Cleavage sites within the poliovirus capsid protein precursors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, G.R.; Anderson, C.W.; Dorner, A.J.

1982-01-01

Partial amino-terminal sequence analysis was performed on radiolabeled poliovirus capsid proteins VP1, VP2, and VP3. A computer-assisted comparison of the amino acid sequences obtained with that predicted by the nucleotide sequence of the poliovirus genome allows assignment of the amino terminus of each capsid protein to a unique position within the virus polyprotein. Sequence analysis of trypsin-digested VP4, which has a blocked amino terminus, demonstrates that VP4 is encoded at or very near to the amino terminus of the polyprotein. The gene order of the capsid proteins is VP4-VP2-VP3-VP1. Cleavage of VP0 to VP4 and VP2 is shown to occurmore » between asparagine and serine, whereas the cleavages that separate VP2/VP3 and VP3/VP1 occur between glutamine and glycine residues. This finding supports the hypothesis that the cleavage of VP0, which occurs during virion morphogenesis, is distinct from the cleavages that separate functional regions of the polyprotein.« less

Unique BK virus non-coding control region (NCCR) variants in hematopoietic stem cell transplant recipients with and without hemorrhagic cystitis.

PubMed

Carr, Michael J; McCormack, Grace P; Mutton, Ken J; Crowley, Brendan

2006-04-01

Hematopoietic stem cell transplant recipients frequently develop BK virus (BKV)-associated hemorrhagic cystitis, which coincides with BK viruria. However, the precise role of BKV in the etiology of hemorrhagic cystitis in hematopoietic stem cell transplant recipients remains unclear, since approximately 50% of all such adult transplant recipients excrete BKV, yet do not develop this clinical condition. In the present study, BKV were analyzed to determine if mutations in the non-coding control region (NCCR), and specific BKV sub-types defined by sequence analysis of major capsid protein VP1, were associated with development of hemorrhagic cystitis in hematopoietic stem cell transplant recipients. The regions encoding VP1 and NCCRs of BKV in urine samples collected from 15 hematopoietic stem cell transplant recipients with hemorrhagic cystitis and 20 without this illness were amplified and sequenced. Sequence variations in the NCCRs of BKV were identified in urine samples from those with and without hemorrhagic cystitis. Furthermore, five unique sequence variations within transcription factor binding sites in the canonical NCCR, O-P-Q-R-S, were identified, representing new BKV variants from a population of cloned quasi-species obtained from patients with and without hemorrhagic cystitis. Thirty-five BKV VP1 sequences were analyzed by phylogenetic analysis but no specific BKV sub-type was associated with hemorrhagic cystitis. Five previously unrecognized naturally occurring variants of the BKV are described which involve amplifications, deletions, and rearrangements of the archetypal BKV NCCRs in individuals with and without hemorrhagic cystitis. Architectural rearrangements in the NCCRs of BKV did not appear to be a prerequisite for development of hemorrhagic cystitis in hematopoietic stem cell transplant recipients. Copyright 2006 Wiley-Liss, Inc.

Characterization of the complete genome segments from BmCPV-SZ, a novel Bombyx mori cypovirus 1 isolate.

PubMed

Cao, Guangli; Meng, Xiangkun; Xue, Renyu; Zhu, Yuexiong; Zhang, Xiaorong; Pan, Zhonghua; Zheng, Xiaojian; Gong, Chengliang

2012-07-01

A novel Bombyx mori cypovirus 1 isolated from infected silkworm larvae and tentatively assigned as Bombyx mori cypovirus 1 isolate Suzhou (BmCPV-SZ). The complete nucleotide sequences of genomic segments S1-S10 from BmCPV-SZ were determined. All segments possessed a single open reading frame; however, bioinformatic evidence suggested a short overlapping coding sequence in S1. Each BmCPV-SZ segment possessed the conserved terminal sequences AGUAA and GUUAGCC at the 5' and 3' ends, respectively. The conserved A/G at the -3 position in relation to the AUG codon could be found in the BmCPV-SZ genome, and it was postulated that this conserved A/G may be the most important nucleotide for efficient translation initiation in cypoviruses (CPVs). Examination of the putative amino acid sequences encoded by BmCPV-SZ revealed some characteristic motifs. Homology searches showed that viral structural proteins VP1, VP3, and VP4 had localized homologies with proteins of Rice ragged stunt virus , a member of the genus Oryzavirus within the family Reoviridae. A phylogenetic tree based on RNA-dependent RNA polymerase sequences demonstrated that CPV is more closely related to Rice ragged stunt virus and Aedes pseudoscutellaris reovirus than to other members of Reoviridae, suggesting that they may have originated from common ancestors.

Capsid coding region diversity of re-emerging lineage C foot-and-mouth disease virus serotype Asia1 from India.

PubMed

Subramaniam, Saravanan; Mohapatra, Jajati K; Das, Biswajit; Sharma, Gaurav K; Biswal, Jitendra K; Mahajan, Sonalika; Misri, Jyoti; Dash, Bana B; Pattnaik, Bramhadev

2015-07-01

Foot-and-mouth disease virus (FMDV) serotype Asia1 was first reported in India in 1951, where three major genetic lineages (B, C and D) of this serotype have been described until now. In this study, the capsid protein coding region of serotype Asia1 viruses (n = 99) from India were analyzed, giving importance to the viruses circulating since 2007. All of the isolates (n = 50) recovered during 2007-2013 were found to group within the re-emerging cluster of lineage C (designated as sublineage C(R)). The evolutionary rate of sublineage C(R) was estimated to be slightly higher than that of the serotype as a whole, and the time of the most recent common ancestor for this cluster was estimated to be approximately 2001. In comparison to the older isolates of lineage C (1993-2001), the re-emerging viruses showed variation at eight amino acid positions, including substitutions at the antigenically critical residues VP279 and VP2131. However, no direct correlation was found between sequence variations and antigenic relationships. The number of codons under positive selection and the nature of the selection pressure varied widely among the structural proteins, implying a heterogeneous pattern of evolution in serotype Asia1. While episodic diversifying selection appears to play a major role in shaping the evolution of VP1 and VP3, selection pressure acting on codons of VP2 is largely pervasive. Further, episodic positive selection appears to be responsible for the early diversification of lineage C. Recombination events identified in the structural protein coding region indicates its probable role in adaptive evolution of serotype Asia1 viruses.

Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs.

PubMed

Lohse, Louise; Jackson, Terry; Bøtner, Anette; Belsham, Graham J

2012-05-24

The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus.In the present study we compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region.Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected with the O1K/O-UKG chimera or the field strain (O-UKG/34/2001) developed fulminant disease. Furthermore, 3 of 4 in-contact pigs exposed to the O1K/O-UKG virus died in the acute phase of infection, likely from myocardial infection. However, in the group exposed to the O1K/A-TUR chimeric virus, only 1 pig showed symptoms of disease within the time frame of the experiment (10 days). All pigs that developed clinical disease showed a high level of viral RNA in serum and infected pigs that survived the acute phase of infection developed a serotype specific antibody response. It is concluded that the capsid coding sequences are determinants of FMDV pathogenicity in pigs.

A 12-residue epitope displayed on phage T7 reacts strongly with antibodies against foot-and-mouth disease virus.

PubMed

Wong, Chuan Loo; Yong, Chean Yeah; Muhamad, Azira; Syahir, Amir; Omar, Abdul Rahman; Sieo, Chin Chin; Tan, Wen Siang

2018-05-01

Foot-and-mouth disease (FMD) is a major threat to the livestock industry worldwide. Despite constant surveillance and effective vaccination, the perpetual mutations of the foot-and-mouth disease virus (FMDV) pose a huge challenge to FMD diagnosis. The immunodominant region of the FMDV VP1 protein (residues 131-170) displayed on phage T7 has been used to detect anti-FMDV in bovine sera. In the present study, the functional epitope was further delineated using amino acid sequence alignment, homology modelling and phage display. Two highly conserved regions (VP1 145-152 and VP1 159-170 ) were identified among different FMDV serotypes. The coding regions of these two epitopes were fused separately to the T7 genome and displayed on the phage particles. Interestingly, chimeric phage displaying the VP1 159-170 epitope demonstrated a higher antigenicity than that displaying the VP1 131-170 epitope. By contrast, phage T7 displaying the VP1 145-152 epitope did not react significantly with the anti-FMDV antibodies in vaccinated bovine sera. This study has successfully identified a smaller functional epitope, VP1 159-170 , located at the C-terminal end of the structural VP1 protein. The phage T7 displaying this shorter epitope is a promising diagnostic reagent to detect anti-FMDV antibodies in vaccinated animals.

Lloviu virus VP24 and VP35 proteins function as innate immune antagonists in human and bat cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feagins, Alicia R.; Basler, Christopher F., E-mail: chris.basler@mssm.edu

Lloviu virus (LLOV) is a new member of the filovirus family that also includes Ebola virus (EBOV) and Marburg virus (MARV). LLOV has not been cultured; however, its genomic RNA sequence indicates the coding capacity to produce homologs of the EBOV and MARV VP24, VP35, and VP40 proteins. EBOV and MARV VP35 proteins inhibit interferon (IFN)-alpha/beta production and EBOV VP35 blocks activation of the antiviral kinase PKR. The EBOV VP24 and MARV VP40 proteins inhibit IFN signaling, albeit by different mechanisms. Here we demonstrate that LLOV VP35 suppresses Sendai virus induced IFN regulatory factor 3 (IRF3) phosphorylation, IFN-α/β production, andmore » PKR phosphorylation. Additionally, LLOV VP24 blocks tyrosine phosphorylated STAT1 binding to karyopherin alpha 5 (KPNA5), STAT1 nuclear accumulation, and IFN-induced gene expression. LLOV VP40 lacks detectable IFN antagonist function. These activities parallel EBOV IFN inhibitory functions. EBOV and LLOV VP35 and VP24 proteins also inhibit IFN responses in bat cells. These data suggest that LLOV infection will block innate immune responses in a manner similar to EBOV. - Highlights: • Lloviu virus (LLOV) is a new member of the filovirus family. • LLOV VP35 blocks IRF3 phosphorylation, IFN-α/β production and PKR phosphorylation. • LLOV VP24 inhibits IFN responses by targeting phospho-STAT1 KPNA interaction. • Infection by LLOV may block innate immune responses in a manner similar to EBOV.« less

An experimental and computational evolution-based method to study a mode of co-evolution of overlapping open reading frames in the AAV2 viral genome.

PubMed

Kawano, Yasuhiro; Neeley, Shane; Adachi, Kei; Nakai, Hiroyuki

2013-01-01

Overlapping open reading frames (ORFs) in viral genomes undergo co-evolution; however, how individual amino acids coded by overlapping ORFs are structurally, functionally, and co-evolutionarily constrained remains difficult to address by conventional homologous sequence alignment approaches. We report here a new experimental and computational evolution-based methodology to address this question and report its preliminary application to elucidating a mode of co-evolution of the frame-shifted overlapping ORFs in the adeno-associated virus (AAV) serotype 2 viral genome. These ORFs encode both capsid VP protein and non-structural assembly-activating protein (AAP). To show proof of principle of the new method, we focused on the evolutionarily conserved QVKEVTQ and KSKRSRR motifs, a pair of overlapping heptapeptides in VP and AAP, respectively. In the new method, we first identified a large number of capsid-forming VP3 mutants and functionally competent AAP mutants of these motifs from mutant libraries by experimental directed evolution under no co-evolutionary constraints. We used Illumina sequencing to obtain a large dataset and then statistically assessed the viability of VP and AAP heptapeptide mutants. The obtained heptapeptide information was then integrated into an evolutionary algorithm, with which VP and AAP were co-evolved from random or native nucleotide sequences in silico. As a result, we demonstrate that these two heptapeptide motifs could exhibit high degeneracy if coded by separate nucleotide sequences, and elucidate how overlap-evoked co-evolutionary constraints play a role in making the VP and AAP heptapeptide sequences into the present shape. Specifically, we demonstrate that two valine (V) residues and β-strand propensity in QVKEVTQ are structurally important, the strongly negative and hydrophilic nature of KSKRSRR is functionally important, and overlap-evoked co-evolution imposes strong constraints on serine (S) residues in KSKRSRR, despite high degeneracy of the motifs in the absence of co-evolutionary constraints.

Rare natural type 3/type 2 intertypic capsid recombinant vaccine-related poliovirus isolated from a case of acute flaccid paralysis in Brazil, 2015.

PubMed

Cassemiro, Klécia M S M; Burlandy, Fernanda M; da Silva, Edson E

2016-07-01

A natural type 3/type 2 intertypic capsid recombinant vaccine-related poliovirus was isolated from an acute flaccid paralytic case in Brazil. Genome sequencing revealed the uncommon location of the crossover site in the VP1 coding region (nucleotides 3251-3258 of Sabin 3 genome). The Sabin 2 donor sequence replaced the last 118 nt of VP1, resulting in the substitution of the complete antigenic site IIIa by PV2-specific amino acids. The low overall number of nucleotide substitutions in P1 region indicated that the predicted replication time of the isolate was about 8-9 weeks. Two of the principal determinants of attenuation in Sabin 3 genomes were mutated (U472C and C2493U), but the temperature-sensitive phenotype of the isolate was preserved. Our results support the theory that there exists a PV3/PV2 recombination hotspot site in the tail region of the VP1 capsid protein and that the recombination may occur soon after oral poliovirus vaccine administration.

The Evolution of Vp1 Gene in Enterovirus C Species Sub-Group That Contains Types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99

PubMed Central

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific ‘signature’ amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific ‘signature’ amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared. PMID:24695547

The evolution of Vp1 gene in enterovirus C species sub-group that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99.

PubMed

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific 'signature' amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific 'signature' amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared.

Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia.

PubMed

Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee

2016-01-01

Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5' and 3' non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63-81% among themselves and 63-96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection.

Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia

PubMed Central

Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee

2016-01-01

Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5′ and 3′ non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63–81% among themselves and 63–96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection. PMID:27199901

On transform coding tools under development for VP10

NASA Astrophysics Data System (ADS)

Parker, Sarah; Chen, Yue; Han, Jingning; Liu, Zoe; Mukherjee, Debargha; Su, Hui; Wang, Yongzhe; Bankoski, Jim; Li, Shunyao

2016-09-01

Google started the WebM Project in 2010 to develop open source, royaltyfree video codecs designed specifically for media on the Web. The second generation codec released by the WebM project, VP9, is currently served by YouTube, and enjoys billions of views per day. Realizing the need for even greater compression efficiency to cope with the growing demand for video on the web, the WebM team embarked on an ambitious project to develop a next edition codec, VP10, that achieves at least a generational improvement in coding efficiency over VP9. Starting from VP9, a set of new experimental coding tools have already been added to VP10 to achieve decent coding gains. Subsequently, Google joined a consortium of major tech companies called the Alliance for Open Media to jointly develop a new codec AV1. As a result, the VP10 effort is largely expected to merge with AV1. In this paper, we focus primarily on new tools in VP10 that improve coding of the prediction residue using transform coding techniques. Specifically, we describe tools that increase the flexibility of available transforms, allowing the codec to handle a more diverse range or residue structures. Results are presented on a standard test set.

Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.

PubMed

Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan

2011-09-01

The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.

Complete genome characterization of a novel enterovirus type EV-B106 isolated in China, 2012.

PubMed

Tang, Jingjing; Tao, Zexin; Ding, Zhengrong; Zhang, Yong; Zhang, Jie; Tian, Bingjun; Zhao, Zhixian; Zhang, Lifen; Xu, Wenbo

2014-03-03

Human enterovirus B106 (EV-B106) is a recently identified member of enterovirus species B. In this study, we report the complete genomic characterization of an EV-B106 strain (148/YN/CHN/12) isolated from an acute flaccid paralysis patient in Yunnan Province, China. The new strain had 79.2-81.3% nucleotide and 89.1-94.8% amino acid similarity in the VP1 region with the other two EV-B106 strains from Bolivia and Pakistan. When compared with other EV serotypes, it had the highest (73.3%) VP1 nucleotide similarity with the EV-B77 prototype strain CF496-99. However, when aligned with all EV-B106 and EV-B77 sequences available from the GenBank database, two major frame shifts were observed in the VP1 coding region, which resulted in substantial (20.5%) VP1 amino acid divergence between the two serotypes. Phylogenetic analysis and similarity plot analysis revealed multiple recombination events in the genome of this strain. This is the first report of the complete genome of EV-B106.

Complete Genome Analysis of an Enterovirus EV-B83 Isolated in China.

PubMed

Tang, Jingjing; Li, Qiongfen; Tian, Bingjun; Zhang, Jie; Li, Kai; Ding, Zhengrong; Lu, Lin

2016-07-12

Enterovirus B83 (EV-B83) is a recently identified member of enterovirus species B. It is a rarely reported serotype and up to date, only the complete genome sequence of the prototype strain from the United States is available. In this study, we describe the complete genomic characterization of an EV-B83 strain 246/YN/CHN/08HC isolated from a healthy child living in border region of Yunnan Province, China in 2008. Compared with the prototype strain, it had 79.6% similarity in the complete genome and 78.9% similarity in the VP1 coding region, reflecting the great genetic divergence among them. VP1-coding region alignment revealed it had 77.2-91.3% with other EV-B83 sequences available in GenBank. Similarity plot analysis revealed it had higher identity with several other EV-B serotypes than the EV-B83 prototype strain in the P2 and P3 coding region, suggesting multiple recombination events might have occurred. The great genetic divergence with previously isolated strains and the extremely rare isolation suggest this serotype has circulated at a low epidemic strength for many years. This is the first report of complete genome of EV-B83 in China.

Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

PubMed

Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

2016-01-01

The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

PubMed

Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

2010-02-01

A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

PubMed

Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

2017-02-01

Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular Cloning, Expression Analysis, and Functional Characterization of the H(+)-Pyrophosphatase from Jatropha curcas.

PubMed

Yang, Yumei; Luo, Zhu; Zhang, Mengru; Liu, Chang; Gong, Ming; Zou, Zhurong

2016-04-01

H(+)-pyrophosphatase (H(+)-PPase) is a primary pyrophosphate (PPi)-energized proton pump to generate electrochemical H(+) gradient for ATP production and substance translocations across membranes. It plays an important role in stress adaptation that was intensively substantiated by numerous transgenic plants overexpressing H(+)-PPases yet devoid of any correlated studies pointing to the elite energy plant, Jatropha curcas. Herein, we cloned the full length of J. curcas H(+)-PPase (JcVP1) complementary DNA (cDNA) by reverse transcription PCR, based on the assembled sequence of its ESTs highly matched to Hevea brasiliensis H(+)-PPase. This gene encodes a polypeptide of 765 amino acids that was predicted as a K(+)-dependent H(+)-PPase evolutionarily closest to those of other Euphorbiaceae plants. Many cis-regulatory elements relevant to environmental stresses, molecular signals, or tissue-specificity were identified by promoter prediction within the 1.5-kb region upstream of JcVP1 coding sequence. Meanwhile, the responses of JcVP1 expression to several common abiotic stresses (salt, drought, heat, cold) were characterized with a considerable accordance with the inherent stress tolerance of J. curcas. Moreover, we found that the heterologous expression of JcVP1 could significantly improve the salt tolerance in both recombinant Escherichia coli and Saccharomyces cerevisiae, and this effect could be further fortified in yeast by N-terminal addition of a vacuole-targeting signal peptide from the H(+)-PPase of Trypanosoma cruzi.

The use of additive and subtractive approaches to examine the nuclear localization sequence of the polyomavirus major capsid protein VP1

NASA Technical Reports Server (NTRS)

Chang, D.; Haynes, J. I. 2nd; Brady, J. N.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1992-01-01

A nuclear localization signal (NLS) has been identified in the N-terminal (Ala1-Pro-Lys-Arg-Lys-Ser-Gly-Val-Ser-Lys-Cys11) amino acid sequence of the polyomavirus major capsid protein VP1. The importance of this amino acid sequence for nuclear transport of VP1 protein was demonstrated by a genetic "subtractive" study using the constructs pSG5VP1 (full-length VP1) and pSG5 delta 5'VP1 (truncated VP1, lacking amino acids Ala1-Cys11). These constructs were used to transfect COS-7 cells, and expression and intracellular localization of the VP1 protein was visualized by indirect immunofluorescence. These studies revealed that the full-length VP1 was expressed and localized in the nucleus, while the truncated VP1 protein was localized in the cytoplasm and not transported to the nucleus. These findings were substantiated by an "additive" approach using FITC-labeled conjugates of synthetic peptides homologous to the NLS of VP1 cross-linked to bovine serum albumin or immunoglobulin G. Both conjugates localized in the nucleus after microinjection into the cytoplasm of 3T6 cells. The importance of individual amino acids found in the basic sequence (Lys3-Arg-Lys5) of the NLS was also investigated. This was accomplished by synthesizing three additional peptides in which lysine-3 was substituted with threonine, arginine-4 was substituted with threonine, or lysine-5 was substituted with threonine. It was found that lysine-3 was crucial for nuclear transport, since substitution of this amino acid with threonine prevented nuclear localization of the microinjected, FITC-labeled conjugate.

Using Virtual Patients to Teach Empathy: A Randomized Controlled Study to Enhance Medical Students' Empathic Communication.

PubMed

Foster, Adriana; Chaudhary, Neelam; Kim, Thomas; Waller, Jennifer L; Wong, Joyce; Borish, Michael; Cordar, Andrew; Lok, Benjamin; Buckley, Peter F

2016-06-01

Physician empathy is a complex phenomenon known to improve illness outcomes; however, few tools are available for deliberate practice of empathy. We used a virtual patient (VP) to teach empathic communication to first-year medical students. We then evaluated students' verbal empathy in a standardized patient (SP) interaction. Seventy medical students, randomly assigned to 3 separate study groups, interacted with (1) a control VP portraying depression, (2) a VP with a backstory simulating patient shadowing, or (3) a VP able to give immediate feedback about empathic communication (empathy-feedback VP). Subsequently, the students interviewed an SP portraying a scenario that included opportunities to express empathy. All SP interviews were recorded and transcribed. The study outcomes were (1) the students' verbal response to the empathic opportunities presented by the SP, as coded by reliable assessors using the Empathic Communication Coding System, and (2) the students' responses as coded by the SPs, using a communication checklist. There were no significant differences in student demographics between groups. The students who interacted with the empathy-feedback VP showed higher empathy in the SP interview than did the students in the backstory VP and the control VP groups [mean (SD) empathy scores coded on a 0-6 scale were 2.91 (0.16) vs. 2.20 (0.22) and 2.27 (0.21), respectively). The difference in scores was significant only for the empathy-feedback VP versus the backstory VP group (P = 0.027). The SPs rated the empathy-feedback and the backstory VP groups significantly higher than the control VP group on offering empathic statements (P < 0.0001), appearing warm and caring (P = 0.015), and forming rapport (P = 0.004). Feedback on empathy in a VP interaction increased students' empathy in encounters with SPs, as rated by trained assessors, whereas a simulation of patient shadowing did not. Both VP interventions increased students' empathy as rated by SPs, compared with the control VP group.

Integrin-Using Rotaviruses Bind α2β1 Integrin α2 I Domain via VP4 DGE Sequence and Recognize αXβ2 and αVβ3 by Using VP7 during Cell Entry

PubMed Central

Graham, Kate L.; Halasz, Peter; Tan, Yan; Hewish, Marilyn J.; Takada, Yoshikazu; Mackow, Erich R.; Robinson, Martyn K.; Coulson, Barbara S.

2003-01-01

Integrins α2β1, αXβ2, and αVβ3 have been implicated in rotavirus cell attachment and entry. The virus spike protein VP4 contains the α2β1 ligand sequence DGE at amino acid positions 308 to 310, and the outer capsid protein VP7 contains the αXβ2 ligand sequence GPR. To determine the viral proteins and sequences involved and to define the roles of α2β1, αXβ2, and αVβ3, we analyzed the ability of rotaviruses and their reassortants to use these integrins for cell binding and infection and the effect of peptides DGEA and GPRP on these events. Many laboratory-adapted human, monkey, and bovine viruses used integrins, whereas all porcine viruses were integrin independent. The integrin-using rotavirus strains each interacted with all three integrins. Integrin usage related to VP4 serotype independently of sialic acid usage. Analysis of rotavirus reassortants and assays of virus binding and infectivity in integrin-transfected cells showed that VP4 bound α2β1, and VP7 interacted with αXβ2 and αVβ3 at a postbinding stage. DGEA inhibited rotavirus binding to α2β1 and infectivity, whereas GPRP binding to αXβ2 inhibited infectivity but not binding. The truncated VP5* subunit of VP4, expressed as a glutathione S-transferase fusion protein, bound the expressed α2 I domain. Alanine mutagenesis of D308 and G309 in VP5* eliminated VP5* binding to the α2 I domain. In a novel process, integrin-using viruses bind the α2 I domain of α2β1 via DGE in VP4 and interact with αXβ2 (via GPR) and αVβ3 by using VP7 to facilitate cell entry and infection. PMID:12941907

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].

PubMed

Lin, Xiaojuan; Liu, Yao; Wang, Suting; Zhang Xiao; Song, Lizhi; Tao, Zexin; Ji, Feng; Xiong, Ping; Xu, Aiqiang

2015-09-01

To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.

[Genetic Characteristics of Type 2 Vaccine-derived Poliovirus in Shanxi Province (China) in 2014].

PubMed

Yan, Dongrei; Li, Xiaolei; Zhang, Yong; Yang, Jianfang; Zhu, Shuangli; Wang, Dongyan; Zhang, Chuangye; Zhu, Hui; Xu, Wenbo

2015-03-01

The World Health Organization redefined the type 2 vaccine-derived poliovirus (VDPV) in 2010. To study the genetic characteristics and evolution of type 2 VDPV under this new definition, we conducted genome sequencing and analyses of type 2 VDPVs isolated from one patient with acute flaccid paralysis in Shanxi province (China) in 2014. Nucleotide sequencing revealed that the full-length of type 2 VDPV is 7439 bases encoding 2207 amino acids with no insertion or deletion of nucleotides compared with Sabin2. One nucleotide substitution identified as a key determinant of the attenuated phenotype of the Sabin 2 strain (A-G reversion at nucleotide nt 481 in the 5-end of the untranslated region) had reverted in the Shanxi type 2 VDPV. The other known key determinant of the attenuated phenotype of the Sabin 2 strain (U-->C reversion at nt2909 in the VP1 coding region that caused a Ile143Thr substitution in VP1) had not reverted in the Shanxi VDPV. The Shanxi type 2 VDPV was S2/S1 recombinant, the crossover site of which mapped to the 3-end of the 3D region (between nt 6247 and nt 6281). A phylogentic tree based on the VP1 coding region showed that evolution of the Shanxi type 2 VDPV was independent of other type 2 VDPVs detected worldwide. We estimated that the strain circulated for approximately = 11 months in the population according to the known evolution rate. The present study confirmed that the Chinese Polio Laboratory Network could discover the VDPV promptly and that it played an important part in maintenance of a polio-free China.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

PubMed Central

Kirkegaard, K; Nelsen, B

1990-01-01

Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

Bioinformatics analysis and genetic diversity of the poliovirus.

PubMed

Liu, Yanhan; Ma, Tengfei; Liu, Jianzhu; Zhao, Xiaona; Cheng, Ziqiang; Guo, Huijun; Wang, Shujing; Xu, Ruixue

2014-12-01

Poliomyelitis, a disease which can manifest as muscle paralysis, is caused by the poliovirus, which is a human enterovirus and member of the family Picornaviridae that usually transmits by the faecal-oral route. The viruses of the OPV (oral poliovirus attenuated-live vaccine) strains can mutate in the human intestine during replication and some of these mutations can lead to the recovery of serious neurovirulence. Informatics research of the poliovirus genome can be used to explain further the characteristics of this virus. In this study, sequences from 100 poliovirus isolates were acquired from GenBank. To determine the evolutionary relationship between the strains, we compared and analysed the sequences of the complete poliovirus genome and the VP1 region. The reconstructed phylogenetic trees for the complete sequences and the VP1 sequences were both divided into two branches, indicating that the genetic relationships of the whole poliovirus genome and the VP1 sequences are very similar. This branching indicates that the virulence and pathogenicity of poliomyelitis may be associated with the VP1 region. Sequence alignment of the VP1 region revealed numerous mutation sites in which mutation rates of >30 % were detected. In a group of strains recorded in the USA, mutation sites and mutation types were the same and this may be associated with their distribution in the evolutionary tree and their genetic relationship. In conclusion, the genetic evolutionary relationships of poliovirus isolate sequences are determined to a great extent by the VP1 protein, and poliovirus strains located on the same branch of the phylogenetic tree contain the same mutation spots and mutation types. Hence, the genetic characteristics of the VP1 region in the poliovirus genome should be analysed to identify the transmission route of poliovirus and provide the basis of viral immunity development. © 2014 The Authors.

Synthetic transcripts of double-stranded Birnavirus genome are infectious.

PubMed Central

Mundt, E; Vakharia, V N

1996-01-01

We have developed a system for generation of infectious bursal disease virus (IBDV), a segmented double-stranded RNA virus of the Birnaviridae family, with the use of synthetic transcripts derived from cloned cDNA. Independent full-length cDNA clones were constructed that contained the entire coding and noncoding regions of RNA segments A and B of two distinguishable IBDV strains of serotype I. Segment A encodes all of the structural (VP2, VP4, and VP3) and nonstructural (VP5) proteins, whereas segment B encodes the RNA-dependent RNA polymerase (VP1). Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated infectious virus as early as 36 hr after transfection. The infectivity and specificity of the recovered chimeric virus was ascertained by the appearance of cytopathic effect in chicken embryo cells, by immunofluorescence staining of infected Vero cells with rabbit anti-IBDV serum, and by nucleotide sequence analysis of the recovered virus, respectively. In addition, transfectant viruses containing genetically tagged sequences in either segment A or segment B of IBDV were generated to confirm the feasibility of this system. The development of a reverse genetics system for double-stranded RNA viruses will greatly facilitate studies of the regulation of viral gene expression, pathogenesis, and design of a new generation of live vaccines. Images Fig. 2 Fig. 3 Fig. 4 PMID:8855321

Whole genome sequences of Japanese porcine species C rotaviruses reveal a high diversity of genotypes of individual genes and will contribute to a comprehensive, generally accepted classification system.

PubMed

Niira, Kazutaka; Ito, Mika; Masuda, Tsuneyuki; Saitou, Toshiya; Abe, Tadatsugu; Komoto, Satoshi; Sato, Mitsuo; Yamasato, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Sano, Kaori; Tuchiaka, Shinobu; Okada, Takashi; Omatsu, Tsutomu; Furuya, Tetsuya; Aoki, Hiroshi; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Taniguchi, Koki; Mizutani, Tetsuya; Nagai, Makoto

2016-10-01

Porcine rotavirus C (RVC) is distributed throughout the world and is thought to be a pathogenic agent of diarrhea in piglets. Although, the VP7, VP4, and VP6 gene sequences of Japanese porcine RVCs are currently available, there is no whole-genome sequence data of Japanese RVC. Furthermore, only one to three sequences are available for porcine RVC VP1-VP3 and NSP1-NSP3 genes. Therefore, we determined nearly full-length whole-genome sequences of nine Japanese porcine RVCs from seven piglets with diarrhea and two healthy pigs and compared them with published RVC sequences from a database. The VP7 genes of two Japanese RVCs from healthy pigs were highly divergent from other known RVC strains and were provisionally classified as G12 and G13 based on the 86% nucleotide identity cut-off value. Pairwise sequence identity calculations and phylogenetic analyses revealed that candidate novel genotypes of porcine Japanese RVC were identified in the NSP1, NSP2 and NSP3 encoding genes, respectively. Furthermore, VP3 of Japanese porcine RVCs was shown to be closely related to human RVCs, suggesting a gene reassortment event between porcine and human RVCs and past interspecies transmission. The present study demonstrated that porcine RVCs show greater genetic diversity among strains than human and bovine RVCs. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular typing of enteroviruses associated with viral meningitis in Cyprus, 2000-2002.

PubMed

Richter, Jan; Koptides, Dana; Tryfonos, Christina; Christodoulou, Christina

2006-08-01

Human enteroviruses are responsible for a wide spectrum of clinical diseases affecting many different organ systems. Although infection is usually asymptomatic, infections of the central nervous system manifested as meningitis or encephalitis can pose a serious public health problem, especially during outbreaks. In this study, samples from 218 patients diagnosed with enteroviral meningitis between January 2000 and December 2002 were analysed in order to assess the epidemiology of human enteroviruses as a cause of viral meningitis in Cyprus. A new typing strategy, based on partial sequencing of the 5' non-coding region (5'NCR), prediction of type, and selection of type-specific primers for sensitive VP1 PCR amplification, was developed. As clustering in the 5'NCR was concordant with clustering in the VP1 region, quick and reliable typing by VP1 sequencing was achieved without virus isolation in cell culture. The most frequent enterovirus serotypes identified were Human echovirus 30 (55.5%), Human echovirus 13 (15.1%), Human echovirus 6 (13.8%) and Human echovirus 9 (8.3%). Human coxsackieviruses B2, B1 and B5, Human echovirus 4, Human enterovirus 71 and Human coxsackievirus A6 represented rather rare serotypes. This is the first molecular epidemiological study of enterovirus meningitis in Cyprus. Serotype distribution corresponded basically with observations in other European countries, suggesting the spread of enteroviruses by tourism.

A Viscoelastic-Plastic Constitutive Model with a Finite Element Solution Methodology

DTIC Science & Technology

1978-06-01

where - r3 K f BT D B dv (4-15) • ,re E,,rae v ’,vp ,vp w F BT dv (4-17)A -vp -Vp 84 ii T In the above, K is the global viscoelastic stiffness matrix anl ...Code C4AA Port Hueneme. CA NAVSE ASYSCOM Code OOC (LT R. MacDougisl). Washington DC NAVSEC Code 6034 1 Library). Washington DC NAVSEC61RLACT PWO. Torni...ESEARCH CO LA HABRA, CA iBROOKSi 0ONCRFE It Il FCH-NoIOGY CORP. TACOMA. ’A At( ANL )ESONi ((tNRAI) ASSOC. Van NuNs CA iA. Luisonit I)RA Vt COR(P I’muitt

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Group A Human Rotavirus Genomics: Evidence that Gene Constellations Are Influenced by Viral Protein Interactions▿ †

PubMed Central

Heiman, Erica M.; McDonald, Sarah M.; Barro, Mario; Taraporewala, Zenobia F.; Bar-Magen, Tamara; Patton, John T.

2008-01-01

Group A human rotaviruses (HRVs) are the major cause of severe viral gastroenteritis in infants and young children. To gain insight into the level of genetic variation among HRVs, we determined the genome sequences for 10 strains belonging to different VP7 serotypes (G types). The HRVs chosen for this study, D, DS-1, P, ST3, IAL28, Se584, 69M, WI61, A64, and L26, were isolated from infected persons and adapted to cell culture to use as serotype references. Our sequencing results revealed that most of the individual proteins from each HRV belong to one of three genotypes (1, 2, or 3) based on their similarities to proteins of genogroup strains (Wa, DS-1, or AU-1, respectively). Strains D, P, ST3, IAL28, and WI61 encode genotype 1 (Wa-like) proteins, whereas strains DS-1 and 69M encode genotype 2 (DS-1-like) proteins. Of the 10 HRVs sequenced, 3 of them (Se584, A64, and L26) encode proteins belonging to more than one genotype, indicating that they are intergenogroup reassortants. We used amino acid sequence alignments to identify residues that distinguish proteins belonging to HRV genotype 1, 2, or 3. These genotype-specific changes cluster in definitive regions within each viral protein, many of which are sites of known protein-protein interactions. For the intermediate viral capsid protein (VP6), the changes map onto the atomic structure at the VP2-VP6, VP4-VP6, and VP7-VP6 interfaces. The results of this study provide evidence that group A HRV gene constellations exist and may be influenced by interactions among viral proteins during replication. PMID:18786998

Characterisation of a rare, reassortant human G10P[14] rotavirus strain detected in Honduras

PubMed Central

Quaye, Osbourne; Roy, Sunando; Rungsrisuriyachai, Kunchala; Esona, Mathew D; Xu, Ziqian; Tam, Ka Ian; Banegas, Dina J Castro; Rey-Benito, Gloria; Bowen, Michael D

2018-01-01

BACKGROUND Although first detected in animals, the rare rotavirus strain G10P[14] has been sporadically detected in humans in Slovenia, Thailand, United Kingdom and Australia among other countries. Earlier studies suggest that the strains found in humans resulted from interspecies transmission and reassortment between human and bovine rotavirus strains. OBJECTIVES In this study, a G10P[14] rotavirus genotype detected in a human stool sample in Honduras during the 2010-2011 rotavirus season, from an unvaccinated 30-month old boy who reported at the hospital with severe diarrhea and vomiting, was characterised to determine the possible evolutionary origin of the rare strain. METHODS For the sample detected as G10P[14], 10% suspension was prepared and used for RNA extraction and sequence independent amplification. The amplicons were sequenced by next-generation sequencing using the Illumina MiSeq 150 paired end method. The sequence reads were analysed using CLC Genomics Workbench 6.0 and phylogenetic trees were constructed using PhyML version 3.0. FINDINGS The next generation sequencing and phylogenetic analyses of the 11-segmented genome of the G10P[14] strain allowed classification as G10-P[14]-I2-R2-C2-M2-A3-N2-T6-E2-H3. Six of the genes (VP1, VP2, VP3, VP6, NSP2 and NSP4) were DS-1-like. NSP1 and NSP5 were AU-1-like and NSP3 was T6, which suggests that multiple reassortment events occurred in the evolution of the strain. The phylogenetic analyses and genetic distance calculations showed that the VP7, VP4, VP6, VP1, VP3, NSP1, NSP3 and NSP4 genes clustered predominantly with bovine strains. NSP2 and VP2 genes were most closely related to simian and human strains, respectively, and NSP5 was most closely related to a rhesus strain. MAIN CONCLUSIONS The genetic characterisation of the G10P[14] strain from Honduras suggests that its genome resulted from multiple reassortment events which were possibly mediated through interspecies transmissions. PMID:29211103

Characterisation of a rare, reassortant human G10P[14] rotavirus strain detected in Honduras.

PubMed

Quaye, Osbourne; Roy, Sunando; Rungsrisuriyachai, Kunchala; Esona, Mathew D; Xu, Ziqian; Tam, Ka Ian; Banegas, Dina J Castro; Rey-Benito, Gloria; Bowen, Michael D

2018-01-01

Although first detected in animals, the rare rotavirus strain G10P[14] has been sporadically detected in humans in Slovenia, Thailand, United Kingdom and Australia among other countries. Earlier studies suggest that the strains found in humans resulted from interspecies transmission and reassortment between human and bovine rotavirus strains. In this study, a G10P[14] rotavirus genotype detected in a human stool sample in Honduras during the 2010-2011 rotavirus season, from an unvaccinated 30-month old boy who reported at the hospital with severe diarrhea and vomiting, was characterised to determine the possible evolutionary origin of the rare strain. For the sample detected as G10P[14], 10% suspension was prepared and used for RNA extraction and sequence independent amplification. The amplicons were sequenced by next-generation sequencing using the Illumina MiSeq 150 paired end method. The sequence reads were analysed using CLC Genomics Workbench 6.0 and phylogenetic trees were constructed using PhyML version 3.0. The next generation sequencing and phylogenetic analyses of the 11-segmented genome of the G10P[14] strain allowed classification as G10-P[14]-I2-R2-C2-M2-A3-N2-T6-E2-H3. Six of the genes (VP1, VP2, VP3, VP6, NSP2 and NSP4) were DS-1-like. NSP1 and NSP5 were AU-1-like and NSP3 was T6, which suggests that multiple reassortment events occurred in the evolution of the strain. The phylogenetic analyses and genetic distance calculations showed that the VP7, VP4, VP6, VP1, VP3, NSP1, NSP3 and NSP4 genes clustered predominantly with bovine strains. NSP2 and VP2 genes were most closely related to simian and human strains, respectively, and NSP5 was most closely related to a rhesus strain. The genetic characterisation of the G10P[14] strain from Honduras suggests that its genome resulted from multiple reassortment events which were possibly mediated through interspecies transmissions.

Mechanism for Coordinated RNA Packaging and Genome Replication by Rotavirus Polymerase VP1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xiaohui; McDonald, Sarah M.; Tortorici, M. Alejandra

2009-04-08

Rotavirus RNA-dependent RNA polymerase VP1 catalyzes RNA synthesis within a subviral particle. This activity depends on core shell protein VP2. A conserved sequence at the 3' end of plus-strand RNA templates is important for polymerase association and genome replication. We have determined the structure of VP1 at 2.9 {angstrom} resolution, as apoenzyme and in complex with RNA. The cage-like enzyme is similar to reovirus {lambda}3, with four tunnels leading to or from a central, catalytic cavity. A distinguishing characteristic of VP1 is specific recognition, by conserved features of the template-entry channel, of four bases, UGUG, in the conserved 3' sequence.more » Well-defined interactions with these bases position the RNA so that its 3' end overshoots the initiating register, producing a stable but catalytically inactive complex. We propose that specific 3' end recognition selects rotavirus RNA for packaging and that VP2 activates the autoinhibited VP1/RNA complex to coordinate packaging and genome replication.« less

Disoxaril mutants of Coxsackievirus B1: phenotypic characteristics and analysis of the target VP1 gene.

PubMed

Nikolova, Ivanka; Galabov, Angel S; Petkova, Rumena; Chakarov, Stoyan; Atanasov, Boris

2011-01-01

Disoxaril inhibits enterovirus replication by binding to the hydrophobic pocket within the VP1 coat protein, thus stabilizing the virion and blocking its uncoating. Disoxaril-resistant (RES) mutants of the Coxsackievirus B1 (CVB1/RES) were derived from the wild disoxaril-sensitive (SOF) strain (CVB1/SOF) using a selection approach. A disoxaril-dependent (DEP) mutant (CVB1/DEP) was obtained following nine consecutive passages of the disoxaril-resistant mutant in the presence of disoxaril. Phenotypic characteristics of the disoxaril mutants were investigated. A timing-of-addition study of the CVB1/DEP replication demonstrated that in the absence of disoxaril the virus particle assembly stopped. VP1 RNA sequences of disoxaril mutants were compared with the existing Gen Bank CVB1 reference structure. The amino acid sequence of a large VP1 196-258 peptide (disoxaril-binding region) of CVB1/RES was significantly different from that of the CVB1/SOF. Crucially important changes in CVB1/RES were two point mutations, M213H and F237L, both in the ligand-binding pocket. The sequence analysis of the CVB1/DEP showed some reversion to CVB1/SOF. The amino acid sequences of the three VP1 proteins are presented.

Comparison of compression efficiency between HEVC/H.265 and VP9 based on subjective assessments

NASA Astrophysics Data System (ADS)

Řeřábek, Martin; Ebrahimi, Touradj

2014-09-01

Current increasing effort of broadcast providers to transmit UHD (Ultra High Definition) content is likely to increase demand for ultra high definition televisions (UHDTVs). To compress UHDTV content, several alternative encoding mechanisms exist. In addition to internationally recognized standards, open access proprietary options, such as VP9 video encoding scheme, have recently appeared and are gaining popularity. One of the main goals of these encoders is to efficiently compress video sequences beyond HDTV resolution for various scenarios, such as broadcasting or internet streaming. In this paper, a broadcast scenario rate-distortion performance analysis and mutual comparison of one of the latest video coding standards H.265/HEVC with recently released proprietary video coding scheme VP9 is presented. Also, currently one of the most popular and widely spread encoder H.264/AVC has been included into the evaluation to serve as a comparison baseline. The comparison is performed by means of subjective evaluations showing actual differences between encoding algorithms in terms of perceived quality. The results indicate a general dominance of HEVC based encoding algorithm in comparison to other alternatives, while VP9 and AVC showing similar performance.

Genetic relatedness among human rotavirus genes coding for VP7, a major neutralization protein, and its application to serotype identification.

PubMed Central

Midthun, K; Flores, J; Taniguchi, K; Urasawa, S; Kapikian, A Z; Chanock, R M

1987-01-01

Antigenic characterization of human rotaviruses by plaque reduction neutralization assay has revealed four distinct serotypes. The outer capsid protein VP7, coded for by gene 8 or 9, is a major neutralization protein; however, studies of rotaviruses derived from genetic reassortment between two strains have confirmed that another outer capsid protein, VP3, is in some cases equally important in neutralization. In this study, the genetic relatedness of the genes coding for VP7 of human rotaviruses belonging to serotypes 1 through 4 was examined by hybridization of their denatured double-stranded genomic RNAs to labeled single-stranded mRNA probes derived from human-animal rotavirus reassortants containing only the VP7 gene of their human rotavirus parent. A high degree of homology was demonstrated between the VP7 genes of strain D and other serotype 1 human rotaviruses, strain DS-1 and other serotype 2 human rotaviruses, strain P and other serotype 3 human rotaviruses, and strain ST3 and other serotype 4 human rotaviruses. Hybrid bands could not be demonstrated between the VP7 gene of D, DS-1, P, or ST3 and the corresponding gene of human rotaviruses belonging to a different serotype. RNA specimens extracted from the stools of 15 Venezuelan children hospitalized with rotavirus diarrhea were hybridized to each of the reassortant probes representing the four human serotypes. All five viruses with short RNA patterns showed homology with the DS-1 strain VP7 gene; two of these were previously adapted to tissue culture and shown to be serotype 2 strains by tissue culture neutralization. Of the remaining 10 viruses with long RNA patterns, 2 hybridized only to the D strain VP7 gene, 6 hybridized only to the P strain VP7 gene, and 2 hybridized only to the ST3 strain VP7 gene. Hybridization using single human rotavirus gene substitution reassortants as probes may provide an alternative method for identifying the VP7 serotype of field isolates that would circumvent the need for tissue culture adaptation. Images PMID:3038948

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

Development of a rapid and simple immunochromatographic assay to identify Vibrio parahaemolyticus.

PubMed

Sakata, Junko; Kawatsu, Kentaro; Iwasaki, Tadashi; Kumeda, Yuko

2015-09-01

To rapidly and simply determine whether or not bacterial colonies growing on agar were Vibrio parahaemolyticus, we developed an immunochromatographic assay (VP-ICA) using two different monoclonal antibodies (designated mAb-VP34 and mAb-VP109) against the delta subunit of V. parahaemolyticus-F0F1 ATP synthase. The epitopes recognized by mAb-VP34 and mAb-VP109 were mapped to sequences of eight ((47)LLTSSFSA(54)) and six amino acid residues ((16)FDFAVD(21)), respectively. An amino acid sequence similarity search of the NCBI database using BLASTP showed that both epitopic amino acid sequences were present together only in V. parahaemolyticus. When 124 V. parahaemolyticus strains and 94 strains of 27 other Vibrio species or 35 non-Vibrio species were tested using the VP-ICA, the VP-ICA identified V. parahaemolyticus with 100% accuracy. The VP-ICA rapidly and simply identified the pathogen directly from a single agar colony within 30 min, indicating that VP-ICA will greatly reduce labor and time required to identify V. parahaemolyticus compared with conventional biochemical tests. Copyright © 2015. Published by Elsevier B.V.

Isolation and in silico analysis of a novel H+-pyrophosphatase gene orthologue from the halophytic grass Leptochloa fusca

NASA Astrophysics Data System (ADS)

Rauf, Muhammad; Saeed, Nasir A.; Habib, Imran; Ahmed, Moddassir; Shahzad, Khurram; Mansoor, Shahid; Ali, Rashid

2017-02-01

Structure prediction can provide information about function and active sites of protein which helps to design new functional proteins. H+-pyrophosphatase is transmembrane protein involved in establishing proton motive force for active transport of Na+ across membrane by Na+/H+ antiporters. A full length novel H+-pyrophosphatase gene was isolated from halophytic grass Leptochloa fusca using RT-PCR and RACE method. Full length LfVP1 gene sequence of 2292 nucleotides encodes protein of 764 amino acids. DNA and protein sequences were used for characterization using bioinformatics tools. Various important potential sites were predicted by PROSITE webserver. Primary structural analysis showed LfVP1 as stable protein and Grand average hydropathy (GRAVY) indicated that LfVP1 protein has good hydrosolubility. Secondary structure analysis showed that LfVP1 protein sequence contains significant proportion of alpha helix and random coil. Protein membrane topology suggested the presence of 14 transmembrane domains and presence of catalytic domain in TM3. Three dimensional structure from LfVP1 protein sequence also indicated the presence of 14 transmembrane domains and hydrophobicity surface model showed amino acid hydrophobicity. Ramachandran plot showed that 98% amino acid residues were predicted in the favored region.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

PubMed

Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

2016-11-30

The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular characterization of rotavirus isolated from alpaca (Vicugna pacos) crias with diarrhea in the Andean Region of Cusco, Peru.

PubMed

Garmendia, Antonio E; Lopez, Wellington; Ortega, Nastassja; Chamorro, Marycris J

2015-10-22

Alpacas (Vicugna pacos), a species of South American camelids (SAC), suffer high morbidity and mortality from infectious diseases. Diarrhea is one of the leading causes of alpaca cria mortality in Peru and elsewhere. In order to develop appropriate control and/or treatment, it is necessary to identify infectious pathogens that cause diarrhea in crias. Rotavirus was isolated in cell culture from feces collected from crias with acute diarrhea that tested positive to rotaviral antigen by rapid immunochromatographic methods in an earlier study. The isolates were identified as rotaviruses by RT-PCR run with specific primers for human rotavirus VP7 coding sequences using total RNA extracted from cells displaying cytopathic effects as template. These alpaca isolates were further identified as group A rotaviruses by means of a VP6-specific PCR and were designated as ALRVA-K'ayra/Perú/3368-10 and ALRVA-K'ayra/Perú/3386-10. Molecular G and P typing, placed the former as G3/P11 and the latter as G3/P?. Sequence analysis of two genome segments (coding for VP4 and VP7) from the alpaca isolates revealed partial homologies to swine and human rotaviruses, respectively. These results demonstrate that rotaviruses are associated with a proportion of cases of diarrhea in crias, although prevalence and impact remain to be determined. The isolation of rotaviruses from alpaca crias with diarrhea will contribute positively to further understand the pathogen and its role in the diarrhea complex. Copyright © 2015 Elsevier B.V. All rights reserved.

Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

PubMed

Hattori, T; Terada, T; Hamasuna, S

1995-06-01

Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

An overview of new video coding tools under consideration for VP10: the successor to VP9

NASA Astrophysics Data System (ADS)

Mukherjee, Debargha; Su, Hui; Bankoski, James; Converse, Alex; Han, Jingning; Liu, Zoe; Xu, Yaowu

2015-09-01

Google started an opensource project, entitled the WebM Project, in 2010 to develop royaltyfree video codecs for the web. The present generation codec developed in the WebM project called VP9 was finalized in mid2013 and is currently being served extensively by YouTube, resulting in billions of views per day. Even though adoption of VP9 outside Google is still in its infancy, the WebM project has already embarked on an ambitious project to develop a next edition codec VP10 that achieves at least a generational bitrate reduction over the current generation codec VP9. Although the project is still in early stages, a set of new experimental coding tools have already been added to baseline VP9 to achieve modest coding gains over a large enough test set. This paper provides a technical overview of these coding tools.

VpRFP1, a novel C4C4-type RING finger protein gene from Chinese wild Vitis pseudoreticulata, functions as a transcriptional activator in defence response of grapevine

PubMed Central

Yu, Yihe; Xu, Weirong; Wang, Shengyi; Xu, Yan; Li, Hui'e; Wang, Yuejin; Li, Shuxiu

2011-01-01

RING finger proteins comprise a large family and play important roles in regulation of growth and development, hormone signalling, and responses to biotic and abiotic stresses in plants. In this study, the identification and functional characterization of a C4C4-type RING finger protein gene from the Chinese wild grapevine Vitis pseudoreticulata (designated VpRFP1) are reported. VpRFP1 was initially identified as an expressed sequence tag (EST) from a cDNA library constructed from leaves of V. pseudoreticulata inoculated with the grapevine powdery mildew Uncinula necator. Sequence analysis of the deduced VpRFP1 protein based on the full-length cDNA revealed an N-terminal nuclear localization signal (NLS) and a C-terminal C4C4-type RING finger motif with the consensus sequence Cys-X2-Cys-X13-Cys-X1-Cys-X4-Cys-X2-Cys-X10-Cys-X2-Cys. Upon inoculation with U. necator, expression of VpRFP1 was rapidly induced to higher levels in mildew-resistant V. pseudoreticulata plants. In contrast, expression of VpRFP1 was down-regulated in mildew-susceptible V. vinifera plants. Western blotting using an antibody raised against VpRFP1 showed that VpRFP1 was also induced to higher levels in V. pseudoreticulata plants at 12–48 hours post-inoculation (hpi). However, there was only slight increase in VpRFP in V. vinifera plants in the same time frame, even though a more significant increase was observed at 96–144 hpi in these plants. Results from transactivation assays in yeast showed that the RING finger motif of VpRFP1 exhibited some activity of transcriptional activation; however, no activity was seen with the full-length VpRFP1. Overexpression of VpRFP1 in Arabidopsis plants was found to enhance resistance to Arabidopsis powdery mildew Golovinomyces cichoracearum, which seemed to be correlated with increased transcript levels of AtPR1 and AtPR2 in the pathogen-infected tissues. In addition, the Arabidopsis transgenic lines showed enhanced resistance to a virulent bacterial pathogen Pseudomonas syringae pv. tomato DC3000. Taken together, the results suggested that VpRFP1 may be a transcriptional activator of defence-related genes in grapevines. PMID:21862480

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

NASA Astrophysics Data System (ADS)

Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

1981-02-01

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

Linear Lepidopteran ambidensovirus 1 sequences drive random integration of a reporter gene in transfected Spodoptera frugiperda cells.

PubMed

Rizk, Francine; Laverdure, Sylvain; d'Alençon, Emmanuelle; Bossin, Hervé; Dupressoir, Thierry

2018-01-01

The Lepidopteran ambidensovirus 1 isolated from Junonia coenia (hereafter JcDV) is an invertebrate parvovirus considered as a viral transduction vector as well as a potential tool for the biological control of insect pests. Previous works showed that JcDV-based circular plasmids experimentally integrate into insect cells genomic DNA. In order to approach the natural conditions of infection and possible integration, we generated linear JcDV- gfp based molecules which were transfected into non permissive Spodoptera frugiperda ( Sf9 ) cultured cells. Cells were monitored for the expression of green fluorescent protein (GFP) and DNA was analyzed for integration of transduced viral sequences. Non-structural protein modulation of the VP-gene cassette promoter activity was additionally assayed. We show that linear JcDV-derived molecules are capable of long term genomic integration and sustained transgene expression in Sf9 cells. As expected, only the deletion of both inverted terminal repeats (ITR) or the polyadenylation signals of NS and VP genes dramatically impairs the global transduction/expression efficiency. However, all the integrated viral sequences we characterized appear "scrambled" whatever the viral content of the transfected vector. Despite a strong GFP expression, we were unable to recover any full sequence of the original constructs and found rearranged viral and non-viral sequences as well. Cellular flanking sequences were identified as non-coding ones. On the other hand, the kinetics of GFP expression over time led us to investigate the apparent down-regulation by non-structural proteins of the VP-gene cassette promoter. Altogether, our results show that JcDV-derived sequences included in linear DNA molecules are able to drive efficiently the integration and expression of a foreign gene into the genome of insect cells, whatever their composition, provided that at least one ITR is present. However, the transfected sequences were extensively rearranged with cellular DNA during or after random integration in the host cell genome. Lastly, the non-structural proteins seem to participate in the regulation of p9 promoter activity rather than to the integration of viral sequences.

Use of mutational pattern in 5'-NCR and VP1 regions of polioviruses for molecular diagnosis.

PubMed

Pliaka, V; Dedepsidis, E; Kyriakopoulou, Z; Papadopoulou, I; Levidiotou, S; Markoulatos, P

2007-08-01

Polioviruses are members of the enterovirus genus, belonging to the Picornaviridae family. They are the causative agents of poliomyelitis, a paralytic and sometimes fatal disease in humans. The number of poliomyelitis cases caused by wild poliovirus infections has been dramatically reduced by the extensive use of two available vaccines: the inactivated poliovirus vaccine (IPV) and the oral poliovirus vaccine (OPV). Despite the importance of OPV in the reduction of poliomyelitis cases, one of the disadvantages associated with this vaccine is the rare occurrence of vaccine-associated paralytic poliomyelitis (VAPP) in vaccinees or their healthy contacts through the accumulation of mutations and/or recombination in Sabin strains genome. Thirteen clinical isolates originating from healthy vaccinees and VAPP cases were investigated in order to identify genomic modifications in 5' non-coding region (5'-NCR) and VP1 genomic regions. The analysis of samples was conducted by RT-PCR, RFLP, sequencing and bioinformatics analysis. All clinical isolates were characterized as OPV-like viruses. Our results showed that analysis of 5'-NCR and VP1 regions of Poliovirus Sabin strains is important in order to identify mutations that increase the neurovirulence conducting to the eventuality of emergence of VAPP cases.

Detection, differentiation, and VP1 sequencing of duck hepatitis A virus type 1 and type 3 by a 1-step duplex reverse-transcription PCR assay.

PubMed

Wen, X J; Cheng, A C; Wang, M S; Jia, R Y; Zhu, D K; Chen, S; Liu, M F; Liu, F; Chen, X Y

2014-09-01

Duck hepatitis A virus (DHAV) is an infectious pathogen causing fatal duck viral hepatitis in ducklings. Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the duck industry in China and South Korea. For rapid detection, differentiation, and epidemic investigation of DHAV in China, a genotype-specific 1-step duplex reverse-transcription (RT) PCR assay was established in this study. The sensitivity and specificity of the developed RT-PCR assay was evaluated with nucleic acids extracted from 2 DHAV reference strains, and 9 other infectious viruses and bacteria. The genotype-specific primers amplified different size DNA fragments encompassing the complete VP1 gene of the DHAV-1 or DHAV-3. The assay detected the liver samples collected from experimentally infected ducklings and dead ducklings collected from different regions of China. Sequence analysis of these DNA fragments indicated that VP1 sequences of DHAV-1 can be used to distinguish wild type and vaccine strains. The phylogenetic analysis of VP1 sequences indicated that the developed RT-PCR assay can be used for epidemic investigation of DHAV-1 and DHAV-3. The developed RT-PCR assay can be used as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV. © 2014 Poultry Science Association Inc.

[Genetic characterization of echovirus 6 isolated from meningitis and encephalitis cases in Shandong Province, China].

PubMed

Lin, Xiao-Juan; Tao, Ze-Xin; Liu, Gui-Fang; Wang, Min; Song, Li-Zhi; Wang, Su-Ting; Ji, Feng; Wang, Hai-Yan; Xu, Ai-Qiang

2014-03-01

To analyze the genetic characteristics of echovirus 6 (E6) isolated from meningitis and encephalitis cases in Shandong Province, China, we collected cerebrospinal fluid samples from meningitis and encephalitis cases in Shandong Province from 2007 to 2012 for virus isolation. Viral RNAs were extracted from positive isolates, and complete VP1 coding regions were amplified by RT-PCR and sequenced. Homology comparison and phylogenetic analysis were performed. Six isolates were identified as E6 by microneutralization assay and molecular typing. The homology analysis showed that the six isolates had 78. 6%-99. 8% nucleotide and 95. 5%-100. 0% amino acid identities with each other, as well as 76. 9%-78. 4% nucleotide and 92. 3%-95. 1% amino acid identities with the prototype strain (D' Amori). The phylogenetic analysis based on the integrated VP1 sequences indicated that all Shandong E6 isolates could be separated into four clusters, designated as A, B, C, and D. The six E6 isolates belonged to clusters A, B, and D. Our study reveals high genetic differences between Shandong E6 isolates and suggests different transmission lineages of E6 co-circulated in Shandong Province.

Comparative assessment of H.265/MPEG-HEVC, VP9, and H.264/MPEG-AVC encoders for low-delay video applications

NASA Astrophysics Data System (ADS)

Grois, Dan; Marpe, Detlev; Nguyen, Tung; Hadar, Ofer

2014-09-01

The popularity of low-delay video applications dramatically increased over the last years due to a rising demand for realtime video content (such as video conferencing or video surveillance), and also due to the increasing availability of relatively inexpensive heterogeneous devices (such as smartphones and tablets). To this end, this work presents a comparative assessment of the two latest video coding standards: H.265/MPEG-HEVC (High-Efficiency Video Coding), H.264/MPEG-AVC (Advanced Video Coding), and also of the VP9 proprietary video coding scheme. For evaluating H.264/MPEG-AVC, an open-source x264 encoder was selected, which has a multi-pass encoding mode, similarly to VP9. According to experimental results, which were obtained by using similar low-delay configurations for all three examined representative encoders, it was observed that H.265/MPEG-HEVC provides significant average bit-rate savings of 32.5%, and 40.8%, relative to VP9 and x264 for the 1-pass encoding, and average bit-rate savings of 32.6%, and 42.2% for the 2-pass encoding, respectively. On the other hand, compared to the x264 encoder, typical low-delay encoding times of the VP9 encoder, are about 2,000 times higher for the 1-pass encoding, and are about 400 times higher for the 2-pass encoding.

Direct identification of non-polio enteroviruses in residual paralysis cases by analysis of VP1 sequences.

PubMed

Rahimi, Pooneh; Tabatabaie, H; Gouya, Mohammad M; Mahmudi, M; Musavi, T; Rad, K Samimi; Azad, T Mokhtari; Nategh, R

2009-06-01

The 66 serotypes of human enteroviruses (EVs) are classified into four species A-D, based on phylogenetic relationships in multiple genome regions. Partial VP(1) amplification and sequence analysis are reliable methods for identifying non-polio enterovirus serotypes, especially in negative cell culture specimens from patients with residual paralysis. In Iran during the years 2000-2002, there were 29 residual paralysis cases with negative cell (RD, HEp(2) and L(20)B) culture results. The genomic RNA was extracted from stool specimens from cases of residual paralysis and detected by amplification of the 5'-nontranslated region using RT-PCR with Pan-EV primers. Partial VP(1) amplification by semi-nested RT-PCR (snRT-PCR) and sequence analysis were done. Specimens from the 29 culture-negative cases contained echoviruses of six different serotypes. The global eradication of wild polioviruses is near and study of non-polio enteroviruses, which can cause poliomyelitis, is increasingly important to understand their pathogenesis. The VP(1) sequences, derived from the snRT-PCR products, allowed rapid molecular analysis of these non-polio strains.

Molecular characterization of serotype Asia-1 foot-and-mouth disease viruses in Pakistan and Afghanistan; emergence of a new genetic Group and evidence for a novel recombinant virus.

PubMed

Jamal, Syed M; Ferrari, Giancarlo; Ahmed, Safia; Normann, Preben; Belsham, Graham J

2011-12-01

Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate appropriate vaccine selection and tracing of outbreaks. The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998-2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1 have circulated in Pakistan during this time. These are Group-II, -VI and, recently, a novel Group (designated here as Group-VII). This new Group has not been detected in neighbouring Afghanistan during the study period but viruses from Groups I and -II are in circulation there. Using near complete genome sequences, from FMD viruses of serotypes Asia-1 and A that are currently circulating in Pakistan, we have identified an interserotypic recombinant virus, which has the VP2-VP3-VP1-2A coding sequences derived from a Group-VII Asia-1 virus and the remainder of the genome from a serotype A virus of the A-Iran05(AFG-07) sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

Genome-wide diversity and selective pressure in the human rhinovirus

PubMed Central

Kistler, Amy L; Webster, Dale R; Rouskin, Silvi; Magrini, Vince; Credle, Joel J; Schnurr, David P; Boushey, Homer A; Mardis, Elaine R; Li, Hao; DeRisi, Joseph L

2007-01-01

Background The human rhinoviruses (HRV) are one of the most common and diverse respiratory pathogens of humans. Over 100 distinct HRV serotypes are known, yet only 6 genomes are available. Due to the paucity of HRV genome sequence, little is known about the genetic diversity within HRV or the forces driving this diversity. Previous comparative genome sequence analyses indicate that recombination drives diversification in multiple genera of the picornavirus family, yet it remains unclear if this holds for HRV. Results To resolve this and gain insight into the forces driving diversification in HRV, we generated a representative set of 34 fully sequenced HRVs. Analysis of these genomes shows consistent phylogenies across the genome, conserved non-coding elements, and only limited recombination. However, spikes of genetic diversity at both the nucleotide and amino acid level are detectable within every locus of the genome. Despite this, the HRV genome as a whole is under purifying selective pressure, with islands of diversifying pressure in the VP1, VP2, and VP3 structural genes and two non-structural genes, the 3C protease and 3D polymerase. Mapping diversifying residues in these factors onto available 3-dimensional structures revealed the diversifying capsid residues partition to the external surface of the viral particle in statistically significant proximity to antigenic sites. Diversifying pressure in the pleconaril binding site is confined to a single residue known to confer drug resistance (VP1 191). In contrast, diversifying pressure in the non-structural genes is less clear, mapping both nearby and beyond characterized functional domains of these factors. Conclusion This work provides a foundation for understanding HRV genetic diversity and insight into the underlying biology driving evolution in HRV. It expands our knowledge of the genome sequence space that HRV reference serotypes occupy and how the pattern of genetic diversity across HRV genomes differs from other picornaviruses. It also reveals evidence of diversifying selective pressure in both structural genes known to interact with the host immune system and in domains of unassigned function in the non-structural 3C and 3D genes, raising the possibility that diversification of undiscovered functions in these essential factors may influence HRV fitness and evolution. PMID:17477878

Molecular characterization of a human G20P[28] rotavirus a strain with multiple genes related to bat rotaviruses.

PubMed

Esona, Mathew D; Roy, Sunando; Rungsrisuriyachai, Kunchala; Gautam, Rashi; Hermelijn, Sandra; Rey-Benito, Gloria; Bowen, Michael D

2018-01-01

Group A rotaviruses are the major cause of severe gastroenteritis in the young of mammals and birds. This report describes characterization of an unusual G20P[28] rotavirus strain detected in a 24month old child from Suriname. Genomic sequence analyses revealed that the genotype constellation of the Suriname strain RVA/Human-wt/SUR/2014735512/2013/G20P[28] was G20-P[28]-I13-R13-C13-M12-A23-N13-T15-E20-H15. Genes VP1, VP2, VP3, NSP1, NSP2, NSP3, NSP4 and NSP5 were recently assigned novel genotypes by the Rotavirus Classification Working Group (RCWG). Three of the 11 gene segments (VP7, VP4, VP6) were similar to cognate gene sequences of bat-like human rotavirus strain Ecu534 from Ecuador and the VP7, NSP3 and NSP5 gene segments of strain RVA/Human-wt/SUR/2014735512/2013/G20P[28] were found to be closely related to gene sequences of bat rotavirus strain 3081/BRA detected in Brazil. Although distantly related, the VP1 gene of the study strain and bat strain BatLi09 detected in Cameroon in 2014 are monophyletic. The NSP1 gene was found to be most closely related to human strain QUI-35-F5 from Brazil. These findings suggest that strain RVA/Human-wt/SUR/2014735512/2013/G20P[28] represents a zoonotic infection from a bat host. Published by Elsevier B.V.

Prevalence, genetic diversity and recombination of species G enteroviruses infecting pigs in Vietnam

PubMed Central

Van Dung, Nguyen; Anh, Pham Hong; Van Cuong, Nguyen; Hoa, Ngo Thi; Carrique-Mas, Juan; Hien, Vo Be; Campbell, James; Baker, Stephen; Farrar, Jeremy; Woolhouse, Mark E.; Bryant, Juliet E.

2014-01-01

Picornaviruses infecting pigs, described for many years as ‘porcine enteroviruses’, have recently been recognized as distinct viruses within three distinct genera (Teschovirus, Sapelovirus and Enterovirus). To better characterize the epidemiology and genetic diversity of members of the Enterovirus genus, faecal samples from pigs from four provinces in Vietnam were screened by PCR using conserved enterovirus (EV)-specific primers from the 5′ untranslated region (5′ UTR). High rates of infection were recorded in pigs on all farms, with detection frequencies of approximately 90 % in recently weaned pigs but declining to 40 % in those aged over 1 year. No differences in EV detection rates were observed between pigs with and without diarrhoea [74 % (n = 70) compared with 72 % (n = 128)]. Genetic analysis of consensus VP4/VP2 and VP1 sequences amplified from a subset of EV-infected pigs identified species G EVs in all samples. Among these, VP1 sequence comparisons identified six type 1 and seven type 6 variants, while four further VP1 sequences failed to group with any previously identified EV-G types. These have now been formally assigned as EV-G types 8–11 by the Picornavirus Study Group. Comparison of VP1, VP4/VP2, 3Dpol and 5′ UTRs of study samples and those available on public databases showed frequent, bootstrap-supported differences in their phylogenies indicative of extensive within-species recombination between genome regions. In summary, we identified extremely high frequencies of infection with EV-G in pigs in Vietnam, substantial genetic diversity and recombination within the species, and evidence for a much larger number of circulating EV-G types than currently described. PMID:24323635

Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

PubMed Central

Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

2014-01-01

Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348

Genome sequencing and analysis of a highly virulent Vibrio parahaemolyticus strain isolated from the marine environment

NASA Astrophysics Data System (ADS)

Parks, M. C.; Moreno, E.

2016-02-01

Vibrio parahaemolyticus [Vp] is a Gram-negative bacterium and a natural inhabitant of coastal marine ecosystems worldwide. Vp is also a coincidental pathogen of humans. Virulent strains are commonly identified by the presence of the thermostable direct (tdh) or tdh-related (trh) hemolysin genes. However, virulence is multifaceted and many clinical Vp isolates do not carry tdh or trh. In this study, we sequenced and assembled the draft genome of a tdh- and trh-negative environmental isolate (805) shown previously to be highly virulent in zebrafish. To investigate potential mechanisms of virulence, we compared 805 to the clinical V. parahaemolyticus type strain (RIMD2210633). Pairwise comparison revealed the presence of multiple genomic regions including an IncF conjugative pilus (1.3 Kb) and a colicin V plasmid (1.49 Kb). These features are homologous to genomic regions present in clinical V. vulnificus and V. cholerae strains. Genome comparison also revealed the presence of five toxin-antitoxin systems. Isolate 805 likely attained these new features through the lateral acquisition of mobile genomic material - a hypothesis supported by the aberrant GC content of these regions. Colicin V plasmids are a diverse group of IncF plasmids found in invasive bacterial strains. Similarly, an abundance of toxin-antitoxin systems have been linked to virulence in Gram-negative bacteria. Current efforts are focused on characterizing 142 coding features present in 805 but absent from the type strain.

Epidemiological features and genetic characterization of virus strains in rotavirus associated gastroenteritis in children of Odisha in Eastern India.

PubMed

Mohanty, Eileena; Dwibedi, Bhagirathi; Kar, S K; Acharya, A S

2017-09-01

We have studied the clinical characteristics, severity and seasonality of rotavirus infection and prevalent genotypes in 652 non-rota vaccinated children in Odisha in eastern India. P genotypes were analysed for their association with host blood group antigens. P type of the virus is determined by the VP8* gene, and specific recognition of A - type of Histo - blood group antigen by P[14]VP8* has been reported. VP4, VP7 and VP6 genes of commonly identified G1P[8] strain were compared with genes of the same strain isolated from other parts of India, elsewhere and strains used for Rotarix and Rotateq vaccines. In 54.75% of children with gastroenteritis, rota virus was found. 9.65% of children had moderate, 78.07% severe, and 12.28% very severe disease as assessed using the Vesikari scoring system. The incidence of infection was highest during winter months. There was no association between any blood group and specific P genotypes. G1P[8] was the commonest cause of gastroenteritis, followed by G1P[11], G3P[8], G9P[8], G2P[4], G2P[6], G9P[4], G9P[11] and G1P[6]. Predominant G genotypes identified were G1 (72.9%), G9 (10.81%), G2 (8.10%) and G3 (8.10%). Sequence analysis of the VP7 gene, placed the G1P[8] strain in lineage 1 and of VP6 gene placed nine G1P[8] strains in subgroup II and one in subgroup I. The VP7 gene segment of two Odisha G1P[8] strains were found to cluster relatively close to the VP7 sequences of Rotarix vaccine. Antigenic differences were found with vaccine strains. Ten G1P[8] strains sequenced for the VP4 gene had 91-93% nucleotide and 92-96% amino acid identity with Rotateq vaccine P[8]). Rotarix vaccine VP4 had 89-91% nucleotide and 90-92% amino acid identity. Our findings indicate genetic variability of rotavirus strains circulating in the region and are significant, given the introduction of rota vaccination in the State. Copyright © 2017 Elsevier B.V. All rights reserved.

A Simple and Reliable Strategy for BK Virus Subtyping and Subgrouping

PubMed Central

Morel, Virginie; Martin, Elodie; François, Catherine; Helle, François; Faucher, Justine; Mourez, Thomas; Choukroun, Gabriel; Duverlie, Gilles; Castelain, Sandrine

2017-01-01

ABSTRACT BK virus (BKV)-associated diseases in transplant recipients are an emerging issue. However, identification of the various BK virus subtypes/subgroups is a long and delicate process on the basis of currently available data. Therefore, we wanted to define a simple and effective one-step strategy for characterizing all BK virus strains from the VP1 gene sequence. Based on the analysis of 199 available complete DNA VP1 sequences, phylogenetic trees, alignments, and isolated polymorphisms were used to define an effective strategy for distinguishing the 12 different BK virus subtypes/subgroups. Based on the 12 subtypes identified from the 199 complete BKV VP1 sequences (1,089 bp), 60 mutations that can be used to differentiate these various subtypes/subgroups were identified. Some genomic areas were more variable and comprised mutational hot spots. From a subregion of only 100 bp in the VP1 region (1977 through 2076), we therefore constructed an algorithm that enabled rapid determination of all BKV subtypes/subgroups with 99% agreement (197/199) relative to the complete VP1 sequence. We called this domain of the BK viral genome the BK typing and grouping region (BKTGR). Finally, we validated our viral subtype identification process in a population of 100 transplant recipients with 100% efficiency. The new simpler method of BKV subtyping/subgrouping reported here constitutes a useful tool for future studies that will help us to more clearly understand the impact of BKV subtypes/subgroups on diagnosis, infection, and BK virus-associated diseases. PMID:28151406

Isolation and molecular cloning of a fast-growing strain of human hepatitis A virus from its double-stranded replicative form.

PubMed Central

Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M

1985-01-01

A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478

Analysis of the vp2 gene sequence of a new mutated mink enteritis parvovirus strain in PR China

PubMed Central

2010-01-01

Background Mink enteritis virus (MEV) causes a highly contagious viral disease of mink with a worldwide distribution. MEV has a linear, single-stranded, negative-sense DNA with a genome length of approximately 5,000 bp. The VP2 protein is the major structural protein of the parvovirus encoded by the vp2 gene. VP2 is highly antigenic and plays important roles in determining viral host ranges and tissue tropisms. This study describes the bionomics and vp2 gene analysis of a mutated strain, MEV-DL, which was isolated recently in China and outlines its homologous relationships with other selected strains registered in Genbank. Results The MEV-DL strain can infect F81 cells with cytopathic effects. Pig erythrocytes were agglutinated by the MEV-DL strain. The generation of MEV-DL in F81 cells could infect mink within three months and cause a disease that was similar to that caused by wild-type MEV. A comparative analysis of the vp2 gene nucleotide (nt) sequence of MEV-DL showed that this was more than 99% homologous with other mink enteritis parvoviruses in Genbank. However, the nucleotide residues at positions 1,065 and 1,238 in the MEV-DL strain of the vp2 gene differed from those of all the other MEV strains described previously. It is noteworthy that the mutation at the nucleotide residues position 1,238 led to Asp/Gly replacement. This may lead to structural changes. A phylogenetic tree and sequence distance table were obtained, which showed that the MEV-DL and ZYL-1 strains had the closest inheritance distance. Conclusions A new variation of the vp2 gene exists in the MEV-DL strain, which may lead to structural changes of the VP2 protein. Phylogenetic analysis showed that MEV-DL may originate from the ZYL-1 strain in DaLian. PMID:20540765

Unrecognized circulation of SAT 1 foot-and-mouth disease virus in cattle herds around Queen Elizabeth National Park in Uganda.

PubMed

Dhikusooka, Moses Tefula; Ayebazibwe, Chrisostom; Namatovu, Alice; Belsham, Graham J; Siegismund, Hans Redlef; Wekesa, Sabenzia Nabalayo; Balinda, Sheila Nina; Muwanika, Vincent B; Tjørnehøj, Kirsten

2016-01-06

Foot-and-mouth disease (FMD) is endemic in Uganda in spite of the control measures used. Various aspects of the maintenance and circulation of FMD viruses (FMDV) in Uganda are not well understood; these include the role of the African buffalo (Syncerus caffer) as a reservoir for FMDV. To better understand the epidemiology of FMD at the livestock-wildlife-interface, samples were collected from young, unvaccinated cattle from 24 pastoral herds that closely interact with wildlife around Queen Elizabeth National Park in Uganda, and analysed for evidence of FMDV infection. In total, 37 (15%) of 247 serum samples had detectable antibodies against FMDV non-structural proteins (NSPs) using a pan-serotypic assay. Within these 37 sera, antibody titres ≥ 80 against the structural proteins of serotypes O, SAT 1, SAT 2 and SAT 3 were detected by ELISA in 5, 7, 4 and 3 samples, respectively, while neutralizing antibodies were only detected against serotype O in 3 samples. Two FMDV isolates, with identical VP1 coding sequences, were obtained from probang samples from clinically healthy calves from the same herd and are serotype SAT 1 (topotype IV (EA-I)). Based on the VP1 coding sequences, these viruses are distinct from previous cattle and buffalo SAT 1 FMDV isolates obtained from the same area (19-30% nucleotide difference) and from the vaccine strain (TAN/155/71) used within Uganda (26% nucleotide difference). Eight herds had only one or a few animals with antibodies against FMDV NSPs while six herds had more substantial evidence of prior infection with FMDV. There was no evidence for exposure to FMDV in the other ten herds. The two identical SAT 1 FMDV VP1 sequences are distinct from former buffalo and cattle isolates from the same area, thus, transmission between buffalo and cattle was not demonstrated. These new SAT 1 FMDV isolates differed significantly from the vaccine strain used to control Ugandan FMD outbreaks, indicating a need for vaccine matching studies. Only six herds had clear serological evidence for exposure to O and SAT 1 FMDV. Scattered presence of antibodies against FMDV in other herds may be due to the occasional introduction of animals to the area or maternal antibodies from past infection and/or vaccination. The evidence for asymptomatic FMDV infection has implications for disease control strategies in the area since this obstructs early disease detection that is based on clinical signs in FMDV infected animals.

Intra-genotypic Diversity of Archival G4P[8] Human Rotaviruses from Washington, DC

PubMed Central

McDonald, Sarah M.; Davis, Kristin; McAllen, John K.; Spiro, David J.; Patton, John T.

2011-01-01

Group A human rotaviruses (RVs) remain the most frequently detected viral agents associated with acute gastroenteritis in infants and young children. Despite their medical importance, relatively few complete genome sequences have been determined for commonly circulating G/P-type strains (i.e., G1P[8], G2P[4], G3P[8], G4P[8], and G9P[8]). In the current study, we sequenced the genomes of 11 G4P[8] isolates from stool specimens that were collected in Washington, DC during the years of 1974-1991. We found that the VP7-VP4-VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6-encoding genes of all 11 G4P[8] RVs have the genotypes of G4-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. By constructing phylogenetic trees for each gene, extensive intra-genotypic diversity was revealed among the G4P[8] RVs, and new sub-genotype gene alleles were identified. Several of these alleles are nearly identical to those of G3P[8] isolates previously sequenced from this same Washington, DC collection, strongly suggesting that the RVs underwent gene reassortment. On the other hand, we observed that some G4P[8] RVs exhibit completely different allele-based genome constellations, despite being collected during the same epidemic season; there was no evidence of gene reassortment between these strains. This observation extends our previous findings and supports the notion that stable, genetically-distinct clades of human RVs with the same G/P-type can co-circulate in a community. Interestingly, the sub-genotype gene alleles found in some of the DC RVs share a close evolutionary relationship with genes of more contemporary human strains. Thus, archival human RVs sequenced in this study might represent evolutionary precursors to modern-day strains. PMID:21712102

Molecular Evolution of a Type 1 Wild-Vaccine Poliovirus Recombinant during Widespread Circulation in China

PubMed Central

Liu, Hong-Mei; Zheng, Du-Ping; Zhang, Li-Bi; Oberste, M. Steven; Pallansch, Mark A.; Kew, Olen M.

2000-01-01

Type 1 wild-vaccine recombinant polioviruses were isolated from poliomyelitis patients in China from 1991 to 1993. We compared the sequences of 34 recombinant isolates over the 1,353-nucleotide (nt) genomic interval (nt 2480 to 3832) encoding the major capsid protein, VP1, and the protease, 2A. All recombinants had a 367-nt block of sequence (nt 3271 to 3637) derived from the Sabin 1 oral poliovirus vaccine strain spanning the 3′-terminal sequences of VP1 (115 nt) and the 5′ half of 2A (252 nt). The remaining VP1 sequences were closely (up to 99.5%) related to those of a major genotype of wild type 1 poliovirus endemic to China up to 1994. In contrast, the non-vaccine-derived sequences at the 3′ half of 2A were more distantly related (<90% nucleotide sequence match) to those of other contemporary wild polioviruses from China. The vaccine-derived sequences of the earliest (April 1991) isolates completely matched those of Sabin 1. Later isolates diverged from the early isolates primarily by accumulation of synonymous base substitutions (at a rate of ∼3.7 × 10−2 substitutions per synonymous site per year) over the entire VP1-2A interval. Distinct evolutionary lineages were found in different Chinese provinces. From the combined epidemiologic and evolutionary analyses, we propose that the recombinant virus arose during mixed infection of a single individual in northern China in early 1991 and that its progeny spread by multiple independent chains of transmission into some of the most populous areas of China within a year of the initiating infection. PMID:11070012

Retrospective Characterization of a Vaccine-Derived Poliovirus Type 1 Isolate from Sewage in Greece▿

PubMed Central

Dedepsidis, Evaggelos; Kyriakopoulou, Zaharoula; Pliaka, Vaia; Kottaridi, Christine; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Komiotis, Dimitri; Markoulatos, Panayotis

2007-01-01

Retrospective molecular and phenotypic characterization of a vaccine-derived poliovirus (VDPV) type 1 isolate (7/b/97) isolated from sewage in Athens, Greece, in 1997 is reported. VP1 sequencing of this isolate revealed 1.87% divergence from the VP1 region of reference strain Sabin 1, while further genomic characterization of isolate 7/b/97 revealed a recombination event in the nonstructural part of the genome between a vaccine strain and a nonvaccine strain probably belonging to Enterovirus species C. Amino acid substitutions commonly found in previous studies were identified in the capsid coding region of the isolate, while most of the attenuation and temperature sensitivity determinants were reverted. The ultimate source of isolate 7/b/97 is unknown. The recovery of such a highly divergent derivative of a vaccine strain emphasizes the need for urgent implementation of environmental surveillance as a supportive procedure in the polio surveillance system even in countries with high rates of OPV coverage in order to prevent cases or even outbreaks of poliomyelitis that otherwise would be inevitable. PMID:17827314

Retrospective characterization of a vaccine-derived poliovirus type 1 isolate from sewage in Greece.

PubMed

Dedepsidis, Evaggelos; Kyriakopoulou, Zaharoula; Pliaka, Vaia; Kottaridi, Christine; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Komiotis, Dimitri; Markoulatos, Panayotis

2007-11-01

Retrospective molecular and phenotypic characterization of a vaccine-derived poliovirus (VDPV) type 1 isolate (7/b/97) isolated from sewage in Athens, Greece, in 1997 is reported. VP1 sequencing of this isolate revealed 1.87% divergence from the VP1 region of reference strain Sabin 1, while further genomic characterization of isolate 7/b/97 revealed a recombination event in the nonstructural part of the genome between a vaccine strain and a nonvaccine strain probably belonging to Enterovirus species C. Amino acid substitutions commonly found in previous studies were identified in the capsid coding region of the isolate, while most of the attenuation and temperature sensitivity determinants were reverted. The ultimate source of isolate 7/b/97 is unknown. The recovery of such a highly divergent derivative of a vaccine strain emphasizes the need for urgent implementation of environmental surveillance as a supportive procedure in the polio surveillance system even in countries with high rates of OPV coverage in order to prevent cases or even outbreaks of poliomyelitis that otherwise would be inevitable.

Type-specific and cross-reactive antibodies and T cell responses in norovirus VLP immunized mice are targeted both to conserved and variable domains of capsid VP1 protein.

PubMed

Malm, Maria; Tamminen, Kirsi; Vesikari, Timo; Blazevic, Vesna

2016-10-01

Norovirus (NoV)-specific antibodies, which block binding of the virus-like particles (VLPs) to the cell receptors are conformation dependent and directed towards the most exposed domain of the NoV capsid VP1 protein, the P2 domain. Limited data are available on the antibodies directed to other domains of the VP1, and even less on the NoV VP1-specific T cell epitopes. In here, BALB/c mice were immunized with six VLPs derived from NoV GII.4-1999, GII.4-2009 (New Orleans), GII.4-2012 (Sydney), GII.12, GI.1, and G1.3. Serum immunoglobulin G binding antibodies, histo-blood group antigen blocking antibodies and T cell responses using type-specific and heterologous NoV VLPs, P-dimers and 76 overlapping synthetic peptides, spanning the entire 539 amino acid sequence of GII.4 VP1, were determined. The results showed that at least half of the total antibody content is directed towards conserved S domain of the VP1. Only a small fraction (<1%) of the VP1 binding antibodies were blocking/neutralizing. With the use of matrix peptide pools and individual peptides, seven CD4 + and CD8 + T cell restricted epitopes were mapped, two located in S domain, four in P2 domain and one in P1 domain of NoV VP1. The epitopes were GII.4 strain-specific but also common GII.4 genotype-specific T cell epitopes were identified. More importantly, the results suggest a 9-amino acids long sequence ( 318 PAPLGTPDF 326 ) in P2 domain of VP1 as a universal NoV genogroup II-specific CD8 + T cell epitope. Distribution of the T cell epitopes alongside the capsid VP1 indicates the need of the complete protein for high immunogenicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Analysis of complete genome sequences of G9P[19] rotavirus strains from human and piglet with diarrhea provides evidence for whole-genome interspecies transmission of nonreassorted porcine rotavirus.

PubMed

Yodmeeklin, Arpaporn; Khamrin, Pattara; Chuchaona, Watchaporn; Kumthip, Kattareeya; Kongkaew, Aphisek; Vachirachewin, Ratchaya; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2017-01-01

Whole genomes of G9P[19] human (RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19]) and porcine (RVA/Pig-wt/THA/CMP-015-12/2012/G9P[19]) rotaviruses concurrently detected in the same geographical area in northern Thailand were sequenced and analyzed for their genetic relationships using bioinformatic tools. The complete genome sequence of human rotavirus RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19] was most closely related to those of porcine rotavirus RVA/Pig-wt/THA/CMP-015-12/2012/G9P[19] and to those of porcine-like human and porcine rotaviruses reference strains than to those of human rotavirus reference strains. The genotype constellation of G9P[19] detected in human and piglet were identical and displayed as the G9-P[19]-I5-R1-C1-M1-A8-N1-T1-E1-H1 genotypes with the nucleotide sequence identities of VP7, VP4, VP6, VP1, VP2, VP3, NSP1, NSP2, NSP3, NSP4, and NSP5 at 99.0%, 99.5%, 93.2%, 97.7%, 97.7%, 85.6%, 89.5%, 93.2%, 92.9%, 94.0%, and 98.1%, respectively. The findings indicate that human rotavirus strain RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19] containing the genome segments of porcine genetic backbone is most likely a human rotavirus of porcine origin. Our data provide an evidence of interspecies transmission and whole-genome transmission of nonreassorted G9P[19] porcine RVA to human occurring in nature in northern Thailand. Copyright © 2016. Published by Elsevier B.V.

Isolation and sequence analysis of the complete NS1 and VP2 genes of canine parvovirus from domestic dogs in 2013 and 2014 in China.

PubMed

Wang, Hualei; Jin, Hongli; Li, Qian; Zhao, Guoxing; Cheng, Nan; Feng, Na; Zheng, Xuexing; Wang, Jianzhong; Zhao, Yongkun; Li, Ling; Cao, Zengguo; Yan, Feihu; Wang, Lina; Wang, Tiecheng; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu

2016-02-01

Canine parvovirus (CPV) can cause severe disease in animals and continuously generates new variant and recombinant strains in dogs that have a strong impact on sanitation. It is therefore necessary to investigate epidemic CPV strains to improve our understanding of CPV transmission and epidemic behavior. However, most studies have focused on the analysis of VP2, and therefore, information about recombination and relationships between strains is still lacking. Here, 14 strains of CPV were isolated from domestic dogs suspected of hosting CPV between 2013 and 2014 in China. The complete NS1 and VP2 genes were sequenced and analyzed. The results suggest that the new CPV-2a and new CPV-2b types are the prevalent strains in China. In addition to a few mutations (residues 19, 544, 545, 572 and 583 of NS1 and residues 267, 370, 377 and 440 of VP2) that were preserved during transmission, new mutations (residues 60, 630 of NS1, and residues 21, 310 of VP2) were found in the isolated strains. A phylogenetic tree based on VP2 sequences illustrated that the new CPV-2a and new CPV-2b strains from China form single clusters that are distinct from lineages from other countries. Moreover, recombination between the new CPV-2a and new CPV-2b types was also identified in the isolated strains. Due to differences in selection pressures or recombination, there were a small number of inconsistencies between the phylogenetic trees for VP2 and NS1, which indicated that phylogenetic relationships based on VP2 might not be representative of those based on NS1. The data indicated that mutations and recombination are constantly occurring along with the spread of CPV in China.

Confirmation of the genome position and mass of the viral protien, VP3, of Solenopsis Invicta Virus 1 (Picornavirales: Dicistroviridae) infecting the Red Imported Fire Ant (Hymenoptera: Formicidae)

USDA-ARS?s Scientific Manuscript database

A predicted peptide sequence corresponding to the capsid protein VP3 of SINV-1 was used to prepare a polyclonal antibody preparation and probe SDS-PAGE separated proteins from SINV-1 particles and S. invicta ants. The SINV-1 VP3 antibody preparation recognized a 24 kDa protein from denatured SINV-1...

Recommendations for the classification of group A rotaviruses using all 11 genomic RNA segments.

PubMed

Matthijnssens, Jelle; Ciarlet, Max; Rahman, Mustafizur; Attoui, Houssam; Bányai, Krisztián; Estes, Mary K; Gentsch, Jon R; Iturriza-Gómara, Miren; Kirkwood, Carl D; Martella, Vito; Mertens, Peter P C; Nakagomi, Osamu; Patton, John T; Ruggeri, Franco M; Saif, Linda J; Santos, Norma; Steyer, Andrej; Taniguchi, Koki; Desselberger, Ulrich; Van Ranst, Marc

2008-01-01

Recently, a classification system was proposed for rotaviruses in which all the 11 genomic RNA segments are used (Matthijnssens et al. in J Virol 82:3204-3219, 2008). Based on nucleotide identity cut-off percentages, different genotypes were defined for each genome segment. A nomenclature for the comparison of complete rotavirus genomes was considered in which the notations Gx-P[x]-Ix-Rx-Cx-Mx-Ax-Nx-Tx-Ex-Hx are used for the VP7-VP4-VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6 encoding genes, respectively. This classification system is an extension of the previously applied genotype-based system which made use of the rotavirus gene segments encoding VP4, VP7, VP6, and NSP4. In order to assign rotavirus strains to one of the established genotypes or a new genotype, a standard procedure is proposed in this report. As more human and animal rotavirus genomes will be completely sequenced, new genotypes for each of the 11 gene segments may be identified. A Rotavirus Classification Working Group (RCWG) including specialists in molecular virology, infectious diseases, epidemiology, and public health was formed, which can assist in the appropriate delineation of new genotypes, thus avoiding duplications and helping minimize errors. Scientists discovering a potentially new rotavirus genotype for any of the 11 gene segments are invited to send the novel sequence to the RCWG, where the sequence will be analyzed, and a new nomenclature will be advised as appropriate. The RCWG will update the list of classified strains regularly and make this accessible on a website. Close collaboration with the Study Group Reoviridae of the International Committee on the Taxonomy of Viruses will be maintained.

Identification of a nuclear localization sequence in the polyomavirus capsid protein VP2

NASA Technical Reports Server (NTRS)

Chang, D.; Haynes, J. I. 2nd; Brady, J. N.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1992-01-01

A nuclear localization signal (NLS) has been identified in the C-terminal (Glu307-Glu-Asp-Gly-Pro-Gln-Lys-Lys-Lys-Arg-Arg-Leu318) amino acid sequence of the polyomavirus minor capsid protein VP2. The importance of this amino acid sequence for nuclear transport of newly synthesized VP2 was demonstrated by a genetic "subtractive" study using the constructs pSG5VP2 (expressing full-length VP2) and pSG5 delta 3VP2 (expressing truncated VP2, lacking amino acids Glu307-Leu318). These constructs were transfected into COS-7 cells, and the intracellular localization of the VP2 protein was determined by indirect immunofluorescence. These studies revealed that the full-length VP2 was localized in the nucleus, while the truncated VP2 protein was localized in the cytoplasm and not transported to the nucleus. A biochemical "additive" approach was also used to determine whether this sequence could target nonnuclear proteins to the nucleus. A synthetic peptide identical to VP2 amino acids Glu307-Leu318 was cross-linked to the nonnuclear proteins bovine serum albumin (BSA) or immunoglobulin G (IgG). The conjugates were then labeled with fluorescein isothiocyanate and microinjected into the cytoplasm of NIH 3T6 cells. Both conjugates localized in the nucleus of the microinjected cells, whereas unconjugated BSA and IgG remained in the cytoplasm. Taken together, these genetic subtractive and biochemical additive approaches have identified the C-terminal sequence of polyoma-virus VP2 (containing amino acids Glu307-Leu318) as the NLS of this protein.

CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

PubMed

Zhou, Carol L Ecale

2015-01-01

In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

Complete coding sequence characterization and comparative analysis of the putative novel human rhinovirus (HRV) species C and B

PubMed Central

2011-01-01

Background Human Rhinoviruses (HRVs) are well recognized viral pathogens associated with acute respiratory tract illnesses (RTIs) abundant worldwide. Although recent studies have phylogenetically identified the new HRV species (HRV-C), data on molecular epidemiology, genetic diversity, and clinical manifestation have been limited. Result To gain new insight into HRV genetic diversity, we determined the complete coding sequences of putative new members of HRV species C (HRV-CU072 with 1% prevalence) and HRV-B (HRV-CU211) identified from clinical specimens collected from pediatric patients diagnosed with a symptom of acute lower RTI. Complete coding sequence and phylogenetic analysis revealed that the HRV-CU072 strain shared a recent common ancestor with most closely related Chinese strain (N4). Comparative analysis at the protein level showed that HRV-CU072 might accumulate substitutional mutations in structural proteins, as well as nonstructural proteins 3C and 3 D. Comparative analysis of all available HRVs and HEVs indicated that HRV-C contains a relatively high G+C content and is more closely related to HEV-D. This might be correlated to their replication and capability to adapt to the high temperature environment of the human lower respiratory tract. We herein report an infrequently occurring intra-species recombination event in HRV-B species (HRV-CU211) with a crossing over having taken place at the boundary of VP2 and VP3 genes. Moreover, we observed phylogenetic compatibility in all HRV species and suggest that dynamic mechanisms for HRV evolution seem to be related to recombination events. These findings indicated that the elementary units shaping the genetic diversity of HRV-C could be found in the nonstructural 2A and 3D genes. Conclusion This study provides information for understanding HRV genetic diversity and insight into the role of selection pressure and recombination mechanisms influencing HRV evolution. PMID:21214911

Complete coding sequence characterization and comparative analysis of the putative novel human rhinovirus (HRV) species C and B.

PubMed

Linsuwanon, Piyada; Payungporn, Sunchai; Suwannakarn, Kamol; Chieochansin, Thaweesak; Theamboonlers, Apiradee; Poovorawan, Yong

2011-01-07

Human Rhinoviruses (HRVs) are well recognized viral pathogens associated with acute respiratory tract illnesses (RTIs) abundant worldwide. Although recent studies have phylogenetically identified the new HRV species (HRV-C), data on molecular epidemiology, genetic diversity, and clinical manifestation have been limited. To gain new insight into HRV genetic diversity, we determined the complete coding sequences of putative new members of HRV species C (HRV-CU072 with 1% prevalence) and HRV-B (HRV-CU211) identified from clinical specimens collected from pediatric patients diagnosed with a symptom of acute lower RTI. Complete coding sequence and phylogenetic analysis revealed that the HRV-CU072 strain shared a recent common ancestor with most closely related Chinese strain (N4). Comparative analysis at the protein level showed that HRV-CU072 might accumulate substitutional mutations in structural proteins, as well as nonstructural proteins 3C and 3 D. Comparative analysis of all available HRVs and HEVs indicated that HRV-C contains a relatively high G+C content and is more closely related to HEV-D. This might be correlated to their replication and capability to adapt to the high temperature environment of the human lower respiratory tract. We herein report an infrequently occurring intra-species recombination event in HRV-B species (HRV-CU211) with a crossing over having taken place at the boundary of VP2 and VP3 genes. Moreover, we observed phylogenetic compatibility in all HRV species and suggest that dynamic mechanisms for HRV evolution seem to be related to recombination events. These findings indicated that the elementary units shaping the genetic diversity of HRV-C could be found in the nonstructural 2A and 3D genes. This study provides information for understanding HRV genetic diversity and insight into the role of selection pressure and recombination mechanisms influencing HRV evolution.

Reassortant group A rotavirus from straw-colored fruit bat (Eidolon helvum).

PubMed

Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Conrardy, Christina; Tong, Suxiang; Kuzmin, Ivan V; Agwanda, Bernard; Breiman, Robert F; Banyai, Krisztian; Niezgoda, Michael; Rupprecht, Charles E; Gentsch, Jon R; Bowen, Michael D

2010-12-01

Bats are known reservoirs of viral zoonoses. We report genetic characterization of a bat rotavirus (Bat/KE4852/07) detected in the feces of a straw-colored fruit bat (Eidolon helvum). Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related. The VP4 gene was nearly identical to that of human P[6] rotavirus strains, and the NSP4 gene was closely related to those of previously described mammalian rotaviruses, including human strains. Analysis of partial sequence of the VP1 gene indicated that it was distinct from cognate genes of other rotaviruses. No sequences were obtained for the VP3 and NSP1 genes of the bat rotavirus. This rotavirus was designated G25-P[6]-I15-R8(provisional)-C8-Mx-Ax-N8-T11-E2-H10. Results suggest that several reassortment events have occurred between human, animal, and bat rotaviruses. Several additional rotavirus strains were detected in bats.

Reassortant Group A Rotavirus from Straw-colored Fruit Bat (Eidolon helvum)

PubMed Central

Esona, Mathew D.; Mijatovic-Rustempasic, Slavica; Conrardy, Christina; Tong, Suxiang; Kuzmin, Ivan V.; Agwanda, Bernard; Breiman, Robert F.; Banyai, Krisztian; Niezgoda, Michael; Rupprecht, Charles E.; Gentsch, Jon R.

2010-01-01

Bats are known reservoirs of viral zoonoses. We report genetic characterization of a bat rotavirus (Bat/KE4852/07) detected in the feces of a straw-colored fruit bat (Eidolon helvum). Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related. The VP4 gene was nearly identical to that of human P[6] rotavirus strains, and the NSP4 gene was closely related to those of previously described mammalian rotaviruses, including human strains. Analysis of partial sequence of the VP1 gene indicated that it was distinct from cognate genes of other rotaviruses. No sequences were obtained for the VP3 and NSP1 genes of the bat rotavirus. This rotavirus was designated G25-P[6]-I15-R8(provisional)-C8-Mx-Ax-N8-T11-E2-H10. Results suggest that several reassortment events have occurred between human, animal, and bat rotaviruses. Several additional rotavirus strains were detected in bats. PMID:21122212

Genetic diversity and phylogenetic analysis of Aleutian mink disease virus isolates in north-east China.

PubMed

Leng, Xue; Liu, Dongxu; Li, Jianming; Shi, Kun; Zeng, Fanli; Zong, Ying; Liu, Yi; Sun, Zhibo; Zhang, Shanshan; Liu, Yadong; Du, Rui

2018-05-01

Aleutian mink disease is the most important disease in the mink-farming industry worldwide. So far, few large-scale molecular epidemiological studies of AMDV, based on the NS1 and VP2 genes, have been conducted in China. Here, eight new Chinese isolates of AMDV from three provinces in north-east China were analyzed to clarify the molecular epidemiology of AMDV. The seroprevalence of AMDV in north-east China was 41.8% according to counterimmuno-electrophoresis. Genetic variation analysis of the eight isolates showed significant non-synonymous substitutions in the NS1 and VP2 genes, especially in the NS1 gene. All eight isolates included the caspase-recognition sequence NS1:285 (DQTD↓S), but not the caspase recognition sequence NS1:227 (INTD↓S). The LN1 and LN2 strains had a new 10-amino-acid deletion in-between amino acids 28-37, while the JL3 strain had a one-amino-acid deletion at position 28 in the VP2 protein, compared with the AMDV-G strain. Phylogenetic analysis based on most of NS1 (1755 bp) and complete VP2 showed that the AMDV genotypes did not cluster according to their pathogenicity or geographic origin. Local and imported ADMV species are all prevalent in mink-farming populations in the north-east of China. This is the first study to report the molecular epidemiology of AMDV in north-east China based on most of NS1 and the complete VP2, and further provides information about polyG deletions and new variations in the amino acid sequences of NS1 and VP2 proteins. This report is a good foundation for further study of AMDV in China.

Characterization of the DNA binding properties of polyomavirus capsid protein

NASA Technical Reports Server (NTRS)

Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

Isolation and characterization of two VpYABBY genes from wild Chinese Vitis pseudoreticulata.

PubMed

Xiang, J; Liu, R Q; Li, T M; Han, L J; Zou, Y; Xu, T F; Wei, J Y; Wang, Y J; Xu, Y

2013-12-01

The establishment of abaxial-adaxial polarity is an important feature of the development of lateral organs in plants. Members of the YABBY gene family may be specific to seed-plant-specific transcriptional regulators that play critical roles in promoting abaxial cell fate in the model eudicot, Arabidopsis thaliana. However, recent study has shown that the roles of YABBY genes are not conserved in the development of angiosperms. The establishment of abaxial-adaxial polarity has not been studied in perennial fruit crops. Grapes are an important fruit crop in many regions of the world. Investigating YABBY genes in grapevines should help us to discover more about the key genetic and molecular pathways in grapevine development. To understand the characterization of YABBY genes in grapevines, two YABBY genes, VpYABBY1 (GenBank accession No. KC139089) and VpYABBY2 (GenBank accession No. KC139090), were isolated from the wild Chinese species Vitis pseudoreticulata. Both of these encode YABBY proteins. Sequence characterization and phylogenetic analyses show that VpYABBY1 is group classified into the FIL subfamily while VpYABBY2 is a member of the YAB2 subfamily of Arabidopsis thaliana. Subcellular localization analysis indicates that VpYABBY1 and VpYABBY2 proteins are localized in the nucleus. Tissue specific expressional analysis reveals that VpYABBY1 is expressed strongly in young leaves of grape but only weakly in the mature leaves. Meanwhile, VpYABBY2 is expressed in grape stems, flowers, tendrils, and leaves. Transgenic Arabidopsis plants ectopically expressing VpYABBY1 caused the partial abaxialization of the adaxial epidermises of leaves, behaving similarly to those over-expressing FIL or YAB3 with abaxialized lateral organs. By contrast, ectopic expression of VpYABBY2 in Arabidopsis did not cause any alteration in the adaxial-abaxial polarity. Sequence characterization and phylogenetic analysis revealed that VpYABBY1 and VpYABBY2 are group-classified into two different subfamilies. They have diverged functionally in the control of lateral organ development. VpYABBY1 may have a function in leaf development, while VpYABBY2 may play a specific role in carpel development and grape berry morphogenesis. It is further possible that during the evolution of different species, YABBY family members have preserved different expression regulatory systems and functions.

The VP35 and VP40 proteins of filoviruses. Homology between Marburg and Ebola viruses.

PubMed

Bukreyev, A A; Volchkov, V E; Blinov, V M; Netesov, S V

1993-05-03

The fragments of genomic RNA sequences of Marburg (MBG) and Ebola (EBO) viruses are reported. These fragments were found to encode the VP35 and VP40 proteins. The canonic sequences were revealed before and after each open reading frame. It is suggested that these sequences are mRNA extremities and at the same time the regulatory elements for mRNA transcription. Homology between the MBG and EBO proteins was discovered.

Phylogenetic analysis of VP2 gene of canine parvovirus and comparison with Indian and world isolates.

PubMed

Kaur, G; Chandra, M; Dwivedi, P N

2016-03-01

Canine parvovirus (CPV) causes hemorrhagic enteritis, especially in young dogs, leading to high morbidity and mortality. It has four main antigenic types CPV-2, CPV-2a, CPV-2b and CPV-2c. Virus protein 2 (VP2) is the main capsid protein and mutations affecting VP2 gene are responsible for the evolution of various antigenic types of CPV. Full length VP2 gene from field isolates was amplified and cloned for sequence analysis. The sequences were submitted to the GenBank and were assigned Acc. Nos., viz. KP406928.1 for P12, KP406927.1 for P15, KP406930.1 for P32, KP406926.1 for Megavac-6 and KP406929.1 for NobivacDHPPi. Phylogenetic analysis indicated that the samples were forming a separate clad with vaccine strains. When the samples were compared with the world and Indian isolates, it was observed that samples formed a separate node indicating regional genetic variation in CPV.

Full-Genome Characterisation of Orungo, Lebombo and Changuinola Viruses Provides Evidence for Co-Evolution of Orbiviruses with Their Arthropod Vectors

PubMed Central

Mohd Jaafar, Fauziah; Belhouchet, Mourad; Belaganahalli, Manjunatha; Tesh, Robert B.; Mertens, Peter P. C.; Attoui, Houssam

2014-01-01

The complete genomes of Orungo virus (ORUV), Lebombo virus (LEBV) and Changuinola virus (CGLV) were sequenced, confirming that they each encode 11 distinct proteins (VP1-VP7 and NS1-NS4). Phylogenetic analyses of cell-attachment protein ‘outer-capsid protein 1′ (OC1), show that orbiviruses fall into three large groups, identified as: VP2(OC1), in which OC1 is the 2nd largest protein, including the Culicoides transmitted orbiviruses; VP3(OC1), which includes the mosquito transmitted orbiviruses; and VP4(OC1) which includes the tick transmitted viruses. Differences in the size of OC1 between these groups, places the T2 ‘subcore-shell protein’ as the third largest protein ‘VP3(T2)’ in the first of these groups, but the second largest protein ‘VP3(T2)’ in the other two groups. ORUV, LEBV and CGLV all group with the Culicoides-borne VP2(OC1)/VP3(T2) viruses. The G+C content of the ORUV, LEBV and CGLV genomes is also similar to that of the Culicoides-borne, rather than the mosquito-borne, or tick borne orbiviruses. These data suggest that ORUV and LEBV are Culicoides- rather than mosquito-borne. Multiple isolations of CGLV from sand flies suggest that they are its primary vector. OC1 of the insect-borne orbiviruses is approximately twice the size of the equivalent protein of the tick borne viruses. Together with internal sequence similarities, this suggests its origin by duplication (concatermerisation) of a smaller OC1 from an ancestral tick-borne orbivirus. Phylogenetic comparisons showing linear relationships between the dates of evolutionary-separation of their vector species, and genetic-distances between tick-, mosquito- or Culicoides-borne virus-groups, provide evidence for co-evolution of the orbiviruses with their arthropod vectors. PMID:24475112

Clinical polyomavirus BK variants with agnogene deletion are non-functional but rescued by trans-complementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myhre, Marit Renee; Olsen, Gunn-Hege; Gosert, Rainer

High-level replication of polyomavirus BK (BKV) in kidney transplant recipients is associated with the emergence of BKV variants with rearranged (rr) non-coding control region (NCCR) increasing viral early gene expression and cytopathology. Cloning and sequencing revealed the presence of a BKV quasispecies which included non-functional variants when assayed in a recombinant virus assay. Here we report that the rr-NCCR of BKV variants RH-3 and RH-12, both bearing a NCCR deletion including the 5' end of the agnoprotein coding sequence, mediated early and late viral reporter gene expression in kidney cells. However, in a recombinant virus they failed to produce infectiousmore » progeny despite large T-antigen and VP1 expression and the formation of nuclear virus-like particles. Infectious progeny was generated when the agnogene was reconstructed in cis or agnoprotein provided in trans from a co-existing BKV rr-NCCR variant. We conclude that complementation can rescue non-functional BKV variants in vitro and possibly in vivo.« less

Complete coding regions of the prototypes enterovirus B93 and C95: phylogenetic analyses of the P1 and P3 regions of EV-B and EV-C strains.

PubMed

Junttila, N; Lévêque, N; Magnius, L O; Kabue, J P; Muyembe-Tamfum, J J; Maslin, J; Lina, B; Norder, H

2015-03-01

Complete coding regions were sequenced for two new enterovirus genomes: EV-B93 previously identified by VP1 sequencing, derived from a child with acute flaccid paralysis in the Democratic Republic of Congo; and EV-C95 from a French soldier with acute gastroenteritis in Djibouti. The EV-B93 P1 had more than 30% nucleotide divergence from other EV-B types, with highest similarity to E-15 and EV-B80. The P1 nucleotide sequence of EV-C95 was most similar, 71%, to CV-A21. Complete coding regions for the new enteroviruses were compared with those of 135 EV-B and 176 EV-C strains representing all types available in GenBank. When strains from the same outbreak or strains isolated during the same year in the same geographical region were excluded, 27 of the 58 EV-B, and 16 of the 23 EV-C types were represented by more than one sequence. However, for EV-B the P3 sequences formed three clades mainly according to origin or time of isolation, irrespective of type, while for EV-C the P3 sequences segregated mainly according to disease manifestation, with most strains causing paralysis, including polioviruses, forming one clade, and strains causing respiratory illness forming another. There was no intermixing of types between these two clades, apart from two EV-C96 strains. The EV-B P3 sequences had lower inter-clade and higher intra-clade variability as compared to the EV-C sequences, which may explain why inter-clade recombinations are more frequent in EV-B. Further analysis of more isolates may shed light on the role of recombinations in the evolution of EV-B in geographical context. © 2014 Wiley Periodicals, Inc.

Proposals for the classification of human rhinovirus species A, B and C into genotypically assigned types

PubMed Central

McIntyre, Chloe L.; Knowles, Nick J.

2013-01-01

Human rhinoviruses (HRVs) frequently cause mild upper respiratory tract infections and more severe disease manifestations such as bronchiolitis and asthma exacerbations. HRV is classified into three species within the genus Enterovirus of the family Picornaviridae. HRV species A and B contain 75 and 25 serotypes identified by cross-neutralization assays, although the use of such assays for routine HRV typing is hampered by the large number of serotypes, replacement of virus isolation by molecular methods in HRV diagnosis and the poor or absent replication of HRV species C in cell culture. To address these problems, we propose an alternative, genotypic classification of HRV-based genetic relatedness analogous to that used for enteroviruses. Nucleotide distances between 384 complete VP1 sequences of currently assigned HRV (sero)types identified divergence thresholds of 13, 12 and 13 % for species A, B and C, respectively, that divided inter- and intra-type comparisons. These were paralleled by 10, 9.5 and 10 % thresholds in the larger dataset of >3800 VP4 region sequences. Assignments based on VP1 sequences led to minor revisions of existing type designations (such as the reclassification of serotype pairs, e.g. A8/A95 and A29/A44, as single serotypes) and the designation of new HRV types A101–106, B101–103 and C34–C51. A protocol for assignment and numbering of new HRV types using VP1 sequences and the restriction of VP4 sequence comparisons to type identification and provisional type assignments is proposed. Genotypic assignment and identification of HRV types will be of considerable value in the future investigation of type-associated differences in disease outcomes, transmission and epidemiology. PMID:23677786

Prediction and characterization of novel epitopes of serotype A foot-and-mouth disease viruses circulating in East Africa using site-directed mutagenesis

PubMed Central

Bari, Fufa Dawo; Parida, Satya; Asfor, Amin S.; Haydon, Daniel T.; Reeve, Richard; Paton, David J.

2015-01-01

Epitopes on the surface of the foot-and-mouth disease virus (FMDV) capsid have been identified by monoclonal antibody (mAb) escape mutant studies leading to the designation of four antigenic sites in serotype A FMDV. Previous work focused on viruses isolated mainly from Asia, Europe and Latin America. In this study we report on the prediction of epitopes in African serotype A FMDVs and testing of selected epitopes using reverse genetics. Twenty-four capsid amino acid residues were predicted to be of antigenic significance by analysing the capsid sequences (n = 56) using in silico methods, and six residues by correlating capsid sequence with serum–virus neutralization data. The predicted residues were distributed on the surface-exposed capsid regions, VP1–VP3. The significance of residue changes at eight of the predicted epitopes was tested by site-directed mutagenesis using a cDNA clone resulting in the generation of 12 mutant viruses involving seven sites. The effect of the amino acid substitutions on the antigenic nature of the virus was assessed by virus neutralization (VN) test. Mutations at four different positions, namely VP1-43, VP1-45, VP2-191 and VP3-132, led to significant reduction in VN titre (P value = 0.05, 0.05, 0.001 and 0.05, respectively). This is the first time, to our knowledge, that the antigenic regions encompassing amino acids VP1-43 to -45 (equivalent to antigenic site 3 in serotype O), VP2-191 and VP3-132 have been predicted as epitopes and evaluated serologically for serotype A FMDVs. This identifies novel capsid epitopes of recently circulating serotype A FMDVs in East Africa. PMID:25614587

Hepatitis A Virus Capsid Protein VP1 Has a Heterogeneous C Terminus

PubMed Central

Graff, Judith; Richards, Oliver C.; Swiderek, Kristine M.; Davis, Michael T.; Rusnak, Felicia; Harmon, Shirley A.; Jia, Xi-Yu; Summers, Donald F.; Ehrenfeld, Ellie

1999-01-01

Hepatitis A virus (HAV) encodes a single polyprotein which is posttranslationally processed into the functional structural and nonstructural proteins. Only one protease, viral protease 3C, has been implicated in the nine protein scissions. Processing of the capsid protein precursor region generates a unique intermediate, PX (VP1-2A), which accumulates in infected cells and is assumed to serve as precursor to VP1 found in virions, although the details of this reaction have not been determined. Coexpression in transfected cells of a variety of P1 precursor proteins with viral protease 3C demonstrated efficient production of PX, as well as VP0 and VP3; however, no mature VP1 protein was detected. To identify the C-terminal amino acid residue of HAV VP1, we performed peptide sequence analysis by protease-catalyzed [18O]H2O incorporation followed by liquid chromatography ion-trap microspray tandem mass spectrometry of HAV VP1 isolated from purified virions. Two different cell culture-adapted isolates of HAV, strains HM175pE and HM175p35, were used for these analyses. VP1 preparations from both virus isolates contained heterogeneous C termini. The predominant C-terminal amino acid in both virus preparations was VP1-Ser274, which is located N terminal to a methionine residue in VP1-2A. In addition, the analysis of HM175pE recovered smaller amounts of amino acids VP1-Glu273 and VP1-Thr272. In the case of HM175p35, which contains valine at amino acid position VP1-273, VP1-Thr272 was found in addition to VP1-Ser274. The data suggest that HAV 3C is not the protease responsible for generation of the VP1 C terminus. We propose the involvement of host cell protease(s) in the production of HAV VP1. PMID:10364353

Characterization of full genome sequences of chicken anemia viruses circulating in Egypt reveals distinct genetic diversity and evidence of recombination.

PubMed

Erfan, Ahmed M; Selim, Abdullah A; Naguib, Mahmoud M

2018-06-02

Chicken anemia virus (CAV) is one of the commercially important diseases of poultry worldwide. In Egypt, CAV has been reported to be a potential threat to the commercial poultry sectors. Hence, this study was aimed at isolation and full genomic analysis of CAVs circulating in chicken populations in different geographical location in Egypt. A total of 42 samples were collected from broiler chicken flocks in 9 governorates in Egypt from 12 to 42 days of age. The mortality rate observed among chickens was ranging from 3% to 22%. Nineteen out of 42 farms were found positive for the CAV genome by polymerase chain reaction (PCR). Full genome sequencing was conducted for 18 positive samples. Genetic analysis revealed a high similarity of >99% in 11 viruses with the vaccine strain Del-Ros; while the other seven samples shared close similarity to CAV field strains isolated from China, Taiwan, and Brazil. The data also indicated Q139 and Q144 amino acids substitutions among the VP1 of Egyptian field strains, which are known to be important in virus replication and spread. Phylogenetic analysis of the sequenced viruses (n = 18) based on either the full gene nucleotide sequence or VP1 coding sequence, suggested the circulation of four distinct genotypes in Egypt designated as group A, B, C and D. Moreover, evidence of recombination was detected among four Egyptian CAVs located within group A. The findings of this study succeeded to elucidate the epidemiological and genetic features of CAVs circulating in Egypt, and underscores the important of CAVs surveillance. Copyright © 2018 Elsevier B.V. All rights reserved.

ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

PubMed

Hobo, T; Asada, M; Kowyama, Y; Hattori, T

1999-09-01

ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

Picornavirus proteins share antigenic determinants with heat shock proteins 60/65.

PubMed

Härkönen, T; Puolakkainen, M; Sarvas, M; Airaksinen, U; Hovi, T; Roivainen, M

2000-11-01

Immunological cross-reactions between enteroviruses and islet cell autoantigens have been suggested to play a role in the etiopathogenesis of insulin dependent diabetes mellitus (IDDM). In the nonobese diabetic mouse, an autoimmune model of IDDM, one of the reactive beta cell autoantigens is the heat shock protein 60 (HSP60). These studies were prompted by sequence homology discovered between the immunogenic region in HSP60 and two regions in enterovirus capsid proteins, one in the VP1 protein and the other in the VP0, the precursor of VP2 and VP4 proteins. Possible immunological cross-reactions between enterovirus proteins and heat shock proteins were studied by EIA and immunoblotting by using purified virus preparations, viral expression proteins VP1 and VP0, and recombinant HSP60/65 proteins, and corresponding polyclonal antisera. The HSP60/65 family of proteins is highly conserved and there is a striking degree of homology between bacterial and human heat shock proteins. Rabbit antibodies to HSP65 of Mycobacterium bovis that reacted with human HSP60 were also found to recognise capsid protein VP1 of coxsackievirus A9, VP1, and/or VP2 of coxsackievirus B4. Both viruses were also recognised by antisera raised against HSP60 of Chlamydia pneumoniae. In addition to the capsid proteins derived from native virions, antisera to both bacterial HSP proteins recognised expression protein VP1 of coxsackievirus A9. The cross-reactivity was also demonstrated the other way around; antisera to purified virus particles reacted with the HSP 60/65 proteins to some extent. These results suggest that apart from the well-documented sequence homology between the 2C protein of coxsackieviruses and the beta-cell autoantigen glutamic acid decarboxylase, there are other motifs in picornavirus proteins homologous to islet cell autoantigens, which might induce cross-reacting immune responses during picornavirus infections.

Nucleotide variation in Sabin type 3 poliovirus from an Albanian infant with agammaglobulinemia and vaccine associated poliomyelitis.

PubMed

Foiadelli, Thomas; Savasta, Salvatore; Battistone, Andrea; Kota, Majlinda; Passera, Carolina; Fiore, Stefano; Bino, Silvia; Amato, Concetta; Lozza, Alessandro; Marseglia, Gian Luigi; Fiore, Lucia

2016-06-10

Vaccine-associated paralytic poliomyelitis (VAPP) and immunodeficient long-term polio excretors constitute a significant public health burden and are a major concern for the WHO global polio eradication endgame. Poliovirus type 3 characterized as Sabin-like was isolated from a 5-month-old Albanian child with X-linked agammaglobulinemia and VAPP after oral polio vaccine administration. Diagnostic workup and treatment were performed in Italy. Poliovirus replicated in the gut for 7 months. The 5' non coding region (NCR), VP1, VP3 capsid proteins and the 3D polymerase genomic regions of sequential isolates were sequenced. Increasing accumulation of nucleotide mutations in the VP1 region was detected over time, reaching 1.0 % of genome variation with respect to the Sabin reference strain, which is the threshold that defines a vaccine-derived poliovirus (VDPV). We identified mutations in the 5'NCR and VP3 regions that are associated with reversion to neurovirulence. Despite this, all isolates were characterized as Sabin-like. Several amino acid mutations were identified in the VP1 region, probably involved in growth adaptation and viral persistence in the human gut. Intertypic recombination with Sabin type 2 polio in the 3D polymerase region, possibly associated with increased virus transmissibility, was found in all isolates. Gamma-globulin replacement therapy led to viral clearance and neurological improvement, preventing the occurrence of persistent immunodeficiency-related VDPV. This is the first case of VAPP in an immunodeficient child detected in Albania through the Acute Flaccid Paralysis surveillance system and the first investigated case of vaccine associated poliomyelitis in Italy since the introduction of an all-Salk schedule in 2002. We discuss over the biological and clinical implications in the context of the Global Polio Eradication Program and emphasize on the importance of the Acute Flaccid Paralysis surveillance.

Structural and Functional Characterization of Reston Ebola Virus VP35 Interferon Inhibitory Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leung, Daisy W.; Shabman, Reed S.; Farahbakhsh, Mina

2010-09-21

Ebolaviruses are causative agents of lethal hemorrhagic fever in humans and nonhuman primates. Among the filoviruses characterized thus far, Reston Ebola virus (REBOV) is the only Ebola virus that is nonpathogenic to humans despite the fact that REBOV can cause lethal disease in nonhuman primates. Previous studies also suggest that REBOV is less effective at inhibiting host innate immune responses than Zaire Ebola virus (ZEBOV) or Marburg virus. Virally encoded VP35 protein is critical for immune suppression, but an understanding of the relative contributions of VP35 proteins from REBOV and other filoviruses is currently lacking. In order to address thismore » question, we characterized the REBOV VP35 interferon inhibitory domain (IID) using structural, biochemical, and virological studies. These studies reveal differences in double-stranded RNA binding and interferon inhibition between the two species. These observed differences are likely due to increased stability and loss of flexibility in REBOV VP35 IID, as demonstrated by thermal shift stability assays. Consistent with this finding, the 1.71-{angstrom} crystal structure of REBOV VP35 IID reveals that it is highly similar to that of ZEBOV VP35 IID, with an overall backbone r.m.s.d. of 0.64 {angstrom}, but contains an additional helical element at the linker between the two subdomains of VP35 IID. Mutations near the linker, including swapping sequences between REBOV and ZEBOV, reveal that the linker sequence has limited tolerance for variability. Together with the previously solved ligand-free and double-stranded-RNA-bound forms of ZEBOV VP35 IID structures, our current studies on REBOV VP35 IID reinforce the importance of VP35 in immune suppression. Functional differences observed between REBOV and ZEBOV VP35 proteins may contribute to observed differences in pathogenicity, but these are unlikely to be the major determinant. However, the high level of similarity in structure and the low tolerance for sequence variability, coupled with the multiple critical roles played by Ebola virus VP35 proteins, highlight the viability of VP35 as a potential target for therapeutic development.« less

Structural and functional characterization of Reston Ebola virus VP35 interferon inhibitory domain.

PubMed

Leung, Daisy W; Shabman, Reed S; Farahbakhsh, Mina; Prins, Kathleen C; Borek, Dominika M; Wang, Tianjiao; Mühlberger, Elke; Basler, Christopher F; Amarasinghe, Gaya K

2010-06-11

Ebolaviruses are causative agents of lethal hemorrhagic fever in humans and nonhuman primates. Among the filoviruses characterized thus far, Reston Ebola virus (REBOV) is the only Ebola virus that is nonpathogenic to humans despite the fact that REBOV can cause lethal disease in nonhuman primates. Previous studies also suggest that REBOV is less effective at inhibiting host innate immune responses than Zaire Ebola virus (ZEBOV) or Marburg virus. Virally encoded VP35 protein is critical for immune suppression, but an understanding of the relative contributions of VP35 proteins from REBOV and other filoviruses is currently lacking. In order to address this question, we characterized the REBOV VP35 interferon inhibitory domain (IID) using structural, biochemical, and virological studies. These studies reveal differences in double-stranded RNA binding and interferon inhibition between the two species. These observed differences are likely due to increased stability and loss of flexibility in REBOV VP35 IID, as demonstrated by thermal shift stability assays. Consistent with this finding, the 1.71-A crystal structure of REBOV VP35 IID reveals that it is highly similar to that of ZEBOV VP35 IID, with an overall backbone r.m.s.d. of 0.64 A, but contains an additional helical element at the linker between the two subdomains of VP35 IID. Mutations near the linker, including swapping sequences between REBOV and ZEBOV, reveal that the linker sequence has limited tolerance for variability. Together with the previously solved ligand-free and double-stranded-RNA-bound forms of ZEBOV VP35 IID structures, our current studies on REBOV VP35 IID reinforce the importance of VP35 in immune suppression. Functional differences observed between REBOV and ZEBOV VP35 proteins may contribute to observed differences in pathogenicity, but these are unlikely to be the major determinant. However, the high level of similarity in structure and the low tolerance for sequence variability, coupled with the multiple critical roles played by Ebola virus VP35 proteins, highlight the viability of VP35 as a potential target for therapeutic development. Copyright 2010 Elsevier Ltd. All rights reserved.

Identification of Recombinant Human Rhinovirus A and C in Circulating Strains from Upper and Lower Respiratory Infections

PubMed Central

Kim, Hak; Kim, Kisoon; Kim, Dae-Won; Jung, Hee-Dong; Min Cheong, Hyang; Kim, Ki Hwan; Soo Kim, Dong; Kim, You-Jin

2013-01-01

Human rhinoviruses (HRVs), in the Enterovirus genus within the family Picornaviridae, are a highly prevalent cause of acute respiratory infection (ARI). Enteroviruses are genetically highly variable, and recombination between serotypes is known to be a major contribution to their diversity. Recently it was reported that recombination events in HRVs cause the diversity of HRV-C. This study analyzed parts of the viral genes spanning the 5′ non- coding region (NCR) through to the viral protein (VP) encoding sequences of 105 HRV field isolates from 51 outpatient cases of Acute Respiratory Infectious Network (ARINET) and 54 inpatient cases of severe lower respiratory infection (SLRI) surveillance, in order to identify recombination in field samples. When analyzing parts of the 5′NCR and VP4/VP2 encoding sequences, we found intra- and interspecies recombinants in field strains of HRV-A and -C. Nineteen cases of recombination events (18.1%) were found among 105 field strains. For HRV-A, there were five cases (4.8%) of intraspecies recombination events and three cases (2.8%) of interspecies recombination events. For HRV-C, there were four cases (3.8%) of intraspecies recombination events and seven cases (6.7%) of interspecies recombination events. Recombination events were significantly more frequently observed in the ARINET samples (18 cases) than in the SLRI samples (1 case; P< 0.0001). The recombination breakpoints were located in nucleotides (nt) 472–554, which comprise stem-loop 5 in the internal ribosomal entry site (IRES), based on the HRV-B 35 sequence (accession no. FJ445187). Our findings regarding genomic recombination in circulating HRV-A and -C strains suggest that recombination might play a role in HRV fitness and could be a possible determinant of disease severity caused by various HRV infections in patients with ARI. PMID:23826363

Genomic Analysis of the Chicken Infectious Anemia Virus in a Specific Pathogen-Free Chicken Population in China

PubMed Central

Li, Yang; Wang, Yixin; Fang, Lichun; Fu, Jiayuan; Cui, Shuai; Zhao, Yingjie; Cui, Zhizhong; Chang, Shuang; Zhao, Peng

2016-01-01

The antibody to chicken infectious anemia virus (CIAV) was positive in a specific pathogen-free (SPF) chicken population by ELISA test in our previous inspection, indicating a possible infection with CIAV. In this study, blood samples collected from the SPF chickens were used to isolate CIAV by inoculating into MSB1 cells and PCR amplification. A CIAV strain (SD1403) was isolated and successfully identified. Three overlapping genomic fragments were obtained by PCR amplification and sequencing. The full genome sequence of the SD1403 strain was obtained by aligning the sequences. The genome of the SD1403 strain was 2293 bp with a nucleotide identity of 94.8% to 98.5% when compared with 30 referred CIAV strains. The viral proteins VP2 and VP3 were highly conserved, but VP1 was not relatively conserved. Both amino acids 139 and 144 of VP1 were glutamine, which was in accord with the low pathogenic characteristics. In this study, we first reported that CIAV exists in Chinese SPF chicken populations and may be an important reason why attenuated vaccine can be contaminated with CIAV. PMID:27298822

Genomic Analysis of the Chicken Infectious Anemia Virus in a Specific Pathogen-Free Chicken Population in China.

PubMed

Li, Yang; Wang, Yixin; Fang, Lichun; Fu, Jiayuan; Cui, Shuai; Zhao, Yingjie; Cui, Zhizhong; Chang, Shuang; Zhao, Peng

2016-01-01

The antibody to chicken infectious anemia virus (CIAV) was positive in a specific pathogen-free (SPF) chicken population by ELISA test in our previous inspection, indicating a possible infection with CIAV. In this study, blood samples collected from the SPF chickens were used to isolate CIAV by inoculating into MSB1 cells and PCR amplification. A CIAV strain (SD1403) was isolated and successfully identified. Three overlapping genomic fragments were obtained by PCR amplification and sequencing. The full genome sequence of the SD1403 strain was obtained by aligning the sequences. The genome of the SD1403 strain was 2293 bp with a nucleotide identity of 94.8% to 98.5% when compared with 30 referred CIAV strains. The viral proteins VP2 and VP3 were highly conserved, but VP1 was not relatively conserved. Both amino acids 139 and 144 of VP1 were glutamine, which was in accord with the low pathogenic characteristics. In this study, we first reported that CIAV exists in Chinese SPF chicken populations and may be an important reason why attenuated vaccine can be contaminated with CIAV.

[Study on the etiological and molecular characteristics of aseptic meningitis epidemic in Zhejiang Province in 2002-2004].

PubMed

Yan, Ju-Ying; Lu, Yi-Yu; Xu, Chang-Ping; Yu, Zhao; Gong, Li-Ming; Chen, Yin; Zhang, Yan-Jun

2011-09-01

In order to confirm the cause of the outbreak of aseptic meningitis in Zhejiang Province in 2002-2004, trace the pathogen and analyze the molecular characteristics, 271 cerebrospinal fluid (CSF) and faeces specimens were collected from suspected patients. The virus strains from the specimens were isolated with RD and Hep-2 cell lines. The VP1 and VP4/VP2 genes of the isolated viruses were sequenced, and their phylogenetic and homology trees were also constructed. Of the total 271 samples, 78 Echovirus type 30 (E30) strains were isolated. All of the complete VP1 genes in 31 sequenced virus isolates of E30 were composed of 876 nt without any insertion or deletion, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 84.7%-86.3% and 92.1%-94.2% between the 31 Zhejiang strains and the prototype strain Bastianni of E30, and 87.1%-99.4% and 96.2%-100% among the 31 Zhejiang strains, respectively. The Zhejiang strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. In G genotype, the Shangdong and Jiangsu E30 strains in 2003 among domestic strains and Ukraine E30 strain in 1999 among overseas strains had maximum similarity with the Zhejiang strains, while H genotype had maximum similarity with the Korea E30 strains in 2008. The phylogenetic tree of the VP4/VP2 genes was similar to that of VP1 gene. The results indicated that the outbreak of aseptic meningitis in Zhejiang Provinec in 2002-2004 was caused by the G and H genotypes of E30 strains existing simultaneously. The H genotype was a new variant strain, which was first isolated in Zhejiang Province in 2002.

Detection and sequencing of rotavirus among sudanese children.

PubMed

Magzoub, Magzoub Abbas; Bilal, Naser Eldin; Bilal, Jalal Ali; Alzohairy, Mohammad Abdulrahman; Elamin, Bahaeldin Khalid; Gasim, Gasim Ibrahim

2017-01-01

Diarrheal diseases are a big public health problem worldwide, particularly among developing countries. The current study was conducted to detect and characterize group A rotavirus among admitted children with gastroenteritis to the pediatric hospitals, Sudan. A total of 755 stool samples were collected from Sudanese children with less than 5 years of age presenting with acute gastroenteritis during the period from April to September 2010. Enzyme-linked immunosorbent assay (ELISA) was used to Detection of Rotavirus antigens. Ribonucleic acid (RNAs) were extracted from rotavirus-positive stool samples using (QIAamp ® Viral RNA Mini Kit). (Omniscript ® Reverse Transcription kit) was used to convert RNA to complementary Deoxyribonucleic acid (cDNA). The cDNAs were used as template for detection of VP4-P (P for Protease-sensitive) and VP7-G (G for Glycoprotein) genotyping of Rotavirus using nested PCR and sequencing. Out of the 755 stool samples from children with acute gastroenteritis, 121 were positive for rotavirus A. Among 24 samples that were sequenced; the VP7 predominant G type was G1 (83.3%), followed by G9 (16.7%). Out of these samples, only one VP4 P[8] genotype was detected. As a conclusion the VP7 predominant G type was G1, followed by G9 whereas only one VP4 genotype was detected and showed similarity to P[8] GenBank strain. It appears that the recently approved rotavirus vaccines in Sudan are well matched to the rotavirus genotypes identified in this study, though more studies are needed.

High-yield production of the VP1 structural protein epitope from serotype O foot-and-mouth disease virus in Escherichia coli.

PubMed

Jung, Joon-Goo; Lee, Yong Jae; Velmurugan, Natarajan; Ko, Young-Joon; Lee, Hyang-Sim; Jeong, Ki Jun

2013-07-01

For effective control of foot-and-mouth disease (FMD), the development of rapid diagnostic systems and vaccines are required against its etiological agent, FMD virus (FMDV). To accomplish this, efficient large-scale expression of the FMDV VP1 protein, with high solubility, needs to be optimized. We attempted to produce high levels of a serotype O FMDV VP1 epitope in Escherichia coli. We identified the subtype-independent serotype O FMDV VP1 epitope sequence and used it to construct a glutathione S-transferase (GST) fusion protein. For efficient production of the FMDV VP1 epitope fused to GST (VP1e-GST), four E. coli strains and three temperatures were examined. The conditions yielding the greatest level of VP1e-GST with highest solubility were achieved with E. coli BL21(DE3) at 25 °C. For high-level production, fed-batch cultures were conducted in 5-l bioreactors. When cells were induced at a high density and complex feeding solutions were supplied, approximately 11 g of VP1e-GST was obtained from a 2.9-l culture. Following purification, the VP1 epitope was used to immunize rabbits, and we confirmed that it induced an immune response.

Molecular characterization of the VP1 gene of a Mexican isolate of infectious pancreatic necrosis virus.

PubMed

Barrera-Mejía, Magda; Simón-Martínez, José; Ulloa-Arvizu, Raúl; Salgado-Miranda, Celene; Soriano-Vargas, Edgardo

2010-07-01

The presence of infectious pancreatic necrosis virus (IPNV) in salmonids predominantly produces a high mortality rate in first-feeding fry. Genomic analysis of the vp2 gene sequence is most commonly used to determine the genetic diversity of IPNV isolates. Recently, information obtained from the vp1 gene allowed for efficient analysis of the genetic diversity of IPNV. In this study, the vp1 gene from a Mexican IPNV isolate was characterized and compared with IPNV isolates from Europe, North America, and Asia. The results indicate that the Mexican isolate is most closely related genetically to the 2310 strain from Spain.

Characteristics of an Environmentally Monitored Prolonged Type 2 Vaccine Derived Poliovirus Shedding Episode that Stopped without Intervention

PubMed Central

Hovi, Tapani; Paananen, Anja; Blomqvist, Soile; Savolainen-Kopra, Carita; Al-Hello, Haider; Smura, Teemu; Shimizu, Hiroyuki; Nadova, Katarina; Sobotova, Zdenka; Gavrilin, Eugene; Roivainen, Merja

2013-01-01

Vaccine derived poliovirus (VDPV) type 2 strains strongly divergent from the corresponding vaccine strain, Sabin 2, were repeatedly isolated from sewage in Slovakia over a period of 22 months in 2003–2005. Cell cultures of stool specimens from known immune deficient patients and from an identified putative source population of 500 people failed to identify the potential excretor(s) of the virus. The occurrence of VDPV in sewage stopped without any intervention. No paralytic cases were reported in Slovakia during the episode. According to a GenBank search and similarity plotting-analysis, the closest known relative of the first isolate PV2/03/SVK/E783 through all main sections of the genome was the type 2 poliovirus Sabin strain, with nucleotide identities in 5′UTR, P1, P2, P3, and 3′UTR parts of the genome of 88.6, 85.9, 87.3, 88.5, and 94.0 percent, respectively. Phenotypic properties of selected Slovakian aVDPV strains resembled those of VDPV strains isolated from immune deficient individuals with prolonged PV infection (iVDPV), including antigenic changes and moderate neurovirulence in the transgenic mouse model. One hundred and two unique VP1 coding sequences were determined from VDPV strains isolated from 34 sewage specimens. Nucleotide differences from Sabin 2 in the VP1 coding region ranged from 12.5 to 15.6 percent, and reached a maximum of 9.6 percent between the VDPV strains under study. Most of the nucleotide substitutions were synonymous but as many as 93 amino acid positions out of 301 in VP1 showed substitutions. We conclude that (1) individuals with prolonged poliovirus infection are not as rare as suggested by the studies on immune deficient patients known to the health care systems and (2) genetic divergence of VDPV strains may remain extensive during years long replication in humans. PMID:23935826

Expression and responses to dehydration and salinity stresses of V-PPase gene members in wheat.

PubMed

Wang, Yuezhi; Xu, Haibin; Zhang, Guangxiang; Zhu, Huilan; Zhang, Lixia; Zhang, Zhengzhi; Zhang, Caiqin; Ma, Zhengqiang

2009-12-01

Vacuolar H(+)-translocating pyrophosphatase (V-PPase) is a key enzyme related to plant growth as well as abiotic stress tolerance. In this work, wheat V-PPase genes TaVP1, TaVP2 and TaVP3 were identified. TaVP1 and TaVP2 are more similar to each other than to TaVP3. Their deduced polypeptide sequences preserve the topological structure and essential residues of V-PPases. Phylogenetic studies suggested that monocot plants, at least monocot grasses, have three VP paralogs. TaVP3 transcripts were only detected in developing seeds, and no TaVP2 transcripts were found in germinating seeds. TaVP2 was mainly expressed in shoot tissues and down-regulated in leaves under dehydration. Its expression was up-regulated in roots under high salinity. TaVP1 was relatively more ubiquitously and evenly expressed than TaVP2. Its expression level in roots was highest among the tissues examined, and was inducible by salinity stress. These results indicated that the V-PPase gene paralogs in wheat are differentially regulated spatially and in response to dehydration and salinity stresses. 2009 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Porcine parvovirus: DNA sequence and genome organization.

PubMed

Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

1989-10-01

We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

First genetic characterization of rotavirus C in Russia.

PubMed

Zhirakovskaia, Elena; Tikunov, Artem; Klemesheva, Vera; Loginovskikh, Natalia; Netesov, Sergey; Tikunova, Nina

2016-04-01

Rotaviruses C (RVC) cause sporadic cases and outbreaks of diarrhea in humans and animals worldwide. The aim of this study was to monitor RVC during a surveillance study of sporadic cases of viral gastroenteritis in the Novosibirsk and Omsk regions of Russia from 2006 to 2011. A total of 2144 stool samples from children and adults hospitalized with acute gastroenteritis were tested for RVC by RT-PCR. Sixteen RVC-positive stool samples were detected at a rate of 0.6% (13/2037) in children and 2.8% (3/107) in adults. The low detection rate suggested that RVC infection was an uncommon cause of hospitalization in Russia. The complete VP7, VP4, VP6, and NSP4 gene sequences were determined. It was found that RVCs with at least two different genome backgrounds circulated in Siberia. VP4, VP6, and NSP4 gene sequences of most Russian RVC strains clustered with South Asian strains, while the VP7 gene showed a closer relationship to European strains. Meanwhile, only VP4 and NSP4 sequences of the strain Omsk08-386 clustered with South Asian strains, while its VP6 and VP7 sequences clustered with European strains. This is the first genetic characterization of Russian RVC strains and the first report on the prevalence of RVC in the Asian part of Russia. Copyright © 2016 Elsevier B.V. All rights reserved.

Sequence analysis of VP7 and VP4 genes of G1P[8] rotaviruses circulating among diarrhoeic children in Pune, India: a comparison with Rotarix and RotaTeq vaccine strains.

PubMed

Kulkarni, Ruta; Arora, Ritu; Arora, Rashmi; Chitambar, Shobha D

2014-08-11

The G1P[8] rotaviruses are a common cause of rotavirus diarrhoea among children in India. Two rotavirus vaccines licensed in India, Rotarix and RotaTeq, contain strains with G1 and P[8] genotypes. A comparative analysis of these genotypes in the live rotavirus vaccines with circulating rotavirus strains is essential for assessment of rotavirus diversity. G1P[8] strains detected during rotavirus surveillance among diarrhoeic children hospitalized in Pune in 1992-1993 and 2006-2008, were included in the study. Amplification, sequencing and phylogenetic analysis of the VP7 and VP4 genes were carried out for identification of the G1 and P[8] lineages, respectively. Antigenic epitopes of VP7 and VP4 encoded proteins were compared to determine the differences between the G1P[8] strains from Pune and the vaccine strains. G1-Lineage 1, P[8]-Lineage 3 strains were predominant in Pune during 1992-1993 and 2006-2008. Strains of G1-Lineage 2, P[8]-Lineage 3 and G1-Lineage 1, P[8]-Lineage 4 were detected at low levels during 2006-2008. The G1-Lineage 1, P[8]-Lineage 3 strains showed up to eight amino acid changes, each in the VP7 and VP4 epitopes, with respect to the Rotarix vaccine strain (G1-Lineage 2, P[8]-Lineage 1) and the G1 (Lineage-3) and P[8] (Lineage 2) components of the RotaTeq vaccine. The G1-Lineage 2 strains were closer to both vaccine strains with no or only two amino acid substitutions in the VP7 epitopes. The divergent P[8]-Lineage 4 (OP354-like) strains showed fourteen and fifteen amino acid differences, with Rotarix and RotaTeq vaccine strains, respectively, in the VP4 epitopes. The differences between the G1P[8] strains in Pune and the G1 and P[8] components of the vaccine strains need to be described for appropriate evaluation of vaccine shedding. Continuous monitoring of the G1P[8] subgenotypic lineages would be necessary to study any long term impact of vaccine use on G1P[8] strain evolution. Copyright © 2014. Published by Elsevier Ltd.

Joint inversion for Vp, Vs, and Vp/Vs at SAFOD, Parkfield, California

USGS Publications Warehouse

Zhang, H.; Thurber, C.; Bedrosian, P.

2009-01-01

We refined the three-dimensional (3-D) Vp, Vs and Vp/Vs models around the San Andreas Fault Observatory at Depth (SAFOD) site using a new double-difference (DD) seismic tomography code (tomoDDPS) that simultaneously solves for earthquake locations and all three velocity models using both absolute and differential P, S, and S-P times. This new method is able to provide a more robust Vp/Vs model than that from the original DD tomography code (tomoDD), obtained simply by dividing Vp by Vs. For the new inversion, waveform cross-correlation times for earthquakes from 2001 to 2002 were also used, in addition to arrival times from earthquakes and explosions in the region. The Vp values extracted from the model along the SAFOD trajectory match well with the borehole log data, providing in situ confirmation of our results. Similar to previous tomographic studies, the 3-D structure around Parkfield is dominated by the velocity contrast across the San Andreas Fault (SAF). In both the Vp and Vs models, there is a clear low-velocity zone as deep as 7 km along the SAF trace, compatible with the findings from fault zone guided waves. There is a high Vp/Vs anomaly zone on the southwest side of the SAF trace that is about 1-2 km wide and extends as deep as 4 km, which is interpreted to be due to fluids and fractures in the package of sedimentary rocks abutting the Salinian basement rock to the southwest. The relocated earthquakes align beneath the northeast edge of this high Vp/Vs zone. We carried out a 2-D correlation analysis for an existing resistivity model and the corresponding profiles through our model, yielding a classification that distinguishes several major lithologies. ?? 2009 by the American Geophysical Union.

Maturation of the Hepatitis A Virus Capsid Protein VP1 Is Not Dependent on Processing by the 3Cpro Proteinase

PubMed Central

Martin, Annette; Bénichou, Danièle; Chao, Shih-Fong; Cohen, Lisette M.; Lemon, Stanley M.

1999-01-01

Most details of the processing of the hepatitis A virus (HAV) polyprotein are known. Unique among members of the family Picornaviridae, the primary cleavage of the HAV polyprotein is mediated by 3Cpro, the only proteinase known to be encoded by the virus, at the 2A/2B junction. All other cleavages of the polyprotein have been considered to be due to 3Cpro, although the precise location and mechanism responsible for the VP1/2A cleavage have been controversial. Here we present data that argue strongly against the involvement of the HAV 3Cpro proteinase in the maturation of VP1 from its VP1-2A precursor. Using a heterologous expression system based on recombinant vaccinia viruses directing the expression of full-length or truncated capsid protein precursors, we show that the C terminus of the mature VP1 capsid protein is located near residue 764 of the polyprotein. However, a proteolytically active HAV 3Cpro that was capable of directing both VP0/VP3 and VP3/VP1 cleavages in vaccinia virus-infected cells failed to process the VP1-2A precursor. Using site-directed mutagenesis of an infectious molecular clone of HAV, we modified potential VP1/2A cleavage sites that fit known 3Cpro recognition criteria and found that a substitution that ablates the presumed 3Cpro dipeptide recognition sequence at Glu764-Ser765 abolished neither infectivity nor normal VP1 maturation. Altered electrophoretic mobility of VP1 from a viable mutant virus with an Arg764 substitution indicated that this residue is present in VP1 and that the VP1/2A cleavage occurs downstream of this residue. These data indicate that maturation of the HAV VP1 capsid protein is not dependent on 3Cpro processing and may thus be uniquely dependent on a cellular proteinase. PMID:10400711

Sequence analysis of the GP, NP, VP40 and VP24 genes of Ebola virus isolated from deceased, surviving and asymptomatically infected individuals during the 1996 outbreak in Gabon: comparative studies and phylogenetic characterization.

PubMed

Leroy, Eric M; Baize, Sylvain; Mavoungou, Elie; Apetrei, Cristian

2002-01-01

The aims of this study were to determine if the clinical outcome of Ebola virus (EBOV) infection is associated with virus genetic structure and to document the genetic changes in the Gabon strains of EBOV by sequencing the GP, NP, VP40 and VP24 genes from deceased and surviving symptomatic and asymptomatic individuals. GP and NP sequences were identical in the three groups of patients and only one silent substitution occurred in the VP40 and VP24 genes in asymptomatic individuals. A strain from an asymptomatic individual had a reverse substitution to the Gabon-94 sequence, indicating that minor virus variants may cocirculate during an outbreak. These results suggest that the different clinical outcomes of EBOV infection do not result from virus mutations. Phylogenetic analysis confirmed that Gabon-96 belonged to the Zaire subtype of EBOV and revealed that synonymous substitution rates were higher than nonsynonymous substitution rates in the GP, VP40 and VP24 genes. In contrast, nonsynonymous substitutions predominated over synonymous substitutions in the NP gene of the two Gabon strains, pointing to divergent evolution of these strains and to selective pressures on this gene.

Abscisic acid and stress signals induce Viviparous1 expression in seed and vegetative tissues of maize.

PubMed

Cao, Xueyuan; Costa, Liliana M; Biderre-Petit, Corinne; Kbhaya, Bouchab; Dey, Nrisingha; Perez, Pascual; McCarty, Donald R; Gutierrez-Marcos, Jose F; Becraft, Philip W

2007-02-01

Viviparous1 (Vp1) encodes a B3 domain-containing transcription factor that is a key regulator of seed maturation in maize (Zea mays). However, the mechanisms of Vp1 regulation are not well understood. To examine physiological factors that may regulate Vp1 expression, transcript levels were monitored in maturing embryos placed in culture under different conditions. Expression of Vp1 decreased after culture in hormone-free medium, but was induced by salinity or osmotic stress. Application of exogenous abscisic acid (ABA) also induced transcript levels within 1 h in a dose-dependent manner. The Vp1 promoter fused to beta-glucuronidase or green fluorescent protein reproduced the endogenous Vp1 expression patterns in transgenic maize plants and also revealed previously unknown expression domains of Vp1. The Vp1 promoter is active in the embryo and aleurone cells of developing seeds and, upon drought stress, was also found in phloem cells of vegetative tissues, including cobs, leaves, and stems. Sequence analysis of the Vp1 promoter identified a potential ABA-responsive complex, consisting of an ACGT-containing ABA response element (ABRE) and a coupling element 1-like motif. Electrophoretic mobility shift assay confirmed that the ABRE and putative coupling element 1 components specifically bound proteins in embryo nuclear protein extracts. Treatment of embryos in hormone-free Murashige and Skoog medium blocked the ABRE-protein interaction, whereas exogenous ABA or mannitol treatment restored this interaction. Our data support a model for a VP1-dependent positive feedback mechanism regulating Vp1 expression during seed maturation.

In Vitro Evolution and Affinity-Maturation with Coliphage Qβ Display

PubMed Central

Skamel, Claudia; Aller, Stephen G.; Bopda Waffo, Alain

2014-01-01

The Escherichia coli bacteriophage, Qβ (Coliphage Qβ), offers a favorable alternative to M13 for in vitro evolution of displayed peptides and proteins due to high mutagenesis rates in Qβ RNA replication that better simulate the affinity maturation processes of the immune response. We describe a benchtop in vitro evolution system using Qβ display of the VP1 G-H loop peptide of foot-and-mouth disease virus (FMDV). DNA encoding the G-H loop was fused to the A1 minor coat protein of Qβ resulting in a replication-competent hybrid phage that efficiently displayed the FMDV peptide. The surface-localized FMDV VP1 G-H loop cross-reacted with the anti-FMDV monoclonal antibody (mAb) SD6 and was found to decorate the corners of the Qβ icosahedral shell by electron microscopy. Evolution of Qβ-displayed peptides, starting from fully degenerate coding sequences corresponding to the immunodominant region of VP1, allowed rapid in vitro affinity maturation to SD6 mAb. Qβ selected under evolutionary pressure revealed a non-canonical, but essential epitope for mAb SD6 recognition consisting of an Arg-Gly tandem pair. Finally, the selected hybrid phages induced polyclonal antibodies in guinea pigs with good affinity to both FMDV and hybrid Qβ-G-H loop, validating the requirement of the tandem pair epitope. Qβ-display emerges as a novel framework for rapid in vitro evolution with affinity-maturation to molecular targets. PMID:25393763

Identification of a T-helper cell epitope on the rotavirus VP6 protein.

PubMed Central

Baños, D M; Lopez, S; Arias, C F; Esquivel, F R

1997-01-01

In this work, we have studied the T-helper (Th)-cell response against rotavirus, in a mouse model. Adult BALB/c mice were inoculated parenterally with porcine rotavirus YM, and the Th-cell response from spleen cells against the virus and two overlapping fragments of the major capsid protein VP6 (VP6(1-192) and VP6(171-397)) were evaluated in vitro. The Th cells recognized the YM virus and the two protein fragments, suggesting that there are at least two Th-cell epitopes on the VP6 molecule. To study the specificity of Th cells against VP6 at the clonal level, we established two Th-cell hybridomas cross-reactive for the VP6 protein of rotavirus strains YM and SA11. Both hybridomas recognized the VP6(171-397) polypeptide, and a synthetic peptide comprising the amino acids 289 to 302 (RLSFQLVRPPNMTP) of YM VP6 in the context of the major histocompatibility complex class II IEd molecule. The Th-cell hybridomas recognized rotavirus VP6 in a highly cross-reactive fashion, since they could be stimulated by eight different strains of rotavirus, including the murine rotavirus EDIM, that represent five G serotypes and at least two subgroups. The amino acid sequence of the VP6 epitope is highly conserved in most group A rotavirus strains sequenced so far. On the other hand, it was found that Th cells specific for the VP6 epitope may constitute an important proportion of the total polyclonal Th-cell response against rotavirus YM in spleen cells. These results demonstrate that VP6 can be a target for highly cross-reactive Th cells. PMID:8985366

Expression of a foot-and-mouth disease virus immunodominant epitope by a filamentous bacteriophage vector.

PubMed

Kim, Y J; Lebreton, F; Kaiser, C; Crucière, C; Rémond, M

2004-02-01

We described the construction of a recombinant filamentous phage displaying on its surface the immunodominant site of VP1 protein of foot-and-mouth disease virus (FMDV). The coding sequence was inserted at the amino-terminus of the major coat protein pVIII via a spacer. The hybrid phage proved to be antigenic as it was recognized by polyclonal and monoclonal anti FMDV sera. In two experiments involving immunisation of guinea-pigs with the recombinant phage, a low antibody response was generated. This suggests a possible role for phage displayed peptides in inducing anti FMDV immunity and the possibility of further development is discussed.

Cloned Viral Protein Vaccine for Foot-and-Mouth Disease: Responses in Cattle and Swine

NASA Astrophysics Data System (ADS)

Kleid, Dennis G.; Yansura, Daniel; Small, Barbara; Dowbenko, Donald; Moore, Douglas M.; Grubman, Marvin J.; McKercher, Peter D.; Morgan, Donald O.; Robertson, Betty H.; Bachrach, Howard L.

1981-12-01

A DNA sequence coding for the immunogenic capsid protein VP3 of foot-and-mouth disease virus A12, prepared from the virion RNA, was ligated to a plasmid designed to express a chimeric protein from the Escherichia coli tryptophan promoter-operator system. When Escherichia coli transformed with this plasmid was grown in tryptophan-depleted media, approximately 17 percent of the total cellular protein was found to be an insoluble and stable chimeric protein. The purified chimeric protein competed equally on a molar basis with VP3 for specific antibodies to foot-and-mouth disease virus. When inoculated into six cattle and two swine, this protein elicited high levels of neutralizing antibody and protection against challenge with foot-and-mouth disease virus.

Structure and transcription of the Helicoverpa armigera densovirus (HaDV2) genome and its expression strategy in LD652 cells.

PubMed

Xu, Pengjun; Graham, Robert I; Wilson, Kenneth; Wu, Kongming

2017-02-07

Densoviruses (DVs) are highly pathogenic to their hosts. However, we previously reported a mutualistic DV (HaDV2). Very little was known about the characteristics of this virus, so herein we undertook a series of experiments to explore the molecular biology of HaDV2 further. Phylogenetic analysis showed that HaDV2 was similar to members of the genus Iteradensovirus. However, compared to current members of the genus Iteradensovirus, the sequence identity of HaDV2 is less than 44% at the nucleotide-level, and lower than 36, 28 and 19% at the amino-acid-level of VP, NS1 and NS2 proteins, respectively. Moreover, NS1 and NS2 proteins from HaDV2 were smaller than those from other iteradensoviruses due to their shorter N-terminal sequences. Two transcripts of about 2.2 kb coding for the NS proteins and the VP proteins were identified by Northern Blot and RACE analysis. Using specific anti-NS1 and anti-NS2 antibodies, Western Blot analysis revealed a 78 kDa and a 48 kDa protein, respectively. Finally, the localization of both NS1 and NS2 proteins within the cell nucleus was determined by using Green Fluorescent Protein (GFP) labelling. The genome organization, terminal hairpin structure, transcription and expression strategies as well as the mutualistic relationship with its host, suggested that HaDV2 was a novel member of the genus Iteradensovirus within the subfamily Densovirinae.

A coevolution analysis for identifying protein-protein interactions by Fourier transform.

PubMed

Yin, Changchuan; Yau, Stephen S-T

2017-01-01

Protein-protein interactions (PPIs) play key roles in life processes, such as signal transduction, transcription regulations, and immune response, etc. Identification of PPIs enables better understanding of the functional networks within a cell. Common experimental methods for identifying PPIs are time consuming and expensive. However, recent developments in computational approaches for inferring PPIs from protein sequences based on coevolution theory avoid these problems. In the coevolution theory model, interacted proteins may show coevolutionary mutations and have similar phylogenetic trees. The existing coevolution methods depend on multiple sequence alignments (MSA); however, the MSA-based coevolution methods often produce high false positive interactions. In this paper, we present a computational method using an alignment-free approach to accurately detect PPIs and reduce false positives. In the method, protein sequences are numerically represented by biochemical properties of amino acids, which reflect the structural and functional differences of proteins. Fourier transform is applied to the numerical representation of protein sequences to capture the dissimilarities of protein sequences in biophysical context. The method is assessed for predicting PPIs in Ebola virus. The results indicate strong coevolution between the protein pairs (NP-VP24, NP-VP30, NP-VP40, VP24-VP30, VP24-VP40, and VP30-VP40). The method is also validated for PPIs in influenza and E.coli genomes. Since our method can reduce false positive and increase the specificity of PPI prediction, it offers an effective tool to understand mechanisms of disease pathogens and find potential targets for drug design. The Python programs in this study are available to public at URL (https://github.com/cyinbox/PPI).

A coevolution analysis for identifying protein-protein interactions by Fourier transform

PubMed Central

Yin, Changchuan; Yau, Stephen S. -T.

2017-01-01

Protein-protein interactions (PPIs) play key roles in life processes, such as signal transduction, transcription regulations, and immune response, etc. Identification of PPIs enables better understanding of the functional networks within a cell. Common experimental methods for identifying PPIs are time consuming and expensive. However, recent developments in computational approaches for inferring PPIs from protein sequences based on coevolution theory avoid these problems. In the coevolution theory model, interacted proteins may show coevolutionary mutations and have similar phylogenetic trees. The existing coevolution methods depend on multiple sequence alignments (MSA); however, the MSA-based coevolution methods often produce high false positive interactions. In this paper, we present a computational method using an alignment-free approach to accurately detect PPIs and reduce false positives. In the method, protein sequences are numerically represented by biochemical properties of amino acids, which reflect the structural and functional differences of proteins. Fourier transform is applied to the numerical representation of protein sequences to capture the dissimilarities of protein sequences in biophysical context. The method is assessed for predicting PPIs in Ebola virus. The results indicate strong coevolution between the protein pairs (NP-VP24, NP-VP30, NP-VP40, VP24-VP30, VP24-VP40, and VP30-VP40). The method is also validated for PPIs in influenza and E.coli genomes. Since our method can reduce false positive and increase the specificity of PPI prediction, it offers an effective tool to understand mechanisms of disease pathogens and find potential targets for drug design. The Python programs in this study are available to public at URL (https://github.com/cyinbox/PPI). PMID:28430779

Synthetic peptides for the immunodiagnosis of hepatitis A virus infection.

PubMed

Gauna, A; Losada, S; Lorenzo, M; Bermúdez, H; Toledo, M; Pérez, H; Chacón, E; Noya, O

2015-12-01

VP1, VP2 and VP3 molecules of hepatitis A virus are exposed capsid proteins that have shown to be antigenic and are used for diagnosis in recombinant-antigen commercial kits. In this study, we developed a sequence analysis in order to predict diagnostic peptide epitopes, followed by their spot synthesis on functionalized cellulose paper (Pepscan). This paper with synthetic peptides was tested against a sera pool of hepatitis A patients. Two peptide sequences, that have shown an antigenic recognition, were selected for greater scale synthesis on resin. A dimeric form of one of these peptides (IMT-1996), located in the C-Terminus region of protein VP1, was antigenic with a recognition frequency of 87-100% of anti-IgG antibodies and 100% of anti-IgM antibodies employing the immunological assays MABA and ELISA. We propose peptide IMT-1996, with less than twenty residues, as a cheaper alternative for prevalence studies and diagnosis of hepatitis A infection. Copyright © 2015 Elsevier B.V. All rights reserved.

Structures of the major capsid proteins of the human Karolinska Institutet and Washington University polyomaviruses.

PubMed

Neu, Ursula; Wang, Jianbo; Macejak, Dennis; Garcea, Robert L; Stehle, Thilo

2011-07-01

The Karolinska Institutet and Washington University polyomaviruses (KIPyV and WUPyV, respectively) are recently discovered human viruses that infect the respiratory tract. Although they have not yet been linked to disease, they are prevalent in populations worldwide, with initial infection occurring in early childhood. Polyomavirus capsids consist of 72 pentamers of the major capsid protein viral protein 1 (VP1), which determines antigenicity and receptor specificity. The WUPyV and KIPyV VP1 proteins are distant in evolution from VP1 proteins of known structure such as simian virus 40 or murine polyomavirus. We present here the crystal structures of unassembled recombinant WUPyV and KIPyV VP1 pentamers at resolutions of 2.9 and 2.55 Å, respectively. The WUPyV and KIPyV VP1 core structures fold into the same β-sandwich that is a hallmark of all polyomavirus VP1 proteins crystallized to date. However, differences in sequence translate into profoundly different surface loop structures in KIPyV and WUPyV VP1 proteins. Such loop structures have not been observed for other polyomaviruses, and they provide initial clues about the possible interactions of these viruses with cell surface receptors.

First study conducted in Northern India that identifies group C rotavirus as the etiological agent of severe diarrhea in children in Delhi.

PubMed

Tiku, Vasundhara Razdan; Jiang, Baoming; Kumar, Praveen; Aneja, Satender; Bagga, Arvind; Bhan, Maharaj Kishen; Ray, Pratima

2017-05-30

Group C Rotavirus (RVC) is an enteric pathogen responsible for acute gastroenteritis in children and adults globally. At present there are no surveillance studies on group C Rotaviruses in India and therefore their prevalence in India remains unknown. The present study aimed to evaluate group C rotavirus infection among <5 years old children hospitalized with acute gastroenteritis in New Delhi. A total of 350 fecal specimens were collected during September 2013 to November 2014 from <5 years old diarrheal patients admitted at KSCH hospital, Delhi. The samples found negative for group A rotavirus (N = 180) by Enzyme immunoassay were screened for group C rotavirus by RT-PCR with VP6, VP7 and VP4 gene specific primers. The PCR products were further sequenced (VP6, VP7, VP4) and analyzed to ascertain their origin and G and P genotypes. Six out of 180 (group A rotavirus negative) samples were found positive for group C rotavirus by VP6 gene specific RT-PCR, of which 3 were also found positive for VP7 and VP4 genes. Phylogenetic analysis of VP7 and VP4 genes of these showed them to be G4 and P[2] genotypes. Overall, the nucleotide sequence data (VP6, VP7 and VP4) revealed a close relationship with the human group C rotavirus with no evidence of animal ancestry. Interestingly, the nucleotide sequence analysis of various genes also indicated differences in their origin. While the identity matrix of VP4 gene (n = 3) showed high amino acid sequence identity (97.60 to 98.20%) with Korean strain, the VP6 gene (n = 6) showed maximum identity with Nigerian strain (96.40 to 97.60%) and VP7 gene (n = 3) with Bangladeshi and USA strains. This is true for all analyzed samples. Our study demonstrated the group C rotavirus as the cause of severe diarrhea in young children in Delhi and provides insights on the origin of group C rotavirus genes among the local strains indicating their source of transmission. Our study also highlights the need for a simple and reliable diagnostic test that can be utilized to determine the disease burden due to group C rotavirus in India.

Evolutionary phylodynamics of foot-and-mouth disease virus serotypes O and A circulating in Vietnam.

PubMed

Le, Van Phan; Vu, Thi Thu Hang; Duong, Hong-Quan; Than, Van Thai; Song, Daesub

2016-11-29

Foot-and-mouth disease virus (FMDV) is one of the highest risk factors that affects the animal industry of the country. The virus causes production loss and high ratio mortality in young cloven-hoofed animals in Vietnam. The VP1 coding gene of 80 FMDV samples (66 samples of the serotype O and 14 samples of the serotype A) collected from endemic outbreaks during 2006-2014 were analyzed to investigate their phylogeny and genetic relationship with other available FMDVs globally. Phylogenetic analysis indicated that the serotype O strains were clustered into two distinct viral topotypes (the SEA and ME-SA), while the serotype A strains were all clustered into the genotype IX. Among the study strains, the amino acid sequence identities were shared at a level of 90.1-100, 92.9-100, and 92.8-100% for the topotypes SEA, ME-SA, and genotype IX, respectively. Substitutions leading to changes in the amino acid sequence, which are critical for the VP1 antigenic sites were also identified. Our results showed that the studied strains are most closely related to the recent FMDV isolates from Southeast Asian countries (Myanmar, Thailand, Cambodia, Malaysia, and Laos), but are distinct from the earlier FMDV isolates within the genotypes. This study provides important evidence of recent movement of FMDVs serotype O and A into Vietnam within the last decade and their genetic accumulation to be closely related to strains causing FMD in surrounding countries.

Molecular characterization of two rare human G8P[14] rotavirus strains, detected in Italy in 2012.

PubMed

Delogu, Roberto; Ianiro, Giovanni; Morea, Anna; Chironna, Maria; Fiore, Lucia; Ruggeri, Franco M

2016-10-01

Since 2007, the Italian Rotavirus Surveillance Program (RotaNet-Italy) has monitored the diversity and distribution of genotypes identified in children hospitalized with rotavirus acute gastroenteritis. We report the genomic characterization of two rare human G8P[14] rotavirus strains, identified in two children hospitalized with acute gastroenteritis in the southern Italian region of Apulia during rotavirus strain surveillance in 2012. Both strains showed a G8-P[14]-I2-R2-C2-M2-A11-N2-T6-E2-H3 genomic constellation (DS-1-like genomic background). Phylogenetic analysis of each genome segment revealed a mixed configuration of genes of animal and zoonotic human origin, indicating that genetic reassortment events generated these unusual human strains. Eight out of 11 genes (VP1, VP2, VP3, VP6, VP7, NSP3, NSP4 and NSP5) of the Italian G8P[14] strains exhibited close identity with a Spanish sheep strain, whereas the remaining genes (VP4, NSP1 and NSP2) were more closely related to human strains. The amino acid sequences of the antigenic regions of outer capsid proteins VP4 and VP7 were compared with vaccine and field strains, showing high conservation between the amino acid sequences of Apulia G8P[14] strains and human and animal strains bearing G8 and/or P[14] proteins, and revealing many substitutions with respect to the RotaTeq™ and Rotarix™ vaccine strains. Conversely, the amino acid analysis of the four antigenic sites of VP6 revealed a high degree of conservation between the two Apulia strains and the human and animal strains analyzed. These results reinforce the potential role of interspecies transmission and reassortment in generating novel rotavirus strains that might not be fully contrasted by current vaccines. Copyright © 2016 Elsevier B.V. All rights reserved.

Zooanthroponotic transmission of rotavirus in Haryana State of Northern India.

PubMed

Choudhary, P; Minakshi, P; Ranjan, K; Basanti, B

Rotaviruses are the major cause of severe gastroenteritis and mortality in young children and animals. Due to segmented nature of dsRNA genome and wide host range, vast genetic and antigenic diversity exists amongst different isolates of rotaviruses. A total of 230 fecal ovine and caprine samples collected from organized farms and villages in Haryana were screened for rotavirus detection. Samples were screened by latex agglutination test and RNA-PAGE followed by RT-PCR and nucleic acid sequencing. The latex agglutination test showed 25 newborn lamb and 4 kid fecal samples positive for rotavirus. However, RNA-PAGE showed only 9 lamb fecal samples positive for rotavirus. All the samples were subjected to RT-PCR employing vp4 and vp7 gene specific primers of group A rotavirus of ovine, bovine and human origin. Only two samples from lamb (Sheep18/Hisar/2013 and Sheep22/Hisar/2013) showed vp4 and vp7 gene specific amplification with human group A rotavirus (GAR) specific primer. However, they did not show any amplification with ovine and bovine rotavirus specific primers. The nucleotide as well as deduced amino acid sequence analysis of vp4 gene of these isolates showed >98/97% and vp7 gene >95/94% nt/aa identity with human GAR from different regions of the world. Based on nucleotide similarity search, Sheep18/Hisar/2013 and Sheep22/Hisar/2013 isolates were genotyped as G1P[8] and G1P[4]. Phylogenetic analysis also confirmed that these isolates were clustered closely with human rotaviruses from different regions of the world. Earlier, higher prevalence of human rotaviruses was reported from the sample collecting area. The amplification of ovine samples with human rotavirus gene specific primers, sequence identity and phylogenetic analysis strongly suggests the zoonotic transmission of human GAR to sheep.

Identification of amino acid sequences in the polyomavirus capsid proteins that serve as nuclear localization signals

NASA Technical Reports Server (NTRS)

Chang, D.; Haynes, J. I. Jr; Brady, J. N.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

The molecular mechanism participating in the transport of newly synthesized proteins from the cytoplasm to the nucleus in mammalian cells is poorly understood. Recently, the nuclear localization signal sequences (NLS) of many nuclear proteins have been identified, and most have been found to be composed of a highly basic amino acid stretch. A genetic "subtractive" and a biochemical "additive" approach were used in our studies to identify the NLS's of the polyomavirus structural capsid proteins. An NLS was identified at the N-terminus (Ala1-Pro-Lys-Arg-Lys-Ser-Gly-Val-Ser-Lys-Cys11) of the major capsid protein VP1 and at the C-terminus (Glu307 -Glu-Asp-Gly-Pro-Glu-Lys-Lys-Lys-Arg-Arg-Leu318) of the VP2/VP3 minor capsid proteins.

Termination and read-through proteins encoded by genome segment 9 of Colorado tick fever virus.

PubMed

Mohd Jaafar, Fauziah; Attoui, Houssam; De Micco, Philippe; De Lamballerie, Xavier

2004-08-01

Genome segment 9 (Seg-9) of Colorado tick fever virus (CTFV) is 1884 bp long and contains a large open reading frame (ORF; 1845 nt in length overall), although a single in-frame stop codon (at nt 1052-1054) reduces the ORF coding capacity by approximately 40 %. However, analyses of highly conserved RNA sequences in the vicinity of the stop codon indicate that it belongs to a class of 'leaky terminators'. The third nucleotide positions in codons situated both before and after the stop codon, shows the highest variability, suggesting that both regions are translated during virus replication. This also suggests that the stop signal is functionally leaky, allowing read-through translation to occur. Indeed, both the truncated 'termination' protein and the full-length 'read-through' protein (VP9 and VP9', respectively) were detected in CTFV-infected cells, in cells transfected with a plasmid expressing only Seg-9 protein products, and in the in vitro translation products from undenatured Seg-9 ssRNA. The ratios of full-length and truncated proteins generated suggest that read-through may be down-regulated by other viral proteins. Western blot analysis of infected cells and purified CTFV showed that VP9 is a structural component of the virion, while VP9' is a non-structural protein.

Analysis of the full genome of human group C rotaviruses reveals lineage diversification and reassortment.

PubMed

Medici, Maria Cristina; Tummolo, Fabio; Martella, Vito; Arcangeletti, Maria Cristina; De Conto, Flora; Chezzi, Carlo; Fehér, Enikő; Marton, Szilvia; Calderaro, Adriana; Bányai, Krisztián

2016-08-01

Group C rotaviruses (RVC) are enteric pathogens of humans and animals. Whole-genome sequences are available only for few RVCs, leaving gaps in our knowledge about their genetic diversity. We determined the full-length genome sequence of two human RVCs (PR2593/2004 and PR713/2012), detected in Italy from hospital-based surveillance for rotavirus infection in 2004 and 2012. In the 11 RNA genomic segments, the two Italian RVCs segregated within separate intra-genotypic lineages showed variation ranging from 1.9 % (VP6) to 15.9 % (VP3) at the nucleotide level. Comprehensive analysis of human RVC sequences available in the databases allowed us to reveal the existence of at least two major genome configurations, defined as type I and type II. Human RVCs of type I were all associated with the M3 VP3 genotype, including the Italian strain PR2593/2004. Conversely, human RVCs of type II were all associated with the M2 VP3 genotype, including the Italian strain PR713/2012. Reassortant RVC strains between these major genome configurations were identified. Although only a few full-genome sequences of human RVCs, mostly of Asian origin, are available, the analysis of human RVC sequences retrieved from the databases indicates that at least two intra-genotypic RVC lineages circulate in European countries. Gathering more sequence data is necessary to develop a standardized genotype and intra-genotypic lineage classification system useful for epidemiological investigations and avoiding confusion in the literature.

Joint innversion of seismic and magnetotelluric data in the Parkfield Region of California using the normalized cross-gradient constraint

USGS Publications Warehouse

Bennington, Ninfa L.; Zhang, Haijiang; Thurber, Cliff; Bedrosian, Paul A.

2015-01-01

We present jointly inverted models of P-wave velocity (Vp) and electrical resistivity for a two-dimensional profile centered on the San Andreas Fault Observatory at Depth (SAFOD). Significant structural similarity between main features of the separately inverted Vp and resistivity models is exploited by carrying out a joint inversion of the two datasets using the normalized cross-gradient constraint. This constraint favors structurally similar Vp and resistivity images that adequately fit the seismic and magnetotelluric (MT) datasets. The new inversion code, tomoDDMT, merges the seismic inversion code tomoDD and the forward modeling and sensitivity kernel subroutines of the MT inversion code OCCAM2DMT. TomoDDMT is tested on a synthetic dataset and demonstrates the code’s ability to more accurately resolve features of the input synthetic structure relative to the separately inverted resistivity and velocity models. Using tomoDDMT, we are able to resolve a number of key issues raised during drilling at SAFOD. We are able to infer the distribution of several geologic units including the Salinian granitoids, the Great Valley sequence, and the Franciscan Formation. The distribution and transport of fluids at both shallow and great depths is also examined. Low values of velocity/resistivity attributed to a feature known as the Eastern Conductor (EC) can be explained in two ways: the EC is a brine-filled, high porosity region, or this region is composed largely of clay-rich shales of the Franciscan. The Eastern Wall, which lies immediately adjacent to the EC, is unlikely to be a fluid pathway into the San Andreas Fault’s seismogenic zone due to its observed higher resistivity and velocity values.

Identification of Two Novel Members of the Tentative Genus Wukipolyomavirus in Wild Rodents

PubMed Central

Nainys, Juozas; Timinskas, Albertas; Schneider, Julia; Ulrich, Rainer G.; Gedvilaite, Alma

2015-01-01

Two novel polyomaviruses (PyVs) were identified in kidney and chest-cavity fluid samples of wild bank voles (Myodes glareolus) and common voles (Microtus arvalis) collected in Germany. All cloned and sequenced genomes had the typical PyV genome organization, including putative open reading frames for early regulatory proteins large T antigen and small T antigen on one strand and for structural late proteins (VP1, VP2 and VP3) on the other strand. Virus-like particles (VLPs) were generated by yeast expression of the VP1 protein of both PyVs. VLP-based ELISA and large T-antigen sequence-targeted polymerase-chain reaction investigations demonstrated signs of infection of these novel PyVs in about 42% of bank voles and 18% of common voles. In most cases only viral DNA, but not VP1-specific antibodies were detected. In additional animals exclusively VP1-specific antibodies, but no viral DNA was detected, indicative for virus clearance. Phylogenetic and clustering analysis including all known PyV genomes placed novel bank vole and common vole PyVs amongst members of the tentative Wukipolymavirus genus. The other known four rodent PyVs, Murine PyV and Hamster PyV, and Murine pneumotropic virus and Mastomys PyV belong to different phylogenetic clades, tentatively named Orthopolyomavirus I and Orthopolyomavirus II, respectively. In conclusion, the finding of novel vole-borne PyVs may suggest an evolutionary origin of ancient wukipolyomaviruses in rodents and may offer the possibility to develop a vole-based animal model for human wukipolyomaviruses. PMID:26474048

Phylogenetic analysis of human G9P[8] rotavirus strains circulating in Jiangsu, China between 2010 and 2016.

PubMed

Xu, Cheng; Fu, Jianguang; Ai, Jing; Zhang, Jun; Liu, Cheng; Huo, Xiang; Bao, Changjun; Zhu, Yefei

2018-05-02

Rotavirus A (RVA) is the leading cause of acute viral gastroenteritis in children under 5 years of age worldwide. G9P[8] is a common RVA genotype that has been persistently prevalent in Jiangsu, China. To determine the genetic diversity of G9P[8] RVAs, 7 representative G9P[8] strains collected from Suzhou Children's Hospital between 2010 and 2016 (named JS2010-JS2016) were analyzed through whole-genome sequencing. All evaluated strains showed the Wa-like constellation G9-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. Furthermore, phylogenetic analysis revealed that the VP7 genes of all strains clustered into lineage G9-III and G9-VI. With the exception of strain JS2012 (P[8]-4), the VP4 sequences of all strains belonged to the P[8]-3 lineage. Sequencing further revealed that amino acid substitutions were present in the antigenic regions of the VP7 and VP4 genes of all strains. Moreover, there were multiple substitutions in antigenic sites I and II of the nonstructural protein 4 (NSP4) genes, whereas the other NSP genes were relatively conserved. In conclusion, our phylogenetic analysis of these 7 G9P[8] strains suggests that RVA varied across regions and time. Therefore, our findings suggest that continued surveillance is necessary to explore the molecular evolutionary characteristics of RVA for better prevention and treatment of acute viral gastroenteritis. © 2018 Wiley Periodicals, Inc.

Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30.

PubMed

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Guoqiang

2016-06-21

Muscovy duck parvovirus (MDPV) is the etiological agent of Muscovy duckling parvoviral disease, which is characterized by diarrhea, locomotive dysfunction, stunting, and death in young ducklings, and causes substantial economic losses in the Muscovy duck industry worldwide. FZ91-30 is an attenuated vaccine strain that is safe and immunogenic to ducklings, but the genomic information and molecular mechanism underlining the attenuation are not understood. The FZ91-30 strain was propagated in 11-day-old embryonated goose eggs, and viral particles were purified from the pooled allantoic fluid by differential centrifugation and ultracentrifugation. Single-stranded genomic DNA was extracted and annealed to form double-stranded DNA. The dsDNA digested with NcoI resulted two sub-genomic fragments, which were then cloned into the modified plasmid pBluescript II SK, respectively, generating plasmid pBSKNL and pBSKNR. The sub-genomic plasmid clones were sequenced and further combined to construct the plasmid pFZ that contained the entire genome of strain FZ91-30. The complete genome sequences of strain FM and YY and partial genome sequences of other strains were retrieved from GenBank for sequence comparison. The plasmid pFZ containing the entire genome of FZ91-30 was transfected in 11-day-old embryonated goose eggs via the chorioallantoic membranes route to rescue infectious virus. A genetic marker was introduced into the rescued virus to discriminate from its parental virus. The genome of FZ91-30 consists of 5,131 nucleotides and has 98.9 % similarity to the FM strain. The inverted terminal repeats (ITR) are 456 nucleotides in length, 14 nucleotides longer than that of Goose parvovirus (GPV). The exterior 415 nucleotides of the ITR form a hairpin structure, and the interior 41 nucleotides constitute the D sequence, a reverse complement of the D' sequence at the 3' ITR. Amino acid sequence alignment of the VP1 proteins between FZ91-30 and five pathogenic MDPV strains revealed that FZ91-30 had five mutations; two in the unique region of the VP1 protein (VP1u) and three in VP3. Sequence alignment of the Rep1 proteins revealed two amino acid alterations for FZ91-30, both of which were conserved for two pathogenic strains YY and P. Transfection of the plasmid pFZ in 11-day-old embryonated goose eggs resulted in generation of infectious virus with similar biological properties as compared with the parental strain. The amino acid mutations identified in the VP1 and Rep1 protein may contribute to the attenuation of FZ91-30 in Muscovy ducklings. Plasmid transfection in embryonated goose eggs was suitable for rescue of infectious MDPV.

Molecular typing of a novel canine parvovirus type 2a mutant circulating in Italy.

PubMed

Mira, Francesco; Dowgier, Giulia; Purpari, Giuseppa; Vicari, Domenico; Di Bella, Santina; Macaluso, Giusi; Gucciardi, Francesca; Randazzo, Vincenzo; Decaro, Nicola; Guercio, Annalisa

2018-07-01

Canine parvovirus (CPV) is the etiological agent of a severe viral disease of dogs. After its emergence in late 1970s, the CPV original type (CPV-2) was rapidly and totally replaced by three antigenic variants named CPV-2a, CPV-2b and CPV-2c. CPV has an evolutionary rate nearest to those of RNA viruses, with consequences on disease diagnosis and epidemiology. This paper reports the molecular characterization of eight CPV-2a strains collected from dogs in Italy in 2016-2017. Genetic analysis was conducted on a CPV genomic region encompassing both open reading frames (ORFs) encoding for nonstructural (NS1-NS2) and structural proteins (VP1-VP2). Sequence analysis indicates new and unreported sequence changes, mainly affecting the VP2 gene, which included the mutation Tyr324Leu. This study represents the first evidence of a new CPV-2a mutant (VP2 324Leu) and illustrates the importance of a continuous molecular survey in order to obtain more information on effective spread of new CPV mutants. Copyright © 2018 Elsevier B.V. All rights reserved.

VP24-Karyopherin Alpha Binding Affinities Differ between Ebolavirus Species, Influencing Interferon Inhibition and VP24 Stability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, Toni M.; Edwards, Megan R.; Diederichs, Audrey

ABSTRACT Zaire ebolavirus(EBOV),Bundibugyo ebolavirus(BDBV), andReston ebolavirus(RESTV) belong to the same genus but exhibit different virulence properties. VP24 protein, a structural protein present in all family members, blocks interferon (IFN) signaling and likely contributes to virulence. Inhibition of IFN signaling by EBOV VP24 (eVP24) involves its interaction with the NPI-1 subfamily of karyopherin alpha (KPNA) nuclear transporters. Here, we evaluated eVP24, BDBV VP24 (bVP24), and RESTV VP24 (rVP24) interactions with three NPI-1 subfamily KPNAs (KPNA1, KPNA5, and KPNA6). Using purified proteins, we demonstrated that each VP24 binds to each of the three NPI-1 KPNAs. bVP24, however, exhibited approximately 10-fold-lower KPNA bindingmore » affinity than either eVP24 or rVP24. Cell-based assays also indicate that bVP24 exhibits decreased KPNA interaction, decreased suppression of IFN induced gene expression, and a decreased half-life in transfected cells compared to eVP24 or rVP24. Amino acid sequence alignments between bVP24 and eVP24 also identified residues within and surrounding the previously defined eVP24-KPNA5 binding interface that decrease eVP24-KPNA affinity or bVP24-KPNA affinity. VP24 mutations that lead to reduced KPNA binding affinity also decrease IFN inhibition and shorten VP24 half-lives. These data identify novel functional differences in VP24-KPNA interaction and reveal a novel impact of the VP24-KPNA interaction on VP24 stability. IMPORTANCEThe interaction of Ebola virus (EBOV) VP24 protein with host karyopherin alpha (KPNA) proteins blocks type I interferon (IFN) signaling, which is a central component of the host innate immune response to viral infection. Here, we quantitatively compared the interactions of VP24 proteins from EBOV and two members of theEbolavirusgenus, Bundibugyo virus (BDBV) and Reston virus (RESTV). The data reveal lower binding affinity of the BDBV VP24 (bVP24) for KPNAs and demonstrate that the interaction with KPNA modulates inhibition of IFN signaling and VP24 stability. The effect of KPNA interaction on VP24 stability is a novel functional consequence of this virus-host interaction, and the differences identified between viral species may contribute to differences in pathogenesis.« less

VP24-Karyopherin Alpha Binding Affinities Differ between Ebolavirus Species, Influencing Interferon Inhibition and VP24 Stability.

PubMed

Schwarz, Toni M; Edwards, Megan R; Diederichs, Audrey; Alinger, Joshua B; Leung, Daisy W; Amarasinghe, Gaya K; Basler, Christopher F

2017-02-15

Zaire ebolavirus (EBOV), Bundibugyo ebolavirus (BDBV), and Reston ebolavirus (RESTV) belong to the same genus but exhibit different virulence properties. VP24 protein, a structural protein present in all family members, blocks interferon (IFN) signaling and likely contributes to virulence. Inhibition of IFN signaling by EBOV VP24 (eVP24) involves its interaction with the NPI-1 subfamily of karyopherin alpha (KPNA) nuclear transporters. Here, we evaluated eVP24, BDBV VP24 (bVP24), and RESTV VP24 (rVP24) interactions with three NPI-1 subfamily KPNAs (KPNA1, KPNA5, and KPNA6). Using purified proteins, we demonstrated that each VP24 binds to each of the three NPI-1 KPNAs. bVP24, however, exhibited approximately 10-fold-lower KPNA binding affinity than either eVP24 or rVP24. Cell-based assays also indicate that bVP24 exhibits decreased KPNA interaction, decreased suppression of IFN induced gene expression, and a decreased half-life in transfected cells compared to eVP24 or rVP24. Amino acid sequence alignments between bVP24 and eVP24 also identified residues within and surrounding the previously defined eVP24-KPNA5 binding interface that decrease eVP24-KPNA affinity or bVP24-KPNA affinity. VP24 mutations that lead to reduced KPNA binding affinity also decrease IFN inhibition and shorten VP24 half-lives. These data identify novel functional differences in VP24-KPNA interaction and reveal a novel impact of the VP24-KPNA interaction on VP24 stability. The interaction of Ebola virus (EBOV) VP24 protein with host karyopherin alpha (KPNA) proteins blocks type I interferon (IFN) signaling, which is a central component of the host innate immune response to viral infection. Here, we quantitatively compared the interactions of VP24 proteins from EBOV and two members of the Ebolavirus genus, Bundibugyo virus (BDBV) and Reston virus (RESTV). The data reveal lower binding affinity of the BDBV VP24 (bVP24) for KPNAs and demonstrate that the interaction with KPNA modulates inhibition of IFN signaling and VP24 stability. The effect of KPNA interaction on VP24 stability is a novel functional consequence of this virus-host interaction, and the differences identified between viral species may contribute to differences in pathogenesis. Copyright © 2017 American Society for Microbiology.

VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones✰

PubMed Central

Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Venermo, Maria S Söderlund; Young, Neal S.; Brown, Kevin E.

2008-01-01

Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus. PMID:18252260

VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones.

PubMed

Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Söderlund-Venermo, Maria; Young, Neal S; Brown, Kevin E

2008-05-10

Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus.

[Study on the pathological and molecular characteristics of viral meningitis outbreaks in Linhai county, Zhejiang province, 2004].

PubMed

Yan, Ju-ying; Lu, Yi-yu; Xu, Chang-ping; Gong, Li-ming; Chen, Yin; Zhang, Yan-jun; Zhu, Jian-sheng

2011-12-01

In order to confirm the causes of viral meningitis outbreaks in Linhai county, Zhejiang province in 2004, and to analyze the relationship between hereditary variation and evolution of the pathogen. 60 cerebrospinal fluid (CSF) specimens were collected from the suspected patients. Virus strains from the specimens were isolated with RD and Hep-2 cell lines, and identified through neutralization test. VP1 and VP4/VP2 genes of the isolated viruses were sequenced. Both phylogenetic and homological trees were also constructed. 19 Echovirus type 30 (E30) strains were isolated from 60 CSFs, in which E30 accounted for 31.7%. All of the complete VP1 genes in 4 sequenced virus isolates of E30 were composed of 876 nt, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 82.4% - 84.1% and 93.5% - 94.2% between the 4 Linhai strains and the prototype strain Bastianni of E30, were 87.1% - 99.9% and 97.9% - 100.0% among the 4 virus strains of E30 from Linhai, respectively. The 4 Linhai strains could be classified into two classes. The diversity of nt and aa was minimal in the same class but obvious between the two classes, with the range of diversities as 12.9% and 2.1%, respectively. The Linhai E30 strains had maximum similarity with the Zhejiang E30 strains in 2002 - 2003. The 4 Linhai strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. The G branch also included the E30 strains from Zhejiang, Jiangsu and Shangdong in 2003, while the H branch including E30 strains from Zhuji, Zhejiang in 2002. The phylogenetic tree of VP4/VP2 genes was similar to that of VP1 gene. The outbreak of viral meningitis in Linhai county in 2004 was caused by the two classes of E30 strains with G and H genotype existed simultaneously. The Linhai E30 strains had maximum genetic relations to the Zhejiang, Jiangsu and Shangdong strains of E30. The H genotype was inferred to be a new variant strain, which was first isolated in Zhejiang province in 2002.

Detection and genetic characterization of bovine kobuvirus from calves in Egypt.

PubMed

Mohamed, Fakry F; Mansour, Shimaa M G; Orabi, Ahmed; El-Araby, Iman E; Ng, Terry Fei Fan; Mor, Sunil K; Goyal, Sagar M

2018-06-01

Kobuviruses are small non-enveloped RNA viruses that probably cause diarrhea in cattle and swine. Since its discovery in 2003, few studies have addressed bovine kobuvirus (BKoV; a species of Aichivirus B) infections. BKoV has been reported in Europe, Asia, and South America, suggesting a worldwide distribution. To investigate the presence of BKoV in Egypt, 36 fecal specimens from diarrheic calves in two different Egyptian provinces (Cairo and Sharkia) were screened by RT-PCR and 24 (66.7%) were found positive for BKoV. RNA from one of the positive samples (BKoV/Egy-1/KY407744) was subjected to next-generation sequencing to determine the complete BKoV genome sequence. When compared to the only recorded BKoV genome sequence (BKoV/U-1/AB084788), the studied strain showed 94 amino acid (aa) substitutions through its entire polyprotein (2463 aa), one nucleotide (nt) insertion and one nt deletion in the 2B gene and 4-nt deletions in the UTRs (2 each). Additionally, five VP1 and seven 3D sequences were obtained from other samples by using RT-PCR and Sanger sequencing. A discrepancy in the phylogenetic topography of VP1 and 3D was observed, where the Egyptian VP1 sequences were classified as a distinct cluster within the proposed lineage 1 (genotype A), which also contained strains from the UK, Brazil, and Japan. While, the 3D sequences from Cairo were related to those of Chinese strains unlike Sharkia ones that were more closer to Korean  strains. To the best of our knowledge, this is the first detection and genomic characterization of BKoV in Egypt or indeed Africa.

Peptide vaccine against canine parvovirus: identification of two neutralization subsites in the N terminus of VP2 and optimization of the amino acid sequence.

PubMed Central

Casal, J I; Langeveld, J P; Cortés, E; Schaaper, W W; van Dijk, E; Vela, C; Kamstrup, S; Meloen, R H

1995-01-01

The N-terminal domain of the major capsid protein VP2 of canine parvovirus was shown to be an excellent target for development of a synthetic peptide vaccine, but detailed information about number of epitopes, optimal length, sequence choice, and site of coupling to the carrier protein was lacking. Therefore, several overlapping peptides based on this N terminus were synthesized to establish conditions for optimal and reproducible induction of neutralizing antibodies in rabbits. The specificity and neutralizing ability of the antibody response for these peptides were determined. Within the N-terminal 23 residues of VP2, two subsites able to induce neutralizing antibodies and which overlapped by only two glycine residues at positions 10 and 11 could be discriminated. The shortest sequence sufficient for neutralization induction was nine residues. Peptides longer than 13 residues consistently induced neutralization, provided that their N termini were located between positions 1 and 11 of VP2. The orientation of the peptides at the carrier protein was also of importance, being more effective when coupled through the N terminus than through the C terminus to keyhole limpet hemocyanin. The results suggest that the presence of amino acid residues 2 to 21 (and probably 3 to 17) of VP2 in a single peptide is preferable for a synthetic peptide vaccine. PMID:7474152

Peptide vaccine against canine parvovirus: identification of two neutralization subsites in the N terminus of VP2 and optimization of the amino acid sequence.

PubMed

Casal, J I; Langeveld, J P; Cortés, E; Schaaper, W W; van Dijk, E; Vela, C; Kamstrup, S; Meloen, R H

1995-11-01

The N-terminal domain of the major capsid protein VP2 of canine parvovirus was shown to be an excellent target for development of a synthetic peptide vaccine, but detailed information about number of epitopes, optimal length, sequence choice, and site of coupling to the carrier protein was lacking. Therefore, several overlapping peptides based on this N terminus were synthesized to establish conditions for optimal and reproducible induction of neutralizing antibodies in rabbits. The specificity and neutralizing ability of the antibody response for these peptides were determined. Within the N-terminal 23 residues of VP2, two subsites able to induce neutralizing antibodies and which overlapped by only two glycine residues at positions 10 and 11 could be discriminated. The shortest sequence sufficient for neutralization induction was nine residues. Peptides longer than 13 residues consistently induced neutralization, provided that their N termini were located between positions 1 and 11 of VP2. The orientation of the peptides at the carrier protein was also of importance, being more effective when coupled through the N terminus than through the C terminus to keyhole limpet hemocyanin. The results suggest that the presence of amino acid residues 2 to 21 (and probably 3 to 17) of VP2 in a single peptide is preferable for a synthetic peptide vaccine.

Genotyping of polyomavirus BK by Real Time PCR for VP1 gene.

PubMed

Gambarino, Stefano; Costa, Cristina; Astegiano, Sara; Piasentin, Elsa Alessio; Segoloni, Giuseppe P; Cavallo, Rossana; Bergallo, Massimiliano

2011-10-01

Polyomavirus BK latently persist in different sites, including the renourinary tract, and may reactivate causing nephropathy in renal transplant recipients or hemorrhagic cystitis in bone marrow recipients. Based on the sequence of the VP1 gene, four genotypes have been described, corresponding to the four serologically differentiated subtypes I-IV, with different prevalence and geographic distribution. In this study, the development and clinical validation of four different Real-Time PCR assays for the detection and discrimination of BKV genotypes as a substitute of DNA sequencing are described. 379 BK VP1 sequences, belonging to the main four genotypes, were aligned and "hot spots" of mutation specific for all the strains or isolates were identified. Specific primers and probes for the detection and discrimination of each genotype by four Real-Time PCR assays were designed and technically validated. Subsequently, the four Real-Time PCR assays were used to test 20 BK-positive urine specimens from renal transplant patients, and evidenced a prevalence of BK genotype I, as previously reported in Europe. Results were confirmed by sequencing. The availability of a rapid and simple genotyping method could be useful for the evaluation of BK genotypes prevalence and studies on the impact of the infecting genotype on viral biological behavior, pathogenic role, and immune evasion strategies.

Identification of three PPV1 VP2 protein-specific B cell linear epitopes using monoclonal antibodies against baculovirus-expressed recombinant VP2 protein.

PubMed

Sun, Jianhui; Huang, Liping; Wei, Yanwu; Wang, Yiping; Chen, Dongjie; Du, Wenjuan; Wu, Hongli; Feng, Li; Liu, Changming

2015-11-01

Porcine parvovirus type 1 (PPV1) is a major causative agent of embryonic and fetal death in swine. The PPV1 VP2 protein is closely associated with viral immunogenicity for eliciting neutralizing antibodies, but its antigenic structures have been largely unknown. We generated three monoclonal antibodies (MAbs) against baculovirus-expressed recombinant PPV1 VP2 protein. A PEPSCAN analysis identified the minimal B cell linear epitopes of PPV1 VP2 based on these MAbs. Three core epitopes, (228)QQITDA(233), (284)RSLGLPPK(291), and (344)FEYSNGGPFLTPI(356), were defined and mapped onto three-dimensional models of the PPV1 virion and VP2 monomer. The epitope (228)QQITDA(233) is exposed on the virion surface, and the other two are located inside the protein. An alignment of the PPV1 VP2 amino acid sequences showed that (284)RSLGLPPK(291) and (344)FEYSNGGPFLTPI(356) are absolutely conserved, whereas (228)QQITDA(233) has a single substitution at residue 233 in some (S → A or T). We developed a VP2 epitope-based indirect enzyme-linked immunosorbent assay (iELISA) to test for anti-PPV1 antibodies. In a comparative analysis with an immunoperoxidase monolayer assay using 135 guinea pig sera, the VP2-epitope-based iELISA had a concordance rate of 85.19 %, sensitivity of 83.33 %, and specificity of 85.47 %. MAb 8H6 was used to monitor VP2 during the PPV1 replication cycle in vitro with an indirect immunofluorescence assay, which indicated that newly encapsulated virions are released from the nucleus at 24 h postinfection and the PPV1 replication cycle takes less than 24 h. This study provides valuable information clarifying the antigenic structure of PPV1 VP2 and lays the foundations for PPV1 serodiagnosis and antigen detection.

Identification of a conserved B-cell epitope on duck hepatitis A type 1 virus VP1 protein.

PubMed

Wu, Xiaoying; Li, Xiaojun; Zhang, Qingshan; Wulin, Shaozhou; Bai, Xiaofei; Zhang, Tingting; Wang, Yue; Liu, Ming; Zhang, Yun

2015-01-01

The VP1 protein of duck hepatitis A virus (DHAV) is a major structural protein that induces neutralizing antibodies in ducks; however, B-cell epitopes on the VP1 protein of duck hepatitis A genotype 1 virus (DHAV-1) have not been characterized. To characterize B-cell epitopes on VP1, we used the monoclonal antibody (mAb) 2D10 against Escherichia coli-expressed VP1 of DHAV-1. In vitro, mAb 2D10 neutralized DHAV-1 virus. By using an array of overlapping 12-mer peptides, we found that mAb 2D10 recognized phages displaying peptides with the consensus motif LPAPTS. Sequence alignment showed that the epitope 173LPAPTS178 is highly conserved among the DHAV-1 genotypes. Moreover, the six amino acid peptide LPAPTS was proven to be the minimal unit of the epitope with maximal binding activity to mAb 2D10. DHAV-1-positive duck serum reacted with the epitope in dot blotting assay, revealing the importance of the six amino acids of the epitope for antibody-epitope binding. Competitive inhibition assays of mAb 2D10 binding to synthetic LPAPTS peptides and truncated VP1 protein fragments, detected by Western blotting, also verify that LPAPTS was the VP1 epitope. We identified LPAPTS as a VP1-specific linear B-cell epitope recognized by the neutralizing mAb 2D10. Our findings have potential applications in the development of diagnostic techniques and epitope-based marker vaccines against DHAV-1.

Diversity and Relationships of Cocirculating Modern Human Rotaviruses Revealed Using Large-Scale Comparative Genomics

PubMed Central

McKell, Allison O.; Rippinger, Christine M.; McAllen, John K.; Akopov, Asmik; Kirkness, Ewen F.; Payne, Daniel C.; Edwards, Kathryn M.; Chappell, James D.; Patton, John T.

2012-01-01

Group A rotaviruses (RVs) are 11-segmented, double-stranded RNA viruses and are primary causes of gastroenteritis in young children. Despite their medical relevance, the genetic diversity of modern human RVs is poorly understood, and the impact of vaccine use on circulating strains remains unknown. In this study, we report the complete genome sequence analysis of 58 RVs isolated from children with severe diarrhea and/or vomiting at Vanderbilt University Medical Center (VUMC) in Nashville, TN, during the years spanning community vaccine implementation (2005 to 2009). The RVs analyzed include 36 G1P[8], 18 G3P[8], and 4 G12P[8] Wa-like genogroup 1 strains with VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6 genotype constellations of I1-R1-C1-M1-A1-N1-T1-E1-H1. By constructing phylogenetic trees, we identified 2 to 5 subgenotype alleles for each gene. The results show evidence of intragenogroup gene reassortment among the cocirculating strains. However, several isolates from different seasons maintained identical allele constellations, consistent with the notion that certain RV clades persisted in the community. By comparing the genes of VUMC RVs to those of other archival and contemporary RV strains for which sequences are available, we defined phylogenetic lineages and verified that the diversity of the strains analyzed in this study reflects that seen in other regions of the world. Importantly, the VP4 and VP7 proteins encoded by VUMC RVs and other contemporary strains show amino acid changes in or near neutralization domains, which might reflect antigenic drift of the virus. Thus, this large-scale, comparative genomic study of modern human RVs provides significant insight into how this pathogen evolves during its spread in the community. PMID:22696651

Genetic diversity of G1P[8] rotavirus VP7 and VP8* antigens in Finland over a 20-year period: No evidence for selection pressure by universal mass vaccination with RotaTeq® vaccine.

PubMed

Hemming, Maria; Vesikari, Timo

2013-10-01

Two live-attenuated oral vaccines (Rotarix™ and Rotateq®) against rotavirus gastroenteritis were licensed in 2006 and have been introduced into National Immunization Programs (NIPs) of several countries. Large scale use of rotavirus vaccines might cause antigenic pressure on circulating rotavirus types or lead to selection of new rotaviruses thus decreasing vaccine efficacy. We examined the nucleotide and amino acid sequences of the surface proteins VP7 and VP4 (cleaved to VP8(*) and VP5(*)) of a total of 108 G1P[8] rotavirus strains collected over a 20-year period from 1992, including the years 2006-2009 when rotavirus vaccine (mainly Rotarix™) was available, and the years 2009-2012 after implementation of RotaTeq® vaccine into the NIP of Finland. In G1 VP7 no changes at amino acid level were observed. In VP8(*) periodical fluctuation of the sublineage over the study period was found with multiple changes both at nucleotide and amino acid levels. Most amino acid changes were in the dominant antigenic epitopes of VP8(*). A change in VP8(*) sublineage occurred between 2008 and 2009, with a temporal correlation to the use of Rotarix™ up to 30% coverage in the period. In contrast, no antigenic changes in the VP8(*) protein appeared to be correlated to the exclusive use of RotaTeq® vaccine after 2009. Nevertheless, long-term surveillance of antigenic changes in VP4 and also VP7 proteins in wild-type rotavirus strains is warranted in countries with large scale use of the currently licensed live oral rotavirus vaccines. Copyright © 2013 Elsevier B.V. All rights reserved.

A free VP3 C-terminus is essential for the replication of infectious bursal disease virus.

PubMed

Mosley, Yung-Yi C; Wu, Ching Ching; Lin, Tsang Long

2017-03-15

Green fluorescent protein (GFP) has been successfully incorporated into the viral-like particles of infectious bursal disease virus (IBDV) with a linker at the C-terminus of VP3 in a baculovirus system. However, when the same locus in segment A was used to express GFP by a reverse genetic (RG) system, no viable GFP-expressing IBDV was recovered. To elucidate the underlying mechanism, cDNA construct of segment A with only the linker sequence (9 amino acids) was applied to generate RG IBDV virus (rIBDV). Similarly, no rIBDV was recovered. Moreover, when the incubation after transfection was extended, wildtype rIBDV without the linker was recovered suggesting a free C-terminus of VP3 might be necessary for IBDV replication. On the other hand, rIBDV could be recovered when additional sequence (up to 40 nucleotides) were inserted at the 3' noncoding region (NCR) adjacent to the stop codon of VP3, suggesting that the burden of the linker sequence was not in the stretched genome size but the disruption of the VP3 function. Finally, when the stop codon of VP3 was deleted in segment A to extend the translation into the 3' NCR without introducing additional genomic sequence, no rIBDV was recovered. Our data suggest that a free VP3 C-terminus is essential for IBDV replication. Copyright © 2017 Elsevier B.V. All rights reserved.

First isolation of new canine parvovirus 2a from Tibetan mastiff and global analysis of the full-length VP2 gene of canine parvoviruses 2 in China.

PubMed

Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng

2014-07-09

Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.

A Sabin 3-Derived Poliovirus Recombinant Contained a Sequence Homologous with Indigenous Human Enterovirus Species C in the Viral Polymerase Coding Region†

PubMed Central

Arita, Minetaro; Zhu, Shuang-Li; Yoshida, Hiromu; Yoneyama, Tetsuo; Miyamura, Tatsuo; Shimizu, Hiroyuki

2005-01-01

Outbreaks of poliomyelitis caused by circulating vaccine-derived polioviruses (cVDPVs) have been reported in areas where indigenous wild polioviruses (PVs) were eliminated by vaccination. Most of these cVDPVs contained unidentified sequences in the nonstructural protein coding region which were considered to be derived from human enterovirus species C (HEV-C) by recombination. In this study, we report isolation of a Sabin 3-derived PV recombinant (Cambodia-02) from an acute flaccid paralysis (AFP) case in Cambodia in 2002. We attempted to identify the putative recombination counterpart of Cambodia-02 by sequence analysis of nonpolio enterovirus isolates from AFP cases in Cambodia from 1999 to 2003. Based on the previously estimated evolution rates of PVs, the recombination event resulting in Cambodia-02 was estimated to have occurred within 6 months after the administration of oral PV vaccine (99.3% nucleotide identity in VP1 region). The 2BC and the 3Dpol coding regions of Cambodia-02 were grouped into the genetic cluster of indigenous coxsackie A virus type 17 (CAV17) (the highest [87.1%] nucleotide identity) and the cluster of indigenous CAV13-CAV18 (the highest [94.9%] nucleotide identity) by the phylogenic analysis of the HEV-C isolates in 2002, respectively. CAV13-CAV18 and CAV17 were the dominant HEV-C serotypes in 2002 but not in 2001 and in 2003. We found a putative recombination between CAV13-CAV18 and CAV17 in the 3CDpro coding region of a CAV17 isolate. These results suggested that a part of the 3Dpol coding region of PV3(Cambodia-02) was derived from a HEV-C strain genetically related to indigenous CAV13-CAV18 strains in 2002 in Cambodia. PMID:16188967

Identification of sequence changes in live attenuated goose parvovirus vaccine strains developed in Asia and Europe.

PubMed

Shien, J-H; Wang, Y-S; Chen, C-H; Shieh, H K; Hu, C-C; Chang, P-C

2008-10-01

Live attenuated vaccines have been used for control of the disease caused by goose parvovirus (GPV), but the mechanism involved in attenuation of GPV remains elusive. This report presents the complete nucleotide sequences of two live attenuated strains of GPV (82-0321V and VG32/1) that were independently developed in Taiwan and Europe, together with the parental strain of 82-0321V and a field strain isolated in Taiwan in 2006. Sequence comparisons showed that 82-0321V and VG32/1 had multiple deletions and substitutions in the inverted terminal repeats region when compared with their parental strain or the field virus, but these changes did not affect the formation of the hairpin structure essential for viral replication. Moreover, 82-0321V and VG32/1 had five amino acid changes in the non-structural protein, but these changes were located at positions distant from known functional motifs in the non-structural protein. In contrast, 82-0321V had nine changes and VG32/1 had 11 changes in their capsid proteins (VP1), and the majority of these changes occurred at positions close to the putative receptor binding sites of VP1, as predicted using the structure of adeno-associated virus 2 as the model system. Taken together, the results suggest that changes in sequence near the receptor binding sites of VP1 might be responsible for attenuation of GPV. This is the first report of complete nucleotide sequences of GPV other than the virulent B strain, and suggests a possible mechanism for attenuation of GPV.

Distinguishing the genotype 1 genes and proteins of human Wa-like rotaviruses vs. porcine rotaviruses

PubMed Central

Silva, Fernanda D.F.; Gregori, F.; McDonald, Sarah M.

2016-01-01

Group A rotaviruses (RVAs) are 11-segmented, double-stranded RNA viruses and important causes of gastroenteritis in the young of many animal species. Previous studies have suggested that human Wa-like RVAs share a close evolutionary relationship with porcine RVAs. Specifically, the VP1-VP3 and NSP2-5/6 genes of these viruses are usually classified as genotype 1 with >81% nucleotide sequence identity. Yet, it remains unknown whether the genotype 1 genes and proteins of human Wa-like strains are distinguishable from those of porcine strains. To investigate this, we performed comprehensive bioinformatic analyses using all known genotype 1 gene sequences. The RVAs analyzed represent wildtype strains isolated from humans or pigs at various geographical locations during the years of 2004–2013, including 11 newly-sequenced porcine RVAs from Brazil. We also analyzed archival strains that were isolated during the years of 1977–1992 as well as atypical strains involved in inter-species transmission between humans and pigs. We found that, in general, the genotype 1 genes of typical modern human Wa-like RVAs clustered together in phylogenetic trees and were separate from those of typical modern porcine RVAs. The only exception was for the NSP5/6 gene, which showed no host-specific phylogenetic clustering. Using amino acid sequence alignments, we identified 34 positions that differentiated the VP1-VP3, NSP2, and NSP3 genotype 1 proteins of typical modern human Wa-like RVAs versus typical modern porcine RVAs and documented how these positions vary in the archival/unusual isolates. No host-specific amino acid positions were identified for NSP4, NSP5, or NSP6. Altogether, the results of this study support the notion that human Wa-like RVAs and porcine RVAs are evolutionarily related, but indicate that some of their genotype 1 genes and proteins have diverged over time possibly as a reflection of sequestered replication and protein co-adaptation in their respective hosts. PMID:27180895

[Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

PubMed

Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

2011-01-01

To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.

Continuing evolution of canine parvovirus in China: Isolation of novel variants with an Ala5Gly mutation in the VP2 protein.

PubMed

Wang, Jianke; Lin, Peng; Zhao, Hang; Cheng, Yuening; Jiang, Zhong; Zhu, Hongwei; Wu, Hua; Cheng, Shipeng

2016-03-01

Canine parvovirus (CPV) type 2c is a new antigenic variant of CPV-2. Since the year 2000 it has spread to several countries, causing severe hemorrhagic enteritis in dogs. In 2014 and 2015, 58 fecal samples were collected from dogs in Beijing with suspected CPV infection. Regardless of the vaccination status of the dogs, 43 samples were found positive for CPV according to PCR results; i.e., 18, 7, and 18 respectively belonged to antigenic types new CPV-2a, new CPV-2b, and CPV-2c. A phylogenetic tree based on their VP2 gene sequences indicated that the Chinese CPV-2c strains form a separate cluster. In addition to synonymous mutations, the CPV-2c strains also contain a unique coding mutation in VP2 that leads to glycine at residue 5, instead of the highly conserved alanine at this position in all other CPV-2c strains sequenced to date. Using F81 cells, several novel isolates of CPV-2c, each with the Ala5Gly mutation, were obtained. One of these was used to infect experimentally beagle dogs, which subsequently developed the typical clinical symptoms of CPV infection. Hence, it appears that CPV-2c is still evolving in China, a finding that warrants continuous surveying and the eventual adaptation of current vaccines. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular epidemiology of rotavirus gastroenteritis in Central Kenya before vaccine introduction, 2009-2014.

PubMed

Wandera, Ernest A; Mohammad, Shah; Komoto, Satoshi; Maeno, Yoshimasa; Nyangao, James; Ide, Tomihiko; Kathiiko, Cyrus; Odoyo, Erick; Tsuji, Takao; Taniguchi, Koki; Ichinose, Yoshio

2017-05-01

Between July 2009 and June 2014, a total of 1,546 fecal specimens were collected from children <5 years of age with acute gastroenteritis admitted to Kiambu County Hospital, Central Kenya. The specimens were screened for group A rotavirus (RVA) using ELISA, and RVA-positive specimens were subjected to semi-nested RT-PCR to determine the G and P genotypes. RVA was detected in 429/1,546 (27.5%) fecal specimens. RVA infections occurred in all age groups <59 months, with an early peak at 6-17 months. The infections persisted year-round with distinct seasonal peaks depending on the year. G1P[8] (28%) was the most predominant genotype, followed by G9P[8] (12%), G8P[4] (7%), G1P[4] (5%), G9P[4] (4%), and G12P[6] (3%). In the yearly change of G and P genotypes, a major shift from G9P[8] to G1P[8] was found in 2012. Phylogenetic analysis of the nucleotide sequences of the VP7 and VP4 genes of seven strains with unusual G8 or P[6] showed that the VP7 nucleotide sequences of G8 were clustered in lineage 6 in which African strains are included, and that there are at least two distinct VP4 nucleotide sequences of P[6] strains. These results represent basic data on RVA strains circulating in this region before vaccine introduction. J. Med. Virol. 89:809-817, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4

PubMed Central

Ikeda, Keiko; Nagaoka, Sumiharu; Winkler, Stefan; Kotani, Kumiko; Yagi, Hiroaki; Nakanishi, Kae; Miyajima, Shigetoshi; Kobayashi, Jun; Mori, Hajime

2001-01-01

The complete nucleotide sequence of the genome segment 4 (S4) of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) was determined. The 3,259-nucleotide sequence contains a single long open reading frame which spans nucleotides 14 to 3187 and which is predicted to encode a protein with a molecular mass of about 130 kDa. Western blot analysis showed that S4 encodes BmCPV protein VP3, which is one of the outer components of the BmCPV virion. Sequence analysis of the deduced amino acid sequence of BmCPV VP3 revealed possible sequence homology with proteins from rice ragged stunt virus (RRSV) S2, Nilaparvata lugens reovirus S4, and Fiji disease fijivirus S4. This may suggest that plant reoviruses originated from insect viruses and that RRSV emerged more recently than other plant reoviruses. A chimeric protein consisting of BmCPV VP3 and green fluorescent protein (GFP) was constructed and expressed with BmCPV polyhedrin using a baculovirus expression vector. The VP3-GFP chimera was incorporated into BmCPV polyhedra and released under alkaline conditions. The results indicate that specific interactions occur between BmCPV polyhedrin and VP3 which might facilitate BmCPV virion occlusion into the polyhedra. PMID:11134312

Novel inter and intra prediction tools under consideration for the emerging AV1 video codec

NASA Astrophysics Data System (ADS)

Joshi, Urvang; Mukherjee, Debargha; Han, Jingning; Chen, Yue; Parker, Sarah; Su, Hui; Chiang, Angie; Xu, Yaowu; Liu, Zoe; Wang, Yunqing; Bankoski, Jim; Wang, Chen; Keyder, Emil

2017-09-01

Google started the WebM Project in 2010 to develop open source, royalty- free video codecs designed specifically for media on the Web. The second generation codec released by the WebM project, VP9, is currently served by YouTube, and enjoys billions of views per day. Realizing the need for even greater compression efficiency to cope with the growing demand for video on the web, the WebM team embarked on an ambitious project to develop a next edition codec AV1, in a consortium of major tech companies called the Alliance for Open Media, that achieves at least a generational improvement in coding efficiency over VP9. In this paper, we focus primarily on new tools in AV1 that improve the prediction of pixel blocks before transforms, quantization and entropy coding are invoked. Specifically, we describe tools and coding modes that improve intra, inter and combined inter-intra prediction. Results are presented on standard test sets.

Concentration of acrylamide in a polyacrylamide gel affects VP4 gene coding assignment of group A equine rotavirus strains with P[12] specificity

PubMed Central

2010-01-01

Background It is universally acknowledged that genome segment 4 of group A rotavirus, the major etiologic agent of severe diarrhea in infants and neonatal farm animals, encodes outer capsid neutralization and protective antigen VP4. Results To determine which genome segment of three group A equine rotavirus strains (H-2, FI-14 and FI-23) with P[12] specificity encodes the VP4, we analyzed dsRNAs of strains H-2, FI-14 and FI-23 as well as their reassortants by polyacrylamide gel electrophoresis (PAGE) at varying concentrations of acrylamide. The relative position of the VP4 gene of the three equine P[12] strains varied (either genome segment 3 or 4) depending upon the concentration of acrylamide. The VP4 gene bearing P[3], P[4], P[6], P[7], P[8] or P[18] specificity did not exhibit this phenomenon when the PAGE running conditions were varied. Conclusions The concentration of acrylamide in a PAGE gel affected VP4 gene coding assignment of equine rotavirus strains bearing P[12] specificity. PMID:20573245

Genotyping of enteroviruses isolated in Kenya from pediatric patients using partial VP1 region.

PubMed

Opanda, Silvanos M; Wamunyokoli, Fred; Khamadi, Samoel; Coldren, Rodney; Bulimo, Wallace D

2016-01-01

Enteroviruses (EV) are responsible for a wide range of clinical diseases in humans. Though studied broadly in several regions of the world, the genetic diversity of human enteroviruses (HEV) circulating in the sub-Saharan Africa remains under-documented. In the current study, we molecularly typed 61 HEV strains isolated in Kenya between 2008 and 2011 targeting the 3'-end of the VP1 gene. Viral RNA was extracted from the archived isolates and part of the VP1 gene amplified by RT-PCR, followed by sequence analysis. Twenty-two different EV types were detected. Majority (72.0 %) of these belonged to Enterovirus B species followed by Enterovirus D (21.3 %) and Enterovirus A (6.5 %). The most frequently detected types were Enterovirus-D68 (EV-D68), followed by Coxsackievirus B2 (CV-B2), CV-B1, CV-B4 and CV-B3. Phylogenetic analyses of these viruses revealed that Kenyan CV-B1 isolates were segregated among sequences of global CV-B1 strains. Conversely, the Kenyan CV-B2, CV-B3, CV-B4 and EV-D68 strains generally grouped together with those detected from other countries. Notably, the Kenyan EV-D68 strains largely clustered with sequences of global strains obtained between 2008 and 2010 than those circulating in recent years. Overall, our results indicate that HEV strains belonging to Enterovirus D and Enterovirus B species pre-dominantly circulated and played a significant role in pediatric respiratory infection in Kenya, during the study period. The Kenyan CV-B1 strains were genetically divergent from those circulating in other countries. Phylogenetic clustering of Kenyan EV-D68 strains with sequences of global strains circulating between 2008 and 2010 than those obtained in recent years suggests a high genomic variability associated with the surface protein encoding VP1 gene in these enteroviruses.

Characterization of Nora Virus Structural Proteins via Western Blot Analysis.

PubMed

Ericson, Brad L; Carlson, Darby J; Carlson, Kimberly A

2016-01-01

Nora virus is a single stranded RNA picorna-like virus with four open reading frames (ORFs). The coding potentials of the ORFs are not fully characterized, but ORF3 and ORF4 are believed to encode the capsid proteins (VP3, VP4a, VP4b, and VP4c) comprising the virion. To determine the polypeptide composition of Nora virus virions, polypeptides from purified virus were compared to polypeptides detected in Nora virus infected Drosophila melanogaster. Nora virus was purified from infected flies and used to challenge mice for the production of antisera. ORF3, ORF4a, ORF4b, and ORF4c were individually cloned and expressed in E. coli; resultant recombinant proteins purified and were used to make monospecific antisera. Antisera were evaluated via Western blot against whole virus particles and Nora virus infected fly lysates. Viral purification yielded two particle types with densities of ~1.31 g/mL (empty particles) and ~1.33 g/mL (complete virions). Comparison of purified virus polypeptide composition to Nora virus infected D. melanogaster lysate showed the number of proteins in infected cell lysates is less than purified virus. Our results suggest the virion is composed of 6 polypeptides, VP3, VP4a, two forms of VP4b, and two forms of VP4c. This polypeptide composition is similar to other small RNA insect viruses.

Characterization of Nora Virus Structural Proteins via Western Blot Analysis

PubMed Central

Ericson, Brad L.; Carlson, Darby J.

2016-01-01

Nora virus is a single stranded RNA picorna-like virus with four open reading frames (ORFs). The coding potentials of the ORFs are not fully characterized, but ORF3 and ORF4 are believed to encode the capsid proteins (VP3, VP4a, VP4b, and VP4c) comprising the virion. To determine the polypeptide composition of Nora virus virions, polypeptides from purified virus were compared to polypeptides detected in Nora virus infected Drosophila melanogaster. Nora virus was purified from infected flies and used to challenge mice for the production of antisera. ORF3, ORF4a, ORF4b, and ORF4c were individually cloned and expressed in E. coli; resultant recombinant proteins purified and were used to make monospecific antisera. Antisera were evaluated via Western blot against whole virus particles and Nora virus infected fly lysates. Viral purification yielded two particle types with densities of ~1.31 g/mL (empty particles) and ~1.33 g/mL (complete virions). Comparison of purified virus polypeptide composition to Nora virus infected D. melanogaster lysate showed the number of proteins in infected cell lysates is less than purified virus. Our results suggest the virion is composed of 6 polypeptides, VP3, VP4a, two forms of VP4b, and two forms of VP4c. This polypeptide composition is similar to other small RNA insect viruses. PMID:27298753

Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin.

PubMed

Gao, Yan; Su, Qiudong; Yi, Yao; Jia, Zhiyuan; Wang, Hao; Lu, Xuexin; Qiu, Feng; Bi, Shengli

2015-01-01

Hepatitis A virus (HAV) and Hepatitis E virus (HEV) are the most common causes of infectious hepatitis. These viruses are spread largely by the fecal-oral route and lead to clinically important disease in developing countries. To evaluate the potential of targeting hepatitis A and E infection simultaneously, a combined mucosal candidate vaccine was developed with the partial open reading frame 2 (ORF2) sequence (aa 368-607) of HEV (HE-ORF2) and partial virus protein 1 (VP1) sequence (aa 1-198) of HAV (HA-VP1), which included the viral neutralization epitopes. Tuftsin is an immunostimulatory peptide which can enhance the immunogenicity of a protein by targeting it to macrophages and dendritic cells. Here, we developed a novel combined protein vaccine by conjugating tuftsin to HE-ORF2 and HA-VP1 and used synthetic CpG oligodeoxynucleotides (ODNs) as the adjuvant. Subsequent experiments in BALB/c mice demonstrated that tuftsin enhanced the serum-specific IgG and IgA antibodies against HEV and HAV at the intestinal, vaginal and pulmonary interface when delivered intranasally. Moreover, mice from the intranasally immunized tuftsin group (HE-ORF2-tuftsin + HA-VP1-tuftsin + CpG) showed higher levels of IFN-γ-secreting splenocytes (Th1 response) and ratio of CD4+/CD8+ T cells than those of the no-tuftsin group (HE-ORF2 + HA-VP1 + CpG). Thus, the tuftsin group generated stronger humoral and cellular immune responses compared with the no-tuftsin group. Moreover, enhanced responses to the combined protein vaccine were obtained by intranasal immunization compared with intramuscular injection. By integrating HE-ORF2, HA-VP1 and tuftsin in a vaccine, this study validated an important concept for further development of a combined mucosal vaccine against hepatitis A and E infection.

Gene Trapping Using Gal4 in Zebrafish

PubMed Central

Balciuniene, Jorune; Balciunas, Darius

2013-01-01

Large clutch size and external development of optically transparent embryos make zebrafish an exceptional vertebrate model system for in vivo insertional mutagenesis using fluorescent reporters to tag expression of mutated genes. Several laboratories have constructed and tested enhancer- and gene-trap vectors in zebrafish, using fluorescent proteins, Gal4- and lexA- based transcriptional activators as reporters 1-7. These vectors had two potential drawbacks: suboptimal stringency (e.g. lack of ability to differentiate between enhancer- and gene-trap events) and low mutagenicity (e.g. integrations into genes rarely produced null alleles). Gene Breaking Transposon (GBTs) were developed to address these drawbacks 8-10. We have modified one of the first GBT vectors, GBT-R15, for use with Gal4-VP16 as the primary gene trap reporter and added UAS:eGFP as the secondary reporter for direct detection of gene trap events. Application of Gal4-VP16 as the primary gene trap reporter provides two main advantages. First, it increases sensitivity for genes expressed at low expression levels. Second, it enables researchers to use gene trap lines as Gal4 drivers to direct expression of other transgenes in very specific tissues. This is especially pertinent for genes with non-essential or redundant functions, where gene trap integration may not result in overt phenotypes. The disadvantage of using Gal4-VP16 as the primary gene trap reporter is that genes coding for proteins with N-terminal signal sequences are not amenable to trapping, as the resulting Gal4-VP16 fusion proteins are unlikely to be able to enter the nucleus and activate transcription. Importantly, the use of Gal4-VP16 does not pre-select for nuclear proteins: we recovered gene trap mutations in genes encoding proteins which function in the nucleus, the cytoplasm and the plasma membrane. PMID:24121167

Genetic variation of viral protein 1 genes of field strains of waterfowl parvoviruses and their attenuated derivatives.

PubMed

Tsai, Hsiang-Jung; Tseng, Chun-hsien; Chang, Poa-chun; Mei, Kai; Wang, Shih-Chi

2004-09-01

To understand the genetic variations between the field strains of waterfowl parvoviruses and their attenuated derivatives, we analyzed the complete nucleotide sequences of the viral protein 1 (VP1) genes of nine field strains and two vaccine strains of waterfowl parvoviruses. Sequence comparison of the VP1 proteins showed that these viruses could be divided into goose parvovirus (GPV) related and Muscovy duck parvovirus (MDPV) related groups. The amino acid difference between GPV- and MDPV-related groups ranged from 13.1% to 15.8%, and the most variable region resided in the N terminus of VP2. The vaccine strains of GPV and MDPV exhibited only 1.2% and 0.3% difference in amino acid when compared with their parental field strains, and most of these differences resided in residues 497-575 of VP1, suggesting that these residues might be important for the attenuation of GPV and MDPV. When the GPV strains isolated in 1982 (the strain 82-0308) and in 2001 (the strain 01-1001) were compared, only 0.3% difference in amino acid was found, while MDPV strains isolated in 1990 (the strain 90-0219) and 1997 (the strain 97-0104) showed only 0.4% difference in amino acid. The result indicates that the genome of waterfowl parvovirus had remained highly stable in the field.

Molecular and biological characterization of the 5 human-bovine rotavirus (WC3)-based reassortant strains of the pentavalent rotavirus vaccine, RotaTeq (registered)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matthijnssens, Jelle; Joelsson, Daniel B.; Warakomski, Donald J.

RotaTeq (registered) is a pentavalent rotavirus vaccine that contains five human-bovine reassortant strains (designated G1, G2, G3, G4, and P1) on the backbone of the naturally attenuated tissue culture-adapted parental bovine rotavirus (BRV) strain WC3. The viral genomes of each of the reassortant strains were completely sequenced and compared pairwise and phylogenetically among each other and to human rotavirus (HRV) and BRV reference strains. Reassortants G1, G2, G3, and G4 contained the VP7 gene from their corresponding HRV parent strains, while reassortants G1 and G2 also contained the VP3 gene (genotype M1) from the HRV parent strain. The P1 reassortantmore » contained the VP4 gene from the HRV parent strain and all the other gene segments from the BRV WC3 strain. The human VP7s had a high level of overall amino acid identity (G1: 95-99%, G2: 94-99% G3: 96-100%, G4: 93-99%) when compared to those of representative rotavirus strains of their corresponding G serotypes. The VP4 of the P1 reassortant had a high identity (92-97%) with those of serotype P1A[8] HRV reference strains, while the BRV VP7 showed identities ranging from 91% to 94% to those of serotype G6 HRV strains. Sequence analyses of the BRV or HRV genes confirmed that the fundamental structure of the proteins in the vaccine was similar to those of the HRV and BRV references strains. Sequences analyses showed that RotaTeq (registered) exhibited a high degree of genetic stability as no mutations were identified in the material of each reassortant, which undergoes two rounds of replication cycles in cell culture during the manufacturing process, when compared to the final material used to fill the dosing tubes. The infectivity of each of the reassortant strains of RotaTeq (registered) , like HRV strains, did not require the presence of sialic acid residues on the cell surface. The molecular and biologic characterization of RotaTeq (registered) adds to the significant body of clinical data supporting the consistent efficacy, immunogenicity, and safety of RotaTeq (registered) .« less

Genetic Relatedness among Hepatitis A Virus Strains Associated with Food-Borne Outbreaks

PubMed Central

Vaughan, Gilberto; Xia, Guoliang; Forbi, Joseph C.; Purdy, Michael A.; Rossi, Lívia Maria Gonçalves; Spradling, Philip R.; Khudyakov, Yury E.

2013-01-01

The genetic characterization of hepatitis A virus (HAV) strains is commonly accomplished by sequencing subgenomic regions, such as the VP1/P2B junction. HAV genome is not extensively variable, thus presenting opportunity for sharing sequences of subgenomic regions among genetically unrelated isolates. The degree of misrepresentation of phylogenetic relationships by subgenomic regions is especially important for tracking transmissions. Here, we analyzed whole-genome (WG) sequences of 101 HAV strains identified from 4 major multi-state, food-borne outbreaks of hepatitis A in the Unites States and from 14 non-outbreak-related HAV strains that shared identical VP1/P2B sequences with the outbreak strains. Although HAV strains with an identical VP1/P2B sequence were specific to each outbreak, WG were different, with genetic diversity reaching 0.31% (mean 0.09%). Evaluation of different subgenomic regions did not identify any other section of the HAV genome that could accurately represent phylogenetic relationships observed using WG sequences. The identification of 2–3 dominant HAV strains in 3 out of 4 outbreaks indicates contamination of the implicated food items with a heterogeneous HAV population. However, analysis of intra-host HAV variants from eight patients involved in one outbreak showed that only a single sequence variant established infection in each patient. Four non-outbreak strains were found closely related to strains from 2 outbreaks, whereas ten were genetically different from the outbreak strains. Thus, accurate tracking of HAV strains can be accomplished using HAV WG sequences, while short subgenomic regions are useful for identification of transmissions only among cases with known epidemiological association. PMID:24223112

Chimaeric Virus-Like Particles Derived from Consensus Genome Sequences of Human Rotavirus Strains Co-Circulating in Africa

PubMed Central

Jere, Khuzwayo C.; O'Neill, Hester G.; Potgieter, A. Christiaan; van Dijk, Alberdina A.

2014-01-01

Rotavirus virus-like particles (RV-VLPs) are potential alternative non-live vaccine candidates due to their high immunogenicity. They mimic the natural conformation of native viral proteins but cannot replicate because they do not contain genomic material which makes them safe. To date, most RV-VLPs have been derived from cell culture adapted strains or common G1 and G3 rotaviruses that have been circulating in communities for some time. In this study, chimaeric RV-VLPs were generated from the consensus sequences of African rotaviruses (G2, G8, G9 or G12 strains associated with either P[4], P[6] or P[8] genotypes) characterised directly from human stool samples without prior adaptation of the wild type strains to cell culture. Codon-optimised sequences for insect cell expression of genome segments 2 (VP2), 4 (VP4), 6 (VP6) and 9 (VP7) were cloned into a modified pFASTBAC vector, which allowed simultaneous expression of up to four genes using the Bac-to-Bac Baculovirus Expression System (BEVS; Invitrogen). Several combinations of the genome segments originating from different field strains were cloned to produce double-layered RV-VLPs (dRV-VLP; VP2/6), triple-layered RV-VLPs (tRV-VLP; VP2/6/7 or VP2/6/7/4) and chimaeric tRV-VLPs. The RV-VLPs were produced by infecting Spodoptera frugiperda 9 and Trichoplusia ni cells with recombinant baculoviruses using multi-cistronic, dual co-infection and stepwise-infection expression strategies. The size and morphology of the RV-VLPs, as determined by transmission electron microscopy, revealed successful production of RV-VLPs. The novel approach of producing tRV-VLPs, by using the consensus insect cell codon-optimised nucleotide sequence derived from dsRNA extracted directly from clinical specimens, should speed-up vaccine research and development by by-passing the need to adapt rotaviruses to cell culture. Other problems associated with cell culture adaptation, such as possible changes in epitopes, can also be circumvented. Thus, it is now possible to generate tRV-VLPs for evaluation as non-live vaccine candidates for any human or animal field rotavirus strain. PMID:25268783

A novel polyomavirus from the nasal cavity of a giant panda (Ailuropoda melanoleuca).

PubMed

Qi, Dunwu; Shan, Tongling; Liu, Zhijian; Deng, Xutao; Zhang, Zhihe; Bi, Wenlei; Owens, Jacob Robert; Feng, Feifei; Zheng, Lisong; Huang, Feng; Delwart, Eric; Hou, Rong; Zhang, Wen

2017-10-27

Polyomaviruses infect a wide variety of mammalian and avian hosts with a broad spectrum of outcomes including asymptomatic infection, acute systemic disease, and tumor induction. Viral metagenomics and general PCR methods were used to detected viral nucleic acid in the samples from a diseased and healthy giant pandas. A novel polyomavirus, the giant panda polyomavirus 1 (GPPyV1) from the nasal cavity of a dead giant panda (Ailuropoda melanoleuca) was characterized. The GPPyV1 genome is 5144 bp in size and reveals five putative open-reading frames coding for the classic small and large T antigens in the early region, and the VP1, VP2 and VP3 capsid proteins in the late region. Phylogenetic analyses of the large T antigen of the GPPyV1 indicated GPPyV1 belonged to a putative new species within genus Deltapolyomavirus, clustering with four human polyomavirus species. The GPPyV1 VP1 and VP2 clustered with genus Alphapolyomavirus. Our epidemiologic study indicated that this novel polyomavirus was also detected in nasal swabs and fecal samples collected from captive healthy giant pandas. A novel polyomavirus was detected in giant pandas and its complete genome was characterized, which may cause latency infection in giant pandas.

Serological detection and analysis of anti-VP1 responses against various enteroviruses (EV) (EV-A, EV-B and EV-C) in Chinese individuals.

PubMed

Gao, Caixia; Ding, Yingying; Zhou, Peng; Feng, Jiaojiao; Qian, Baohua; Lin, Ziyu; Wang, Lili; Wang, Jinhong; Zhao, Chunyan; Li, Xiangyu; Cao, Mingmei; Peng, Heng; Rui, Bing; Pan, Wei

2016-02-26

The overall serological prevalence of EV infections based on ELISA remains unknown. In the present study, the antibody responses against VP1 of the EV-A species (enterovirus 71 (EV71), Coxsackievirus A16 (CA16), Coxsackievirus A5 (CA5) and Coxsackievirus A6 (CA6)), of the EV-B species (Coxsackievirus B3 (CB3)), and of the EV-C species (Poliovirus 1 (PV1)) were detected and analyzed by a NEIBM (novel evolved immunoglobulin-binding molecule)-based ELISA in Shanghai blood donors. The serological prevalence of anti-CB3 VP1 antibodies was demonstrated to show the highest level, with anti-PV1 VP1 antibodies at the second highest level, and anti-CA5, CA6, CA16 and EV71 VP1 antibodies at a comparatively low level. All reactions were significantly correlated at different levels, which were approximately proportional to their sequence similarities. Antibody responses against EV71 VP1 showed obvious differences with responses against other EV-A viruses. Obvious differences in antibody responses between August 2013 and May 2014 were revealed. These findings are the first to describe the detailed information of the serological prevalence of human antibody responses against the VP1 of EV-A, B and C viruses, and could be helpful for understanding of the ubiquity of EV infections and for identifying an effective approach for seroepidemiological surveillance based on ELISA.

Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

NASA Technical Reports Server (NTRS)

Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

1996-01-01

A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

Detection of the first G6P[14] human rotavirus strain in an infant with diarrhoea in Ghana.

PubMed

Damanka, Susan; Lartey, Belinda; Agbemabiese, Chantal; Dennis, Francis E; Adiku, Theophilus; Nyarko, Kofi; Ofori, Michael; Armah, George E

2016-11-10

Rotaviruses with G6P[14] specificity are mostly isolated in cattle and have been established as a rare cause of gastroenteritis in humans. This study reports the first detection of G6P[14] rotavirus strain in Ghana from the stool of an infant during a hospital-based rotavirus surveillance study in 2010. Viral RNA was extracted and rotavirus VP7 and VP4 genes amplified by one step RT-PCR using gene-specific primers. The DNA was purified, sequenced and genotypes determined using BLAST and RotaC v2.0. Phylogenetic tree was constructed using maximum likelihood method in MEGA v6.06 software and statistically supported by bootstrapping with 1000 replicates. Phylogenetic distances were calculated using the Kimura-2 parameter model. The study strain, GHA-M0084/2010 was characterised as G6P[14]. The VP7 gene of the Ghanaian strain clustered in G6 lineage-III together with artiodactyl and human rotavirus (HRV) strains. It exhibited the highest nucleotide (88.1 %) and amino acid (86.9 %) sequence identity with Belgian HRV strain, B10925. The VP8* fragment of the VP4 gene was closely related to HRV strains detected in France, Italy, Spain and Belgium. It exhibited the strongest nucleotide sequence identity (87.9 %) with HRV strains, PA169 and PR/1300 (Italy) and the strongest amino acid sequence identity (89.3 %) with HRV strain R2775/FRA/07 (France). The study reports the first detection of G6P[14] HRV strain in an infant in Ghana. The detection of G6P[14], an unusual strain pre-vaccine introduction in Ghana, suggests a potential compromise of vaccine effectiveness and indicates the necessity for continuous surveillance in the post vaccine era.

GENETIC CHARACTERIZATION OF CANINE PARVOVIRUS IN SYMPATRIC FREE-RANGING WILD CARNIVORES IN PORTUGAL.

PubMed

Miranda, Carla; Santos, Nuno; Parrish, Colin; Thompson, Gertrude

2017-10-01

Since its emergence in the 1970s, canine parvovirus (CPV) has been reported in domestic and nondomestic carnivores worldwide with severe implications on their health and survival. Here, we aim to better understand CPV circulation in multihost-pathogens systems by characterizing CPV DNA or viruses in 227 free-ranging wild carnivores of 12 species from Portugal. Collected samples during 1995-2011 were analyzed by PCR and sequence analysis. The canine parvovirus DNA was detected in 4 (2%) animals of two species, namely in wolves (Canis lupus; 3/63, 5%, 95% confidence interval=1.6-3.15) and in a stone marten (Martes foina; 1/36, 3%, 95% confidence interval=0.5-14.2). Viruses in two wolves had VP2 residue 426 as aspartic acid (so-called CPV-2b) and the third had VP2 residue 426 as asparagine (CPV-2a), while the virus in the stone marten uniquely had VP2 residue 426 as glutamic acid (CPV-2c). The comparative analysis of the full-length VP2 gene of our isolates showed other nonsynonymous mutations. The phylogenetic analysis demonstrated that the sequences from wolves clustered together, showing a close relationship with European domestic dogs (Canis lupus familiaris) and wolf strains while the viral sequence from the stone marten grouped with other viruses contained the glutamic acid VP2 426 along with raccoon (Procyon lotor), bobcat (Lynx rufus), and domestic dog strains. This study confirmed that wild carnivores in Portugal are infected by CPV variants, strongly suggesting viral transmission between the wild and domestic populations and suggesting a need for a better understanding of the epidemiology of the disease and its management in wild populations.

Molecular Evolution of Enterovirus 68 Detected in the Philippines

PubMed Central

Imamura, Tadatsugu; Suzuki, Akira; Lupisan, Socorro; Okamoto, Michiko; Aniceto, Rapunzel; Egos, Rutchie J.; Daya, Edgardo E.; Tamaki, Raita; Saito, Mariko; Fuji, Naoko; Roy, Chandra Nath; Opinion, Jaime M.; Santo, Arlene V.; Macalalad, Noel G.; Tandoc, Amado; Sombrero, Lydia; Olveda, Remigio; Oshitani, Hitoshi

2013-01-01

Background Detection of Enterovirus 68 (EV68) has recently been increased. However, underlying evolutionary mechanism of this increasing trend is not fully understood. Methods Nasopharyngeal swabs were collected from 5,240 patients with acute respiratory infections in the Philippines from June 2009 to December 2011. EV68 was detected by polymerase chain reaction (PCR) targeting for 5′ untranslated region (5′UTR), viral protein 1 (VP1), and VP4/VP2. Phylogenetic trees were generated using the obtained sequences. Results Of the 5,240 tested samples, 12 EV68 positive cases were detected between August and December in 2011 (detection rate, 0.23%). The detection rate was higher among inpatients than outpatients (p<0.0001). Among VP1 sequences detected from 7 patients in 2011, 5 in lineage 2 were diverged from those detected in the Philippines in 2008, however, 2 in lineage 3 were not diverged from strains detected in the Philippines in 2008 but closely associated with strains detected in the United States. Combined with our previous report, EV68 occurrences were observed twice in the Philippines within the last four years. Conclusions EV68 detections might be occurring in cyclic patterns, and viruses might have been maintained in the community while some strains might have been newly introduced. PMID:24073203

Development of ELISA using recombinant antigens for specific detection of mouse parvovirus infection.

PubMed

Kunita, Satoshi; Chaya, Miyuki; Hagiwara, Kozue; Ishida, Tomoko; Takakura, Akira; Sugimoto, Tatsuya; Iseki, Hiroyoshi; Fuke, Kumiko; Sugiyama, Fumihiro; Yagami, Ken-ichi

2006-04-01

Nucleotide sequences of mouse parvovirus (MPV) isolate, named MPV/UT, and mouse minute virus (MMV) were analyzed and used for expressing recombinant proteins in E. coli. ELISA tests using recombinant major capsid protein (rVP2) and recombinant major non-structural protein (rNS1) as antigens were developed and their performance in serologic detection of rodent parvovirus infection was assessed. MPV-rVP2 and MMV-rVP2 ELISAs reacted specifically with anti-MPV and anti-MMV mouse sera, respectively. MMV-rNS1 antigen had a wide reaction range with antisera to rodent parvoviruses including MPV, MMV, Kilham rat virus (KRV) and H-1 virus. All mice oronasally infected with MPV were seropositive at 4 weeks post-infection in screening by ELISAs using MPV-rVP2 and MMV-rNS1 antigens, but were negative by conventional ELISA using whole MMV antigen. A contact transmission experiment revealed that transmission of MPV occurred up to 4 weeks post-infection, and all cage mates were seropositive in screening with MPV-rVP2 and MMV-rNS1 ELISAs. These results indicate that MPV-rVP2 and MMV-rVP2 are specific ELISA antigens which distinguish between MPV and MVM infection, while MMV-rNS1 antigen can be used in generic ELISA for a variety of rodent parvoviruses. The higher sensitivity of MPV-rVP2 ELISA than conventional ELISA for detecting seroconversion to MPV in oronasally infected mice as well as in cage mates suggests the usefulness of MPV-rVP2 ELISA in quarantine and microbiological monitoring of MPV infection in laboratory mice.

First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

PubMed Central

Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng

2014-01-01

Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China. PMID:25007818

Molecular identification of enteroviruses including two new types (EV-98 and EV-107) isolated from Japanese travellers from Asian countries.

PubMed

Yamashita, Teruo; Ito, Miyabi; Tsuzuki, Hideaki; Sakae, Kenji; Minagawa, Hiroko

2010-04-01

Of 58 enterovirus strains isolated from Japanese travellers returning from Asian countries, eight were non-serotypable with existing antisera. By sequencing a part of the VP1 region, six of these strains were typed as echovirus 9, enterovirus (EV)-73, EV-79 or EV-97. The nucleotide identity of the VP1 region of isolate T92-1499 to all enterovirus prototypes was <70 %. The VP1 sequence of isolate TN94-0349 was closely related to coxsackievirus (CV)-A9 (73.3 % nucleotide identity), but the virus could not be neutralized with a serum raised against the prototype CV-A9 strain. On the basis of complete molecular comparisons, T92-1499 and TN94-0349 were identified as EV-98 and EV-107, respectively, by the ICTV Picornavirus Study Group. Serum neutralization tests of Japanese individuals revealed a seroprevalence rate of 11 % for EV-73, and even lower seroprevalence rates, 1.0-3.8 %, were found for the other new enteroviruses, suggesting that prior circulation of these viruses in Japan was unlikely.

Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China.

PubMed

Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo

2014-04-01

Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

PubMed

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Detection of Rare G3P[19] Porcine Rotavirus Strains in Chiang Mai, Thailand, Provides Evidence for Origin of the VP4 Genes of Mc323 and Mc345 Human Rotaviruses▿

PubMed Central

Maneekarn, Niwat; Khamrin, Pattara; Chan-it, Wisoot; Peerakome, Supatra; Sukchai, Sujin; Pringprao, Kidsadagon; Ushijima, Hiroshi

2006-01-01

Among 175 fecal specimens collected from diarrheic piglets during a surveillance of porcine rotavirus (PoRV) strains in Chiang Mai, Thailand, 39 (22.3%) were positive for group A rotaviruses. Of these, 33.3% (13 of 39) belonged to G3P[19], which was a rare P genotype seldom reported. Interestingly, their VP4 nucleotide sequences were most closely related to human P[19] strains (Mc323 and Mc345) isolated in 1989 from the same geographical area where these PoRV strains were isolated. These P[19] PoRV strains were also closely related to another human P[19] strain (RMC321), isolated from India in 1990. The VP4 sequence identities with human P[19] were 95.4% to 97.4%, while those to a porcine P[19] strain (4F) were only 87.6 to 89.1%. Phylogenetic analysis of the VP4 gene revealed that PoRV P[19] strains clustered with human P[19] strains in a monophyletic branch separated from strain 4F. Analysis of the VP7 gene confirmed that these strains belonged to the G3 genotype and shared 97.7% to 98.3% nucleotide identities with other G3 PoRV strains circulating in the regions. This close genetic relationship was also reflected in the phylogenetic analysis of their VP7 genes. Altogether, the findings provided peculiar evidence that supported the porcine origin of VP4 genes of Mc323 and Mc345 human rotaviruses. PMID:16988014

Culture-dependent and culture-independent assessment of spoilage community growth on VP lamb meat from packaging to past end of shelf-life.

PubMed

Kaur, Mandeep; Shang, Hongshan; Tamplin, Mark; Ross, Tom; Bowman, John P

2017-12-01

Packaging and storage temperature are important factors that influence the shelf-life of vacuum packed (VP) meat. In this study the shelf-life of VP bone-in lamb hind shanks stored at 8 °C and -1.2 °C was determined in parallel to analyses of starting and eventual spoilage bacterial communities via Illumina MiSeq based 16S rRNA amplicon sequencing. The mean total viable counts (TVC) and lactic acid bacterial viable counts (LAB) were observed to increase to log 7.5 CFU/cm 2 and 7 CFU/cm 2 after 6 and 42 days at 8 °C and -1.2 °C and stayed stable until shelf-life termination after 13 and 124 days, respectively. The sequence data showed initial communities were patchily distributed and were mainly derived from skin microbiome taxa likely prevalent within the abattoir. A broad diversity of VP meat associated specific spoilage organisms (SSO) were comparatively abundant in this initial population. Overtime meat spoilage communities developed a distinctive and stable microbiome. At -1.2 °C SSO included mainly Carnobacterium, Yersinia and Clostridium spp. while at 8 °C SSO expanded to include Hafnia, Lactococcus, Providencia spp. Growth curves inferred from the sequence data after taking into account rRNA copy number suggested that SSO growth rates were consistent with overall growth rates determined from TVC and LAB data and are predictable. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Abrogation of Microsatellite-instable Tumors Using a Highly Selective Suicide Gene/Prodrug Combination

PubMed Central

Ferrás, Cristina; Oude Vrielink, Joachim AF; Verspuy, Johan WA; te Riele, Hein; Tsaalbi-Shtylik, Anastasia; de Wind, Niels

2009-01-01

A substantial fraction of sporadic and inherited colorectal and endometrial cancers in humans is deficient in DNA mismatch repair (MMR). These cancers are characterized by length alterations in ubiquitous simple sequence repeats, a phenotype called microsatellite instability. Here we have exploited this phenotype by developing a novel approach for the highly selective gene therapy of MMR-deficient tumors. To achieve this selectivity, we mutated the VP22FCU1 suicide gene by inserting an out-of-frame microsatellite within its coding region. We show that in a significant fraction of microsatellite-instable (MSI) cells carrying the mutated suicide gene, full-length protein becomes expressed within a few cell doublings, presumably resulting from a reverting frameshift within the inserted microsatellite. Treatment of these cells with the innocuous prodrug 5-fluorocytosine (5-FC) induces strong cytotoxicity and we demonstrate that this owes to multiple bystander effects conferred by the suicide gene/prodrug combination. In a mouse model, MMR-deficient tumors that contained the out-of-frame VP22FCU1 gene displayed strong remission after treatment with 5-FC, without any obvious adverse systemic effects to the mouse. By virtue of its high selectivity and potency, this conditional enzyme/prodrug combination may hold promise for the treatment or prevention of MMR-deficient cancer in humans. PMID:19471249

Whole-genome sequencing and analyses identify high genetic heterogeneity, diversity and endemicity of rotavirus genotype P[6] strains circulating in Africa.

PubMed

Nyaga, Martin M; Tan, Yi; Seheri, Mapaseka L; Halpin, Rebecca A; Akopov, Asmik; Stucker, Karla M; Fedorova, Nadia B; Shrivastava, Susmita; Duncan Steele, A; Mwenda, Jason M; Pickett, Brett E; Das, Suman R; Jeffrey Mphahlele, M

2018-05-18

Rotavirus A (RVA) exhibits a wide genotype diversity globally. Little is known about the genetic composition of genotype P[6] from Africa. This study investigated possible evolutionary mechanisms leading to genetic diversity of genotype P[6] VP4 sequences. Phylogenetic analyses on 167 P[6] VP4 full-length sequences were conducted, which included six porcine-origin sequences. Of the 167 sequences, 57 were newly acquired through whole genome sequencing as part of this study. The other 110 sequences were all publicly-available global P[6] VP4 full-length sequences downloaded from GenBank. The strength of association between the phenotypic features and the phylogeny was also determined. A number of reassortment and mixed infections of RVA genotype P[6] strains were observed in this study. Phylogenetic analyses demostrated the extensive genetic diversity that exists among human P[6] strains, porcine-like strains, their concomitant clades/subclades and estimated that P[6] VP4 gene has a higher substitution rate with the mean of 1.05E-3 substitutions/site/year. Further, the phylogenetic analyses indicated that genotype P[6] strains were endemic in Africa, characterised by an extensive genetic diversity and long-time local evolution of the viruses. This was also supported by phylogeographic clustering and G-genotype clustering of the P[6] strains when Bayesian Tip-association Significance testing (BaTS) was applied, clearly supporting that the viruses evolved locally in Africa instead of spatial mixing among different regions. Overall, the results demonstrated that multiple mechanisms such as reassortment events, various mutations and possibly interspecies transmission account for the enormous diversity of genotype P[6] strains in Africa. These findings highlight the need for continued global surveillance of rotavirus diversity. Copyright © 2018 Elsevier B.V. All rights reserved.

Construction and cellular immune response induction of HA-based alphavirus replicon vaccines against human-avian influenza (H5N1).

PubMed

Yang, Shi-gui; Wo, Jian-er; Li, Min-wei; Mi, Fen-fang; Yu, Cheng-bo; Lv, Guo-liang; Cao, Hong-Cui; Lu, Hai-feng; Wang, Bao-hong; Zhu, Hanping; Li, Lan-Juan

2009-12-09

Several approaches are being taken worldwide to develop vaccines against H5N1 viruses; most of them, however, pose both practical and immunological challenges. One potential strategy for improving the immunogenicity of vaccines involves the use of alphavirus replicons and VP22, a herpes simplex type 1 (HSV-1) protein. In this study, we analysed the antigenic peptides and homogeneity of the HA sequences (human isolates of the H5N1 subtype, from 1997 to 2003) and explored a novel alphavirus replicon system of VP22 fused with HA, to assess whether the immunogenicity of an HA-based replicon vaccine could be induced and augmented via fusion with VP22. Further, replicon particles expressing VP22, and enhanced green fluorescent protein (EGFP) were individually used as controls. Cellular immune responses in mice immunised with replicons were evaluated by identifying specific intracellular cytokine production with flow cytometry (FCM). Animal-based experimentation indicated that both the IL-4 expression of CD4(+) T cells and the IFN-gamma expression of CD8(+) T cells were significantly increased in mice immunised with VPR-HA and VPR-VP22/HA. A dose titration effect vis-à-vis both IL-4 expression and IFN-gamma expression were observed in VPR-HA- and VPR-VP22/HA-vaccinated mice. Our results revealed that both VPR-VP22/HA and VPR-HA replicon particles presented a promising approach for developing vaccines against human-avian influenza, and VP22 could enhance the immunogenicity of the HA antigens to which it is fused.

Mutations in the putative calcium-binding domain of polyomavirus VP1 affect capsid assembly

NASA Technical Reports Server (NTRS)

Haynes, J. I. 2nd; Chang, D.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

Calcium ions appear to play a major role in maintaining the structural integrity of the polyomavirus and are likely involved in the processes of viral uncoating and assembly. Previous studies demonstrated that a VP1 fragment extending from Pro-232 to Asp-364 has calcium-binding capabilities. This fragment contains an amino acid stretch from Asp-266 to Glu-277 which is quite similar in sequence to the amino acids that make up the calcium-binding EF hand structures found in many proteins. To assess the contribution of this domain to polyomavirus structural integrity, the effects of mutations in this region were examined by transfecting mutated viral DNA into susceptible cells. Immunofluorescence studies indicated that although viral protein synthesis occurred normally, infective viral progeny were not produced in cells transfected with polyomavirus genomes encoding either a VP1 molecule lacking amino acids Thr-262 through Gly-276 or a VP1 molecule containing a mutation of Asp-266 to Ala. VP1 molecules containing the deletion mutation were unable to bind 45Ca in an in vitro assay. Upon expression in Escherichia coli and purification by immunoaffinity chromatography, wild-type VP1 was isolated as pentameric, capsomere-like structures which could be induced to form capsid-like structures upon addition of CaCl2, consistent with previous studies. However, although VP1 containing the point mutation was isolated as pentamers which were indistinguishable from wild-type VP1 pentamers, addition of CaCl2 did not result in their assembly into capsid-like structures. Immunogold labeling and electron microscopy studies of transfected mammalian cells provided in vivo evidence that a mutation in this region affects the process of viral assembly.

Dynamics and asymmetry in the dimer of the norovirus major capsid protein.

PubMed

Tubiana, Thibault; Boulard, Yves; Bressanelli, Stéphane

2017-01-01

Noroviruses are the major cause of non-bacterial acute gastroenteritis in humans and livestock worldwide, despite being physically among the simplest animal viruses. The icosahedral capsid encasing the norovirus RNA genome is made of 90 dimers of a single ca 60-kDa polypeptide chain, VP1, arranged with T = 3 icosahedral symmetry. Here we study the conformational dynamics of this main building block of the norovirus capsid. We use molecular modeling and all-atom molecular dynamics simulations of the VP1 dimer for two genogroups with 50% sequence identity. We focus on the two points of flexibility in VP1 known from the crystal structure of the genogroup I (GI, human) capsid and from subsequent cryo-electron microscopy work on the GII capsid (also human). First, with a homology model of the GIII (bovine) VP1 dimer subjected to simulated annealing then classical molecular dynamics simulations, we show that the N-terminal arm conformation seen in the GI crystal structure is also favored in GIII VP1 but depends on the protonation state of critical residues. Second, simulations of the GI dimer show that the VP1 spike domain will not keep the position found in the GII electron microscopy work. Our main finding is a consistent propensity of the VP1 dimer to assume prominently asymmetric conformations. In order to probe this result, we obtain new SAXS data on GI VP1 dimers. These data are not interpretable as a population of symmetric dimers, but readily modeled by a highly asymmetric dimer. We go on to discuss possible implications of spontaneously asymmetric conformations in the successive steps of norovirus capsid assembly. Our work brings new lights on the surprising conformational range encoded in the norovirus major capsid protein.

Mutations Allow JC Polyomaviruses to Elude Antibody Recognition | Center for Cancer Research

Cancer.gov

JC polyomavirus (JCV) infects the urinary tract of most adults. In healthy individuals, JCV infection does not cause noticeable symptoms. However, in those with compromised immune systems, JCV can cause a lethal brain disease called progressive multifocal leukoencephalopathy (PML). Data from a recently approved assay to detect serum antibodies specific for the JCV protein VP1 revealed that patients with antibodies are at increased risk of developing PML. At the same time, sequencing studies of JCV in cerebrospinal fluid (CSF) identified a number of mutations in VP1. Christopher Buck, Ph.D., and Diana Pastrana, Ph.D., of CCR’s Laboratory of Cellular Oncology, and their colleagues hypothesized that the VP1 mutations could allow the virus to evade antibody-mediated elimination.

Identification of antigenic regions on VP2 of African horsesickness virus serotype 3 by using phage-displayed epitope libraries.

PubMed

Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H

2000-04-01

VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.

A porcine G9 rotavirus strain shares neutralization and VP7 phylogenetic sequence lineage 3 characteristics with contemporary human G9 rotavirus strains.

PubMed

Hoshino, Yasutaka; Honma, Shinjiro; Jones, Ronald W; Ross, Jerri; Santos, Norma; Gentsch, Jon R; Kapikian, Albert Z; Hesse, Richard A

2005-02-05

Of five globally important VP7 (G) serotypes (G1-4 and 9) of group A rotaviruses (the single most important etiologic agents of infantile diarrhea worldwide), G9 continues to attract considerable attention because of its unique natural history. Serotype G9 rotavirus was isolated from a child with diarrhea first in the United States in 1983 and subsequently in Japan in 1985. Curiously, soon after their detection, G9 rotaviruses were not detected for about a decade in both countries and then reemerged in both countries in the mid-1990s. Unexpectedly, however, such reemerged G9 strains were distinct genetically and molecularly from those isolated in the 1980s. Thus, the origin of the reemerged G9 viruses remains an enigma. Sequence analysis has demonstrated that the G9 rotavirus VP7 gene belongs to one of at least three phylogenetic lineages: lineage 1 (strains isolated in the 1980s in the United States and Japan), lineage 2 (strains first isolated in 1986 and exclusively in India thus far), and lineage 3 (strains that emerged/reemerged in the mid-1990s). Currently, lineage 3 G9 viruses are the most frequently detected G9 strains globally. We characterized a porcine rotavirus (A2 strain) isolated in the United States that was known to belong to the P[7] genotype but had not been serotyped by neutralization. The A2 strain was found to bear serotype G9 and P9 specificities as well as NSP4 [B] and subgroup I characteristics. By VP7-specific neutralization, the porcine G9 strain was more closely related to lineage 3 viruses than to lineage 1 or 2 viruses. Furthermore, by sequence analysis, the A2 VP7 was shown to belong to lineage 3 G9. These findings raise intriguing questions regarding possible explanations for the emergence of variations among the G9 strains.

The Ebola virus VP35 protein binds viral immunostimulatory and host RNAs identified through deep sequencing.

PubMed

Dilley, Kari A; Voorhies, Alexander A; Luthra, Priya; Puri, Vinita; Stockwell, Timothy B; Lorenzi, Hernan; Basler, Christopher F; Shabman, Reed S

2017-01-01

Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN) response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV), and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA) or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI) RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV). Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR) activation.

The Ebola virus VP35 protein binds viral immunostimulatory and host RNAs identified through deep sequencing

PubMed Central

Voorhies, Alexander A.; Luthra, Priya; Puri, Vinita; Stockwell, Timothy B.; Lorenzi, Hernan; Basler, Christopher F.; Shabman, Reed S.

2017-01-01

Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN) response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV), and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA) or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI) RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV). Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR) activation. PMID:28636653

A core functional region of the RFP1 promoter from Chinese wild grapevine is activated by powdery mildew pathogen and heat stress.

PubMed

Yu, Yihe; Xu, Weirong; Wang, Jie; Wang, Lei; Yao, Wenkong; Xu, Yan; Ding, Jiahua; Wang, Yuejin

2013-01-01

RING-finger proteins (RFP) function as ubiquitin ligases and play key roles in plant responses to biotic and abiotic stresses. However, little information is available on the regulation of RFP expression. Here, we isolate and characterize the RFP promoter sequence from the disease-resistant Chinese wild grape Vitis pseudoreticulata accession Baihe-35-1. Promoter-GUS fusion assays revealed that defense signaling molecules, powdery mildew infection, and heat stress induce VpRFP1 promoter activity. By contrast, the RFP1 promoter isolated from Vitis vinifera was only slightly induced by pathogen infection and heat treatment. By promoter deletion analysis, we found that the -148 bp region of the VpRFP1 promoter was the core functional promoter region. We also found that, in Arabidopsis, VpRFP1 expressed under its own promoter activated defense-related gene expression and improved disease resistance, but the same construct using the VvRFP1 promoter slightly improve disease resistance. Our results demonstrated that the -148 bp region of the VpRFP1 promoter plays a key role in response to pathogen and heat stress, and suggested that expression differences between VpRFP1 and VvRFP1 may be key for the differing disease resistance phenotypes of the two Vitis genotypes.

Controlled conformational transitions in the MVM virion expose the VP1 N-terminus and viral genome without particle disassembly.

PubMed

Cotmore, S F; D'abramo, A M; Ticknor, C M; Tattersall, P

1999-02-01

Antisera were raised against peptides corresponding to the N-termini of capsid proteins VP1 and VP2 from the parvovirus minute virus of mice. Epitopes in the 142-amino-acid VP1-specific region were not accessible in the great majority of newly released viral particles, and sera directed against them failed to neutralize virus directly or deplete stocks of infectious virions. However, brief exposure to temperatures of 45 degreesC or more induced a conformational transition in a population of full virions, but not in empty viral particles, in which VP1-specific sequences became externally accessible. In contrast, the VP2 N-terminus was antibody-accessible in all full, but not empty, particles without prior treatment. An electrophoretic mobility shift assay, in which particles were heat-treated and/or preincubated with antibodies prior to electrophoresis, confirmed this pattern of epitope accessibility, showing that the heat-induced conformational transition produces a retarded form of virion that can be supershifted by incubation with VP1-specific sera. The proportion of virions undergoing transition increased with temperature, but at all temperatures up to 70 degreesC viral particles retained structure-specific antigenic determinants and remained essentially intact, without shedding individual polypeptide species or subunits. However, despite the apparent integrity of its protective coat, the genome became accessible to externally applied enzymes in an increasing proportion of virions through this temperature range, suggesting that the conformational transitions that expose VP1 likely also allow access to the genome. Heating particles to 80 degreesC or above finally induced disassembly to polypeptide monomers. Copyright 1999 Academic Press.

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

Evaluation of the immunogenicity of a recombinant HSV-1 vector expressing human group C rotavirus VP6 protein.

PubMed

Rota, Rosana P; Palacios, Carlos A; Temprana, C Facundo; Argüelles, Marcelo H; Mandile, Marcelo G; Mattion, Nora; Laimbacher, Andrea S; Fraefel, Cornell; Castello, Alejandro A; Glikmann, Graciela

2018-06-01

Group C Rotavirus (RVC) has been associated globally with sporadic outbreaks of gastroenteritis in children and adults. RVC also infects animals, and interspecies transmission has been reported as well as its zoonotic potential. Considering its genetic diversity and the absence of effective vaccines, it is important and necessary to develop new generation vaccines against RVC for both humans and animals. The aim of the present study was to develop and characterize an HSV-1-based amplicon vector expressing a human RVC-VP6 protein and evaluate the humoral immune response induced after immunizing BALB/c mice. Local fecal samples positive for RVC were used for isolation and sequencing of the vp6 gene, which phylogenetically belongs to the I2 genotype. We show here that cells infected with the HSV[VP6C] amplicon vector efficiently express the VP6 protein, and induced specific anti-RVC antibodies in mice immunized with HSV[VP6C], in a prime-boost schedule. This work highlights that amplicon vectors are an attractive platform for the generation of safe genetic immunogens against RVC, without the addition of external adjuvants. Copyright © 2018 Elsevier B.V. All rights reserved.

Constitutive heterologous overexpression of a TIR-NB-ARC-LRR gene encoding a putative disease resistance protein from wild Chinese Vitis pseudoreticulata in Arabidopsis and tobacco enhances resistance to phytopathogenic fungi and bacteria.

PubMed

Wen, Zhifeng; Yao, Liping; Singer, Stacy D; Muhammad, Hanif; Li, Zhi; Wang, Xiping

2017-03-01

Plants use resistance (R) proteins to detect pathogen effector proteins and activate their innate immune response against the pathogen. The majority of these proteins contain an NB-ARC (nucleotide-binding adaptor shared by APAF-1, R proteins, and CED-4) domain along with a leucine-rich repeat (LRR), and some also bear a toll interleukin 1 receptor (TIR) domain. In this study, we characterized a gene encoding a TIR-NB-ARC-LRR R protein (VpTNL1) (GenBank accession number KX649890) from wild Chinese grapevine Vitis pseudoreticulata accession "Baihe-35-1", which was identified previously from a transcriptomic analysis of leaves inoculated with powdery mildew (PM; Erysiphe necator (Schw.)). The VpTNL1 transcript was found to be highly induced in V. pseudoreticulata following inoculation with E. necator, as well as treatment with salicylic acid (SA). Sequence analysis demonstrated that the deduced amino acid sequence contained a TIR domain at the N-terminus, along with an NB-ARC and four LRRs domains within the C-terminus. Constitutive expression of VpTNL1 in Arabidopsis thaliana resulted in either a wild-type or dwarf phenotype. Intriguingly, the phenotypically normal transgenic lines displayed enhanced resistance to Arabidopsis PM, Golovinomyces cichoracearum, as well as to the virulent bacterial pathogen Pseudomonas syringae pv. tomato DC3000. Similarly, constitutive expression of VpTNL1 in Nicotiana tabacum was found to confer enhanced resistance to tobacco PM, Erysiphe cichoacearum DC. Subsequent isolation of the VpTNL1 promoter and deletion analysis indicated that TC-rich repeats and TCA elements likely play an important role in its response to E. necator and SA treatment, respectively. Taken together, these results indicate that VpTNL1 contributes to PM resistance in grapevine and provide an interesting gene target for the future amelioration of grape via breeding and/or biotechnology. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Bioinformatics analysis and characteristics of VP23 encoded by the newly identified UL18 gene of duck enteritis virus

NASA Astrophysics Data System (ADS)

Chen, Xiwen; Cheng, Anchun; Wang, Mingshu; Xiang, Jun

2011-10-01

In this study, the predicted information about structures and functions of VP23 encoded by the newly identified DEV UL18 gene through bioinformatics softwares and tools. The DEV UL18 was predicted to encode a polypeptide with 322 amino acids, termed VP23, with a putative molecular mass of 35.250 kDa and a predicted isoelectric point (PI) of 8.37, no signal peptide and transmembrane domain in the polypeptide. The prediction of subcellular localization showed that the DEV-VP23 located at endoplasmic reticulum with 33.3%, mitochondrial with 22.2%, extracellular, including cell wall with 11.1%, vesicles of secretory system with 11.1%, Golgi with 11.1%, and plasma membrane with 11.1%. The acid sequence of analysis showed that the potential antigenic epitopes are situated in 45-47, 53-60, 102-105, 173-180, 185-189, 260-265, 267-271, and 292-299 amino acids. All the consequences inevitably provide some insights for further research about the DEV-VP23 and also provide a fundament for further study on the the new type clinical diagnosis of DEV and can be used for the development of new DEV vaccine.

Seismic tomography of the area of the 2010 Beni-Ilmane earthquake sequence, north-central Algeria.

PubMed

Abacha, Issam; Koulakov, Ivan; Semmane, Fethi; Yelles-Chaouche, Abd Karim

2014-01-01

The region of Beni-Ilmane (District of M'sila, north-central Algeria) was the site of an earthquake sequence that started on 14 May 2010. This sequence, which lasted several months, was triggered by conjugate E-W reverse and N-S dextral faulting. To image the crustal structure of these active faults, we used a set of 1406 well located aftershocks events and applied the local tomography software (LOTOS) algorithm, which includes absolute source location, optimization of the initial 1D velocity model, and iterative tomographic inversion for 3D seismic P- and S-wave velocities (and the Vp/Vs ratio), and source parameters. The patterns of P-wave low-velocity anomalies correspond to the alignments of faults determined from geological evidence, and the P-wave high-velocity anomalies may represent rigid blocks of the upper crust that are not deformed by regional stresses. The S-wave low-velocity anomalies coincide with the aftershock area, where relatively high values of Vp/Vs ratio (1.78) are observed compared with values in the surrounding areas (1.62-1.66). These high values may indicate high fluid contents in the aftershock area. These fluids could have been released from deeper levels by fault movements during earthquakes and migrated rapidly upwards. This hypothesis is supported by vertical sections across the study area show that the major Vp/Vs anomalies are located above the seismicity clusters.

Rational design of Pleurotus eryngii versatile ligninolytic peroxidase for enhanced pH and thermal stability through structure-based protein engineering.

PubMed

Gao, Yu; Li, Jian-Jun; Zheng, Lanyan; Du, Yuguang

2017-11-01

Versatile peroxidase (VP) from Pleurotus eryngii is a high redox potential peroxidase. It has aroused great biotechnological interest due to its ability to oxidize a wide range of substrates, but its application is still limited due to low pH and thermal stability. Since CiP (Coprinopsis cinerea peroxidase) and PNP (peanut peroxidase) exhibited higher pH and thermal stability than VP, several motifs, which might contribute to their pH and thermal stability, were identified through structure and sequence alignment. Six VP variants incorporating the beneficial motifs were designed and constructed. Most variants were nearly completely inactivated except V1 (Variant 1) and V4. V1 showed comparable activity to WT VP against ABTS, while V4 exhibited reduced activity. V1 displayed improved pH stability than WT VP, at pH 3.0 in particular, whereas the pH stability of V4 did not change a lot. The thermal stabilities of V1 and V4 were enhanced with T50 raised by 3°C. The results demonstrated that variants containing the beneficial motifs of CiP and PNP conferred VP with improved pH and thermal stability. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Genomic characterization of two new enterovirus types, EV-A114 and EV-A121.

PubMed

Deshpande, Jagadish M; Sharma, Deepa K; Saxena, Vinay K; Shetty, Sushmitha A; Qureshi, Tarique Husain I H; Nalavade, Uma P

2016-12-01

Enteroviruses cause a variety of illnesses of the gastrointestinal tract, central nervous system and cardiovascular system. Phylogenetic analysis of VP1 sequences has identified 106 different human enteroviruses classified into four enterovirus species within the genus Enterovirus of the family Picornaviridae. It is likely that not all enterovirus types have been discovered. Between September 2013 and October 2014, stool samples of 6274 apparently healthy children of up to 5 years of age residing in Gorakhpur district, Uttar Pradesh, India were screened for enteroviruses. Virus isolates obtained in RD and Hep-2c cells were identified by complete VP1 sequencing. Enteroviruses were isolated from 3042 samples. A total of 87 different enterovirus types were identified. Two isolates with 71 and 74 % nucleotide sequence similarity to all other known enteroviruses were recognized as novel types. In this paper we report identification and complete genome sequence analysis of these two isolates classified as EV-A114 and EV-A121.

Comparative characteristics of the VP7 and VP4 antigenic epitopes of the rotaviruses circulating in Russia (Nizhny Novgorod) and the Rotarix and RotaTeq vaccines.

PubMed

Morozova, O V; Sashina, T A; Fomina, S G; Novikova, N A

2015-07-01

Two live, attenuated rotavirus A (RVA) vaccines, Rotarix and RotaTeq, have been successfully introduced into national immunization programs worldwide. The parent strains of both vaccines were obtained more than 30 years ago. Nonetheless, only very limited data are available on the molecular similarity of the vaccine strains and their genetic relationships to the wild-type strains circulating within the territory of Russian Federation. In this study, we have determined the nucleotide sequences of the genes encoding the viral proteins VP7 and VP4 (the globular domain VP8*) of vaccine strains and natural isolates of rotaviruses in Nizhny Novgorod, Russia. The VP7 and VP4 proteins contain antigenic sites that are the main targets of neutralizing antibodies. Phylogenetic analysis based on VP4 and VP7 showed that the majority of the natural RVA isolates from Nizhny Novgorod and the vaccine strains belong to different clusters. Four amino acids within the VP7 antigenic sites were common in both the wild-type and vaccine strains. The largest number of amino acid differences was found between the vaccine strain Rotarix and the Nizhny Novgorod G2 strains (19 residues out of 29). From 3 to 5 amino acid differences per strain were identified in the antigenic sites of VP4 (domain VP8*) between wild-type strains and the vaccine RotaTeq, and 6-8 substitutions were found when they were compared with the vaccine strain Rotarix. For the first time, immunodominant T-cell epitopes of VP7 were analyzed, and differences in the sequences between the vaccine and the wild-type strains were found. The accumulation of amino acid substitutions in the VP7 and VP4 antigenic sites may potentially reduce the immune protection of vaccinated children from wild-type strains of rotavirus.

RNA binding specificity of Ebola virus transcription factor VP30.

PubMed

Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K

2016-09-01

The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

[Genetic variation analysis of canine parvovirus VP2 gene in China].

PubMed

Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

2009-11-01

To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

PubMed

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Species C Rotaviruses in Children with Diarrhea in India, 2010-2013: A Potentially Neglected Cause of Acute Gastroenteritis.

PubMed

Bhat, Sudipta; Kattoor, Jobin Jose; Malik, Yashpal Singh; Sircar, Shubhankar; Deol, Pallavi; Rawat, Vinita; Rakholia, Ritu; Ghosh, Souvik; Vlasova, Anastasia N; Nadia, Touil; Dhama, Kuldeep; Kobayashi, Nobumichi

2018-02-17

All over the world, children and adults are severely affected by acute gastroenteritis, caused by one of the emerging enteric pathogens, rotavirus C (RVC). At present, no extensive surveillance program is running for RVC in India, and its prevalence is largely unknown except cases of local outbreaks. Here, we intended to detect the presence of RVC in diarrheic children visiting or admitted to hospitals in Haldwani (state of Uttarakhand, India), a city located in the foothills of the Himalayas. During 2010-2013, we screened 119 samples for RVC by an RVC VP6 gene-specific RT-PCR. Of these, 38 (31.93%) were found positive, which is higher than the incidence rates reported so far from India. The phylogenetic analysis of the derived nucleotide sequences from one of the human RVC (HuRVC) isolates, designated as HuRVC/H28/2013/India, showed that the study isolate belongs to genotype I2, P2 and E2 for RVC structural genes 6 and 4 (VP6, and VP4) and non-structural gene 4 (NSP4), respectively. Furthermore, the VP6 gene of HuRVC/H28/2013/India shows the highest similarity to a recently-reported human-like porcine RVC (PoRVC/ASM140/2013/India, KT932963) from India suggesting zoonotic transmission. We also report a full-length NSP4 gene sequence of human RVC from India. Under the One-health platforms there is a need to launch combined human and animal RVC surveillance programs for a better understanding of the epidemiology of RVC infections and for implementing control strategies. Reoviridae , possess 11 double-stranded segments of RNA that encode six structural viral proteins (VP1, VP2, VP3, VP4, VP6, VP7) and five/six non-structural proteins (NSP1-NSP5/6) [7]. Based on the antigenic properties of the major inner capsid protein (VP6), RVs are subdivided into eight well-characterized species (A-H) and two putative species viz. I and J [8-10]. Humans and other mammalian species are affected by species A, B, C and H rotaviruses and birds by species D, F and G, and species E has been reported exclusively in pigs [7,8,11-17]. The newly-proposed species I is reported in dogs [18] and cats [19], whereas species J is found in bats [10].

Development of a One-Step Duplex RT-PCR Method for the Simultaneous Detection of VP3/VP1 and VP1/P2B Regions of the Hepatitis A Virus.

PubMed

Kim, Mi-Ju; Lee, Shin-Young; Kim, Hyun-Joong; Lee, Jeong Su; Joo, In Sun; Kwak, Hyo Sun; Kim, Hae-Yeong

2016-08-28

The simultaneous detection and accurate identification of hepatitis A virus (HAV) is critical in food safety and epidemiological studies to prevent the spread of HAV outbreaks. Towards this goal, a one-step duplex reverse-transcription (RT)-PCR method was developed targeting the VP1/P2B and VP3/VP1 regions of the HAV genome for the qualitative detection of HAV. An HAV RT-qPCR standard curve was produced for the quantification of HAV RNA. The detection limit of the duplex RT-PCR method was 2.8 × 10(1) copies of HAV. The PCR products enabled HAV genotyping analysis through DNA sequencing, which can be applied for epidemiological investigations. The ability of this duplex RT-PCR method to detect HAV was evaluated with HAV-spiked samples of fresh lettuce, frozen strawberries, and oysters. The limit of detection of the one-step duplex RT-PCR for each food model was 9.4 × 10(2) copies/20 g fresh lettuce, 9.7 × 10(3) copies/20 g frozen strawberries, and 4.1 × 10(3) copies/1.5 g oysters. Use of a one-step duplex RT-PCR method has advantages such as shorter time, decreased cost, and decreased labor owing to the single amplification reaction instead of four amplifications necessary for nested RT-PCR.

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Detection and characterization of hepatitis A virus circulating in Egypt.

PubMed

Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

2017-07-01

Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

VpWRKY3, a biotic and abiotic stress-related transcription factor from the Chinese wild Vitis pseudoreticulata.

PubMed

Zhu, Ziguo; Shi, Jiangli; Cao, Jiangling; He, Mingyang; Wang, Yuejin

2012-11-01

Chinese wild grapevine Vitis pseudoreticulata accession 'Baihe-35-1' is identified as the precious resource with multiple resistances to pathogens. A directional cDNA library was constructed from the young leaves inoculated with Erysiphe necator. A total of 3,500 clones were sequenced, yielding 1,727 unigenes. Among them, 762 unigenes were annotated and classified into three classes, respectively, using Gene Ontology, including 22 ESTs related to transcription regulator activity. A novel WRKY transcription factor was isolated from the library, and designated as VpWRKY3 (GenBank Accession No. JF500755). The full-length cDNA is 1,280 bp, encoding a WRKY protein of 320 amino acids. VpWRKY3 is localized to nucleus and functions as a transcriptional activator. QRT-PCR analysis showed that the VpWRKY3 specifically accumulated in response to pathogen, salicylic acid, ethylene and drought stress. Overexpression of VpWRKY3 in tobacco increased the resistance to Ralstonia solanacearum, indicating that VpWRKY3 participates in defense response. Furthermore, VpWRKY3 is also involved in abscisic acid signal pathway and salt stress. This experiment provided an important basis for understanding the defense mechanisms mediated by WRKY genes in China wild grapevine. Generation of the EST collection from the cDNA library provided valuable information for the grapevine breeding. Key message We constructed a cDNA library from Chinese wild grapevine leaves inoculated with powdery mildew. VpWRKY3 was isolated and demonstrated that it was involved in biotic and abiotic stress responses.

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose.

PubMed

Ju, Huanyu; Wei, Na; Wang, Qian; Wang, Chunyuan; Jing, Zhiqiang; Guo, Lu; Liu, Dapeng; Gao, Mingchun; Ma, Bo; Wang, Junwei

2011-05-27

Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particles (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs. Copyright © 2011 Elsevier Inc. All rights reserved.

Cloning and expression of a sorghum gene with homology to maize vp1. Its potential involvement in pre-harvest sprouting resistance.

PubMed

Carrari, F; Perez-Flore, L; Lijavetzky, D; Enciso, S; Sanchez, R; Benech-Arnold, R; Iusem, N

2001-04-01

Pre-harvest sprouting (PHS) in sorghum is related to the lack of a normal dormancy level during seed development and maturation. Based on previous evidence that seed dormancy in maize is controlled by the vp1 gene, we used a PCR-based approach to isolate two Sorghum bicolor genomic and cDNA clones from two genotypes exhibiting different PHS behaviour and sensitivity to abscisic acid (ABA). The two 699 amino acid predicted protein sequences differ in two residues at positions 341 (Gly or Cys within the repression domain) and 448 (Pro or Ser) and show over 80, 70 and 60% homology to maize, rice and oat VP1 proteins respectively. Expression analysis of the sorghum vp1 gene in the two lines shows a slightly higher level of vp1 mRNA in the embryos susceptible to PHS than in those resistant to PHS during embryogenesis. However, timing of expression was different between these genotypes during this developmental process. Whereas for the former the main peak of expression was observed at 20 days after pollination (DAP), the peak in the latter was found at later developmental stages when seed maturation was almost complete. Under favourable germination conditions and in the presence of fluridone (an inhibitor of ABA biosynthesis), sorghum vp1 mRNA showed to be consistently correlated with sensitivity to ABA but not with ABA content and dormancy.

Frequency and significance of parvovirus B19 infection in patients with rheumatoid arthritis.

PubMed

Naciute, Milda; Mieliauskaite, Diana; Rugiene, Rita; Nikitenkiene, Rita; Jancoriene, Ligita; Mauricas, Mykolas; Nora-Krukle, Zaiga; Murovska, Modra; Girkontaite, Irute

2016-12-01

The present study aims to clarify the possible involvement of parvovirus B19 (B19V) infection in rheumatoid arthritis (RA) pathogenesis by investigating the presence of B19V infection markers (genomic sequences and virus-specific antibodies) in association with the level of cytokines and RA clinical activity and aggressiveness. A total of 118 RA patients and 49 age- and sex-matched healthy volunteers were enrolled in the study. Nested PCR was used to detect B19V sequences in whole blood and cell-free plasma DNA, ELISA to detect virus-specific antibodies and cytokine levels in plasma and recomLine dot blot assay for antibodies to separate B19V antigens. The detection frequency of B19V DNA was higher in patients with RA (25.4 %) in comparison with healthy persons (18.4 %). B19V DNA in cell-free plasma (B19+p) was detected significantly often in RA patients in comparison with healthy controls (13.6 vs 2 %; P=0.0002). RA B19+p patients had higher disease activity and aggressiveness, decreased haemoglobin and increased erythrocyte sedimentation rates. IL-6 plasma levels were significantly higher in RA patients than in controls. Within the RA patients' group the IL-6 level was significantly increased in B19+p patients with disease activity scores of DAS28>5.2, high C-reactive protein and low haemoglobin. Contrary to the healthy controls, the majority of RA B19+p patients did not have antibodies to VP-1S (VP1u) and VP-N (N-terminal half of structural proteins VP1 and VP2), which correspond to the epitopes of neutralizing antibodies. These results indicate that B19V infection at least in some patients is involved in RA pathogenesis.

Detection of uncommon G3P[3] rotavirus A (RVA) strain in rat possessing a human RVA-like VP6 and a novel NSP2 genotype.

PubMed

Ianiro, Giovanni; Di Bartolo, Ilaria; De Sabato, Luca; Pampiglione, Guglielmo; Ruggeri, Franco M; Ostanello, Fabio

2017-09-01

Rotavirus is one of the leading causes of acute gastroenteritis in infants and young children. RVAs infect not only humans but also a wide range of mammals including rats, which represent a reservoir of several other zoonotic pathogens. Due to the segmented nature of the RVA genome, animal RVA strains can easily adapt to the human host by reassortment with co-infecting human viruses. This study aims to detect and characterize RVA in the intestinal content of Italian sinantropic rats (Rattus rattus). Out of 40 samples examined following molecular approach, one resulted positive for RVA. The molecular characterization of VP1-4, 6 and 7, and NSP1-5 genes by sequencing revealed the genomic constellation G3-P[3]-I1-R11-C11-M10-A22-N18-T14-E18-H13. This uncommon genomic combination includes: the VP1-4,VP7, the NSP1, 3, 4 and 5 gene segments, closely related to those of RVA from rodents, the N18 novel genotype established for the NSP2 gene segment and the human Wa-like VP6 gene, suggesting interspecies reassortment. Copyright © 2017 Elsevier B.V. All rights reserved.

SU-E-I-37: Eye Lens Dose Reduction From CT Scan Using Organ Based Tube Current Modulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, H; Rensselaer Polytechnic Inst., Troy, NY; Liu, T

Purpose: To investigate the eye lens dose reduction by CT scan with organ based tube current modulation (OBTCM) using GPU Monte Carlo code ARCHER-CT. Methods: 36 X-ray sources and bowtie filters were placed around the patient head with the projection angle interval of 10° for one rotation of CT scan, each projection was simulated respectively. The voxel eye models with high resolution(0.1mm*0.1mm*0.1mm) were used in the simulation and different tube voltage including 80kVp, 100kVp, 120kVp and 140kVp were taken into consideration. Results: The radiation doses to the eye lens increased with the tube voltage raised from 80kVp to 140kVp, andmore » the dose results from 0° (AP) direction are much higher than those from 180° (PA) direction for all the 4 different tube voltage investigated. This 360° projection dose characteristic enables organ based TCM, which can reduce the eye lens dose by more than 55%. Conclusion: As the eye lens belongs to superficial tissues, its radiation dose to external exposure like CT is direction sensitive, and this characteristic feature makes organ based TCM to be an effective way to reduce the eye lens dose, so more clinical use of this technique were recommended. National Nature Science Foundation of China(No.11475047)« less

Molecular docking and simulation studies of 3-(1-chloropiperidin-4-yl)-6-fluoro benzisoxazole 2 against VP26 and VP28 proteins of white spot syndrome virus.

PubMed

Sudharsana, S; Rajashekar Reddy, C B; Dinesh, S; Rajasekhara Reddy, S; Mohanapriya, A; Itami, T; Sudhakaran, R

2016-10-01

White spot syndrome virus (WSSV), an aquatic virus infecting shrimps and other crustaceans, is widely distributed in Asian subcontinents including India. The infection has led to a serious economic loss in shrimp farming. The WSSV genome is approximately 300 kb and codes for several proteins mediating the infection. The envelope proteins VP26 and VP28 play a major role in infection process and also in the interaction with the host cells. A comprehensive study on the viral proteins leading to the development of safe and potent antiviral therapeutic is of adverse need. The novel synthesized compound 3-(1-chloropiperidin-4-yl)-6-fluoro benzisoxazole 2 is proved to have potent antiviral activity against WSSV. The compound antiviral activity is validated in freshwater crabs (Paratelphusa hydrodomous). An in silico molecular docking and simulation analysis of the envelope proteins VP26 and VP28 with the ligand 3-(1-chloropiperidin-4-yl)-6-fluoro benzisoxazole 2 are carried out. The docking analysis reveals that the polar amino acids in the pore region of the envelope proteins were involved in the ligand binding. The influence of the ligand binding on the proteins is validated by the molecular dynamics and simulation study. These in silico approaches together demonstrate the ligand's efficiency in preventing the trimers from exhibiting their physiological function. © 2016 John Wiley & Sons Ltd.

Foot-and-mouth disease virus serotype SAT1 in cattle, Nigeria.

PubMed

Ehizibolo, D O; Haegeman, A; De Vleeschauwer, A R; Umoh, J U; Kazeem, H M; Okolocha, E C; Van Borm, S; De Clercq, K

2017-06-01

The knowledge of foot-and-mouth disease virus (FMDV) dynamics and epidemiology in Nigeria and the West Africa subregion is important to support local and regional control plans and international risk assessment. Foot-and-mouth disease virus serotype South African territories (SAT)1 was isolated, identified and characterized from an FMD outbreak in cattle in Nigeria in 2015, 35 years after the last report of FMDV SAT1 in West Africa. The VP1 coding sequence of the Nigerian 2015 SAT1 isolates diverges from reported SAT1 topotypes resulting in a separate topotype. The reporting of a novel FMDV SAT1 strain in the virus pool 5 (West and Central Africa) highlights the dynamic and complex nature of FMDV in this region of Africa. Sustained surveillance is needed to understand the origin, the extent and distribution of this novel SAT1 topotype in the region as well as to detect and monitor the occurrence of (re-)emerging FMDV strains. © 2017 Blackwell Verlag GmbH.

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Effects of Debris Entrainment and Multi-Phase Flow on Plug Loading in an MX Trench.

DTIC Science & Technology

1978-09-15

gas stream of density (pg) and velocity (Vg) is: -., * -) - * 2~ TD FD Pg (V P V) Vp-Vg I CD( TD ) (A.1) 4 where the drag coefficient (CD) is defined by...ATTN: FCPR ATTN: Code L53 , J. Forrest Field Command Naval Facilities Engineering Command Defense Nuclear Agency ATTN: Code 09M22C Livermore Division

Identification of the initiation site of poliovirus polyprotein synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dorner, A.J.; Dorner, L.F.; Larsen, G.R.

1982-06-01

The complete nucleotide sequence of poliovirus RNA has a long open reading frame capable of encoding the precursor polyprotein NCVPOO. The first AUG codon in this reading frame is located 743 nucleotides from the 5' end of the RNA and is preceded by eight AUG codons in all three reading frames. Because all proteins that map at the amino terminus of the polyprotein (P1-1a, VPO, and VP4) are blocked at their amino termini and previous studies of ribosome binding have been inconclusive, direct identification of the initiation site of protein synthesis was difficult. We separated and identified all of themore » tryptic peptides of capsid protein VP4 and correlated these peptides with the amino acid sequence predicted to follow the AUG codon at nucleotide 743. Our data indicate that VP4 begins with a blocked glycine that is encoded immediately after the AUG codon at nucleotide 743. An S1 nuclease analysis of poliovirus mRNA failed to reveal a splice in the 5' region. We concluded that synthesis of poliovirus polyprotein is initiated at nucleotide 743, the first AUG codon in the long open reading frame.« less

Characterization and Expression Analysis of a Retinoblastoma-Related Gene from Chinese Wild Vitis pseudoreticulata.

PubMed

Wen, Zhifeng; Gao, Min; Jiao, Chen; Wang, Qian; Xu, Hui; Walter, Monika; Xu, Weirong; Bassett, Carole; Wang, Xiping

2012-01-01

Retinoblastoma-related (RBR) genes, a conserved gene family in higher eukaryotes, play important roles in cell differentiation, development, and mammalian cell death; however, little is known of their function in plants. In this study, a RBR gene was isolated from the Chinese wild grape, Vitis pseudoreticulata W. T. Wang clone "Baihe-35-1", and designated as VpRBR . The cDNA sequence of VpRBR was 3,030 bp and contained an open reading frame of 3,024 bp. Conceptual translation of this gene indicated a composition of 1,007 amino acids with a predicted molecular mass of 117.3 kDa. The predicted protein showed a retinoblastoma-associated protein domain A from amino acid residues 416 to 579, and domain B from residues 726 to 855. The result of expression analysis indicated that VpRBR was expressed in tissues, leaves, stem, tendrils, flower, and grape skin at different expression levels. Further quantitative reverse transcription-PCR (qRT-PCR) data indicated that VpRBR levels were higher in Erysiphe necator-treated "Baihe-35-1" and "Baihe-13-1", two resistant clones of Chinese wild V. pseudoreticulata , than in E. necator-treated "Hunan-1", a susceptible clone of V. pseudoreticulata . Furthermore, the expression of VpRBR in response to salicylic acid (SA), methyl jasmonate (MeJA), and ethylene (Eth) in grape leaves was also investigated. Taken together, these data indicate that VpRBR may contribute to some aspect of powdery mildew resistance in grape.

Characterization of a G1P[8] rotavirus causing an outbreak of gastroenteritis in the Northern Territory, Australia, in the vaccine era.

PubMed

Donato, Celeste M; Cowley, Daniel; Snelling, Thomas L; Akopov, Asmik; Kirkness, Ewen F; Kirkwood, Carl D

2014-07-01

In 2010, a large outbreak of rotavirus gastroenteritis occurred in the Alice Springs region of the Northern Territory, Australia. The outbreak occurred 43 months after the introduction of the G1P[8] rotavirus vaccine Rotarix(®). Forty-three infants were hospitalized during the outbreak and analysis of fecal samples from each infant revealed a G1P[8] rotavirus strain. The outbreak strain was adapted to cell culture and neutralization assays were performed using VP7 and VP4 neutralizing monoclonal antibodies. The outbreak strain exhibited a distinct neutralization resistance pattern compared to the Rotarix(®) vaccine strain. Whole genome sequencing of the 2010 outbreak virus strain demonstrated numerous amino acid differences compared to the Rotarix(®) vaccine strain in the characterized neutralization epitopes of the VP7 and VP4 proteins. Phylogenetic analysis of the outbreak strain revealed a close genetic relationship to global strains, in particular RVA/Human-wt/BEL/BE0098/2009/G1P[8] and RVA/Human-wt/BEL/BE00038/2008/G1P[8] for numerous genes. The 2010 outbreak strain was likely introduced from a globally circulating population of strains rather than evolving from an endemic Australian strain. The outbreak strain possessed antigenic differences in the VP7 and VP4 proteins compared to the Rotarix(®) vaccine strain. The outbreak was associated with moderate vaccine coverage and possibly low vaccine take in the population.

Metagenomic Analysis of Viral Communities in (Hado)Pelagic Sediments

PubMed Central

Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken

2013-01-01

In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth = 9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 106 to 1011 viruses/cm3 of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24−30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10−3 in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95−99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses. PMID:23468952

Metagenomic analysis of viral communities in (hado)pelagic sediments.

PubMed

Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken

2013-01-01

In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth = 9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 10(6) to 10(11) viruses/cm(3) of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24-30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10(-3) in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95-99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses.

Molecular characterization of echovirus 30-associated outbreak of aseptic meningitis in Korea in 2008.

PubMed

Choi, Young Jin; Park, Kwi Sung; Baek, Kyoung Ah; Jung, Eun Hye; Nam, Hae Seon; Kim, Yong Bae; Park, Joon Soo

2010-03-01

Evaluation of the primary etiologic agents that cause aseptic meningitis outbreaks may provide valuable information regarding the prevention and management of aseptic meningitis. In Korea, an outbreak of aseptic meningitis caused by echovirus type 30 (E30) occurred from May to October in 2008. In order to determine the etiologic agent, CSF and/or stool specimens from 140 children hospitalized for aseptic meningitis at Soonchunhyang University Cheonan Hospital between June and October of 2008 were tested for virus isolation and identification. E30 accounted for 61.7% (37 cases) and echovirus 6 accounted for 21.7% (13 cases) of all the human enteroviruses (HEVs) isolates (60 cases in total). For the molecular characterization of the isolates, the VP1 gene sequence of 18 Korean E30 isolates was compared pairwise using the MegAlign with 34 reference strains from the GenBank database. The pairwise comparison of the nucleotide sequences of the VP1 genes demonstrated that the sequences of the Korean strains differed from those of lineage groups A, B, C, D, E, F and G. Reconstruction of the phylogenetic tree based on the complete VP1 nucleotide sequences resulted in a monophyletic tree, with eight clustered lineage groups. All Korean isolates were segregated from other lineage groups, thus suggesting that the Korean strains were a distinct lineage of E30, and a probable cause of this outbreak. This manuscript is the first report, to the best of our knowledge, of the molecular characteristics of E30 strains associated with an aseptic meningitis outbreak in Korea, and their respective phylogenetic relationships.

Phylogenetic analysis of G1P[8] and G12P[8] rotavirus A samples obtained in the pre- and post-vaccine periods, and molecular modeling of VP4 and VP7 proteins.

PubMed

Almeida, Tâmera Nunes Vieira; de Sousa, Teresinha Teixeira; da Silva, Roosevelt Alves; Fiaccadori, Fabíola Souza; Souza, Menira; Badr, Kareem Rady; de Paula Cardoso, Divina das Dôres

2017-09-01

Reduction in morbimortality rates for acute gastroenteritis (AGE) by Rotavirus A (RVA) has been observed after the introduction of vaccines, however the agent continues to circulate. The present study described the genomic characterization of the 11 dsRNA segments of two RVA samples G1P[8] obtained in the pre- and post-vaccination periods and one of G12P[8] sample (post-vaccine), compared to Rotarix™ vaccine. Analysis by molecular sequencing of the samples showed that the three samples belonged to genogroup I. In addition, the analysis of VP7 gene revealed that the samples G1 (pre-vaccine), G1 (post-vaccine) and G12 were characterized as lineages II, I and III, respectively. Regarding to VP4 and NSP4 gene it was observed that all samples belonged to lineage III, whereas for VP6 gene, the sample of the pre- and post-vaccine belonged to the lineage IV and I, respectively. Considering the VP7 gene, it was observed high nucleotide and amino acid identity for the two G1 samples when compared to Rotarix™ vaccine and lesser identity for the G12 sample. In relation to antigenic epitope of VP7 greater modifications were observed for the G12 sample in the 7-2 epitope that was confirmed by molecular modeling. On the other hand, for VP4, some changes in the 8-1 and 8-3 antigenic epitopes was observed for the three samples. This data could be interpreted as a low selective pressure exerted by vaccination in relation to G1P[8] samples and lesser protection in relation to G12P[8]. Thus, the continuous monitoring of RVA circulating samples remains important. Copyright © 2017 Elsevier B.V. All rights reserved.

Towards a next generation open-source video codec

NASA Astrophysics Data System (ADS)

Bankoski, Jim; Bultje, Ronald S.; Grange, Adrian; Gu, Qunshan; Han, Jingning; Koleszar, John; Mukherjee, Debargha; Wilkins, Paul; Xu, Yaowu

2013-02-01

Google has recently been developing a next generation opensource video codec called VP9, as part of the experimental branch of the libvpx repository included in the WebM project (http://www.webmproject.org/). Starting from the VP8 video codec released by Google in 2010 as the baseline, a number of enhancements and new tools have been added to improve the coding efficiency. This paper provides a technical overview of the current status of this project along with comparisons and other stateoftheart video codecs H. 264/AVC and HEVC. The new tools that have been added so far include: larger prediction block sizes up to 64x64, various forms of compound INTER prediction, more modes for INTRA prediction, ⅛pel motion vectors and 8tap switchable subpel interpolation filters, improved motion reference generation and motion vector coding, improved entropy coding and framelevel entropy adaptation for various symbols, improved loop filtering, incorporation of Asymmetric Discrete Sine Transforms and larger 16x16 and 32x32 DCTs, frame level segmentation to group similar areas together, etc. Other tools and various bitstream features are being actively worked on as well. The VP9 bitstream is expected to be finalized by earlyto mid2013. Results show VP9 to be quite competitive in performance with mainstream stateoftheart codecs.

Prevalence and distribution of White Spot Syndrome Virus in cultured shrimp.

PubMed

Hossain, A; Nandi, S P; Siddique, M A; Sanyal, S K; Sultana, M; Hossain, M A

2015-02-01

White Spot Syndrome Virus (WSSV) is a dsDNA virus causing White Spot Syndrome Disease (WSSD) in shrimp with almost 100% morality rate within 3-10 days. In Bangladesh, WSSD is one of the major impediments of shrimp farming. This study first investigated the prevalence and distribution of WSSV in cultured shrimps of the coastal regions in Bangladesh. A total of 60 shrimp samples, collected from the 25 shrimp farms of different coastal regions (Satkhira, Khulna, Bagerhat and Cox's Bazar), were analysed during 2013-2014 by conventional PCR using VP28 and VP664 gene-specific primers; 39 of 60 samples were found WSSV positive. SYBR green real-time PCR using 71-bp amplicon for VP664 gene correlated well with conventional PCR data. The prevalence rates of WSSV among the collected 60 samples were Satkhira 79%, Khulna 50%, Bagerhat 38% and Cox's Bazar 25%. Sequencing of WSSV-positive PCR amplicons of VP28 showed 99% similarity with WSSV NCBI Ref/Seq Sequences. Molecular analysis of the VP28 gene sequences of WSSV revealed that Bangladeshi strains phylogenetically affiliated to the strains belong to India. This work concluded that WSSV infections are widely distributed in the coastal regions cultured shrimp in Bangladesh. © 2014 The Society for Applied Microbiology.

Molecular characterization of canine parvovirus variants (CPV-2a, CPV-2b, and CPV-2c) based on the VP2 gene in affected domestic dogs in Ecuador.

PubMed

la Torre, David De; Mafla, Eulalia; Puga, Byron; Erazo, Linda; Astolfi-Ferreira, Claudete; Ferreira, Antonio Piantino

2018-04-01

The objective of this study was to determine the presence of the variants of canine parvovirus (CPV)-2 in the city of Quito, Ecuador, due to the high domestic and street-type canine population, and to identify possible mutations at a genetic level that could be causing structural changes in the virus with a consequent influence on the immune response of the hosts. Thirty-five stool samples from different puppies with characteristic signs of the disease and positives for CPV through immunochromatography kits were collected from different veterinarian clinics of the city. Polymerase chain reaction and DNA sequencing were used to determine the mutations in residue 426 of the VP2 gene, which determines the variants of CPV-2; in addition, four samples were chosen for complete sequencing of the VP2 gene to identify all possible mutations in the circulating strains in this region of the country. The results revealed the presence of the three variants of CPV-2 with a prevalence of 57.1% (20/35) for CPV-2a, 8.5% (3/35) for CPV-2b, and 34.3% (12/35) for CPV-2c. In addition, complete sequencing of the VP2 gene showed amino acid substitutions in residues 87, 101, 139, 219, 297, 300, 305, 322, 324, 375, 386, 426, 440, and 514 of the three Ecuadorian variants when compared with the original CPV-2 sequence. This study describes the detection of CPV variants in the city of Quito, Ecuador. Variants of CPV-2 (2a, 2b, and 2c) have been reported in South America, and there are cases in Ecuador where CVP-2 is affecting even vaccinated puppies.

The SRL peptide of Rhesus Rotavirus VP4 protein governs cholangiocyte infection and the murine model of biliary atresia

PubMed Central

Mohanty, Sujit K.; Donnelly, Bryan; Lobeck, Inna; Walther, Ashley; Dupree, Phylicia; Coots, Abigail; Meller, Jaroslaw; McNeal, Monica; Sestak, Karol; Tiao, Greg

2016-01-01

Biliary atresia (BA) is a neonatal obstructive cholangiopathy which progresses to end stage liver disease, often requiring transplantation. The murine model of BA, employing rhesus rotavirus (RRV), parallels human disease and has been used to elucidate mechanistic aspects of a virus induced biliary cholangiopathy. We previously reported that RRV VP4 gene plays an integral role in activating the immune system and induction of BA. Utilizing rotavirus binding and blocking assays, this study elucidated how RRV VP4 protein governs cholangiocyte susceptibility to infection both in vitro and in vivo in the murine model of BA. We identified the amino acid sequence on VP4 and its cholangiocyte binding protein, finding that the sequence is specific to those rotavirus strains which cause an obstructive cholangiopathy. Pretreatment of murine and human cholangiocytes with this VP4 derived peptide (TRTRVSRLY), significantly reduced RRV’s ability to bind and infect the cells. However, the peptide did not block cholangiocyte binding of TUCH and Ro1845, strains which do not induce murine BA. The SRL sequence within TRTRVSRLY is required for cholangiocyte binding and viral replication. The cholangiocyte membrane protein bound by SRL was found to be Hsc70. Inhibition of Hsc70 by siRNAs reduced RRV’s ability to infect cholangiocytes. This virus-cholangiocyte interaction is also seen in vivo in the murine model of BA, where inoculation of mice with TRTRVSRLY peptide significantly reduced symptoms and mortality in RRV-injected mice. Conclusion The tri-peptide SRL on RRV VP4 binds to the cholangiocyte membrane protein Hsc70 defining a novel binding site governing VP4 attachment. Investigations are underway to determine the cellular response following this interaction to understand how it contributes to the pathogenesis of BA. PMID:27859498

The Receptor-Binding Domain in the VP1u Region of Parvovirus B19.

PubMed

Leisi, Remo; Di Tommaso, Chiarina; Kempf, Christoph; Ros, Carlos

2016-02-24

Parvovirus B19 (B19V) is known as the human pathogen causing the mild childhood disease erythema infectiosum. B19V shows an extraordinary narrow tissue tropism for erythroid progenitor cells in the bone marrow, which is determined by a highly restricted uptake. We have previously shown that the specific internalization is mediated by the interaction of the viral protein 1 unique region (VP1u) with a yet unknown cellular receptor. To locate the receptor-binding domain (RBD) within the VP1u, we analyzed the effect of truncations and mutations on the internalization capacity of the recombinant protein into UT7/Epo cells. Here we report that the N-terminal amino acids 5-80 of the VP1u are necessary and sufficient for cellular binding and internalization; thus, this N-terminal region represents the RBD required for B19V uptake. Using site-directed mutagenesis, we further identified a cluster of important amino acids playing a critical role in VP1u internalization. In silico predictions and experimental results suggest that the RBD is structured as a rigid fold of three α-helices. Finally, we found that dimerization of the VP1u leads to a considerably enhanced cellular binding and internalization. Taken together, we identified the RBD that mediates B19V uptake and mapped functional and structural motifs within this sequence. The findings reveal insights into the uptake process of B19V, which contribute to understand the pathogenesis of the infection and the neutralization of the virus by the immune system.

The Receptor-Binding Domain in the VP1u Region of Parvovirus B19

PubMed Central

Leisi, Remo; Di Tommaso, Chiarina; Kempf, Christoph; Ros, Carlos

2016-01-01

Parvovirus B19 (B19V) is known as the human pathogen causing the mild childhood disease erythema infectiosum. B19V shows an extraordinary narrow tissue tropism for erythroid progenitor cells in the bone marrow, which is determined by a highly restricted uptake. We have previously shown that the specific internalization is mediated by the interaction of the viral protein 1 unique region (VP1u) with a yet unknown cellular receptor. To locate the receptor-binding domain (RBD) within the VP1u, we analyzed the effect of truncations and mutations on the internalization capacity of the recombinant protein into UT7/Epo cells. Here we report that the N-terminal amino acids 5–80 of the VP1u are necessary and sufficient for cellular binding and internalization; thus, this N-terminal region represents the RBD required for B19V uptake. Using site-directed mutagenesis, we further identified a cluster of important amino acids playing a critical role in VP1u internalization. In silico predictions and experimental results suggest that the RBD is structured as a rigid fold of three α-helices. Finally, we found that dimerization of the VP1u leads to a considerably enhanced cellular binding and internalization. Taken together, we identified the RBD that mediates B19V uptake and mapped functional and structural motifs within this sequence. The findings reveal insights into the uptake process of B19V, which contribute to understand the pathogenesis of the infection and the neutralization of the virus by the immune system. PMID:26927158

Exposure of Piglets to Enteroviruses Investigated by an Immunoassay Based on the EV-G1 VP4 Peptide.

PubMed

Benkahla, Mehdi A; Sane, Famara; Desailloud, Rachel; Hober, Didier

2016-01-01

The aim of this study was to investigate the exposure of piglets to enteroviruses-G (EV-G) through the presence of antibodies in their serum. Serum samples were obtained from the vena cava of 10 piglets at 9 weeks of age and again 39 days later (day 39). They were tested using an immunoassay based on the EV-G1 VP4 peptide, since VP4 is highly conserved among the four Enterovirus capsid proteins, and by using a seroneutralization assay. For each serum collected on day 39 the optical density was high compared to the value obtained in serum collected earlier (p = 0.002). However, the titers of anti-EV-G1 serum neutralizing activity were not different in paired samples (p > 0.999). The sequence alignment of the EV-G1 VP4 peptide, encompassing 50 amino acids, used in the immunoassay showed 88% homology with EV-G, suggesting that antibodies directed toward other EV-G than EV-G1 may be detected. An immunoassay based on EV-G1 VP4 can detect an increased level of EV-G antibodies in piglet serum samples. Further studies are needed to determine whether this immunoassay may be useful for diagnosis and/or epidemiological studies and to monitor EV-G infection in pigs to evaluate strategies aimed to prevent enterovirus infections. © 2016 S. Karger AG, Basel.

Evaluation of the potential impact of Ebola virus genomic drift on the efficacy of sequence-based candidate therapeutics.

PubMed

Kugelman, Jeffrey R; Sanchez-Lockhart, Mariano; Andersen, Kristian G; Gire, Stephen; Park, Daniel J; Sealfon, Rachel; Lin, Aaron E; Wohl, Shirlee; Sabeti, Pardis C; Kuhn, Jens H; Palacios, Gustavo F

2015-01-20

Until recently, Ebola virus (EBOV) was a rarely encountered human pathogen that caused disease among small populations with extraordinarily high lethality. At the end of 2013, EBOV initiated an unprecedented disease outbreak in West Africa that is still ongoing and has already caused thousands of deaths. Recent studies revealed the genomic changes this particular EBOV variant undergoes over time during human-to-human transmission. Here we highlight the genomic changes that might negatively impact the efficacy of currently available EBOV sequence-based candidate therapeutics, such as small interfering RNAs (siRNAs), phosphorodiamidate morpholino oligomers (PMOs), and antibodies. Ten of the observed mutations modify the sequence of the binding sites of monoclonal antibody (MAb) 13F6, MAb 1H3, MAb 6D8, MAb 13C6, and siRNA EK-1, VP24, and VP35 targets and might influence the binding efficacy of the sequence-based therapeutics, suggesting that their efficacy should be reevaluated against the currently circulating strain. Copyright © 2015 Kugelman, et al.

Genetic evolution of Human Enterovirus A71 subgenotype C4 in Shenzhen, China, 1998-2013.

PubMed

He, Yaqing; Zou, Linjie; Chong, Marc Ka Chun; Men, Ruoting; Xu, Wenbo; Yang, Hong; Yao, Xiangjie; Chen, Long; Xian, Huixia; Zhang, Hailong; Luo, Min; Cheng, Jinquan; Ma, Hanwu; Feng, Qianjin; Huang, Yun; Wang, Yujie; Yeoh, Eng-Kiong; Zee, Benny Chung-Ying; Zhou, Yuanping; He, Ming-Liang; Wang, Maggie Haitian

2016-06-01

Human Enterovirus A71 (EV-A71) is one of the severest enteroviruses that causes hand, foot, and mouth disease (HFMD) among children. This study identified the mutations of EV-A71 VP1 amino acid residues over a number of years and explored the possible association of identified mutations and HFMD epidemic outbreaks in Shenzhen, China. A total of 3760 stool specimens were collected from HFMD patients by Shenzhen Centers for Disease Control and Prevention (CDC) between 1998 and 2013. In total 289 VP1 strains were sequenced in this study, and amino acids mutation frequency was calculated. There were 2040 China nationwide sequences downloaded from Genebank as replication data. In our samples, 1036 subjects (27.6%) were EV-A71 infected. Three amino acid positions on VP1 protein were found to have high mutation prevalence. These are Q22H, S283T, and A289H. Site 22 showed a fast mutation fixation in the year 2008, at the time of the large scale epidemic outbreak in Shenzhen. Analysis of the nationwide data replicated the same trend of mutation prevalence of the three sites. The switching from Q to H on site 22 of the EV-A71 VP1 strain might be associated with the HFMD outbreak in Shenzhen in 2008. The identified amino acid sites 22, 283 and 289 provided information for developing anti-viral drugs against EV-A71 in the future. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

The Murine Norovirus Core Subgenomic RNA Promoter Consists of a Stable Stem-Loop That Can Direct Accurate Initiation of RNA Synthesis

PubMed Central

Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng

2014-01-01

ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209

The murine norovirus core subgenomic RNA promoter consists of a stable stem-loop that can direct accurate initiation of RNA synthesis.

PubMed

Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C Cheng; Goodfellow, Ian

2015-01-15

All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3' of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Complete Genome Sequence of the Circulatory Foot-and-Mouth Disease Virus Serotype Asia1 in Bangladesh

PubMed Central

Ali, M. Rahmat; Alam, A. S. M. Rubayet Ul; Amin, M. Al; Ullah, Huzzat; Siddique, Mohammad Anwar; Momtaz, Samina; Sultana, Munawar

2017-01-01

ABSTRACT The complete genome sequence of foot-and-mouth disease virus (FMDV) serotype Asia1 isolated from Bangladesh is reported here. Genome analysis revealed amino acid substitutions in the VP1 antigenic region and deletions in both the 5′ and 3′ untranslated regions (UTRs) compared to the genome of the existing vaccine strain (GenBank accession no. AY304994). PMID:29074654

Virucidal efficacy of glutaraldehyde against enteroviruses is related to the location of lysine residues in exposed structures of the VP1 capsid protein.

PubMed

Chambon, Martine; Archimbaud, Christine; Bailly, Jean-Luc; Gourgand, Jeanne-Marie; Charbonné, Françoise; Peigue-Lafeuille, Hélène

2004-03-01

Glutaraldehyde (GTA) is a potent virucidal disinfectant whose exact mode of action against enteroviruses is not understood. Earlier reports showed that GTA reacts preferentially with the VP1 capsid protein of echovirus 25 and poliovirus 1 and that GTA has affinity for exposed lysine residues on proteins. To investigate further the inactivation of enteroviruses by GTA, seven strains were selected on the basis of differences in their overall number and the positions of lysine residues in the amino acid sequences of the VP1 polypeptide. Inactivation kinetics experiments were performed with 0.10% GTA. The viruses grouped into three clusters and exhibited significantly different levels of sensitivity to GTA. The results were analyzed in the light of current knowledge of the three-dimensional structure of enteroviruses and the viral life cycle. The differences observed in sensitivity to GTA were related to the number of lysine residues and their locations in the VP1 protein. The overall findings suggest that the BC and DE loops, which cluster at the fivefold axis of symmetry and are the most exposed on the outer surface of the virions, are primary reactive sites for GTA.

Virucidal Efficacy of Glutaraldehyde against Enteroviruses Is Related to the Location of Lysine Residues in Exposed Structures of the VP1 Capsid Protein

PubMed Central

Chambon, Martine; Archimbaud, Christine; Bailly, Jean-Luc; Gourgand, Jeanne-Marie; Charbonné, Françoise; Peigue-Lafeuille, Hélène

2004-01-01

Glutaraldehyde (GTA) is a potent virucidal disinfectant whose exact mode of action against enteroviruses is not understood. Earlier reports showed that GTA reacts preferentially with the VP1 capsid protein of echovirus 25 and poliovirus 1 and that GTA has affinity for exposed lysine residues on proteins. To investigate further the inactivation of enteroviruses by GTA, seven strains were selected on the basis of differences in their overall number and the positions of lysine residues in the amino acid sequences of the VP1 polypeptide. Inactivation kinetics experiments were performed with 0.10% GTA. The viruses grouped into three clusters and exhibited significantly different levels of sensitivity to GTA. The results were analyzed in the light of current knowledge of the three-dimensional structure of enteroviruses and the viral life cycle. The differences observed in sensitivity to GTA were related to the number of lysine residues and their locations in the VP1 protein. The overall findings suggest that the BC and DE loops, which cluster at the fivefold axis of symmetry and are the most exposed on the outer surface of the virions, are primary reactive sites for GTA. PMID:15006797

Molecular characterization of rotavirus strains detected during a clinical trial of a human rotavirus vaccine in Blantyre, Malawi

PubMed Central

Nakagomi, Toyoko; Nakagomi, Osamu; Dove, Winifred; Doan, Yen Hai; Witte, Desiree; Ngwira, Bagrey; Todd, Stacy; Steele, A Duncan; Neuzil, Kathleen M; Cunliffe, Nigel A

2014-01-01

The human, G1P[8] rotavirus vaccine (Rotarix) significantly reduced severe rotavirus gastroenteritis episodes in a clinical trial in South Africa and Malawi, but vaccine efficacy was lower in Malawi (49.5%) than reported in South Africa (76.9%) and elsewhere. The aim of this study was to examine the molecular relationships of circulating wild-type rotaviruses detected during the clinical trial in Malawi to RIX4414 (the strain contained in Rotarix) and to common human rotavirus strains. Of 88 rotavirus-positive, diarrhoeal stool specimens, 43 rotaviruses exhibited identifiable RNA migration patterns when examined by polyacrylamide gel electrophoresis. The genes encoding VP7, VP4, VP6 and NSP4 of 5 representative strains possessing genotypes G12P[6], G1P[8], G9P[8], and G8P[4] were sequenced. While their VP7 (G) and VP4 (P) genotype designations were confirmed, the VP6 (I) and NSP4 (E) genotypes were either I1E1 or I2E2, indicating that they were of human rotavirus origin. RNA-RNA hybridization using 21 culture-adapted strains showed that Malawian rotaviruses had a genomic RNA constellation common to either the Wa-like or DS-1 like human rotaviruses. Overall, the Malawi strains appear similar in their genetic make-up to rotaviruses described in countries where vaccine efficacy is greater, suggesting that the lower efficacy in Malawi is unlikely to be explained by the diversity of circulating strains. PMID:22520123

Molecular characterization of rotavirus strains detected during a clinical trial of a human rotavirus vaccine in Blantyre, Malawi.

PubMed

Nakagomi, Toyoko; Nakagomi, Osamu; Dove, Winifred; Doan, Yen Hai; Witte, Desiree; Ngwira, Bagrey; Todd, Stacy; Duncan Steele, A; Neuzil, Kathleen M; Cunliffe, Nigel A

2012-04-27

The human, G1P[8] rotavirus vaccine (Rotarix™) significantly reduced severe rotavirus gastroenteritis episodes in a clinical trial in South Africa and Malawi, but vaccine efficacy was lower in Malawi (49.5%) than reported in South Africa (76.9%) and elsewhere. The aim of this study was to examine the molecular relationships of circulating wild-type rotaviruses detected during the clinical trial in Malawi to RIX4414 (the strain contained in Rotarix™) and to common human rotavirus strains. Of 88 rotavirus-positive, diarrhoeal stool specimens, 43 rotaviruses exhibited identifiable RNA migration patterns when examined by polyacrylamide gel electrophoresis. The genes encoding VP7, VP4, VP6 and NSP4 of 5 representative strains possessing genotypes G12P[6], G1P[8], G9P[8], and G8P[4] were sequenced. While their VP7 (G) and VP4 (P) genotype designations were confirmed, the VP6 (I) and NSP4 (E) genotypes were either I1E1 or I2E2, indicating that they were of human rotavirus origin. RNA-RNA hybridization using 21 culture-adapted strains showed that Malawian rotaviruses had a genomic RNA constellation common to either the Wa-like or the DS-1 like human rotaviruses. Overall, the Malawi strains appear similar in their genetic make-up to rotaviruses described in countries where vaccine efficacy is greater, suggesting that the lower efficacy in Malawi is unlikely to be explained by the diversity of circulating strains. Copyright © 2011 Elsevier Ltd. All rights reserved.

A Conserved Epitope Mapped with a Monoclonal Antibody against the VP3 Protein of Goose Parvovirus by Using Peptide Screening and Phage Display Approaches.

PubMed

Li, Chenxi; Liu, Hongyu; Li, Jinzhe; Liu, Dafei; Meng, Runze; Zhang, Qingshan; Shaozhou, Wulin; Bai, Xiaofei; Zhang, Tingting; Liu, Ming; Zhang, Yun

2016-01-01

Waterfowl parvovirus (WPV) infection causes high mortality and morbidity in both geese (Anser anser) and Muscovy ducks (Cairina moschata), resulting in significant losses to the waterfowl industries. The VP3 protein of WPV is a major structural protein that induces neutralizing antibodies in the waterfowl. However, B-cell epitopes on the VP3 protein of WPV have not been characterized. To understand the antigenic determinants of the VP3 protein, we used the monoclonal antibody (mAb) 4A6 to screen a set of eight partially expressed overlapping peptides spanning VP3. Using western blotting and an enzyme-linked immunosorbent assay (ELISA), we localized the VP3 epitope between amino acids (aa) 57 and 112. To identify the essential epitope residues, a phage library displaying 12-mer random peptides was screened with mAb 4A6. Phage clone peptides displayed a consensus sequence of YxRFHxH that mimicked the sequence 82Y/FNRFHCH88, which corresponded to amino acid residues 82 to 88 of VP3 protein of WPVs. mAb 4A6 binding to biotinylated fragments corresponding to amino acid residues 82 to 88 of the VP3 protein verified that the 82FxRFHxH88 was the VP3 epitope and that amino acids 82F is necessary to retain maximal binding to mAb 4A6. Parvovirus-positive goose and duck sera reacted with the epitope peptide by dot blotting assay, revealing the importance of these amino acids of the epitope in antibody-epitope binding reactivity. We identified the motif FxRFHxH as a VP3-specific B-cell epitope that is recognized by the neutralizing mAb 4A6. This finding might be valuable in understanding of the antigenic topology of VP3 of WPV.

Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

PubMed

Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

2015-02-01

Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

First complete genome sequences of genogroup V, genotype 3 porcine sapoviruses: common 5'-terminal genomic feature of sapoviruses.

PubMed

Oka, Tomoichiro; Doan, Yen Hai; Shimoike, Takashi; Haga, Kei; Takizawa, Takenori

2017-12-01

Sapoviruses (SaVs) are enteric viruses and have been detected in various mammals. They are divided into multiple genogroups and genotypes based on the entire major capsid protein (VP1) encoding region sequences. In this study, we determined the first complete genome sequences of two genogroup V, genotype 3 (GV.3) SaV strains detected from swine fecal samples, in combination with Illumina MiSeq sequencing of the libraries prepared from viral RNA and PCR products. The lengths of the viral genome (7494 nucleotides [nt] excluding polyA tail) and short 5'-untranslated region (14 nt) as well as two predicted open reading frames are similar to those of other SaVs. The amino acid differences between the two porcine SaVs are most frequent in the central region of the VP1-encoding region. A stem-loop structure which was predicted in the first 41 nt of the 5'-terminal region of GV.3 SaVs and the other available complete genome sequences of SaVs may have a critical role in viral genome replication. Our study provides complete genome sequences of rarely reported GV.3 SaV strains and highlights the common 5'-terminal genomic feature of SaVs detected from different mammalian species.

An Outbreak of Acute Hepatitis Caused by Genotype IB Hepatitis A Viruses Contaminating the Water Supply in Thailand.

PubMed

Ruchusatsawat, Kriangsak; Wongpiyabovorn, Jongkonnee; Kawidam, Chonthicha; Thiemsing, Laddawan; Sangkitporn, Somchai; Yoshizaki, Sayaka; Tatsumi, Masashi; Takeda, Naokazu; Ishii, Koji

2016-01-01

In 2000, an outbreak of acute hepatitis A was reported in a province adjacent to Bangkok, Thailand. To investigate the cause of the 2000 hepatitis A outbreaks in Thailand using molecular epidemiological analysis. Serum and stool specimens were collected from patients who were clinically diagnosed with acute viral hepatitis. Water samples from drinking water and deep-drilled wells were also collected. These specimens were subjected to polymerase chain reaction (PCR) amplification and sequencing of the VP1/2A region of the hepatitis A virus (HAV) genome. The entire genome sequence of one of the fecal specimens was determined and phylogenetically analyzed with those of known HAV sequences. Eleven of 24 fecal specimens collected from acute viral hepatitis patients were positive as determined by semi- nested reverse transcription PCR targeting the VP1/2A region of HAV. The nucleotide sequence of these samples had an identical genotype IB sequence, suggesting that the same causative agent was present. The complete nucleotide sequence derived from one of the samples indicated that the Thai genotype IB strain should be classified in a unique phylogenetic cluster. The analysis using an adjusted odds ratio showed that the consumption of groundwater was the most likely risk factor associated with the disease. © 2017 S. Karger AG, Basel.

A Temperature-Sensitive Lesion in the N-Terminal Domain of the Rotavirus Polymerase Affects Its Intracellular Localization and Enzymatic Activity

PubMed Central

McKell, Allison O.; LaConte, Leslie E. W.

2017-01-01

ABSTRACT Temperature-sensitive (ts) mutants of simian rotavirus (RV) strain SA11 have been previously created to investigate the functions of viral proteins during replication. One mutant, SA11-tsC, has a mutation that maps to the gene encoding the VP1 polymerase and shows diminished growth and RNA synthesis at 39°C compared to that at 31°C. In the present study, we sequenced all 11 genes of SA11-tsC, confirming the presence of an L138P mutation in the VP1 N-terminal domain and identifying 52 additional mutations in four other viral proteins (VP4, VP7, NSP1, and NSP2). To investigate whether the L138P mutation induces a ts phenotype in VP1 outside the SA11-tsC genetic context, we employed ectopic expression systems. Specifically, we tested whether the L138P mutation affects the ability of VP1 to localize to viroplasms, which are the sites of RV RNA synthesis, by expressing the mutant form as a green fluorescent protein (GFP) fusion protein (VP1L138P-GFP) (i) in wild-type SA11-infected cells or (ii) in uninfected cells along with viroplasm-forming proteins NSP2 and NSP5. We found that VP1L138P-GFP localized to viroplasms and interacted with NSP2 and/or NSP5 at 31°C but not at 39°C. Next, we tested the enzymatic activity of a recombinant mutant polymerase (rVP1L138P) in vitro and found that it synthesized less RNA at 39°C than at 31°C, as well as less RNA than the control at all temperatures. Together, these results provide a mechanistic basis for the ts phenotype of SA11-tsC and raise important questions about the role of leucine 138 in supporting key protein interactions and the catalytic function of the VP1 polymerase. IMPORTANCE RVs cause diarrhea in the young of many animal species, including humans. Despite their medical and economic importance, gaps in knowledge exist about how these viruses replicate inside host cells. Previously, a mutant simian RV (SA11-tsC) that replicates worse at higher temperatures was identified. This virus has an amino acid mutation in VP1, which is the enzyme responsible for copying the viral RNA genome. The mutation is located in a poorly understood region of the polymerase called the N-terminal domain. In this study, we determined that the mutation reduces the ability of VP1 to properly localize within infected cells at high temperatures, as well as reduced the ability of the enzyme to copy viral RNA in a test tube. The results of this study explain the temperature sensitivity of SA11-tsC and shed new light on functional protein-protein interaction sites of VP1. PMID:28100623

Two novel noroviruses and a novel norovirus genogroup in California sea lions.

PubMed

Teng, Jade L L; Martelli, Paolo; Chan, Wan-Mui; Lee, Hwei Huih; Hui, Suk-Wai; Lau, Candy C Y; Tse, Herman; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y

2018-06-01

In this study, two novel noroviruses (NoVs) were discovered from faecal samples from California sea lions from an oceanarium in Hong Kong, and named California sea lion NoV 1 (Csl/NoV1) and California sea lion NoV 2 (Csl/NoV2). Whole-genome sequencing showed that the genome organization and amino acid motifs of both Csl/NoV1 and Csl/NoV2 were typical of those of other NoVs in their open reading frames (ORFs). Csl/NoV1 possessed only 52.6-52.8 % amino acid identity in VP1 to the closest matches in genogroup GII. Therefore, Csl/NoV1 should constitute a novel genogroup of NoV. Shifting of the phylogenetic position of Csl/NoV1 in the RdRp, VP1 and VP2 trees was observed, which may have been due to recombination events and/or biased mutations. Csl/NoV2 possessed 55.4-56.2 % amino acid identity in VP1 to its closest relatives in genogroup GVI, which means that it represents a new genotype in genogroup GVI. Further studies will reveal what diseases these NoVs can cause in marine mammals.

Development of an Efficient Entire-Capsid-Coding-Region Amplification Method for Direct Detection of Poliovirus from Stool Extracts

PubMed Central

Kilpatrick, David R.; Nakamura, Tomofumi; Burns, Cara C.; Bukbuk, David; Oderinde, Soji B.; Oberste, M. Steven; Kew, Olen M.; Pallansch, Mark A.; Shimizu, Hiroyuki

2014-01-01

Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. PMID:25339406

Draft Genome Sequence of trh+ Vibrio parahaemolyticus VP-49, Isolated from Seafood Harvested along the Mangalore Coast, India.

PubMed

Kumar, Ballamoole Krishna; Deekshit, Vijaya Kumar; Rai, Praveen; Gurtler, Volker; Karunasagar, Iddya; Karunasagar, Indrani

2014-06-26

Vibrio parahaemolyticus is a seafood-borne pathogen autochthonous to the marine and estuarine ecosystem, which is responsible for gastroenteritis due to the consumption of contaminated raw seafood. Here, we report the draft genome sequence of V. parahaemolyticus VP-49, isolated from seafood, to identify the different virulence attributes and to study the mechanisms that enhance its environmental fitness. Copyright © 2014 Kumar et al.

Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

PubMed

Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

2016-11-01

Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Epidemiology and Genetic Characterization of Hepatitis A Virus Genotype IIA▿

PubMed Central

Desbois, Delphine; Couturier, Elisabeth; Mackiewicz, Vincent; Graube, Arielle; Letort, Marie-José; Dussaix, Elisabeth; Roque-Afonso, Anne-Marie

2010-01-01

Three hepatitis A virus (HAV) genotypes, I, II, and III, divided into subtypes A and B, infect humans. Genotype I is the most frequently reported, while genotype II is hardly ever isolated, and its genetic diversity is unknown. From 2002 to 2007, a French epidemiological survey of HAV identified 6 IIA isolates, mostly from patients who did not travel abroad. The possible African origin of IIA strains was investigated by screening the 2008 mandatory notification records of HAV infection: 171 HAV strains from travelers to West Africa and Morocco were identified. Genotyping was performed by sequencing of the VP1/2A junction in 68 available sera. Entire P1 and 5′ untranslated regions of IIA strains were compared to reference sequences of other genotypes. The screening retrieved 5 imported IIA isolates. An additional autochthonous case and 2 more African cases were identified in 2008 and 2009, respectively. A total of 14 IIA isolates (8 African and 6 autochthonous) were analyzed. IIA sequences presented lower nucleotide and amino acid variability than other genotypes. The highest variability was observed in the N-terminal region of VP1, while for other genotypes the highest variability was observed at the VP1/2A junction. Phylogenetic analysis identified 2 clusters, one gathering all African and two autochthonous cases and a second including only autochthonous isolates. In conclusion, most IIA strains isolated in France are imported by travelers returning from West Africa. However, the unexplained contamination mode of autochthonous cases suggests another, still to be discovered geographical origin or a French reservoir to be explored. PMID:20592136

Identification and characterization of novel mosquito-borne (Kammavanpettai virus) and tick-borne (Wad Medani) reoviruses isolated in India.

PubMed

Yadav, Pragya D; Shete, Anita M; Nyayanit, Dimpal A; Albarino, Cesar G; Jain, Shilpi; Guerrero, Lisa W; Kumar, Sandeep; Patil, Deepak Y; Nichol, Stuart T; Mourya, Devendra T

2018-06-25

In 1954, a virus named Wad Medani virus (WMV) was isolated from Hyalomma marginatum ticks from Maharashtra State, India. In 1963, another virus was isolated from Sturnia pagodarum birds in Tamil Nadu, India, and named Kammavanpettai virus (KVPTV) based on the site of its isolation. Originally these virus isolates could not be identified with conventional methods. Here we describe next-generation sequencing studies leading to the determination of their complete genome sequences, and identification of both virus isolates as orbiviruses (family Reoviridae). Sequencing data showed that KVPTV has an AT-rich genome, whereas the genome of WMV is GC-rich. The size of the KVPTV genome is 18 234 nucleotides encoding proteins ranging 238-1290 amino acids (aa) in length. Similarly, the size of the WMV genome is 16 941 nucleotides encoding proteins ranging 214-1305 amino acids in length. Phylogenetic analysis of the VP1 gene, along with the capsid genes VP5 and VP7, revealed that KVPTV is likely a novel mosquito-borne virus and WMV is a tick-borne orbivirus. This study focuses on the phylogenetic comparison of these newly identified orbiviruses with mosquito-, tick- and Culicoides-borne orbiviruses isolated in India and other countries.

Phylogenetic analysis of the complete genome of 11 BKV isolates obtained from allogenic stem cell transplant recipients in Ireland.

PubMed

Drew, Richard John; Walsh, Anne; Laoi, Bairbre Ni; Crowley, Brendan

2012-07-01

BK polyomavirus (family Polyomaviridae) may cause hemorrhagic cystitis (BKV-HC) in hematopoietic stem cell transplant recipients. Eleven complete BKV genomes (GenBank accession numbers: JN192431-JN192441) were sequenced from urine samples of allogenic hematopoietic stem cell transplant recipients and compared to complete BKV genomes in the published literature. Of the 11 isolates, seven (64%) were subgroup Ib-1, three (27%) isolates belonged to subgroup Ib-2 and a single isolate belonged to subtype III. The analysis of single-nucleotide polymorphisms in this study showed that isolates could be subclassified into subtypes I-IV and subgroups Ib-1 and Ib-2 on the basis of VP1 of the first part of the Large T-antigen (LTag). The non-coding control region (NCCR) of the 11 isolates was also sequenced. These sequences showed that there was consistent sequence homology within subgroups Ib-1 and Ib-2. Two new mutations were described in the isolates, G→C at O(84) in isolate SJH-LG-310, and a deletion at R(2-7) in isolate SJH-LG-309. No known transcription factor is thought to be present at the site of either of these mutations. There were no rearrangements seen in isolates and this may be because the patients were not followed up over time. There were five nucleotide positions at which subgroup Ib-1 isolated differed from subgroup Ib-2 isolates in the NCCR sequence, O(41) , P(18) , P(31) , R(4) , and S(18) . The mutation O(41) is present in the promoter granulocyte/macrophage stimulating factor) gene and the P(31) mutation is present in the NF-1 gene. Copyright © 2012 Wiley Periodicals, Inc.

Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis.

PubMed

Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S

2015-01-01

The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

Molecular characterization of feline panleukopenia virus isolated from mink and its pathogenesis in mink.

PubMed

Fei-Fei, Diao; Yong-Feng, Zhao; Jian-Li, Wang; Xue-Hua, Wei; Kai, Cui; Chuan-Yi, Liu; Shou-Yu, Guo; Jiang, Shijin; Zhi-Jing, Xie

2017-06-01

Six feline panleukopenia viruses (FPV) were detected in the intestinal samples from the 176 mink collected in China during 2015 to 2016, named MEV-SD1, MEV-SD2, MEV-SD3, MEV-SD4, MEV-SD5 and MEV-SD6. The VP2 genes of the isolates shared 98.9%-100% identity with the reference sequences. The substitution of residue V300A in VP2 protein differentiates the isolates from the reference MEVs, and A300 is a characteristic of FPV. Furthermore, phylogenetic analysis of VP2 genes indicated that the six isolates were clustered into the same branch of all the reference FPVs. The NS1 genes of the isolates shared 98.2%-100% identity with the reference sequences. The NS1 genes of the six isolates and the three reference FPVs formed one unique evolutionary branch. To clarify the pathogenicity of the isolates, animal experiments were performed on healthy mink, using MEV-SD1. As a result, the morbidity of the inoculated animals was 100% and the mortality was as high as 38.9%. It was implied that the FPV infection caused a high morbidity and mortality in mink and the inoculation dose had an effect on pathogenicity of MEV-SD1 in mink. Copyright © 2017 Elsevier B.V. All rights reserved.

An Outbreak of Type Π Vaccine-Derived Poliovirus in Sichuan Province, China: Emergence and Circulation in an Under-Immunized Population

PubMed Central

Fan, Chun-Xiang; Liu, Qing-Lian; Hao, Li-Xin; Liu, Yu; Zheng, Jing-Shan; Qin, Zhi-Ying; Xia, Wei; Zhang, Shi-Yue; Yin, Zun-Dong; Jing, Qiong; Zhang, Yan-Xia; Huang, Rong-Na; Yang, Ru-Pei; Tong, Wen-Bin; Qi, Qi; Guan, Xu-Jing; Jing, Yu-Lin; Ma, Qian-Li; Wang, Jin; Ma, Xiao-Zhen; Chen, Na; Zheng, Hong-Ru; Li, Yin-Qiao; Ma, Chao; Su, Qi-Ru; Reilly, Kathleen H.; Luo, Hui-Ming; Wu, Xian-Ping; Wen, Ning; Yang, Wei-Zhong

2014-01-01

Background During August 2011–February 2012, an outbreak of type Π circulating vaccine-derived poliovirus (cVDPVs) occurred in Sichuan Province, China. Methods A field investigation of the outbreak was conducted to characterize outbreak isolates and to guide emergency response. Sequence analysis of poliovirus capsid protein VP1 was performed to determine the viral propagation, and a coverage survey was carried out for risk assessment. Results One clinical compatible polio case and three VDPV cases were determined in Ngawa County, Ngawa Tibetan and Qiang Autonomous Prefecture, Sichuan Province. Case patients were unimmunized children, 0.8–1 years old. Genetic sequencing showed that the isolates diverged from the VP1 region of the type Π Sabin strain by 5–12 nucleotides (nt) and shared the same 5 nt VP1 substitutions, which indicate single lineage of cVDPVs. Of the 7 acute flaccid paralysis cases (all>6 months) reported in Ngawa Prefecture in 2011, 4 (57.1%) cases (including 2 polio cases) did not receive oral attenuated poliovirus vaccine. Supplementary immunization activities (SIAs) were conducted in February–May, 2012, and the strain has not been isolated since. Conclusion High coverage of routine immunization should be maintained among children until WPV transmission is globally eradicated. Risk assessments should be conducted regularly to pinpoint high risk areas or subpopulations, with SIAs developed if necessary. PMID:25503964

Deciphering the role of multiple betaine-carnitine-choline transporters in the Halophile Vibrio parahaemolyticus.

PubMed

Ongagna-Yhombi, Serge Y; McDonald, Nathan D; Boyd, E Fidelma

2015-01-01

Vibrio parahaemolyticus is a halophile that is the predominant cause of bacterial seafood-related gastroenteritis worldwide. To survive in the marine environment, V. parahaemolyticus must have adaptive strategies to cope with salinity changes. Six putative compatible solute (CS) transport systems were previously predicted from the genome sequence of V. parahaemolyticus RIMD2210633. In this study, we determined the role of the four putative betaine-carnitine-choline transporter (BCCT) homologues VP1456, VP1723, VP1905, and VPA0356 in the NaCl stress response. Expression analysis of the four BCCTs subjected to NaCl upshock showed that VP1456, VP1905, and VPA0356, but not VP1723, were induced. We constructed in-frame single-deletion mutant strains for all four BCCTs, all of which behaved similarly to the wild-type strain, demonstrating a redundancy of the systems. Growth analysis of a quadruple mutant and four BCCT triple mutants demonstrated the requirement for at least one BCCT for efficient CS uptake. We complemented Escherichia coli MHK13, a CS synthesis- and transporter-negative strain, with each BCCT and examined CS uptake by growth analysis and (1)H nuclear magnetic resonance (NMR) spectroscopy analyses. These data demonstrated that VP1456 had the most diverse substrate transport ability, taking up glycine betaine (GB), proline, choline, and ectoine. VP1456 was the sole ectoine transporter. In addition, the data demonstrated that VP1723 can transport GB, proline, and choline, whereas VP1905 and VPA0356 transported only GB. Overall, the data showed that the BCCTs are functional and that there is redundancy among them. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Frequency and significance of parvovirus B19 infection in patients with rheumatoid arthritis

PubMed Central

Naciute, Milda; Mieliauskaite, Diana; Rugiene, Rita; Nikitenkiene, Rita; Jancoriene, Ligita; Mauricas, Mykolas; Nora-Krukle, Zaiga; Murovska, Modra

2016-01-01

The present study aims to clarify the possible involvement of parvovirus B19 (B19V) infection in rheumatoid arthritis (RA) pathogenesis by investigating the presence of B19V infection markers (genomic sequences and virus-specific antibodies) in association with the level of cytokines and RA clinical activity and aggressiveness. A total of 118 RA patients and 49 age- and sex-matched healthy volunteers were enrolled in the study. Nested PCR was used to detect B19V sequences in whole blood and cell-free plasma DNA, ELISA to detect virus-specific antibodies and cytokine levels in plasma and recomLine dot blot assay for antibodies to separate B19V antigens. The detection frequency of B19V DNA was higher in patients with RA (25.4 %) in comparison with healthy persons (18.4 %). B19V DNA in cell-free plasma (B19+p) was detected significantly often in RA patients in comparison with healthy controls (13.6 vs 2 %; P=0.0002). RA B19+p patients had higher disease activity and aggressiveness, decreased haemoglobin and increased erythrocyte sedimentation rates. IL-6 plasma levels were significantly higher in RA patients than in controls. Within the RA patients’ group the IL-6 level was significantly increased in B19+p patients with disease activity scores of DAS28>5.2, high C-reactive protein and low haemoglobin. Contrary to the healthy controls, the majority of RA B19+p patients did not have antibodies to VP-1S (VP1u) and VP-N (N-terminal half of structural proteins VP1 and VP2), which correspond to the epitopes of neutralizing antibodies. These results indicate that B19V infection at least in some patients is involved in RA pathogenesis. PMID:27902343

Method for measuring the focal spot size of an x-ray tube using a coded aperture mask and a digital detector.

PubMed

Russo, Paolo; Mettivier, Giovanni

2011-04-01

The goal of this study is to evaluate a new method based on a coded aperture mask combined with a digital x-ray imaging detector for measurements of the focal spot sizes of diagnostic x-ray tubes. Common techniques for focal spot size measurements employ a pinhole camera, a slit camera, or a star resolution pattern. The coded aperture mask is a radiation collimator consisting of a large number of apertures disposed on a predetermined grid in an array, through which the radiation source is imaged onto a digital x-ray detector. The method of the coded mask camera allows one to obtain a one-shot accurate and direct measurement of the two dimensions of the focal spot (like that for a pinhole camera) but at a low tube loading (like that for a slit camera). A large number of small apertures in the coded mask operate as a "multipinhole" with greater efficiency than a single pinhole, but keeping the resolution of a single pinhole. X-ray images result from the multiplexed output on the detector image plane of such a multiple aperture array, and the image of the source is digitally reconstructed with a deconvolution algorithm. Images of the focal spot of a laboratory x-ray tube (W anode: 35-80 kVp; focal spot size of 0.04 mm) were acquired at different geometrical magnifications with two different types of digital detector (a photon counting hybrid silicon pixel detector with 0.055 mm pitch and a flat panel CMOS digital detector with 0.05 mm pitch) using a high resolution coded mask (type no-two-holes-touching modified uniformly redundant array) with 480 0.07 mm apertures, designed for imaging at energies below 35 keV. Measurements with a slit camera were performed for comparison. A test with a pinhole camera and with the coded mask on a computed radiography mammography unit with 0.3 mm focal spot was also carried out. The full width at half maximum focal spot sizes were obtained from the line profiles of the decoded images, showing a focal spot of 0.120 mm x 0.105 mm at 35 kVp and M = 6.1, with a detector entrance exposure as low as 1.82 mR (0.125 mA s tube load). The slit camera indicated a focal spot of 0.112 mm x 0.104 mm at 35 kVp and M = 3.15, with an exposure at the detector of 72 mR. Focal spot measurements with the coded mask could be performed up to 80 kVp. Tolerance to angular misalignment with the reference beam up to 7 degrees in in-plane rotations and 1 degrees deg in out-of-plane rotations was observed. The axial distance of the focal spot from the coded mask could also be determined. It is possible to determine the beam intensity via measurement of the intensity of the decoded image of the focal spot and via a calibration procedure. Coded aperture masks coupled to a digital area detector produce precise determinations of the focal spot of an x-ray tube with reduced tube loading and measurement time, coupled to a large tolerance in the alignment of the mask.

Sarcocystis masoni, n. sp. (Apicomplexa: Sarcocystidae), and redescription of Sarcocystis aucheniae from llama (Lama glama), guanaco (Lama guanicoe) and alpaca (Vicugna pacos).

PubMed

Moré, Gastón; Regensburger, Cristian; Gos, M Laura; Pardini, Lais; Verma, Shiv K; Ctibor, Juliana; Serrano-Martínez, Marcos Enrique; Dubey, Jitender P; Venturini, M Cecilia

2016-04-01

There is considerable confusion concerning the species of Sarcocystis in South American camelids (SAC). Several species names have been used; however, proper descriptions are lacking. In the present paper, we redescribe the macroscopic sarcocyst forming Sarcocystis aucheniae and describe and propose a new name, Sarcocystis masoni for the microscopic sarcocyst forming species. Muscles samples were obtained from llamas (Lama glama) and guanacos (Lama guanicoe) from Argentina and from alpacas (Vicugna pacos) and llamas from Peru. Individual sarcocysts were processed by optical and electron microscopy, and molecular studies. Microscopic sarcocysts of S. masoni were up to 800 µm long and 35-95 µm wide, the sarcocyst wall was 2·5-3·5 µm thick, and had conical to cylindrical villar protrusions (vp) with several microtubules. Each vp had 11 or more rows of knob-like projections. Seven 18S rRNA gene sequences obtained from sarcocysts revealed 95-96% identity with other Sarcocystis spp. sequences reported in the GenBank. Sarcocysts of S. aucheniae were macroscopic, up to 1·2 cm long and surrounded by a dense and laminar 50 µm thick secondary cyst wall. The sarcocyst wall was up to 10 µm thick, and had branched vp, appearing like cauliflower. Comparison of the 11 sequences obtained from individual macroscopic cysts evidenced a 98-99% of sequence homology with other S. aucheniae sequences. In conclusion, 2 morphologically and molecularly different Sarcocystis species, S. masoni (microscopic cysts) and S. aucheniae (macroscopic cysts), were identified affecting different SAC from Argentina and Peru.

Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011.

PubMed

Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo

2013-06-01

Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.

Wild poliovirus circulation among healthy children immunized with oral polio vaccine in Antananarivo, Madagascar.

PubMed

Andrianarivelo, M R; Rabarijaona, L; Boisier, P; Chezzi, C; Zeller, H G

1999-01-01

From July 1995 to December 1996, 3185 stool specimens from healthy children aged 6-59 months attending 6 dispensaries in the Antananarivo area were examined for poliovirus. The children had been routinely immunized according to the Expanded Programme on Immunization (EPI) schedule and received the last dose of oral polio vaccine (OPV) more than 1 month before stool collection. 99.4% of the children were immunized with at least 3 doses of OPV. HEp-2 cell culture revealed virus infections in 192 stools (6.0%), including 9 poliovirus (0.3%) and 183 nonpolio enterovirus isolates (5.7%). Infections occurred throughout the year, but incidence was higher during the hot and rainy season (P=0.01). Using a neutralization test with monoclonal antibodies and PCR-RFLP in two genomic regions coding for the VP1 capsid and RNA polymerase, 4 wild polioviruses (3 type 1 and 1 type 3) and 5 vaccine-related polioviruses (2 Sabin 1-like variants, 1 Sabin 2-like and 2 Sabin 3-like) strains were identified. The wild polioviruses were isolated at the beginning and the end of the dry season. Similar RFLP patterns were observed for the 3 wild type 1 polioviruses. Comparison of partial genomic sequences in the VP1/2 A region of 1 of the wild type 1 isolates with 2 wild type strains isolated in Antananarivo in 1992 and 1993 showed a divergence of at least 10% between the strains, suggesting at least two different pathways of transmission during this period. Our findings demonstrate that immunization with 3 doses of OPV did not prevent intestinal carriage of wild poliovirus strains, and that there is a risk of wild poliovirus transmission to susceptible children in the area. Multiple strategies are required to improve immunization coverage in Madagascar.

Genetic characterization of type 2a canine parvoviruses from Taiwan reveals the emergence of an Ile324 mutation in VP2

PubMed Central

2014-01-01

Background Canine parvovirus 2 (CPV 2) is a major infectious cause of mortality in puppies. The characteristic symptom of CPV 2 disease is intestinal hemorrhage with severe bloody diarrhea. Soon after CPV was first recognized in the late 1970s, the original virus, CPV 2, was replaced in the canine population by strains carrying minor antigenic variants (termed 2a, 2b, and 2c) of the VP2 gene that could be distinguished using monoclonal antibodies and molecular analyses. Here, we provide an updated molecular characterization of the CPV 2 circulating in Taiwan. Methods In this study, 28 isolates of CPV 2 from 144 dogs with suspected CPV infection were obtained from northern, central, and southern Taiwan from 2008 to 2012 and screened by PCR. The 28 isolates were sequenced, and a phylogenetic analysis of the VP2 gene was performed. Results Of the 28 Taiwanese CPV 2 isolates, 15 were identified as new CPV 2a, and 13 were identified as new CPV 2b. Compared to the reference CPV 2a, all 15 of the CPV 2a sequences collected in this study contain an Ile324 mutation caused by a TAT to ATT mutation at nucleotides 970–972 of the VP2 gene. Conclusion Our VP2 sequence data revealed that both types are currently prevalent CPV 2 field strains circulating in Taiwan, and a unique Ile324 VP2 mutation was found in our Taiwanese CPV 2a isolates and recent Asian isolates. CPV 2c was not observed in this study. PMID:24568207

Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region

PubMed Central

Dolz, Roser; Valle, Rosa; Perera, Carmen L.; Bertran, Kateri; Frías, Maria T.; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J.

2013-01-01

Background Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Methodology/Principal Findings Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. Conclusions/Significance To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide. PMID:23805195

Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

PubMed

Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J

2013-01-01

Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

Crystal Structures of Yellowtail Ascites Virus VP4 Protease

PubMed Central

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-01-01

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

PubMed

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-05-03

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.

Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

PubMed Central

Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

2014-01-01

Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

Calculation of spherical harmonics and Wigner d functions by FFT. Applications to fast rotational matching in molecular replacement and implementation into AMoRe.

PubMed

Trapani, Stefano; Navaza, Jorge

2006-07-01

The FFT calculation of spherical harmonics, Wigner D matrices and rotation function has been extended to all angular variables in the AMoRe molecular replacement software. The resulting code avoids singularity issues arising from recursive formulas, performs faster and produces results with at least the same accuracy as the original code. The new code aims at permitting accurate and more rapid computations at high angular resolution of the rotation function of large particles. Test calculations on the icosahedral IBDV VP2 subviral particle showed that the new code performs on the average 1.5 times faster than the original code.

Transcription-associated mutational pressure in the Parvovirus B19 genome: Reactivated genomes contribute to the variability of viral populations.

PubMed

Khrustalev, Vladislav Victorovich; Ermalovich, Marina Anatolyevna; Hübschen, Judith M; Khrustaleva, Tatyana Aleksandrovna

2017-12-21

In this study we used non-overlapping parts of the two long open reading frames coding for nonstructural (NS) and capsid (VP) proteins of all available sequences of the Parvovirus B19 subgenotype 1a genome and found out that the rates of A to G, C to T and A to T mutations are higher in the first long reading frame (NS) of the virus than in the second one (VP). This difference in mutational pressure directions for two parts of the same viral genome can be explained by the fact of transcription of just the first long reading frame during the lifelong latency in nonerythroid cells. Adenine deamination (producing A to G and A to T mutations) and cytosine deamination (producing C to T mutations) occur more frequently in transcriptional bubbles formed by DNA "plus" strand of the first open reading frame. These mutations can be inherited only in case of reactivation of the infectious virus due to the help of Adenovirus that allows latent Parvovirus B19 to start transcription of the second reading frame and then to replicate its genome by the rolling circle mechanism using the specific origin. Results of this study provide evidence that the genomes reactivated from latency make significant contributions to the variability of Parvovirus B19. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Large and Intact Viral Particle Penetrates the Endoplasmic Reticulum Membrane to Reach the Cytosol

PubMed Central

Inoue, Takamasa; Tsai, Billy

2011-01-01

Non-enveloped viruses penetrate host membranes to infect cells. A cell-based assay was used to probe the endoplasmic reticulum (ER)-to-cytosol membrane transport of the non-enveloped SV40. We found that, upon ER arrival, SV40 is released into the lumen and undergoes sequential disulfide bond disruptions to reach the cytosol. However, despite these ER-dependent conformational changes, SV40 crosses the ER membrane as a large and intact particle consisting of the VP1 coat, the internal components VP2, VP3, and the genome. This large particle subsequently disassembles in the cytosol. Mutant virus and inhibitor studies demonstrate VP3 and likely the viral genome, as well as cellular proteasome, control ER-to-cytosol transport. Our results identify the sequence of events, as well as virus and host components, that regulate ER membrane penetration. They also suggest that the ER membrane supports passage of a large particle, potentially through either a sizeable protein-conducting channel or the lipid bilayer. PMID:21589906

An automated genotyping tool for enteroviruses and noroviruses.

PubMed

Kroneman, A; Vennema, H; Deforche, K; v d Avoort, H; Peñaranda, S; Oberste, M S; Vinjé, J; Koopmans, M

2011-06-01

Molecular techniques are established as routine in virological laboratories and virus typing through (partial) sequence analysis is increasingly common. Quality assurance for the use of typing data requires harmonization of genotype nomenclature, and agreement on target genes, depending on the level of resolution required, and robustness of methods. To develop and validate web-based open-access typing-tools for enteroviruses and noroviruses. An automated web-based typing algorithm was developed, starting with BLAST analysis of the query sequence against a reference set of sequences from viruses in the family Picornaviridae or Caliciviridae. The second step is phylogenetic analysis of the query sequence and a sub-set of the reference sequences, to assign the enterovirus type or norovirus genotype and/or variant, with profile alignment, construction of phylogenetic trees and bootstrap validation. Typing is performed on VP1 sequences of Human enterovirus A to D, and ORF1 and ORF2 sequences of genogroup I and II noroviruses. For validation, we used the tools to automatically type sequences in the RIVM and CDC enterovirus databases and the FBVE norovirus database. Using the typing-tools, 785(99%) of 795 Enterovirus VP1 sequences, and 8154(98.5%) of 8342 norovirus sequences were typed in accordance with previously used methods. Subtyping into variants was achieved for 4439(78.4%) of 5838 NoV GII.4 sequences. The online typing-tools reliably assign genotypes for enteroviruses and noroviruses. The use of phylogenetic methods makes these tools robust to ongoing evolution. This should facilitate standardized genotyping and nomenclature in clinical and public health laboratories, thus supporting inter-laboratory comparisons. Copyright © 2011 Elsevier B.V. All rights reserved.

Genetic Analyses Reveal Differences in the VP7 and VP4 Antigenic Epitopes between Human Rotaviruses Circulating in Belgium and Rotaviruses in Rotarix and RotaTeq

PubMed Central

Zeller, Mark; Patton, John T.; Heylen, Elisabeth; De Coster, Sarah; Ciarlet, Max; Van Ranst, Marc

2012-01-01

Two live-attenuated rotavirus group A (RVA) vaccines, Rotarix (G1P[8]) and RotaTeq (G1-G4, P[8]), have been successfully introduced in many countries worldwide, including Belgium. The parental RVA strains used to generate the vaccines were isolated more than 20 years ago in France (G4 parental strain in RotaTeq) and the United States (all other parental strains). At present, little is known about the relationship between currently circulating human RVAs and the vaccine strains. In this study, we determined sequences for the VP7 and VP4 outer capsid proteins of representative G1P[8], G2P[4], G3P[8], G4P[8], G9P[8], and G12P[8] RVAs circulating in Belgium during 2007 to 2009. The analyses showed that multiple amino acid differences existed between the VP7 and VP4 antigenic epitopes of the vaccine viruses and the Belgian isolates, regardless of their G and P genotypes. However, the highest variability was observed among the circulating G1P[8] RVA strains and the G1 and P[8] components of both RVA vaccines. In particular, RVA strains of the P[8] lineage 4 (OP354-like) showed a significant number of amino acid differences with the P[8] VP4 of both vaccines. In addition, the circulating Belgian G3 RVA strains were found to possibly possess an extra N-linked glycosylation site compared to the G3 RVA vaccine strain of RotaTeq. These results indicate that the antigenic epitopes of RVA strains contained in the vaccines differ substantially from those of the currently circulating RVA strains in Belgium. Over time, these differences might result in selection for strains that escape the RVA neutralizing-antibody pressure induced by vaccines. PMID:22189107

Genetic analyses reveal differences in the VP7 and VP4 antigenic epitopes between human rotaviruses circulating in Belgium and rotaviruses in Rotarix and RotaTeq.

PubMed

Zeller, Mark; Patton, John T; Heylen, Elisabeth; De Coster, Sarah; Ciarlet, Max; Van Ranst, Marc; Matthijnssens, Jelle

2012-03-01

Two live-attenuated rotavirus group A (RVA) vaccines, Rotarix (G1P[8]) and RotaTeq (G1-G4, P[8]), have been successfully introduced in many countries worldwide, including Belgium. The parental RVA strains used to generate the vaccines were isolated more than 20 years ago in France (G4 parental strain in RotaTeq) and the United States (all other parental strains). At present, little is known about the relationship between currently circulating human RVAs and the vaccine strains. In this study, we determined sequences for the VP7 and VP4 outer capsid proteins of representative G1P[8], G2P[4], G3P[8], G4P[8], G9P[8], and G12P[8] RVAs circulating in Belgium during 2007 to 2009. The analyses showed that multiple amino acid differences existed between the VP7 and VP4 antigenic epitopes of the vaccine viruses and the Belgian isolates, regardless of their G and P genotypes. However, the highest variability was observed among the circulating G1P[8] RVA strains and the G1 and P[8] components of both RVA vaccines. In particular, RVA strains of the P[8] lineage 4 (OP354-like) showed a significant number of amino acid differences with the P[8] VP4 of both vaccines. In addition, the circulating Belgian G3 RVA strains were found to possibly possess an extra N-linked glycosylation site compared to the G3 RVA vaccine strain of RotaTeq. These results indicate that the antigenic epitopes of RVA strains contained in the vaccines differ substantially from those of the currently circulating RVA strains in Belgium. Over time, these differences might result in selection for strains that escape the RVA neutralizing-antibody pressure induced by vaccines.

A Temperature-Sensitive Lesion in the N-Terminal Domain of the Rotavirus Polymerase Affects Its Intracellular Localization and Enzymatic Activity.

PubMed

McKell, Allison O; LaConte, Leslie E W; McDonald, Sarah M

2017-04-01

Temperature-sensitive ( ts ) mutants of simian rotavirus (RV) strain SA11 have been previously created to investigate the functions of viral proteins during replication. One mutant, SA11- ts C, has a mutation that maps to the gene encoding the VP1 polymerase and shows diminished growth and RNA synthesis at 39°C compared to that at 31°C. In the present study, we sequenced all 11 genes of SA11- ts C, confirming the presence of an L138P mutation in the VP1 N-terminal domain and identifying 52 additional mutations in four other viral proteins (VP4, VP7, NSP1, and NSP2). To investigate whether the L138P mutation induces a ts phenotype in VP1 outside the SA11- ts C genetic context, we employed ectopic expression systems. Specifically, we tested whether the L138P mutation affects the ability of VP1 to localize to viroplasms, which are the sites of RV RNA synthesis, by expressing the mutant form as a green fluorescent protein (GFP) fusion protein (VP1 L138P -GFP) (i) in wild-type SA11-infected cells or (ii) in uninfected cells along with viroplasm-forming proteins NSP2 and NSP5. We found that VP1 L138P -GFP localized to viroplasms and interacted with NSP2 and/or NSP5 at 31°C but not at 39°C. Next, we tested the enzymatic activity of a recombinant mutant polymerase (rVP1 L138P ) in vitro and found that it synthesized less RNA at 39°C than at 31°C, as well as less RNA than the control at all temperatures. Together, these results provide a mechanistic basis for the ts phenotype of SA11- ts C and raise important questions about the role of leucine 138 in supporting key protein interactions and the catalytic function of the VP1 polymerase. IMPORTANCE RVs cause diarrhea in the young of many animal species, including humans. Despite their medical and economic importance, gaps in knowledge exist about how these viruses replicate inside host cells. Previously, a mutant simian RV (SA11- ts C) that replicates worse at higher temperatures was identified. This virus has an amino acid mutation in VP1, which is the enzyme responsible for copying the viral RNA genome. The mutation is located in a poorly understood region of the polymerase called the N-terminal domain. In this study, we determined that the mutation reduces the ability of VP1 to properly localize within infected cells at high temperatures, as well as reduced the ability of the enzyme to copy viral RNA in a test tube. The results of this study explain the temperature sensitivity of SA11- ts C and shed new light on functional protein-protein interaction sites of VP1. Copyright © 2017 American Society for Microbiology.

Molecular differentiation and phylogenetic analysis of the Egyptian foot-and-mouth disease virus SAT2.

PubMed

El-Shehawy, Laila I; Abu-Elnaga, Hany I; Rizk, Sonia A; Abd El-Kreem, Ahmed S; Mohamed, A A; Fawzy, Hossam G

2014-03-01

In February 2012, a massive new foot-and-mouth disease (FMD) outbreak struck Egypt. In this work, one-step RT-PCR assays were used for in-house detection and differentiation of foot-and-mouth disease virus (FMDV) in Egypt in this year using pan-serotypic and serotype-targeting sequence primers. FMDV SAT2 was the dominant virus in the examined isolates from the epidemic. The complete VP1 coding regions of two isolates were sequenced. The two isolates had 99.2 % sequence identity to most contemporary Egyptian SAT2 reference viruses, whereas they had 89.7-90.1 % identity to the SAT2/EGY/2/2012 isolate, which was collected from Alexandria, Egypt, and previously sequenced by WRLFMD. Phylogenetic analysis showed that Egypt had one topotype and two lineage of FMDV SAT2 in 2012. The Egyptian and the Palestinian 2012 strains were associated mainly with topotype VII, lineage SAT2/VII/Ghb-12, while the virus isolated from Alexandria Governorate belonged to the SAT2/VII/Alx-12 lineage. Topotype VII also comprised lineages that included strains isolated from Libya in 2012 and 2003. Furthermore, within the same topotype, the Egyptian SAT2/2012 isolates were related to strains from Saudi Arabia, Sudan, Eritrea, Cameroon and Nigeria. Nevertheless, more epidemiological work with neighboring countries is needed to prevent cross-border spread of disease and to reach a precise conclusion about the origin of the 2012 FMDV SAT2 emergency in the Middle East.

Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

PubMed

Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

2018-03-15

The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan at molecular level. The detection of FPV could be a case of real co-infection or a case of dual presence, due to ingestion of contaminated food.

Molecular characterization of canine parvovirus variants (CPV-2a, CPV-2b, and CPV-2c) based on the VP2 gene in affected domestic dogs in Ecuador

PubMed Central

la Torre, David De; Mafla, Eulalia; Puga, Byron; Erazo, Linda; Astolfi-Ferreira, Claudete; Ferreira, Antonio Piantino

2018-01-01

Aim The objective of this study was to determine the presence of the variants of canine parvovirus (CPV)-2 in the city of Quito, Ecuador, due to the high domestic and street-type canine population, and to identify possible mutations at a genetic level that could be causing structural changes in the virus with a consequent influence on the immune response of the hosts. Materials and Methods Thirty-five stool samples from different puppies with characteristic signs of the disease and positives for CPV through immunochromatography kits were collected from different veterinarian clinics of the city. Polymerase chain reaction and DNA sequencing were used to determine the mutations in residue 426 of the VP2 gene, which determines the variants of CPV-2; in addition, four samples were chosen for complete sequencing of the VP2 gene to identify all possible mutations in the circulating strains in this region of the country. Results The results revealed the presence of the three variants of CPV-2 with a prevalence of 57.1% (20/35) for CPV-2a, 8.5% (3/35) for CPV-2b, and 34.3% (12/35) for CPV-2c. In addition, complete sequencing of the VP2 gene showed amino acid substitutions in residues 87, 101, 139, 219, 297, 300, 305, 322, 324, 375, 386, 426, 440, and 514 of the three Ecuadorian variants when compared with the original CPV-2 sequence. Conclusion This study describes the detection of CPV variants in the city of Quito, Ecuador. Variants of CPV-2 (2a, 2b, and 2c) have been reported in South America, and there are cases in Ecuador where CVP-2 is affecting even vaccinated puppies. PMID:29805214

The genetic evolution of canine parvovirus - A new perspective.

PubMed

Zhou, Pei; Zeng, Weijie; Zhang, Xin; Li, Shoujun

2017-01-01

To trace the evolution process of CPV-2, all of the VP2 gene sequences of CPV-2 and FPV (from 1978 to 2015) from GenBank were analyzed in this study. Then, several new ideas regarding CPV-2 evolution were presented. First, the VP2 amino acid 555 and 375 positions of CPV-2 were first ruled out as a universal mutation site in CPV-2a and amino acid 101 position of FPV feature I or T instead of only I in existing rule. Second, the recently confusing nomenclature of CPV-2 variants was substituted with a optional nomenclature that would serve future CPV-2 research. Third, After check the global distribution of variants, CPV-2a is the predominant variant in Asia and CPV-2c is the predominant variant in Europe and Latin America. Fourth, a series of CPV-2-like strains were identified and deduced to evolve from modified live vaccine strains. Finally, three single VP2 mutation (F267Y, Y324I, and T440A) strains were caught concern. Furthermore, these three new VP2 mutation strains may be responsible for vaccine failure, and the strains with VP2 440A may become the novel CPV sub-variant. In conclusion, a summary of all VP2 sequences provides a new perspective regarding CPV-2 evolution and the correlative biological studies needs to be further performed.

Joint Inversion of Vp, Vs, and Resistivity at SAFOD

NASA Astrophysics Data System (ADS)

Bennington, N. L.; Zhang, H.; Thurber, C. H.; Bedrosian, P. A.

2010-12-01

Seismic and resistivity models at SAFOD have been derived from separate inversions that show significant spatial similarity between the main model features. Previous work [Zhang et al., 2009] used cluster analysis to make lithologic inferences from trends in the seismic and resistivity models. We have taken this one step further by developing a joint inversion scheme that uses the cross-gradient penalty function to achieve structurally similar Vp, Vs, and resistivity images that adequately fit the seismic and magnetotelluric MT data without forcing model similarity where none exists. The new inversion code, tomoDDMT, merges the seismic inversion code tomoDD [Zhang and Thurber, 2003] and the MT inversion code Occam2DMT [Constable et al., 1987; deGroot-Hedlin and Constable, 1990]. We are exploring the utility of the cross-gradients penalty function in improving models of fault-zone structure at SAFOD on the San Andreas Fault in the Parkfield, California area. Two different sets of end-member starting models are being tested. One set is the separately inverted Vp, Vs, and resistivity models. The other set consists of simple, geologically based block models developed from borehole information at the SAFOD drill site and a simplified version of features seen in geophysical models at Parkfield. For both starting models, our preliminary results indicate that the inversion produces a converging solution with resistivity, seismic, and cross-gradient misfits decreasing over successive iterations. We also compare the jointly inverted Vp, Vs, and resistivity models to borehole information from SAFOD to provide a "ground truth" comparison.

The role of nuclear localization signal in parvovirus life cycle.

PubMed

Liu, Peng; Chen, Shun; Wang, Mingshu; Cheng, Anchun

2017-04-14

Parvoviruses are small, non-enveloped viruses with an approximately 5.0 kb, single-stranded DNA genome. Usually, the parvovirus capsid gene contains one or more nuclear localization signals (NLSs), which are required for guiding the virus particle into the nucleus through the nuclear pore. However, several classical NLSs (cNLSs) and non-classical NLSs (ncNLSs) have been identified in non-structural genes, and the ncNLSs can also target non-structural proteins into the nucleus. In this review, we have summarized recent research findings on parvovirus NLSs. The capsid protein of the adeno-associated virus has four potential nuclear localization sequences, named basic region 1 (BR), BR2, BR3 and BR4. BR3 was identified as an NLS by fusing it with green fluorescent protein. Moreover, BR3 and BR4 are required for infectivity and virion assembly. In Protoparvovirus, the canine parvovirus has a common cNLS located in the VP1 unique region, similar to parvovirus minute virus of mice (MVM) and porcine parvovirus. Moreover, an ncNLS is found in the C-terminal region of MVM VP1/2. Parvovirus B19 also contains an ncNLS in the C-terminal region of VP1/2, which is essential for the nuclear transport of VP1/VP2. Approximately 1 or 2 cNLSs and 1 ncNLS have been reported in the non-structural protein of bocaviruses. Understanding the role of the NLS in the process of parvovirus infection and its mechanism of nuclear transport will contribute to the development of therapeutic vaccines and novel antiviral medicines.

Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis

PubMed Central

Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P. N.; Sharma, N. S.

2015-01-01

Aim: The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2. PMID:27046996

Laboratory investigation and phylogenetic analysis of enteroviruses involved in an aseptic meningitis outbreak in Greece during the summer of 2007.

PubMed

Logotheti, Maria; Pogka, Vasiliki; Horefti, Elina; Papadakos, Konstantinos; Giannaki, Maria; Pangalis, Anastasia; Sgouras, Dionyssios; Mentis, Andreas

2009-11-01

Aseptic meningitis is the most commonly observed CNS infection and is mainly attributed to Non-Polio Enteroviruses (EV). Identification and genetic analysis of the EV involved in the recent aseptic meningitis outbreak which occurred in Greece, during the summer of 2007. In total, 213 CSF and faecal samples were examined for EV presence by culture, while enteroviral RNA detection was performed by nucleic acid sequence-based amplification assay (NASBA). EV strains were typed by seroneutralization, as well as nested RT-PCR followed by VP1-2A gene partial sequencing. Phylogenetic analysis was carried out for the identification of the genetic relatedness among the isolated EV strains. EV detection rate in CSF and faecal samples was 43.9% and 70.8%, respectively. EV serotyping and VP1 region analysis revealed the predominance of echovirus 4 (ECV4) serotype and the circulation of ECV6, 9, 14, 25, Coxsackie A6, A15, A24 and Coxsackie B1 serotypes. All ECV4 isolates presented a 98.7% similarity in nucleotide sequence, with a Spanish ECV4 strain, isolated during a meningitis outbreak in 2006. It is the first time that ECV4 is associated with an aseptic meningitis outbreak in Greece, during which 9 different EV serotypes were co-circulating. All Greek ECV4 isolates were closely related to the Spanish ECV4 strain. Genetic analysis of the VP1 gene can significantly contribute to the revelation of the endemic EV strains circulation pattern and their phylogenetic relationship with enteroviruses involved in epidemics of distant geographical areas at different time periods.

Acute diarrhea in West African children: diverse enteric viruses and a novel parvovirus genus.

PubMed

Phan, Tung G; Vo, Nguyen P; Bonkoungou, Isidore J O; Kapoor, Amit; Barro, Nicolas; O'Ryan, Miguel; Kapusinszky, Beatrix; Wang, Chunling; Delwart, Eric

2012-10-01

Parvoviruses cause a variety of mild to severe symptoms or asymptomatic infections in humans and animals. During a viral metagenomic analysis of feces from children with acute diarrhea in Burkina Faso, we identified in decreasing prevalence nucleic acids from anelloviruses, dependoviruses, sapoviruses, enteroviruses, bocaviruses, noroviruses, adenoviruses, parechoviruses, rotaviruses, cosavirus, astroviruses, and hepatitis B virus. Sequences from a highly divergent parvovirus, provisionally called bufavirus, were also detected whose NS1 and VP1 proteins showed <39% and <31% identities to those of previously known parvoviruses. Four percent of the fecal samples were PCR positive for this new parvovirus, including a related bufavirus species showing only 72% identity in VP1. The high degree of genetic divergence of these related genomes from those of other parvoviruses indicates the presence of a proposed new Parvoviridae genus containing at least two species. Studies of the tropism and pathogenicity of these novel parvoviruses will be facilitated by the availability of their genome sequences.

Acute Diarrhea in West African Children: Diverse Enteric Viruses and a Novel Parvovirus Genus

PubMed Central

Phan, Tung G.; Vo, Nguyen P.; Bonkoungou, Isidore J. O.; Kapoor, Amit; Barro, Nicolas; O'Ryan, Miguel; Kapusinszky, Beatrix; Wang, Chunling

2012-01-01

Parvoviruses cause a variety of mild to severe symptoms or asymptomatic infections in humans and animals. During a viral metagenomic analysis of feces from children with acute diarrhea in Burkina Faso, we identified in decreasing prevalence nucleic acids from anelloviruses, dependoviruses, sapoviruses, enteroviruses, bocaviruses, noroviruses, adenoviruses, parechoviruses, rotaviruses, cosavirus, astroviruses, and hepatitis B virus. Sequences from a highly divergent parvovirus, provisionally called bufavirus, were also detected whose NS1 and VP1 proteins showed <39% and <31% identities to those of previously known parvoviruses. Four percent of the fecal samples were PCR positive for this new parvovirus, including a related bufavirus species showing only 72% identity in VP1. The high degree of genetic divergence of these related genomes from those of other parvoviruses indicates the presence of a proposed new Parvoviridae genus containing at least two species. Studies of the tropism and pathogenicity of these novel parvoviruses will be facilitated by the availability of their genome sequences. PMID:22855485

Identification of canine parvovirus with the Q370R point mutation in the VP2 gene from a giant panda (Ailuropoda melanoleuca).

PubMed

Guo, Ling; Yang, Shao-lin; Chen, Shi-jie; Zhang, Zhihe; Wang, Chengdong; Hou, Rong; Ren, Yupeng; Wen, Xintian; Cao, Sanjie; Guo, Wanzhu; Hao, Zhongxiang; Quan, Zifang; Zhang, Manli; Yan, Qi-gui

2013-05-26

In this study, we sequenced and phylogenetic analyses of the VP2 genes from twelve canine parvovirus (CPV) strains obtained from eleven domestic dogs and a giant panda (Ailuropoda melanoleuca) in China. A novel canine parvovirus (CPV) was detected from the giant panda in China. Nucleotide and phylogenetic analysis of the capsid protein VP2 gene classified the CPV as a new CPV-2a type. Substitution of Gln for Arg at the conserved 370 residue in CPV presents an unusual variation in the new CPV-2a amino acid sequence of the giant panda and is further evidence for the continuing evolution of the virus. These findings extend the knowledge on CPV molecular epidemiology of particular relevance to wild carnivores.

Phylogeny of imported and reestablished wild polioviruses in theDemocratic Republic of the Congo from 2006 to 2011.

PubMed

Gumede, Nicksy; Jorba, Jaume; Deshpande, Jagadish; Pallansch, Mark; Yogolelo, Riziki; Muyembe-Tamfum, Jean Jacques; Kew, Olen; Venter, Marietjie; Burns, Cara C

2014-11-01

The last case of polio associated with wild poliovirus (WPV) indigenous to the Democratic Republic of the Congo (DRC) was reported in 2001, marking a major milestone toward polio eradication in Africa. However, during 2006-2011, outbreaks associated with WPV type 1 (WPV1) were widespread in the DRC, with >250 reported cases. WPV1 isolates obtained from patients with acute flaccid paralysis (AFP) were compared by nucleotide sequencing of the VP1 capsid region (906 nucleotides). VP1 sequence relationships among isolates from the DRC and other countries were visualized in phylogenetic trees, and isolates representing distinct lineage groups were mapped. Phylogenetic analysis indicated that WPV1 was imported twice in 2004-2005 and once in approximately 2006 from Uttar Pradesh, India (a major reservoir of endemicity for WPV1 and WPV3 until 2010-2011), into Angola. WPV1 from the first importation spread to the DRC in 2006, sparking a series of outbreaks that continued into 2011. WPV1 from the second importation was widely disseminated in the DRC and spread to the Congo in 2010-2011. VP1 sequence relationships revealed frequent transmission of WPV1 across the borders of Angola, the DRC, and the Congo. Long branches on the phylogenetic tree signaled prolonged gaps in AFP surveillance and a likely underreporting of polio cases. The reestablishment of widespread and protracted WPV1 transmission in the DRC and Angola following long-range importations highlights the continuing risks of WPV spread until global eradication is achieved, and it further underscores the need for all countries to maintain high levels of poliovirus vaccine coverage and sensitive surveillance to protect their polio-free status. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Molecular phylogeny of Coxsackievirus A16 in Shenzhen, China, from 2005 to 2009.

PubMed

Zong, Wenping; He, Yaqing; Yu, Shouyi; Yang, Hong; Xian, Huixia; Liao, Yuxue; Hu, Guifang

2011-04-01

Phylogenetic analysis of a Coxsackievirus A16 (CA16) sequence from Shenzhen, China, and other Chinese and international CA16 sequences revealed a pattern of endemic cocirculation of strains of clusters B2a and B2b within subtype B2 viruses. Amino acid evolution and nucleotide variation in the VP1 region were slight for 5 years.

Identification of novel rabbit hemorrhagic disease virus B-cell epitopes and their interaction with host histo-blood group antigens.

PubMed

Song, Yanhua; Wang, Fang; Fan, Zhiyu; Hu, Bo; Liu, Xing; Wei, Houjun; Xue, Jiabin; Xu, Weizhong; Qiu, Rulong

2016-02-01

Rabbit haemorrhagic disease, caused by rabbit hemorrhagic disease virus (RHDV), results in the death of millions of adult rabbits worldwide, with a mortality rate that exceeds 90%. The sole capsid protein, VP60, is divided into shell (S) and protruding (P) domains, and the more exposed P domain likely contains determinants for cell attachment and antigenic diversity. Nine mAbs against VP60 were screened and identified. To map antigenic epitopes, a set of partially overlapping and consecutive truncated proteins spanning VP60 were expressed. The minimal determinants of the linear B-cell epitopes of VP60 in the P domain, N(326)PISQV(331), D(338)MSFV(342) and K(562)STLVFNL(569), were recognized by one (5H3), four (1B8, 3D11, 4C2 and 4G2) and four mAbs (1D4, 3F7, 5G2 and 6B2), respectively. Sequence alignment showed epitope D(338)MSFV(342) was conserved among all RHDV isolates. Epitopes N(326)PISQV(331) and K(562)STLVFNL(569) were highly conserved among RHDV G1-G6 and variable in RHDV2 strains. Previous studies demonstrated that native viral particles and virus-like particles (VLPs) of RHDV specifically bound to synthetic blood group H type 2 oligosaccharides. We established an oligosaccharide-based assay to analyse the binding of VP60 and epitopes to histo-blood group antigens (HBGAs). Results showed VP60 and its epitopes (aa 326-331 and 338-342) in the P2 subdomain could significantly bind to blood group H type 2. Furthermore, mAbs 1B8 and 5H3 could block RHDV VLP binding to synthetic H type 2. Collectively, these two epitopes might play a key role in the antigenic structure of VP60 and interaction of RHDV and HBGA.

Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China

PubMed Central

WANG, ZHANG-YANG; HONG, WEI-LONG; ZHU, ZHE-HUI; CHEN, YUN-HAO; YE, WEN-LE; CHU, GUANG-YU; LI, JIA-LIN; CHEN, BI-CHENG; XIA, PENG

2015-01-01

BK polyomavirus (BKV) is important pathogen for kidney transplant recipients, as it is frequently re-activated, leading to nephropathy. The aim of this study was to investigate the phylogenetic reconstruction and polymorphism of the VP2 gene in BKV isolated from Chinese kidney transplant recipients. Phylogenetic analysis was carried out in the VP2 region from 135 BKV-positive samples and 28 reference strains retrieved from GenBank. The unweighted pair-group method with arithmetic mean (UPGMA) grouped all strains into subtypes, but failed to subdivide strains into subgroups. Among the plasma and urine samples, all plasma (23/23) and 82 urine samples (82/95) were identified to contain subtype I; the other 10 urine samples contained subtype IV. A 86-bp fragment was identified as a highly conserved sequence. Following alignment with 36 published BKV sequences from China, 92 sites of polymorphism were identified, including 11 single nucleotide polymorphisms (SNPs) prevalent in Chinese individuals and 30 SNPs that were specific to the two predominant subtypes I and IV. The limitations of the VP2 gene segment in subgrouping were confirmed by phylogenetic analysis. The conserved sequence and polymorphism identified in this study may be helpful in the detection and genotyping of BKV. PMID:26640547

Isolation of sabin-like polioviruses from wastewater in a country using inactivated polio vaccine.

PubMed

Zurbriggen, Sebastian; Tobler, Kurt; Abril, Carlos; Diedrich, Sabine; Ackermann, Mathias; Pallansch, Mark A; Metzler, Alfred

2008-09-01

From 2001 to 2004, Switzerland switched from routine vaccination with oral polio vaccine (OPV) to inactivated polio vaccine (IPV), using both vaccines in the intervening period. Since IPV is less effective at inducing mucosal immunity than OPV, this change might allow imported poliovirus to circulate undetected more easily in an increasingly IPV-immunized population. Environmental monitoring is a recognized tool for identifying polioviruses in a community. To look for evidence of poliovirus circulation following cessation of OPV use, two sewage treatment plants located in the Zurich area were sampled from 2004 to 2006. Following virus isolation using either RD or L20B cells, enteroviruses and polioviruses were identified by reverse transcription-PCR. A total of 20 out of 174 wastewater samples were positive for 62 Sabin-like isolates. One isolate from each poliovirus-positive sample was analyzed in more detail. Sequencing the complete viral protein 1 (VP1) capsid coding region, as well as intratypic differentiation (ITD), identified 3 Sabin type 1, 13 Sabin type 2, and 4 Sabin type 3 strains. One serotype 1 strain showed a discordant result in the ITD. Three-quarters of the strains showed mutations within the 5' untranslated region and VP1, known to be associated with reversion to virulence. Moreover, three strains showed heterotypic recombination (S2/S1 and S3/S2/S3). The low number of synonymous mutations and the partial temperature sensitivity are not consistent with extended circulation of these Sabin virus strains. Nevertheless, the continuous introduction of polioviruses into the community emphasizes the necessity for uninterrupted child vaccination to maintain high herd immunity.

The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development.

PubMed

Hou, Hongmin; Yan, Xiaoxiao; Sha, Ting; Yan, Qin; Wang, Xiping

2017-07-13

Flowering occurs in angiosperms during a major developmental transition from vegetative growth to the reproductive phase. Squamosa promoter binding protein (SBP)-box genes have been found to play critical roles in regulating flower and fruit development, but their roles in grapevine have remained unclear. To better understand the functions of the grape SBP-box genes in both vegetative and reproductive growth phases, a full-length complementary DNA (cDNA) sequence of the putative SBP-box transcription factor gene, VpSBP11 , was obtained from Chinese wild grapevine Vitis pseudoreticulata Wen Tsai Wang (W. T. Wang) clone 'Baihe-35-1'. VpSBP11 encoded a putative polypeptide of 170 amino acids with a highly conserved SBP-domain with two zinc-binding sites of the Cx2C-x3-H-x11-C-x6-H (C2HCH) type and a nuclear localization signal. We confirmed that the VpSBP11 protein was targeted to the nucleus and possessed transcriptional activation activity by subcellular localization and trans -activation assay. Over-expression of VpSBP11 in Arabidopsis thaliana was shown to activate the FUL gene, and subsequently the AP1 and LFY genes, all of which were floral meristem identity genes, and to cause earlier flowering than in wild type (WT) plants. The pattern of vegetative growth was also different between the transgenic and WT plants. For example, in the VpSBP11 over-expressing transgenic plants, the number of rosette leaves was less than that of WT; the petiole was significantly elongated; and the rosette and cauline leaves curled upwards or downwards. These results were consistent with VpSBP11 acting as a transcription factor during the transition from the vegetative stage to the reproductive stage.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Expression and purification of recombinant polyomavirus VP2 protein and its interactions with polyomavirus proteins

NASA Technical Reports Server (NTRS)

Cai, X.; Chang, D.; Rottinghaus, S.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1994-01-01

Recombinant polyomavirus VP2 protein was expressed in Escherichia coli (RK1448), using the recombinant expression system pFPYV2. Recombinant VP2 was purified to near homogeneity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electroelution, and Extracti-Gel chromatography. Polyclonal serum to this protein which reacted specifically with recombinant VP2 as well as polyomavirus virion VP2 and VP3 on Western blots (immunoblots) was produced. Purified VP2 was used to establish an in vitro protein-protein interaction assay with polyomavirus structural proteins and purified recombinant VP1. Recombinant VP2 interacted with recombinant VP1, virion VP1, and the four virion histones. Recombinant VP1 coimmunoprecipitated with recombinant VP2 or truncated VP2 (delta C12VP2), which lacked the carboxy-terminal 12 amino acids. These experiments confirmed the interaction between VP1 and VP2 and revealed that the carboxyterminal 12 amino acids of VP2 and VP3 were not necessary for formation of this interaction. In vivo VP1-VP2 interaction study accomplished by cotransfection of COS-7 cells with VP2 and truncated VP1 (delta N11VP1) lacking the nuclear localization signal demonstrated that VP2 was capable of translocating delta N11VP1 into the nucleus. These studies suggest that complexes of VP1 and VP2 may be formed in the cytoplasm and cotransported to the nucleus for virion assembly to occur.

Molecular and Cellular Mechanisms for the Interaction between Gold Nanoparticles and Neuroimmune Cells Based on Size, Shape, and Charge

DTIC Science & Technology

2014-04-25

IgG secretion. 2.3 Designing of Synthetic peptide The immunogenic peptides against the foot and mouth disease virus ( FMDV ) were designed and...synthesized based on viral protein 1 of type O FMDV . The amino acid sequence for pFMDV is NGSSKYGDTSTNNVRGDLQVLAQKAERTLC. An extra cysteine was added...peptides were synthesized based on the amino acid sequence of the VP1 coat protein of the FMDV (table 1). The peptide pFMDVD (19 amino acids in length

Molecular epidemiology of Avian Rotaviruses Group A and D shed by different bird species in Nigeria.

PubMed

Pauly, Maude; Oni, Oluwole O; Sausy, Aurélie; Owoade, Ademola A; Adeyefa, Christopher A O; Muller, Claude P; Hübschen, Judith M; Snoeck, Chantal J

2017-06-12

Avian rotaviruses (RVs) cause gastrointestinal diseases of birds worldwide. However, prevalence, diversity, epidemiology and phylogeny of RVs remain largely under-investigated in Africa. Fecal samples from 349 birds (158 symptomatic, 107 asymptomatic and 84 birds without recorded health status) were screened by reverse transcription PCR to detect RV groups A and D (RVA and RVD). Partial gene sequences of VP4, VP6, VP7 and NSP4 for RVA, and of VP6 and VP7 for RVD were obtained and analyzed to infer phylogenetic relationship. Fisher's exact test and logistic regression were applied to identify factors potentially influencing virus shedding in chickens. A high prevalence of RVA (36.1%; 126/349) and RVD (31.8%; 111/349) shedding was revealed in birds. In chickens, RV shedding was age-dependent and highest RVD shedding rates were found in commercial farms. No negative health effect could be shown, and RVA and RVD shedding was significantly more likely in asymptomatic chickens: RVA/RVD were detected in 51.9/48.1% of the asymptomatic chickens, compared to 18.9/29.7% of the symptomatic chickens (p < 0.001/p = 0.01). First RVA sequences were obtained from mallard ducks (Anas platyrhynchos) and guinea fowls (Numida meleagris). Phylogenetic analyses illustrated the high genetic diversity of RVA and RVD in Nigerian birds and suggested cross-species transmission of RVA, especially at live bird markets. Indeed, RVA strains highly similar to a recently published fox rotavirus (RVA/Fox-tc/ITA/288356/2011/G18P[17]) and distantly related to other avian RVs were detected in different bird species, including pigeons, ducks, guinea fowls, quails and chickens. This study provides new insights into epidemiology, diversity and classification of avian RVA and RVD in Nigeria. We show that cross-species transmission of host permissive RV strains occurs when different bird species are mixed.

An Equality in Stochastic Processes

DTIC Science & Technology

1971-06-21

Neyman have dis- cussed extensively this model in their study of the probabilities of relapse, re- covery, and death for cancer patients [6] (see also Du...negative constant and vp a positive constant. Explicit formulas of the probabilities Pa )(to, t) have been derived in terms of vP.. and vP. (see [2...transitions from Sp occurring during (T, t); the probability of this sequence of events is (52) P’aja’(to 7-)[ vap d7-]P,’’ (TX t)- Integrating (52) from T

Virtual patient design: exploring what works and why. A grounded theory study.

PubMed

Bateman, James; Allen, Maggie; Samani, Dipti; Kidd, Jane; Davies, David

2013-06-01

Virtual patients (VPs) are online representations of clinical cases used in medical education. Widely adopted, they are well placed to teach clinical reasoning skills. International technology standards mean VPs can be created, shared and repurposed between institutions. A systematic review has highlighted the lack of evidence to support which of the numerous VP designs may be effective, and why. We set out to research the influence of VP design on medical undergraduates. This is a grounded theory study into the influence of VP design on undergraduate medical students. Following a review of the literature and publicly available VP cases, we identified important design properties. We integrated them into two substantial VPs produced for this research. Using purposeful iterative sampling, 46 medical undergraduates were recruited to participate in six focus groups. Participants completed both VPs, an evaluation and a 1-hour focus group discussion. These were digitally recorded, transcribed and analysed using grounded theory, supported by computer-assisted analysis. Following open, axial and selective coding, we produced a theoretical model describing how students learn from VPs. We identified a central core phenomenon designated 'learning from the VP'. This had four categories: VP Construction; External Preconditions; Student-VP Interaction, and Consequences. From these, we constructed a three-layer model describing the interactions of students with VPs. The inner layer consists of the student's cognitive and behavioural preconditions prior to sitting a case. The middle layer considers the VP as an 'encoded object', an e-learning artefact and as a 'constructed activity', with associated pedagogic and organisational elements. The outer layer describes cognitive and behavioural change. This is the first grounded theory study to explore VP design. This original research has produced a model which enhances understanding of how and why the delivery and design of VPs influence learning. The model may be of practical use to authors, institutions and researchers. © 2013 John Wiley & Sons Ltd.

Conserved differences in protein sequence determine the human pathogenicity of Ebolaviruses

PubMed Central

Pappalardo, Morena; Juliá, Miguel; Howard, Mark J.; Rossman, Jeremy S.; Michaelis, Martin; Wass, Mark N.

2016-01-01

Reston viruses are the only Ebolaviruses that are not pathogenic in humans. We analyzed 196 Ebolavirus genomes and identified specificity determining positions (SDPs) in all nine Ebolavirus proteins that distinguish Reston viruses from the four human pathogenic Ebolaviruses. A subset of these SDPs will explain the differences in human pathogenicity between Reston and the other four ebolavirus species. Structural analysis was performed to identify those SDPs that are likely to have a functional effect. This analysis revealed novel functional insights in particular for Ebolavirus proteins VP40 and VP24. The VP40 SDP P85T interferes with VP40 function by altering octamer formation. The VP40 SDP Q245P affects the structure and hydrophobic core of the protein and consequently protein function. Three VP24 SDPs (T131S, M136L, Q139R) are likely to impair VP24 binding to human karyopherin alpha5 (KPNA5) and therefore inhibition of interferon signaling. Since VP24 is critical for Ebolavirus adaptation to novel hosts, and only a few SDPs distinguish Reston virus VP24 from VP24 of other Ebolaviruses, human pathogenic Reston viruses may emerge. This is of concern since Reston viruses circulate in domestic pigs and can infect humans, possibly via airborne transmission. PMID:27009368

Conserved differences in protein sequence determine the human pathogenicity of Ebolaviruses.

PubMed

Pappalardo, Morena; Juliá, Miguel; Howard, Mark J; Rossman, Jeremy S; Michaelis, Martin; Wass, Mark N

2016-03-24

Reston viruses are the only Ebolaviruses that are not pathogenic in humans. We analyzed 196 Ebolavirus genomes and identified specificity determining positions (SDPs) in all nine Ebolavirus proteins that distinguish Reston viruses from the four human pathogenic Ebolaviruses. A subset of these SDPs will explain the differences in human pathogenicity between Reston and the other four ebolavirus species. Structural analysis was performed to identify those SDPs that are likely to have a functional effect. This analysis revealed novel functional insights in particular for Ebolavirus proteins VP40 and VP24. The VP40 SDP P85T interferes with VP40 function by altering octamer formation. The VP40 SDP Q245P affects the structure and hydrophobic core of the protein and consequently protein function. Three VP24 SDPs (T131S, M136L, Q139R) are likely to impair VP24 binding to human karyopherin alpha5 (KPNA5) and therefore inhibition of interferon signaling. Since VP24 is critical for Ebolavirus adaptation to novel hosts, and only a few SDPs distinguish Reston virus VP24 from VP24 of other Ebolaviruses, human pathogenic Reston viruses may emerge. This is of concern since Reston viruses circulate in domestic pigs and can infect humans, possibly via airborne transmission.

First Report of a Fatal Case Associated with EV-D68 Infection in Hong Kong and Emergence of an Interclade Recombinant in China Revealed by Genome Analysis.

PubMed

Yip, Cyril C Y; Lo, Janice Y C; Sridhar, Siddharth; Lung, David C; Luk, Shik; Chan, Kwok-Hung; Chan, Jasper F W; Cheng, Vincent C C; Woo, Patrick C Y; Yuen, Kwok-Yung; Lau, Susanna K P

2017-05-16

A fatal case associated with enterovirus D68 (EV-D68) infection affecting a 10-year-old boy was reported in Hong Kong in 2014. To examine if a new strain has emerged in Hong Kong, we sequenced the partial genome of the EV-D68 strain identified from the fatal case and the complete VP1, and partial 5'UTR and 2C sequences of nine additional EV-D68 strains isolated from patients in Hong Kong. Sequence analysis indicated that a cluster of strains including the previously recognized A2 strains should belong to a separate clade, clade D, which is further divided into subclades D1 and D2. Among the 10 EV-D68 strains, 7 (including the fatal case) belonged to the previously described, newly emerged subclade B3, 2 belonged to subclade B1, and 1 belonged to subclade D1. Three EV-D68 strains, each from subclades B1, B3, and D1, were selected for complete genome sequencing and recombination analysis. While no evidence of recombination was noted among local strains, interclade recombination was identified in subclade D2 strains detected in mainland China in 2008 with VP2 acquired from clade A. This study supports the reclassification of subclade A2 into clade D1, and demonstrates interclade recombination between clades A and D2 in EV-D68 strains from China.

Development of an efficient entire-capsid-coding-region amplification method for direct detection of poliovirus from stool extracts.

PubMed

Arita, Minetaro; Kilpatrick, David R; Nakamura, Tomofumi; Burns, Cara C; Bukbuk, David; Oderinde, Soji B; Oberste, M Steven; Kew, Olen M; Pallansch, Mark A; Shimizu, Hiroyuki

2015-01-01

Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Predictive and comparative analysis of Ebolavirus proteins

PubMed Central

Cong, Qian; Pei, Jimin; Grishin, Nick V

2015-01-01

Ebolavirus is the pathogen for Ebola Hemorrhagic Fever (EHF). This disease exhibits a high fatality rate and has recently reached a historically epidemic proportion in West Africa. Out of the 5 known Ebolavirus species, only Reston ebolavirus has lost human pathogenicity, while retaining the ability to cause EHF in long-tailed macaque. Significant efforts have been spent to determine the three-dimensional (3D) structures of Ebolavirus proteins, to study their interaction with host proteins, and to identify the functional motifs in these viral proteins. Here, in light of these experimental results, we apply computational analysis to predict the 3D structures and functional sites for Ebolavirus protein domains with unknown structure, including a zinc-finger domain of VP30, the RNA-dependent RNA polymerase catalytic domain and a methyltransferase domain of protein L. In addition, we compare sequences of proteins that interact with Ebolavirus proteins from RESTV-resistant primates with those from RESTV-susceptible monkeys. The host proteins that interact with GP and VP35 show an elevated level of sequence divergence between the RESTV-resistant and RESTV-susceptible species, suggesting that they may be responsible for host specificity. Meanwhile, we detect variable positions in protein sequences that are likely associated with the loss of human pathogenicity in RESTV, map them onto the 3D structures and compare their positions to known functional sites. VP35 and VP30 are significantly enriched in these potential pathogenicity determinants and the clustering of such positions on the surfaces of VP35 and GP suggests possible uncharacterized interaction sites with host proteins that contribute to the virulence of Ebolavirus. PMID:26158395

Predictive and comparative analysis of Ebolavirus proteins.

PubMed

Cong, Qian; Pei, Jimin; Grishin, Nick V

2015-01-01

Ebolavirus is the pathogen for Ebola Hemorrhagic Fever (EHF). This disease exhibits a high fatality rate and has recently reached a historically epidemic proportion in West Africa. Out of the 5 known Ebolavirus species, only Reston ebolavirus has lost human pathogenicity, while retaining the ability to cause EHF in long-tailed macaque. Significant efforts have been spent to determine the three-dimensional (3D) structures of Ebolavirus proteins, to study their interaction with host proteins, and to identify the functional motifs in these viral proteins. Here, in light of these experimental results, we apply computational analysis to predict the 3D structures and functional sites for Ebolavirus protein domains with unknown structure, including a zinc-finger domain of VP30, the RNA-dependent RNA polymerase catalytic domain and a methyltransferase domain of protein L. In addition, we compare sequences of proteins that interact with Ebolavirus proteins from RESTV-resistant primates with those from RESTV-susceptible monkeys. The host proteins that interact with GP and VP35 show an elevated level of sequence divergence between the RESTV-resistant and RESTV-susceptible species, suggesting that they may be responsible for host specificity. Meanwhile, we detect variable positions in protein sequences that are likely associated with the loss of human pathogenicity in RESTV, map them onto the 3D structures and compare their positions to known functional sites. VP35 and VP30 are significantly enriched in these potential pathogenicity determinants and the clustering of such positions on the surfaces of VP35 and GP suggests possible uncharacterized interaction sites with host proteins that contribute to the virulence of Ebolavirus.

Novel Positive-Sense, Single-Stranded RNA (+ssRNA) Virus with Di-Cistronic Genome from Intestinal Content of Freshwater Carp (Cyprinus carpio)

PubMed Central

Pankovics, Péter; Simmonds, Peter

2011-01-01

A novel positive-sense, single-stranded RNA (+ssRNA) virus (Halastavi árva RNA virus, HalV; JN000306) with di-cistronic genome organization was serendipitously identified in intestinal contents of freshwater carps (Cyprinus carpio) fished by line-fishing from fishpond “Lőrinte halastó” located in Veszprém County, Hungary. The complete nucleotide (nt) sequence of the genomic RNA is 9565 nt in length and contains two long - non-in-frame - open reading frames (ORFs), which are separated by an intergenic region. The ORF1 (replicase) is preceded by an untranslated sequence of 827 nt, while an untranslated region of 139 nt follows the ORF2 (capsid proteins). The deduced amino acid (aa) sequences of the ORFs showed only low (less than 32%) and partial similarity to the non-structural (2C-like helicase, 3C-like cystein protease and 3D-like RNA dependent RNA polymerase) and structural proteins (VP2/VP4/VP3) of virus families in Picornavirales especially to members of the viruses with dicistronic genome. Halastavi árva RNA virus is present in intestinal contents of omnivorous freshwater carps but the origin and the host species of this virus remains unknown. The unique viral sequence and the actual position indicate that Halastavi árva RNA virus seems to be the first member of a new di-cistronic ssRNA virus. Further studies are required to investigate the specific host species (and spectrum), ecology and role of Halastavi árva RNA virus in the nature. PMID:22195010

Velocity Gradient Across the San Andreas Fault and Changes in Slip Behavior as Outlined by Full non Linear Tomography

NASA Astrophysics Data System (ADS)

Chiarabba, C.; Giacomuzzi, G.; Piana Agostinetti, N.

2017-12-01

The San Andreas Fault (SAF) near Parkfield is the best known fault section which exhibit a clear transition in slip behavior from stable to unstable. Intensive monitoring and decades of studies permit to identify details of these processes with a good definition of fault structure and subsurface models. Tomographic models computed so far revealed the existence of large velocity contrasts, yielding physical insight on fault rheology. In this study, we applied a recently developed full non-linear tomography method to compute Vp and Vs models which focus on the section of the fault that exhibit fault slip transition. The new tomographic code allows not to impose a vertical seismic discontinuity at the fault position, as routinely done in linearized codes. Any lateral velocity contrast found is directly dictated by the data themselves and not imposed by subjective choices. The use of the same dataset of previous tomographic studies allows a proper comparison of results. We use a total of 861 earthquakes, 72 blasts and 82 shots and the overall arrival time dataset consists of 43948 P- and 29158 S-wave arrival times, accurately selected to take care of seismic anisotropy. Computed Vp and Vp/Vs models, which by-pass the main problems related to linarized LET algorithms, excellently match independent available constraints and show crustal heterogeneities with a high resolution. The high resolution obtained in the fault surroundings permits to infer lateral changes of Vp and Vp/Vs across the fault (velocity gradient). We observe that stable and unstable sliding sections of the SAF have different velocity gradients, small and negligible in the stable slip segment, but larger than 15 % in the unstable slip segment. Our results suggest that Vp and Vp/Vs gradients across the fault control fault rheology and the attitude of fault slip behavior.

Recombinant vaccine for canine parvovirus in dogs.

PubMed

López de Turiso, J A; Cortés, E; Martínez, C; Ruiz de Ybáñez, R; Simarro, I; Vela, C; Casal, I

1992-05-01

VP2 is the major component of canine parvovirus (CPV) capsids. The VP2-coding gene was engineered to be expressed by a recombinant baculovirus under the control of the polyhedrin promoter. A transfer vector that contains the lacZ gene under the control of the p10 promoter was used in order to facilitate the selection of recombinants. The expressed VP2 was found to be structurally and immunologically indistinguishable from authentic VP2. The recombinant VP2 shows also the capability to self-assemble, forming viruslike particles similar in size and appearance to CPV virions. These viruslike particles have been used to immunize dogs in different doses and combinations of adjuvants, and the anti-CPV responses have been measured by enzyme-linked immunosorbent assay, monolayer protection assays, and an assay for the inhibition of hemagglutination. A dose of ca. 10 micrograms of VP2 was able to elicit a good protective response, higher than that obtained with a commercially available, inactivated vaccine. The results indicate that these viruslike particles can be used to protect dogs from CPV infection.

Recombinant vaccine for canine parvovirus in dogs.

PubMed Central

López de Turiso, J A; Cortés, E; Martínez, C; Ruiz de Ybáñez, R; Simarro, I; Vela, C; Casal, I

1992-01-01

VP2 is the major component of canine parvovirus (CPV) capsids. The VP2-coding gene was engineered to be expressed by a recombinant baculovirus under the control of the polyhedrin promoter. A transfer vector that contains the lacZ gene under the control of the p10 promoter was used in order to facilitate the selection of recombinants. The expressed VP2 was found to be structurally and immunologically indistinguishable from authentic VP2. The recombinant VP2 shows also the capability to self-assemble, forming viruslike particles similar in size and appearance to CPV virions. These viruslike particles have been used to immunize dogs in different doses and combinations of adjuvants, and the anti-CPV responses have been measured by enzyme-linked immunosorbent assay, monolayer protection assays, and an assay for the inhibition of hemagglutination. A dose of ca. 10 micrograms of VP2 was able to elicit a good protective response, higher than that obtained with a commercially available, inactivated vaccine. The results indicate that these viruslike particles can be used to protect dogs from CPV infection. Images PMID:1313899

Ebolavirus Classification Based on Natural Vectors

PubMed Central

Zheng, Hui; Yin, Changchuan; Hoang, Tung; He, Rong Lucy; Yang, Jie

2015-01-01

According to the WHO, ebolaviruses have resulted in 8818 human deaths in West Africa as of January 2015. To better understand the evolutionary relationship of the ebolaviruses and infer virulence from the relationship, we applied the alignment-free natural vector method to classify the newest ebolaviruses. The dataset includes three new Guinea viruses as well as 99 viruses from Sierra Leone. For the viruses of the family of Filoviridae, both genus label classification and species label classification achieve an accuracy rate of 100%. We represented the relationships among Filoviridae viruses by Unweighted Pair Group Method with Arithmetic Mean (UPGMA) phylogenetic trees and found that the filoviruses can be separated well by three genera. We performed the phylogenetic analysis on the relationship among different species of Ebolavirus by their coding-complete genomes and seven viral protein genes (glycoprotein [GP], nucleoprotein [NP], VP24, VP30, VP35, VP40, and RNA polymerase [L]). The topology of the phylogenetic tree by the viral protein VP24 shows consistency with the variations of virulence of ebolaviruses. The result suggests that VP24 be a pharmaceutical target for treating or preventing ebolaviruses. PMID:25803489

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ju, Huanyu; Wei, Na; Wang, Qian

Highlights: {yields} All three capsid proteins can be expressed in insect cells in baculovirus expression system. {yields} All three recombinant proteins were spontaneously self-assemble into virus-like particles whose size and appearance were similar to those of native purified GPV virions. {yields} The immunogenicity of GPV-VLPs was better than commercial inactivated vaccine and attenuated vaccine. -- Abstract: Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particlesmore » (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs.« less

Ebola VP40 in Exosomes Can Cause Immune Cell Dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pleet, Michelle L.; Mathiesen, Allison; DeMarino, Catherine

Ebola virus (EBOV) is an enveloped, ssRNA virus from the family Filoviridae capable of causing severe hemorrhagic fever with up to 80–90% mortality rates. The most recent outbreak of EBOV in West Africa starting in 2014 resulted in over 11,300 deaths; however, long-lasting persistence and recurrence in survivors has been documented, potentially leading to further transmission of the virus. We have previously shown that exosomes from cells infected with HIV-1, HTLV-1 and Rift Valley Fever virus are able to transfer viral proteins and non-coding RNAs to naïve recipient cells, resulting in an altered cellular activity. In the current manuscript, wemore » examined the effect of Ebola structural proteins VP40, GP, NP and VLPs on recipient immune cells, as well as the effect of exosomes containing these proteins on naïve immune cells. We found that VP40-transfected cells packaged VP40 into exosomes, and that these exosomes were capable of inducing apoptosis in recipient immune cells. In addition, we show that presence of VP40 within parental cells or in exosomes delivered to naïve cells could result in the regulation of RNAi machinery including Dicer, Drosha, and Ago 1, which may play a role in the induction of cell death in recipient immune cells. Exosome biogenesis was regulated by VP40 in transfected cells by increasing levels of ESCRT-II proteins EAP20 and EAP45, and exosomal marker proteins CD63 and Alix. VP40 was phosphorylated by Cdk2/Cyclin complexes at Serine 233 which could be reversed with r-Roscovitine treatment. The level of VP40-containing exosomes could also be regulated by treated cells with FDA-approved Oxytetracycline. Additionally, we utilized novel nanoparticles to safely capture VP40 and other viral proteins from Ebola VLPs spiked into human samples using SDS/reducing agents, thus minimizing the need for BSL-4 conditions for most downstream assays. Collectively, our data indicates that VP40 packaged into exosomes may be responsible for the deregulation and eventual destruction of the T-cell and myeloid arms of the immune system (bystander lymphocyte apoptosis), allowing the virus to replicate to high titers in the immunocompromised host. Moreover, our results suggest that the use of drugs such as Oxytetracycline to modulate the levels of exosomes exiting EBOV-infected cells may be able to prevent the devastation of the adaptive immune system and allow for an improved rate of survival.« less

Ebola VP40 in Exosomes Can Cause Immune Cell Dysfunction

DOE PAGES

Pleet, Michelle L.; Mathiesen, Allison; DeMarino, Catherine; ...

2016-11-07

Ebola virus (EBOV) is an enveloped, ssRNA virus from the family Filoviridae capable of causing severe hemorrhagic fever with up to 80–90% mortality rates. The most recent outbreak of EBOV in West Africa starting in 2014 resulted in over 11,300 deaths; however, long-lasting persistence and recurrence in survivors has been documented, potentially leading to further transmission of the virus. We have previously shown that exosomes from cells infected with HIV-1, HTLV-1 and Rift Valley Fever virus are able to transfer viral proteins and non-coding RNAs to naïve recipient cells, resulting in an altered cellular activity. In the current manuscript, wemore » examined the effect of Ebola structural proteins VP40, GP, NP and VLPs on recipient immune cells, as well as the effect of exosomes containing these proteins on naïve immune cells. We found that VP40-transfected cells packaged VP40 into exosomes, and that these exosomes were capable of inducing apoptosis in recipient immune cells. In addition, we show that presence of VP40 within parental cells or in exosomes delivered to naïve cells could result in the regulation of RNAi machinery including Dicer, Drosha, and Ago 1, which may play a role in the induction of cell death in recipient immune cells. Exosome biogenesis was regulated by VP40 in transfected cells by increasing levels of ESCRT-II proteins EAP20 and EAP45, and exosomal marker proteins CD63 and Alix. VP40 was phosphorylated by Cdk2/Cyclin complexes at Serine 233 which could be reversed with r-Roscovitine treatment. The level of VP40-containing exosomes could also be regulated by treated cells with FDA-approved Oxytetracycline. Additionally, we utilized novel nanoparticles to safely capture VP40 and other viral proteins from Ebola VLPs spiked into human samples using SDS/reducing agents, thus minimizing the need for BSL-4 conditions for most downstream assays. Collectively, our data indicates that VP40 packaged into exosomes may be responsible for the deregulation and eventual destruction of the T-cell and myeloid arms of the immune system (bystander lymphocyte apoptosis), allowing the virus to replicate to high titers in the immunocompromised host. Moreover, our results suggest that the use of drugs such as Oxytetracycline to modulate the levels of exosomes exiting EBOV-infected cells may be able to prevent the devastation of the adaptive immune system and allow for an improved rate of survival.« less

Ebola VP40 in Exosomes Can Cause Immune Cell Dysfunction.

PubMed

Pleet, Michelle L; Mathiesen, Allison; DeMarino, Catherine; Akpamagbo, Yao A; Barclay, Robert A; Schwab, Angela; Iordanskiy, Sergey; Sampey, Gavin C; Lepene, Benjamin; Nekhai, Sergei; Aman, M J; Kashanchi, Fatah

2016-01-01

Ebola virus (EBOV) is an enveloped, ssRNA virus from the family Filoviridae capable of causing severe hemorrhagic fever with up to 80-90% mortality rates. The most recent outbreak of EBOV in West Africa starting in 2014 resulted in over 11,300 deaths; however, long-lasting persistence and recurrence in survivors has been documented, potentially leading to further transmission of the virus. We have previously shown that exosomes from cells infected with HIV-1, HTLV-1 and Rift Valley Fever virus are able to transfer viral proteins and non-coding RNAs to naïve recipient cells, resulting in an altered cellular activity. In the current manuscript, we examined the effect of Ebola structural proteins VP40, GP, NP and VLPs on recipient immune cells, as well as the effect of exosomes containing these proteins on naïve immune cells. We found that VP40-transfected cells packaged VP40 into exosomes, and that these exosomes were capable of inducing apoptosis in recipient immune cells. Additionally, we show that presence of VP40 within parental cells or in exosomes delivered to naïve cells could result in the regulation of RNAi machinery including Dicer, Drosha, and Ago 1, which may play a role in the induction of cell death in recipient immune cells. Exosome biogenesis was regulated by VP40 in transfected cells by increasing levels of ESCRT-II proteins EAP20 and EAP45, and exosomal marker proteins CD63 and Alix. VP40 was phosphorylated by Cdk2/Cyclin complexes at Serine 233 which could be reversed with r-Roscovitine treatment. The level of VP40-containing exosomes could also be regulated by treated cells with FDA-approved Oxytetracycline. Additionally, we utilized novel nanoparticles to safely capture VP40 and other viral proteins from Ebola VLPs spiked into human samples using SDS/reducing agents, thus minimizing the need for BSL-4 conditions for most downstream assays. Collectively, our data indicates that VP40 packaged into exosomes may be responsible for the deregulation and eventual destruction of the T-cell and myeloid arms of the immune system (bystander lymphocyte apoptosis), allowing the virus to replicate to high titers in the immunocompromised host. Moreover, our results suggest that the use of drugs such as Oxytetracycline to modulate the levels of exosomes exiting EBOV-infected cells may be able to prevent the devastation of the adaptive immune system and allow for an improved rate of survival.

Identification and molecular analysis of infectious bursal disease in broiler farms in the Kurdistan Regional Government of Iraq.

PubMed

Amin, Oumed Gerjis M; Jackwood, Daral J

2014-10-01

The present study was undertaken to characterize field isolates of infectious bursal disease virus (IBDV). The identification was done using reverse transcription-polymerase chain reaction (RT-PCR) and partial sequencing of the VP2 gene. Pooled bursal samples were collected from commercial broiler farms located in the Kurdistan Regional Government (KRG) of Iraq. The genetic material of the IBDV was detected in 10 out of 29 field samples. Sequences of the hypervariable VP2 region were determined for 10 of these viruses. Molecular analysis of the VP2 gene of five IBDVs showed amino acid sequences consistent with the very virulent (vv) IBDV. Two samples were identified as classic vaccine viruses, and three samples were classic vaccine viruses that appear to have mutated during replication in the field. Phylogenetic analysis showed that all five field IBDV strains of the present study were closely related to each other. On the basis of nucleotide sequencing and phylogenetic analysis, it is very likely that IBD-causing viruses in this part of Iraq are of the very virulent type. These IBDVs appear to be evolving relative to their type strains.

Identification of canine parvovirus with the Q370R point mutation in the VP2 gene from a giant panda (Ailuropoda melanoleuca)

PubMed Central

2013-01-01

Background In this study, we sequenced and phylogenetic analyses of the VP2 genes from twelve canine parvovirus (CPV) strains obtained from eleven domestic dogs and a giant panda (Ailuropoda melanoleuca) in China. A novel canine parvovirus (CPV) was detected from the giant panda in China. Results Nucleotide and phylogenetic analysis of the capsid protein VP2 gene classified the CPV as a new CPV-2a type. Substitution of Gln for Arg at the conserved 370 residue in CPV presents an unusual variation in the new CPV-2a amino acid sequence of the giant panda and is further evidence for the continuing evolution of the virus. Conclusions These findings extend the knowledge on CPV molecular epidemiology of particular relevance to wild carnivores. PMID:23706032

Valine/isoleucine variants drive selective pressure in the VP1 sequence of EV-A71 enteroviruses.

PubMed

Duy, Nghia Ngu; Huong, Le Thi Thanh; Ravel, Patrice; Huong, Le Thi Song; Dwivedi, Ankit; Sessions, October Michael; Hou, Yan'An; Chua, Robert; Kister, Guilhem; Afelt, Aneta; Moulia, Catherine; Gubler, Duane J; Thiem, Vu Dinh; Thanh, Nguyen Thi Hien; Devaux, Christian; Duong, Tran Nhu; Hien, Nguyen Tran; Cornillot, Emmanuel; Gavotte, Laurent; Frutos, Roger

2017-05-08

In 2011-2012, Northern Vietnam experienced its first large scale hand foot and mouth disease (HFMD) epidemic. In 2011, a major HFMD epidemic was also reported in South Vietnam with fatal cases. This 2011-2012 outbreak was the first one to occur in North Vietnam providing grounds to study the etiology, origin and dynamic of the disease. We report here the analysis of the VP1 gene of strains isolated throughout North Vietnam during the 2011-2012 outbreak and before. The VP1 gene of 106 EV-A71 isolates from North Vietnam and 2 from Central Vietnam were sequenced. Sequence alignments were analyzed at the nucleic acid and protein level. Gene polymorphism was also analyzed. A Factorial Correspondence Analysis was performed to correlate amino acid mutations with clinical parameters. The sequences were distributed into four phylogenetic clusters. Three clusters corresponded to the subgenogroup C4 and the last one corresponded to the subgenogroup C5. Each cluster displayed different polymorphism characteristics. Proteins were highly conserved but three sites bearing only Isoleucine (I) or Valine (V) were characterized. The isoleucine/valine variability matched the clusters. Spatiotemporal analysis of the I/V variants showed that all variants which emerged in 2011 and then in 2012 were not the same but were all present in the region prior to the 2011-2012 outbreak. Some correlation was found between certain I/V variants and ethnicity and severity. The 2011-2012 outbreak was not caused by an exogenous strain coming from South Vietnam or elsewhere but by strains already present and circulating at low level in North Vietnam. However, what triggered the outbreak remains unclear. A selective pressure is applied on I/V variants which matches the genetic clusters. I/V variants were shown on other viruses to correlate with pathogenicity. This should be investigated in EV-A71. I/V variants are an easy and efficient way to survey and identify circulating EV-A71 strains.

Elucidation of Echovirus 30's Origin and Transmission during the 2012 Aseptic Meningitis Outbreak in Guangdong, China, through Continuing Environmental Surveillance

PubMed Central

Lu, Jing; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen

2015-01-01

An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

Peptides from the scorpion Vaejovis punctatus with broad antimicrobial activity.

PubMed

Ramírez-Carreto, Santos; Jiménez-Vargas, Juana María; Rivas-Santiago, Bruno; Corzo, Gerardo; Possani, Lourival D; Becerril, Baltazar; Ortiz, Ernesto

2015-11-01

The antimicrobial potential of two new non-disulfide bound peptides, named VpAmp1.0 (LPFFLLSLIPSAISAIKKI, amidated) and VpAmp2.0 (FWGFLGKLAMKAVPSLIGGNKSSSK) is here reported. These are 19- and 25-aminoacid-long peptides with +2 and +4 net charges, respectively. Their sequences correspond to the predicted mature regions from longer precursors, putatively encoded by cDNAs derived from the venom glands of the Mexican scorpion Vaejovis punctatus. Both peptides were chemically synthesized and assayed against a variety of microorganisms, including pathogenic strains from clinical isolates and strains resistant to conventional antibiotics. Two shorter variants, named VpAmp1.1 (FFLLSLIPSAISAIKKI, amidated) and VpAmp2.1 (FWGFLGKLAMKAVPSLIGGNKK), were also synthesized and tested. The antimicrobial assays revealed that the four synthetic peptides effectively inhibit the growth of both Gram-positive (Staphylococcus aureus and Streptococcus agalactiaea) and Gram-negative (Escherichia coli and Pseudomonas aeruginosa) bacteria, with MICs in the range of 2.5-24.0 μM; yeasts (Candida albicans and Candida glabrata) with MICs of 3.1-50.0 μM; and two clinically isolated strains of Mycobacterium tuberculosis-including a multi-drug resistant one- with MICs in the range of 4.8-30.5 μM. A comparison between the activities of the original peptides and their derivatives gives insight into the structural/functional role of their distinctive residues. Copyright © 2015 Elsevier Inc. All rights reserved.

Global Distribution and Evolutionary History of Enterovirus D68, with Emphasis on the 2014 Outbreak in Ontario, Canada.

PubMed

Eshaghi, Alireza; Duvvuri, Venkata R; Isabel, Sandra; Banh, Philip; Li, Aimin; Peci, Adriana; Patel, Samir N; Gubbay, Jonathan B

2017-01-01

Despite its first appearance in 1962, human enterovirus D68 (EV-D68) has been recognized as an emerging respiratory pathogen in the last decade when it caused outbreaks and clusters in several countries including Japan, the Philippines, and the Netherlands. The most recent and largest outbreak of EV-D68 associated with severe respiratory illness took place in North America between August 2014 and January 2015. Between September 1 and October 31 2014, EV-D68 infection was laboratory confirmed among 153/907 (16.9%) persons tested for the virus in Ontario, Canada, using real time RT-PCR and subsequent genotyping by sequencing of partial VP1 gene. In order to understand the evolutionary history of the 2014 North American EV-D68 outbreak, we conducted phylogenetic and phylodynamic analyses using available partial VP1 genes ( n = 469) and NCBI available whole genome sequences (WGS) ( n = 38). The global EV-D68 phylogenetic tree ( n = 469) reconfirms the divergence of three distinct clades A, B, and C from the prototype EV-D68 Fermon strain as previously documented. Two sub-clades (B1 and B2) were identified, with most 2014 EV-D68 outbreak strains belonging to sub-cluster B2b2 (one of the two emerging clusters within sub-clade B2), with two signature substitutions T650A and M700V in BC and DE loops of VP1 gene, respectively. The close homology between WGS of strains from Ontario ( n = 2) and USA ( n = 21) in the recent EV-D68 outbreak suggests genetic relatedness and also a common source for the outbreak. The time of most recent common ancestor of EV-D68 and the 2014 EV-D68 outbreak strain suggest that the viruses possibly emerged during 1960-1961 and 2012-2013, respectively. We observed lower mean evolutionary rates of global EV-D68 using WGS data than estimated with partial VP1 gene sequences. Based on WGS data, the estimated mean rate of evolution of the EV-D68 B2b cluster was 9.75 × 10 -3 substitutions/site/year (95% BCI 4.11 × 10 -3 to 16 × 10 -3 ).

Global Distribution and Evolutionary History of Enterovirus D68, with Emphasis on the 2014 Outbreak in Ontario, Canada

PubMed Central

Eshaghi, Alireza; Duvvuri, Venkata R.; Isabel, Sandra; Banh, Philip; Li, Aimin; Peci, Adriana; Patel, Samir N.; Gubbay, Jonathan B.

2017-01-01

Despite its first appearance in 1962, human enterovirus D68 (EV-D68) has been recognized as an emerging respiratory pathogen in the last decade when it caused outbreaks and clusters in several countries including Japan, the Philippines, and the Netherlands. The most recent and largest outbreak of EV-D68 associated with severe respiratory illness took place in North America between August 2014 and January 2015. Between September 1 and October 31 2014, EV-D68 infection was laboratory confirmed among 153/907 (16.9%) persons tested for the virus in Ontario, Canada, using real time RT-PCR and subsequent genotyping by sequencing of partial VP1 gene. In order to understand the evolutionary history of the 2014 North American EV-D68 outbreak, we conducted phylogenetic and phylodynamic analyses using available partial VP1 genes (n = 469) and NCBI available whole genome sequences (WGS) (n = 38). The global EV-D68 phylogenetic tree (n = 469) reconfirms the divergence of three distinct clades A, B, and C from the prototype EV-D68 Fermon strain as previously documented. Two sub-clades (B1 and B2) were identified, with most 2014 EV-D68 outbreak strains belonging to sub-cluster B2b2 (one of the two emerging clusters within sub-clade B2), with two signature substitutions T650A and M700V in BC and DE loops of VP1 gene, respectively. The close homology between WGS of strains from Ontario (n = 2) and USA (n = 21) in the recent EV-D68 outbreak suggests genetic relatedness and also a common source for the outbreak. The time of most recent common ancestor of EV-D68 and the 2014 EV-D68 outbreak strain suggest that the viruses possibly emerged during 1960–1961 and 2012–2013, respectively. We observed lower mean evolutionary rates of global EV-D68 using WGS data than estimated with partial VP1 gene sequences. Based on WGS data, the estimated mean rate of evolution of the EV-D68 B2b cluster was 9.75 × 10-3 substitutions/site/year (95% BCI 4.11 × 10-3 to 16 × 10-3). PMID:28298902

Modeling and Analysis of Wrinkled Membranes: An Overview

NASA Technical Reports Server (NTRS)

Yang, B.; Ding, H.; Lou, M.; Fang, H.; Broduer, Steve (Technical Monitor)

2001-01-01

Thin-film membranes are basic elements of a variety of space inflatable/deployable structures. Wrinkling degrades the performance and reliability of these membrane structures, and hence has been a topic of continued interest. Wrinkling analysis of membranes for general geometry and arbitrary boundary conditions is quite challenging. The objective of this presentation is two-fold. Firstly, the existing models of wrinkled membranes and related numerical solution methods are reviewed. The important issues to be discussed are the capability of a membrane model to characterize taut, wrinkled and slack states of membranes in a consistent and physically reasonable manner; the ability of a wrinkling analysis method to predict the formation and growth of wrinkled regions, and to determine out-of-plane deformation and wrinkled waves; the convergence of a numerical solution method for wrinkling analysis; and the compatibility of a wrinkling analysis with general-purpose finite element codes. According to this review, several opening issues in modeling and analysis of wrinkled membranes that are to be addressed in future research are summarized, The second objective of this presentation is to discuss a newly developed membrane model of two viable parameters (2-VP model) and associated parametric finite element method (PFEM) for wrinkling analysis are introduced. The innovations and advantages of the proposed membrane model and PFEM-based wrinkling analysis are: (1) Via a unified stress-strain relation; the 2-VP model treat the taut, wrinkled, and slack states of membranes consistently; (2) The PFEM-based wrinkling analysis has guaranteed convergence; (3) The 2-VP model along with PFEM is capable of predicting membrane out-of-plane deformations; and (4) The PFEM can be integrated into any existing finite element code. Preliminary numerical examples are also included in this presentation to demonstrate the 2-VP model and PFEM-based wrinkling analysis approach.

Recombination in the evolution of enterovirus C species sub-group that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99.

PubMed

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genetic recombination is considered to be a very frequent phenomenon among enteroviruses (Family Picornaviridae, Genus Enterovirus). However, the recombination patterns may differ between enterovirus species and between types within species. Enterovirus C (EV-C) species contains 21 types. In the capsid coding P1 region, the types of EV-C species cluster further into three sub-groups (designated here as A-C). In this study, the recombination pattern of EV-C species sub-group B that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99 was determined using partial 5'UTR and VP1 sequences of enterovirus strains isolated during poliovirus surveillance and previously published complete genome sequences. Several inter-typic recombination events were detected. Furthermore, the analyses suggested that inter-typic recombination events have occurred mainly within the distinct sub-groups of EV-C species. Only sporadic recombination events between EV-C species sub-group B and other EV-C sub-groups were detected. In addition, strict recombination barriers were inferred for CVA-21 genotype C and CVA-24 variant strains. These results suggest that the frequency of inter-typic recombinations, even within species, may depend on the phylogenetic position of the given viruses.

Functional characterization of two new members of the caffeoyl CoA O-methyltransferase-like gene family from Vanilla planifolia reveals a new class of plastid-localized O-methyltransferases.

PubMed

Widiez, Thomas; Hartman, Thomas G; Dudai, Nativ; Yan, Qing; Lawton, Michael; Havkin-Frenkel, Daphna; Belanger, Faith C

2011-08-01

Caffeoyl CoA O-methyltransferases (OMTs) have been characterized from numerous plant species and have been demonstrated to be involved in lignin biosynthesis. Higher plant species are known to have additional caffeoyl CoA OMT-like genes, which have not been well characterized. Here, we identified two new caffeoyl CoA OMT-like genes by screening a cDNA library from specialized hair cells of pods of the orchid Vanilla planifolia. Characterization of the corresponding two enzymes, designated Vp-OMT4 and Vp-OMT5, revealed that in vitro both enzymes preferred as a substrate the flavone tricetin, yet their sequences and phylogenetic relationships to other enzymes are distinct from each other. Quantitative analysis of gene expression indicated a dramatic tissue-specific expression pattern for Vp-OMT4, which was highly expressed in the hair cells of the developing pod, the likely location of vanillin biosynthesis. Although Vp-OMT4 had a lower activity with the proposed vanillin precursor, 3,4-dihydroxybenzaldehyde, than with tricetin, the tissue specificity of expression suggests it may be a candidate for an enzyme involved in vanillin biosynthesis. In contrast, the Vp-OMT5 gene was mainly expressed in leaf tissue and only marginally expressed in pod hair cells. Phylogenetic analysis suggests Vp-OMT5 evolved from a cyanobacterial enzyme and it clustered within a clade in which the sequences from eukaryotic species had predicted chloroplast transit peptides. Transient expression of a GFP-fusion in tobacco demonstrated that Vp-OMT5 was localized in the plastids. This is the first flavonoid OMT demonstrated to be targeted to the plastids.

Molecular Epidemiology of Seal Parvovirus, 1988–2014

PubMed Central

Bodewes, Rogier; Hapsari, Rebriarina; Rubio García, Ana; Sánchez Contreras, Guillermo J.; van de Bildt, Marco W. G.; de Graaf, Miranda; Kuiken, Thijs; Osterhaus, Albert D. M. E.

2014-01-01

A novel parvovirus was discovered recently in the brain of a harbor seal (Phoca vitulina) with chronic meningo-encephalitis. Phylogenetic analysis of this virus indicated that it belongs to the genus Erythroparvovirus, to which also human parvovirus B19 belongs. In the present study, the prevalence, genetic diversity and clinical relevance of seal parvovirus (SePV) infections was evaluated in both harbor and grey seals (Halichoerus grypus) that lived in Northwestern European coastal waters from 1988 to 2014. To this end, serum and tissue samples collected from seals were tested for the presence of seal parvovirus DNA by real-time PCR and the sequences of the partial NS gene and the complete VP2 gene of positive samples were determined. Seal parvovirus DNA was detected in nine (8%) of the spleen tissues tested and in one (0.5%) of the serum samples tested, including samples collected from seals that died in 1988. Sequence analysis of the partial NS and complete VP2 genes of nine SePV revealed multiple sites with nucleotide substitutions but only one amino acid change in the VP2 gene. Estimated nucleotide substitution rates per year were 2.00×10−4 for the partial NS gene and 1.15×10−4 for the complete VP2 gene. Most samples containing SePV DNA were co-infected with phocine herpesvirus 1 or PDV, so no conclusions could be drawn about the clinical impact of SePV infection alone. The present study is one of the few in which the mutation rates of parvoviruses were evaluated over a period of more than 20 years, especially in a wildlife population, providing additional insights into the genetic diversity of parvoviruses. PMID:25390639

Molecular epidemiology of seal parvovirus, 1988-2014.

PubMed

Bodewes, Rogier; Hapsari, Rebriarina; Rubio García, Ana; Sánchez Contreras, Guillermo J; van de Bildt, Marco W G; de Graaf, Miranda; Kuiken, Thijs; Osterhaus, Albert D M E

2014-01-01

A novel parvovirus was discovered recently in the brain of a harbor seal (Phoca vitulina) with chronic meningo-encephalitis. Phylogenetic analysis of this virus indicated that it belongs to the genus Erythroparvovirus, to which also human parvovirus B19 belongs. In the present study, the prevalence, genetic diversity and clinical relevance of seal parvovirus (SePV) infections was evaluated in both harbor and grey seals (Halichoerus grypus) that lived in Northwestern European coastal waters from 1988 to 2014. To this end, serum and tissue samples collected from seals were tested for the presence of seal parvovirus DNA by real-time PCR and the sequences of the partial NS gene and the complete VP2 gene of positive samples were determined. Seal parvovirus DNA was detected in nine (8%) of the spleen tissues tested and in one (0.5%) of the serum samples tested, including samples collected from seals that died in 1988. Sequence analysis of the partial NS and complete VP2 genes of nine SePV revealed multiple sites with nucleotide substitutions but only one amino acid change in the VP2 gene. Estimated nucleotide substitution rates per year were 2.00 × 10(-4) for the partial NS gene and 1.15 × 10(-4) for the complete VP2 gene. Most samples containing SePV DNA were co-infected with phocine herpesvirus 1 or PDV, so no conclusions could be drawn about the clinical impact of SePV infection alone. The present study is one of the few in which the mutation rates of parvoviruses were evaluated over a period of more than 20 years, especially in a wildlife population, providing additional insights into the genetic diversity of parvoviruses.

Isolation and characterization of a new enterovirus F in yak feces in the Qinghai-Tibetan Plateau.

PubMed

He, Huan; Tang, Cheng; Chen, Xinnuo; Yue, Hua; Ren, Yupeng; Liu, Yan; Zhang, Bin

2017-02-01

An enterovirus (EV) strain, designated as SWUN-AB001, was isolated in the Qinghai-Tibetan Plateau from a yak with severe diarrheal disease. The complete genome of strain SWUN-AB001 was 7,382 bp in length and shared 35.1-68.5% nt identities with bovine EVs belonging to a candidate new type EV-F7. Using the sequence difference values in the VP1 gene as a criterion for demarcating a new serotype/genotype in the Enterovirus genus, strain SWUN-AB001 had only a 71.1% nt and a 79.2% aa identity, in the VP1 region, with the most closely matched EV, further indicating that a new type of EV had been identified. Phylogenetic analysis of the nt sequence of the viral polyprotein and of VP1 genes demonstrated that the virus fell within the EV-F cluster, but was located in a unique lineage. Furthermore, a large-scale surveillance study indicated that the prevalence of this EV in yaks was 31.05% (95% CI = 25.5-37.6%) in 235 animals with diarrhea and 24.13% (95% CI = 17.4-32.4%) in 116 healthy yaks. However, there was no significant difference in virus prevalence between diarrheal and healthy samples. Interestingly, in the Tibet region, diarrheal feces had a higher incidence of EVs than feces of healthy yaks (odd ratios = 6.03, 95% CI = 1.93-18.86), indicating that the incidence of EV was potentially correlated with the clinical symptom of diarrhea in yaks.

Detection of emerging rotavirus G12P[8] in Sonora, México.

PubMed

González-Ochoa, G; J, G de; Calleja-García, P M; Rosas-Rodríguez, J A; Virgen-Ortíz, A; Tamez-Guerra, P

2016-06-01

Rotavirus is the most common cause of gastroenteritis in children up to five years of age worldwide. The aim of the present study was to analyze the genotypes of rotavirus strains isolated from children with gastroenteritis, after the introduction of the rotavirus vaccine in México. Rotavirus was detected in 14/100 (14%) fecal samples from children with gastroenteritis, using a commercial test kit. The viral genome was purified from these samples and used as a template in RT-PCR amplification of the VP4 and VP7 genes, followed by gene cloning and sequencing. Among the rotavirus strains, 4/14 (28.5%) were characterized as G12P[8], 2/14 (14.3%), as G12P (not typed), and 3/14 (21.42%) as G (not typed) P[8]. Phylogenetic analysis of the VP7 gene showed that G12 genotypes clustered in lineage III. Phylogenetic analysis revealed that VP4 genotype P[8] sequences clustered in lineage V, whereas other P[8] sequences previously reported in Mexico (2005-2008) clustered in different lineages. Rotavirus genotype G12 is currently recognized as a globally emerging rotavirus. To our knowledge, this is the first report of this emerging rotavirus strain G12P[8] in México. Ongoing surveillance is recommended to monitor the distribution of rotavirus genotypes and to continually reassess the suitability of currently available rotavirus vaccines.

Screening of virulence-associated genes as a molecular typing method for characterization of Streptococcus suis isolates recovered from wild boars and pigs.

PubMed

Sánchez del Rey, Verónica; Fernández-Garayzábal, José F; Domínguez, Lucas; Gottschalk, Marcelo; Vela, Ana I

2016-03-01

Streptococcus suis is an important zoonotic pathogen associated with a wide range of diseases in pigs, but has also been isolated from wild animals such as rabbits and wild boars. In the current study, 126 S. suis isolates recovered from pigs (n = 85) and wild boars (n = 41) were tested by polymerase chain reaction (PCR) for the presence of nine virulence-associated genes. S. suis isolates from wild boars were differentiated by the lower detection rates of the epf, sly, mrp, sao and dltA genes (0%, 2.4%, 2.4%, 4.8% and 21.9%, respectively) compared with the isolates from pigs (56.5%, 75.3%, 56.5%, 88.2.0% and 88.2%, respectively). The differences in the content of these virulence-associated genes were statistically significant (P < 0.05). There was a correlation between the variants saoM and saoL and serotypes 2 and 9, respectively (P < 0.05). Isolates were classified into 31 virulence-associated gene profiles (VPs). Ten VPs were detected among wild boar isolates and 22 VPs among pig isolates, with only two VPs common to wild boars and pigs. The predominant VPs among isolates from wild boars (VP1, VP7) were different from those observed in pig isolates (VP16 and VP26). VP16 was detected exclusively in clinical pig isolates of serotype 9 and VP26 was detected in 71.4% of the serotype 2 clinical pig isolates. Further multilocus sequence typing (MLST) analysis showed a significant correlation association between certain VPs and STs (VP16 and VP17 with ST123 and ST125 and VP26 with ST1). In conclusion, the current study showed that combination of virulence-associated gene profiling and MLST analysis may provide more information of the relatedness of the S. suis strains from different animal species that could be useful for epidemiological purposes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Shift of Enterovirus species among children in Cameroon--identification of a new enterovirus, EV-A119.

PubMed

Ayukekbong, James; Kabayiza, Jean-Claude; Lindh, Magnus; Nkuo-Akenji, Theresia; Tah, Ferdinand; Bergström, Tomas; Norder, Helene

2013-09-01

Infections caused by human enteroviruses (EVs) are often asymptomatic or mild, although they may cause more severe illnesses as meningitis and acute flaccid paralysis. EVs have globally posed a threat to children, and outbreaks of aseptic meningitis and hand, foot and mouth disease are frequently reported. To identify EV strains circulating among healthy children in a small community in Limbe, Cameroon two years apart. Species and EV types were obtained by partial 5'UTR-VP4 and VP1 sequencing of RNA from stool samples collected in October 2009 and September 2011 from 150 children in Cameroon. In all, 74 children (49%) were infected with 28 different types of EV. There were 29 (54%) infected children in 2009, and 45 (47%) in 2011. There was a significant difference between detected species of EV, with 15 (47%) children infected with EV-A in 2009, and 22 (71%) with EV-B in 2011 (p=0.0001). In 2009, one child was infected by a divergent EV, which was most similar to EV-A90. Based on the complete VP1 sequence, it was shown to be a new EV designated EV-A119. The current study shows a high heterogeneity of circulating EV types among children in Limbe, Cameroon, and a previously not described shift in predominating EV species. Copyright © 2013 Elsevier B.V. All rights reserved.

Characterization and protective efficacy in an animal model of a novel truncated rotavirus VP8 subunit parenteral vaccine candidate.

PubMed

Xue, Miaoge; Yu, Linqi; Che, Yaojian; Lin, Haijun; Zeng, Yuanjun; Fang, Mujin; Li, Tingdong; Ge, Shengxiang; Xia, Ningshao

2015-05-21

The cell-attachment protein VP8* of rotavirus is a potential candidate parenteral vaccine. However, the yield of full-length VP8 protein (VP8*, residues 1-231) expressed in Escherichia coli was low, and a truncated VP8 protein (ΔVP8*, residues 65-231) cannot elicit efficient protective immunity in a mouse model. In this study, tow novel truncated VP8 proteins, VP8-1 (residues 26-231) and VP8-2 (residues 51-231), were expressed in E. coli and evaluated for immunogenicity and protective efficacy, compared with VP8* and ΔVP8*. As well as ΔVP8*, the protein VP8-1 and VP8-2 were successfully expressed in high yield and purified in homogeneous dimeric forms, while the protein VP8* was expressed with lower yield and prone to aggregation and degradation in solution. Although the immunogenicity of the protein VP8*, VP8-1, VP8-2 and ΔVP8* was comparable, immunization of VP8* and VP8-1 elicited significantly higher neutralizing antibody titers than that of VP8-2 and ΔVP8* in mice. Furthermore, when assessed using a mouse maternal antibody model, the efficacy of VP8-1 to protect against rotavirus-induced diarrhea in pups was comparable to that of VP8*, both were dramatically higher than that of VP8-2 and ΔVP8*. Taken together, the novel truncated protein VP8-1, with increased yield, improved homogeneity and high protective efficacy, is a viable candidate for further development of a parenterally administrated prophylactic vaccine against rotavirus infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of Recent Serotype O Foot-and-Mouth Disease Viruses from Livestock in Kenya: Evidence of Four Independently Evolving Lineages.

PubMed

Wekesa, S N; Muwanika, V B; Siegismund, H R; Sangula, A K; Namatovu, A; Dhikusooka, M T; Tjørnehøj, K; Balinda, S N; Wadsworth, J; Knowles, N J; Belsham, G J

2015-06-01

Foot-and-mouth disease (FMD) is endemic in Kenya where four serotypes (O, A, SAT 1 and SAT 2) of the virus are currently in circulation. Within 2010 and 2011, the National Laboratory recorded an increase in the number of FMD outbreaks caused by serotype O virus. The characteristics of these viruses were determined to ascertain whether these were independent outbreaks or one single strain spreading throughout the country. The sequences of the complete VP1-coding region were analysed from viruses sampled within different areas of Kenya during 2010 and 2011. The results indicated that the 2010 to 2011 outbreaks in Kenya were caused by four independent strains. By comparison with earlier type O isolates from Eastern Africa, it was apparent that the outbreaks were caused by viruses from three different lineages of topotype EA-2 and a fourth virus strain belonging to topotype EA-4. The topotypes EA-1 and EA-3 were not detected from these outbreaks. Implications of these results for FMD control in Eastern Africa are discussed. © 2013 Blackwell Verlag GmbH.

Identification of Site-Specific Adaptations Conferring Increased Neural Cell Tropism during Human Enterovirus 71 Infection

PubMed Central

Schibler, Manuel; Martinez, Yannick; Gerlach, Daniel; van Belle, Sandra; Turin, Lara; Zdobnov, Evgeny; Kaiser, Laurent; Tapparel, Caroline

2012-01-01

Enterovirus 71 (EV71) is one of the most virulent enteroviruses, but the specific molecular features that enhance its ability to disseminate in humans remain unknown. We analyzed the genomic features of EV71 in an immunocompromised host with disseminated disease according to the different sites of infection. Comparison of five full-length genomes sequenced directly from respiratory, gastrointestinal, nervous system, and blood specimens revealed three nucleotide changes that occurred within a five-day period: a non-conservative amino acid change in VP1 located within the BC loop (L97R), a region considered as an immunogenic site and possibly important in poliovirus host adaptation; a conservative amino acid substitution in protein 2B (A38V); and a silent mutation in protein 3D (L175). Infectious clones were constructed using both BrCr (lineage A) and the clinical strain (lineage C) backgrounds containing either one or both non-synonymous mutations. In vitro cell tropism and competition assays revealed that the VP197 Leu to Arg substitution within the BC loop conferred a replicative advantage in SH-SY5Y cells of neuroblastoma origin. Interestingly, this mutation was frequently associated in vitro with a second non-conservative mutation (E167G or E167A) in the VP1 EF loop in neuroblastoma cells. Comparative models of these EV71 VP1 variants were built to determine how the substitutions might affect VP1 structure and/or interactions with host cells and suggest that, while no significant structural changes were observed, the substitutions may alter interactions with host cell receptors. Taken together, our results show that the VP1 BC loop region of EV71 plays a critical role in cell tropism independent of EV71 lineage and, thus, may have contributed to dissemination and neurotropism in the immunocompromised patient. PMID:22910880

Early events of polyoma infection: adsorption, penetration and nuclear transport

NASA Technical Reports Server (NTRS)

Consigli, R. A.; Haynes, J. I. Jr; Chang, D.; Grenz, L.; Richter, D.; Spooner, B. S. (Principal Investigator)

1992-01-01

Polyoma virions have different attachment proteins which are responsible for hemagglutination of erythrocytes and attachment to cultured mouse kidney cells (MKC). Virion binding studies demonstrated that MKC possess specific (productive infection) and nonspecific (nonproductive) receptors. Empty polyoma capsids have hemagglutination activity and bind to non-specific MKC receptors, but they are not capable of competing for specific virion cell receptors or preventing productive infection. Isoelectric focusing of the virion major capsid protein, VP1, separated this protein into six species (A through F). These species had identical amino acid sequences, but differed in degree of modification (phosphorylation, acetylation, sulfation and hydroxylation). Evidence based upon precipitation with specific antisera supports the view that VP1 species E is required for specific adsorption and that D and F are required for hemagglutination. The virion attachment domain has been localized to an 18 kilodalton fragment of the C-terminal region of VP1. Monopinocytotic vesicles containing 125I-labeled polyoma virions were isolated from infected MKC. A crosslinker was used to bind the MKC cell receptor(s) covalently to VP1 attachment protein, and a new 120 kilodalton band was identified by SDS-PAGE. An anti-idiotype antibody prepared against a neutralizing polyoma monoclonal antiody was used to identify a putative 50 kilodalton receptor protein from a detergent extract of MKC, as well as from MKC membrane preparation.

Virtual patient design: exploring what works and why. A grounded theory study

PubMed Central

Bateman, James; Allen, Maggie; Samani, Dipti; Kidd, Jane; Davies, David

2013-01-01

Objectives Virtual patients (VPs) are online representations of clinical cases used in medical education. Widely adopted, they are well placed to teach clinical reasoning skills. International technology standards mean VPs can be created, shared and repurposed between institutions. A systematic review has highlighted the lack of evidence to support which of the numerous VP designs may be effective, and why. We set out to research the influence of VP design on medical undergraduates. Methods This is a grounded theory study into the influence of VP design on undergraduate medical students. Following a review of the literature and publicly available VP cases, we identified important design properties. We integrated them into two substantial VPs produced for this research. Using purposeful iterative sampling, 46 medical undergraduates were recruited to participate in six focus groups. Participants completed both VPs, an evaluation and a 1-hour focus group discussion. These were digitally recorded, transcribed and analysed using grounded theory, supported by computer-assisted analysis. Following open, axial and selective coding, we produced a theoretical model describing how students learn from VPs. Results We identified a central core phenomenon designated ‘learning from the VP’. This had four categories: VP Construction; External Preconditions; Student–VP Interaction, and Consequences. From these, we constructed a three-layer model describing the interactions of students with VPs. The inner layer consists of the student's cognitive and behavioural preconditions prior to sitting a case. The middle layer considers the VP as an ‘encoded object’, an e-learning artefact and as a ‘constructed activity’, with associated pedagogic and organisational elements. The outer layer describes cognitive and behavioural change. Conclusions This is the first grounded theory study to explore VP design. This original research has produced a model which enhances understanding of how and why the delivery and design of VPs influence learning. The model may be of practical use to authors, institutions and researchers. PMID:23662877

The phylogenetic analysis of VP1 genomic region in foot-and-mouth disease virus serotype O isolates in Sri Lanka reveals the existence of 'Srl-97', a newly named endemic lineage

PubMed Central

Abeyratne, S. A. E.; Amarasekera, S. S. C.; Knowles, N. J.; Wadsworth, J.; Puvanendiran, S.; Kothalawala, H.; Jayathilake, B. K.; Wijithasiri, H. A.; Chandrasena, M. M. P. S. K.

2018-01-01

Foot and mouth disease (FMD) has devastated the cattle industry in Sri Lanka many times in the past. Despite its seriousness, limited attempts have been made to understand the disease to ameliorate its effects–current recommendation for vaccines being based solely on immunological assessments rather than on molecular identification. The general belief is that the cattle population in Sri Lanka acquired the FMD virus (FMDV) strains via introductions from India. However, there could be endemic FMDV lineages circulating in Sri Lanka. To infer the phylogenetic relationships of the FMDV strains in the island, we sequenced the VP1 genomic region of the virus isolates collected during the 2014 outbreak together with a few reported cases in 2012 and 1997 and compared them to VP1 sequences from South Asia. The FMDV strains collected in the 2014 outbreak belonged to the lineage, Ind-2001d, of the topotype, ME-SA. The strains collected in 2012 and 1997 belonged to another lineage called 'unnamed' by the World Reference Laboratory for Foot and Mouth Disease (WRLFMD). Based on the present analysis, we designate the lineage 'unnamed' as Srl-97 which we found endemic to Sri Lanka. The evolutionary rates of Srl-97 and Ind-2001d in Sri Lanka were estimated to be 0.0004 and 0.0046 substitutions/site/year, respectively, suggesting that Srl-97 evolves slowly. PMID:29570746

The phylogenetic analysis of VP1 genomic region in foot-and-mouth disease virus serotype O isolates in Sri Lanka reveals the existence of 'Srl-97', a newly named endemic lineage.

PubMed

Abeyratne, S A E; Amarasekera, S S C; Ranaweera, L T; Salpadoru, T B; Thilakarathne, S M N K; Knowles, N J; Wadsworth, J; Puvanendiran, S; Kothalawala, H; Jayathilake, B K; Wijithasiri, H A; Chandrasena, M M P S K; Sooriyapathirana, S D S S

2018-01-01

Foot and mouth disease (FMD) has devastated the cattle industry in Sri Lanka many times in the past. Despite its seriousness, limited attempts have been made to understand the disease to ameliorate its effects-current recommendation for vaccines being based solely on immunological assessments rather than on molecular identification. The general belief is that the cattle population in Sri Lanka acquired the FMD virus (FMDV) strains via introductions from India. However, there could be endemic FMDV lineages circulating in Sri Lanka. To infer the phylogenetic relationships of the FMDV strains in the island, we sequenced the VP1 genomic region of the virus isolates collected during the 2014 outbreak together with a few reported cases in 2012 and 1997 and compared them to VP1 sequences from South Asia. The FMDV strains collected in the 2014 outbreak belonged to the lineage, Ind-2001d, of the topotype, ME-SA. The strains collected in 2012 and 1997 belonged to another lineage called 'unnamed' by the World Reference Laboratory for Foot and Mouth Disease (WRLFMD). Based on the present analysis, we designate the lineage 'unnamed' as Srl-97 which we found endemic to Sri Lanka. The evolutionary rates of Srl-97 and Ind-2001d in Sri Lanka were estimated to be 0.0004 and 0.0046 substitutions/site/year, respectively, suggesting that Srl-97 evolves slowly.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

Interaction of Tsg101 with Marburg Virus VP40 Depends on the PPPY Motif, but Not the PT/SAP Motif as in the Case of Ebola Virus, and Tsg101 Plays a Critical Role in the Budding of Marburg Virus-Like Particles Induced by VP40, NP, and GP▿

PubMed Central

Urata, Shuzo; Noda, Takeshi; Kawaoka, Yoshihiro; Morikawa, Shigeru; Yokosawa, Hideyoshi; Yasuda, Jiro

2007-01-01

Marburg virus (MARV) VP40 is a matrix protein that can be released from mammalian cells in the form of virus-like particles (VLPs) and contains the PPPY sequence, which is an L-domain motif. Here, we demonstrate that the PPPY motif is important for VP40-induced VLP budding and that VLP production is significantly enhanced by coexpression of NP and GP. We show that Tsg101 interacts with VP40 depending on the presence of the PPPY motif, but not the PT/SAP motif as in the case of Ebola virus, and plays an important role in VLP budding. These findings provide new insights into the mechanism of MARV budding. PMID:17301151

Tomographic models and seismotectonics of the Reggio Emilia region, Italy

NASA Astrophysics Data System (ADS)

Ciaccio, M. G.; Chiarabba, C.

2002-02-01

The aim of this study is to define the Vp and Vp/Vs structure of the fault zone ruptured by the M L 5.1 earthquake of October 15, 1996 which occurred near Reggio Emilia (central-northern Italy). A 1-month-long seismic sequence followed the mainshock and occurred in a small region along the outer border of the northern Apenninic belt, at depth ranging between 10 and 17 km. P- and S-wave arrival times from 304 aftershocks recorded by two local dense seismic arrays installed in the epicentral region have been inverted to obtain one- and three-dimensional velocity models by using state of the art local earthquake tomographic techniques. Velocity models and aftershock relocation help us to infer the seismotectonic of the region. Earthquakes originated along a NW-dipping backthrust of a NE-trending main thrust, composing the western part of the broad Ferrara Arc. A main high Vp and high Vp/Vs region delineates a pop-up structure in the center of the area. The high Vp/Vs within the pop-up structure supports the presence of a zone with increased pore pressure. The hypocentral depth of both mainshock and aftershocks is greater than those usually found for the main seismogenic regions of the Apenninic belt. P-wave velocity values in the seismogenic area, obtained by tomography, are compatible with rocks of the Mesozoic cover and suggest that seismicity occurred within the Mesozoic units stack at present by compressional tectonics.

Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005

PubMed Central

Klein, Joern; Hussain, Manzoor; Ahmad, Munir; Normann, Preben; Afzal, Muhammad; Alexandersen, Soren

2007-01-01

Background According to the World Reference Laboratory for FMD, a new subtype of FMDV serotype A was detected in Iran in 2005. This subtype was designated A/IRN/2005, and rapidly spread throughout Iran and moved westwards into Saudi Arabia and Turkey where it was initially detected from August 2005 and subsequently caused major disease problems in the spring of 2006. The same subtype reached Jordan in 2007. As part of an ongoing project we have also detected this subtype in Pakistan with the first positive samples detected in April 2006. To characterise this subtype in detail, we have sequenced and analysed the complete coding sequence of three subtype A/IRN/2005 isolates collected in Pakistan in 2006, the complete coding sequence of one subtype A/IRN/2005 isolate collected during the first outbreak in Turkey in 2005 and, in addition, the partial 1D coding sequence derived from 4 epithelium samples and 34 swab-samples from Asian buffaloes or cattle subsequently found to be infected with the A/IRN/2005 subtype. Results The phylogenies of the genome regions encoding for the structural proteins, displayed, with the exception of 1A, distinct, serotype-specific clustering and an evolutionary relationship of the A/IRN/2005 sublineage with the A22 sublineage. Potential recombination events have been detected in parts of the genome region coding for the non-structural proteins of FMDV. In addition, amino acid substitutions have been detected in the deduced VP1 protein sequence, potentially related to clinical or subclinical outcome of FMD. Indications of differential susceptibility for developing a subclinical course of disease between Asian buffaloes and cattle have been detected. Furthermore, hitherto unknown insertions of 2 amino acids before the second start codon, as well as sublineage specific amino acids have been detected in the genome region encoding for the leader proteinase of A/IRN/2005 sublineage. Conclusion Our findings indicate that the A/IRN/2005 sublineage has undergone two different paths of evolution for the structural and non-structural genome regions. The structural genome regions have had their evolutionary starting point in the A22 sublineage. It can be assumed that, due to the quasispecies structure of FMDV populations and the error-prone replication process, advantageous mutations in a changed environment have been fixed and lead to the occurrence of the new A/IRN/2005 sublineage. Together with this mechanism, recombination within the non-structural genome regions, potentially modifying the virulence of the virus, may be involved in the success of this new sublineage. The possible origin of this recombinant virus may be a co-infection with Asia1 and a serotype A precursor of the A/IRN/2005 sublineage potentially within Asian Buffaloes, as these appears to relatively easy become infected, but usually without developing clinical disease and consequently showing not a strong acute inflammatory immune response against a second FMDV infection. PMID:18001482

Formation of Covalently Modified Folding Intermediates of Simian Virus 40 Vp1 in Large T Antigen-Expressing Cells

PubMed Central

Watanabe, Marika; Phamduong, Ellen; Huang, Chu-Han; Itoh, Noriko; Bernal, Janie; Nakanishi, Akira; Rundell, Kathleen; Gjoerup, Ole

2013-01-01

The folding and pentamer assembly of the simian virus 40 (SV40) major capsid protein Vp1, which take place in the infected cytoplasm, have been shown to progress through disulfide-bonded Vp1 folding intermediates. In this report, we further demonstrate the existence of another category of Vp1 folding or assembly intermediates: the nonreducible, covalently modified mdVp1s. These species were present in COS-7 cells that expressed a recombinant SV40 Vp1, Vp1ΔC, through plasmid transfection. The mdVp1s persisted under cell and lysate treatment and SDS-PAGE conditions that are expected to have suppressed the formation of artifactual disulfide cross-links. As shown through a pulse-chase analysis, the mdVp1s were derived from the newly synthesized Vp1ΔC in the same time frame as Vp1's folding and oligomerization. The apparent covalent modifications occurred in the cytoplasm within the core region of Vp1 and depended on the coexpression of the SV40 large T antigen (LT) in the cells. Analogous covalently modified species were found with the expression of recombinant polyomavirus Vp1s and human papillomavirus L1s in COS-7 cells. Furthermore, the mdVp1s formed multiprotein complexes with LT, Hsp70, and Hsp40, and a fraction of the largest mdVp1, md4, was disulfide linked to the unmodified Vp1ΔC. Both mdVp1 formation and most of the multiprotein complex formation were blocked by a Vp1 folding mutation, C87A-C254A. Our observations are consistent with a role for LT in facilitating the folding process of SV40 Vp1 by stimulating certain covalent modifications of Vp1 or by recruiting certain cellular proteins. PMID:23427157

Improving Shipboard Applications of Non-Intrusive Load Monitoring

DTIC Science & Technology

2008-06-01

EVENTS_LIST (EventNum) .EVENTCODE) case 0 %Unclassifiable case 1 %VP On STATE.VP.ON = STATE.VP.ON + 1; STATE.VP.START = true; PICTURES.RUNNING.VP.SHOW...true; case 2 %VP Off STATE.VP.STOP = true; PICTURES. RUNNING.VP. SHOW false; case 3 %DP On 149 STATE.DP.ON = STATE.DP.ON + 1; STATE.DP.START = true...PICTURES.RUNNING.DP.SHOW true; case 4 %DP Off STATE.DP.STOP = true; PICTURES.RUNNING.DP.SHOW = false; case 5 %VP On (Clogged) STATE.VP.ON = STATE.VP.ON

Novel evolutionary lineages of the invertebrate oxytocin/vasopressin superfamily peptides and their receptors in the common octopus (Octopus vulgaris)

PubMed Central

Kanda, Atsuhiro; Satake, Honoo; Kawada, Tsuyoshi; Minakata, Hiroyuki

2004-01-01

The common octopus, Octopus vulgaris, is the first invertebrate species that was shown to possess two oxytocin/vasopressin (OT/VP) superfamily peptides, octopressin (OP) and cephalotocin (CT). Previously, we cloned a GPCR (G-protein-coupled receptor) specific to CT [CTR1 (CT receptor 1)]. In the present study, we have identified an additional CTR, CTR2, and a novel OP receptor, OPR. Both CTR2 and OPR include domains and motifs typical of GPCRs, and the intron– exon structures are in accord with those of OT/VP receptor genes. CTR2 and OPR expressed in Xenopus oocytes induced calcium-mediated inward chloride current in a CT- and OP-specific manner respectively. Several regions and residues, which are requisite for binding of the vertebrate OT/VP receptor family with their ligands, are highly conserved in CTRs, but not in OPR. These different sequences between CTRs and OPR, as well as the amino acid residues of OP and CT at positions 2–5, were presumed to play crucial roles in the binding selectivity to their receptors, whereas the difference in the polarity of OT/VP family peptide residues at position 8 confers OT and VP with the binding specificity in vertebrates. CTR2 mRNA was present in various peripheral tissues, and OPR mRNA was detected in both the nervous system and peripheral tissues. Our findings suggest that the CT and OP genes, similar to the OT/VP family, evolved through duplication, but the ligand–receptor selectivity were established through different evolutionary lineages from those of their vertebrate counterparts. PMID:15504101

Genome Sequencing and Comparative Analysis of Saccharomyces cerevisiae Strains of the Peterhof Genetic Collection

PubMed Central

Drozdova, Polina B.; Tarasov, Oleg V.; Matveenko, Andrew G.; Radchenko, Elina A.; Sopova, Julia V.; Polev, Dmitrii E.; Inge-Vechtomov, Sergey G.; Dobrynin, Pavel V.

2016-01-01

The Peterhof genetic collection of Saccharomyces cerevisiae strains (PGC) is a large laboratory stock that has accumulated several thousands of strains for over than half a century. It originated independently of other common laboratory stocks from a distillery lineage (race XII). Several PGC strains have been extensively used in certain fields of yeast research but their genomes have not been thoroughly explored yet. Here we employed whole genome sequencing to characterize five selected PGC strains including one of the closest to the progenitor, 15V-P4, and several strains that have been used to study translation termination and prions in yeast (25-25-2V-P3982, 1B-D1606, 74-D694, and 6P-33G-D373). The genetic distance between the PGC progenitor and S288C is comparable to that between two geographically isolated populations. The PGC seems to be closer to two bakery strains than to S288C-related laboratory stocks or European wine strains. In genomes of the PGC strains, we found several loci which are absent from the S288C genome; 15V-P4 harbors a rare combination of the gene cluster characteristic for wine strains and the RTM1 cluster. We closely examined known and previously uncharacterized gene variants of particular strains and were able to establish the molecular basis for known phenotypes including phenylalanine auxotrophy, clumping behavior and galactose utilization. Finally, we made sequencing data and results of the analysis available for the yeast community. Our data widen the knowledge about genetic variation between Saccharomyces cerevisiae strains and can form the basis for planning future work in PGC-related strains and with PGC-derived alleles. PMID:27152522

Characterization of genome sequences and clinical features of coxsackievirus A6 strains collected in Hyogo, Japan in 1999-2013.

PubMed

Ogi, Miki; Yano, Yoshihiko; Chikahira, Masatsugu; Takai, Denshi; Oshibe, Tomohiro; Arashiro, Takeshi; Hanaoka, Nozomu; Fujimoto, Tsuguto; Hayashi, Yoshitake

2017-08-01

Coxsackievirus A6 (CV-A6) is an enterovirus, which is known to cause herpangina. However, since 2009 it has frequently been isolated from children with hand, foot, and mouth disease (HFMD). In Japan, CV-A6 has been linked to HFMD outbreaks in 2011 and 2013. In this study, the full-length genome sequencing of CV-A6 strains were analyzed to identify the association with clinical manifestations. Five thousand six hundred and twelve children with suspected enterovirus infection (0-17 years old) between 1999 and 2013 in Hyogo Prefecture, Japan, were enrolled. Enterovirus infection was confirmed with reverse transcriptase-PCR in 753 children (791 samples), 127 of whom (133 samples) were positive for CV-A6 based on the direct sequencing of the VP4 region. The complete genomes of CV-A6 from 22 positive patients with different clinical manifestations were investigated. A phylogenetic analysis divided these 22 strains into two clusters based on the VP1 region; cluster I contained strains collected in 1999-2009 and mostly related to herpangina, and cluster II contained strains collected in 2011-2013 and related to HFMD outbreak. Based on the full-length polyprotein analysis, the amino acid differences between the strains in cluster I and II were 97.7 ± 0.28%. Amino acid differences were detected in 17 positions within the polyprotein. Strains collected in 1999-2009 and those in 2011-2013 were separately clustered by phylogenetic analysis based on 5'UTR and 3Dpol region, as well as VP1 region. In conclusion, HFMD outbreaks by CV-A6 were recently frequent in Japan and the accumulation of genomic change might be associated with the clinical course. © 2017 Wiley Periodicals, Inc.

Molecular characterization of birnaviruses isolated from wild marine fishes at the Flemish Cap (Newfoundland)

USGS Publications Warehouse

Romero-Brey, I.; Batts, W.N.; Bandin, I.; Winton, J.R.; Dopazo, C.P.

2004-01-01

Several isolates of aquatic birnaviruses were recovered from different species of wild fish caught in the Flemish Cap, a Newfoundland fishery close to the Atlantic coast of Canada. The nucleotide sequence of a region of the NS gene was identical among the isolates and was most similar to the Dry Mills and West Buxton reference strains of infectious pancreatic necrosis virus (IPNV). Phylogenetic analysis of the sequence of a region of the VP2 gene demonstrated that the isolates were most closely aligned with the American strains of IPNV serotype Al. Electron microscopy of virus structures clarified and concentrated from cultures of infected chinook salmon embryo (CHSE-214) cells revealed a majority of typical IPNV-like icosahedral particles, as well as a low proportion of type I tubules having a diameter of approximately 55 nm and a variable length of up to 2 ??m. The tubules could be propagated in cell cultures, but always in the presence of low proportions of icosahedral particles. Cloning of selected isolates by serial dilution yielded preparations with a high proportion of the tubular structures with a density in CsCl gradients of approximately 1.30 g cm-3. Polyacrylamide gel electrophoresis revealed the material in the band was composed of the IPNV pVP2 and VP2 proteins.

Immunogenicity of a recombinant fusion protein of tandem repeat epitopes of foot-and-mouth disease virus type Asia 1 for guinea pigs.

PubMed

Zhang, Q; Yang, Y Q; Zhang, Z Y; Li, L; Yan, W Y; Jiang, W J; Xin, A G; Lei, C X; Zheng, Z X

2002-01-01

In this study, the sequences of capsid protein VPI regions of YNAs1.1 and YNAs1.2 isolates of foot-and-mouth disease virus (FMDV) were analyzed and a peptide containing amino acids (aa) 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia I was assumed to contain B and T cell epitopes, because it is hypervariable and includes a cell attachment site RGD located in the G-H loop. The DNA fragments encoding aa 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia 1 were chemically synthesized and ligated into a tandem repeat of aa 133-158-20 approximately 34-133-158. In order to enhance its immunogenicity, the tandem repeat was inserted downstream of the beta-galactosidase gene in the expression vector pWR590. This insertion yielded a recombinant expression vector pAS1 encoding the fusion protein. The latter reacted with sera from FMDV type Asia 1-infected animals in vitro and elicited high levels of neutralizing antibodies in guinea pigs. The T cell proliferation in immunized animals increased following stimulation with the fusion protein. It is reported for the first time that a recombinant fusion protein vaccine was produced using B and T cell epitopes of FMDV type Asia 1 and that this fusion protein was immunogenic. The fusion protein reported here can serve as a candidate of fusion epitopes for design of a vaccine against FMDV type Asia 1.

Inhibition of IRF-3 activation by VP35 is critical for the high level of virulence of ebola virus.

PubMed

Hartman, Amy L; Bird, Brian H; Towner, Jonathan S; Antoniadou, Zoi-Anna; Zaki, Sherif R; Nichol, Stuart T

2008-03-01

Zaire ebolavirus causes a rapidly progressing hemorrhagic disease with high mortality. Identification of the viral virulence factors that contribute to the severity of disease induced by Ebola virus is critical for the design of therapeutics and vaccines against the disease. Given the rapidity of disease progression, virus interaction with the innate immune system early in the course of infection likely plays an important role in determining the outcome of the disease. The Ebola virus VP35 protein inhibits the activation of IRF-3, a critical transcription factor for the induction of early antiviral immunity. Previous studies revealed that a single amino acid change (R312A) in VP35 renders the protein unable to inhibit IRF-3 activation. A reverse-genetics-generated, mouse-adapted, recombinant Ebola virus that encodes the R312A mutation in VP35 was produced. We found that relative to the case for wild-type virus containing the authentic VP35 sequence, this single amino acid change in VP35 renders the virus completely attenuated in mice. Given that these viruses differ by only a single amino acid in the IRF-3 inhibitory domain of VP35, the level of alteration of virulence is remarkable and highlights the importance of VP35 for the pathogenesis of Ebola virus.

Shrimp arginine kinase being a binding protein of WSSV envelope protein VP31

NASA Astrophysics Data System (ADS)

Ma, Cuiyan; Gao, Qiang; Liang, Yan; Li, Chen; Liu, Chao; Huang, Jie

2016-11-01

Viral entry into the host is the earliest stage of infection in the viral life cycle in which attachment proteins play a key role. VP31 (WSV340/WSSV396), an envelope protein of white spot syndrome virus (WSSV), contains an Arg-Gly-Asp (RGD) peptide domain known as a cellular attachment site. At present, the process of VP31 interacting with shrimp host cells has not been explored. Therefore, the VP31 gene was cloned into pET30a (+), expressed in Escherichia coli strain BL21 and purified with immobilized metal ion affinity chromatography. Four gill cellular proteins of shrimp ( Fenneropenaeus chinensis) were pulled down by an affinity column coupled with recombinant VP31 (rVP31), and the amino acid sequences were identified with MALDI-TOF/TOF mass spectrometry. Hemocyanin, beta-actin, arginine kinase (AK), and an unknown protein were suggested as the putative VP31 receptor proteins. SDS-PAGE showed that AK is the predominant binding protein of VP31. An i n vitro binding activity experiment indicated that recombinant AK's (rAK) binding activity with rVP31 is comparable to that with the same amount of WSSV. These results suggested that AK, as a member of the phosphagen kinase family, plays a role in WSSV infection. This is the first evidence showing that AK is a binding protein of VP31. Further studies on this topic will elucidate WSSV infection mechanism in the future.

Prevalence and genetic heterogeneity of porcine group C rotaviruses in nursing and weaned piglets in Ohio, USA and identification of a potential new VP4 genotype.

PubMed

Amimo, J O; Vlasova, A N; Saif, L J

2013-05-31

Swine fecal samples collected from seven farms were screened for group C rotaviruses (RVCs) using a reverse transcription-polymerase chain reaction assay. A total of 380 samples were tested and 19.5% were positive. Of the 128 samples collected in 2012, 23.5% from nursing piglets and 8.5% from weaned piglets were RVC positive, with a higher RVC frequency in diarrheic (28.4%) than in non-diarrheic (6.6%) piglets. Two strains (RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px) from two different farms were characterized genetically to gain information on virus diversity based on full length sequences of the inner capsid VP6, enterotoxin NSP4 and the outer capsid VP7 and VP4 (partial for RV0104) genes. The VP6 gene of the two strains showed high (99%) nucleotide identity to one another, 84-91% identity to other porcine RVCstrains and 81-82% identity to human and bovine RVC strains. The NSP4 gene analysis revealed that RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px strains were not closely related to each other (87% identity), but shared higher identity with prototype RVC/Pig-wt/USA/Cowden/1980/G1Px strain (93% and 89%, respectively) and were more distantly related to human strains (72-76% identity). The VP7 gene analysis indicated that the two strains were distantly related to one another (72% identity). RVC/Pig-wt/USA/RV0143/2012/G6Px was most closely related to porcine RVC G6 strains (82-86% identity), whereas RVC/Pig-wt/USA/RV0104/2011/G3PX was most closely related to porcine HF (G3) strain (94% identity). Analysis of the full length nucleotide sequence of the VP4 gene revealed that RVC/Pig-wt/USA/RV0143/2012/G6Px was distantly related to porcine (75%), bovine (74%) and human (70%) strains. The deduced amino acid identities (69.5-75.6%) of VP4 between RVC/Pig-wt/USA/RV0143/2012/G6Px and other RVCs were low; hence, we propose that this strain comprises a new VP4 genotype. Our results indicate high genetic heterogeneity in RVCs genes and the concurrent co-circulation of different genotypes at the same time. Our findings are useful for the development of more accurate diagnostic tools, for basic research to understand gene function and to provide information for RVC diversity germane to vaccine development. Copyright © 2013 Elsevier B.V. All rights reserved.

Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

PubMed

Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

2014-06-19

Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.

Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme

PubMed Central

Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

2014-01-01

Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

VP1 amino acid residue 145 of enterovirus 71 is a key residue for its receptor attachment and resistance to neutralizing antibody during cynomolgus monkey infection.

PubMed

Fujii, Ken; Sudaka, Yui; Takashino, Ayako; Kobayashi, Kyousuke; Kataoka, Chikako; Suzuki, Tadaki; Iwata-Yoshikawa, Naoko; Kotani, Osamu; Ami, Yasushi; Shimizu, Hiroyuki; Nagata, Noriyo; Mizuta, Katsumi; Matsuzaki, Yoko; Koike, Satoshi

2018-05-30

Enterovirus 71 (EV71) is a causative agent of hand, foot, and mouth disease and sometimes causes severe or fatal neurological complications. The amino acid at VP1-145 determines virological characteristics of EV71. Viruses with glutamic acid (E) at VP1-145 (VP1-145E) are virulent in neonatal mice and transgenic mice expressing human scavenger receptor B2, whereas those with glutamine (Q) or glycine (G) are not. However, the contribution of this variation to pathogenesis in humans is not fully understood. We compared the virulence of VP1-145E and VP1-145G viruses of Isehara and C7/Osaka backgrounds in cynomolgus monkeys. VP1-145E, but not VP1-145G, viruses induced neurological symptoms. VP1-145E viruses were frequently detected in the tissues of infected monkeys. VP1-145G viruses were detected less frequently and disappeared quickly. Instead, mutants that had a G to E mutation at VP1-145 emerged, suggesting that VP1-145E viruses have a replication advantage in the monkeys. This is consistent with our hypothesis proposed in the accompanying paper that the VP1-145G virus is attenuated due to its adsorption by heparan sulfate. Monkeys infected with both viruses produced neutralizing antibodies before the onset of the disease. Interestingly, VP1-145E viruses were more resistant to neutralizing antibodies than VP1-145G viruses in vitro A small amount of neutralizing antibody raised in the early phase of infection may not be sufficient to block the dissemination of VP1-145E viruses. The different resistance of the VP1-145 variants to neutralizing antibodies may be one of the reasons for the difference in virulence. IMPORTANCE The contribution of VP1-145 variants in humans is not fully understood. In some reports, VP1-145G/Q viruses were more frequently isolated from severely affected than from mildly affected patients, suggesting that VP1-145G/Q viruses are more virulent. In the accompanying paper, we showed that VP1-145E viruses are more virulent than VP1-145G viruses in human SCARB2 transgenic mice. Heparan sulfate acts as a decoy to specifically trap the VP1-145G viruses and leads to abortive infection. Here, we demonstrated that VP1-145G was attenuated in cynomolgus monkeys, suggesting that this hypothesis is also true in a non-human primate model. VP1-145E viruses, but not VP1-145G viruses, were highly resistant to neutralizing antibodies. We propose the difference in resistance against neutralizing antibodies as another mechanism of EV71 virulence. In summary, VP1-145 contributes to virulence determination by controlling attachment receptor usage and antibody sensitivity. Copyright © 2018 American Society for Microbiology.

Extreme Mutation Tolerance: Nearly Half of the Archaeal Fusellovirus Sulfolobus Spindle-Shaped Virus 1 Genes Are Not Required for Virus Function, Including the Minor Capsid Protein Gene vp3

PubMed Central

Iverson, Eric A.; Goodman, David A.; Gorchels, Madeline E.

2017-01-01

ABSTRACT Viruses infecting the Archaea harbor a tremendous amount of genetic diversity. This is especially true for the spindle-shaped viruses of the family Fuselloviridae, where >90% of the viral genes do not have detectable homologs in public databases. This significantly limits our ability to elucidate the role of viral proteins in the infection cycle. To address this, we have developed genetic techniques to study the well-characterized fusellovirus Sulfolobus spindle-shaped virus 1 (SSV1), which infects Sulfolobus solfataricus in volcanic hot springs at 80°C and pH 3. Here, we present a new comparative genome analysis and a thorough genetic analysis of SSV1 using both specific and random mutagenesis and thereby generate mutations in all open reading frames. We demonstrate that almost half of the SSV1 genes are not essential for infectivity, and the requirement for a particular gene correlates well with its degree of conservation within the Fuselloviridae. The major capsid gene vp1 is essential for SSV1 infectivity. However, the universally conserved minor capsid gene vp3 could be deleted without a loss in infectivity and results in virions with abnormal morphology. IMPORTANCE Most of the putative genes in the spindle-shaped archaeal hyperthermophile fuselloviruses have no sequences that are clearly similar to characterized genes. In order to determine which of these SSV genes are important for function, we disrupted all of the putative genes in the prototypical fusellovirus, SSV1. Surprisingly, about half of the genes could be disrupted without destroying virus function. Even deletions of one of the known structural protein genes that is present in all known fuselloviruses, vp3, allows the production of infectious viruses. However, viruses lacking vp3 have abnormal shapes, indicating that the vp3 gene is important for virus structure. Identification of essential genes will allow focused research on minimal SSV genomes and further understanding of the structure of these unique, ubiquitous, and extremely stable archaeal viruses. PMID:28148789

Extreme Mutation Tolerance: Nearly Half of the Archaeal Fusellovirus Sulfolobus Spindle-Shaped Virus 1 Genes Are Not Required for Virus Function, Including the Minor Capsid Protein Gene vp3.

PubMed

Iverson, Eric A; Goodman, David A; Gorchels, Madeline E; Stedman, Kenneth M

2017-05-15

Viruses infecting the Archaea harbor a tremendous amount of genetic diversity. This is especially true for the spindle-shaped viruses of the family Fuselloviridae , where >90% of the viral genes do not have detectable homologs in public databases. This significantly limits our ability to elucidate the role of viral proteins in the infection cycle. To address this, we have developed genetic techniques to study the well-characterized fusellovirus Sulfolobus spindle-shaped virus 1 (SSV1), which infects Sulfolobus solfataricus in volcanic hot springs at 80°C and pH 3. Here, we present a new comparative genome analysis and a thorough genetic analysis of SSV1 using both specific and random mutagenesis and thereby generate mutations in all open reading frames. We demonstrate that almost half of the SSV1 genes are not essential for infectivity, and the requirement for a particular gene correlates well with its degree of conservation within the Fuselloviridae The major capsid gene vp1 is essential for SSV1 infectivity. However, the universally conserved minor capsid gene vp3 could be deleted without a loss in infectivity and results in virions with abnormal morphology. IMPORTANCE Most of the putative genes in the spindle-shaped archaeal hyperthermophile fuselloviruses have no sequences that are clearly similar to characterized genes. In order to determine which of these SSV genes are important for function, we disrupted all of the putative genes in the prototypical fusellovirus, SSV1. Surprisingly, about half of the genes could be disrupted without destroying virus function. Even deletions of one of the known structural protein genes that is present in all known fuselloviruses, vp3 , allows the production of infectious viruses. However, viruses lacking vp3 have abnormal shapes, indicating that the vp3 gene is important for virus structure. Identification of essential genes will allow focused research on minimal SSV genomes and further understanding of the structure of these unique, ubiquitous, and extremely stable archaeal viruses. Copyright © 2017 American Society for Microbiology.

A Rapid Screen for Host-Encoded miRNAs with Inhibitory Effects against Ebola Virus Using a Transcription- and Replication-Competent Virus-Like Particle System.

PubMed

Wang, Zhongyi; Li, Jiaming; Fu, Yingying; Zhao, Zongzheng; Zhang, Chunmao; Li, Nan; Li, Jingjing; Cheng, Hongliang; Jin, Xiaojun; Lu, Bing; Guo, Zhendong; Qian, Jun; Liu, Linna

2018-05-16

MicroRNAs (miRNAs) may become efficient antiviral agents against the Ebola virus (EBOV) targeting viral genomic RNAs or transcripts. We previously conducted a genome-wide search for differentially expressed miRNAs during viral replication and transcription. In this study, we established a rapid screen for miRNAs with inhibitory effects against EBOV using a tetracistronic transcription- and replication-competent virus-like particle (trVLP) system. This system uses a minigenome comprising an EBOV leader region, luciferase reporter, VP40, GP, VP24, EBOV trailer region, and three noncoding regions from the EBOV genome and can be used to model the life cycle of EBOV under biosafety level (BSL) 2 conditions. Informatic analysis was performed to select up-regulated miRNAs targeting the coding regions of the minigenome with the highest binding energy to perform inhibitory effect screening. Among these miRNAs, miR-150-3p had the most significant inhibitory effect. Reverse transcription polymerase chain reaction (RT-PCR), Western blot, and double fluorescence reporter experiments demonstrated that miR-150-3p inhibited the reproduction of trVLPs via the regulation of GP and VP40 expression by directly targeting the coding regions of GP and VP40. This novel, rapid, and convenient screening method will efficiently facilitate the exploration of miRNAs against EBOV under BSL-2 conditions.

Pre-harvest sprouting resistance and haplotype variation of ThVp-1 gene in the collection of wheat-wheatgrass hybrids

PubMed Central

Kocheshkova, A. A.; Kroupin, P. Yu.; Bazhenov, M. S.; Karlov, G. I.; Pochtovyy, A. A.; Upelniek, V. P.; Belov, V. I.

2017-01-01

The germplasm collection of 87 wheat-wheatgrass hybrids developed in Tsitisin Main Botanical Garden (Russia, Moscow) was evaluated for resistance to pre-harvest sprouting (PHS) by spike sprouting (SS) and germination index (GI) assays as well as for spike and grain features. The PHS resistance variation and haplotype polymorphism of the wheatgrass ThVp-1 and wheat TaVp-1B genes orthologues of Vp-1 was revealed in the studied collection. Four haplotypes of ThVp-1 were revealed: ThVp-1a (41% of the entries), ThVp-1b (13%), ThVp-1c (29%), and ThVp-1d (15%). The association between the allelic state of ThVp-1 and PHS resistance in the wheat-wheatgrass hybrids was shown: haplotype ThVp-1d of the wheatgrass Vp-1 gene is significantly associated with reduced PHS in the wheat-wheatgrass hybrids (mean SS 0.33, mean GI 0.64). The resistant entries may be perspective as a source of PHS resistance in the development of commercial cultivars of perennial wheat. PMID:29131854

HLA-A02:01-restricted epitopes identified from the herpes simplex virus tegument protein VP11/12 preferentially recall polyfunctional effector memory CD8+ T cells from seropositive asymptomatic individuals and protect humanized HLA-A*02:01 transgenic mice against ocular herpes.

PubMed

Srivastava, Ruchi; Khan, Arif A; Spencer, Doran; Vahed, Hawa; Lopes, Patricia P; Thai, Nhi Thi Uyen; Wang, Christine; Pham, Thanh T; Huang, Jiawei; Scarfone, Vanessa M; Nesburn, Anthony B; Wechsler, Steven L; BenMohamed, Lbachir

2015-03-01

The HSV type 1 tegument virion phosphoprotein (VP) 11/12 (VP11/12) is a major Ag targeted by CD8(+) T cells from HSV-seropositive individuals. However, whether and which VP11/12 epitope-specific CD8(+) T cells play a role in the "natural" protection seen in seropositive healthy asymptomatic (ASYMP) individuals (who have never had clinical herpes disease) remain to be determined. In this study, we used multiple prediction computer-assisted algorithms to identify 10 potential HLA-A*02:01-restricted CD8(+) T cell epitopes from the 718-aa sequence of VP11/12. Three of 10 epitopes exhibited high-to-moderate binding affinity to HLA-A*02:01 molecules. In 10 sequentially studied HLA-A*02:01-positive and HSV-1-seropositive ASYMP individuals, the most frequent, robust, and polyfunctional effector CD8(+) T cell responses, as assessed by a combination of tetramer frequency, granzyme B, granzyme K, perforin, CD107(a/b) cytotoxic degranulation, IFN-γ, and multiplex cytokines assays, were predominantly directed against three epitopes: VP11/1266-74, VP11/12220-228, and VP11/12702-710. Interestingly, ASYMP individuals had a significantly higher proportion of CD45RA(low)CCR7(low)CD44(high)CD62L(low)CD27(low)CD28(low)CD8(+) effector memory CD8(+) T cells (TEMs) specific to the three epitopes, compared with symptomatic individuals (with a history of numerous episodes of recurrent ocular herpetic disease). Moreover, immunization of HLA-A*02:01 transgenic mice with the three ASYMP CD8(+) TEM cell epitopes induced robust and polyfunctional epitope-specific CD8(+) TEM cells that were associated with a strong protective immunity against ocular herpes infection and disease. Our findings outline phenotypic and functional features of protective HSV-specific CD8(+) T cells that should guide the development of an effective T cell-based herpes vaccine. Copyright © 2015 by The American Association of Immunologists, Inc.

Generation of Recombinant Porcine Parvovirus Virus-Like Particles in Saccharomyces cerevisiae and Development of Virus-Specific Monoclonal Antibodies

PubMed Central

Tamošiūnas, Paulius Lukas; Petraitytė-Burneikienė, Rasa; Lasickienė, Rita; Sereika, Vilimas; Lelešius, Raimundas; Žvirblienė, Aurelija; Sasnauskas, Kęstutis

2014-01-01

Porcine parvovirus (PPV) is a widespread infectious virus that causes serious reproductive diseases of swine and death of piglets. The gene coding for the major capsid protein VP2 of PPV was amplified using viral nucleic acid extract from swine serum and inserted into yeast Saccharomyces cerevisiae expression plasmid. Recombinant PPV VP2 protein was efficiently expressed in yeast and purified using density gradient centrifugation. Electron microscopy analysis of purified PPV VP2 protein revealed the self-assembly of virus-like particles (VLPs). Nine monoclonal antibodies (MAbs) against the recombinant PPV VP2 protein were generated. The specificity of the newly generated MAbs was proven by immunofluorescence analysis of PPV-infected cells. Indirect IgG ELISA based on the recombinant VLPs for detection of PPV-specific antibodies in swine sera was developed and evaluated. The sensitivity and specificity of the new assay were found to be 93.4% and 97.4%, respectively. In conclusion, yeast S. cerevisiae represents a promising expression system for generating recombinant PPV VP2 protein VLPs of diagnostic relevance. PMID:25045718

Comparative evaluation of laboratory developed real-time PCR assays and RealStar(®) BKV PCR Kit for quantitative detection of BK polyomavirus.

PubMed

Hasan, Mohammad R; Tan, Rusung; Al-Rawahi, Ghada; Thomas, Eva; Tilley, Peter

2016-08-01

Quantitative, viral load monitoring for BK virus (BKV) by real-time PCR is an important tool in the management of polyomavirus associated nephropathy in renal transplant patients. However, variability in PCR results has been reported because of polymorphisms in viral genes among different subtypes of BKV, and lack of standardization of the PCR assays among different laboratories. In this study we have compared the performance of several laboratory developed PCR assays that target highly conserved regions of BKV genome with a commercially available, RealStar(®) BKV PCR Kit. Three real-time PCR assays (i) VP1 assay: selected from the literature that targets the major capsid protein (VP1) gene (ii) VP1MOD assay: VP1 assay with a modified probe, and (iii) BKLTA assay: newly designed assay that targets the large T antigen gene were assessed in parallel, using controls and clinical specimens that were previously tested using RealStar(®) BKV PCR Kit (Altona Diagnostics GmbH, Hamburg, Germany). Nucleic acid from all samples were extracted using the QIA symphony virus/bacteria kit on an automated DNA extraction platform QIA symphony SP (Qiagen). Primer and probe concentration, and reaction conditions for laboratory developed assays were optimized and the limit of detection of different assays was determined. Positive control for laboratory developed BK assays was prepared through construction of a plasmid carrying respective amplicon sequences. The 95% detection limit of VP1, VP1MOD and BKLTA assays were 1.8×10(2), 3×10(3) and 3.5×10(2) genomic copies/ml, respectively, as determined by Probit regression analysis of data obtained by testing a dilution series of a titered patient specimen, using RealStar(®) BKV PCR Kit. The inter-assay and intra-assay, coefficient of variations of these assays using calibrated, plasmid standards were <1%. All assays, including the RealStar(®) BKV PCR assay, were highly specific when tested against a panel of external proficiency specimens containing both BK and JC viruses. All assays, except the VP1MOD assay determined BK viral load in proficiency specimens within the same log values. With reference to results obtained by RealStar(®) BKV PCR assay, the sensitivity and specificity of different assays tested in 116 serum specimens submitted for BK viral load assay were 91% and 97% for VP1 assay, 88% and 97% for VP1MOD assay, and 97% and 98% for BKLTA assay, respectively. BK Viral load in positive specimens determined by various assays was highly correlated (R(2)>0.97), based on linear regression analysis. The performance characteristics of the newly designed, BKLTA assay were highly comparable to RealStar(®) BKV PCR assay, and can be used for routine detection and viral load monitoring of BKV in a cost-effective manner. Copyright © 2016 Elsevier B.V. All rights reserved.

Genetic variation of the VP1 gene of the virulent duck hepatitis A virus type 1 (DHAV-1) isolates in Shandong province of China.

PubMed

Gao, Jiming; Chen, Junhao; Si, Xingkui; Xie, Zhijing; Zhu, Yanli; Zhang, Xingxiao; Wang, Shujing; Jiang, Shijin

2012-08-01

To investigate the relationship of the variation of virulence and the external capsid proteins of the pandemic duck hepatitis A virus type 1 (DHAV-1) isolates, the virulence, cross neutralization assays and the complete sequence of the virion protein 1 (VP1) gene of nine virulent DHAV-1 strains, which were isolated from infected ducklings with clinical symptoms in Shandong province of China in 2007-2008, were tested. The fifth generation duck embryo allantoic liquids of the 9 isolates were tested on 12-day-old duck embryos and on 7-day-old ducklings for the median embryonal lethal doses (ELD(50)s) and the median lethal doses (LD(50)s), respectively. The results showed that the ELD(50)s of embryonic duck eggs of the 9 DHAV-1 isolates were between 1.9 × 10(6)/mL to 1.44 × 10(7)/mL, while the LD(50)s were 2.39 × 10(5)/mL to 6.15 × 10(6)/mL. Cross-neutralization tests revealed that the 9 DHAV-1 isolates were completely neutralized by the standard serum and the hyperimmune sera against the 9 DHAV-1 isolates, respectively. Compared with other virulent, moderate virulent, attenuated vaccine and mild strains, the VP1 genes of the 9 strains shared 89.8%-99.7% similarity at the nucleotide level and 92.4%-99.6% at amino acid level with other DHAV-1 strains. There were three hypervariable regions at the C-terminus (aa 158-160, 180-193 and 205-219) and other variable points in VP1 protein, but which didn't cause virulence of DHAV-1 change.

First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh.

PubMed

Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh; Sharma, Vivek; Sharma, Mandeep

2016-09-01

The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR) targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102) of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5 th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610) used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.

Possible involvement of inefficient cleavage of preprovasopressin by signal peptidase as a cause for familial central diabetes insipidus.

PubMed Central

Ito, M; Oiso, Y; Murase, T; Kondo, K; Saito, H; Chinzei, T; Racchi, M; Lively, M O

1993-01-01

A transition of G to A at nucleotide position 279 in exon 1 of the vasopressin gene has been identified in patients with familial central diabetes insipidus. The mutation predicts an amino acid substitution of Thr (ACG) for Ala (GCG) at the COOH terminus of the signal peptide in preprovasopression (preproVP). Translation in vitro of wild-type and mutant mRNAs produced 19-kD preproVPs. When translated in the presence of canine pancreatic rough microsomes, wild-type preproVP was converted to a 21-kD protein, whereas the mutant mRNA produced proteins of 21 kD and 23 kD. NH2-terminal amino acid sequence analysis revealed that the 21-kD proteins from the wild-type and the mutants were proVPs generated by the proteolytic cleavage of the 19-residue signal peptide and the addition of carbohydrate. Accordingly, mutant preproVP was cleaved at the correct site after Thr-19, but the efficiency of cleavage by signal peptidase was < 25% that observed for the wild-type preproVP, resulting in the formation of a predominant glycosylated but uncleaved 23-kD product. These data suggest that inefficient processing of preproVP produced by the mutant allele is possibly involved in the pathogenesis of diabetes insipidus in the affected individuals. Images PMID:8514868

Rotavirus Genotypes in Sewage Treatment Plants and in Children Hospitalized with Acute Diarrhea in Italy in 2010 and 2011

PubMed Central

Ruggeri, Franco M.; Bonomo, Paolo; Ianiro, Giovanni; Battistone, Andrea; Delogu, Roberto; Germinario, Cinzia; Chironna, Maria; Triassi, Maria; Campagnuolo, Rosalba; Cicala, Antonella; Giammanco, Giovanni M.; Castiglia, Paolo; Serra, Caterina; Gaggioli, Andrea

2014-01-01

Although the molecular surveillance network RotaNet-Italy provides useful nationwide data on rotaviruses causing severe acute gastroenteritis in children in Italy, scarce information is available on rotavirus circulation in the general Italian population, including adults with mild or asymptomatic infection. We investigated the genotypes of rotaviruses present in urban wastewaters and compared them with those of viral strains from clinical pediatric cases. During 2010 and 2011, 285 sewage samples from 4 Italian cities were tested by reverse transcription-PCRs (RT-PCRs) specific for rotavirus VP7 and VP4 genes. Rotavirus was detected in 172 (60.4%) samples, 26 of which contained multiple rotavirus G (VP7 gene) genotypes, for a total of 198 G types. Thirty-two samples also contained multiple P (VP4 gene) genotypes, yielding 204 P types in 172 samples. Genotype G1 accounted for 65.6% of rotaviruses typed, followed by genotypes G2 (20.2%), G9 (7.6%), G4 (4.6%), G6 (1.0%), G3 (0.5%), and G26 (0.5%). VP4 genotype P[8] accounted for 75.0% of strains, genotype P[4] accounted for 23.0% of strains, and the uncommon genotypes P[6], P[9], P[14], and P[19] accounted for 2.0% of strains altogether. These rotavirus genotypes were also found in pediatric patients hospitalized in the same areas and years but in different proportions. Specifically, genotypes G2, G9, and P[4] were more prevalent in sewage samples than among samples from patients, which suggests either a larger circulation of the latter strains through the general population not requiring medical care or their greater survival in wastewaters. A high level of nucleotide identity in the G1, G2, and G6 VP7 sequences was observed between strains from the environment and those from patients. PMID:25344240

Unexpected detection of porcine rotavirus C strains carrying human origin VP6 gene.

PubMed

Kattoor, Jobin Jose; Saurabh, Sharad; Malik, Yashpal Singh; Sircar, Shubhankar; Dhama, Kuldeep; Ghosh, Souvik; Bányai, Krisztián; Kobayashi, Nobumichi; Singh, Raj Kumar

2017-12-01

Rotavirus C (RVC), a known etiological agent of diarrheal outbreaks, mainly inflicts swine population globally with sporadic incidence in human, cattle, ferret, mink and dog. To demonstrate the presence of RVC in Indian swine population and characterization of its selected structural (VP6) and non-structural (NSP4 and NSP5) genes. A total of 108 diarrheic samples from different regions of India were used. Isolated RNA was loaded onto polyacrylamide gel to screen for the presence of RVs through the identification of specific electrophoretic genomic migration pattern. To characterize the RVC strains, VP6 gene and NSP4 and NSP5 genes were amplified, sequenced and analyzed. Based on VP6 gene specific diagnostic RT-PCR, the presence of RVC was confirmed in 12.0% (13/108) piglet fecal specimens. The nucleotide sequence analysis of VP6 gene, encoding inner capsid protein, from selected porcine RVC (PoRVC) strains revealed more than 93% homologies to human RVC strains (HuRVC) of Eurasian origin. These strains were distant from hitherto reported PoRVCs and clustered with HuRVCs, owning I2 genotype. However, the two non-structural genes, i.e. NSP4 and NSP5, of these strains were found to be of swine type, signifying a re-assortment event that has occurred in the Indian swine population. The findings indicate the presence of human-like RVC in Indian pigs and division of RVC clade with I2 genotype into further sub-clades. To the best of our knowledge, this appears to be the first report of RVC in Indian swine population. Incidence of human-like RVC VP6 gene in swine supports its subsequent zoonotic prospective.

HLA-A02:01-Restricted Epitopes Identified from the Herpes Simplex Virus Tegument Protein VP11/12 Preferentially Recall Polyfunctional Effector Memory CD8+ T Cells from Seropositive Asymptomatic Individuals and Protect “Humanized” HLA-A*02:01 Transgenic Mice Against Ocular Herpes

PubMed Central

Srivastava, Ruchi; Khan, Arif A.; Spencer, Doran; Vahed, Hawa; Lopes, Patricia P.; Thai, Nhi Thi Uyen; Wang, Christine; Pham, Thanh T.; Huang, Jiawei; Scarfone, Vanessa M.; Nesburn, Anthony B.; Wechsler, Steven L.; BenMohamed, Lbachir

2014-01-01

The Herpes Simplex Virus type 1 virion tegument phosphoprotein 11/12 (HSV-1 VP11/12) is a major antigen targeted by CD8+ T cells from HSV-seropositive individuals. However, whether and which VP11/12-epitope-specific CD8+ T cells play a role in the “natural” protection seen in seropositive healthy asymptomatic (ASYMP) individuals (who have never had clinical herpes disease) remain to be determined. In this study, we used multiple prediction computer-assisted algorithms to identify 10 potential HLA-A*02:01-restricted CD8+ T cell epitopes from the 716 amino acids sequence of VP11/12. Three out of ten epitopes exhibited high to moderate binding affinity to HLA-A*02:01 molecules. In ten sequentially studied HLA-A*02:01 positive and HSV-1-seropositive ASYMP individuals, the most frequent, robust and polyfunctional effector CD8+ T-cell responses, as assessed by a combination of tetramer frequency, granzyme B, granzyme K, perforin, CD107a/b cytotoxic degranulation, IFN-γ and multiplex cytokines assays, were predominantly directed against three epitopes: VP11/1266–74, VP11/12220–228 and VP11/12702–710. Interestingly, ASYMP individuals had significantly higher proportion of CD45RAlowCCR7lowCD44highCD62LlowCD27lowCD28lowCD8+ effector memory T cells (TEM) specific to the three epitopes, compared to symptomatic (SYMP) individuals (with a history of numerous episodes of recurrent ocular herpetic disease). Moreover, immunization of HLA-A*02:01 transgenic mice with the three ASYMP CD8+ TEM cell epitopes induced robust and polyfunctional epitope-specific CD8+ TEM cells that were associated with a strong protective immunity against ocular herpes infection and disease. Our findings outline phenotypic and functional features of protective HSV-specific CD8+ T cells that should guide the development of an effective T-cell-based herpes vaccine. PMID:25617474

T helper cell-mediated interferon-gamma expression after human parvovirus B19 infection: persisting VP2-specific and transient VP1u-specific activity

PubMed Central

Franssila, R; Auramo, J; Modrow, S; Möbs, M; Oker-Blom, C; Käpylä, P; Söderlund-Venermo, M; Hedman, K

2005-01-01

Human parvovirus B19 is a small non-enveloped DNA virus with an icosahedral capsid consisting of proteins of only two species, the major protein VP2 and the minor protein VP1. VP2 is contained within VP1, which has an additional unique portion (VP1u) of 227 amino acids. We determined the ability of eukaryotically expressed parvovirus B19 virus-like particles consisting of VP1 and VP2 in the ratio recommended for vaccine use, or of VP2 alone, to stimulate, in an HLA class II restricted manner, peripheral blood mononuclear cells (PBMC) to proliferate and to secrete interferon gamma (IFN-γ) and interleukin (IL)-10 cytokines among recently and remotely B19 infected subjects. PBMC reactivity with VP1u was determined specifically with a prokaryotically expressed VP1u antigen. In general, B19-specific IFN-γ responses were stronger than IL-10 responses in both recent and remote infection; however, IL-10 responses were readily detectable among both groups, with the exception of patients with relapsed or persisting symptoms who showed strikingly low IL-10 responses. Whereas VP1u-specific IFN-γ responses were very strong among the recently infected subjects, the VP1u-specific IFN-γ and IL-10 responses were virtually absent among the remotely infected subjects. The disappearance of VP1u-specific IFN-γ expression is surprising, as B-cell immunity against VP1u is well maintained. PMID:16178856

[Analysis of genetic characteristics of type II non-wild poliovirus in mainland China, 2010].

PubMed

Jiang, Hua-Fang; Yan, Dong-Mei; Zhu, Shuang-Li; Wang, Dong-Yan; Zhang, Yong; Zhu, Hui; An, Hong-Qiu; Xu, Wen-Bo; Kong, Xiao-Hui

2012-03-01

To study the genetic characteristics of 123 type II non-wild polioviruses isolated from acute flaccid paralysis (AFP) cases in mainland China in 2010, provide the scientific basis for maintaining the "polio-free" status, and the switching use of polio vaccine for China. VP1 gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and the PCR products were then sequenced. The sequence results were analyzed with Sequencher 4.8, BioEdit 7.0.9 and MEGA 5.0. Of 65 strains, nt2909 was found to be a mutation hotspot, and also a neurovirulence determinant in VP1 region. During 2010, two vaccine-derived polioviruses (VDPVs) were isolated from Yunnan province, China and no wild poliovirus (WPV) was isolated. The epidemiological studies and laboratory results of the two VDPVs showed that they were newly discovered VDPVs because of the genetic difference from other VDPVs strains isolated in the world, implying the sensitive poliovirus surveillance network could timely detect the transmission of VDPVs and the importation of WPV.

Real-time RT-PCR assays to differentiate wild-type group A rotavirus strains from Rotarix(®) and RotaTeq(®) vaccine strains in stool samples.

PubMed

Gautam, Rashi; Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Ian Tam, Ka; Gentsch, Jon R; Bowen, Michael D

2014-01-01

Group A rotaviruses (RVA) are the leading cause of severe diarrhea in young children worldwide. Two live-attenuated RVA vaccines, Rotarix(®) and RotaTeq(®) are recommended by World Health Organization (WHO) for routine immunization of all infants. Rotarix(®) and RotaTeq(®) vaccines have substantially reduced RVA associated mortality but occasionally have been associated with acute gastroenteritis (AGE) cases identified in vaccinees and their contacts. High-throughput assays are needed to monitor the prevalence of vaccine strains in AGE cases and emergence of new vaccine-derived strains following RVA vaccine introduction. In this study, we have developed quantitative real-time RT-PCR (qRT-PCR) assays for detection of Rotarix(®) and RotaTeq(®) vaccine components in stool samples. Real-time RT-PCR assays were designed for vaccine specific targets in the genomes of Rotarix(®) (NSP2, VP4) and RotaTeq(®) (VP6, VP3-WC3, VP3-human) and validated on sequence confirmed stool samples containing vaccine strains, wild-type RVA strains, and RVA-negative stools. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Rotarix(®) NSP2 and VP4 qRT-PCR assays exhibited 92-100% sensitivity, 99-100% specificity, 94-105% efficiency, and a limit of detection of 2-3 copies per reaction. RotaTeq(®) VP6, VP3-WC3, and VP3-human qRT-PCR assays displayed 100% sensitivity, 94-100% specificity, 91-102% efficiency and limits of detection of 1 copy, 2 copies, and 140 copies, respectively. These assays permit rapid identification of Rotarix(®) and RotaTeq(®) vaccine components in stool samples from clinical and surveillance studies and will be helpful in determining the frequency of vaccine strain-associated AGE.

Real-time RT-PCR assays to differentiate wild-type group A rotavirus strains from Rotarix® and RotaTeq® vaccine strains in stool samples

PubMed Central

Gautam, Rashi; Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Ian Tam, Ka; Gentsch, Jon R; Bowen, Michael D

2014-01-01

Group A rotaviruses (RVA) are the leading cause of severe diarrhea in young children worldwide. Two live-attenuated RVA vaccines, Rotarix® and RotaTeq® are recommended by World Health Organization (WHO) for routine immunization of all infants. Rotarix® and RotaTeq® vaccines have substantially reduced RVA associated mortality but occasionally have been associated with acute gastroenteritis (AGE) cases identified in vaccinees and their contacts. High-throughput assays are needed to monitor the prevalence of vaccine strains in AGE cases and emergence of new vaccine-derived strains following RVA vaccine introduction. In this study, we have developed quantitative real-time RT-PCR (qRT-PCR) assays for detection of Rotarix® and RotaTeq® vaccine components in stool samples. Real-time RT-PCR assays were designed for vaccine specific targets in the genomes of Rotarix® (NSP2, VP4) and RotaTeq® (VP6, VP3-WC3, VP3-human) and validated on sequence confirmed stool samples containing vaccine strains, wild-type RVA strains, and RVA-negative stools. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Rotarix® NSP2 and VP4 qRT-PCR assays exhibited 92–100% sensitivity, 99–100% specificity, 94–105% efficiency, and a limit of detection of 2–3 copies per reaction. RotaTeq® VP6, VP3-WC3, and VP3-human qRT-PCR assays displayed 100% sensitivity, 94–100% specificity, 91–102% efficiency and limits of detection of 1 copy, 2 copies, and 140 copies, respectively. These assays permit rapid identification of Rotarix® and RotaTeq® vaccine components in stool samples from clinical and surveillance studies and will be helpful in determining the frequency of vaccine strain-associated AGE. PMID:24342877

Vaccination with multimeric recombinant VP28 induces high protection against white spot syndrome virus in shrimp.

PubMed

Taengchaiyaphum, Suparat; Nakayama, Hideki; Srisala, Jiraporn; Khiev, Ratny; Aldama-Cano, Diva January; Thitamadee, Siripong; Sritunyalucksana, Kallaya

2017-11-01

To improve the efficacy of WSSV protection, multimeric (tetrameric) recombinant VP28 (4XrVP28) was produced and tested in comparison with those of monomeric VP28 (1XrVP28). In vitro binding of either 1XrVP28 or 4XrVP28 to shrimp hemocyte surface was evident as early as 10 min after protein inoculation. Similar results were obtained in vivo when shrimp were injected with recombinant proteins that the proteins bound to the hemocyte surface could be detected since 5 min after injection. Comparison of the WSSV protection efficiencies of 1XrVP28 or 4XrVP28 were performed by injection the purified 1XrVP28 or 4XrVP28 (22.5 μg/shrimp) and WSSV inoculum (1000 copies/shrimp) into shrimp. At 10 dpi, while shrimp injected with WSSV inoculum reached 100% mortality, shrimp injected with 1XrVP28 + WSSV or 4XrVP28 + WSSV showed relative percent survival (RPS) of 67% and 81%, respectively. PCR quantification revealed high number of WSSV in the moribund shrimp of WSSV- and 1XrVP28+WSSV-injected group. In contrast, lower number of WSSV copies were found in the survivors both from 1XrVP28+WSSV- or 4XrVP28+WSSV- injected groups. Histopathological analysis demonstrated the WSSV infected lesions found in the moribund from WSSV-infected group and 1XrVP28+WSSV-injected group, but less or none in the survivors. ELISA demonstrated that 4XrVP28 exhibited higher affinity binding to rPmRab7, a WSSV binding protein essential for WSSV entry to the cell than 1XrVP28. Taken together, the protection against WSSV in shrimp could be improved by application of multimeric rVP28. Copyright © 2017 Elsevier Ltd. All rights reserved.

A real time genotyping PCR assay for polyomavirus BK.

PubMed

Gard, Lilli; Niesters, Hubert G M; Riezebos-Brilman, Annelies

2015-09-01

Polyomavirus BK (BKV) may cause nephropathy in renal transplant recipients and hemorrhagic cystitis in bone marrow recipients. We developed real-time PCRs (RT-PCR) to determine easily and rapidly the different BKV genotypes (BKGT) (I-IV). On the VP1 gene a duplex of RT-PCRs was developed and validated to differentiate the four main BKGT. 212 BKV positive samples (21 plasma, 191 urine) were tested with these specific PCRs. Of these 212 samples, 55 PCR results were additionally confirmed by sequencing a VP1 gene fragment (nucleotide 1630-1956). For every genotype, a highly specific, precise and internally controlled assay was developed with a limit of detection of log 3 copies per ml. In 18 (8.5%) of these samples genotyping was not successful due to a low viral load. By sequence analysis, the genotype of 46 out of 55 and 2 out of 4 samples with double infection could be confirmed. This study describes RT-PCRs for detection of the main BKGT. It proved to be rapid, cheap and sensitive compared to sequencing. Double infections can also be detected. This method will be of value to investigate the role of BKV infection in relation to the genotype. Copyright © 2015 Elsevier B.V. All rights reserved.

Overexpression of VpEIFP1, a novel F-box/Kelch-repeat protein from wild Chinese Vitis pseudoreticulata, confers higher tolerance to powdery mildew by inducing thioredoxin z proteolysis.

PubMed

Wang, Jie; Yao, Wenkong; Wang, Lei; Ma, Fuli; Tong, Weihuo; Wang, Chen; Bao, Rui; Jiang, Changyue; Yang, Yazhou; Zhang, Jianxia; Xu, Yan; Wang, Xiping; Zhang, Chaohong; Wang, Yuejin

2017-10-01

An F-box protein (VpEIFP1) induced by Erysiphe necator was isolated from Vitis pseudoreticulata, a wild Chinese grapevine species naturally resistant to powdery mildew (PM). It contains an F-box domain and two Kelch-repeat motifs. Expression profiles indicate the VpEIFP1 is strongly induced at both transcriptional and translational levels by PM infection. A subcellular localisation assay showed that VpEIFP1 is predominantly located in the nucleus and cytoplasm. Overexpression of VpEIFP1 accelerated the accumulation of hydrogen peroxide (H 2 O 2 ) and up-regulated the expressions of ICS2, NPR1 and PR1 involved in defence responses, resulting in suppression of PM germination and growth. As an F-box protein, VpEIFP1 interacts with thioredoxin z (VpTrxz) in the yeast-two-hybrid (Y2H) assay and in the bimolecular fluorescence complementation (BiFC) assay. Decreased amounts of VpTrxz protein in transgenic grapevine leaves overexpressing VpEIFP1 were restored by proteasome inhibitor MG132, implying that VpEIFP1 mediated VpTrxz for degradation through the SCF VpEIFP1 (Skp1-Cullin-F-box) E3 ubiquitin ligase complex. The RNA interference line of VpTrxz showed increased H 2 O 2 accumulation following PM inoculation. We propose VpEIFP1 positively modulates the grapevine defence response to PM by inducing the degradation of VpTrxz via the ubiquitin/26S proteasome system. Copyright © 2017 Elsevier B.V. All rights reserved.

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

Genetic characterization of enterovirus strains identified in Hand, Foot and Mouth Disease (HFMD): Emergence of B1c, C1 subgenotypes, E2 sublineage of CVA16, EV71 and CVA6 strains in India.

PubMed

Ganorkar, Nital N; Patil, Pooja R; Tikute, Sanjay S; Gopalkrishna, Varanasi

2017-10-01

Hand, Foot and Mouth disease (HFMD) is a common childhood disease and caused due to Enterovirus-A (EV-A), EV-B and EV-C species worldwide. Cases of HFMD were reported from, Ahmedabad (Gujarat, 2012) and Pune (Maharashtra, 2013-2014) in India. The present study highlights the identification of EV strains (CVA16, CVA6, CVA4 and Echo12), characterization of subgenotypes of CVA16, CVA6 strains during 2012-14 and CVA16, CVA6, EV71 strains reported from the earlier study (2009-10) in HFMD cases from India. A total 158 clinical specimens collected from 64 HFMD cases (2012-2014) were included in the study. EV detection was carried out by 5'NCR based RT-PCR, molecular typing and subgenotyping was by VP1/2A junction or VP1, full VP1 gene amplification respectively followed by phylogenetic analysis. The present study reports 63.92% (101/158) EV positivity by RT-PCR. Ninety four of the 101 (93.06%) EV positive strains were amplified by VP1/2A junction or VP1 regions. Sequence analysis revealed the presence of CVA16 (61.7%), CVA6 (34.04%), CVA4 and Echo12 (4.3%). A total of 114 EV positive strains were genotyped using full and partial VP1 region. All CVA16 Indian strains (n=70) clustered with rarely reported B1c subgenotype, CVA6 (n=43) and EV71 (n=1) strains clustered with sub-lineage E2 and C1 subgenotypes respectively. In summary, the study reports genetic characterization of CVA16, CVA6, CVA4 and Echo12 strains in HFMD cases from India. Circulation of B1c subgenotype of CVA16, E2 sub-lineage of CVA6 and C1 subgenotype of EV 71 strains in HFMD cases were reported for the first time from India. This study helps to understand the genotype distribution, genetic diversity of EV strains associated with HFMD from Eastern, Western and Southern regions in India. Copyright © 2017 Elsevier B.V. All rights reserved.

Bacteriophage P23-77 Capsid Protein Structures Reveal the Archetype of an Ancient Branch from a Major Virus Lineage

PubMed Central

Rissanen, Ilona; Grimes, Jonathan M.; Pawlowski, Alice; Mäntynen, Sari; Harlos, Karl; Bamford, Jaana K.H.; Stuart, David I.

2013-01-01

Summary It has proved difficult to classify viruses unless they are closely related since their rapid evolution hinders detection of remote evolutionary relationships in their genetic sequences. However, structure varies more slowly than sequence, allowing deeper evolutionary relationships to be detected. Bacteriophage P23-77 is an example of a newly identified viral lineage, with members inhabiting extreme environments. We have solved multiple crystal structures of the major capsid proteins VP16 and VP17 of bacteriophage P23-77. They fit the 14 Å resolution cryo-electron microscopy reconstruction of the entire virus exquisitely well, allowing us to propose a model for both the capsid architecture and viral assembly, quite different from previously published models. The structures of the capsid proteins and their mode of association to form the viral capsid suggest that the P23-77-like and adeno-PRD1 lineages of viruses share an extremely ancient common ancestor. PMID:23623731

Recombination in the Evolution of Enterovirus C Species Sub-Group that Contains Types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99

PubMed Central

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genetic recombination is considered to be a very frequent phenomenon among enteroviruses (Family Picornaviridae, Genus Enterovirus). However, the recombination patterns may differ between enterovirus species and between types within species. Enterovirus C (EV-C) species contains 21 types. In the capsid coding P1 region, the types of EV-C species cluster further into three sub-groups (designated here as A–C). In this study, the recombination pattern of EV-C species sub-group B that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99 was determined using partial 5′UTR and VP1 sequences of enterovirus strains isolated during poliovirus surveillance and previously published complete genome sequences. Several inter-typic recombination events were detected. Furthermore, the analyses suggested that inter-typic recombination events have occurred mainly within the distinct sub-groups of EV-C species. Only sporadic recombination events between EV-C species sub-group B and other EV-C sub-groups were detected. In addition, strict recombination barriers were inferred for CVA-21 genotype C and CVA-24 variant strains. These results suggest that the frequency of inter-typic recombinations, even within species, may depend on the phylogenetic position of the given viruses. PMID:24722726

The C-terminal residue of phage Vp16 PDF, the smallest peptide deformylase, acts as an offset element locking the active conformation.

PubMed

Grzela, Renata; Nusbaum, Julien; Fieulaine, Sonia; Lavecchia, Francesco; Bienvenut, Willy V; Dian, Cyril; Meinnel, Thierry; Giglione, Carmela

2017-09-08

Prokaryotic proteins must be deformylated before the removal of their first methionine. Peptide deformylase (PDF) is indispensable and guarantees this mechanism. Recent metagenomics studies revealed new idiosyncratic PDF forms as the most abundant family of viral sequences. Little is known regarding these viral PDFs, including the capacity of the corresponding encoded proteins to ensure deformylase activity. We provide here the first evidence that viral PDFs, including the shortest PDF identified to date, Vp16 PDF, display deformylase activity in vivo, despite the absence of the key ribosome-interacting C-terminal region. Moreover, characterization of phage Vp16 PDF underscores unexpected structural and molecular features with the C-terminal Isoleucine residue significantly contributing to deformylase activity both in vitro and in vivo. This residue fully compensates for the absence of the usual long C-domain. Taken together, these data elucidate an unexpected mechanism of enzyme natural evolution and adaptation within viral sequences.

Infectious pancreatic necrosis virus in Atlantic salmon, Salmo salar L., post-smolts in the Shetland Isles, Scotland: virus identification, histopathology, immunohistochemistry and genetic comparison with Scottish mainland isolates.

PubMed

Smail, D A; Bain, N; Bruno, D W; King, J A; Thompson, F; Pendrey, D J; Morrice, S; Cunningham, C O

2006-01-01

During mid-June 1999 peak mortalities of 11% of the total stock per week were seen at a sea cage site of Atlantic salmon, Salmo salar L., post-smolts in the Shetland Isles, Scotland. Virus was isolated on chinook salmon embryo (CHSE) cells in a standard diagnostic test and infectious pancreatic necrosis virus (IPNV) identified by enzyme-linked immunosorbent assay. IPNV was confirmed as serogroup A by a cell immunofluorescent antibody test using the cross-reactive monoclonal antibody AS-1. Four weeks after the main outbreak, virus titres in surviving moribund fish were assayed at >10(10) TCID50 g(-1) kidney. Histopathology of moribund fish was characterized by pancreatic acinar cell necrosis and a marked catarrhal enteritis of the intestinal mucosa. In the liver, necrosis, leucocytic infiltration and a generalized cell vacuolation were noted. IPNV-specific immunostaining was demonstrated in pancreas, liver, heart, gill and kidney tissue. The nucleotide sequence of the coding region of segment A was determined from the Shetland isolate. A 1180 bp fragment of the VP2 gene of this isolate was compared with a 1979 reference isolate from mainland Scottish Atlantic salmon, La/79 and another more recent mainland isolate, 432/00. Both A2 isolates were derived from carrier fish without signs of IPN and serotyped by a plaque neutralization test. The Shetland isolate shows a different nucleotide and amino acid sequence compared with the two isolates from carrier fish. These latter isolates showed identical amino acid sequences in the fragment examined, despite the 21 years separating the isolations. Sequence comparisons with other A2 (Sp) isolates on the database confirm all three Scottish isolates are A2 (Sp).

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Lichenase and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2000-08-15

The present invention provides a fungal lichenase, i.e., an endo-1,3-1,4-.beta.-D-glucanohydrolase, its coding sequence, recombinant DNA molecules comprising the lichenase coding sequences, recombinant host cells and methods for producing same. The present lichenase is from Orpinomyces PC-2.

Investigations of different kilovoltage x-ray energy for three-dimensional converging stereotactic radiotherapy system: Monte Carlo simulations with CT data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deloar, Hossain M.; Kunieda, Etsuo; Kawase, Takatsugu

2006-12-15

We are investigating three-dimensional converging stereotactic radiotherapy (3DCSRT) with suitable medium-energy x rays as treatment for small lung tumors with better dose homogeneity at the target. A computed tomography (CT) system dedicated for non-coplanar converging radiotherapy was simulated with BEAMnrc (EGS4) Monte-Carlo code for x-ray energy of 147.5, 200, 300, and 500 kilovoltage (kVp). The system was validated by comparing calculated and measured percentage of depth dose in a water phantom for the energy of 120 and 147.5 kVp. A thorax phantom and CT data from lung tumors (<20 cm{sup 3}) were used to compare dose homogeneities of kVp energiesmore » with MV energies of 4, 6, and 10 MV. Three non-coplanar arcs (0 deg. and {+-}25 deg. ) around the center of the target were employed. The Monte Carlo dose data format was converted to the XiO RTP format to compare dose homogeneity, differential, and integral dose volume histograms of kVp and MV energies. In terms of dose homogeneity and DVHs, dose distributions at the target of all kVp energies with the thorax phantom were better than MV energies, with mean dose absorption at the ribs (human data) of 100%, 85%, 50%, 30% for 147.5, 200, 300, and 500 kVp, respectively. Considering dose distributions and reduction of the enhanced dose absorption at the ribs, a minimum of 500 kVp is suitable for the lung kVp 3DCSRT system.« less

Localization of the herpes simplex virus type 1 major capsid protein VP5 to the cell nucleus requires the abundant scaffolding protein VP22a.

PubMed

Nicholson, P; Addison, C; Cross, A M; Kennard, J; Preston, V G; Rixon, F J

1994-05-01

The intracellular distributions of three herpes simplex virus type 1 (HSV-1) capsid proteins, VP23, VP5 and VP22a, were examined using vaccinia virus and plasmid expression systems. During infection of cells with HSV-1 wild-type virus, all three proteins were predominantly located in the nucleus, which is the site of capsid assembly. However, when expressed in the absence of any other HSV-1 proteins, although VP22a was found exclusively in the nucleus as expected, VP5 and VP23 were distributed throughout the cell. Thus nuclear localization is not an intrinsic property of these proteins but must be mediated by one or more HSV-1-induced proteins. Co-expression experiments demonstrated that VP5 was efficiently transported to the nucleus in the presence of VP22a, but the distribution of VP23 was unaffected by the presence of either or both of the other two proteins.

Phylogenetic comparison of the VP7, VP4, VP6, and NSP4 genes of rotaviruses isolated from children in Nizhny Novgorod, Russia, 2015-2016, with cogent genes of the Rotarix and RotaTeq vaccine strains.

PubMed

Morozova, O V; Sashina, T A; Epifanova, N V; Zverev, V V; Kashnikov, A U; Novikova, N A

2018-04-01

Group A rotaviruses (RVA) are one of the leading causes of gastroenteritis in young children worldwide. The introduction of universal mass vaccination around the world has contributed to a reduction in hospitalizations and outpatient visits associated with rotavirus infection. Continued surveillance of RVA strains is needed to determine long-term effects of vaccine introduction. In the present work, we carried out the analysis of the genotypic diversity of RVA strains isolated in Nizhny Novgorod (Russia) during the 2015-2016 epidemic season. Also we conducted a comparative analysis of the amino acid sequences of T-cell epitopes of wild-type and vaccine (RotaTeq and Rotarix) strains. In total, 1461 samples were examined. RVAs were detected in 30.4% of cases. Rotaviruses with genotype G9P[8] (40.5%) dominated in the 2015-16 epidemic season. Additionally, RVAs with the following genotypes were detected: G4P[8] (25.4%), G1P[8] (13%), G2P[4] (3.2%). Rotaviruses with genotypes G3P[9], G6P[9], and G1P[9] totaled 3%. The number of partially typed and untyped RVA samples was 66 (14.9%). The findings of a RVA of G6P[9] genotype in Russia were an original observation. Our analysis of VP6 and NSP4 T-cell epitopes showed highly conserved amino acid sequences. The found differences seem not to be caused by the immune pressure but were rather related to the genotypic affiliations of the proteins. Vaccination against rotavirus infection is not included in the national vaccination schedule in Russia. Monitoring of the genotypic and antigenic diversity of contemporary RVA will allow providing a comparative analysis of wild-type strains in areas with and without vaccine campaign.

Enterovirus 71 viral capsid protein linear epitopes: Identification and characterization

PubMed Central

2012-01-01

Background To characterize the human humoral immune response against enterovirus 71 (EV71) infection and map human epitopes on the viral capsid proteins. Methods A series of 256 peptides spanning the capsid proteins (VP1, VP2, VP3) of BJ08 strain (genomic C4) were synthesized. An indirect enzyme-linked immunosorbent assay (ELISA) was carried out to detect anti-EV71 IgM and IgG in sera of infected children in acute or recovery phase. The partially overlapped peptides contained 12 amino acids and were coated in the plate as antigen (0.1 μg/μl). Sera from rabbits immunized with inactivated BJ08 virus were also used to screen the peptide panel. Results A total of 10 human anti-EV71 IgM epitopes (vp1-14 in VP1; vp2-6, 21, 40 and 50 in VP2 and vp3-10, 12, 15, 24 and 75 in VP3) were identified in acute phase sera. In contrast, only one anti-EV71 IgG epitope in VP1 (vp1-15) was identified in sera of recovery stage. Four rabbit anti-EV71 IgG epitopes (vp1-14, 31, 54 and 71) were identified and mapped to VP1. Conclusion These data suggested that human IgM epitopes were mainly mapped to VP2 and VP3 with multi-epitope responses occurred at acute infection, while the only IgG epitope located on protein VP1 was activated in recovery phase sera. The dynamic changes of humoral immune response at different stages of infection may have public health significance in evaluation of EV71 vaccine immunogenicity and the clinical application of diagnostic reagents. PMID:22264266

Human Asymptomatic Epitopes Identified from the Herpes Simplex Virus Tegument Protein VP13/14 (UL47) Preferentially Recall Polyfunctional Effector Memory CD44high CD62Llow CD8+ TEM Cells and Protect Humanized HLA-A*02:01 Transgenic Mice against Ocular Herpesvirus Infection.

PubMed

Srivastava, Ruchi; Khan, Arif A; Garg, Sumit; Syed, Sabrina A; Furness, Julie N; Vahed, Hawa; Pham, Tiffany; Yu, Howard T; Nesburn, Anthony B; BenMohamed, Lbachir

2017-01-15

Herpes simplex virus 1 (HSV-1) infection is widespread among humans. The HSV-1 virion protein 13/14 (VP13/14), also known as UL47, is a tegument antigen targeted by CD8 + T cells from HSV-seropositive individuals. However, whether VP13/14-specific CD8 + T cells play a role in the natural protection seen in asymptomatic (ASYMP) individuals (individuals who have never had a clinical herpetic disease) has not been elucidated. Using predictive computer-assisted algorithms, we identified 10 potential HLA-A*02:01-restricted CD8 + T-cell epitopes from the 693-amino-acid sequence of the VP13/14 protein. Three out of 10 epitopes exhibited a high to moderate affinity of binding to soluble HLA-A*02:01 molecules. The phenotype and function of CD8 + T cells specific for each epitope were compared in HLA-A*02:01-positive ASYMP individuals and symptomatic (SYMP) individuals (individuals who have frequent clinical herpetic diseases) using determination of a combination of tetramer frequency and the levels of granzyme B, granzyme K, perforin, gamma interferon, tumor necrosis factor alpha, and interleukin-2 production and CD107 a/b cytotoxic degranulation. High frequencies of multifunctional CD8 + T cells directed against three epitopes, VP13/14 from amino acids 286 to 294 (VP13/14 286-294 ), VP13/14 from amino acids 504 to 512 (VP13/14 504-512 ), and VP13/14 from amino acids 544 to 552 (VP13/14 544-552 ), were detected in ASYMP individuals, while only low frequencies were detected in SYMP individuals. The three epitopes also predominantly recalled more CD45RA low CD44 high CCR7 low CD62L low CD8 + effector memory T cells (T EM cells) in ASYMP individuals than SYMP individuals. Moreover, immunization of HLA-A*02:01 transgenic mice with the three CD8 + T EM -cell epitopes from ASYMP individuals induced robust and polyfunctional HSV-specific CD8 + T EM cells associated with strong protective immunity against ocular herpesvirus infection and disease. Our findings outline the phenotypic and functional features of protective HSV-specific CD8 + T cells that should guide the development of a safe and effective T-cell-based herpes simplex vaccine. Although most herpes simplex virus 1 (HSV-1)-infected individuals shed the virus in their body fluids following reactivation from latently infected sensory ganglia, the majority never develop a recurrent herpetic disease and remain asymptomatic (ASYMP). In contrast, small proportions of individuals are symptomatic (SYMP) and develop frequent bouts of recurrent disease. The present study demonstrates that naturally protected ASYMP individuals have a higher frequency of effector memory CD8 + T cells (CD8 + T EM cells) specific to three epitopes derived from the HSV-1 tegument protein VP13/14 (VP13/14 286-294 ,VP13/14 504-512 , and VP13/14 544-552 ) than SYMP patients. Moreover, immunization of humanized HLA-A*02:01 transgenic mice with the three CD8 + T EM -cell epitopes from ASYMP individuals induced robust and polyfunctional HSV-specific CD8 + T cells associated with strong protective immunity against ocular herpesvirus infection and disease. The findings support the emerging concept of the development of a safe and effective asymptomatic herpes simplex vaccine that is selectively based on CD8 + T-cell epitopes from ASYMP individuals. Copyright © 2017 American Society for Microbiology.

Study of canine parvovirus evolution: comparative analysis of full-length VP2 gene sequences from Argentina and international field strains.

PubMed

Gallo Calderón, Marina; Wilda, Maximiliano; Boado, Lorena; Keller, Leticia; Malirat, Viviana; Iglesias, Marcela; Mattion, Nora; La Torre, Jose

2012-02-01

The continuous emergence of new strains of canine parvovirus (CPV), poorly protected by current vaccination, is a concern among breeders, veterinarians, and dog owners around the world. Therefore, the understanding of the genetic variation in emerging CPV strains is crucial for the design of disease control strategies, including vaccines. In this paper, we obtained the sequences of the full-length gene encoding for the main capsid protein (VP2) of 11 canine parvovirus type 2 (CPV-2) Argentine representative field strains, selected from a total of 75 positive samples studied in our laboratory in the last 9 years. A comparative sequence analysis was performed on 9 CPV-2c, one CPV-2a, and one CPV-2b Argentine strains with respect to international strains reported in the GenBank database. In agreement with previous reports, a high degree of identity was found among CPV-2c Argentine strains (99.6-100% and 99.7-100% at nucleotide and amino acid levels, respectively). However, the appearance of a new substitution in the 440 position (T440A) in four CPV-2c Argentine strains obtained after the year 2009 gives support to the variability observed for this position located within the VP2, three-fold spike. This is the first report on the genetic characterization of the full-length VP2 gene of emerging CPV strains in South America and shows that all the Argentine CPV-2c isolates cluster together with European and North American CPV-2c strains.

Acute Hepatopancreatic Necrosis Disease-Causing Vibrio parahaemolyticus Strains Maintain an Antibacterial Type VI Secretion System with Versatile Effector Repertoires.

PubMed

Li, Peng; Kinch, Lisa N; Ray, Ann; Dalia, Ankur B; Cong, Qian; Nunan, Linda M; Camilli, Andrew; Grishin, Nick V; Salomon, Dor; Orth, Kim

2017-07-01

Acute hepatopancreatic necrosis disease (AHPND) is a newly emerging shrimp disease that has severely damaged the global shrimp industry. AHPND is caused by toxic strains of Vibrio parahaemolyticus that have acquired a "selfish plasmid" encoding the deadly binary toxins PirA vp /PirB vp To better understand the repertoire of virulence factors in AHPND-causing V. parahaemolyticus , we conducted a comparative analysis using the genome sequences of the clinical strain RIMD2210633 and of environmental non-AHPND and toxic AHPND isolates of V. parahaemolyticus Interestingly, we found that all of the AHPND strains, but none of the non-AHPND strains, harbor the antibacterial type VI secretion system 1 (T6SS1), which we previously identified and characterized in the clinical isolate RIMD2210633. This finding suggests that the acquisition of this T6SS might confer to AHPND-causing V. parahaemolyticus a fitness advantage over competing bacteria and facilitate shrimp infection. Additionally, we found highly dynamic effector loci in the T6SS1 of AHPND-causing strains, leading to diverse effector repertoires. Our discovery provides novel insights into AHPND-causing pathogens and reveals a potential target for disease control. IMPORTANCE Acute hepatopancreatic necrosis disease (AHPND) is a serious disease that has caused severe damage and significant financial losses to the global shrimp industry. To better understand and prevent this shrimp disease, it is essential to thoroughly characterize its causative agent, Vibrio parahaemolyticus Although the plasmid-encoded binary toxins PirA vp /PirB vp have been shown to be the primary cause of AHPND, it remains unknown whether other virulent factors are commonly present in V. parahaemolyticus and might play important roles during shrimp infection. Here, we analyzed the genome sequences of clinical, non-AHPND, and AHPND strains to characterize their repertoires of key virulence determinants. Our studies reveal that an antibacterial type VI secretion system is associated with the AHPND strains and differentiates them from non-AHPND strains, similar to what was seen with the PirA/PirB toxins. We propose that T6SS1 provides a selective advantage during shrimp infections. Copyright © 2017 American Society for Microbiology.

Circulation of Endemic Type 2 Vaccine-Derived Poliovirus in Egypt from 1983 to 1993

PubMed Central

Yang, Chen-Fu; Naguib, Tary; Yang, Su-Ju; Nasr, Eman; Jorba, Jaume; Ahmed, Nahed; Campagnoli, Ray; van der Avoort, Harrie; Shimizu, Hiroyuki; Yoneyama, Tetsuo; Miyamura, Tatsuo; Pallansch, Mark; Kew, Olen

2003-01-01

From 1988 to 1993, 30 cases of poliomyelitis associated with poliovirus type 2 were found in seven governorates of Egypt. Because many of the cases were geographically and temporally clustered and because the case isolates differed antigenically from the vaccine strain, it was initially assumed that the cases signaled the continued circulation of wild type 2 poliovirus. However, comparison of sequences encoding the major capsid protein, VP1 (903 nucleotides), revealed that the isolates were related (93 to 97% nucleotide sequence identity) to the Sabin type 2 oral poliovirus vaccine (OPV) strain and unrelated (<82% nucleotide sequence identity) to the wild type 2 polioviruses previously indigenous to Egypt (last known isolate: 1979) or to any contemporary wild type 2 polioviruses found elsewhere. The rate and pattern of VP1 divergence among the circulating vaccine-derived poliovirus (cVDPV) isolates suggested that all lineages were derived from a single OPV infection that occurred around 1983 and that progeny from the initiating infection circulated for approximately a decade within Egypt along several independent chains of transmission. Complete genomic sequences of an early (1988) and a late (1993) cVDPV isolate revealed that their 5′ untranslated region (5′ UTR) and noncapsid- 3′ UTR sequences were derived from other species C enteroviruses. Circulation of type 2 cVDPVs occurred at a time of low OPV coverage in the affected communities and ceased when OPV coverage rates increased. The potential for cVDPVs to circulate in populations with low immunity to poliovirus has important implications for current and future strategies to eradicate polio worldwide. PMID:12857906

Circulation of endemic type 2 vaccine-derived poliovirus in Egypt from 1983 to 1993.

PubMed

Yang, Chen-Fu; Naguib, Tary; Yang, Su-Ju; Nasr, Eman; Jorba, Jaume; Ahmed, Nahed; Campagnoli, Ray; van der Avoort, Harrie; Shimizu, Hiroyuki; Yoneyama, Tetsuo; Miyamura, Tatsuo; Pallansch, Mark; Kew, Olen

2003-08-01

From 1988 to 1993, 30 cases of poliomyelitis associated with poliovirus type 2 were found in seven governorates of Egypt. Because many of the cases were geographically and temporally clustered and because the case isolates differed antigenically from the vaccine strain, it was initially assumed that the cases signaled the continued circulation of wild type 2 poliovirus. However, comparison of sequences encoding the major capsid protein, VP1 (903 nucleotides), revealed that the isolates were related (93 to 97% nucleotide sequence identity) to the Sabin type 2 oral poliovirus vaccine (OPV) strain and unrelated (<82% nucleotide sequence identity) to the wild type 2 polioviruses previously indigenous to Egypt (last known isolate: 1979) or to any contemporary wild type 2 polioviruses found elsewhere. The rate and pattern of VP1 divergence among the circulating vaccine-derived poliovirus (cVDPV) isolates suggested that all lineages were derived from a single OPV infection that occurred around 1983 and that progeny from the initiating infection circulated for approximately a decade within Egypt along several independent chains of transmission. Complete genomic sequences of an early (1988) and a late (1993) cVDPV isolate revealed that their 5' untranslated region (5' UTR) and noncapsid- 3' UTR sequences were derived from other species C enteroviruses. Circulation of type 2 cVDPVs occurred at a time of low OPV coverage in the affected communities and ceased when OPV coverage rates increased. The potential for cVDPVs to circulate in populations with low immunity to poliovirus has important implications for current and future strategies to eradicate polio worldwide.

Purification of recombinant budgerigar fledgling disease virus VP1 capsid protein and its ability for in vitro capsid assembly

NASA Technical Reports Server (NTRS)

Rodgers, R. E.; Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1994-01-01

A recombinant system for the major capsid VP1 protein of budgerigar fledgling disease virus has been established. The VP1 gene was inserted into a truncated form of the pFlag-1 vector and expressed in Escherichia coli. The budgerigar fledgling disease virus VP1 protein was purified to near homogeneity by immunoaffinity chromatography. Fractions containing highly purified VP1 were pooled and found to constitute 3.3% of the original E. coli-expressed VP1 protein. Electron microscopy revealed that the VP1 protein was isolated as pentameric capsomeres. Electron microscopy also revealed that capsid-like particles were formed in vitro from purified VP1 capsomeres with the addition of Ca2+ ions and the removal of chelating and reducing agents.

Genetic characterization and molecular epidemiology of foot-and-mouth disease viruses isolated from Afghanistan in 2003-2005.

PubMed

Schumann, Kate R; Knowles, Nick J; Davies, Paul R; Midgley, Rebecca J; Valarcher, Jean-Francois; Raoufi, Abdul Quader; McKenna, Thomas S; Hurtle, William; Burans, James P; Martin, Barbara M; Rodriguez, Luis L; Beckham, Tammy R

2008-04-01

Foot-and-mouth disease virus (FMDV) isolates collected from various geographic locations in Afghanistan between 2003 and 2005 were genetically characterized, and their phylogeny was reconstructed utilizing nucleotide sequences of the complete VP1 coding region. Three serotypes of FMDV (types A, O, and Asia 1) were identified as causing clinical disease in Afghanistan during this period. Phylogenetic analysis revealed that the type A viruses were most closely related to isolates collected in Iran during 2002-2004. This is the first published report of serotype A in Afghanistan since 1975, therefore indicating the need for inclusion of serotype A in vaccine formulations that will be used to control disease outbreaks in this country. Serotype O virus isolates were closely related to PanAsia strains, including those that originated from Bhutan and Nepal during 2003-2004. The Asia 1 viruses, collected along the northern and eastern borders of Afghanistan, were most closely related to FMDV isolates collected in Pakistan during 2003 and 2004. Data obtained from this study provide valuable information on the FMDV serotypes circulating in Afghanistan and their genetic relationship with strains causing FMD in neighboring countries.

Antigenicity analysis of human parvovirus B19-VP1u protein in the induction of anti-phospholipid syndrome.

PubMed

Lin, Chun-Yu; Chiu, Chun-Ching; Cheng, Ju; Lin, Chia-Yun; Shi, Ya-Fang; Tsai, Chun-Chou; Tzang, Bor-Show; Hsu, Tsai-Ching

2018-01-01

Mounting evidence suggests a connection between human parvovirus B19 (B19) and autoimmune diseases, and especially an association between the B19-VP1 unique region (VP1u) and anti-phospholipid syndrome (APS). However, little is known about the antigenicity of B19-VP1u in the induction of APS-like syndrome. To elucidate the antigenicity of B19-VP1u in the induction of APS, N-terminal truncated B19-VP1u (tVP1u) proteins were prepared to immunize Balb/c mice to generate antibodies against B19-tVP1u proteins. The secreted phospholipase A2 (sPLA2) activities and binding specificity of mice anti-B19-tVP1u antibodies with cardiolipin (CL) and beta-2-glycoprotein I (β2GPI) were evaluated by performing immunoblot, ELISA and absorption experiments. A mice model of passively induced APS was adopted. Although sPLA2 activities were identified in all B19-tVP1u proteins, only amino acid residues 61-227 B19-tVP1u exhibited a higher sPLA2 activity. Autoantibodies against CL and β2GPI exhibited binding activities with all B19-tVP1u proteins. IgG that was purified from mice that had been immunized with amino acid residues 21-227 to 121-227 B19-tVP1u proteins exhibited significantly higher binding activity with CL. IgG that was purified from mice that had been immunized with amino acid residues 21-227, 31-227, 82-227 and 91-227 B19-tVP1u proteins exhibited significantly higher binding activity with β2GPI. Accordingly, significantly higher binding inhibition of CL was detected in the presence of amino acid residues 61-227 and 101-227 B19-tVP1u. Significantly higher binding inhibition of β2GPI was detected in the presence of amino acid residues 21-227, 31-227, 82-227 and 91-227 B19-tVP1u. The mice that received amino acid residues 31-227 or 61-227 anti-tB19-VP1u IgG revealed significant thrombocytopenia and those that received amino acid residues 21-227, 31-227, 61-227, 71-227, 82-227, 91-227, 101-227 or 114-227 anti-tB19-VP1u IgG exhibited significantly prolonged aPTT. These findings provide further information concerning the role of B19-VP1u antigenicity in APS-like autoimmunity.

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

PubMed

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Ancient DNA sequence revealed by error-correcting codes.

PubMed

Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

2015-07-10

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

Ancient DNA sequence revealed by error-correcting codes

PubMed Central

Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

2015-01-01

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

Predominance of G9P[8] rotavirus strains throughout France, 2014-2017.

PubMed

Kaplon, J; Grangier, N; Pillet, S; Minoui-Tran, A; Vabret, A; Wilhelm, N; Prieur, N; Lazrek, M; Alain, S; Mekki, Y; Foulongne, V; Guinard, J; Avettand-Fenoel, V; Schnuriger, A; Beby-Defaux, A; Lagathu, G; Pothier, P; de Rougemont, A

2018-06-01

Group A rotavirus is a major cause of acute gastroenteritis in young children worldwide. A prospective surveillance network has been set up in France to investigate rotavirus infections and to detect the emergence of potentially epidemic strains. From 2014 to 2017, rotavirus-positive stool samples were collected from 2394 children under 5 years old attending the paediatric emergency units of 13 large hospitals. Rotaviruses were genotyped by RT-PCR with regard to their outer capsid proteins VP4 and VP7. Genotyping of 2421 rotaviruses showed that after a marked increase in G9P[8] (32.1%) during the 2014-2015 season, G9P[8] became the predominant genotype during the 2015-2016 and 2016-2017 seasons with detection rates of 64.1% and 77.3%, respectively, whereas G1P[8] were detected at low rates of 16.8% and 6.6%, respectively. Phylogenetic analysis of the partial rotavirus VP7 and VP4 coding genes revealed that all of these G9P [8] strains belonged to the lineage III and the P [8]-3 lineage, respectively, and shared the same genetic background (G9-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1) as did most of previously detected G9P[8] strains and particularly the emerging G9P[8] strains from the 2004-2005 season in France. G9P[8] rotaviruses have become the predominant circulating genotype for the first time since their emergence a decade ago. In the absence of rotavirus immunization programmes in France, our data give an insight into the natural fluctuation of rotavirus genotypes in a non-vaccinated population and provide a base line for a better interpretation of data in European countries with routine rotavirus vaccination. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Two novel bocaparvovirus species identified in wild Himalayan marmots.

PubMed

Ao, Yuanyun; Li, Xiaoyue; Li, Lili; Xie, Xiaolu; Jin, Dong; Yu, Jiemei; Lu, Shan; Duan, Zhaojun

2017-12-01

Bocaparvovirus (BOV) is a genetically diverse group of DNA viruses and a possible cause of respiratory, enteric, and neurological diseases in humans and animals. Here, two highly divergent BOVs (tentatively named as Himalayan marmot BOV, HMBOV1 and HMBOV2) were identified in the livers and feces of wild Himalayan marmots in China, by viral metagenomic analysis. Five of 300 liver samples from Himalayan marmots were positive for HMBOV1 and five of 99 fecal samples from these animals for HMBOV2. Their nearly complete genome sequences are 4,672 and 4,887 nucleotides long, respectively, with a standard genomic organization and containing protein-coding motifs typical for BOVs. Based on their NS1, NP1, and VP1, HMBOV1 and HMBOV2 are most closely related to porcine BOV SX/1-2 (approximately 77.0%/50.0%, 50.0%/53.0%, and 79.0%/54.0% amino acid identity, respectively). Phylogenetic analysis of these three proteins showed that HMBOV1 and HMBOV2 formed two distinctly independent branches in BOVs. According to these results, HMBOV1 and HMBOV2 are two different novel species in the Bocaparvovirus genus. Their identification expands our knowledge of the genetic diversity and evolution of BOVs. Further studies are needed to investigate their potential pathogenicity and their impact on Himalayan marmots and humans.

Molecular characterization of wild-type polioviruses isolated in Greece during the 1996 outbreak in Albania.

PubMed

Kyriakopoulou, Zaharoula; Kottaridi, Christine; Dedepsidis, Evaggelos; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Markoulatos, Panayotis

2006-03-01

During the present study three type 1 poliovirus strains isolated in Greece during the 1996 poliomyelitis outbreak in Albania were retrospectively investigated and determination of their relationship with other epidemic strains isolated in Albania or elsewhere during previous epidemics was attempted. SimPlot analysis revealed that the three Greek strains are the result of a recombination event in the VP2 coding region.

Expression and immunogenic analysis of recombinant polypeptides derived from capsid protein VP1 for developing subunit vaccine material against hepatitis A virus.

PubMed

Jang, Kyoung Ok; Park, Jong-Hwa; Lee, Hyun Ho; Chung, Dae Kyun; Kim, Wonyong; Chung, In Sik

2014-08-01

Three recombinant polypeptides, VP1-His, VP1-3N-His, and 3D2-His, were produced by Escherichia coli expression system. Recombinant VP1-His, VP1-3N-His, and 3D2-His were expressed as bands with molecular weights of 32, 38, and 30 kDa, respectively. These were purified by affinity chromatography using Ni-NTA Fast-flow resin and/or ion-exchange chromatography using DEAE-Sepharose Fast-flow resin. Intraperitoneal immunizations of recombinant polypeptides successfully elicited the productions of VP1-His, VP1-3N-His, and 3D2-His specific IgG antibodies (IgG subclass distribution of IgG1>IgG2a>IgG2b>IgG3) in sera and induced the secretions of cytokines IFN-γ and IL-6 in spleen cells. Sera from recombinant VP1-His-, VP1-3N-His-, and 3D2-His-immunized mice neutralized the propagation of HAV. The highest neutralizing activity was shown in sera from recombinant VP1-3N-His-immunized mice. These results suggest that recombinant VP1-3N-His can be a useful source for developing hepatitis A virus (HAV) subunit vaccine candidates. Copyright © 2014 Elsevier Inc. All rights reserved.

Crustal Fracturing Field and Presence of Fluid as Revealed by Seismic Anisotropy

NASA Astrophysics Data System (ADS)

Pastori, M.; Piccinini, D.; de Gori, P.; Margheriti, L.; Barchi, M. R.; di Bucci, D.

2010-12-01

In the last three years, we developed, tested and improved an automatic analysis code (Anisomat+) to calculate the shear wave splitting parameters, fast polarization direction (φ) and delay time (∂t). The code is a set of MatLab scripts able to retrieve crustal anisotropy parameters from three-component seismic recording of local earthquakes using horizontal component cross-correlation method. The analysis procedure consists in choosing an appropriate frequency range, that better highlights the signal containing the shear waves, and a length of time window on the seismogram centered on the S arrival (the temporal window contains at least one cycle of S wave). The code was compared to other two automatic analysis code (SPY and SHEBA) and tested on three Italian areas (Val d’Agri, Tiber Valley and L’Aquila surrounding) along the Apennine mountains. For each region we used the anisotropic parameters resulting from the automatic computation as a tool to determine the fracture field geometries connected with the active stress field. We compare the temporal variations of anisotropic parameters to the evolution of vp/vs ratio for the same seismicity. The anisotropic fast directions are used to define the active stress field (EDA model), finding a general consistence between fast direction and main stress indicators (focal mechanism and borehole break-out). The magnitude of delay time is used to define the fracture field intensity finding higher value in the volume where micro-seismicity occurs. Furthermore we studied temporal variations of anisotropic parameters and vp/vs ratio in order to explain if fluids play an important role in the earthquake generation process. The close association of anisotropic and vp/vs parameters variations and seismicity rate changes supports the hypothesis that the background seismicity is influenced by the fluctuation of pore fluid pressure in the rocks.

Assessment of polarization effect on aerosol retrievals from MODIS

NASA Astrophysics Data System (ADS)

Korkin, S.; Lyapustin, A.

2010-12-01

Light polarization affects the total intensity of scattered radiation. In this work, we compare aerosol retrievals performed by code MAIAC [1] with and without taking polarization into account. The MAIAC retrievals are based on the look-up tables (LUT). For this work, MAIAC was run using two different LUTs, the first one generated using the scalar code SHARM [2], and the second one generated with the vector code Modified Vector Discrete Ordinates Method (MVDOM). MVDOM is a new code suitable for computations with highly anisotropic phase functions, including cirrus clouds and snow [3]. To this end, the solution of the vector radiative transfer equation (VRTE) is represented as a sum of anisotropic and regular components. The anisotropic component is evaluated in the Small Angle Modification of the Spherical Harmonics Method (MSH) [4]. The MSH is formulated in the frame of reference of the solar beam where z-axis lies along the solar beam direction. In this case, the MSH solution for anisotropic part is nearly symmetric in azimuth, and is computed analytically. In scalar case, this solution coincides with the Goudsmit-Saunderson small-angle approximation [5]. To correct for an analytical separation of the anisotropic part of the signal, the transfer equation for the regular part contains a correction source function term [6]. Several examples of polarization impact on aerosol retrievals over different surface types will be presented. 1. Lyapustin A., Wang Y., Laszlo I., Kahn R., Korkin S., Remer L., Levy R., and Reid J. S. Multi-Angle Implementation of Atmospheric Correction (MAIAC): Part 2. Aerosol Algorithm. J. Geophys. Res., submitted (2010). 2. Lyapustin A., Muldashev T., Wang Y. Code SHARM: fast and accurate radiative transfer over spatially variable anisotropic surfaces. In: Light Scattering Reviews 5. Chichester: Springer, 205 - 247 (2010). 3. Budak, V.P., Korkin S.V. On the solution of a vectorial radiative transfer equation in an arbitrary three-dimensional turbid medium with anisotropic scattering. JQSRT, 109, 220-234 (2008). 4. Budak V.P., Sarmin S.E. Solution of radiative transfer equation by the method of spherical harmonics in the small angle modification. Atmospheric and Oceanic Optics, 3, 898-903 (1990). 5. Goudsmit S., Saunderson J.L. Multiple scattering of electrons. Phys. Rev., 57, 24-29 (1940). 6. Budak V.P, Klyuykov D.A., Korkin S.V. Convergence acceleration of radiative transfer equation solution at strongly anisotropic scattering. In: Light Scattering Reviews 5. Chichester: Springer, 147 - 204 (2010).

Nonlinear Propagation of Sound in Recently Settled Flocculated Sediments

NASA Astrophysics Data System (ADS)

Reed, A. H.; Sanders, W. M.

2016-12-01

Cohesive sediments undergo changes in a whirlwind. Dumped out of the river and into the estuary, they get bathed in salty water and subject to turbulent motion. During this sequence of events, the clay particles form clay aggregates of larger size with higher settling rates than the clay particles. Once the flocs have settled, cohesive sediments may form a sediment deposit of mud. Our interest is in the factors that control the development of soundspeed within these muds. This paper addresses organic matter influences on floc aggregation and settling rates. In laboratory studies, organic matter type differed in mixtures with either bentonite or kaolinite clays. The organic matter types used were guar gum, a net positive biopolymer, and xanthan gum, a net negative biopolymer derived from bacterial exudates, similar to those commonly found in estuaries. These biopolymers were dissolved into low salinity water (0-10 ppt). The biopolymer mixture was degassed and during the degassing process, either bentonite or kaolinite clay was added to the vessel. Surprisingly, different settling rates occurred in the clay-biopolymer mixtures. The settling rates of the clay-guar mixtures was more rapid (1-2 days) than the settling rate for the clay-xanthan mixtures. While clay-guar consolidated further, clay-xanthan maintained consistency for more than 2 weeks with density slowly increasing during that period. Compressional soundspeed (Vp) measurements were made with depth through the vessel using 0.5 mHz piezoelectric transducers. It was found that Vp in water was similar to that of the clay-xanthan. Vp was the same in the upper 6 cm of mud as it was in the overlying water and Vp decreased to become slower with increasing depth. Compressional wave velocity (Vp) also changed slightly with the guar complexes below the sediment water interface to the depth of the vessel. Vp was slightly slower in the mud than in the water column. Vp of the water was 1480-1495 m/s whereas Vp within the clay-biopolymer was below the minimum Vp in the water column. This slight decrease in Vp with depth is consistent for that of naturally occurring surficial mud deposits. This work suggests that organic matter type can play a critical role in the rate of consolidation within a mud deposit, which has implications for mud strength development and transport potential.

Marburg Virus VP24 Protein Relieves Suppression of the NF-κB Pathway Through Interaction With Kelch-like ECH-Associated Protein 1.

PubMed

Edwards, Megan R; Basler, Christopher F

2015-10-01

Marburg virus (MARV) is an emerging zoonotic pathogen that causes hemorrhagic fever. MARV VP24 (mVP24) protein interacts with the host cell protein Kelch-like-ECH-associated protein 1 (Keap1). Keap1 interacts with and promotes the degradation of IκB kinase β (IKKβ), a component of the IκB kinase (IKK) complex that regulates nuclear factor-κB (NF-κB) activity. We studied whether mVP24 could relieve Keap1 repression of the NF-κB pathway. Coimmunoprecipitation assays were used to examine the interaction between Keap1 and IKKβ in the presence of wild-type mVP24 and mutants of mVP24 defective for binding to Keap1. Western blotting was used to determine levels of IKKβ expression in the presence of Keap1 and mVP24. NF-κB promoter-luciferase assays were used to determine the effect of mVP24 on Keap1-induced repression of activity. Expression of wild-type mVP24 disrupted the interaction of IKKβ and Keap1, whereas weakly interacting and noninteracting mVP24 mutants did not disrupt the interaction between Keap1 and IKKβ. The interaction of mVP24 with Keap1 enhanced IKKβ levels in the presence of Keap1. The interaction of mVP24 with Keap1 also relieved Keap1 repression of NF-κB reporter activity. mVP24 can relieve Keap1 repression of the NF-κB pathway through its interaction with Keap1. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Sarcocystis arctica (Apicomplexa: Sarcocystidae): ultrastructural description and its new host record, the Alaskan wolf (Canis lupus).

PubMed

Calero-Bernal, Rafael; Cerqueira-Cézar, Camila K; Verma, Shiv Kumar; Mowery, Joseph; Carmena, David; Beckmen, Kimberlee; Dubey, Jitender P

2016-07-01

Sarcocystis sarcocysts are common in muscles of herbivores but are rare in muscles of carnivores. Here, we report sarcocysts in the muscles of a gray wolf (Canis lupus) from Alaska, USA, for the first time. Sarcocysts extracted from the tongue of the wolf were up to 900 μm long and slender and appeared to have a relatively thin wall by light microscope. By transmission electron microscopy, the sarcocyst wall most closely resembled "type 9c," and had a wavy parasitophorous vacuolar membrane folded as pleomorphic villar protrusions (vp), with anastomoses of tips. The vp and the ground substance (gs) layer were smooth without tubules or granules. The gs was up to 2.0 μm thick. The total width of the wall including vp and the gs was 3.5 μm. The vp were up to 1.5 μm long. Mature sarcocysts contained numerous bradyzoites and few metrocytes. The bradyzoites were 9.5 μm long and 1.5 μm wide, and contained all organelles found in Sarcocystis bradyzoites with at least two rhoptries. Molecular characterization showed the highest identity for 18S rRNA, 28S rRNA, ITS-1, and cox1 sequences of Sarcocystis arctica of the Arctic fox (Vulpes lagopus) from Norway. The ultrastructure of S. arctica from the fox is unknown. Here, we provide ultrastructure of S. arctica from the Alaskan wolf for the first time. The definitive host of S. arctica remains unknown.

The study of the intercellular trafficking of the fusion proteins of herpes simplex virus protein VP22.

PubMed

Xue, Xiaodong; Huang, Jianhua; Wang, Huishan

2014-01-01

Genetic modifications can improve the therapeutic efficacy of mesenchymal stem cell (MSC) transplantation in myocardial infarction. However, so far, the efficiency of MSC modification is very low. Seeking for a more efficient way of MSC modification, we investigated the possibility of employing the intercellular trafficking capacity of the herpes simplex virus type-1 tegument protein VP22 on the enhancement of MSC modification. Plasmids pVP22-myc, pVP22-EGFP, pEGFP-VP22, pVP22-hBcl-xL and phBcl-xL-VP22 were constructed for the expressions of the myc-tagged VP22 and the fusion proteins VP22-EGFP, EGFP-VP22, VP22-hBcl-xL and hBcl-xL-VP22. MSCs were isolated from rat bone marrow and the surface markers were identified by Flowcytometry. COS-1 cells were transfected with the above plasmids and co-cultured with untransfected MSCs, the intercellular transportations of the constructed proteins were studied by immunofluorescence. The solubility of VP22-hBcl-xL and hBcl-xL-VP22 was analyzed by Western blot. VP22-myc could be expressed in and spread between COS-1 cells, which indicates the validity of our VP22 expression construct. Flowcytometry analysis revealed that the isolated MSCs were CD29, CD44, and CD90 positive and were negative for the hematopoietic markers, CD34 and CD45. The co-culturing and immunofluorescence assay showed that VP22-myc, VP22-EGFP and EGFP-VP22 could traffic between COS-1 cells and MSCs, while the evidence of intercellular transportation of VP22-hBcl-xL and hBcl-xL-VP22 was not detected. Western blot analysis showed that VP22-hBcl-xL and hBcl-xL-VP22 were both insoluble in the cell lysate suggesting interactions of the fusion proteins with other cellular components. The intercellular trafficking of VP22-myc, VP22-EGFP and EGFP-VP22 between COS-1 cells and MSCs presents an intriguing prospect in the therapeutic application of VP22 as a delivery vehicle which enhances genetic modifications of MSCs. However, VP22-hBcl-xL and hBcl-xL-VP22 failed to spread between cells, which are due to the insolubility of the fusion protein incurred by interactions with other cellular components.

The Study of the Intercellular Trafficking of the Fusion Proteins of Herpes Simplex Virus Protein VP22

PubMed Central

Xue, Xiaodong; Huang, Jianhua; Wang, Huishan

2014-01-01

Background Genetic modifications can improve the therapeutic efficacy of mesenchymal stem cell (MSC) transplantation in myocardial infarction. However, so far, the efficiency of MSC modification is very low. Seeking for a more efficient way of MSC modification, we investigated the possibility of employing the intercellular trafficking capacity of the herpes simplex virus type-1 tegument protein VP22 on the enhancement of MSC modification. Methods Plasmids pVP22-myc, pVP22-EGFP, pEGFP-VP22, pVP22-hBcl-xL and phBcl-xL-VP22 were constructed for the expressions of the myc-tagged VP22 and the fusion proteins VP22-EGFP, EGFP-VP22, VP22-hBcl-xL and hBcl-xL-VP22. MSCs were isolated from rat bone marrow and the surface markers were identified by Flowcytometry. COS-1 cells were transfected with the above plasmids and co-cultured with untransfected MSCs, the intercellular transportations of the constructed proteins were studied by immunofluorescence. The solubility of VP22-hBcl-xL and hBcl-xL-VP22 was analyzed by Western blot. Results VP22-myc could be expressed in and spread between COS-1 cells, which indicates the validity of our VP22 expression construct. Flowcytometry analysis revealed that the isolated MSCs were CD29, CD44, and CD90 positive and were negative for the hematopoietic markers, CD34 and CD45. The co-culturing and immunofluorescence assay showed that VP22-myc, VP22-EGFP and EGFP-VP22 could traffic between COS-1 cells and MSCs, while the evidence of intercellular transportation of VP22-hBcl-xL and hBcl-xL-VP22 was not detected. Western blot analysis showed that VP22-hBcl-xL and hBcl-xL-VP22 were both insoluble in the cell lysate suggesting interactions of the fusion proteins with other cellular components. Conclusions The intercellular trafficking of VP22-myc, VP22-EGFP and EGFP-VP22 between COS-1 cells and MSCs presents an intriguing prospect in the therapeutic application of VP22 as a delivery vehicle which enhances genetic modifications of MSCs. However, VP22-hBcl-xL and hBcl-xL-VP22 failed to spread between cells, which are due to the insolubility of the fusion protein incurred by interactions with other cellular components. PMID:24955582

Enterovirus Migration Patterns between France and Tunisia.

PubMed

Othman, Ines; Mirand, Audrey; Slama, Ichrak; Mastouri, Maha; Peigue-Lafeuille, Hélène; Aouni, Mahjoub; Bailly, Jean-Luc

2015-01-01

The enterovirus (EV) types echovirus (E-) 5, E-9, and E-18, and coxsackievirus (CV-) A9 are infrequently reported in human diseases and their epidemiologic features are poorly defined. Virus transmission patterns between countries have been estimated with phylogenetic data derived from the 1D/VP1 and 3CD gene sequences of a sample of 74 strains obtained in France (2000-2012) and Tunisia (2011-2013) and from the publicly available sequences. The EV types (E-5, E-9, and E-18) exhibited a lower worldwide genetic diversity (respective number of genogroups: 4, 5, and 3) in comparison to CV-A9 (n = 10). The phylogenetic trees estimated with both 1D/VP1 and 3CD sequence data showed variations in the number of co-circulating lineages over the last 20 years among the four EV types. Despite the low number of genogroups in E-18, the virus exhibited the highest number of recombinant 3CD lineages (n = 10) versus 4 (E-5) to 8 (E-9). The phylogenies provided evidence of multiple transportation events between France and Tunisia involving E-5, E-9, E-18, and CV-A9 strains. Virus spread events between France and 17 other countries in five continents had high probabilities of occurrence as those between Tunisia and two European countries other than France. All transportation events were supported by BF values > 10. Inferring the source of virus transmission from phylogenetic data may provide insights into the patterns of sporadic and epidemic diseases caused by EVs.

Combination of Near Infrared Light-Activated Photodynamic Therapy Mediated by Indocyanine Green with Etoposide to Treat Non-Small-Cell Lung Cancer

PubMed Central

Luo, Ting; Zhang, Qinrong; Lu, Qing-Bin

2017-01-01

Indocyanine green (ICG) has been reported as a potential near-infrared (NIR) photosensitizer for photodynamic therapy (PDT) of cancer. However the application of ICG-mediated PDT is both intrinsically and physiologically limited. Here we report a combination of ICG-PDT with a chemotherapy drug etoposide (VP-16), aiming to enhance the anticancer efficacy, to circumvent limitations of PDT using ICG, and to reduce side effects of VP-16. We found in controlled in vitro cell-based assays that this combination is effective in killing non-small-cell lung cancer cells (NSCLC, A549 cell line). We also found that the combination of ICG-PDT and VP-16 exhibits strong synergy in killing non-small-cell lung cancer cells partially through inducing more DNA double-strand breaks (DSBs), while it has a much weaker synergy in killing human normal cells (GM05757). Furthermore, by studying the treatment sequence dependence and the cytotoxicity of laser-irradiated mixtures of ICG and VP-16, we found that the observed synergy involves direct/indirect reactions between ICG and VP-16. We further propose that there exists an electron transfer reaction between ICG and VP-16 under irradiation. This study therefore shows the anticancer efficacy of ICG-PDT combined with VP-16. These findings suggest that ICG-mediated PDT may be applied in combination with the chemotherapy drug VP-16 to treat some cancers, especially the non-small-cell lung cancer. PMID:28587258

Progress Report for DOE DE-FG03-98ER20317 ''Regulation of the floral homeotic gene AGAMOUS'' Current and Final Funding Period: September 1, 2002, to December 31, 2002

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weigel, D.

2003-03-11

OAK-B135 Results obtained during this funding period: (1) Phylogenetic footprinting of AG regulatory sequences Sequences necessary and sufficient for AGAMOUS (AG) expression in the center of Arabidopsis flowers are located in the second intron, which is about 3 kb in size. This intron contains binding sites for two transcription factors, LEAFY (LFY) and WUSCHEL (WUS), which are direct activators of AG. We used the new method of phylogenetic shadowing to identify new regulatory elements. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested sixmore » of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. (2) Repression of AG by MADS box genes A candidate for repressing AG in the shoot apical meristem has been the MADS box gene FUL, since it is expressed in the shoot apical meristem and since an activated version (FUL:VP16) leads to ectopic AG expression in the shoot apical meristem. However, there is no ectopic AG expression in full single mutants. We therefore started to generate VP16 fusions of several other MADS box genes expressed in the shoot apical meristem, to determine which of these might be candidates for FUL redundant genes. We found that AGL6:VP16 has a similar phenotype as FUL:VP16, suggesting that AGL6 and FUL interact. We are now testing this hypothesis. (3) Two candidate AG regulators, WOW and ULA Because the phylogenetic footprinting project has identified several new candidate regulatory motifs, of which at least one (the CCAATCA motif) has rather strong effects, we had decided to put the analysis of WOW and ULA on hold, and to focus on using the newly identified motifs as tools. We conduct ed yeast one-hybrid screen with two of the conserved motifs, and identified several classes of transcription factors that can interact with them. One of these is encoded by the PAN gene, previously known to be expressed in a domain that overlaps the AG domain, but not known before to regulate AG. (4) New genetic modifiers of AG This part of the project was concluded in the previous funding period.« less

A simplified approach to characterizing a kilovoltage source spectrum for accurate dose computation.

PubMed

Poirier, Yannick; Kouznetsov, Alexei; Tambasco, Mauro

2012-06-01

To investigate and validate the clinical feasibility of using half-value layer (HVL) and peak tube potential (kVp) for characterizing a kilovoltage (kV) source spectrum for the purpose of computing kV x-ray dose accrued from imaging procedures. To use this approach to characterize a Varian® On-Board Imager® (OBI) source and perform experimental validation of a novel in-house hybrid dose computation algorithm for kV x-rays. We characterized the spectrum of an imaging kV x-ray source using the HVL and the kVp as the sole beam quality identifiers using third-party freeware Spektr to generate the spectra. We studied the sensitivity of our dose computation algorithm to uncertainties in the beam's HVL and kVp by systematically varying these spectral parameters. To validate our approach experimentally, we characterized the spectrum of a Varian® OBI system by measuring the HVL using a Farmer-type Capintec ion chamber (0.06 cc) in air and compared dose calculations using our computationally validated in-house kV dose calculation code to measured percent depth-dose and transverse dose profiles for 80, 100, and 125 kVp open beams in a homogeneous phantom and a heterogeneous phantom comprising tissue, lung, and bone equivalent materials. The sensitivity analysis of the beam quality parameters (i.e., HVL, kVp, and field size) on dose computation accuracy shows that typical measurement uncertainties in the HVL and kVp (±0.2 mm Al and ±2 kVp, respectively) source characterization parameters lead to dose computation errors of less than 2%. Furthermore, for an open beam with no added filtration, HVL variations affect dose computation accuracy by less than 1% for a 125 kVp beam when field size is varied from 5 × 5 cm(2) to 40 × 40 cm(2). The central axis depth dose calculations and experimental measurements for the 80, 100, and 125 kVp energies agreed within 2% for the homogeneous and heterogeneous block phantoms, and agreement for the transverse dose profiles was within 6%. The HVL and kVp are sufficient for characterizing a kV x-ray source spectrum for accurate dose computation. As these parameters can be easily and accurately measured, they provide for a clinically feasible approach to characterizing a kV energy spectrum to be used for patient specific x-ray dose computations. Furthermore, these results provide experimental validation of our novel hybrid dose computation algorithm. © 2012 American Association of Physicists in Medicine.

Immunogenicity and protective efficacy of rotavirus VP8* fused to cholera toxin B subunit in a mouse model.

PubMed

Xue, Miaoge; Yu, Linqi; Jia, Lianzhi; Li, Yijian; Zeng, Yuanjun; Li, Tingdong; Ge, Shengxiang; Xia, Ningshao

2016-11-01

In attempts to develop recombinant subunit vaccines against rotavirus disease, it was previously shown that the N-terminal truncated VP8* protein, VP8-1 (aa26-231), is a good vaccine candidate when used for immunization in combination with Freund's adjuvant. However, this protein stimulated only weak immune response when aluminum hydroxide was used as an adjuvant. In this study, the nontoxic B subunit of cholera toxin (CTB) was employed as intra-molecular adjuvant to improve the immunogenicity of VP8-1. Both, the N-terminal and C-terminal fusion proteins, were purified to homogeneity, at which stage they formed pentamers, and showed significantly higher immunogenicity and protective efficacy than a VP8-1/aluminum hydroxide mixture in a mouse model. Compared to VP8-1-CTB, CTB-VP8-1 showed higher binding activity to both, GM1 and the conformation sensitive neutralizing monoclonal antibodies specific to VP8. More importantly, CTB-VP8-1 elicited higher titers of neutralizing antibodies and conferred higher protective efficacy than VP8-1-CTB. Therefore, the protein CTB-VP8-1, with enhanced immunogenicity and immunoprotectivity, could be considered as a viable candidate for further development of an alternative, replication-incompetent, parenterally administered vaccine against rotavirus disease.

No evidence for a role of modified live virus vaccines in the emergence of canine parvovirus.

PubMed

Truyen, U; Geissler, K; Parrish, C R; Hermanns, W; Siegl, G

1998-05-01

In this study the early evolution and potential origins of canine parvovirus (CPV) were examined. We cloned and sequenced the VP2 capsid protein genes of three German CPV strains isolated in 1979-1980, as well as two feline panleukopenia virus (FPV) vaccine viruses that were previously shown to have some restriction enzyme cleavage sites in common with CPV. Other partial VP2 gene sequences were obtained by amplifying CPV DNA from paraffin-embedded tissues of dogs which were early parvovirus disease cases in Germany in 1978-1979. Sequences were analysed with respect to their evolutionary relationships to other CPV and FPV isolates. Those analyses did not support the hypothesis that CPV emerged as a variant of an FPV vaccine virus. Neither did they reveal ancestral sequences among the very early CPV isolates examined. Other possible sources for the origin of CPV are examined, including the involvement of viruses from wild carnivores.

Human parechovirus-3 infection in children, South Korea.

PubMed

Han, Tae-Hee; Chung, Ju-Young; You, Su Jeong; Youn, Jeong-Lim; Shim, Gyu-Hong

2013-09-01

Human parechoviruses (HPeVs) have recently been recognized as important viral pathogens causing sepsis-like illness and meningitis in children, but the data on these infections in Korea is limited. Klassevirus is emerging as a novel etiologic agent of acute gastroenteritis, but its role in meningitis remains unclear. To understand the epidemiology of HPeVs and klassevirus in sepsis-like illness and meningitis through the detection and typing of the virus in cerebrospinal fluid (CSF) samples. One hundred and eighty-three CSF samples collected from 183 patients ranging in the age group 1 day to 15 years were tested by using a RT-PCR assay for HPeV, EV and klassevirus. Amplification products of the VP3/VP1 and 3D region of the HPeV, and VP1 region of the EV were sequenced to identify the type. A total of 12 HPeV positive samples (6.5%) were detected from 183 CSF samples and all the samples were typed as HPeV-3. EVs were detected in 39 patients (21.3%) in which echovirus 25 and CVA6 were frequently detected, but mixed infection of HPeV-3 and EV was not observed. Klassevirus was not detected in the study population. Most of the HPeV-3 positive patients were under 3 months of age. HPeV-3 infection was detected mostly in the summer season. The VP3/VP1 gene of the 12 Korean strains clustered most closely to the Japan strain (AB759192) and the 3D gene of the Korean strains also clustered to the Japan strain, which showed no evidence of recombination. To our knowledge, this is the first report on the detection of HPeV-3 from CSF samples in Korea, which suggests the necessity of routine screening for this virus in young infants with sepsis-like illness and meningitis. Copyright © 2013 Elsevier B.V. All rights reserved.

Cryo-Electron Microscopy Reconstruction Shows Poliovirus 135S Particles Poised for Membrane Interaction and RNA Release

PubMed Central

Butan, Carmen; Filman, David J.

2014-01-01

During infection, binding of mature poliovirus to cell surface receptors induces an irreversible expansion of the capsid, to form an infectious cell-entry intermediate particle that sediments at 135S. In these expanded virions, the major capsid proteins (VP1 to VP3) adopt an altered icosahedral arrangement to open holes in the capsid at 2-fold and quasi-3-fold axes, and internal polypeptides VP4 and the N terminus of VP1, which can bind membranes, become externalized. Cryo-electron microscopy images for 117,330 particles were collected using Leginon and reconstructed using FREALIGN. Improved rigid-body positioning of major capsid proteins established reliably which polypeptide segments become disordered or rearranged. The virus-to-135S transition includes expansion of 4%, rearrangements of the GH loops of VP3 and VP1, and disordering of C-terminal extensions of VP1 and VP2. The N terminus of VP1 rearranges to become externalized near its quasi-3-fold exit, binds to rearranged GH loops of VP3 and VP1, and attaches to the top surface of VP2. These details improve our understanding of subsequent stages of infection, including endocytosis and RNA transfer into the cytoplasm. PMID:24257617

[Prokaryotic expression of vp3 gene of Muscovy duck parvovirus, and its antiserum preparation for detection of virus multiplication].

PubMed

Huang, Yu; Zhu, Yumin; Dong, Shijuan; Yu, Ruisong; Zhang, Yuanshu; Li, Zhen

2015-01-01

New epidemic broke out in recent year which was suspected to be caused by variant Muscovy duck parvovirus (MDPV). For this reason, new MDPV detection methods are needed for the new virus strains. In this study, a pair of primers were designed according to the full-length genome of MDPV strain SAAS-SHNH, which were identified in 2012, and were used to amplify the vp3 gene of MDPV by polymerase chain reaction. After being sequenced, the vp3 gene was subcloned into the prokaryotic expression vector PET28a. The recombinant plasmid was transformed into E. coli BL21 and induced with IPTG. SDS-PAGE and Western blotting analysis showed the MDPV vp3 gene was successfully expressed. After being purified by Ni2+ affinity chromatography system, the recombinant protein was used as antigen to immunize rabbits to obtain antiserum. Western blotting analysis showed that the acquired antiserum could react specifically with VP3 protein of J3D6 strain and MDPV vaccine strain. The antiserum could also be used for detection of cultured MDPV from primary duck embryo fibroblasts by immune fluorescence assay (IFA). It could be concluded that the VP3 protein and its antibody prepared in the research could be used for detection of VP3 antiserum and antigen respectively.

A gyrovirus infecting a sea bird

PubMed Central

Li, Linlin; Pesavento, Patricia A.; Gaynor, Anne M.; Duerr, Rebecca S.; Phan, Tung Gia; Zhang, Wen; Deng, Xutao

2015-01-01

We characterized the genome of a highly divergent gyrovirus (GyV8) in the spleen and uropygial gland tissues of a diseased northern fulmar (Fulmarus glacialis), a pelagic bird beached in San Francisco, California. No other exogenous viral sequences could be identified using viral metagenomics. The small circular DNA genome shared no significant nucleotide sequence identity, and only 38–42 % amino acid sequence identity in VP1, with any of the previously identified gyroviruses. GyV8 is the first member of the third major phylogenetic clade of this viral genus and the first gyrovirus detected in an avian species other than chicken. PMID:26036564

Ubiquitin Ligase WWP1 Interacts with Ebola Virus VP40 To Regulate Egress.

PubMed

Han, Ziying; Sagum, Cari A; Takizawa, Fumio; Ruthel, Gordon; Berry, Corbett T; Kong, Jing; Sunyer, J Oriol; Freedman, Bruce D; Bedford, Mark T; Sidhu, Sachdev S; Sudol, Marius; Harty, Ronald N

2017-10-15

Ebola virus (EBOV) is a member of the Filoviridae family and the cause of hemorrhagic fever outbreaks. The EBOV VP40 (eVP40) matrix protein is the main driving force for virion assembly and budding. Indeed, expression of eVP40 alone in mammalian cells results in the formation and budding of virus-like particles (VLPs) which mimic the budding process and morphology of authentic, infectious EBOV. To complete the budding process, eVP40 utilizes its PPXY L-domain motif to recruit a specific subset of host proteins containing one or more modular WW domains that then function to facilitate efficient production and release of eVP40 VLPs. In this report, we identified additional host WW-domain interactors by screening for potential interactions between mammalian proteins possessing one or more WW domains and WT or PPXY mutant peptides of eVP40. We identified the HECT family E3 ubiquitin ligase WWP1 and all four of its WW domains as strong interactors with the PPXY motif of eVP40. The eVP40-WWP1 interaction was confirmed by both peptide pulldown and coimmunoprecipitation assays, which also demonstrated that modular WW domain 1 of WWP1 was most critical for binding to eVP40. Importantly, the eVP40-WWP1 interaction was found to be biologically relevant for VLP budding since (i) small interfering RNA (siRNA) knockdown of endogenous WWP1 resulted in inhibition of eVP40 VLP egress, (ii) coexpression of WWP1 and eVP40 resulted in ubiquitination of eVP40 and a subsequent increase in eVP40 VLP egress, and (iii) an enzymatically inactive mutant of WWP1 (C890A) did not ubiquitinate eVP40 or enhance eVP40 VLP egress. Last, our data show that ubiquitination of eVP40 by WWP1 enhances egress of VLPs and concomitantly decreases cellular levels of higher-molecular-weight oligomers of eVP40. In sum, these findings contribute to our fundamental understanding of the functional interplay between host E3 ligases, ubiquitination, and regulation of EBOV VP40-mediated egress. IMPORTANCE Ebola virus (EBOV) is a high-priority, emerging human pathogen that can cause severe outbreaks of hemorrhagic fever with high mortality rates. As there are currently no approved vaccines or treatments for EBOV, a better understanding of the biology and functions of EBOV-host interactions that promote or inhibit viral budding is warranted. Here, we describe a physical and functional interaction between EBOV VP40 (eVP40) and WWP1, a host E3 ubiquitin ligase that ubiquitinates VP40 and regulates VLP egress. This viral PPXY-host WW domain-mediated interaction represents a potential new target for host-oriented inhibitors of EBOV egress. Copyright © 2017 American Society for Microbiology.

Structural Protein VP2 of African Horse Sickness Virus Is Not Essential for Virus Replication In Vitro

PubMed Central

van de Water, Sandra G. P.; Potgieter, Christiaan A.; van Rijn, Piet A.

2016-01-01

ABSTRACT The Reoviridae family consists of nonenveloped multilayered viruses with a double-stranded RNA genome consisting of 9 to 12 genome segments. The Orbivirus genus of the Reoviridae family contains African horse sickness virus (AHSV), bluetongue virus, and epizootic hemorrhagic disease virus, which cause notifiable diseases and are spread by biting Culicoides species. Here, we used reverse genetics for AHSV to study the role of outer capsid protein VP2, encoded by genome segment 2 (Seg-2). Expansion of a previously found deletion in Seg-2 indicates that structural protein VP2 of AHSV is not essential for virus replication in vitro. In addition, in-frame replacement of RNA sequences in Seg-2 by that of green fluorescence protein (GFP) resulted in AHSV expressing GFP, which further confirmed that VP2 is not essential for virus replication. In contrast to virus replication without VP2 expression in mammalian cells, virus replication in insect cells was strongly reduced, and virus release from insect cells was completely abolished. Further, the other outer capsid protein, VP5, was not copurified with virions for virus mutants without VP2 expression. AHSV without VP5 expression, however, could not be recovered, indicating that outer capsid protein VP5 is essential for virus replication in vitro. Our results demonstrate for the first time that a structural viral protein is not essential for orbivirus replication in vitro, which opens new possibilities for research on other members of the Reoviridae family. IMPORTANCE Members of the Reoviridae family cause major health problems worldwide, ranging from lethal diarrhea caused by rotavirus in humans to economic losses in livestock production caused by different orbiviruses. The Orbivirus genus contains many virus species, of which bluetongue virus, epizootic hemorrhagic disease virus, and African horse sickness virus (AHSV) cause notifiable diseases according to the World Organization of Animal Health. Recently, it has been shown that nonstructural proteins NS3/NS3a and NS4 are not essential for virus replication in vitro, whereas it is generally assumed that structural proteins VP1 to -7 of these nonenveloped, architecturally complex virus particles are essential. Here we demonstrate for the first time that structural protein VP2 of AHSV is not essential for virus replication in vitro. Our findings are very important for virologists working in the field of nonenveloped viruses, in particular reoviruses. PMID:27903804

Enhancement of VP6 immunogenicity and protective efficacy against rotavirus by VP2 in a genetic immunization.

PubMed

Lopez-Guerrero, D V; Arias, N; Gutierrez-Xicotencatl, L; Chihu-Amparan, L; González, A; Pedroza-Saavedra, A; Rosas-Salgado, G; Villegas-Garcia, J C; Badillo-Godinez, O; Fernandez, G; Lopez, S; Esquivel-Guadarrama, F

2018-05-24

VP2/VP6 virus like particles (VLPs) are very effective in inducing protection against the rotavirus infection in animal models. Individually, VP6 can also induce protection. However, there is no information about the immunogenicity of VP2. The aim of this work was to evaluate the efficacy of DNA vaccines codifying for VP2 or VP6, alone or combined, to induce protection against the rotavirus infection. Murine rotavirus VP2 and VP6 genes were cloned into the pcDNA3 vector. Adult BALB/c mice were inoculated three times by intramuscular (i.m.) injections with 100 or 200µg of pcDNA3-VP2 or pcDNA3-VP6 alone or co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6. Two weeks after the last inoculation, mice were challenged with the wild type murine rotavirus strain epizootic diarrhea of infant mice (EDIM wt ). We found that both plasmids, pcDNA3-VP2 and pcDNA3-VP6, were able to induce rotavirus-specific serum antibodies, but not intestinal rotavirus-specific IgA; only 200µg of pcDNA3-VP6 induced 35% protection against the infection. A similar level of protection was found when mice were co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:1 ratio). However, the best protection (up to 58%) occurred when mice were inoculated with 10µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:10 ratio). These results indicate that the DNA plasmid expressing VP6 is a better vaccine candidate that the one expressing VP2. However, when co-expressed, VP2 potentiates the immunogenicity and protective efficacy of VP6. Copyright © 2017. Published by Elsevier Ltd.

Phylodynamic reconstruction of O CATHAY topotype foot-and-mouth disease virus epidemics in the Philippines.

PubMed

Di Nardo, Antonello; Knowles, Nick J; Wadsworth, Jemma; Haydon, Daniel T; King, Donald P

2014-08-24

Reconstructing the evolutionary history, demographic signal and dispersal processes from viral genome sequences contributes to our understanding of the epidemiological dynamics underlying epizootic events. In this study, a Bayesian phylogenetic framework was used to explore the phylodynamics and spatio-temporal dispersion of the O CATHAY topotype of foot-and-mouth disease virus (FMDV) that caused epidemics in the Philippines between 1994 and 2005. Sequences of the FMDV genome encoding the VP1 showed that the O CATHAY FMD epizootic in the Philippines resulted from a single introduction and was characterised by three main transmission hubs in Rizal, Bulacan and Manila Provinces. From a wider regional perspective, phylogenetic reconstruction of all available O CATHAY VP1 nucleotide sequences identified three distinct sub-lineages associated with country-based clusters originating in Hong Kong Special Administrative Region (SAR), the Philippines and Taiwan. The root of this phylogenetic tree was located in Hong Kong SAR, representing the most likely source for the introduction of this lineage into the Philippines and Taiwan. The reconstructed O CATHAY phylodynamics revealed three chronologically distinct evolutionary phases, culminating in a reduction in viral diversity over the final 10 years. The analysis suggests that viruses from the O CATHAY topotype have been continually maintained within swine industries close to Hong Kong SAR, following the extinction of virus lineages from the Philippines and the reduced number of FMD cases in Taiwan.

Recombinant VP1 protein of duck hepatitis virus 1 expressed in Pichia pastoris and its immunogenicity in ducks.

PubMed

Wang, C; Li, X K; Wu, T C; Wang, Y; Zhang, C J; Cheng, X C; Chen, P Y

2014-01-01

The VP1 gene of duck hepatitis virus type 1 (DHV-1) strain VJ09 was amplified by reverse transcription PCR from the liver of a duckling with clinical symptoms of viral hepatitis. The resulting VP1 cDNA was 720 bp in length and encoded a 240-amino-acid protein. In VP1 gene-based phylogenetic analysis, the VJ09 strain grouped with DHV-1 genotype C. The VP1 gene was inserted into the expression vector pPICZαA and expressed in Pichia pastoris. The expressed VP1 protein was purified and identified by western blot analysis. To evaluate the recombinant VP1's immunogenic potential in ducklings, the antibodies raised in the immunized ducklings were titrated by ELISA, and lymphocyte proliferation and virus neutralization assays were performed. The results show that the recombinant VP1 protein induced a significant immune response in ducklings and this could be a candidate for the development of a subunit vaccine against DHV-1 genotype C.

Human Bocavirus in Korean Children with Gastroenteritis and Respiratory Tract Infections.

PubMed

Lee, Eun Jin; Kim, Han-Sung; Kim, Hyun Soo; Kim, Jae-Seok; Song, Wonkeun; Kim, MiYoung; Lee, Young Kyung; Kang, Hee Jung

2016-01-01

Human bocaviruses (HBoVs) are suggested to be etiologic agents of childhood respiratory and gastrointestinal infections. There are four main recognized genotypes of HBoVs (HBoV1-4); the HBoV-1 genotype is considered to be the primary etiologic agent in respiratory infections, whereas the HBoV2-4 genotypes have been mainly associated with gastrointestinal infections. The aim of the present study was to determine the distribution of HBoV genotypes in children with respiratory or gastrointestinal infections in a hospital in Korea. A total of 662 nasopharyngeal swabs (NPSs) and 155 fecal specimens were collected from children aged 5 years or less. Polymerase chain reaction (PCR) was conducted to detect the NS1 HBoV gene. The VP1 gene of HBoV was further amplified in samples that were positive for the NS1 gene. The PCR products of VP1 gene amplification were genotyped by sequence analysis. HBoV was detected in 69 (14.5%) of 662 NPSs and in 10 (6.5%) of 155 fecal specimens. Thirty-three isolates from NPSs and five isolates from fecal specimens were genotyped, and all 38 sequenced isolates were identified as the HBoV-1 genotype. HBoV-1 is the most prevalent genotype in children with respiratory or gastrointestinal HBoV infections in a hospital in Korea.

Human Bocavirus in Korean Children with Gastroenteritis and Respiratory Tract Infections

PubMed Central

Lee, Eun Jin; Kim, Jae-Seok; Song, Wonkeun; Kim, MiYoung; Lee, Young Kyung

2016-01-01

Human bocaviruses (HBoVs) are suggested to be etiologic agents of childhood respiratory and gastrointestinal infections. There are four main recognized genotypes of HBoVs (HBoV1–4); the HBoV-1 genotype is considered to be the primary etiologic agent in respiratory infections, whereas the HBoV2–4 genotypes have been mainly associated with gastrointestinal infections. The aim of the present study was to determine the distribution of HBoV genotypes in children with respiratory or gastrointestinal infections in a hospital in Korea. A total of 662 nasopharyngeal swabs (NPSs) and 155 fecal specimens were collected from children aged 5 years or less. Polymerase chain reaction (PCR) was conducted to detect the NS1 HBoV gene. The VP1 gene of HBoV was further amplified in samples that were positive for the NS1 gene. The PCR products of VP1 gene amplification were genotyped by sequence analysis. HBoV was detected in 69 (14.5%) of 662 NPSs and in 10 (6.5%) of 155 fecal specimens. Thirty-three isolates from NPSs and five isolates from fecal specimens were genotyped, and all 38 sequenced isolates were identified as the HBoV-1 genotype. HBoV-1 is the most prevalent genotype in children with respiratory or gastrointestinal HBoV infections in a hospital in Korea. PMID:27990436

Visual pattern image sequence coding

NASA Technical Reports Server (NTRS)

Silsbee, Peter; Bovik, Alan C.; Chen, Dapang

1990-01-01

The visual pattern image coding (VPIC) configurable digital image-coding process is capable of coding with visual fidelity comparable to the best available techniques, at compressions which (at 30-40:1) exceed all other technologies. These capabilities are associated with unprecedented coding efficiencies; coding and decoding operations are entirely linear with respect to image size and entail a complexity that is 1-2 orders of magnitude faster than any previous high-compression technique. The visual pattern image sequence coding to which attention is presently given exploits all the advantages of the static VPIC in the reduction of information from an additional, temporal dimension, to achieve unprecedented image sequence coding performance.

Live Attenuated Vaccine Based on Duck Enteritis Virus against Duck Hepatitis A Virus Types 1 and 3

PubMed Central

Zou, Zhong; Ma, Ji; Huang, Kun; Chen, Huanchun; Liu, Ziduo; Jin, Meilin

2016-01-01

As causative agents of duck viral hepatitis, duck hepatitis A virus type 1 (DHAV-1) and type 3 (DHAV-3) causes significant economic losses in the duck industry. However, a licensed commercial vaccine that simultaneously controls both pathogens is currently unavailable. Here, we generated duck enteritis virus recombinants (rC-KCE-2VP1) containing both VP1 from DHAV-1 (VP1/DHAV-1) and VP1 from DHAV-3 (VP1/DHAV-3) between UL27 and UL26. A self-cleaving 2A-element of FMDV was inserted between the two different types of VP1, allowing production of both proteins from a single open reading frame. Immunofluorescence and Western blot analysis results demonstrated that both VP1 proteins were robustly expressed in rC-KCE-2VP1-infected chicken embryo fibroblasts. Ducks that received a single dose of rC-KCE-2VP1 showed potent humoral and cellular immune responses and were completely protected against challenges of both pathogenic DHAV-1 and DHAV-3 strains. The protection was rapid, achieved as early as 3 days after vaccination. Moreover, viral replication was fully blocked in vaccinated ducks as early as 1 week post-vaccination. These results demonstrated, for the first time, that recombinant rC-KCE-2VP1 is potential fast-acting vaccine against DHAV-1 and DHAV-3. PMID:27777571

The oncogenic potential of BK-polyomavirus is linked to viral integration into the human genome.

PubMed

Kenan, Daniel J; Mieczkowski, Piotr A; Burger-Calderon, Raquel; Singh, Harsharan K; Nickeleit, Volker

2015-11-01

It has been suggested that BK-polyomavirus is linked to oncogenesis via high expression levels of large T-antigen in some urothelial neoplasms arising following kidney transplantation. However, a causal association between BK-polyomavirus, large T-antigen expression and oncogenesis has never been demonstrated in humans. Here we describe an investigation using high-throughput sequencing of tumour DNA obtained from an urothelial carcinoma arising in a renal allograft. We show that a novel BK-polyomavirus strain, named CH-1, is integrated into exon 26 of the myosin-binding protein C1 gene (MYBPC1) on chromosome 12 in tumour cells but not in normal renal cells. Integration of the BK-polyomavirus results in a number of discrete alterations in viral gene expression, including: (a) disruption of VP1 protein expression and robust expression of large T-antigen; (b) preclusion of viral replication; and (c) deletions in the non-coding control region (NCCR), with presumed alterations in promoter feedback loops. Viral integration disrupts one MYBPC1 gene copy and likely alters its expression. Circular episomal BK-polyomavirus gene sequences are not found, and the renal allograft shows no productive polyomavirus infection or polyomavirus nephropathy. These findings support the hypothesis that integration of polyomaviruses is essential to tumourigenesis. It is likely that dysregulation of large T-antigen, with persistent over-expression in non-lytic cells, promotes cell growth, genetic instability and neoplastic transformation. © 2015 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

Canine Parvovirus Types 2c and 2b Circulating in North American Dogs in 2006 and 2007▿

PubMed Central

Kapil, Sanjay; Cooper, Emily; Lamm, Cathy; Murray, Brandy; Rezabek, Grant; Johnston, Larry; Campbell, Gregory; Johnson, Bill

2007-01-01

Parvovirus is the most common viral cause of diarrhea in young puppies. Based on the analysis of a partial VP2 sequence of 54 samples, canine parvovirus type 2c (CPV-2c) (n = 26), CPV-2b (n = 25), and CPV-2 (n = 3) were detected in the United States. The American CPV-2b isolates have unique codons (494 and 572) in VP2. PMID:17928423

[Indirect ELISA for simultaneous detection of antibodies against duck hepatitis A type 1 and 3 viruses].

PubMed

Zhang, Yuyao; Ma, Xiuli; Huang, Bing; Li, Yufeng; Yu, Kexiang; Li, Jianliang; Liu, Cunxia; Han, Hongyu; Cui, Yanshun

2015-04-04

To simultaneously detect antibodies against Duck hepatitis A type 1 (DHAV-1) and type 3 (DHAV-3) viruses, we developed an indirect enzyme-linked immunosobent assay (ELISA) with bacterially expressed recombinant viral protein as antigen in Escherichia coli. We amplified the full-length VP3 gene of DHAV-1 and the full-length VP1 gene of DHAV-3 through reverse transcription-polymerase chain reaction (RT-PCR) and then cloned them into pET-32a expression vector, designated as pET-1VP3-3VP1. The fusion protein DHAV-1VP3-3VP1 expressed correctly and was subsequently used to develop an indirect ELISA assay. DHAV-1VP3-3VP1 fusion protein expressed in BL21 (DE3) cells following induction by Isopropyl-beta-D-1-thiogalactopyranoside (IPTG). The expressed protein was very antigenic and reactive to virus-specific antibodies in western blot assay. The optimal working concentration for coating antigen was 1.0 microg per well and the working concentration of serum samples was 1:200 dilution and the cut-off value that distinguished the positive from negative serum samples was OD650 > OR = 0.38. The ELISA method based on the prokaryotic expression of VP3 (DHAV-1) and VP1 proteins (DHAV-3) can be used effectively for the clinical detection antibodies against DHAV-1 and DHAV-3.

Changes in the microbiota of lamb packaged in a vacuum and in modified atmospheres during chilled storage analysed by high-throughput sequencing.

PubMed

Wang, Taojun; Zhao, Liang; Sun, Yanan; Ren, Fazheng; Chen, Shanbin; Zhang, Hao; Guo, Huiyuan

2016-11-01

Changes in the microbiota of lamb were investigated under vacuum packaging (VP) and under 20% CO2/80% N2 (LC), 60% CO2/40% N2 (MC), and 100% CO2 (HC) modified atmosphere packaging (MAP) during chilled storage. Viable counts were monitored, and the total microbial communities were assessed by high-throughput sequencing. The starting community had the highest microbial diversity, after which Lactococcus and Carnobacterium spp. outcompeted during the 28-day storage. The relative abundances of Brochothrix spp. in the LC atmosphere were much higher than those of the other groups on days 7 and 28. The bacterial inhibiting effect of the MAP environments on microbial growth was positively correlated with the CO2 concentration. The HC atmosphere inhibited microbial growth and delayed changes in the microbial community composition, extending the lamb's shelf life by approximately 7days compared with the VP atmosphere. Lamb packaged in the VP atmosphere had a more desirable colour but a higher weight loss than lamb packaged in the MAP atmospheres. Copyright © 2016 Elsevier Ltd. All rights reserved.

Interaction of the Mouse Polyomavirus Capsid Proteins with Importins Is Required for Efficient Import of Viral DNA into the Cell Nucleus.

PubMed

Soldatova, Irina; Prilepskaja, Terezie; Abrahamyan, Levon; Forstová, Jitka; Huérfano, Sandra

2018-03-31

The mechanism used by mouse polyomavirus (MPyV) overcomes the crowded cytosol to reach the nucleus has not been fully elucidated. Here, we investigated the involvement of importin α/β1 mediated transport in the delivery of MPyV genomes into the nucleus. Interactions of the virus with importin β1 were studied by co-immunoprecipitation and proximity ligation assay. For infectivity and nucleus delivery assays, the virus and its capsid proteins mutated in the nuclear localization signals (NLSs) were prepared and produced. We found that at early times post infection, virions bound importin β1 in a time dependent manner with a peak of interactions at 6 h post infection. Mutation analysis revealed that only when the NLSs of both VP1 and VP2/3 were disrupted, virus did not bind efficiently to importin β1 and its infectivity remarkably decreased (by 80%). Nuclear targeting of capsid proteins was improved when VP1 and VP2 were co-expressed. VP1 and VP2 were effectively delivered into the nucleus, even when one of the NLS, either VP1 or VP2, was disrupted. Altogether, our results showed that MPyV virions can use VP1 and/or VP2/VP3 NLSs in concert or individually to bind importins to deliver their genomes into the cell nucleus.

Wide Angle Converted Shear Wave Analysis of North Atlantic Volcanic Rifted Continental Margins

NASA Astrophysics Data System (ADS)

Eccles, J. D.; White, R. S.; Christie, P. A.

2007-12-01

High-quality, wide-angle, ocean bottom seismometer (OBS) data have been acquired with a low frequency (9 Hz) seismic source across the Faroes and Hatton Bank volcanic rifted continental margins in the North Atlantic. In these regions thick Tertiary flood basalt sequences provide a challenge to deep seismic imaging. S-wave arrivals, which are dominantly converted from P- to S-waves at the sediment-top basalt interface, were recorded at 170 4-component OBS locations. Variation in the conversion efficiency was observed along the profiles. Tomographic inversion of over 70,000 converted S-wave crustal diving waves and Moho reflections was performed to produce S-wave velocity models and hence, when combined with pre-existing P-wave velocity models, a measure of the Vp/Vs ratio structure of the crust. Resolution testing shows the structure of the oceanic crust and continent-ocean transition is generally well resolved on both profiles. Lateral and vertical changes in Vp/Vs resolves changing crustal composition within, and between, oceanic and continental crust, including regions in the lower crust at the continent-ocean transition with high P-wave velocities of up to 7.5 km/s and low Vp/Vs ratios of ~ 1.75 associated with intense high-temperature intrusion at the time of break-up. Vp/Vs ratios of 1.75-1.80 at the base of the thickened oceanic crust are also lower than generally reported in normal oceanic crust. The P-wave travel-time tomography revealed a low velocity zone (LVZ) beneath the basalt on the Faroes margin and additional constraint on the Vp/Vs of the LVZ beneath the Fugloy Ridge has been gained by analysing the relative travel-time delays between basalt and basement refractions for P- and S-waves. This approach is less subject to the velocity-depth ambiguity associated with velocity inversions than is the determination of P- or S- wave velocity alone. Comparison of the calculated Vp/Vs ratio and P-wave velocity with measurements from relevant lithologies reveals that the LVZ is likely to contain sill-intruded Paleocene sedimentary rock rather than igneous hyaloclastites similar to those found beneath the basalt in a nearby well. Immediately beneath the LVZ, a unit with Vp/Vs ratios of 1.80-1.85 and P-wave velocities of 5.5-6.0 km/s is interpreted as sill-intruded sedimentary rock of a pre-breakup Mesozoic basin. We thank C.J. Parkin, A.W. Roberts and L.K. Smith for their contributions.

Expression and characterization of highly antigenic domains of chicken anemia virus viral VP2 and VP3 subunit proteins in a recombinant E. coli for sero-diagnostic applications

PubMed Central

2013-01-01

Background Chicken anemia virus (CAV) is an important viral pathogen that causes anemia and severe immunodeficiency syndrome in chickens worldwide. Generally, CAV infection occurs via vertical transmission in young chicks that are less than two weeks old, which are very susceptible to the disease. Therefore, epidemiological investigations of CAV infection and/or the evaluation of the immunization status of chickens is necessary for disease control. Up to the present, systematically assessing viral protein antigenicity and/or determining the immunorelevant domain(s) of viral proteins during serological testing for CAV infection has never been performed. The expression, production and antigenic characterization of CAV viral proteins such as VP1, VP2 and VP3, and their use in the development of diagnostic kit would be useful for CAV infection prevention. Results Three CAV viral proteins VP1, VP2 and VP3 was separately cloned and expressed in recombinant E. coli. The purified recombinant CAV VP1, VP2 and VP3 proteins were then used as antigens in order to evaluate their reactivity against chicken sera using indirect ELISA. The results indicated that VP2 and VP3 show good immunoreactivity with CAV-positive chicken sera, whereas VP1 was found to show less immunoreactivity than VP2 and VP3. To carry out the further antigenic characterization of the immunorelevant domains of the VP2 and VP3 proteins, five recombinant VP2 subunit proteins (VP2-435N, VP2-396N, VP2-345N, VP2-171C and VP2-318C) and three recombinant VP3 subunit proteins (VP3-123N, VP3-246M, VP3-366C), spanning the defined regions of VP2 and VP3 were separately produced by an E. coli expression system. These peptides were then used as antigens in indirect ELISAs against chicken sera. The results of these ELISAs using truncated recombinant VP2 and VP3 subunit proteins as coating antigen showed that VP2-345N, VP2-396N and VP3-246M gave good immunoreactivity with CAV-positive chicken sera compared to the other subunit proteins. Moreover, the VP2-396N and VP2-345 based ELISAs had better sensitivity (97.5%) and excellent specificity (100%) during serodiagnosis testing using a mean plus three standard deviations cut-off. The VP3-246M based ELISA showed a sensitivity of 85% and a specificity of 100% at the same cut-off value. Conclusions This is the first report to systematically assess the antigenic characteristics of CAV viral proteins for sero-diagnosis purposes. Purified recombinant VP2-396N and VP2-345N subunit proteins, which span defined regions of VP2, were demonstrated to have good antigenicity and higher sensitivities than VP3-246M and were able to recognize CAV-positive chicken serum using an ELISA assay. The defined antigenicity potential of these chimeric subunit proteins produced by expression in E. coli seem to have potential and could be useful in the future for the development of the CAV diagnostic tests based on a subunit protein ELISA system. PMID:23937712

Electrical detection of the biological interaction of a charged peptide via gallium arsenide junction-field-effect transistors

PubMed Central

Lee, Kangho; Nair, Pradeep R.; Alam, Muhammad A.; Janes, David B.; Wampler, Heeyeon P.; Zemlyanov, Dmitry Y.; Ivanisevic, Albena

2008-01-01

GaAs junction-field-effect transistors (JFETs) are utilized to achieve label-free detection of biological interaction between a probe transactivating transcriptional activator (TAT) peptide and the target trans-activation-responsive (TAR) RNA. The TAT peptide is a short sequence derived from the human immunodeficiency virus-type 1 TAT protein. The GaAs JFETs are modified with a mixed adlayer of 1-octadecanethiol (ODT) and TAT peptide, with the ODT passivating the GaAs surface from polar ions in physiological solutions and the TAT peptide providing selective binding sites for TAR RNA. The devices modified with the mixed adlayer exhibit a negative pinch-off voltage (VP) shift, which is attributed to the fixed positive charges from the arginine-rich regions in the TAT peptide. Immersing the modified devices into a TAR RNA solution results in a large positive VP shift (>1 V) and a steeper subthreshold slope (∼80 mV∕decade), whereas “dummy” RNA induced a small positive VP shift (∼0.3 V) without a significant change in subthreshold slopes (∼330 mV∕decade). The observed modulation of device characteristics is analyzed with analytical modeling and two-dimensional numerical device simulations to investigate the electronic interactions between the GaAs JFETs and biological molecules. PMID:19484151

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* sialic acid-binding domain of porcine rotavirus strain OSU

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui

2007-02-01

Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less

Recombinant infectious hematopoietic necrosis virus expressing infectious pancreatic necrosis virus VP2 protein induces immunity against both pathogens.

PubMed

Guo, Mengting; Shi, Wen; Wang, Yanxue; Wang, Yuting; Chen, Yaping; Li, Dechuan; Ren, Xuanyu; Hua, Xiaojing; Tang, Lijie; Li, Yijing; Liu, Min

2018-04-21

Infectious hematopoietic necrosis virus (IHNV) and infectious pancreatic necrosis virus (IPNV) are typical pathogens of rainbow trout. Their co-infection is also common, which causes great economic loss in juvenile salmon species. Although vaccines against IHNV and IPNV have been commercialized in many countries, the prevalence of IHNV and IPNV is still widespread in modern aquaculture. In the present study, two IHNV recombinant viruses displaying IPNV VP2 protein (rIHNV-IPNV VP2 and rIHNV-IPNV VP2COE) were generated using the RNA polymerase Ⅱ system to explore the immunogenicity of IHNV and IPNV. The recombinant IHNV viruses were stable, which was confirmed by sequencing, indirect immunofluorescence assay, western blotting, transmission electron microscopy and viral growth curve assay. IHNV and IPNV challenge showed that the recombinant viruses had high protection rates against IHNV and IPNV with approximately 65% relative percent survival rates. Rainbow trout (mean weight 20 g) vaccinated with these two recombinant viruses showed a high level of antibodies against IHNV and IPNV infection. Taken together, our findings demonstrate that rIHNV-IPNV VP2 and rIHNV-IPNV VP2COE might be promising vaccine candidates against IHNV and IPNV. Copyright © 2018. Published by Elsevier Ltd.

Peptide deformylases from Vibrio parahaemolyticus phage and bacteria display similar deformylase activity and inhibitor binding clefts.

PubMed

Grzela, Renata; Nusbaum, Julien; Fieulaine, Sonia; Lavecchia, Francesco; Desmadril, Michel; Nhiri, Naima; Van Dorsselaer, Alain; Cianferani, Sarah; Jacquet, Eric; Meinnel, Thierry; Giglione, Carmela

2018-02-01

Unexpected peptide deformylase (PDF) genes were recently retrieved in numerous marine phage genomes. While various hypotheses dealing with the occurrence of these intriguing sequences have been made, no further characterization and functional studies have been described thus far. In this study, we characterize the bacteriophage Vp16 PDF enzyme, as representative member of the newly identified C-terminally truncated viral PDFs. We show here that conditions classically used for bacterial PDFs lead to an enzyme exhibiting weak activity. Nonetheless, our integrated biophysical and biochemical approaches reveal specific effects of pH and metals on Vp16 PDF stability and activity. A novel purification protocol taking in account these data allowed strong improvement of Vp16 PDF specific activity to values similar to those of bacterial PDFs. We next show that Vp16 PDF is as sensitive to the natural inhibitor compound of PDFs, actinonin, as bacterial PDFs. Comparison of the 3D structures of Vp16 and E. coli PDFs bound to actinonin also reveals that both PDFs display identical substrate binding mode. We conclude that bacteriophage Vp16 PDF protein has functional peptide deformylase activity and we suggest that encoded phage PDFs might be important for viral fitness. Copyright © 2017 Elsevier B.V. All rights reserved.

Different Temporal Effects of Ebola Virus VP35 and VP24 Proteins on Global Gene Expression in Human Dendritic Cells.

PubMed

Ilinykh, Philipp A; Lubaki, Ndongala M; Widen, Steven G; Renn, Lynnsey A; Theisen, Terence C; Rabin, Ronald L; Wood, Thomas G; Bukreyev, Alexander

2015-08-01

Ebola virus (EBOV) causes a severe hemorrhagic fever with a deficient immune response, lymphopenia, and lymphocyte apoptosis. Dendritic cells (DC), which trigger the adaptive response, do not mature despite EBOV infection. We recently demonstrated that DC maturation is unblocked by disabling the innate response antagonizing domains (IRADs) in EBOV VP35 and VP24 by the mutations R312A and K142A, respectively. Here we analyzed the effects of VP35 and VP24 with the IRADs disabled on global gene expression in human DC. Human monocyte-derived DC were infected by wild-type (wt) EBOV or EBOVs carrying the mutation in VP35 (EBOV/VP35m), VP24 (EBOV/VP24m), or both (EBOV/VP35m/VP24m). Global gene expression at 8 and 24 h was analyzed by deep sequencing, and the expression of interferon (IFN) subtypes up to 5 days postinfection was analyzed by quantitative reverse transcription-PCR (qRT-PCR). wt EBOV induced a weak global gene expression response, including markers of DC maturation, cytokines, chemokines, chemokine receptors, and multiple IFNs. The VP35 mutation unblocked the expression, resulting in a dramatic increase in expression of these transcripts at 8 and 24 h. Surprisingly, DC infected with EBOV/VP24m expressed lower levels of many of these transcripts at 8 h after infection, compared to wt EBOV. In contrast, at 24 h, expression of the transcripts increased in DC infected with any of the three mutants, compared to wt EBOV. Moreover, sets of genes affected by the two mutations only partially overlapped. Pathway analysis demonstrated that the VP35 mutation unblocked pathways involved in antigen processing and presentation and IFN signaling. These data suggest that EBOV IRADs have profound effects on the host adaptive immune response through massive transcriptional downregulation of DC. This study shows that infection of DC with EBOV, but not its mutant forms with the VP35 IRAD and/or VP24 IRAD disabled, causes a global block in expression of host genes. The temporal effects of mutations disrupting the two IRADs differ, and the lists of affected genes only partially overlap such that VP35 and VP24 IRADs each have profound effects on antigen presentation by exposed DC. The global modulation of DC gene expression and the resulting lack of their maturation represent a major mechanism by which EBOV disables the T cell response and suggests that these suppressive pathways are a therapeutic target that may unleash the T cell responses during EBOV infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Integrated Warfighter Biodefense Program (IWBP)

DTIC Science & Technology

2011-08-01

Distribution. Sincerely, Frank T. Abbott VP of Administration & Finance fta @quantumleap.us cc: Dr. Ganesh Vaidyanathan, Project Manager, Code 34...goals of IWBP. Areas of potential application include health care administration, clinical data analysis and health care research applications

Effect of vacuum and modified atmosphere packaging on the microbiological, chemical and sensory properties of tropical red drum (Sciaenops ocellatus) fillets stored at 4°C.

PubMed

Silbande, Adèle; Adenet, Sandra; Chopin, Christine; Cornet, Josiane; Smith-Ravin, Juliette; Rochefort, Katia; Leroi, Françoise

2018-02-02

The effect of vacuum (VP - 4°C) and CO 2 /N 2 -atmosphere (MAP - 4°C) packaging on the quality of red drum fillets compared with whole gutted iced fish was investigated. A metagenomic approach, bacterial enumeration and isolation, biochemical and sensory analyses were carried out. The organoleptic rejection of whole fish was observed at day 15 whereas VP and MAP fillets appeared unacceptable only after 29days. At these dates, total mesophilic counts reached 10 7 -10 8 CFU g -1 . According to Illumina MiSeq sequencing, Arthrobacter, Chryseobacterium, Brevibacterium, Staphylococcus and Kocuria were the main genera of the fresh red drum fillets. At the sensory rejection time, lactic acid bacteria (LAB), particularly Carnobacterium sp., dominated the microbiota of both types of packaging. The pH value of fresh samples was between 5.96 and 6.37 and did not vary greatly in all trials. Total volatile basic nitrogen (TVBN) and trimethylamine (TMA) concentrations were low and not represent reliable indicators of the spoilage, contrary to some biogenic amines (cadaverine, putrescine and tyramine). Chilled packed fillets of red drum have an extended shelf-life compared to whole gutted iced fish. Overall, few differences in sensory and microbial quality were observed between the VP and MAP samples. Next-Generation Sequencing (NGS) provided data on the microbiota of a tropical fish. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of Human Parvovirus B19 and Bocavirus VP1 Unique Region on Tight Junction of Human Airway Epithelial A549 Cells

PubMed Central

Chiu, Chun-Ching; Shi, Ya-Fang; Yang, Jiann-Jou; Hsiao, Yuan-Chao; Tzang, Bor-Show; Hsu, Tsai-Ching

2014-01-01

As is widely recognized, human parvovirus B19 (B19) and human bocavirus (HBoV) are important human pathogens. Obviously, both VP1 unique region (VP1u) of B19 and HBoV exhibit the secreted phospholipase A2 (sPLA2)-like enzymatic activity and are recognized to participate in the pathogenesis of lower respiratory tract illnesses. However, exactly how, both VP1u from B19 and HBoV affect tight junction has seldom been addressed. Therefore, this study investigates how B19-VP1u and HBoV-VP1u may affect the tight junction of the airway epithelial A549 cells by examining phospholipase A2 activity and transepithelial electrical resistance (TEER) as well as performing immunoblotting analyses. Experimental results indicate that TEER is more significantly decreased in A549 cells by treatment with TNF-α (10 ng), two dosages of B19-VP1u and BoV-VP1u (400 ng and 4000 ng) or bee venom PLA2 (10 ng) than that of the control. Accordingly, more significantly increased claudin-1 and decreased occludin are detected in A549 cells by treatment with TNF-α or both dosages of HBoV-VP1u than that of the control. Additionally, more significantly decreased Na+/K+ ATPase is observed in A549 cells by treatment with TNF-α, high dosage of B19-VP1u or both dosages of BoV-VP1u than that of the control. Above findings suggest that HBoV-VP1u rather than B19 VP1u likely plays more important roles in the disruption of tight junction in the airway tract. Meanwhile, this discrepancy appears not to be associated with the secreted phospholipase A2 (sPLA2)-like enzymatic activity. PMID:25268969

Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

PubMed

Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

2014-08-01

The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

Intrinsically-disordered N-termini in human parechovirus 1 capsid proteins bind encapsidated RNA.

PubMed

Shakeel, Shabih; Evans, James D; Hazelbaker, Mark; Kao, C Cheng; Vaughan, Robert C; Butcher, Sarah J

2018-04-11

Human parechoviruses (HPeV) are picornaviruses with a highly-ordered RNA genome contained within icosahedrally-symmetric capsids. Ordered RNA structures have recently been shown to interact with capsid proteins VP1 and VP3 and facilitate virus assembly in HPeV1. Using an assay that combines reversible cross-linking, RNA affinity purification and peptide mass fingerprinting (RCAP), we mapped the RNA-interacting regions of the capsid proteins from the whole HPeV1 virion in solution. The intrinsically-disordered N-termini of capsid proteins VP1 and VP3, and unexpectedly, VP0, were identified to interact with RNA. Comparing these results to those obtained using recombinantly-expressed VP0 and VP1 confirmed the virion binding regions, and revealed unique RNA binding regions in the isolated VP0 not previously observed in the crystal structure of HPeV1. We used RNA fluorescence anisotropy to confirm the RNA-binding competency of each of the capsid proteins' N-termini. These findings suggests that dynamic interactions between the viral RNA and the capsid proteins modulate virus assembly, and suggest a novel role for VP0.

Molecular characterization of infectious bursal disease virus isolates from Nepal based on hypervariable region of VP2 gene.

PubMed

Sharma, K; Hair-Bejo, M; Omar, A R; Aini, I

2005-01-01

Two Infectious bursal disease virus (IBDV) isolates, NP1SSH and NP2K were obtained from a severe infectious bursal disease (IBD) outbreak in Nepal in 2002. The hypervariable (HV) region of VP2 gene (1326 bp) of the isolates was generated by RT-PCR and sequenced. The obtained nucleotide sequences were compared with those of twenty other IBDV isolates/strains. Phylogenetic analysis based on this comparison revealed that NP1SSH and NP2K clustered with very virulent (vv) IBDV strains of serotype 1. In contrast, classical, Australian classical and attenuated strains of serotype 1 and avirulent IBDV strains of serotype 2 formed a different cluster. The deduced amino acid sequences of the two isolates showed a 98.3% identity with each other and 97.1% and 98.3% identities, respectively with very virulent IBDV (vvIBDV) isolates/strains. Three amino acids substitutions at positions 300 (E-->A), 308 (I-->F) and 334 (A-->P) within the HV region were common for both the isolates. The amino acids substitutions at positions 27 (S-->T), 28 (I-->T), 31 (D-->A), 36 (H-->Y), 135 (E-->G), 223 (G-->S), 225 (V-->I), 351 (L-->I), 352 (V-->E) and 399 (I-->S) for NP1SSH and at position 438 (I-->S) for NP2K were unique and differed from other IBDV isolates/strains. NP1SSH and NP2K showed highest similarity (97.8%) with the BD399 strain from Bangladesh as compared with other vvIBDV isolates/strains. We conclude that the NP1SSH and NP2K isolates of IBDV from Nepal represent vvIBDV of serotype 1.

Folding units in calcium vector protein of amphioxus: Structural and functional properties of its amino- and carboxy-terminal halves.

PubMed

Baladi, S; Tsvetkov, P O; Petrova, T V; Takagi, T; Sakamoto, H; Lobachov, V M; Makarov, A A; Cox, J A

2001-04-01

Muscle of amphioxus contains large amounts of a four EF-hand Ca2+-binding protein, CaVP, and its target, CaVPT. To study the domain structure of CaVP and assess the structurally important determinants for its interaction with CaVPT, we expressed CaVP and its amino (N-CaVP) and carboxy-terminal halves (C-CaVP). The interactive properties of recombinant and wild-type CaVP are very similar, despite three post-translational modifications in the wild-type protein. N-CaVP does not bind Ca2+, shows a well-formed hydrophobic core, and melts at 44 degrees C. C-CaVP binds two Ca2+ with intrinsic dissociation constants of 0.22 and 140 microM (i.e., very similar to the entire CaVP). The metal-free domain in CaVP and C-CaVP shows no distinct melting transition, whereas its 1Ca2+ and 2Ca2+) forms melt in the 111 degrees -123 degrees C range, suggesting that C-CaVP and the carboxy- domain of CaVP are natively unfolded in the metal-free state and progressively gain structure upon binding of 1Ca2+ and 2Ca2+. Thermal denaturation studies provide evidence for interdomain interaction: the apo, 1Ca2+ and 2Ca2+ states of the carboxy-domain destabilize to different degrees the amino-domain. Only C-CaVP forms a Ca2+-dependent 1:1 complex with CaVPT. Our results suggest that the carboxy-terminal domain of CaVP interacts with CaVPT and that the amino-terminal lobe modulates this interaction.

Folding units in calcium vector protein of amphioxus: Structural and functional properties of its amino- and carboxy-terminal halves

PubMed Central

Baladi, Sibyl; Tsvetkov, Philipp O.; Petrova, Tatiana V.; Takagi, Takashi; Sakamoto, Hiroshi; Lobachov, Vladimir M.; Makarov, Alexander A.; Cox, Jos A.

2001-01-01

Muscle of amphioxus contains large amounts of a four EF-hand Ca2+-binding protein, CaVP, and its target, CaVPT. To study the domain structure of CaVP and assess the structurally important determinants for its interaction with CaVPT, we expressed CaVP and its amino (N-CaVP) and carboxy-terminal halves (C-CaVP). The interactive properties of recombinant and wild-type CaVP are very similar, despite three post-translational modifications in the wild-type protein. N-CaVP does not bind Ca2+, shows a well-formed hydrophobic core, and melts at 44°C. C-CaVP binds two Ca2+ with intrinsic dissociation constants of 0.22 and 140 μM (i.e., very similar to the entire CaVP). The metal-free domain in CaVP and C-CaVP shows no distinct melting transition, whereas its 1Ca2+ and 2Ca2+ forms melt in the 111°–123°C range, suggesting that C-CaVP and the carboxy- domain of CaVP are natively unfolded in the metal-free state and progressively gain structure upon binding of 1Ca2+ and 2Ca2+. Thermal denaturation studies provide evidence for interdomain interaction: the apo, 1Ca2+ and 2Ca2+ states of the carboxy-domain destabilize to different degrees the amino-domain. Only C-CaVP forms a Ca2+-dependent 1:1 complex with CaVPT. Our results suggest that the carboxy-terminal domain of CaVP interacts with CaVPT and that the amino-terminal lobe modulates this interaction. PMID:11274468

Recombinant VP1 protein as a potential marker for the diagnosis of acute hepatitis A virus infection.

PubMed

da Silva Junior, Haroldo Cid; da Silva, Edimilson Domingos; Lewis-Ximenez de Souza Rodrigues, Lia Laura; Medeiros, Marco Alberto

2017-07-01

Since hepatitis A virus (HAV) production is time-consuming and expensive, the use of recombinant proteins may represent an alternative source of antigens for diagnostic purposes. The present study aimed to express, purify and evaluate the potential of recombinant VP1 protein (rVP1) as a marker for the diagnosis of acute HAV infection. The rVP1 was expressed and purified successfully from Escherichia coli. The purified rVP1 was used to establish an in-house enzyme-linked immunosorbent assay (ELISA-rVP1) for detection of IgM antibodies in sera from HAV-positive patients. For a cut-off point of 0.351, the sensitivity and specificity of ELISA-rVP1 were 100.0% and 95.0%, respectively. These results indicate that rVP1 may be a useful antigen for detection of IgM antibodies against HAV. Copyright © 2017 Elsevier B.V. All rights reserved.

Human parvovirus B19 VP1u Protein as inflammatory mediators induces liver injury in naïve mice.

PubMed

Hsu, Tsai-Ching; Chiu, Chun-Ching; Chang, Shun-Chih; Chan, Hsu-Chin; Shi, Ya-Fang; Chen, Tzy-Yen; Tzang, Bor-Show

2016-01-01

Human parvovirus B19 (B19V) is a human pathogen known to be associated with many non-erythroid diseases, including hepatitis. Although B19V VP1-unique region (B19-VP1u) has crucial roles in the pathogenesis of B19V infection, the influence of B19-VP1u proteins on hepatic injury is still obscure. This study investigated the effect and possible inflammatory signaling of B19-VP1u in livers from BALB/c mice that were subcutaneously inoculated with VP1u-expressing COS-7 cells. The in vivo effects of B19-VP1u were analyzed by using live animal imaging system (IVIS), Haematoxylin-Eosin staining, gel zymography, and immunoblotting after inoculation. Markedly hepatocyte disarray and lymphocyte infiltration, enhanced matrix metalloproteinase (MMP)-9 activity and increased phosphorylation of p38, ERK, IKK-α, IκB and NF-κB (p-p65) proteins were observed in livers from BALB/c mice receiving COS-7 cells expressing B19-VP1u as well as the significantly increased CRP, IL-1β and IL-6. Notably, IFN-γ and phosphorylated STAT1, but not STAT3, were also significantly increased in the livers of BALB/c mice that were subcutaneously inoculated with VP1u-expressing COS-7 cells. These findings revealed the effects of B19-VP1u on liver injury and suggested that B19-VP1u may have a role as mediators of inflammation in B19V infection.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

Exploitation of stable nanostructures based on the mouse polyomavirus for development of a recombinant vaccine against porcine circovirus 2

PubMed Central

Fraiberk, Martin; Hájková, Michaela; Krulová, Magdaléna; Kojzarová, Martina; Drda Morávková, Alena; Pšikal, Ivan

2017-01-01

The aim of this study was to develop a suitable vaccine antigen against porcine circovirus 2 (PCV2), the causative agent of post-weaning multi-systemic wasting syndrome, which causes significant economic losses in swine breeding. Chimeric antigens containing PCV2b Cap protein sequences based on the mouse polyomavirus (MPyV) nanostructures were developed. First, universal vectors for baculovirus-directed production of chimeric MPyV VLPs or pentamers of the major capsid protein, VP1, were designed for their exploitation as vaccines against other pathogens. Various strategies were employed based on: A) exposure of selected immunogenic epitopes on the surface of MPyV VLPs by insertion into a surface loop of the VP1 protein, B) insertion of foreign protein molecules inside the VLPs, or C) fusion of a foreign protein or its part with the C-terminus of VP1 protein, to form giant pentamers of a chimeric protein. We evaluated these strategies by developing a recombinant vaccine against porcine circovirus 2. All candidate vaccines induced the production of antibodies against the capsid protein of porcine circovirus after immunization of mice. The candidate vaccine, Var C, based on fusion of mouse polyomavirus and porcine circovirus capsid proteins, could induce the production of antibodies with the highest PCV2 neutralizing capacity. Its ability to induce the production of neutralization antibodies was verified after immunization of pigs. The advantage of this vaccine, apart from its efficient production in insect cells and easy purification, is that it represents a DIVA (differentiating infected from vaccinated animals) vaccine, which also induces an immune response against the mouse polyoma VP1 protein and is thus able to distinguish between vaccinated and naturally infected animals. PMID:28922413

Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

PubMed

Shaukat, Shahzad; Angez, Mehar; Alam, Muhammad Masroor; Sharif, Salmaan; Khurshid, Adnan; Malik, Farzana; Rehman, Lubna; Zaidi, Syed Sohail Zahoor

2014-01-01

Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1) transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3%) out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6%) were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

A conserved carboxy-terminal domain in the major tegument structural protein VP22 facilitates virion packaging of a chimeric protein during productive herpes simplex virus 1 infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlegel, Elisabeth F.M.; Blaho, John A., E-mail: john.blaho@mssm.ed

2009-05-10

Recombinant virus HSV-1(RF177) was previously generated to examine tegument protein VP22 function by inserting the GFP gene into the gene encoding VP22. During a detailed analysis of this virus, we discovered that RF177 produces a novel fusion protein between the last 15 amino acids of VP22 and GFP, termed GCT-VP22. Thus, the VP22 carboxy-terminal specific antibody 22-3 and two anti-GFP antibodies reacted with an approximately 28 kDa protein from RF177-infected Vero cells. GCT-VP22 was detected at 1 and 3 hpi. Examination of purified virions indicated that GCT-VP22 was incorporated into RF177 virus particles. These observations imply that at least amore » portion of the information required for virion targeting is located in this domain of VP22. Indirect immunofluorescence analyses showed that GCT-VP22 also localized to areas of marginalized chromatin during RF177 infection. These results indicate that the last fifteen amino acids of VP22 participate in virion targeting during HSV-1 infection.« less

Decreased LRIG1 in Human Ovarian Cancer Cell SKOV3 Upregulates MRP-1 and Contributes to the Chemoresistance of VP16.

PubMed

Yang, Hua; Yao, Jun; Yin, Jiangpin; Wei, Xuan

2016-05-01

The leucine-rich repeats and immunoglobulin-like domains (LRIG) are used as tumor suppressors in clinical applications. Although the LRIG has been identified to manipulate the cell proliferation via various oncogenic receptor tyrosine kinases in diverse cancers, its role in multidrug resistance needs to be further elucidated, especially in human ovarian cancer. We herein established that the etoposide (VP16)-resistant SKOV3 human ovarian cancer cell clones (SKOV3/VP16 cells) and mRNA expression of LRIG1 were significantly reduced by the treatment of VP16 in a concentration-dependent manner. Moreover, downregulated LRIG1 in SKOV3 could enhance the colony formation and resist the inhibition of proliferation by VP16, leading to the elevated expression of Bcl-2 and decreased apoptosis of SKOV3. Interestingly, our results uncovered that the multidrug resistance-associated protein 1 (MRP-1) was upregulated for the chemoresistance of VP16. To overcome the chemoresistance of SKOV3, SKOV3/VP16 was ectopically expressed of LRIG1. We found that the inhibition of VP16 on colony formation and proliferation was remarkably enhanced with increased apoptosis in SKOV3/VP16. Furthermore, the expression of MRP-1 and Bcl-2 was also inhibited, suggesting that the LRIG1could negatively control MRP-1 and the apoptosis to improve the sensitivity of VP16-related chemotherapy.

Assembly of the Herpes Simplex Virus Capsid: Preformed Triplexes Bind to the Nascent Capsid

PubMed Central

Spencer, Juliet V.; Newcomb, William W.; Thomsen, Darrell R.; Homa, Fred L.; Brown, Jay C.

1998-01-01

The herpes simplex virus type 1 (HSV-1) capsid is a T=16 icosahedral shell that forms in the nuclei of infected cells. Capsid assembly also occurs in vitro in reaction mixtures created from insect cell extracts containing recombinant baculovirus-expressed HSV-1 capsid proteins. During capsid formation, the major capsid protein, VP5, and the scaffolding protein, pre-VP22a, condense to form structures that are extended into procapsids by addition of the triplex proteins, VP19C and VP23. We investigated whether triplex proteins bind to the major capsid-scaffold protein complexes as separate polypeptides or as preformed triplexes. Assembly products from reactions lacking one triplex protein were immunoprecipitated and examined for the presence of the other. The results showed that neither triplex protein bound unless both were present, suggesting that interaction between VP19C and VP23 is required before either protein can participate in the assembly process. Sucrose density gradient analysis was employed to determine the sedimentation coefficients of VP19C, VP23, and VP19C-VP23 complexes. The results showed that the two proteins formed a complex with a sedimentation coefficient of 7.2S, a value that is consistent with formation of a VP19C-VP232 heterotrimer. Furthermore, VP23 was observed to have a sedimentation coefficient of 4.9S, suggesting that this protein exists as a dimer in solution. Deletion analysis of VP19C revealed two domains that may be required for attachment of the triplex to major capsid-scaffold protein complexes; none of the deletions disrupted interaction of VP19C with VP23. We propose that preformed triplexes (VP19C-VP232 heterotrimers) interact with major capsid-scaffold protein complexes during assembly of the HSV-1 capsid. PMID:9557680

Sporadic isolation of sabin-like polioviruses and high-level detection of non-polio enteroviruses during sewage surveillance in seven Italian cities, after several years of inactivated poliovirus vaccination.

PubMed

Battistone, A; Buttinelli, G; Fiore, S; Amato, C; Bonomo, P; Patti, A M; Vulcano, A; Barbi, M; Binda, S; Pellegrinelli, L; Tanzi, M L; Affanni, P; Castiglia, P; Germinario, C; Mercurio, P; Cicala, A; Triassi, M; Pennino, F; Fiore, L

2014-08-01

Sewage surveillance in seven Italian cities between 2005 and 2008, after the introduction of inactivated poliovirus vaccination (IPV) in 2002, showed rare polioviruses, none that were wild-type or circulating vaccine-derived poliovirus (cVDPV), and many other enteroviruses among 1,392 samples analyzed. Two of five polioviruses (PV) detected were Sabin-like PV2 and three PV3, based on enzyme-linked immunosorbent assay (ELISA) and PCR results. Neurovirulence-related mutations were found in the 5'noncoding region (5'NCR) of all strains and, for a PV2, also in VP1 region 143 (Ile>Thr). Intertypic recombination in the 3D region was detected in a second PV2 (Sabin 2/Sabin 1) and a PV3 (Sabin 3/Sabin 2). The low mutation rate in VP1 for all PVs suggests limited interhuman virus passages, consistent with efficient polio immunization in Italy. Nonetheless, these findings highlight the risk of wild or Sabin poliovirus reintroduction from abroad. Non-polio enteroviruses (NPEVs) were detected, 448 of which were coxsackievirus B (CVB) and 294 of which were echoviruses (Echo). Fifty-six NPEVs failing serological typing were characterized by sequencing the VP1 region (nucleotides [nt] 2628 to 2976). A total of 448 CVB and 294 Echo strains were identified; among those strains, CVB2, CVB5, and Echo 11 predominated. Environmental CVB5 and CVB2 strains from this study showed high sequence identity with GenBank global strains. The high similarity between environmental NPEVs and clinical strains from the same areas of Italy and the same periods indicates that environmental strains reflect the viruses circulating in the population and highlights the potential risk of inefficient wastewater treatments. This study confirmed that sewage surveillance can be more sensitive than acute flaccid paralysis (AFP) surveillance in monitoring silent poliovirus circulation in the population as well as the suitability of molecular approaches to enterovirus typing.

Whole genome analysis provides evidence for porcine-to-simian interspecies transmission of rotavirus-A.

PubMed

Navarro, Ryan; Aung, Meiji Soe; Cruz, Katalina; Ketzis, Jennifer; Gallagher, Christa Ann; Beierschmitt, Amy; Malik, Yashpal Singh; Kobayashi, Nobumichi; Ghosh, Souvik

2017-04-01

We report here whole genome analysis of a porcine rotavirus-A (RVA) strain RVA/Pig-wt/KNA/ET8B/2015/G5P[13] detected in a diarrheic piglet, and nearly whole genome (except for VP4 gene) analysis of a simian RVA strain RVA/Simian-wt/KNA/08979/2015/G5P[X] detected in a non-diarrheic African green monkey (AGM) on the island of St. Kitts, Caribbean region. Strain ET8B exhibited a G5-P[13]-I5-R1-C1-M1-A8-N1-T7-E1-H1 genotype constellation that was identical to those of Brazilian porcine RVA G5P[13] strains RVA/Pig-wt/BRA/ROTA01/2013/G5P[13] and RVA/Pig-wt/BRA/ROTA07/2013/G5P[13], the only porcine G5P[13] RVAs that have been analyzed for the whole genome so far. Phylogenetically, all the 11 gene segments of ET8B were closely related to those of porcine and porcine-like human RVAs within the respective genotypes. Although the porcine G5P[13] RVAs exhibited identical genotype constellations, ET8B did not appear to share common evolutionary pathways with the Brazilian porcine G5P[13] RVAs. Interestingly, the VP2, VP3, VP6, VP7, and NSP1-NSP5 genes of simian RVA strain 08979 were closely related to those of porcine and porcine-like human RVA strains, exhibiting 99%-100% nucleotide sequence identities to cognate genes of co-circulating porcine RVA strain ET8B. On the other hand, the VP1 of 08979 appeared to be genetically divergent from porcine and human RVAs within the R1 genotype, and its exact origin could not be ascertained. Taken together, these observations suggested that simian strain 08979 might have been derived from interspecies transmission events involving transmission of ET8B-like RVAs from pigs to AGMs. In St. Kitts, AGMs often stray from the wild into livestock farms. Therefore, it may be possible that the AGM acquired the infection from a pig farm on the island. To our knowledge, this is the first report on detection of porcine-like RVAs in monkeys. Also, the present study is the first to report whole genomic analysis of a porcine RVA strain from the Caribbean region. Copyright © 2016 Elsevier B.V. All rights reserved.

Purification of full-length VP22 from cells infected with HSV-1: A two-pronged approach for the solubilization and purification of viral proteins for use in biochemical studies

PubMed Central

Dewberry, Ebony J.; Dunkerley, Eric; Duffy, Carol

2012-01-01

Summary VP22, encoded by the UL49 gene, is one of the most abundant proteins of the herpes simplex virus type 1 (HSV-1) tegument and has been shown to be important for virus replication and spread. However, the exact role(s) played by VP22 in the HSV-1 replication cycle have yet to be delineated. The lack of a procedure to purify full-length VP22 has limited molecular studies on VP22 function. A procedure was developed for the purification of soluble, full-length VP22 from cells infected with HSV-1. A recombinant virus encoding His-tagged VP22 was generated and found to express VP22 at levels comparable to the wild type virus upon infection of Vero cells. By experimenting with a wide variety of cell lysis buffer conditions, several buffers that promote the solubility of full-length VP22 were identified. Buffers that gave the highest levels of solubility were then used in immobilized metal ion affinity chromatography experiments to identify conditions that provided the greatest level of VP22 binding and recovery from cobalt and nickel affinity resins. Using this strategy soluble, full-length VP22 was purified from cells infected with HSV-1. PMID:22569534

Enterovirus Migration Patterns between France and Tunisia

PubMed Central

Othman, Ines; Mirand, Audrey; Slama, Ichrak; Mastouri, Maha; Peigue-Lafeuille, Hélène; Aouni, Mahjoub; Bailly, Jean-Luc

2015-01-01

The enterovirus (EV) types echovirus (E-) 5, E-9, and E-18, and coxsackievirus (CV-) A9 are infrequently reported in human diseases and their epidemiologic features are poorly defined. Virus transmission patterns between countries have been estimated with phylogenetic data derived from the 1D/VP1 and 3CD gene sequences of a sample of 74 strains obtained in France (2000–2012) and Tunisia (2011–2013) and from the publicly available sequences. The EV types (E-5, E-9, and E-18) exhibited a lower worldwide genetic diversity (respective number of genogroups: 4, 5, and 3) in comparison to CV-A9 (n = 10). The phylogenetic trees estimated with both 1D/VP1 and 3CD sequence data showed variations in the number of co-circulating lineages over the last 20 years among the four EV types. Despite the low number of genogroups in E-18, the virus exhibited the highest number of recombinant 3CD lineages (n = 10) versus 4 (E-5) to 8 (E-9). The phylogenies provided evidence of multiple transportation events between France and Tunisia involving E-5, E-9, E-18, and CV-A9 strains. Virus spread events between France and 17 other countries in five continents had high probabilities of occurrence as those between Tunisia and two European countries other than France. All transportation events were supported by BF values > 10. Inferring the source of virus transmission from phylogenetic data may provide insights into the patterns of sporadic and epidemic diseases caused by EVs. PMID:26709514

Molecular epidemiological studies on foot-and-mouth disease type O Taiwan viruses from the 1997 epidemic.

PubMed

Tsai, C P; Pan, C H; Liu, M Y; Lin, Y L; Chen, C M; Huang, T S; Cheng, I C; Jong, M H; Yang, P C

2000-06-01

Sequence diversity was assessed of the complete VP1 gene directly amplified from 49 clinical specimens during an explosive foot-and-mouth disease (FMD) outbreak in Taiwan. Type O Taiwan FMD viruses are genetically highly homogenous, as seen by the minute divergence of 0.2-0.9% revealed in 20 variants. The O/HCP-0314/TW/97 and O/TCP-022/TW/97 viral variants dominated FMD outbreaks and were prevalent in most affected pig-raising areas. Comparison of deduced amino acid sequences around the main neutralizable antigenic sites on the VP1 polypeptide showed no significant antigenic variation. However, the O/CHP-158/TW/97 variant had an alternative critical residue at position 43 in antigenic site 3, which may be due to selective pressure in the field. Two vaccine production strains (O1/Manisa/Turkey/69 and O1/Campos/Brazil/71) probably provide partial heterologous protection of swine against O Taiwan viruses. The type O Taiwan variants clustered in sublineage A1 of four main lineages in the phylogenetic tree. The O/Hong Kong/9/94 and O/1685/Moscow/Russia/95 viruses in sublineage A2 are closely related to the O Taiwan variants. The causative agent for the 1997 epidemic presumably originated from a single common source of type O FMD viruses prevalent in neighboring areas.

Identification of Novel Rosavirus Species That Infects Diverse Rodent Species and Causes Multisystemic Dissemination in Mouse Model

PubMed Central

Fan, Rachel Y. Y.; Zhang, Anna J. X.; Chan, Brandon C. C.; Lam, Carol S. F.; Yip, Cyril C. Y.; Chan, Kwok-Hung; Chen, Zhi-Wei; Yuen, Kwok-Yung

2016-01-01

While novel picornaviruses are being discovered in rodents, their host range and pathogenicity are largely unknown. We identified two novel picornaviruses, rosavirus B from the street rat, Norway rat, and rosavirus C from five different wild rat species (chestnut spiny rat, greater bandicoot rat, Indochinese forest rat, roof rat and Coxing's white-bellied rat) in China. Analysis of 13 complete genome sequences showed that “Rosavirus B” and “Rosavirus C” represent two potentially novel picornavirus species infecting different rodents. Though being most closely related to rosavirus A, rosavirus B and C possessed distinct protease cleavage sites and variations in Yn-Xm-AUG sequence in 5’UTR and myristylation site in VP4. Anti-rosavirus B VP1 antibodies were detected in Norway rats, whereas anti-rosavirus C VP1 and neutralizing antibodies were detected in Indochinese forest rats and Coxing's white-bellied rats. While the highest prevalence was observed in Coxing's white-bellied rats by RT-PCR, the detection of rosavirus C from different rat species suggests potential interspecies transmission. Rosavirus C isolated from 3T3 cells causes multisystemic diseases in a mouse model, with high viral loads and positive viral antigen expression in organs of infected mice after oral or intracerebral inoculation. Histological examination revealed alveolar fluid exudation, interstitial infiltration, alveolar fluid exudate and wall thickening in lungs, and hepatocyte degeneration and lymphocytic/monocytic inflammatory infiltrates with giant cell formation in liver sections of sacrificed mice. Since rosavirus A2 has been detected in fecal samples of children, further studies should elucidate the pathogenicity and emergence potential of different rosaviruses. PMID:27737017

Human Rhinovirus 87 and Enterovirus 68 Represent a Unique Serotype with Rhinovirus and Enterovirus Features

PubMed Central

Blomqvist, Soile; Savolainen, Carita; Råman, Laura; Roivainen, Merja; Hovi, Tapani

2002-01-01

It has recently been reported that all but one of the 102 known serotypes of the genus Rhinovirus segregate into two genetic clusters (C. Savolainen, S. Blomqvist, M. N. Mulders, and T. Hovi, J. Gen. Virol. 83:333-340, 2002). The only exception is human rhinovirus 87 (HRV87). Here we demonstrate that HRV87 is genetically and antigenically highly similar to enterovirus 68 (EV68) and is related to EV70, the other member of human enterovirus group D. The partial nucleotide sequences of the 5′ untranslated region, capsid regions VP4/VP2 and VP1, and the 3D RNA polymerase gene of the HRV87 prototype strain F02-3607 Corn showed 97.3, 97.8, 95.2, and 95.9% identity to the corresponding regions of EV68 prototype strain Fermon. The amino acid identities were 100 and 98.1% for the products of the two capsid regions and 97.9% for 3D RNA polymerase. Antigenic cross-reaction between HRV87 and EV68 was indicated by microneutralization with monotypic antisera. Phylogenetic analysis showed definite clustering of HRV87 and EV68 with EV70 for all sequences examined. Both HRV87 and EV68 were shown to be acid sensitive by two different assays, while EV70 was acid resistant, which is typical of enteroviruses. The cytopathic effect induced by HRV87 or EV68 was inhibited by monoclonal antibodies to the decay-accelerating factor known to be the receptor of EV70. We conclude that HRV87 and EV68 are strains of the same picornavirus serotype presenting features of both rhinoviruses and enteroviruses. PMID:12409401

Genetic diversity and comparison of diagnostic tests for characterization of foot-and-mouth disease virus strains from Pakistan 2008-2012.

PubMed

Ahmed, Z; Pauszek, S J; Ludi, A; LaRocco, M; Khan, E-U-H; Afzal, M; Arshed, M J; Farooq, U; Arzt, J; Bertram, M; Brito, B; Naeem, K; Abubakar, M; Rodriguez, L L

2018-04-01

We report the laboratory analysis of 125 clinical samples from suspected cases of foot-and-mouth disease (FMD) in cattle and Asian buffalo collected in Pakistan between 2008 and 2012. Of these samples, 89 were found to contain viral RNA by rRT-PCR, of which 88 were also found to contain infectious FMD virus (FMDV) by virus isolation (VI), with strong correlation between these tests (κ = 0.96). Samples that were VI-positive were serotyped by antigen detection ELISA (Ag-ELISA) and VP1 sequence acquisition and analysis. Sequence data identified FMDV serotypes A (n = 13), O (n = 36) and Asia-1 (n = 41), including three samples from which both serotypes Asia-1 and O were detected. Serotype A viruses were classified within three different Iran-05 sublineages: HER-10, FAR-11 and ESF-10. All serotype Asia-1 were within Group VII (Sindh-08 lineage), in a genetic clade that differs from viruses isolated prior to 2010. All serotypes O were classified as PanAsia-2 within two different sublineages: ANT-10 and BAL-09. Using VP1 sequencing as the gold standard for serotype determination, the overall sensitivity of Ag-ELISA to correctly determine serotype was 74%, and serotype-specific sensitivity was 8% for serotype A, 88% for Asia-1 and 89% for O. Serotype-specific specificity was 100% for serotype A, 93% for Asia-1 and 94% for O. Interestingly, 12 of 13 serotype A viruses were not detected by Ag-ELISA. This study confirms earlier accounts of regional genetic diversity of FMDV in Pakistan and highlights the importance of continued validation of diagnostic tests for rapidly evolving pathogens such as FMDV. © 2017 Blackwell Verlag GmbH.

Halon Replacement Program for Aviation, Aircraft Engine Nacelle Application Phase II - Operational Comparison of Selected Extinguishants

DTIC Science & Technology

1997-05-01

Control Butterfly Hi-Pressure High Flow Control Butterfly Ejector Primary Clycol Control Valve Scrubber Fan Pressure Control Butterfly 8" Venturi ...the scrubber . 20 ■ SCRUBBER FAN BLOWER INLET VALVE VP-2 VP-3 VP-4 VP-5 VP-6 VP-7 VP-8 VP-9 VP-10 SV-1 SV-2 DESCRIPTION Atmospheric...Blower Bypass Butterfly 24" Venturi Control Butterfly 24" Test Section Exit Butterfly Ejector 10’ Secondary Inlet-Butterfly Hi-pressure Low Flow

Recombinant VP1, an Akt Inhibitor, Suppresses Progression of Hepatocellular Carcinoma by Inducing Apoptosis and Modulation of CCL2 Production

PubMed Central

Chen, Tai-An; Wang, Jui-Ling; Hung, Shao-Wen; Chu, Chiao-Li; Cheng, Yung-Chih; Liang, Shu-Mei

2011-01-01

Background The application of viral elements in tumor therapy is one facet of cancer research. Recombinant capsid protein VP1 (rVP1) of foot-and-mouth disease virus has previously been demonstrated to induce apoptosis in cancer cell lines. Here, we aim to further investigate its apoptotic mechanism and possible anti-metastatic effect in murine models of hepatocellular carcinoma (HCC), one of the most common human cancers worldwide. Methodology/Principal Findings Treatment with rVP1 inhibited cell proliferation in two murine HCC cell lines, BNL and Hepa1-6, with IC50 values in the range of 0.1–0.2 µM. rVP1 also induced apoptosis in these cells, which was mediated by Akt deactivation and dissociation of Ku70-Bax, and resulted in conformational changes and mitochondrial translocation of Bax, leading to the activation of caspases-9, -3 and -7. Treatment with 0.025 µM rVP1, which did not affect the viability of normal hepatocytes, suppressed cell migration and invasion via attenuating CCL2 production. The production of CCL2 was modulated by Akt-dependent NF-κB activation that was decreased after rVP1 treatment. The in vivo antitumor effects of rVP1 were assessed in both subcutaneous and orthotopic mouse models of HCC in immune-competent BALB/c mice. Intratumoral delivery of rVP1 inhibited subcutaneous tumor growth as a result of increased apoptosis. Intravenous administration of rVP1 in an orthotopic HCC model suppressed tumor growth, inhibited intra-hepatic metastasis, and prolonged survival. Furthermore, a decrease in the serum level of CCL2 was observed in rVP1-treated mice. Conclusions/Significance The data presented herein suggest that, via inhibiting Akt phosphorylation, rVP1 suppresses the growth, migration, and invasion of murine HCC cells by inducing apoptosis and attenuating CCL2 production both in vitro and in vivo. Recombinant protein VP1 thus has the potential to be developed as a new therapeutic agent for HCC. PMID:21826248

Expression, purification and crystallization of two major envelope proteins from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Xuhua; Hew, Choy Leong, E-mail: dbshewcl@nus.edu.sg

2007-07-01

The crystallization of the N-terminal transmembrane region-truncated VP26 and VP28 of white spot syndrome virus is described. White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapour-diffusion method. Crystals ofmore » SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 M sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 Å resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 Å. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 Å, and diffracts to 2.0 Å resolution.« less

Pros and cons of VP1-specific maternal IgG for the protection of Enterovirus 71 infection.

PubMed

Kim, Young-In; Song, Jae-Hyoung; Kwon, Bo-Eun; Kim, Ha-Neul; Seo, Min-Duk; Park, KwiSung; Lee, SangWon; Yeo, Sang-Gu; Kweon, Mi-Na; Ko, Hyun-Jeong; Chang, Sun-Young

2015-11-27

Enterovirus 71 (EV71) causes hand, foot, and mouth diseases and can result in severe neurological disorders when it infects the central nervous system. Thus, there is a need for the development of effective vaccines against EV71 infection. Here we report that viral capsid protein 1 (VP1), one of the main capsid proteins of EV71, efficiently elicited VP1-specific immunoglobulin G (IgG) in the serum of mice immunized with recombinant VP1. The VP1-specific IgG produced in female mice was efficiently transferred to their offspring, conferring protection against EV71 infection immediately after birth. VP1-specific antibody can neutralize EV71 infection and protect host cells. VP1-specific maternal IgG in offspring was maintained for over 6 months. However, the pre-existence of VP1-specific maternal IgG interfered with the production of VP1-specific IgG antibody secreting cells by active immunization in offspring. Therefore, although our results showed the potential for VP1-specific maternal IgG protection against EV71 in neonatal mice, other strategies must be developed to overcome the hindrance of maternal IgG in active immunization. In this study, we developed an effective and feasible animal model to evaluate the protective efficacy of humoral immunity against EV71 infection using a maternal immunity concept. Copyright © 2015 Elsevier Ltd. All rights reserved.

A recombinant fusion protein and DNA vaccines against foot-and-mouth disease virus type Asia 1 infection in guinea pigs.

PubMed

Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X

2003-01-01

On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.

The Genome of Gryllus bimaculatus Nudivirus Indicates an Ancient Diversification of Baculovirus-Related Nonoccluded Nudiviruses of Insects▿

PubMed Central

Wang, Yongjie; Kleespies, Regina G.; Huger, Alois M.; Jehle, Johannes A.

2007-01-01

The Gryllus bimaculatus nudivirus (GbNV) infects nymphs and adults of the cricket Gryllus bimaculatus (Orthoptera: Gryllidae). GbNV and other nudiviruses such as Heliothis zea nudivirus 1 (HzNV-1) and Oryctes rhinoceros nudivirus (OrNV) were previously called “nonoccluded baculoviruses” as they share some similar structural, genomic, and replication aspects with members of the family Baculoviridae. Their relationships to each other and to baculoviruses are elucidated by the sequence of the complete genome of GbNV, which is 96,944 bp, has an AT content of 72%, and potentially contains 98 predicted protein-coding open reading frames (ORFs). Forty-one ORFs of GbNV share sequence similarities with ORFs found in OrNV, HzNV-1, baculoviruses, and bacteria. Most notably, 15 GbNV ORFs are homologous to the baculovirus core genes, which are associated with transcription (lef-8, lef-9, lef-4, vlf-1, and lef-5), replication (dnapol), structural proteins (p74, pif-1, pif-2, pif-3, vp91, and odv-e56), and proteins of unknown function (38K, ac81, and 19kda). Homologues to these baculovirus core genes have been predicted in HzNV-1 as well. Six GbNV ORFs are homologous to nonconserved baculovirus genes dnaligase, helicase 2, rr1, rr2, iap-3, and desmoplakin. However, the remaining 57 ORFs revealed no homology or poor similarities to the current gene databases. No homologous repeat (hr) sequences but fourteen short direct repeat (dr) regions were detected in the GbNV genome. Gene content and sequence similarity suggest that the nudiviruses GbNV, HzNV-1, and OrNV form a monophyletic group of nonoccluded double-stranded DNA viruses, which separated from the baculovirus lineage before this radiated into dipteran-, hymenopteran-, and lepidopteran-specific clades of occluded nucleopolyhedroviruses and granuloviruses. The accumulated information on the GbNV genome suggests that nudiviruses form a highly diverse and phylogenetically ancient sister group of the baculoviruses, which have evolved in a variety of highly divergent host orders. PMID:17360757

Identification of a novel NLS of herpes simplex virus type 1 (HSV-1) VP19C and its nuclear localization is required for efficient production of HSV-1.

PubMed

Li, You; Zhao, Lei; Wang, Shuai; Xing, Junji; Zheng, Chunfu

2012-09-01

Herpes simplex virus type 1 (HSV-1) triplex is a complex of three protein subunits, consisting of two copies of VP23 and one copy of VP19C. Here, we identified a non-classical NLS of VP19C between aa 50 and 61, and the nuclear import of VP19C was mediated by RanGTP and importin β1-, but not importin α5-, dependent pathway. Additionally, recombinant virus harbouring this NLS mutation (NLSm) replicates less efficiently as wild-type. These data strongly suggested that the nuclear import of VP19C is required for efficient HSV-1 production.

Heat Shock Protein 70 Enhances Mucosal Immunity against Human Norovirus When Coexpressed from a Vesicular Stomatitis Virus Vector

PubMed Central

Ma, Yuanmei; Duan, Yue; Wei, Yongwei; Liang, Xueya; Niewiesk, Stefan; Oglesbee, Michael

2014-01-01

ABSTRACT Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942–2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 × 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 × 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine. IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is uncultivable. Thus, a live vector-based vaccine may provide an alternative vaccine strategy. In this study, we developed a vesicular stomatitis virus (VSV)-based human NoV vaccine candidate. We constructed rVSV-HSP70-VP1, coexpressing heat shock protein (HSP70) and capsid (VP1) genes of human NoV, and rVSV-Luc-VP1, coexpressing firefly luciferase (Luc) and VP1 genes. We found that VSVs with a double gene insertion were significantly more attenuated than VSV with a single VP1 insertion (rVSV-VP1). Furthermore, we found that coexpression or coadministration of HSP70 from VSV vector significantly enhanced human NoV-specific mucosal immunity. Collectively, we developed an improved live vectored vaccine candidate for human NoV which will be useful for future clinical studies. PMID:24574391

[Application of second generation dual-source computed tomography dual-energy scan mode in detecting pancreatic adenocarcinoma].

PubMed

Xue, Hua-dan; Liu, Wei; Sun, Hao; Wang, Xuan; Chen, Yu; Su, Bai-yan; Sun, Zhao-yong; Chen, Fang; Jin, Zheng-yu

2010-12-01

To analyze the clinical value of multiple sequences derived from dual-source computed tomography (DSCT) dual-energy scan mode in detecting pancreatic adenocarcinoma. Totally 23 patients with clinically or pathologically diagnosed pancreatic cancer were enrolled in this retrospective study. DSCT (Definition Flash) was used and dual-energy scan mode was used in their pancreatic parenchyma phase scan (100kVp/230mAs and Sn140kVp/178mAs) . Mono-energetic 60kev, mono-energetic 80kev, mono-energetic 100kev, mono-energetic 120kev, linear blend image, non-linear blend image, and iodine map were acquired. pancreatic parenchyma-tumor CT value difference, ratio of tumor to pancreatic parenchyma, and pancreatic parenchyma-tumor contrast to noise ratio were calculated. One-way ANOVA was used for the comparison of diagnostic values of the above eight different dual-energy derived sequences for pancreatic cancer. The pancreatic parenchyma-tumor CT value difference, ratio of tumor to pancreatic parenchyma, and pancreatic parenchyma-tumor contrast to noise ratio were significantly different among eight sequences (P<0.05) . Mono-energetic 60kev image showed the largest parenchyma-tumor CT value [ (77.53 ± 23.42) HU] , and iodine map showed the lowest tumor/parenchyma enhancement ratio (0.39?0.12) and the largest contrast to noise ratio (4.08 ± 1.46) . Multiple sequences can be derived from dual-energy scan mode with DSCT via multiple post-processing methods. Integration of these sequences may further improve the sensitivity of the multislice spiral CT in the diagnosis of pancreatic cancer.

Phylogenetic analysis of a transfusion-transmitted hepatitis A outbreak.

PubMed

Hettmann, Andrea; Juhász, Gabriella; Dencs, Ágnes; Tresó, Bálint; Rusvai, Erzsébet; Barabás, Éva; Takács, Mária

2017-02-01

A transfusion-associated hepatitis A outbreak was found in the first time in Hungary. The outbreak involved five cases. Parenteral transmission of hepatitis A is rare, but may occur during viraemia. Direct sequencing of nested PCR products was performed, and all the examined samples were identical in the VP1/2A region of the hepatitis A virus genome. HAV sequences found in recent years were compared and phylogenetic analysis showed that the strain which caused these cases is the same as that had spread in Hungary recently causing several hepatitis A outbreaks throughout the country.

Molecular Tectonic Model of Virus Structural Transitions: the Putative Cell Entry States of Poliovirus

PubMed Central

Belnap, David M.; Filman, David J.; Trus, Benes L.; Cheng, Naiqian; Booy, Frank P.; Conway, James F.; Curry, Stephen; Hiremath, Chaitanya N.; Tsang, Simon K.; Steven, Alasdair C.; Hogle, James M.

2000-01-01

Upon interacting with its receptor, poliovirus undergoes conformational changes that are implicated in cell entry, including the externalization of the viral protein VP4 and the N terminus of VP1. We have determined the structures of native virions and of two putative cell entry intermediates, the 135S and 80S particles, at ∼22-Å resolution by cryo-electron microscopy. The 135S and 80S particles are both ∼4% larger than the virion. Pseudoatomic models were constructed by adjusting the beta-barrel domains of the three capsid proteins VP1, VP2, and VP3 from their known positions in the virion to fit the 135S and 80S reconstructions. Domain movements of up to 9 Å were detected, analogous to the shifting of tectonic plates. These movements create gaps between adjacent subunits. The gaps at the sites where VP1, VP2, and VP3 subunits meet are plausible candidates for the emergence of VP4 and the N terminus of VP1. The implications of these observations are discussed for models in which the externalized components form a transmembrane pore through which viral RNA enters the infected cell. PMID:10627545

Molecular tectonic model of virus structural transitions: the putative cell entry states of poliovirus.

PubMed

Belnap, D M; Filman, D J; Trus, B L; Cheng, N; Booy, F P; Conway, J F; Curry, S; Hiremath, C N; Tsang, S K; Steven, A C; Hogle, J M

2000-02-01

Upon interacting with its receptor, poliovirus undergoes conformational changes that are implicated in cell entry, including the externalization of the viral protein VP4 and the N terminus of VP1. We have determined the structures of native virions and of two putative cell entry intermediates, the 135S and 80S particles, at approximately 22-A resolution by cryo-electron microscopy. The 135S and 80S particles are both approximately 4% larger than the virion. Pseudoatomic models were constructed by adjusting the beta-barrel domains of the three capsid proteins VP1, VP2, and VP3 from their known positions in the virion to fit the 135S and 80S reconstructions. Domain movements of up to 9 A were detected, analogous to the shifting of tectonic plates. These movements create gaps between adjacent subunits. The gaps at the sites where VP1, VP2, and VP3 subunits meet are plausible candidates for the emergence of VP4 and the N terminus of VP1. The implications of these observations are discussed for models in which the externalized components form a transmembrane pore through which viral RNA enters the infected cell.

Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

PubMed Central

2014-01-01

Background The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. Results Heterologous expression of the class II peroxidase genes, followed by kinetic studies, enabled their functional classification. The resulting inventory revealed the absence of lignin peroxidases (LiPs) and the presence of three versatile peroxidases (VPs) and six manganese peroxidases (MnPs), the crystal structures of two of them (VP1 and MnP4) were solved at 1.0 to 1.1 Å showing significant structural differences. Gene expansion supports the importance of both peroxidase types in the white-rot lifestyle of this fungus. Using a lignin model dimer and synthetic lignin, we showed that VP is able to degrade lignin. Moreover, the dual Mn-mediated and Mn-independent activity of P. ostreatus MnPs justifies their inclusion in a new peroxidase subfamily. The availability of the whole POD repertoire enabled investigation, at a biochemical level, of the existence of duplicated genes. Differences between isoenzymes are not limited to their kinetic constants. Surprising differences in their activity T50 and residual activity at both acidic and alkaline pH were observed. Directed mutagenesis and spectroscopic/structural information were combined to explain the catalytic and stability properties of the most interesting isoenzymes, and their evolutionary history was analyzed in the context of over 200 basidiomycete peroxidase sequences. Conclusions The analysis of the P. ostreatus genome shows a lignin-degrading system where the role generally played by LiP has been assumed by VP. Moreover, it enabled the first characterization of the complete set of peroxidase isoenzymes in a basidiomycete, revealing strong differences in stability properties and providing enzymes of biotechnological interest. PMID:24387130

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.