periodical fluctuation of the sublineage over the study period was found with multiple changes both at nucleotide and amino acid levels. Most amino acid changes were in the dominant antigenic epitopes of VP8(*). A change in VP8(*) sublineage occurred between 2008 and 2009, with a temporal correlation to the use of Rotarix™ up to 30% coverage in the period. In contrast, no antigenic changes in the VP8(*) protein appeared to be correlated to the exclusive use of RotaTeq® vaccine after 2009. Nevertheless, long-term surveillance of antigenic changes in VP4 and also VP7 proteins in wild-type rotavirus strains is warranted in countries with large scale use of the currently licensed live oral rotavirus vaccines. Copyright © 2013 Elsevier B.V. All rights reserved.

Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells.

PubMed

Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng

2012-01-01

Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

The ventral pallidum: Subregion-specific functional anatomy and roles in motivated behaviors

PubMed Central

Root, David H.; Melendez, Roberto I.; Zaborszky, Laszlo; Napier, T. Celeste

2015-01-01

The ventral pallidum (VP) plays a critical role in the processing and execution of motivated behaviors. Yet this brain region is often overlooked in published discussions of the neurobiology of mental health (e.g., addiction, depression). This contributes to a gap in understanding the neurobiological mechanisms of psychiatric disorders. This review is presented to help bridge the gap by providing a resource for current knowledge of VP anatomy, projection patterns and subregional circuits, and how this organization relates to the function of VP neurons and ultimately behavior. For example, ventromedial (VPvm) and dorsolateral (VPdl) VP subregions receive projections from nucleus accumbens shell and core, respectively. Inhibitory GABAergic neurons of the VPvm project to mediodorsal thalamus, lateral hypothalamus, and ventral tegmental area, and this VP subregion helps discriminate the appropriate conditions to acquire natural rewards or drugs of abuse, consume preferred foods, and perform working memory tasks. GABAergic neurons of the VPdl project to subthalamic nucleus and substantia nigra pars reticulata, and this VP subregion is modulated by, and is necessary for, drug-seeking behavior. Additional circuits arise from nonGABAergic neuronal phenotypes that are likely to excite rather than inhibit their targets. These subregional and neuronal phenotypic circuits place the VP in a unique position to process motivationally-relevant stimuli and coherent adaptive behaviors. PMID:25857550

Rapid detection of EBOLA VP40 in microchip immunofiltration assay

NASA Astrophysics Data System (ADS)

Miethe, Peter; Gary, Dominik; Hlawatsch, Nadine; Gad, Anne-Marie

2015-05-01

In the spring of 2014, the Ebola virus (EBOV) strain Zaire caused a dramatic outbreak in several regions of West Africa. The RT-PCR and antigen capture diagnostic proved to be effective for detecting EBOV in blood and serum. In this paper, we present data of a rapid antigen capture test for the detection of VP40. The test was performed in a microfluidic chip for immunofiltration analysis. The chip integrates all necessary assay components. The analytical sensitivity of the rapid test was 8 ng/ml for recombinant VP40. In serum and whole blood samples spiked with virus culture material, the detection limit was 2.2 x 102 PFU/ml. The performance data of the rapid test (15 min) are comparable to that of the VP40 laboratory ELISA.

Epidemiology and Genetic Characterization of Hepatitis A Virus Genotype IIA▿

PubMed Central

Desbois, Delphine; Couturier, Elisabeth; Mackiewicz, Vincent; Graube, Arielle; Letort, Marie-José; Dussaix, Elisabeth; Roque-Afonso, Anne-Marie

2010-01-01

Three hepatitis A virus (HAV) genotypes, I, II, and III, divided into subtypes A and B, infect humans. Genotype I is the most frequently reported, while genotype II is hardly ever isolated, and its genetic diversity is unknown. From 2002 to 2007, a French epidemiological survey of HAV identified 6 IIA isolates, mostly from patients who did not travel abroad. The possible African origin of IIA strains was investigated by screening the 2008 mandatory notification records of HAV infection: 171 HAV strains from travelers to West Africa and Morocco were identified. Genotyping was performed by sequencing of the VP1/2A junction in 68 available sera. Entire P1 and 5′ untranslated regions of IIA strains were compared to reference sequences of other genotypes. The screening retrieved 5 imported IIA isolates. An additional autochthonous case and 2 more African cases were identified in 2008 and 2009, respectively. A total of 14 IIA isolates (8 African and 6 autochthonous) were analyzed. IIA sequences presented lower nucleotide and amino acid variability than other genotypes. The highest variability was observed in the N-terminal region of VP1, while for other genotypes the highest variability was observed at the VP1/2A junction. Phylogenetic analysis identified 2 clusters, one gathering all African and two autochthonous cases and a second including only autochthonous isolates. In conclusion, most IIA strains isolated in France are imported by travelers returning from West Africa. However, the unexplained contamination mode of autochthonous cases suggests another, still to be discovered geographical origin or a French reservoir to be explored. PMID:20592136

Structures of the major capsid proteins of the human Karolinska Institutet and Washington University polyomaviruses.

PubMed

Neu, Ursula; Wang, Jianbo; Macejak, Dennis; Garcea, Robert L; Stehle, Thilo

2011-07-01

The Karolinska Institutet and Washington University polyomaviruses (KIPyV and WUPyV, respectively) are recently discovered human viruses that infect the respiratory tract. Although they have not yet been linked to disease, they are prevalent in populations worldwide, with initial infection occurring in early childhood. Polyomavirus capsids consist of 72 pentamers of the major capsid protein viral protein 1 (VP1), which determines antigenicity and receptor specificity. The WUPyV and KIPyV VP1 proteins are distant in evolution from VP1 proteins of known structure such as simian virus 40 or murine polyomavirus. We present here the crystal structures of unassembled recombinant WUPyV and KIPyV VP1 pentamers at resolutions of 2.9 and 2.55 Å, respectively. The WUPyV and KIPyV VP1 core structures fold into the same β-sandwich that is a hallmark of all polyomavirus VP1 proteins crystallized to date. However, differences in sequence translate into profoundly different surface loop structures in KIPyV and WUPyV VP1 proteins. Such loop structures have not been observed for other polyomaviruses, and they provide initial clues about the possible interactions of these viruses with cell surface receptors.

The Novel Gene VpPR4-1 from Vitis pseudoreticulata Increases Powdery Mildew Resistance in Transgenic Vitis vinifera L.

PubMed Central

Dai, Lingmin; Wang, Dan; Xie, Xiaoqing; Zhang, Chaohong; Wang, Xiping; Xu, Yan; Wang, Yuejin; Zhang, Jianxia

2016-01-01

Pathogenesis-related proteins (PRs) can lead to increased resistance of the whole plant to pathogen attack. Here, we isolate and characterize a PR-4 protein (VpPR4-1) from a wild Chinese grape Vitis pseudoreticulata which shows greatly elevated transcription following powdery mildew infection. Its expression profiles under a number of abiotic stresses were also investigated. Powdery mildew, salicylic acid, and jasmonic acid methyl ester significantly increased the VpPR4-1 induction while NaCl and heat treatments just slightly induced VpPR4-1 expression. Abscisic acid and cold treatment slightly affected the expression level of VpPR4-1. The VpPR4-1 gene was overexpressed in 30 regenerated V. vinifera cv. Red Globe via Agrobacterium tumefaciens-mediated transformation and verified by the Western blot. The 26 transgenic grapevines exhibited higher expression levels of PR-4 protein content than wild-type vines and six of them were inoculated with powdery mildew which showed that the growth of powdery mildew was repressed. The powdery mildew-resistance of Red Globe transformed with VpPR4-1 was enhanced inoculated with powdery mildew. Moreover, other powdery mildew resistant genes were associated with feedback regulation since VpPR4-1 is in abundance. This study demonstrates that PR-4 protein in grapes plays a vital role in defense against powdery mildew invasion. PMID:27303413

The Novel Gene VpPR4-1 from Vitis pseudoreticulata Increases Powdery Mildew Resistance in Transgenic Vitis vinifera L.

PubMed

Dai, Lingmin; Wang, Dan; Xie, Xiaoqing; Zhang, Chaohong; Wang, Xiping; Xu, Yan; Wang, Yuejin; Zhang, Jianxia

2016-01-01

Pathogenesis-related proteins (PRs) can lead to increased resistance of the whole plant to pathogen attack. Here, we isolate and characterize a PR-4 protein (VpPR4-1) from a wild Chinese grape Vitis pseudoreticulata which shows greatly elevated transcription following powdery mildew infection. Its expression profiles under a number of abiotic stresses were also investigated. Powdery mildew, salicylic acid, and jasmonic acid methyl ester significantly increased the VpPR4-1 induction while NaCl and heat treatments just slightly induced VpPR4-1 expression. Abscisic acid and cold treatment slightly affected the expression level of VpPR4-1. The VpPR4-1 gene was overexpressed in 30 regenerated V. vinifera cv. Red Globe via Agrobacterium tumefaciens-mediated transformation and verified by the Western blot. The 26 transgenic grapevines exhibited higher expression levels of PR-4 protein content than wild-type vines and six of them were inoculated with powdery mildew which showed that the growth of powdery mildew was repressed. The powdery mildew-resistance of Red Globe transformed with VpPR4-1 was enhanced inoculated with powdery mildew. Moreover, other powdery mildew resistant genes were associated with feedback regulation since VpPR4-1 is in abundance. This study demonstrates that PR-4 protein in grapes plays a vital role in defense against powdery mildew invasion.

Identification of the initiation site of poliovirus polyprotein synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dorner, A.J.; Dorner, L.F.; Larsen, G.R.

1982-06-01

The complete nucleotide sequence of poliovirus RNA has a long open reading frame capable of encoding the precursor polyprotein NCVPOO. The first AUG codon in this reading frame is located 743 nucleotides from the 5' end of the RNA and is preceded by eight AUG codons in all three reading frames. Because all proteins that map at the amino terminus of the polyprotein (P1-1a, VPO, and VP4) are blocked at their amino termini and previous studies of ribosome binding have been inconclusive, direct identification of the initiation site of protein synthesis was difficult. We separated and identified all of themore » tryptic peptides of capsid protein VP4 and correlated these peptides with the amino acid sequence predicted to follow the AUG codon at nucleotide 743. Our data indicate that VP4 begins with a blocked glycine that is encoded immediately after the AUG codon at nucleotide 743. An S1 nuclease analysis of poliovirus mRNA failed to reveal a splice in the 5' region. We concluded that synthesis of poliovirus polyprotein is initiated at nucleotide 743, the first AUG codon in the long open reading frame.« less

The 164 K, 165 K and 167 K residues in 160YPVVKKPKLTEE171 are required for the nuclear import of goose parvovirus VP1.

PubMed

Chen, Shun; Liu, Peng; He, Yu; Yang, Chao; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Yang, Qiao; Wu, Ying; Cheng, Anchun

2018-06-01

goose parvovirus (GPV) belongs to the Dependoparvovirus genus in Parvovirinae subfamily within Parvoviridae family, is the etiological agent of Derzsy's disease. Nuclear localization signal (NLS) is important for parvovirus lifecycle in the delivery of genomes and the structural protein of progeny virus into the nucleus. Here, NLS was first identified in GPV. By using the PSORT II program, a basic region (BR, 160YPVVKKPKLTEE171) in the N-terminus of VP1 was found, which predicted as putative NLS motif of goose parvovirus capsid. The GPV BR could transfer both small reporter proteins (EGFP) and large reporter protein (β-galactosidase) into the nucleus by Immunofluorescence assay. Furthermore, the K164A, or K165A, or K167A substitutions mutation of GPV VP1 did abolish its nuclear localization, suggesting that the 164 K, 165 K and 167 K residues in the 160YPVVKKPKLTEE171 are required for its for nuclear import. Our finding may help us to gain a better understand of GPV lifecycle. Copyright © 2018 Elsevier Inc. All rights reserved.

The MRI-measured arterial input function resulting from a bolus injection of Gd-DTPA in a rat model of stroke slightly underestimates that of Gd-[14C]DTPA and marginally overestimates the blood-to-brain influx rate constant determined by Patlak plots

PubMed Central

Nagaraja, Tavarekere N.; Karki, Kishor; Ewing, James R.; Divine, George W.; Fenstermacher, Joseph D.; Patlak, Clifford S.; Knight, Robert A.

2009-01-01

The hypothesis that the arterial input function (AIF) of gadolinium-diethylenetriaminepentaacetic acid (Gd-DTPA) injected by intravenous (iv) bolus and measured by the change in the T1-relaxation rate (ΔR1; R1=1/T1) of superior sagittal sinus blood (AIF-I) approximates the AIF of 14C-labeled Gd-DTPA measured in arterial blood (AIF*) was tested in a rat stroke model (n=13). Contrary to the hypothesis, the initial part of the ΔR1-time curve was underestimated, and the area under the normalized curve for AIF-I was about 15% lower than that for AIF*, the reference AIF. Hypothetical AIF’s for Gd-DTPA (AIF-II) were derived from the AIF* values and averaged to obtain AIF-III. Influx rate constants (Ki) and proton distribution volumes at zero time (Vp+Vo) were estimated with Patlak plots of AIF-I, -II and -III and tissue ΔR1 data. For the regions of interest, the Ki’s estimated with AIF-I were slightly but not significantly higher than those obtained with AIF-II and AIF-III. In contrast, Vp+Vo was significantly higher when calculated with AIF-I. Similar estimates of Ki and Vp+Vo were obtained with AIF-II and AIF-III. In summary, AIF-I underestimated the reference AIF (AIF*); this shortcoming had little effect on the Ki calculated by Patlak plot but produced a significant overestimation of Vp+Vo. PMID:20512853

A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

PubMed

Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

2016-10-01

Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The ebolavirus VP24 interferon antagonist

PubMed Central

Zhang, Adrianna P.P.; Abelson, Dafna M.; Bornholdt, Zachary A.; Liu, Tong; Woods, Jr, Virgil L.; Saphire, Erica Ollmann

2012-01-01

Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways.1,2 The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation.3 A more recent discovery is that VP24 also binds STAT1 directly,4 suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses. PMID:23076242

An adaptively refined XFEM with virtual node polygonal elements for dynamic crack problems

NASA Astrophysics Data System (ADS)

Teng, Z. H.; Sun, F.; Wu, S. C.; Zhang, Z. B.; Chen, T.; Liao, D. M.

2018-02-01

By introducing the shape functions of virtual node polygonal (VP) elements into the standard extended finite element method (XFEM), a conforming elemental mesh can be created for the cracking process. Moreover, an adaptively refined meshing with the quadtree structure only at a growing crack tip is proposed without inserting hanging nodes into the transition region. A novel dynamic crack growth method termed as VP-XFEM is thus formulated in the framework of fracture mechanics. To verify the newly proposed VP-XFEM, both quasi-static and dynamic cracked problems are investigated in terms of computational accuracy, convergence, and efficiency. The research results show that the present VP-XFEM can achieve good agreement in stress intensity factor and crack growth path with the exact solutions or experiments. Furthermore, better accuracy, convergence, and efficiency of different models can be acquired, in contrast to standard XFEM and mesh-free methods. Therefore, VP-XFEM provides a suitable alternative to XFEM for engineering applications.

Optimized energy of spectral CT for infarct imaging: Experimental validation with human validation.

PubMed

Sandfort, Veit; Palanisamy, Srikanth; Symons, Rolf; Pourmorteza, Amir; Ahlman, Mark A; Rice, Kelly; Thomas, Tom; Davies-Venn, Cynthia; Krauss, Bernhard; Kwan, Alan; Pandey, Ankur; Zimmerman, Stefan L; Bluemke, David A

Late contrast enhancement visualizes myocardial infarction, but the contrast to noise ratio (CNR) is low using conventional CT. The aim of this study was to determine if spectral CT can improve imaging of myocardial infarction. A canine model of myocardial infarction was produced in 8 animals (90-min occlusion, reperfusion). Later, imaging was performed after contrast injection using CT at 90 kVp/150 kVpSn. The following reconstructions were evaluated: Single energy 90 kVp, mixed, iodine map, multiple monoenergetic conventional and monoenergetic noise optimized reconstructions. Regions of interest were measured in infarct and remote regions to calculate contrast to noise ratio (CNR) and Bhattacharya distance (a metric of the differentiation between regions). Blinded assessment of image quality was performed. The same reconstruction methods were applied to CT scans of four patients with known infarcts. For animal studies, the highest CNR for infarct vs. myocardium was achieved in the lowest keV (40 keV) VMo images (CNR 4.42, IQR 3.64-5.53), which was superior to 90 kVp, mixed and iodine map (p = 0.008, p = 0.002, p < 0.001, respectively). Compared to 90 kVp and iodine map, the 40 keV VMo reconstructions showed significantly higher histogram separation (p = 0.042 and p < 0.0001, respectively). The VMo reconstructions showed the highest rate of excellent quality scores. A similar pattern was seen in human studies, with CNRs for infarct maximized at the lowest keV optimized reconstruction (CNR 4.44, IQR 2.86-5.94). Dual energy in conjunction with noise-optimized monoenergetic post-processing improves CNR of myocardial infarct delineation by approximately 20-25%. Published by Elsevier Inc.

Identification of a conserved B-cell epitope on duck hepatitis A type 1 virus VP1 protein.

PubMed

Wu, Xiaoying; Li, Xiaojun; Zhang, Qingshan; Wulin, Shaozhou; Bai, Xiaofei; Zhang, Tingting; Wang, Yue; Liu, Ming; Zhang, Yun

2015-01-01

The VP1 protein of duck hepatitis A virus (DHAV) is a major structural protein that induces neutralizing antibodies in ducks; however, B-cell epitopes on the VP1 protein of duck hepatitis A genotype 1 virus (DHAV-1) have not been characterized. To characterize B-cell epitopes on VP1, we used the monoclonal antibody (mAb) 2D10 against Escherichia coli-expressed VP1 of DHAV-1. In vitro, mAb 2D10 neutralized DHAV-1 virus. By using an array of overlapping 12-mer peptides, we found that mAb 2D10 recognized phages displaying peptides with the consensus motif LPAPTS. Sequence alignment showed that the epitope 173LPAPTS178 is highly conserved among the DHAV-1 genotypes. Moreover, the six amino acid peptide LPAPTS was proven to be the minimal unit of the epitope with maximal binding activity to mAb 2D10. DHAV-1-positive duck serum reacted with the epitope in dot blotting assay, revealing the importance of the six amino acids of the epitope for antibody-epitope binding. Competitive inhibition assays of mAb 2D10 binding to synthetic LPAPTS peptides and truncated VP1 protein fragments, detected by Western blotting, also verify that LPAPTS was the VP1 epitope. We identified LPAPTS as a VP1-specific linear B-cell epitope recognized by the neutralizing mAb 2D10. Our findings have potential applications in the development of diagnostic techniques and epitope-based marker vaccines against DHAV-1.

Radiation dose and image conspicuity comparison between conventional 120 kVp and 150 kVp with spectral beam shaping for temporal bone CT.

PubMed

Kim, Chang Rae; Jeon, Ji Young

2018-05-01

The purpose of this article is to compare radiation doses and conspicuity of anatomic landmarks of the temporal bone between the CT technique using spectral beam shaping at 150 kVp with a dedicated tin filter (150 kVp-Sn) and the conventional protocol at 120 kVp. 25 patients (mean age, 46.8 ± 21.2 years) were examined using the 150-kVp Sn protocol (200 reference mAs using automated tube current modulation, 64 × 0.6 mm collimation, 0.6 mm slice thickness, pitch 0.8), whereas 30 patients (mean age, 54.5 ± 17.8 years) underwent the 120-kVp protocol (180 mAs, 128 × 0.6 mm collimation, 0.6 mm slice thickness, pitch 0.8). Radiation doses were compared between the two acquisition techniques, and dosimetric data from the literature were reviewed for comparison of radiation dose reduction. Subjective conspicuity of 23 anatomic landmarks of the temporal bone, expressed by 5-point rating scale and objective conspicuity by signal-to-noise ratio (SNR) which measured in 4 different regions of interest (ROI), were compared between 150-kVp Sn and 120-kVp acquisitions. The mean dose-length-product (DLP) and effective dose were significantly lower for the 150-kVp Sn scans (0.26 ± 0.26 mSv) compared with the 120-kVp scans (0.92 ± 0.10 mSv, p < 0.001). The lowest effective dose from the literature-based protocols was 0.31 ± 0.12 mSv, which proposed as a low-dose protocol in the setting of spiral multislice temporal bone CT. SNR was slightly superior for 120-kVp images, however analyzability of the 23 anatomic structures did not differ significantly between 150-kVp Sn and 120-kVp scans. Temporal bone CT performed at 150 kVp with an additional tin filter for spectral shaping markedly reduced radiation exposure when compared with conventional temporal bone CT at 120 kVp while maintaining anatomic conspicuity. The decreased radiation dose of the 150-kVp Sn was also lower in comparison to the previous literature-based low-dose temporal bone CT protocol. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular characterization of birnaviruses isolated from wild marine fishes at the Flemish Cap (Newfoundland)

USGS Publications Warehouse

Romero-Brey, I.; Batts, W.N.; Bandin, I.; Winton, J.R.; Dopazo, C.P.

2004-01-01

Several isolates of aquatic birnaviruses were recovered from different species of wild fish caught in the Flemish Cap, a Newfoundland fishery close to the Atlantic coast of Canada. The nucleotide sequence of a region of the NS gene was identical among the isolates and was most similar to the Dry Mills and West Buxton reference strains of infectious pancreatic necrosis virus (IPNV). Phylogenetic analysis of the sequence of a region of the VP2 gene demonstrated that the isolates were most closely aligned with the American strains of IPNV serotype Al. Electron microscopy of virus structures clarified and concentrated from cultures of infected chinook salmon embryo (CHSE-214) cells revealed a majority of typical IPNV-like icosahedral particles, as well as a low proportion of type I tubules having a diameter of approximately 55 nm and a variable length of up to 2 ??m. The tubules could be propagated in cell cultures, but always in the presence of low proportions of icosahedral particles. Cloning of selected isolates by serial dilution yielded preparations with a high proportion of the tubular structures with a density in CsCl gradients of approximately 1.30 g cm-3. Polyacrylamide gel electrophoresis revealed the material in the band was composed of the IPNV pVP2 and VP2 proteins.

Proteomic analysis of the herpes simplex virus 1 virion protein 16 transactivator protein in infected cells.

PubMed

Suk, Hyung; Knipe, David M

2015-06-01

The herpes simplex virus 1 virion protein 16 (VP16) tegument protein forms a transactivation complex with the cellular proteins host cell factor 1 (HCF-1) and octamer-binding transcription factor 1 (Oct-1) upon entry into the host cell. VP16 has also been shown to interact with a number of virion tegument proteins and viral glycoprotein H to promote viral assembly, but no comprehensive study of the VP16 proteome has been performed at early times postinfection. We therefore performed a proteomic analysis of VP16-interacting proteins at 3 h postinfection. We confirmed the interaction of VP16 with HCF-1 and a large number of cellular Mediator complex proteins, but most surprisingly, we found that the major viral protein associating with VP16 is the infected cell protein 4 (ICP4) immediate-early (IE) transactivator protein. These results raise the potential for a new function for VP16 in associating with the IE ICP4 and playing a role in transactivation of early and late gene expression, in addition to its well-documented function in transactivation of IE gene expression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rotavirus A strains obtained from children with acute gastroenteritis in Mozambique, 2012-2013: G and P genotypes and phylogenetic analysis of VP7 and partial VP4 genes.

PubMed

João, Eva Dora; Strydom, Amy; O'Neill, Hester G; Cuamba, Assa; Cassocera, Marta; Acácio, Sozinho; Mandomando, Inácio; Motanyane, Lithabiso; Page, Nicola; de Deus, Nilsa

2018-01-01

In Mozambique rotavirus (RV) was shown to be the greatest cause of acute diarrhoea in infants from 0 to 11 months, and in 2015, national rotavirus vaccination was introduced. As with other developing countries, there is very limited active strain characterisation. Rotavirus positive clinical specimens, collected between 2012 and 2013, have now provided information on the genotypes circulating in southern Mozambique prior to vaccine introduction. Genotypes G2 (32.4%), G12 (28.0%), P[4] (41.4%) and P[6] (22.9%) (n = 157) strains were commonly detected with G2P[4] (42.3%) RVs being predominant, specifically during 2013. Phylogenetic evaluation of the VP7 and VP8* encoding genes showed, for the majority of the Mozambican strains, that they clustered with other African strains based on genotype. RVA/Human-wt/MOZ/0153/2013/G2P[4], RVA/Human-wt/MOZ/0308/2012/G2P[4] and RVA/Human-wt/MOZ/0288/2012/G12P[8] formed separate clusters from the other Mozambican strains with similar genotypes, suggesting possible reassortment. Amino acid substitutions in selected epitope regions also supported phylogenetic clustering. As expected, the VP7 and VP8* genes from the Mozambican strains differed from both the RotaTeq ® (SC2-9) G2P[5] and Rotarix ® (A41CB052A) G1P[8] genes. This study provides information on the genetic diversity of rotavirus strains prior to vaccine introduction and generates baseline data for future monitoring of any changes in rotavirus strains in response to vaccine pressure.

Unusual structural transition of antimicrobial VP1 peptide.

PubMed

Shanmugam, Ganesh; Phambu, Nsoki; Polavarapu, Prasad L

2011-05-01

VP1 peptide, an active domain of m-calpain enzyme with antimicrobial activity is found to undergo an unusual conformational transition in trifluoroethanol (TFE) solvent. The nature of, and time dependent variations in, circular dichroism associated with the amide I vibrations, suggest that VP1 undergoes self-aggregation forming anti-parallel β-sheet structure in TFE. Transmission electron micrograph (TEM) images revealed that β-sheet aggregates formed by VP1 possess fibril-like assemblies. Copyright © 2011 Elsevier B.V. All rights reserved.

A pragmatic approach to determine the optimal kVp in cone beam CT: balancing contrast-to-noise ratio and radiation dose

PubMed Central

Silkosessak, O; Jacobs, R; Bogaerts, R; Bosmans, H; Panmekiate, S

2014-01-01

Objectives: To determine the optimal kVp setting for a particular cone beam CT (CBCT) device by maximizing technical image quality at a fixed radiation dose. Methods: The 3D Accuitomo 170 (J. Morita Mfg. Corp., Kyoto, Japan) CBCT was used. The radiation dose as a function of kVp was measured in a cylindrical polymethyl methacrylate (PMMA) phantom using a small-volume ion chamber. Contrast-to-noise ratio (CNR) was measured using a PMMA phantom containing four materials (air, aluminium, polytetrafluoroethylene and low-density polyethylene), which was scanned using 180 combinations of kVp/mA, ranging from 60/1 to 90/8. The CNR was measured for each material using PMMA as background material. The pure effect of kVp and mAs on the CNR values was analysed. Using a polynomial fit for CNR as a function of mA for each kVp value, the optimal kVp was determined at five dose levels. Results: Absorbed doses ranged between 0.034 mGy mAs−1 (14 × 10 cm, 60 kVp) and 0.108 mGy mAs−1 (14 × 10 cm, 90 kVp). The relation between kVp and dose was quasilinear (R2 > 0.99). The effect of mA and kVp on CNR could be modelled using a second-degree polynomial. At a fixed dose, there was a tendency for higher CNR values at increasing kVp values, especially at low dose levels. A dose reduction through mA was more efficient than an equivalent reduction through kVp in terms of image quality deterioration. Conclusions: For the investigated CBCT model, the most optimal contrast at a fixed dose was found at the highest available kVp setting. There is great potential for dose reduction through mA with a minimal loss in image quality. PMID:24708447

Evaluation of two strains of Marek's disease virus serotype 1 for the development of recombinant vaccines against very virulent infectious bursal disease virus.

PubMed

Li, Kai; Liu, Yongzhen; Liu, Changjun; Gao, Li; Gao, Yulong; Zhang, Yanping; Cui, Hongyu; Qi, Xiaole; Zhong, Li; Wang, Xiaomei

2017-03-01

Attenuated strains of Marek's disease virus serotype 1 (MDV1), and the closely related herpesvirus of turkeys, are among the most potent vectors for development of recombinant vaccines for poultry. To investigate the effects of MDV1 strain characteristics on the protective efficacy of the recombinant vaccines, we developed two recombinant MDV1 vaccines for expressing the VP2 gene of infectious bursal disease virus (IBDV) based on two different MDV1 strains, the attenuated strain 814 and the Meq gene-deleted recombinant MDV1 strain rLMS△Meq, as the viral vectors. The r814-VP2 virus based on the 814 strain exhibited higher replication efficiency in cell culture while lower viral titers in chickens, compared to rLMS△Meq-VP2 derived from the rLMS△Meq strain. Further studies indicated that r814-VP2 produced higher levels of VP2 protein in cells and elicited stronger immune responses against IBDV in chickens than rLMS△Meq-VP2. After IBDV challenge, rLMS△Meq-VP2 provided 50% protection against mortality, and the birds that survived developed bursal atrophy and gross lesions. In contrast, r814-VP2 conferred complete protection not only against development of clinical signs and mortality, but also against the formation of bursal lesions. The results indicate that different MDV1 vector influences the protective efficacy of recombinant MDV1 vaccines. The r814-VP2 has the potential to serve as a bivalent vaccine against two important lethal pathogens of chickens. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of a conserved neutralizing linear B-cell epitope in the VP1 proteins of duck hepatitis A virus type 1 and 3.

PubMed

Zhang, Ruihua; Zhou, Guomei; Xin, Yinghao; Chen, Junhao; Lin, Shaoli; Tian, Ye; Xie, Zhijing; Jiang, Shijin

2015-11-18

Duck virus hepatitis (DVH), mainly caused by duck hepatitis A virus (DHAV), is a severe disease threaten to duck industry and has worldwide distribution. As the major structural protein, the VP1 protein of DHAV is able to induce neutralizing antibody in ducks. In this study, a monoclonal antibody (mAb) 4F8 against the intact DHAV-1 particles was used to identify the possible epitope in the three serotypes of DHAV. The mAb 4F8 had weak neutralizing activities to both DHAV-1 and DHAV-3, and reacted with the conserved linear B-cell epitopes of (75)GEIILT(80) in DHAV-1 VP1 and (75)GEVILT(80) in DHAV-3 VP1 protein, respectively, while not with DHAV-2 VP1. This was the first report about identification of the common conserved neutralizing linear B-cell epitope of DHAV-1 and DHAV-3, which will facilitate understanding of the antigenic structure of VP1 and the serologic diagnosis of DHAV infection. Copyright © 2015 Elsevier B.V. All rights reserved.

The Role of VP1 Amino Acid Residue 145 of Enterovirus 71 in Viral Fitness and Pathogenesis in a Cynomolgus Monkey Model

PubMed Central

Kataoka, Chikako; Suzuki, Tadaki; Kotani, Osamu; Iwata-Yoshikawa, Naoko; Nagata, Noriyo; Ami, Yasushi; Wakita, Takaji; Nishimura, Yorihiro; Shimizu, Hiroyuki

2015-01-01

Enterovirus 71 (EV71), a major causative agent of hand, foot, and mouth disease, occasionally causes severe neurological symptoms. We identified P-selectin glycoprotein ligand-1 (PSGL-1) as an EV71 receptor and found that an amino acid residue 145 in the capsid protein VP1 (VP1-145) defined PSGL-1-binding (PB) and PSGL-1-nonbinding (non-PB) phenotypes of EV71. However, the role of PSGL-1-dependent EV71 replication in neuropathogenesis remains poorly understood. In this study, we investigated viral replication, genetic stability, and the pathogenicity of PB and non-PB strains of EV71 in a cynomolgus monkey model. Monkeys were intravenously inoculated with cDNA-derived PB and non-PB strains of EV71, EV71-02363-EG and EV71-02363-KE strains, respectively, with two amino acid differences at VP1-98 and VP1-145. Mild neurological symptoms, transient lymphocytopenia, and inflammatory cytokine responses, were found predominantly in the 02363-KE-inoculated monkeys. During the early stage of infection, viruses were frequently detected in clinical samples from 02363-KE-inoculated monkeys but rarely in samples from 02363-EG-inoculated monkeys. Histopathological analysis of central nervous system (CNS) tissues at 10 days postinfection revealed that 02363-KE induced neuropathogenesis more efficiently than that induced by 02363-EG. After inoculation with 02363-EG, almost all EV71 variants detected in clinical samples, CNS, and non-CNS tissues, possessed a G to E amino acid substitution at VP1-145, suggesting a strong in vivo selection of VP1-145E variants and CNS spread presumably in a PSGL-1-independent manner. EV71 variants with VP1-145G were identified only in peripheral blood mononuclear cells in two out of four 02363-EG-inoculated monkeys. Thus, VP1-145E variants are mainly responsible for the development of viremia and neuropathogenesis in a non-human primate model, further suggesting the in vivo involvement of amino acid polymorphism at VP1-145 in cell-specific viral replication, in vivo fitness, and pathogenesis in EV71-infected individuals. PMID:26181772

Preliminary molecular detection of the somatic embryogenesis receptor-like kinase (VpSERK) and knotted-like homeobox (VpKNOX1) genes during in vitro morphogenesis of Vanilla planifolia Jacks.

PubMed

Ramírez-Mosqueda, Marco A; Iglesias-Andreu, Lourdes G; Sáenz, Luis; Córdova, Iván

2018-02-01

This work aimed to evaluate the embryogenic competence of different tissues from different stages (friable callus, bud-regenerating callus, and whole buds) of Vanilla planifolia , through the molecular detection of the somatic embryogenesis receptor-like kinase ( VpSERK ) and knotted-like homeobox ( VpKNOX1 ) genes. RNA was extracted with Trizol ® , cDNA was obtained, and the studied transcripts were amplified. Using non-specific primers, VpSERK and VpSTM gene expression was detected in the three stages evaluated. This study might contribute to providing an explanation for the recalcitrance of this Vanilla species to somatic embryogenesis.

Structural dissection of Ebola virus and its assembly determinants using cryo-electron tomography.

PubMed

Bharat, Tanmay A M; Noda, Takeshi; Riches, James D; Kraehling, Verena; Kolesnikova, Larissa; Becker, Stephan; Kawaoka, Yoshihiro; Briggs, John A G

2012-03-13

Ebola virus is a highly pathogenic filovirus causing severe hemorrhagic fever with high mortality rates. It assembles heterogenous, filamentous, enveloped virus particles containing a negative-sense, single-stranded RNA genome packaged within a helical nucleocapsid (NC). We have used cryo-electron microscopy and tomography to visualize Ebola virus particles, as well as Ebola virus-like particles, in three dimensions in a near-native state. The NC within the virion forms a left-handed helix with an inner nucleoprotein layer decorated with protruding arms composed of VP24 and VP35. A comparison with the closely related Marburg virus shows that the N-terminal region of nucleoprotein defines the inner diameter of the Ebola virus NC, whereas the RNA genome defines its length. Binding of the nucleoprotein to RNA can assemble a loosely coiled NC-like structure; the loose coil can be condensed by binding of the viral matrix protein VP40 to the C terminus of the nucleoprotein, and rigidified by binding of VP24 and VP35 to alternate copies of the nucleoprotein. Four proteins (NP, VP24, VP35, and VP40) are necessary and sufficient to mediate assembly of an NC with structure, symmetry, variability, and flexibility indistinguishable from that in Ebola virus particles released from infected cells. Together these data provide a structural and architectural description of Ebola virus and define the roles of viral proteins in its structure and assembly.

Oceanic crustal velocities from laboratory and logging measurements of Integrated Ocean Drilling Program Hole 1256D

NASA Astrophysics Data System (ADS)

Gilbert, Lisa A.; Salisbury, Matthew H.

2011-09-01

Drilling and logging of Integrated Ocean Drilling Program (IODP) Hole 1256D have provided a unique opportunity for systematically studying a fundamental problem in marine geophysics: What influences the seismic structure of oceanic crust, porosity or composition? Compressional wave velocities (Vp) logged in open hole or from regional refraction measurements integrate both the host rock and cracks in the crust. To determine the influence of cracks on Vp at several scales, we first need an accurate ground truth in the form of laboratory Vp on crack-free, or nearly crack-free samples. We measured Vp on 46 water-saturated samples at in situ pressures to determine the baseline velocities of the host rock. These new results match or exceed Vp logs throughout most of the hole, especially in the lower dikes and gabbros, where porosities are low. In contrast, samples measured at sea under ambient laboratory conditions, had consistently lower Vp than the Vp logs, even after correction to in situ pressures. Crack-free Vp calculated from simple models of logging and laboratory porosity data for different lithologies and facies suggest that crustal velocities in the lavas and upper dikes are controlled by porosity. In particular, the models demonstrate significant large-scale porosity in the lavas, especially in the sections identified as fractured flows and breccias. However, crustal velocities in the lower dikes and gabbros are increasingly controlled by petrology as the layer 2-3 boundary is approached.

Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

NASA Technical Reports Server (NTRS)

Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

1996-01-01

A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

Variation in Crustal Structure of the Lesser Caucasus Region from Teleseismic Receiver Functions

NASA Astrophysics Data System (ADS)

Lin, C. M.; Tseng, T. L.; Huang, B. S.; Legendre, C. P.; Karakhanian, A.

2016-12-01

The Caucasus, including the mountains of Greater and Lesser Caucasus, is formed by the continental collision between Arabia and Eurasia. The crustal thickness for this region was mostly constrained by joint analysis of receiver functions and surface waves. Although the thickest value of 52 km was reported under the Lesser Caucasus, the resolution of earlier studies were often limited by sparse array. Large gradient across Moho also makes the definition of Moho difficult. Moreover, higher value of the Vp/Vs ratio is commonly reported in the northeastern Turkey but no estimates had been made for the Caucasus. To further investigate the detail structure around the Lesser Caucasus, we constructed a new seismic network in Georgia and Armenia. We also include other broadband stations to enhance the coverage. The average interval in the Lesser Caucasus is roughly 30 km, much denser than any previous experiments. We selected P-waveforms from teleseismic earthquakes during the operation (January 2012 - June 2016) to calculate receiver functions and then estimate the crustal thickness (H) and Vp/Vs ratio (k) with the H-k stacking technique. Our preliminary results show that Moho depth increases from 40 km under the northeastern Turkey to 50 km beneath northern Georgia, no station with Moho deeper than 50 km under the Lesser Caucasus. The Vp/Vs ratios in the northeastern Anatolian plateau are around 1.8, which is slightly higher than the average of global continents but consistent with the previous estimates. Further to the east, some stations show anomalously higher Vp/Vs ratio in central & southern Armenia that may be associated with Holocene volcanism. In the future, we plan to join locally measured dispersion curves to invert the velocity model without velocity-depth trade-off. We expect to resolve the velocity variations of the crust beneath this region in small scale that may be tied to the continental collision and surface volcanism. Keywords: Caucasus, receiver function, continental collision, volcanic plateau, crustal structure

Imaging the source region of the 2003 San Simeon earthquake within the weak Franciscan subduction complex, central California

USGS Publications Warehouse

Hauksson, E.; Oppenheimer, D.; Brocher, T.M.

2004-01-01

Data collected from the 2003 Mw6.5 San Simeon earthquake sequence in central California and a 1986 seismic refraction experiment demonstrate that the weak Franciscan subduction complex suffered brittle failure in a region without significant velocity contrast across a slip plane. Relocated hypocenters suggest a spatial relationship between the seismicity and the Oceanic fault, although blind faulting on a nearby, unknown fault is an equally plausible alternative. The aftershock volume is sandwiched between the Nacimiento and Oceanic faults and is characterized by rocks of low compressional velocity (Vp) abutted to the east and west by rocks of higher Vp. This volume of inferred Franciscan rocks is embedded within the larger Santa Lucia anticline. Pore fluids, whose presence is implied by elevated Vp/Vs values, may locally decrease normal stress and limit the aftershock depth distribution between 3 to 10 km within the hanging wall. The paucity of aftershocks along the mainshock rupture surface may reflect either the absence of a damage zone or an almost complete stress drop within the low Vp or weak rock matrix surrounding the mainshock rupture. Copyright 2004 by the American Geophysical Union.

Genetic characterization and molecular epidemiology of foot-and-mouth disease viruses isolated from Afghanistan in 2003-2005.

PubMed

Schumann, Kate R; Knowles, Nick J; Davies, Paul R; Midgley, Rebecca J; Valarcher, Jean-Francois; Raoufi, Abdul Quader; McKenna, Thomas S; Hurtle, William; Burans, James P; Martin, Barbara M; Rodriguez, Luis L; Beckham, Tammy R

2008-04-01

Foot-and-mouth disease virus (FMDV) isolates collected from various geographic locations in Afghanistan between 2003 and 2005 were genetically characterized, and their phylogeny was reconstructed utilizing nucleotide sequences of the complete VP1 coding region. Three serotypes of FMDV (types A, O, and Asia 1) were identified as causing clinical disease in Afghanistan during this period. Phylogenetic analysis revealed that the type A viruses were most closely related to isolates collected in Iran during 2002-2004. This is the first published report of serotype A in Afghanistan since 1975, therefore indicating the need for inclusion of serotype A in vaccine formulations that will be used to control disease outbreaks in this country. Serotype O virus isolates were closely related to PanAsia strains, including those that originated from Bhutan and Nepal during 2003-2004. The Asia 1 viruses, collected along the northern and eastern borders of Afghanistan, were most closely related to FMDV isolates collected in Pakistan during 2003 and 2004. Data obtained from this study provide valuable information on the FMDV serotypes circulating in Afghanistan and their genetic relationship with strains causing FMD in neighboring countries.

Tomographic evidence for enhanced fracturing and permeability within the relatively aseismic Nemaha Fault Zone, Oklahoma

NASA Astrophysics Data System (ADS)

Stevens, N. T.; Keranen, K. M.; Lambert, C.

2017-12-01

Recent earthquakes in north central Oklahoma are dominantly hosted on unmapped basement faults away from and outside of the largest regional structure, the Nemaha Fault Zone (NFZ) [Lambert, 2016]. The NFZ itself remains largely aseismic, despite the presence of disposal wells and numerous faults. Here we present results from double-difference tomography using TomoDD [Zhang and Thurber, 2003] for the NFZ and the surrounding region, utilizing a seismic catalog of over 10,000 local events acquired by 144 seismic stations deployed between 2013 and 2017. Inversion results for shallow crustal depth, beneath the 2-3 km sedimentary cover, show compressional wavespeeds (Vp) of >6 km/sec and shear wavespeeds (Vs) >4 km/sec outside the NFZ, consistent with crystalline rock. Along the western margin of the NFZ, both Vp and Vs are reduced, and Vp/Vs gradients parallel the trend of major faults, suggesting enhanced fault density and potentially enhanced fluid pressure within the study region. Enhanced fracture density within the NFZ, and associated permeability enhancement, could reduce the effect of regional fluid pressurization from injection wells, contributing to the relative aseismicity of the NFZ.

Vaccination with recombinant Modified Vaccinia Ankara (MVA) viruses expressing single African horse sickness virus VP2 antigens induced cross-reactive virus neutralising antibodies (VNAb) in horses when administered in combination.

PubMed

Manning, Nicola Mary; Bachanek-Bankowska, Katarzyna; Mertens, Peter Paul Clement; Castillo-Olivares, Javier

2017-10-20

African horse sickness is a lethal viral disease of equids transmitted by biting midges of the Genus Culicoides. The disease is endemic to sub-Saharan Africa but outbreaks of high mortality and economic impact have occurred in the past in non-endemic regions of Africa, Asia and Southern Europe. Vaccination is critical for the control of this disease but only live attenuated vaccines are currently available. However, there are bio-safety concerns over the use of this type of vaccines, especially in non-endemic countries, and live attenuated vaccines do not have DIVA (Differentiation of Infected from Vaccinated Animals) capacity. In addition, large scale manufacturing of live attenuated vaccines of AHSV represents a significant environmental and health risk and level 3 bio-safety containment facilities are required for their production. A variety of different technologies have been investigated over the years to develop alternative AHSV vaccines, including the use of viral vaccine vectors such Modified Vaccinia Ankara virus (MVA). In previous studies we demonstrated that recombinant MVA expressing outer capsid protein AHSV-VP2 induced virus neutralising antibodies and protection against virulent challenge both in a mouse model and in the horse. However, AHSV-VP2 is antigenically variable and determines the existence of 9 different AHSV serotypes. Immunity against AHSV is serotype-specific and there is limited cross-reactivity between certain AHSV serotypes: 1 and 2, 3 and 7, 5 and 8, 6 and 9. In Africa, multiple serotypes circulate simultaneously and a polyvalent attenuated vaccine comprising different AHSV serotypes is used. We investigated the potential of a polyvalent AHSV vaccination strategy based on combinations of MVA-VP2 viruses each expressing a single VP2 antigen from a specific serotype. We showed that administration of 2 different recombinant MVA viruses, each expressing a single VP2 protein from AHSV serotype 4 or 9, denoted respectively as MVA-VP2(4) and MVA-VP2(9), induced virus neutralising antibodies against the homologous AHSV serotypes. Vaccination was more efficient when vaccines were administered simultaneously than when they were administered sequentially. A third and fourth dose of a different MVA expressing VP2 of AHSV serotype 5, given 4months later to ponies previously vaccinated with MVA-VP2(4) and MVA-VP2(9), resulted in the induction of VNAb against serotypes 4, 5, 6, 8 and 9. The anamnestic antibody response against AHSV 9 and AHSV 4 following the MVA-VP2(5) boost suggests that it is possible some shared epitopes exist between different serotypes. In conclusion this study showed that it is feasible to develop a polyvalent AHSV vaccination regime based on the use of combinations of MVA-VP2 viruses. Copyright © 2017. Published by Elsevier Ltd.

Nematicidal fluorescent pseudomonads for the in vitro and in vivo suppression of root knot (Meloidogyne incognita) of Capsicum annuum L.

PubMed

Wahla, Verinder; Maheshwari, Dinesh K; Bajpai, Vivek K

2012-08-01

Considerable attention has been paid to plant-growth-promoting rhizobacteria (PGPR), especially the fluorescent group of Pseudomonas species, as the best alternatives to chemicals for facilitating ecofriendly biological control of soil- and seedborne microorganisms. On the basis of their novel plant-growth-promoting attributes, two rhizobacteria Pseudomonas aeruginosa VP1 and VP2 selected out of over 63 isolates from the rhizosphere of chilli (Capsicum annuum) were identified as potential candidates for biocontrol of the root-knot nematode Meloidogyne incognita on chilli. The nematicidal activity of both strains was evaluated in vitro and in vivo for their efficacy against M. incognita. P. aeruginosa VP2 exhibited strong nematicidal activity in comparison with VP1, based on the in vitro killing of the second-stage juveniles (J2) of M. incognita. Seed bacterisation with both strains VP1 and VP2 was able to manage root-knot M. incognita on chilli (C. annuum) in a pot trial study. Increase in root and shoot length and in fresh and dry weight of root and shoot and reduction in the root-knot index over the control were attained. In overall performance, VP2 was 29.5% more effective than VP1, and about 30% more effective than the control (non-bacterised). The application of P. aeruginosa VP1 and P. aeruginosa VP2 controls the development of M. incognita in C. annuum, and hence they are recommended as efficient plant growth promotors and biocontrolling agents for raising healthy crop of C. annuum that can promote the growth of plants and reduce the nematode (M. incognita) population. Copyright © 2012 Society of Chemical Industry.

The ebolavirus VP24 interferon antagonist: know your enemy.

PubMed

Zhang, Adrianna P P; Abelson, Dafna M; Bornholdt, Zachary A; Liu, Tong; Woods, Virgil L; Saphire, Erica Ollmann

2012-08-15

Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways. The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation. A more recent discovery is that VP24 also binds STAT1 directly, suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses.

Immunogenicity of Newcastle Disease Virus Vectors Expressing Norwalk Virus Capsid Protein in the Presence or Absence of VP2 Protein

PubMed Central

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y.; Samal, Siba K.

2015-01-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirs-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. PMID:26099695

In-depth proteomic analysis of Varroa destructor: Detection of DWV-complex, ABPV, VdMLV and honeybee proteins in the mite.

PubMed

Erban, Tomas; Harant, Karel; Hubalek, Martin; Vitamvas, Pavel; Kamler, Martin; Poltronieri, Palmiro; Tyl, Jan; Markovic, Martin; Titera, Dalibor

2015-09-11

We investigated pathogens in the parasitic honeybee mite Varroa destructor using nanoLC-MS/MS (TripleTOF) and 2D-E-MS/MS proteomics approaches supplemented with affinity-chromatography to concentrate trace target proteins. Peptides were detected from the currently uncharacterized Varroa destructor Macula-like virus (VdMLV), the deformed wing virus (DWV)-complex and the acute bee paralysis virus (ABPV). Peptide alignments revealed detection of complete structural DWV-complex block VP2-VP1-VP3, VDV-1 helicase and single-amino-acid substitution A/K/Q in VP1, the ABPV structural block VP1-VP4-VP2-VP3 including uncleaved VP4/VP2, and VdMLV coat protein. Isoforms of viral structural proteins of highest abundance were localized via 2D-E. The presence of all types of capsid/coat proteins of a particular virus suggested the presence of virions in Varroa. Also, matches between the MWs of viral structural proteins on 2D-E and their theoretical MWs indicated that viruses were not digested. The absence/scarce detection of non-structural proteins compared with high-abundance structural proteins suggest that the viruses did not replicate in the mite; hence, virions accumulate in the Varroa gut via hemolymph feeding. Hemolymph feeding also resulted in the detection of a variety of honeybee proteins. The advantages of MS-based proteomics for pathogen detection, false-positive pathogen detection, virus replication, posttranslational modifications, and the presence of honeybee proteins in Varroa are discussed.

In-depth proteomic analysis of Varroa destructor: Detection of DWV-complex, ABPV, VdMLV and honeybee proteins in the mite

PubMed Central

Erban, Tomas; Harant, Karel; Hubalek, Martin; Vitamvas, Pavel; Kamler, Martin; Poltronieri, Palmiro; Tyl, Jan; Markovic, Martin; Titera, Dalibor

2015-01-01

We investigated pathogens in the parasitic honeybee mite Varroa destructor using nanoLC-MS/MS (TripleTOF) and 2D-E-MS/MS proteomics approaches supplemented with affinity-chromatography to concentrate trace target proteins. Peptides were detected from the currently uncharacterized Varroa destructor Macula-like virus (VdMLV), the deformed wing virus (DWV)-complex and the acute bee paralysis virus (ABPV). Peptide alignments revealed detection of complete structural DWV-complex block VP2-VP1-VP3, VDV-1 helicase and single-amino-acid substitution A/K/Q in VP1, the ABPV structural block VP1-VP4-VP2-VP3 including uncleaved VP4/VP2, and VdMLV coat protein. Isoforms of viral structural proteins of highest abundance were localized via 2D-E. The presence of all types of capsid/coat proteins of a particular virus suggested the presence of virions in Varroa. Also, matches between the MWs of viral structural proteins on 2D-E and their theoretical MWs indicated that viruses were not digested. The absence/scarce detection of non-structural proteins compared with high-abundance structural proteins suggest that the viruses did not replicate in the mite; hence, virions accumulate in the Varroa gut via hemolymph feeding. Hemolymph feeding also resulted in the detection of a variety of honeybee proteins. The advantages of MS-based proteomics for pathogen detection, false-positive pathogen detection, virus replication, posttranslational modifications, and the presence of honeybee proteins in Varroa are discussed. PMID:26358842

Dexamethasone effects on (/sup 125/I)albumin distribution in experimental RG-2 gliomas and adjacent brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakagawa, H.; Groothuis, D.R.; Owens, E.S.

1987-12-01

A total of 72 RG-2 transplanted gliomas were studied in 58 rats at three time points (1, 30, 240 min) after intravenous injection of (/sup 125/I)radioiodinated serum albumin ((/sup 125/I)RISA). The animals were divided into two groups: a control group that received no treatment and a second group that was treated with five doses of 1.5 mg/kg of dexamethasone over 2.5 days. Local tissue concentrations of (/sup 125/I)RISA were measured with quantitative autoradiography based on morphological features of the tumors and used to calculate the tissue distribution space. Two models were used to analyze the data. A two compartment modelmore » yielded estimates of local blood-to-tissue influx constants (K1), lower limit extracellular volumes (Ve), and plasma vascular volumes (Vp) in different tumor regions. Treatment with dexamethasone consistently reduced the RISA distribution space in the RG-2 tumors; the reduction in Ve was statistically significant in almost all tumor regions: whole tumor Ve (mean +/- SE) was reduced from 0.14 +/- 0.02 ml g-1 in control animals to 0.08 +/- 0.01 ml g-1 in dexamethasone treated animals. K1 and Vp were also decreased in all tumor regions after treatment with dexamethasone (whole tumor K1 decreased from 2.36 +/- 0.89 to 0.83 +/- 0.29 microliter g-1 min-1 and Vp decreased slightly from 0.016 +/- 0.013 to 0.010 +/- 0.005 ml g-1 after dexamethasone treatment), but these changes were not statistically significant. A comparison of the tumor influx constants in control animals and the aqueous diffusion constants of two different size molecules (RISA and aminoisobutyric acid) suggests that the ''pores'' across RG-2 capillaries are large and may not restrict the free diffusion of RISA (estimated minimum pore diameter greater than 36 nm) and that the total pore area is approximately 6.2 X 10(-5) cm2 g-1 in RG-2 tumor tissue.« less

Importation and outbreak of wild polioviruses from 2000 to 2014 and interruption of transmission in Cameroon.

PubMed

Endegue-Zanga, Marie Claire; Sadeuh-Mba, Serge Alain; Iber, Jane; Burns, Cara C; Moeletsi, Nicksy Gumede; Baba, Marycelin; Bukbuk, David; Delpeyroux, Francis; Mengouo, Marcellin Nimpa; Demanou, Maurice; Vernet, Guy; Etoa, François-Xavier; Njouom, Richard

2016-06-01

Efficient implementation of the global eradication strategies consisting of Acute Flaccid Paralysis (AFP) surveillance and mass immunization campaigns led to interruption of indigenous wild poliovirus transmission in Cameroon in 1999. This study describes type 1 and type 3 wild poliovirus (WPV) importation, incidence, geographic distribution and control since the original interruption of transmission in Cameroon. Stool samples from AFP patients under the age of 15 years in Cameroon were collected nationwide and subjected to virus isolation on RD and L20B cell cultures. Resulting virus isolates were typed by intratypic differentiation (ITD) and analysis of the VP1 coding sequence of the viral genome. Surveillance data originating from Cameroon between 2000 and 2014 were considered for retrospective descriptive analyses. From 2003 to 2009, multiple WPV importation events from neighboring countries affected mainly in the northern regions of Cameroon but did not led to sustained local transmission. Throughout this period, 16 WPV1 and 5 WPV3 were detected and identified as members of multiple clusters within type-specific West Africa B genotypes (WEAF-B). In 2013-2014, a polio outbreak associated to a highly evolved ("orphan") WPV1 affected four southern regions of Cameroon. The appearance of highly evolved lineage of type 1 WPV suggests potential surveillance gap and underscore the need to maintain comprehensive polio immunization activities and sensitive surveillance systems in place as long as any country in the world remains endemic for WPV. Copyright © 2016 Elsevier B.V. All rights reserved.

Micro-seismicity and seismic moment release within the Coso Geothermal Field, California

USGS Publications Warehouse

Kaven, Joern; Hickman, Stephen H.; Davatzes, Nicholas C.

2014-01-01

We relocate 16 years of seismicity in the Coso Geothermal Field (CGF) using differential travel times and simultaneously invert for seismic velocities to improve our knowledge of the subsurface geologic and hydrologic structure. We expand on our previous results by doubling the number of relocated events from April 1996 through May 2012 using a new field-wide 3-D velocity model. Relocated micro-seismicity sharpens in many portions of the active geothermal reservoir, likely defining large-scale fault zones and fluid pressure compartment boundaries. However, a significant fraction of seismicity remains diffuse and does not cluster into sharply defined structures, suggesting that permeability is maintained within the reservoir through distributed brittle failure. The seismic velocity structure reveals heterogeneous distributions of compressional (Vp) and shear (Vs) wave speed, with Vs generally higher in the Main Field and East Flank and Vp remaining relatively uniform across the CGF, but with significant local variations. The Vp/Vs ratio appears to outline the two main producing compartments of the reservoir at depths below mean ground level of approximately 1 to 2.5 km, with a ridge of relatively high Vp/Vs separating the Main Field from the East Flank. Detailed analyses of spatial and temporal variations in earthquake relocations and cumulative seismic moment release in the East Flank reveal three regions with persistently high rates of seismic activity. Two of these regions exhibit sharp, stationary boundaries at the margins of the East Flank that likely represent barriers to fluid flow and advective heat transport. However, seismicity and moment release in a third region at the northern end of the East Flank spread over time to form an elongated NE to SW structure, roughly parallel both to an elongated cluster of seismicity at the southern end of the East Flank and to regional fault traces mapped at the surface. Our results indicate that high-precision relocations of micro-seismicity and simultaneous velocity inversions in conjunction with mapping of seismic moment release can provide useful insights into subsurface structural features and hydrologic compartmentalization within the Coso Geothermal Field.

Three-dimensional velocity models of the Mount St. Helens magmatic system using the iMUSH active-source data set

NASA Astrophysics Data System (ADS)

Kiser, E.; Levander, A.; Zelt, C. A.; Palomeras, I.; Creager, K.; Ulberg, C. W.; Schmandt, B.; Hansen, S. M.; Harder, S. H.; Abers, G. A.; Crosbie, K.

2017-12-01

Building upon previously published 2D results, this presentation will show the first 3D velocity models down to the Moho using the iMUSH (imaging Magma Under St. Helens) active-source seismic data set. Direct P and S wave travel times from 23 borehole shots recorded at approximately 6000 seismograph locations are used to model Vp, Vs, and Vp/Vs over an area extending approximately 75 km from the edifice of Mount St. Helens and down to approximately 15 km depth. At shallow depths, results show several high and low velocity anomalies that correspond well with known geological features. These include the Chehalis Basin northwest of Mount St. Helens, and the Silver Star Mountain, Spirit Lake, and Spud Mountain plutons. Starting at 4 km depth, low velocities and high Vp/Vs values are observed near Mount St. Helens, which may be associated with shallow magmatic fluids. High Vp/Vs values are also observed beneath the Indian Heaven Volcanic Field southeast of Mount St. Helens. At the regional scale, high amplitude north/south trending low and high velocity features extend from the western margin of the resolved models to approximately 30 km west of Mount St. Helens. In general these high and low velocity features also correspond to high and low Vp/Vs anomalies, respectively. These results are in agreement with previous studies that conclude that the accreted terrane Siletzia is composed of multiple igneous bodies interspersed with sedimentary units in this region. Another regional feature of interest is a broad low Vp/Vs area between Mount St. Helens, Mount Adams, and Mount Rainier that spatially correlates with the Southern Washington Cascades Conductor, indicating a non-magmatic origin to this body at shallow and mid-crustal depths. In addition to these shallow results, preliminary 3D velocity models of the entire crust will be presented that utilize both direct and reflected seismic phases from the Moho and other mid-crustal discontinuities. These models will constrain the lateral extents of lower-crustal high and low velocity features observed in previous 2D results. This information will be critical for understanding the distribution of cumulate bodies, magma reservoirs, and accreted terranes in the lower crust, and how these features have affected recent volcanic activity in this region.

Effect of small flow reversals on aerosol mixing in the alveolar region of the human lung.

PubMed

Darquenne, Chantal; Prisk, G Kim

2004-12-01

It has been suggested that irreversibility of alveolar flow combined with a stretched and folded pattern of streamlines can lead to a sudden increase in mixing in the lung. To determine whether this phenomenon is operative in the human lung in vivo, we performed a series of bolus studies with a protocol designed to induce complex folding patterns. Boli of 0.5- and 1-microm-diameter particles were inhaled at penetration volumes (V(p)) of 300 and 1,200 ml in eight subjects during short periods of microgravity aboard the National Aeronautics and Space Administration Microgravity Research Aircraft. Inspiration was from residual volume to 1 liter above 1 G functional residual capacity. This was followed by a 10-s breathhold, during which up to seven 100-ml flow reversals (FR) were imposed at V(p) = 300 ml and up to four 500-ml FR at V(p) = 1,200 ml, and by an expiration to residual volume. Bolus dispersion and deposition were calculated from aerosol concentration and flow rate continuously monitored at the mouth. There was no significant increase in dispersion and deposition with increasing FR except for dispersion between 0 and 7 FR at V(p) = 300 ml with 0.5-microm-diameter particles, and this increase was small. This suggested that either the phenomenon of stretch and fold did not occur within the number of FR we performed or that it had already occurred during the one breathing cycle included in the basic maneuver. We speculate that the phenomenon occurred during the basic maneuver, which is consistent with the high degree of dispersion and deposition observed previously in microgravity.

Object-oriented code SUR for plasma kinetic simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levchenko, V.D.; Sigov, Y.S.

1995-12-31

We have developed a self-consistent simulation code based on object-oriented model of plasma (OOMP) for solving the Vlasov/Poisson (V/P), Vlasov/Maxwell (V/M), Bhatnagar-Gross-Krook (BGK) as well as Fokker-Planck (FP) kinetic equations. The application of an object-oriented approach (OOA) to simulation of plasmas and plasma-like media by means of splitting methods permits to uniformly describe and solve the wide circle of plasma kinetics problems, including those being very complicated: many-dimensional, relativistic, with regard for collisions, specific boundary conditions etc. This paper gives the brief description of possibilities of the SUR code, as a concrete realization of OOMP.

Compressional and shear-wave velocity versus depth relations for common rock types in northern California

USGS Publications Warehouse

Brocher, T.M.

2008-01-01

This article presents new empirical compressional and shear-wave velocity (Vp and Vs) versus depth relationships for the most common rock types in northern California. Vp versus depth relations were developed from borehole, laboratory, seismic refraction and tomography, and density measurements, and were converted to Vs versus depth relations using new empirical relations between Vp and Vs. The relations proposed here account for increasing overburden pressure but not for variations in other factors that can influence velocity over short distance scales, such as lithology, consolidation, induration, porosity, and stratigraphic age. Standard deviations of the misfits predicted by these relations thus provide a measure of the importance of the variability in Vp and Vs caused by these other factors. Because gabbros, greenstones, basalts, and other mafic rocks have a different Vp and Vs relationship than sedimentary and granitic rocks, the differences in Vs between these rock types at depths below 6 or 7 km are generally small. The new relations were used to derive the 2005 U.S. Geological Survey seismic velocity model for northern California employed in the broadband strong motion simulations of the 1989 Loma Prieta and 1906 San Francisco earthquakes; initial tests of the model indicate that the Vp model generally compares favorably to regional seismic tomography models but that the Vp and Vs values proposed for the Franciscan Complex may be about 5% too high.

Evasion of interferon responses by Ebola and Marburg viruses.

PubMed

Basler, Christopher F; Amarasinghe, Gaya K

2009-09-01

The filoviruses, Ebola virus (EBOV) and Marburg virus (MARV), cause frequently lethal viral hemorrhagic fever. These infections induce potent cytokine production, yet these host responses fail to prevent systemic virus replication. Consistent with this, filoviruses have been found to encode proteins VP35 and VP24 that block host interferon (IFN)-alpha/beta production and inhibit signaling downstream of the IFN-alpha/beta and the IFN-gamma receptors, respectively. VP35, which is a component of the viral nucleocapsid complex and plays an essential role in viral RNA synthesis, acts as a pseudosubstrate for the cellular kinases IKK-epsilon and TBK-1, which phosphorylate and activate interferon regulatory factor 3 (IRF-3) and interferon regulatory factor 7 (IRF-7). VP35 also promotes SUMOylation of IRF-7, repressing IFN gene transcription. In addition, VP35 is a dsRNA-binding protein, and mutations that disrupt dsRNA binding impair VP35 IFN-antagonist activity while leaving its RNA replication functions intact. The phenotypes of recombinant EBOV bearing mutant VP35s unable to inhibit IFN-alpha/beta demonstrate that VP35 IFN-antagonist activity is critical for full virulence of these lethal pathogens. The structure of the VP35 dsRNA-binding domain, which has recently become available, is expected to provide insight into how VP35 IFN-antagonist and dsRNA-binding functions are related. The EBOV VP24 protein inhibits IFN signaling through an interaction with select host cell karyopherin-alpha proteins, preventing the nuclear import of otherwise activated STAT1. It remains to be determined to what extent VP24 may also modulate the nuclear import of other host cell factors and to what extent this may influence the outcome of infection. Notably, the Marburg virus VP24 protein does not detectably block STAT1 nuclear import, and, unlike EBOV, MARV infection inhibits STAT1 and STAT2 phosphorylation. Thus, despite their similarities, there are fundamental differences by which these deadly viruses counteract the IFN system. It will be of interest to determine how these differences influence pathogenesis.

Full-Genome Characterisation of Orungo, Lebombo and Changuinola Viruses Provides Evidence for Co-Evolution of Orbiviruses with Their Arthropod Vectors

PubMed Central

Mohd Jaafar, Fauziah; Belhouchet, Mourad; Belaganahalli, Manjunatha; Tesh, Robert B.; Mertens, Peter P. C.; Attoui, Houssam

2014-01-01

The complete genomes of Orungo virus (ORUV), Lebombo virus (LEBV) and Changuinola virus (CGLV) were sequenced, confirming that they each encode 11 distinct proteins (VP1-VP7 and NS1-NS4). Phylogenetic analyses of cell-attachment protein ‘outer-capsid protein 1′ (OC1), show that orbiviruses fall into three large groups, identified as: VP2(OC1), in which OC1 is the 2nd largest protein, including the Culicoides transmitted orbiviruses; VP3(OC1), which includes the mosquito transmitted orbiviruses; and VP4(OC1) which includes the tick transmitted viruses. Differences in the size of OC1 between these groups, places the T2 ‘subcore-shell protein’ as the third largest protein ‘VP3(T2)’ in the first of these groups, but the second largest protein ‘VP3(T2)’ in the other two groups. ORUV, LEBV and CGLV all group with the Culicoides-borne VP2(OC1)/VP3(T2) viruses. The G+C content of the ORUV, LEBV and CGLV genomes is also similar to that of the Culicoides-borne, rather than the mosquito-borne, or tick borne orbiviruses. These data suggest that ORUV and LEBV are Culicoides- rather than mosquito-borne. Multiple isolations of CGLV from sand flies suggest that they are its primary vector. OC1 of the insect-borne orbiviruses is approximately twice the size of the equivalent protein of the tick borne viruses. Together with internal sequence similarities, this suggests its origin by duplication (concatermerisation) of a smaller OC1 from an ancestral tick-borne orbivirus. Phylogenetic comparisons showing linear relationships between the dates of evolutionary-separation of their vector species, and genetic-distances between tick-, mosquito- or Culicoides-borne virus-groups, provide evidence for co-evolution of the orbiviruses with their arthropod vectors. PMID:24475112

Sequence analysis of VP7 and VP4 genes of G1P[8] rotaviruses circulating among diarrhoeic children in Pune, India: a comparison with Rotarix and RotaTeq vaccine strains.

PubMed

Kulkarni, Ruta; Arora, Ritu; Arora, Rashmi; Chitambar, Shobha D

2014-08-11

The G1P[8] rotaviruses are a common cause of rotavirus diarrhoea among children in India. Two rotavirus vaccines licensed in India, Rotarix and RotaTeq, contain strains with G1 and P[8] genotypes. A comparative analysis of these genotypes in the live rotavirus vaccines with circulating rotavirus strains is essential for assessment of rotavirus diversity. G1P[8] strains detected during rotavirus surveillance among diarrhoeic children hospitalized in Pune in 1992-1993 and 2006-2008, were included in the study. Amplification, sequencing and phylogenetic analysis of the VP7 and VP4 genes were carried out for identification of the G1 and P[8] lineages, respectively. Antigenic epitopes of VP7 and VP4 encoded proteins were compared to determine the differences between the G1P[8] strains from Pune and the vaccine strains. G1-Lineage 1, P[8]-Lineage 3 strains were predominant in Pune during 1992-1993 and 2006-2008. Strains of G1-Lineage 2, P[8]-Lineage 3 and G1-Lineage 1, P[8]-Lineage 4 were detected at low levels during 2006-2008. The G1-Lineage 1, P[8]-Lineage 3 strains showed up to eight amino acid changes, each in the VP7 and VP4 epitopes, with respect to the Rotarix vaccine strain (G1-Lineage 2, P[8]-Lineage 1) and the G1 (Lineage-3) and P[8] (Lineage 2) components of the RotaTeq vaccine. The G1-Lineage 2 strains were closer to both vaccine strains with no or only two amino acid substitutions in the VP7 epitopes. The divergent P[8]-Lineage 4 (OP354-like) strains showed fourteen and fifteen amino acid differences, with Rotarix and RotaTeq vaccine strains, respectively, in the VP4 epitopes. The differences between the G1P[8] strains in Pune and the G1 and P[8] components of the vaccine strains need to be described for appropriate evaluation of vaccine shedding. Continuous monitoring of the G1P[8] subgenotypic lineages would be necessary to study any long term impact of vaccine use on G1P[8] strain evolution. Copyright © 2014. Published by Elsevier Ltd.

Unrecognized circulation of SAT 1 foot-and-mouth disease virus in cattle herds around Queen Elizabeth National Park in Uganda.

PubMed

Dhikusooka, Moses Tefula; Ayebazibwe, Chrisostom; Namatovu, Alice; Belsham, Graham J; Siegismund, Hans Redlef; Wekesa, Sabenzia Nabalayo; Balinda, Sheila Nina; Muwanika, Vincent B; Tjørnehøj, Kirsten

2016-01-06

Foot-and-mouth disease (FMD) is endemic in Uganda in spite of the control measures used. Various aspects of the maintenance and circulation of FMD viruses (FMDV) in Uganda are not well understood; these include the role of the African buffalo (Syncerus caffer) as a reservoir for FMDV. To better understand the epidemiology of FMD at the livestock-wildlife-interface, samples were collected from young, unvaccinated cattle from 24 pastoral herds that closely interact with wildlife around Queen Elizabeth National Park in Uganda, and analysed for evidence of FMDV infection. In total, 37 (15%) of 247 serum samples had detectable antibodies against FMDV non-structural proteins (NSPs) using a pan-serotypic assay. Within these 37 sera, antibody titres ≥ 80 against the structural proteins of serotypes O, SAT 1, SAT 2 and SAT 3 were detected by ELISA in 5, 7, 4 and 3 samples, respectively, while neutralizing antibodies were only detected against serotype O in 3 samples. Two FMDV isolates, with identical VP1 coding sequences, were obtained from probang samples from clinically healthy calves from the same herd and are serotype SAT 1 (topotype IV (EA-I)). Based on the VP1 coding sequences, these viruses are distinct from previous cattle and buffalo SAT 1 FMDV isolates obtained from the same area (19-30% nucleotide difference) and from the vaccine strain (TAN/155/71) used within Uganda (26% nucleotide difference). Eight herds had only one or a few animals with antibodies against FMDV NSPs while six herds had more substantial evidence of prior infection with FMDV. There was no evidence for exposure to FMDV in the other ten herds. The two identical SAT 1 FMDV VP1 sequences are distinct from former buffalo and cattle isolates from the same area, thus, transmission between buffalo and cattle was not demonstrated. These new SAT 1 FMDV isolates differed significantly from the vaccine strain used to control Ugandan FMD outbreaks, indicating a need for vaccine matching studies. Only six herds had clear serological evidence for exposure to O and SAT 1 FMDV. Scattered presence of antibodies against FMDV in other herds may be due to the occasional introduction of animals to the area or maternal antibodies from past infection and/or vaccination. The evidence for asymptomatic FMDV infection has implications for disease control strategies in the area since this obstructs early disease detection that is based on clinical signs in FMDV infected animals.

Detection and characterization of hepatitis A virus circulating in Egypt.

PubMed

Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

2017-07-01

Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

Deposition and dispersion of 1-micrometer aerosol boluses in the human lung: effect of micro- and hypergravity

NASA Technical Reports Server (NTRS)

Darquenne, C.; West, J. B.; Prisk, G. K.

1998-01-01

We performed bolus inhalations of 1-micrometer particles in four subjects on the ground (1 G) and during parabolic flights both in microgravity (microG) and in approximately 1.6 G. Boluses of approximately 70 ml were inhaled at different points in an inspiration from residual volume to 1 liter above functional residual capacity. The volume of air inhaled after the bolus [the penetration volume (Vp)] ranged from 200 to 1,500 ml. Aerosol concentration and flow rate were continuously measured at the mouth. The deposition, dispersion, and position of the bolus in the expired gas were calculated from these data. For Vp >/=400 ml, both deposition and dispersion increased with Vp and were strongly gravity dependent, with the greatest deposition and dispersion occurring for the largest G level. At Vp = 800 ml, deposition and dispersion increased from 33.9% and 319 ml in microG to 56.9% and 573 ml at approximately 1.6 G, respectively (P < 0.05). At each G level, the bolus was expired at a smaller volume than Vp, and this volume became smaller with increasing Vp. Although dispersion was lower in microG than in 1 G and approximately 1.6 G, it still increased steadily with increasing Vp, showing that nongravitational ventilatory inhomogeneity is partly responsible for dispersion in the human lung.

Evaluation of Trichodysplasia Spinulosa-Associated Polyomavirus Capsid Protein as a New Carrier for Construction of Chimeric Virus-Like Particles Harboring Foreign Epitopes

PubMed Central

Gedvilaite, Alma; Kucinskaite-Kodze, Indre; Lasickiene, Rita; Timinskas, Albertas; Vaitiekaite, Ausra; Ziogiene, Danguole; Zvirbliene, Aurelija

2015-01-01

Recombinant virus-like particles (VLPs) represent a promising tool for protein engineering. Recently, trichodysplasia spinulosa-associated polyomavirus (TSPyV) viral protein 1 (VP1) was efficiently produced in yeast expression system and shown to self-assemble to VLPs. In the current study, TSPyV VP1 protein was exploited as a carrier for construction of chimeric VLPs harboring selected B and T cell-specific epitopes and evaluated in comparison to hamster polyomavirus VP1 protein. Chimeric VLPs with inserted either hepatitis B virus preS1 epitope DPAFR or a universal T cell-specific epitope AKFVAAWTLKAAA were produced in yeast Saccharomyces cerevisiae. Target epitopes were incorporated either at the HI or BC loop of the VP1 protein. The insertion sites were selected based on molecular models of TSPyV VP1 protein. The surface exposure of the insert positions was confirmed using a collection of monoclonal antibodies raised against the intact TSPyV VP1 protein. All generated chimeric proteins were capable to self-assemble to VLPs, which induced a strong immune response in mice. The chimeric VLPs also activated dendritic cells and T cells as demonstrated by analysis of cell surface markers and cytokine production profiles in spleen cell cultures. In conclusion, TSPyV VP1 protein represents a new potential carrier for construction of chimeric VLPs harboring target epitopes. PMID:26230706

M cell-targeting strategy facilitates mucosal immune response and enhances protection against CVB3-induced viral myocarditis elicited by chitosan-DNA vaccine.

PubMed

Ye, Ting; Yue, Yan; Fan, Xiangmei; Dong, Chunsheng; Xu, Wei; Xiong, Sidong

2014-07-31

Efficient delivery of antigen to mucosal associated lymphoid tissue is a first and critical step for successful induction of mucosal immunity by vaccines. Considering its potential transcytotic capability, M cell has become a more and more attractive target for mucosal vaccines. In this research, we designed an M cell-targeting strategy by which mucosal delivery system chitosan (CS) was endowed with M cell-targeting ability via conjugating with a CPE30 peptide, C terminal 30 amino acids of clostridium perfringens enterotoxin (CPE), and then evaluated its immune-enhancing ability in the context of coxsackievirus B3 (CVB3)-specific mucosal vaccine consisting of CS and a plasmid encoding CVB3 predominant antigen VP1. It had shown that similar to CS-pVP1, M cell-targeting CPE30-CS-pVP1 vaccine appeared a uniform spherical shape with about 300 nm diameter and +22 mV zeta potential, and could efficiently protect DNA from DNase I digestion. Mice were orally immunized with 4 doses of CPE30-CS-pVP1 containing 50 μg pVP1 at 2-week intervals and challenged with CVB3 4 weeks after the last immunization. Compared with CS-pVP1 vaccine, CPE30-CS-pVP1 vaccine had no obvious impact on CVB3-specific serum IgG level and splenic T cell immune responses, but significantly increased specific fecal SIgA level and augmented mucosal T cell immune responses. Consequently, much milder myocarditis and lower viral load were witnessed in CPE30-CS-pVP1 immunized group. The enhanced immunogenicity and immunoprotection were associated with the M cell-targeting ability of CPE30-CS-pVP1 which improved its mucosal uptake and transcytosis. Our findings indicated that CPE30-CS-pVP1 may represent a novel prophylactic vaccine against CVB3-induced myocarditis, and this M cell-targeting strategy indeed could be applied as a promising and universal platform for mucosal vaccine development. Copyright © 2014 Elsevier Ltd. All rights reserved.

Circulation of a type 1 recombinant vaccine-derived poliovirus strain in a limited area in Romania.

PubMed

Combiescu, M; Guillot, S; Persu, A; Baicus, A; Pitigoi, D; Balanant, J; Oprisan, G; Crainic, R; Delpeyroux, F; Aubert-Combiescu, A

2007-01-01

After intensive immunisation campaigns with the oral polio vaccine (OPV) as part of the Global Polio Eradication Initiative, poliomyelitis due to wild viruses has disappeared from most parts of the world, including Europe. Here, we report the characterization of a serotype 1 vaccine-derived poliovirus (VDPV) isolated from one acute flaccid paralysis (AFP) case with tetraplegia and eight healthy contacts belonging to the same small socio-cultural group having a low vaccine coverage living in a small town in Romania. The genomes of the isolated strains appeared to be tripartite type 1/type 2/type 1 vaccine intertypic recombinant genomes derived from a common ancestor strain. The presence of 1.2% nucleotide substitutions in the VP1 capsid protein coding region of most of the strains indicated a circulation time of about 14 months. These VDPVs were thermoresistant and, in transgenic mice expressing the human poliovirus receptor, appeared to have lost the attenuated phenotype. These results suggest that small populations with low vaccine coverage living in globally well-vaccinated countries can be the origin of VDPV emergence and circulation. These results reaffirm the importance of active surveillance for acute flaccid paralysis and poliovirus in both polio-free and polio-endemic countries.

Development of ELISA using recombinant antigens for specific detection of mouse parvovirus infection.

PubMed

Kunita, Satoshi; Chaya, Miyuki; Hagiwara, Kozue; Ishida, Tomoko; Takakura, Akira; Sugimoto, Tatsuya; Iseki, Hiroyoshi; Fuke, Kumiko; Sugiyama, Fumihiro; Yagami, Ken-ichi

2006-04-01

Nucleotide sequences of mouse parvovirus (MPV) isolate, named MPV/UT, and mouse minute virus (MMV) were analyzed and used for expressing recombinant proteins in E. coli. ELISA tests using recombinant major capsid protein (rVP2) and recombinant major non-structural protein (rNS1) as antigens were developed and their performance in serologic detection of rodent parvovirus infection was assessed. MPV-rVP2 and MMV-rVP2 ELISAs reacted specifically with anti-MPV and anti-MMV mouse sera, respectively. MMV-rNS1 antigen had a wide reaction range with antisera to rodent parvoviruses including MPV, MMV, Kilham rat virus (KRV) and H-1 virus. All mice oronasally infected with MPV were seropositive at 4 weeks post-infection in screening by ELISAs using MPV-rVP2 and MMV-rNS1 antigens, but were negative by conventional ELISA using whole MMV antigen. A contact transmission experiment revealed that transmission of MPV occurred up to 4 weeks post-infection, and all cage mates were seropositive in screening with MPV-rVP2 and MMV-rNS1 ELISAs. These results indicate that MPV-rVP2 and MMV-rVP2 are specific ELISA antigens which distinguish between MPV and MVM infection, while MMV-rNS1 antigen can be used in generic ELISA for a variety of rodent parvoviruses. The higher sensitivity of MPV-rVP2 ELISA than conventional ELISA for detecting seroconversion to MPV in oronasally infected mice as well as in cage mates suggests the usefulness of MPV-rVP2 ELISA in quarantine and microbiological monitoring of MPV infection in laboratory mice.

Targeting of rotavirus VP6 to DEC-205 induces protection against the infection in mice.

PubMed

Badillo-Godinez, O; Gutierrez-Xicotencatl, L; Plett-Torres, T; Pedroza-Saavedra, A; Gonzalez-Jaimes, A; Chihu-Amparan, L; Maldonado-Gama, M; Espino-Solis, G; Bonifaz, L C; Esquivel-Guadarrama, F

2015-08-20

Rotavirus (RV) is the primary etiologic agent of severe gastroenteritis in human infants. Although two attenuated RV-based vaccines have been licensed to be applied worldwide, they are not so effective in low-income countries, and the induced protection mechanisms have not been clearly established. Thus, it is important to develop new generation vaccines that induce long lasting heterotypic immunity. VP6 constitutes the middle layer protein of the RV virion. It is the most conserved protein and it is the target of protective T-cells; therefore, it is a potential candidate antigen for a new generation vaccine against the RV infection. We determined whether targeting the DEC-205 present in dendritic cells (DCs) with RV VP6 could induce protection at the intestinal level. VP6 was cross-linked to a monoclonal antibody (mAb) against murine DEC-205 (αDEC-205:VP6), and BALB/c mice were inoculated subcutaneously (s.c.) twice with the conjugated containing 1.5 μg of VP6 in the presence of polyinosinic-polycytidylic acid (Poly I:C) as adjuvant. As controls and following the same protocol, mice were immunized with ovalbumin (OVA) cross-linked to the mAb anti-DEC-205 (αDEC-205:OVA), VP6 cross-linked to a control isotype mAb (Isotype:VP6), 3 μg of VP6 alone, Poly I:C or PBS. Two weeks after the last inoculation, mice were orally challenged with a murine RV. Mice immunized with α-DEC-205:VP6 and VP6 alone presented similar levels of serum Abs to VP6 previous to the virus challenge. However, after the virus challenge, only α-DEC-205:VP6 induced up to a 45% IgA-independent protection. Memory T-helper (Th) cells from the spleen and the mesenteric lymph node (MLN) showed a Th1-type response upon antigen stimulation in vitro. These results show that when VP6 is administered parenterally targeting DEC-205, it can induce protection at the intestinal level at a very low dose, and this protection may be Th1-type cell dependent. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses.

PubMed

Johnson, Britney; Li, Jing; Adhikari, Jagat; Edwards, Megan R; Zhang, Hao; Schwarz, Toni; Leung, Daisy W; Basler, Christopher F; Gross, Michael L; Amarasinghe, Gaya K

2016-08-28

Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulate nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Britney; Li, Jing; Adhikari, Jagat

Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulatemore » nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections.« less

Crustal tomographic imaging of a transitional continental rift: the Ethiopian rift

NASA Astrophysics Data System (ADS)

Daly, E.; Keir, D.; Ebinger, C. J.; Stuart, G. W.; Bastow, I. D.; Ayele, A.

2008-03-01

In this study we image crustal structure beneath a magmatic continental rift to understand the interplay between crustal stretching and magmatism during the late stages of continental rifting: the Main Ethiopian Rift (MER). The northern sector of this region marks the transition from continental rifting in the East African Rift to incipient seafloor spreading in the southern Red Sea and western Gulf of Aden. Our local tomographic inversion exploits 172 broad-band instruments covering an area of 250 × 350 km of the rift and adjacent plateaux. The instruments recorded a total of 2139 local earthquakes over a 16-month period. Several synthetic tests show that resolution is good between 12 and 25 km depth (below sea level), but some horizontal velocity smearing is evident along the axis of the Main Ethiopian Rift below 16 km. We present a 3-D P-wave velocity model of the mid-crust and present the first 3-D Vp/Vs model of the region. Our models show high P-wave velocities (6.5 km s-1) beneath the axis of the rift at a depth of 12-25 km. The presence of high Vp/Vs ratios (1.81-1.84) at the same depth range suggest that they are cooled mafic intrusions. The high Vp/Vs values, along with other geophysical evidence, suggest that dyking is pervasive beneath the axis of the rift from the mid-crustal depths to the surface and that some portion of partial melt may exist at lower crustal depths. Although the crustal stretching factor across the Main Ethiopian Rift is ~1.7, our results indicate that magma intrusion in narrow zones accommodates a large proportion of extensional strain, with similarities to slow-spreading mid-ocean ridge processes.

W 2 and Q 2 dependence of charged hadron and pion multiplicities in vp andbar vp charged current interactionscharged current interactions

NASA Astrophysics Data System (ADS)

Jones, G. T.; Jones, R. W. L.; Morrison, D. R. O.; Mobayyen, M. M.; Wainstein, S.; Aderholz, M.; Hantke, D.; Hoffmann, E.; Katz, U. F.; Kern, J.; Schmitz, N.; Wittek, W.; Allport, P.; Borner, H. P.; Myatt, G.; Radojicic, D.; Bullock, F. W.; Burke, S.

1990-03-01

Using data on vp andbar vp charged current interactions from a bubble chamber experiment with BEBC at CERN, the average multiplicities of charged hadrons and pions are determined as functions of W 2 and Q 2. The analysis is based on ˜20000 events with incident v and ˜10000 events with incidentbar v. In addition to the known dependence of the average multiplicity on W 2 a weak dependence on Q 2 for fixed intervals of W is observed. For W>2 GeV and Q 2>0.1 GeV2 the average multiplicity of charged hadrons is well described by =a 1+ a 2ln( W 2/GeV2)+ a 3ln( Q 2/GeV2) with a 1=0.465±0.053, a 2=1.211±0.021, a 3=0.103±0.014 for the vp and a 1=-0.372±0.073, a 2=1.245±0.028, a 3=0.093±0.015 for thebar vp reaction.

Measurements of wave velocity and electrical conductivity of an amphibolite from southwestern margin of the Tarim Basin at pressures to 1.0 GPa and temperatures to 700 °C: comparison with field observations

NASA Astrophysics Data System (ADS)

Zhou, Wenge; Fan, Dawei; Liu, Yonggang; Xie, Hongsen

2011-12-01

In situ measurements of elastic wave velocities and electrical conductivities in the three structural directions (normal to foliation Z, perpendicular to lineation in foliation Y and parallel to lineation X) for an amphibolite collected from southwestern margin of the Tarim Basin, northwest China, were carried out in the laboratory. The elastic wave velocity was measured with the combined transmission-reflection method at pressures up to 1.0 GPa (at room temperature) and temperatures up to 700 °C (at 1.0 GPa) and the electrical conductivity was measured with the impedance spectroscopy from 250 to 700 °C at 1.0 GPa. The experimentally determined data included compressional (Vp) and shear wave velocities (Vs), velocity anisotropy (Av), intrinsic pressure and temperature derivatives of Vp and Vs, electrical conductivity (σ), electrical conductivity anisotropy (Aσ) and the parameters of the Arrhenius relationship. Elastic wave velocities increase in the structural directions Z, Y, X, with Vp of 6.63, 6.78 and 6.95 km s-1 and Vs of 3.75, 3.82 and 3.96 km s-1 for Z, Y and X, respectively, at pressure of 1.0 GPa. Elastic wave velocities increase linearly with pressure at room temperature and pressures between 0.25 and 1.0 GPa and decrease linearly with increasing temperature at 1.0 GPa. The pressure coefficients of the sample are in the range of 0.1883-0.2308 km s-1 GPa-1 for Vp and 0.1149-0.1678 km s-1 GPa-1 for Vs. The temperature coefficients are in the range of 2.09-2.35 × 10-4 km s-1 GPa-1 for Vp and 1.28-1.68 × 10-4 km s-1 GPa-1 for Vs. The electrical conductivity increases with increasing temperature, consistent with the Arrhenius relationship. Activation energies for the three structural directions of the amphibolite are in the range of 0.71-0.75 eV. The amphibolite shows velocity anisotropy (4.15-4.86 per cent for Vp and 5.29-5.84 per cent for Vs at 0.25-1.0 GPa) and electrical conductivity anisotropy (11.1-25.2 per cent). Based on the regional crust model and geothermal gradient, velocity and electrical conductivity-depth profiles were calculated for the sample. These profiles were then compared with those derived from seismic reflection/refraction data and from electromagnetic data. Our results showed that the amphibolite sample has Vp and Vs in agreement with those of the middle and lower crust obtained from seismic reflection/refraction data, and σ in accord with that of the lower crust deduced from electromagnetic data. The lower crust of the electromagnetic crust model is roughly equivalent to the middle and lower crust layers of the seismic crust model. Therefore, it is suggest that the amphibolite may be one of the constituents of the present middle and lower crust in the Tarim Basin.

Plasmid dynamics in Vibrio parahaemolyticus strains related to shrimp Acute Hepatopancreatic Necrosis Syndrome (AHPNS).

PubMed

Theethakaew, Chonchanok; Nakamura, Shota; Motooka, Daisuke; Matsuda, Shigeaki; Kodama, Toshio; Chonsin, Kaknokrat; Suthienkul, Orasa; Iida, Tetsuya

2017-07-01

Vibrio parahaemolyticus is a causative agent of acute hapatopancreatic necrosis syndrome (AHPNS) which causes early mortality in white shrimp. Emergence of AHPNS has caused tremendous economic loss for aquaculture industry particularly in Asia since 2010. Previous studies reported that strains causing AHPNS harbor a 69-kb plasmid with possession of virulence genes, pirA and pirB. However, genetic variation of the 69-kb plasmid among AHPNS related strains has not been investigated. This study aimed to analyze genetic composition and diversity of the 69-kb plasmid in strains isolated from shrimps affected by AHPNS. Plasmids recovered from V. parahaemolyticus strain VPE61 which represented typical AHPNS pathogenicity, strain VP2HP which did not represent AHPNS pathogenicity but was isolated from AHPNS affected shrimp and other AHPNS V. parahaemolyticus isolates in Genbank were investigated. Protein coding genes of the 69-kb plasmid from the strain VPE61 were identical to that of AHPNS strain from Vietnam except the inverted complement 3.4-kb transposon covering pirA and pirB. The strain VP2HP possessed remarkable large 183-kb plasmid which shared similar protein coding genes to those of the 69-kb plasmid from strain VPE61. However, the 3.4-kb transposon covering pirA and pirB was absent from the 183-kb plasmid in strain VP2HP. A number of protein coding genes from the 183-kb plasmid were also detected in other AHPNS strains. In summary, this study identified a novel 183-kb plasmid that is related to AHPNS causing strains. Homologous recombination of the 69-kb AHPNS plasmid and other naturally occurring plasmids together with loss and gain of AHPNS virulence genes in V. parahaemolyticus were observed. The outcome of this research enables understanding of plasmid dynamics that possibly affect variable degrees of AHPNS pathogenicity. Copyright © 2017 Elsevier B.V. All rights reserved.

Independent segregation of two antigenic specificities (VP3 and VP7) involved in neutralization of rotavirus infectivity.

PubMed Central

Hoshino, Y; Sereno, M M; Midthun, K; Flores, J; Kapikian, A Z; Chanock, R M

1985-01-01

Antiserum prepared against the M37 strain of rotavirus, recovered from an asymptomatic newborn infant in Venezuela, neutralized two prototype human rotaviruses that define two separate serotypes: serotype 1 (Wa) and serotype 4 (ST3). Thus, the M37 strain is a naturally occurring intertypic rotavirus. Analysis of reassortant viruses produced during coinfection in vitro indicated that the observed dual serotype specificity of M37 resulted from sharing a related outer capsid protein, VP3, with the ST3 virus and another related outer capsid protein, VP7, with the Wa virus. Analysis of single (VP3)-gene-substitution reassortants indicated that VP3 was as potent an immunogen as VP7. In addition, direct evidence was obtained that the serotype specificity of neutralizing antibody elicited by VP3 can differ from the serotype specificity of neutralizing antibody elicited by VP7, indicating the need for a dual system of rotavirus classification in which the neutralization specificity of both VP3 and VP7 outer capsid proteins are identified. Images PMID:3001716

Immunogenicity of Newcastle disease virus vectors expressing Norwalk virus capsid protein in the presence or absence of VP2 protein.

PubMed

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y; Samal, Siba K

2015-10-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirus-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. Copyright © 2015 Elsevier Inc. All rights reserved.

Histologic differences between orthotopic xenograft pancreas models affect Verteporfin uptake measured by fluorescence microscopy and spectroscopy

NASA Astrophysics Data System (ADS)

O'Hara, Julia A.; Samkoe, Kimberley S.; Chen, Alina; Isabelle, Martin; Hoopes, P. J.; Hasan, Tayyaba; Pogue, Brian W.

2012-02-01

Photodynamic therapy (PDT) that uses the second generation photosensitizer, verteporfin (VP), is a developing therapy for pancreatic cancer. The optimal timing of light delivery related to VP uptake and distribution in pancreatic tumors will be important information to obtain to improve treatment for this intractable disease. In this work we examined uptake and distribution of VP in two orthotopic pancreatic tumors with different histological structure. ASPC-1 (fast-growing) and Panc-1 (slower growing) tumors were implanted in SCID mice and studied when tumors were approximately 100mm3. In a pilot study, these tumors had been shown to differ in uptake of VP using lightinduced fluorescence spectroscopy (LIFS) in vivo and fluorescence imaging ex vivo and that work is extended here. In vivo fluorescence mean readings of tumor and liver increased rapidly up to 15 minutes after photosensitizer injection for both tumor types, and then continued to increase up to 60 minutes post injection to a higher level in ASPC-1 than in Panc-1. There was variability among animals with the same tumor type, in both liver and tumor uptake and no selectivity of tumor over liver. In this work we further examined VP uptake at multiple time points in relation to microvascular density and perfusion, using DiOC7 (to mark blood vessels) and VP fluorescence in the same tissue slices. Analysis of DiOC7 fluorescence indicates that AsPC-1 and Panc-1 have different vascular densities but AsPC-1 vasculature is more perfusive. Analysis of colocalized DiOC7 and VP fluorescence showed ASPC-1 with higher accumulation of VP 3 hrs after injection and more VP at a distance from blood vessels compared to Panc-1. This work shows the need for techniques to analyze photosensitizer distribution in order to optimize photodynamic therapy as an effective treatment for pancreatic tumors.

Expression and characterization of a novel truncated rotavirus VP4 for the development of a recombinant rotavirus vaccine.

PubMed

Li, Yijian; Xue, Miaoge; Yu, Linqi; Luo, Guoxing; Yang, Han; Jia, Lianzhi; Zeng, Yuanjun; Li, Tingdong; Ge, Shengxiang; Xia, Ningshao

2018-04-12

The outer capsid protein VP4 is an important target for the development of a recombinant rotavirus vaccine because it mediates the attachment and penetration of rotavirus. Due to the poor solubility of full-length VP4, VP8 was explored as candidate rotavirus vaccines in the past years. In previous studies, it has been found that the N-terminal truncated VP8 protein, VP8-1 (aa26-231), could be expressed in soluble form with improved immunogenicity compared to the core of VP8 (aa65-223). However, this protein stimulated only a weak immune response when aluminum hydroxide was used as an adjuvant. In addition, it should be noted that the protective efficacy of VP4 was higher than that of VP8 and VP5. In this study, it was found that when the N-terminal 25 amino acids were deleted, the truncated VP4 ∗ (aa26-476) containing VP8 and the stalk domain of VP5 could be expressed in soluble form in E. coli and purified to homogeneous trimers. Furthermore, the truncated VP4 could induce high titers of neutralizing antibodies when aluminum adjuvant was used and conferred high protective efficacy in reducing the severity of diarrhea and rotavirus shedding in stools in animal models. The immunogenicity of the truncated VP4 was significantly higher than that of VP8 ∗ and VP5 ∗ alone. Taken together, the truncated VP4 ∗ (aa26-476), with enhanced immunogenicity and immunoprotectivity, could be considered as a viable candidate for further development and has the potential to become a parenterally administered rotavirus vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.

The feasibility of polychromatic cone-beam x-ray fluorescence computed tomography (XFCT) imaging of gold nanoparticle-loaded objects: a Monte Carlo study.

PubMed

Jones, Bernard L; Cho, Sang Hyun

2011-06-21

A recent study investigated the feasibility to develop a bench-top x-ray fluorescence computed tomography (XFCT) system capable of determining the spatial distribution and concentration of gold nanoparticles (GNPs) in vivo using a diagnostic energy range polychromatic (i.e. 110 kVp) pencil-beam source. In this follow-up study, we examined the feasibility of a polychromatic cone-beam implementation of XFCT by Monte Carlo (MC) simulations using the MCNP5 code. In the current MC model, cylindrical columns with various sizes (5-10 mm in diameter) containing water loaded with GNPs (0.1-2% gold by weight) were inserted into a 5 cm diameter cylindrical polymethyl methacrylate phantom. The phantom was then irradiated by a lead-filtered 110 kVp x-ray source, and the resulting gold fluorescence and Compton-scattered photons were collected by a series of energy-sensitive tallies after passing through lead parallel-hole collimators. A maximum-likelihood iterative reconstruction algorithm was implemented to reconstruct the image of GNP-loaded objects within the phantom. The effects of attenuation of both the primary beam through the phantom and the gold fluorescence photons en route to the detector were corrected during the image reconstruction. Accurate images of the GNP-containing phantom were successfully reconstructed for three different phantom configurations, with both spatial distribution and relative concentration of GNPs well identified. The pixel intensity of regions containing GNPs was linearly proportional to the gold concentration. The current MC study strongly suggests the possibility of developing a bench-top, polychromatic, cone-beam XFCT system for in vivo imaging.

Acutely elevated vasopressin increases circulating concentrations of cortisol and aldosterone in fasting northern elephant seal (Mirounga angustirostris) pups

NASA Technical Reports Server (NTRS)

Ortiz, Rudy M.; Wade, Charles E.; Ortiz, C. Leo; Talamantes, Frank

2003-01-01

The physiological actions of vasopressin (VP) in marine mammals are not well defined. To help elucidate its hormonal and renal effects in this group of mammals, northern elephant seal (Mirounga angustirostris) pups (N=7; 99+/-4 kg) were first infused with 0.9% saline (control; 220 ml), followed 24 h later with VP (as a 20 ng kg(-1) bolus, then 2 ng kg(-1) min(-1) for approximately 35 min in 225+/-16 ml saline). During both control and VP periods, blood samples were collected prior to infusion, and 15, 30, 60, 120 min and 24 h after infusion to examine the hormonal responses of the pups to VP. Renal responses were quantified from 24 h urine samples obtained prior to infusion (control) and 24 h post-infusion. Compared to the control period, infusion of VP increased plasma concentrations of cortisol over a 120 min period and aldosterone over 30 min, while plasma renin activity (PRA) was decreased for a 120 min period. The plasma urea:creatinine ratio was elevated following infusion of VP. Urine output and osmotic clearance were increased by 69+/-18% (mean +/- S.E.M.) and 36+/-10%, respectively, but free water clearance and glomerular filtration rate were not significantly altered 24 h post-infusion of VP. Solute (osmolality, Na(+), K(+) and Cl(-)) excretion and fractional excretion of electrolytes were also increased when compared to control values. The increase in cortisol concentration suggests that VP may possess corticotropin releasing hormone-like activity in elephant seals. If osmotic diuresis and natriuresis are typical consequences of elevated [VP] in fasting pups, then not increasing VP normally during the fast may serve as a protective mechanism to avoid the potential loss of Na(+) induced by elevated [VP]. Therefore, under natural fasting conditions, pups may be highly sensitive to small changes in [VP], resulting in the maintenance of water and electrolyte balance.

Electrical detection of the biological interaction of a charged peptide via gallium arsenide junction-field-effect transistors

PubMed Central

Lee, Kangho; Nair, Pradeep R.; Alam, Muhammad A.; Janes, David B.; Wampler, Heeyeon P.; Zemlyanov, Dmitry Y.; Ivanisevic, Albena

2008-01-01

GaAs junction-field-effect transistors (JFETs) are utilized to achieve label-free detection of biological interaction between a probe transactivating transcriptional activator (TAT) peptide and the target trans-activation-responsive (TAR) RNA. The TAT peptide is a short sequence derived from the human immunodeficiency virus-type 1 TAT protein. The GaAs JFETs are modified with a mixed adlayer of 1-octadecanethiol (ODT) and TAT peptide, with the ODT passivating the GaAs surface from polar ions in physiological solutions and the TAT peptide providing selective binding sites for TAR RNA. The devices modified with the mixed adlayer exhibit a negative pinch-off voltage (VP) shift, which is attributed to the fixed positive charges from the arginine-rich regions in the TAT peptide. Immersing the modified devices into a TAR RNA solution results in a large positive VP shift (>1 V) and a steeper subthreshold slope (∼80 mV∕decade), whereas “dummy” RNA induced a small positive VP shift (∼0.3 V) without a significant change in subthreshold slopes (∼330 mV∕decade). The observed modulation of device characteristics is analyzed with analytical modeling and two-dimensional numerical device simulations to investigate the electronic interactions between the GaAs JFETs and biological molecules. PMID:19484151

[Protective immune response of guinea pigs against challenge with foot and mouth disease virus by immunization with foliar extracts from transgenic tomato plants expressing the FMDV structural protein VP1].

PubMed

Pan, Li; Zhang, Yong-Guang; Wang, Yong-Lu; Wang, Bao-Qin; Xie, Qing-Ge

2006-10-01

The plant constitutive expression vector pBin438/VP1 for VP1 gene of foot-and-mouth disease virus strain O/ China/99 was constructed. Mediated with Agrobacterium tumefaciens GV3101 harboring pBin438/VP1, VP1 gene was transferred into cotyledons of tomato. After selected by Kanamysin, sixty resistant lines were obtained. The integration and transcription of the VP1 gene in transformed plants was detected by PCR and RT-PCR. After being detected by sandwich-ELISA assays, about 40% transformed plants confirmed to express the recombinant protein. The leave extracts of two positive lines were respectively emulsified in Freund's adjuvant and guinea pigs were intramuscular inoculation at days 0, 15 and 30d. According to the sera antibody levels and the protection of the vaccinated guinea pigs against challenge with 100ID50 FMDV, probed into the immunogenicity of the target protein expressed in transgenic plants. Experimental results showed that the plant expression vector was successfully constructed. PCR and RT-PCR analyses confirmed VP1 gene was transformed into tomato plants and got expression at the transcription levels. The expressed VP1 protein of FMDV, which was identified by ELISA and Western blot, can be specifically recognized by polyclonal antibodies against FMDV. Indirect-ELISA antibody titers reached 1:64 twenty-one days after the third inoculation. In the challenge test, the protection against FMDV challenge in two groups was 80% and 40% respectively. The immunization test in guinea pigs indicated that the expression product of transgenic tomato plants had immunogenicity and could effectively induce the specific antibodies against FMDV.

Oral immunization of mice using transgenic tomato fruit expressing VP1 protein from enterovirus 71.

PubMed

Chen, Hsuan-Fu; Chang, Meng-Huei; Chiang, Bor-Luen; Jeng, Shih-Tong

2006-04-05

Enterovirus 71 (EV71) causes seasonal epidemics of hand-foot-and-mouth disease associated with fatal neurological complications in young children, and several major outbreaks have occurred recently. This study developed an effective antiviral agent by transforming the gene for VP1 protein, a previously defined epitope and also a coat protein of EV71, into tomato plant. VP1 protein was first fused with sorting signals to enable it to be retained in the endoplasmic reticulum of tomato plant, and its expression level increased to 27 microg/g of fresh tomato fruit. Transgenic tomato fruit expressing VP1 protein was then used as an oral vaccine, and the development of VP1-specific fecal IgA and serum IgG were observed in BALB/c mice. Additionally, serum from mice fed transgenic tomato could neutralize the infection of EV71 to rhabdomyosarcoma cells, indicating that tomato fruit expressing VP1 was successful in orally immunizing mice. Moreover, the proliferation of spleen cells from orally immunized mice was stimulated by VP1 protein, and provided further evidence of both humoral and cellular immunity. Results of this study not only demonstrate the feasibility of using transgenic tomato as an oral vaccine to generate protective immunity in mice against EV71, but also suggest the probability of enterovirus vaccine development.

A simulation investigation on interaction mechanism between Ebola nucleoprotein and VP35 peptide.

PubMed

Ding, Jing-Na; Zhang, Yan-Jun; Zhong, Hui; Ao, Cheng-Cheng; Han, Ju-Guang

2018-03-01

Ebola viruses (EBOV) will induce acute hemorrhagic fever, which is fatal to humans and nonhuman primates. The combination of EBOV VP35 peptide with nucleoprotein N-terminal (NPNTD) is proposed based on static crystal structures in recent studies, but VP35 binding mechanism and conformational dynamics are still unclear. This investigation, using Molecular Dynamic (MD) simulation and Molecular Mechanics Generalized Born Surface Area (MM-GB/SA) energy calculation, more convincingly proves the greater roles of the protein binding mechanisms than do hints from the static crystal structure observations. Conformational analysis of the systems demonstrate that combination with VP35 may lead to the conformational transition of NPNTD from "open" to "closed" state. According to the analyses of binding free energies and their decomposition, VP35 residue R37 plays a crucial role in wild type as well as mutant systems. Mutations of I29 and L33 to aspartate as well as M34 to proline affect binding affinity mainly through influencing electrostatic interaction, which is closely related to H-bonds formation. In addition, mutations mainly affect β-hairpin and loop regions, among which, M34P may have the greatest influence to the binding. This study may provide specific binding mechanisms between VP35 peptide and NPNTD, especially some important residues concerning binding.

Single Mutations in the VP2 300 Loop Region of the Three-Fold Spike of the Carnivore Parvovirus Capsid Can Determine Host Range.

PubMed

Allison, Andrew B; Organtini, Lindsey J; Zhang, Sheng; Hafenstein, Susan L; Holmes, Edward C; Parrish, Colin R

2016-01-15

Sylvatic carnivores, such as raccoons, have recently been recognized as important hosts in the evolution of canine parvovirus (CPV), a pandemic pathogen of domestic dogs. Although viruses from raccoons do not efficiently bind the dog transferrin receptor (TfR) or infect dog cells, a single mutation changing an aspartic acid to a glycine at capsid (VP2) position 300 in the prototype raccoon CPV allows dog cell infection. Because VP2 position 300 exhibits extensive amino acid variation among the carnivore parvoviruses, we further investigated its role in determining host range by analyzing its diversity and evolution in nature and by creating a comprehensive set of VP2 position 300 mutants in infectious clones. Notably, some position 300 residues rendered CPV noninfectious for dog, but not cat or fox, cells. Changes of adjacent residues (residues 299 and 301) were also observed often after cell culture passage in different hosts, and some of the mutations mimicked changes seen in viruses recovered from natural infections of alternative hosts, suggesting that compensatory mutations were selected to accommodate the new residue at position 300. Analysis of the TfRs of carnivore hosts used in the experimental evolution studies demonstrated that their glycosylation patterns varied, including a glycan present only on the domestic dog TfR that dictates susceptibility to parvoviruses. Overall, there were significant differences in the abilities of viruses with alternative position 300 residues to bind TfRs and infect different carnivore hosts, demonstrating that the process of infection is highly host dependent and that VP2 position 300 is a key determinant of host range. Although the emergence and pandemic spread of canine parvovirus (CPV) are well documented, the carnivore hosts and evolutionary pathways involved in its emergence remain enigmatic. We recently demonstrated that a region in the capsid structure of CPV, centered around VP2 position 300, varies after transfer to alternative carnivore hosts and may allow infection of previously nonsusceptible hosts in vitro. Here we show that VP2 position 300 is the most variable residue in the parvovirus capsid in nature, suggesting that it is a critical determinant in the cross-species transfer of viruses between different carnivores due to its interactions with the transferrin receptor to mediate infection. To this end, we demonstrated that there are substantial differences in receptor binding and infectivity of various VP2 position 300 mutants for different carnivore species and that single mutations in this region can influence whether a host is susceptible or refractory to virus infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Single Mutations in the VP2 300 Loop Region of the Three-Fold Spike of the Carnivore Parvovirus Capsid Can Determine Host Range

PubMed Central

Organtini, Lindsey J.; Zhang, Sheng; Hafenstein, Susan L.; Holmes, Edward C.

2015-01-01

ABSTRACT Sylvatic carnivores, such as raccoons, have recently been recognized as important hosts in the evolution of canine parvovirus (CPV), a pandemic pathogen of domestic dogs. Although viruses from raccoons do not efficiently bind the dog transferrin receptor (TfR) or infect dog cells, a single mutation changing an aspartic acid to a glycine at capsid (VP2) position 300 in the prototype raccoon CPV allows dog cell infection. Because VP2 position 300 exhibits extensive amino acid variation among the carnivore parvoviruses, we further investigated its role in determining host range by analyzing its diversity and evolution in nature and by creating a comprehensive set of VP2 position 300 mutants in infectious clones. Notably, some position 300 residues rendered CPV noninfectious for dog, but not cat or fox, cells. Changes of adjacent residues (residues 299 and 301) were also observed often after cell culture passage in different hosts, and some of the mutations mimicked changes seen in viruses recovered from natural infections of alternative hosts, suggesting that compensatory mutations were selected to accommodate the new residue at position 300. Analysis of the TfRs of carnivore hosts used in the experimental evolution studies demonstrated that their glycosylation patterns varied, including a glycan present only on the domestic dog TfR that dictates susceptibility to parvoviruses. Overall, there were significant differences in the abilities of viruses with alternative position 300 residues to bind TfRs and infect different carnivore hosts, demonstrating that the process of infection is highly host dependent and that VP2 position 300 is a key determinant of host range. IMPORTANCE Although the emergence and pandemic spread of canine parvovirus (CPV) are well documented, the carnivore hosts and evolutionary pathways involved in its emergence remain enigmatic. We recently demonstrated that a region in the capsid structure of CPV, centered around VP2 position 300, varies after transfer to alternative carnivore hosts and may allow infection of previously nonsusceptible hosts in vitro. Here we show that VP2 position 300 is the most variable residue in the parvovirus capsid in nature, suggesting that it is a critical determinant in the cross-species transfer of viruses between different carnivores due to its interactions with the transferrin receptor to mediate infection. To this end, we demonstrated that there are substantial differences in receptor binding and infectivity of various VP2 position 300 mutants for different carnivore species and that single mutations in this region can influence whether a host is susceptible or refractory to virus infection. PMID:26512077

Serological detection and analysis of anti-VP1 responses against various enteroviruses (EV) (EV-A, EV-B and EV-C) in Chinese individuals.

PubMed

Gao, Caixia; Ding, Yingying; Zhou, Peng; Feng, Jiaojiao; Qian, Baohua; Lin, Ziyu; Wang, Lili; Wang, Jinhong; Zhao, Chunyan; Li, Xiangyu; Cao, Mingmei; Peng, Heng; Rui, Bing; Pan, Wei

2016-02-26

The overall serological prevalence of EV infections based on ELISA remains unknown. In the present study, the antibody responses against VP1 of the EV-A species (enterovirus 71 (EV71), Coxsackievirus A16 (CA16), Coxsackievirus A5 (CA5) and Coxsackievirus A6 (CA6)), of the EV-B species (Coxsackievirus B3 (CB3)), and of the EV-C species (Poliovirus 1 (PV1)) were detected and analyzed by a NEIBM (novel evolved immunoglobulin-binding molecule)-based ELISA in Shanghai blood donors. The serological prevalence of anti-CB3 VP1 antibodies was demonstrated to show the highest level, with anti-PV1 VP1 antibodies at the second highest level, and anti-CA5, CA6, CA16 and EV71 VP1 antibodies at a comparatively low level. All reactions were significantly correlated at different levels, which were approximately proportional to their sequence similarities. Antibody responses against EV71 VP1 showed obvious differences with responses against other EV-A viruses. Obvious differences in antibody responses between August 2013 and May 2014 were revealed. These findings are the first to describe the detailed information of the serological prevalence of human antibody responses against the VP1 of EV-A, B and C viruses, and could be helpful for understanding of the ubiquity of EV infections and for identifying an effective approach for seroepidemiological surveillance based on ELISA.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

An Outbreak of Type Π Vaccine-Derived Poliovirus in Sichuan Province, China: Emergence and Circulation in an Under-Immunized Population

PubMed Central

Fan, Chun-Xiang; Liu, Qing-Lian; Hao, Li-Xin; Liu, Yu; Zheng, Jing-Shan; Qin, Zhi-Ying; Xia, Wei; Zhang, Shi-Yue; Yin, Zun-Dong; Jing, Qiong; Zhang, Yan-Xia; Huang, Rong-Na; Yang, Ru-Pei; Tong, Wen-Bin; Qi, Qi; Guan, Xu-Jing; Jing, Yu-Lin; Ma, Qian-Li; Wang, Jin; Ma, Xiao-Zhen; Chen, Na; Zheng, Hong-Ru; Li, Yin-Qiao; Ma, Chao; Su, Qi-Ru; Reilly, Kathleen H.; Luo, Hui-Ming; Wu, Xian-Ping; Wen, Ning; Yang, Wei-Zhong

2014-01-01

Background During August 2011–February 2012, an outbreak of type Π circulating vaccine-derived poliovirus (cVDPVs) occurred in Sichuan Province, China. Methods A field investigation of the outbreak was conducted to characterize outbreak isolates and to guide emergency response. Sequence analysis of poliovirus capsid protein VP1 was performed to determine the viral propagation, and a coverage survey was carried out for risk assessment. Results One clinical compatible polio case and three VDPV cases were determined in Ngawa County, Ngawa Tibetan and Qiang Autonomous Prefecture, Sichuan Province. Case patients were unimmunized children, 0.8–1 years old. Genetic sequencing showed that the isolates diverged from the VP1 region of the type Π Sabin strain by 5–12 nucleotides (nt) and shared the same 5 nt VP1 substitutions, which indicate single lineage of cVDPVs. Of the 7 acute flaccid paralysis cases (all>6 months) reported in Ngawa Prefecture in 2011, 4 (57.1%) cases (including 2 polio cases) did not receive oral attenuated poliovirus vaccine. Supplementary immunization activities (SIAs) were conducted in February–May, 2012, and the strain has not been isolated since. Conclusion High coverage of routine immunization should be maintained among children until WPV transmission is globally eradicated. Risk assessments should be conducted regularly to pinpoint high risk areas or subpopulations, with SIAs developed if necessary. PMID:25503964