Sample records for watson method

  1. Algebraic Methods to Design Signals

    DTIC Science & Technology

    2015-08-27

    sequence pairs with optimal correlation values. 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially balanced incomplete block designs with two...IEEE Transactions Information Theory, Volume: 58, Issue: 11, Nov 2012, Page(s): 6968 – 6978 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially

  2. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    PubMed

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P < .001). Despite the high correlation, the Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist circumference (general and abdominal obesity) were correlated with the greater TBW overestimation by the Watson formula. We created separate equations for men and women based on weight and waist circumference. The main limitation of our study was the lack of an external validation for our novel estimating equation. Furthermore, though BIS has been validated against traditional reference standards, our assumption that it represents the "gold standard" for body compartment assessment may be flawed. The Watson formula generally overestimates TBW in chronic dialysis recipients, particularly in patients with the highest waist circumference. Widespread reliance on the Watson formula for derivation of TBW may lead to the underestimation of Kt/V urea. .

  3. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    ERIC Educational Resources Information Center

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  4. Behaviorism

    ERIC Educational Resources Information Center

    Moore, J.

    2011-01-01

    Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

  5. Closure properties of Watson-Crick grammars

    NASA Astrophysics Data System (ADS)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  6. Automated problem list generation and physicians perspective from a pilot study.

    PubMed

    Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric

    2017-09-01

    An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Elevation, west portal. Sign on portal reads Watson Mill Bridge, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Elevation, west portal. Sign on portal reads Watson Mill Bridge, est. 1885. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA

  8. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    USDA-ARS?s Scientific Manuscript database

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. Weighted Watson-Crick automata

    NASA Astrophysics Data System (ADS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-07-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  11. Durbin-Watson partial least-squares regression applied to MIR data on adulteration with edible oils of different origins.

    PubMed

    Jović, Ozren

    2016-12-15

    A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    PubMed

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  13. Data Discovery with IBM Watson

    NASA Astrophysics Data System (ADS)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes andmore » fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.« less

  15. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    PubMed

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and James Watson will not just be exonerated but vindicated as an exemplar of the true morality of science: that scientific communication needs to be allowed to be clear, direct - even crass - in the pursuit of truth. James Watson has been a hero of science for the achievements of his career, and also a martyr for science at the end of his career.

  16. 76 FR 55425 - Post Office Closing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-07

    ... the closing of the Watson, Alabama post office has been filed. It identifies preliminary steps and... Postal Service's determination to close the Watson post office in Watson, Alabama. The petition was filed...

  17. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  18. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  19. An analytical and numerical study of Galton-Watson branching processes relevant to population dynamics

    NASA Astrophysics Data System (ADS)

    Jang, Sa-Han

    Galton-Watson branching processes of relevance to human population dynamics are the subject of this thesis. We begin with an historical survey of the invention of the invention of this model in the middle of the 19th century, for the purpose of modelling the extinction of unusual surnames in France and Britain. We then review the principal developments and refinements of this model, and their applications to a wide variety of problems in biology and physics. Next, we discuss in detail the case where the probability generating function for a Galton-Watson branching process is a geometric series, which can be summed in closed form to yield a fractional linear generating function that can be iterated indefinitely in closed form. We then describe the matrix method of Keyfitz and Tyree, and use it to determine how large a matrix must be chosen to model accurately a Galton-Watson branching process for a very large number of generations, of the order of hundreds or even thousands. Finally, we show that any attempt to explain the recent evidence for the existence thousands of generations ago of a 'mitochondrial Eve' and a 'Y-chromosomal Adam' in terms of a the standard Galton-Watson branching process, or indeed any statistical model that assumes equality of probabilities of passing one's genes to one's descendents in later generations, is unlikely to be successful. We explain that such models take no account of the advantages that the descendents of the most successful individuals in earlier generations enjoy over their contemporaries, which must play a key role in human evolution.

  20. Sleeping under the stars

    NASA Astrophysics Data System (ADS)

    Zirkel, Jack

    Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

  1. John B. Watson's Legacy: Learning and Environment.

    ERIC Educational Resources Information Center

    Horowitz, Frances Degen

    1992-01-01

    Evaluates John B. Watson's contributions to developmental psychology. Watson's insistence on objective methodology in psychology retains its influence, but his extreme environmentalism has been rejected. His concern with the principles of learning is reflected in the work of Hull and Skinner. (BC)

  2. Oblique perspective of portal, due north. Bridge has gable roof ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Oblique perspective of portal, due north. Bridge has gable roof clad with wood shingles and has board and batten siding. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA

  3. Oblique perspective, due east by 70 degrees. Note concrete pier, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Oblique perspective, due east by 70 degrees. Note concrete pier, added CA. 1930's. Other piers and abutments are heavily mortared rubble stone. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA

  4. Some Lady! A Conversation with Dorothy Watson, Outstanding Educator in the Language Arts.

    ERIC Educational Resources Information Center

    Bishop, Rudine Sims

    2002-01-01

    Presents a conversation with Dorothy Watson, the 2002 Outstanding Educator in the Language Arts recipient. Hopes that this profile will provide insight into Dorothy Watson and her intellectual foundations, her humaneness, and her passion for teaching and learning. (SG)

  5. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    PubMed

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  6. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    PubMed Central

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  7. The multiple personalities of Watson and Crick strands.

    PubMed

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  8. 78 FR 52230 - Government/Industry Aeronautical Charting Forum Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-22

    ...: [email protected] . For information relating to the Charting Group, contact Valerie S. Watson...) 427-5155; Email: valerie.s.watson@faa.gov . SUPPLEMENTARY INFORMATION: Pursuant to Sec. 10(a)(2) of... if time permits. Issued in Washington, DC, on August 15, 2013. Valerie S. Watson, Co-Chair...

  9. 77 FR 1471 - The Historically Black College and University Capital Financing Advisory Board

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-10

    ... INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black College and University Capital...; telephone: (202) 219-7037; fax: (202) 502-7852; email: donald.watson@ed.gov . Individuals who use a..., assistance listening devices, or materials in alternative format) should notify Donald Watson at (202) 219...

  10. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-20

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  11. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-25

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  12. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  13. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  14. Propagation of Species at Risk Atlantic Pigtoe on Military Installations

    DTIC Science & Technology

    2010-04-30

    adult mussels are constantly being adapted to meet the needs of each species. 6.0. PROCEDURES 6.1. Potential Host Fish Collection In order to...Watson) o VA freshwater mussel web atlas (Watson) o Freshwater gastropod of VA web atlas, Atlantic slope (Watson) 5) Other Issues of Interest

  15. Historical Review of Emergency Tourniquet Use to Stop Bleeding

    DTIC Science & Technology

    2012-02-01

    comment to, “More lives have been lost than were ever saved by the use of the tourniquet.”49 Watson- Jones concluded that the emergency tourniquet was a dan...in major limb trauma. J Trauma 2008;64: S38–50. 21. Kragh JF Jr, Littrel ML, Jones JA, et al. Battle casualty survival with emergency tourniquet use...Watson- Jones . J Bone Joint Surg 1972;54B:569–75. 48. Watson- Jones R. Fractures and Joint Injuries. London: Livingstone; 1955:121–2. 49. Watson- Jones R

  16. The multiple personalities of Watson and Crick strands

    PubMed Central

    2011-01-01

    Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550

  17. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    PubMed

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  18. 75 FR 42081 - The Historically Black College and University Capital Financing Advisory Board

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-20

    ..., DC. 20001. FOR FURTHER INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black... 6071, Washington, DC 20006; telephone: (202) 219-7037; fax: (202) 502-7852; e-mail: donald.watson@ed...) should notify Donald Watson at 202 219-7037, no later than July 16, 2010. We will attempt to meet...

  19. 76 FR 5424 - Motor Carrier Safety Advisory Committee; Request for Nominations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-31

    ... FURTHER INFORMATION CONTACT: Ms. Shannon L. Watson, MCSAC Liaison, FMCSA, at 202-385-2395 or via e-mail at Shannon.Watson@dot.gov . SUPPLEMENTARY INFORMATION: I. Background Section 4144 of the Safe, Accountable...://mcsac.fmcsa.dot.gov/ , completed on-line, and e-mailed to Shannon L. Watson, MCSAC liaison, at Shannon...

  20. Computational Methods for Inviscid and Viscous Two-and-Three-Dimensional Flow Fields.

    DTIC Science & Technology

    1975-01-01

    Difference Equations Over a Network, Watson Sei. Comput. Lab. Report, 19U9. 173- Isaacson, E. and Keller, H. B., Analaysis of Numerical Methods...element method has given a new impulse to the old mathematical theory of multivariate interpolation. We first study the one-dimensional case, which

  1. 77 FR 40058 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-06

    ... Affairs Officer) 90 Hennepin Avenue, Minneapolis, Minnesota 55480-0291: 1. Thomas Watson, Grand Forks, North Dakota, as an individual and as trustee, and Thomas Watson and Toby Kommer, Fargo, North Dakota... indirectly acquire control of Bank Forward, Hannaford, North Dakota. In addition, Mr. Watson and Mr. Kommer...

  2. Making IBM's Computer, Watson, Human

    ERIC Educational Resources Information Center

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  3. 77 FR 57068 - Hours of Service of Drivers of Commercial Motor Vehicles; Regulatory Guidance for Oil Field...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-17

    ... 20590, phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson..., 1200 New Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Ms. Watson...

  4. 77 FR 46640 - Hours of Service of Drivers of Commercial Motor Vehicles; Regulatory Guidance for Oil Field...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-06

    ..., phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson, Senior... Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Shannon Watson at (202...

  5. From theory to practice: caring science according to Watson and Brewer.

    PubMed

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  6. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    PubMed

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  7. Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

    PubMed

    Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

    2017-07-11

    RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

  8. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    ERIC Educational Resources Information Center

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  9. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  10. Binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs in the Watson-Crick and Hoogsteen configurations.

    PubMed

    Morari, Cristian; Bogdan, Diana; Muntean, Cristina M

    2012-11-01

    The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.

  11. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    ERIC Educational Resources Information Center

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  12. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    PubMed

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  13. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    PubMed

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  14. Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer

    DTIC Science & Technology

    2001-10-01

    Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES...markers of the invasive phenotype in human breast cancer" Dr Peter H. Watson INTRODUCTION. The acquisition of the ability to invade is the single most

  15. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    PubMed

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  16. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    PubMed

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  17. Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression.

    PubMed

    Chen, Yanguang

    2016-01-01

    In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson's statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran's index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China's regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test.

  18. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)<-->A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  19. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  20. 77 FR 13683 - Government/Industry Aeronautical Charting Forum Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-07

    .... Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance & Regulatory..., on February 28, 2012. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum. [FR Doc. 2012-5293...

  1. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    PubMed

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  2. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    DTIC Science & Technology

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  3. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  4. 78 FR 12415 - Government/Industry Aeronautical Charting Forum Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-22

    ... Valerie S. Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance.... Issued in Washington, DC, on February 19, 2013. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum...

  5. Genetics Home Reference: Alagille syndrome

    MedlinePlus

    ... my area? Other Names for This Condition Alagille-Watson Syndrome Alagille's syndrome arteriohepatic dysplasia (AHD) cardiovertebral syndrome ... hypoplasia hepatofacioneurocardiovertebral syndrome paucity of interlobular bile ducts Watson-Miller syndrome Related Information How are genetic conditions ...

  6. 20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. Gary Stich, operator. - Juniata Shops, Erecting Shop & Machine Shop, East of Fourth Avenue, between Fourth & Fifth Streets, Altoona, Blair County, PA

  7. Replication infidelity via a mismatch with Watson-Crick geometry.

    PubMed

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  8. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    PubMed

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. A BAYESIAN METHOD OF ESTIMATING KINETIC PARAMETERS FOR THE INACTIVATION OF CRYPTOSPORIDIUM PARVUM OOCYSTS WITH CHLORINE DIOXIDE AND OZONE

    EPA Science Inventory

    The main objective of this paper is to use Bayesian methods to estimate the kinetic parameters for the inactivation kinetics of Cryptosporidium parvum oocysts with chlorine dioxide or ozone which are characterized by the delayed Chick-Watson model, i.e., a lag phase or shoulder f...

  10. 27 CFR 9.137 - Grand Valley.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

  11. 76 FR 53924 - Merchant Mariner Medical Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-30

    ... and swearing in of the new members; (3) Remarks from Coast Guard Leadership, Rear Admiral J. A. Watson.../presentations; and (3) Closing remarks/plans for next meeting. Dated: August 24, 2011. J. A. Watson, Rear...

  12. 27 CFR 9.137 - Grand Valley.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

  13. 76 FR 58817 - National Boating Safety Advisory Council; Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-22

    ... and RADM James Watson, USCG Director of Prevention Policy; (2) Receipt and discussion of the following... October 3, 2011. Dated: September 16, 2011. James A. Watson, Rear Admiral, U.S. Coast Guard, Director of...

  14. 27 CFR 9.137 - Grand Valley.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

  15. 27 CFR 9.137 - Grand Valley.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

  16. 27 CFR 9.137 - Grand Valley.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

  17. 77 FR 40947 - Motor Carrier Safety Advisory Committee (MCSAC): Membership Solicitation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-11

    .... Shannon L. Watson, Senior Advisor to the Associate Administrator for Policy, Federal Motor Carrier Safety....fmcsa.dot.gov/ , completed on-line and emailed to Shannon L. Watson, Senior Advisor to the Associate...

  18. 75 FR 63509 - Notice of Determinations Regarding Eligibility To Apply for Worker Adjustment Assistance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-15

    .... Products LLC. 74,606 Watson Laboratories, Inc., Carmel, NY September 3, 2009. Watson Pharmaceuticals...--Enterprise Services), Virtual Workers Across the United States. 74,343 JohnsonDiversey Santa Cruz, CA...

  19. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  20. James E. Watson, Jr.: Named to the Health Physics Society

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strom, Daniel J.; Stansbury, Paul S.

    At its 2010 Annual Meeting, the Health Physics Society named James E. Watson, Jr. to its Honor Roll of distinguished members. This citation summarizes Professor Jim Watson's life and professional career at the University of North Carolina at Chapel Hill, where he led the Radiological Hygiene program in the School of Public Health for nearly 3 decades. He was President of the Health Physics Society during the 1985-1986 term. He did pioneering work in radiation dose reconstruction for epidemiology as part of the U.S. Department of Energy Health and Mortality Studies.

  1. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  2. How Many Cancers Are Linked with HPV Each Year?

    MedlinePlus

    ... 24:1548–1556. 3 Viens LJ, Henley SJ, Watson M, Markowitz LE, Thomas CC, Thompson TD, Razzaghi ... Lynch CF, Hernandez BY, Lyu CW, Steinau M, Watson M, Wilkinson EJ, Hopenhayn C, Copeland G, Cozen ...

  3. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    EPA Pesticide Factsheets

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  4. 21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 049185 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Olney Ave., Cherry Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880...

  5. 21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 50704 017139 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000842 Texas...

  6. Commentary on Malone: Who Founded Behaviorism?

    PubMed

    Reese, Hayne W

    2015-05-01

    Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

  7. A Vision System Model

    DTIC Science & Technology

    1991-06-01

    Away" in Mind and Cognition: A Reader. Ed. William G. Lycan. Cambridge MA: Basil Blackwell. Pp. 63-77. (1990c). Descartes , Rene . Rules for the Direction...other case, we accept that we cannot or need not understand the methods of the brain [behaviorism - Watson; Dualism - Descartes ; Intentionalism

  8. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    PubMed

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  9. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean-Watson formula

    NASA Astrophysics Data System (ADS)

    Hey, J. D.

    2014-08-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean-Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon-Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n‧ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound-bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521, Ali-Haïmoud 2013 Phys. Rev. D 87 023526).

  10. Discovering Watson's Crick in High School Chemistry.

    ERIC Educational Resources Information Center

    Whitman, Mark

    1984-01-01

    High school chemistry students begin the school year by reading and studying "The Double Helix" by James B. Watson. Rationale, objectives, and instructional strategies for this assignment are discussed. Sample discussion questions based on the book are included. (JN)

  11. X-Ray Diffraction and the Discovery of the Structure of DNA

    ERIC Educational Resources Information Center

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  12. 77 FR 54577 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-05

    ..., Dallas, Texas 75201-2272: 1. Rebecca Watson Vizard, St. Joseph Louisiana; Michael Rene Vizard, St. Joseph... William Wade Watson, St. Joseph, Louisiana, (collectively known as the ``Vizard Family Group'') to retain...

  13. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories

    PubMed Central

    Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein

    2017-01-01

    Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker–Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Conclusions: Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence. PMID:28584543

  15. Oncologists partner with Watson on genomics.

    PubMed

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  16. The web server of IBM's Bioinformatics and Pattern Discovery group.

    PubMed

    Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo

    2003-07-01

    We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.

  17. The web server of IBM's Bioinformatics and Pattern Discovery group

    PubMed Central

    Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo

    2003-01-01

    We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/. PMID:12824385

  18. Promoting Literacy Development for Beginning English Learners

    ERIC Educational Resources Information Center

    Bauer, Eurydice Bouchereau; Arazi, Juliana

    2011-01-01

    Studies show that teachers struggle with meeting the needs of immigrant students, especially recent arrivals (Szente, Hoot, & Taylor, 2006; Tadesse, Hoot, & Watson-Thompson, 2009). To some extent, this is due to the instructional method and unfamiliar curriculum to the students. This column presents elements of one teacher's literacy instruction…

  19. Riemann tensor of motion vision revisited.

    PubMed

    Brill, M

    2001-07-02

    This note shows that the Riemann-space interpretation of motion vision developed by Barth and Watson is neither necessary for their results, nor sufficient to handle an intrinsic coordinate problem. Recasting the Barth-Watson framework as a classical velocity-solver (as in computer vision) solves these problems.

  20. Making IBM's Computer, Watson, Human

    PubMed Central

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial “self,” are all incidental to its humanity. PMID:22942530

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geltman, S.

    Recent measurements on CO{sub 2}-laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for {ital E}{sub 0}/2{omega}{sup 2}{lt}1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations inmore » perturbation theory shows that use of the {open_quote}{open_quote}outgoing{close_quote}{close_quote} wave final state gives much better agreement with experiment than does the {open_quote}{open_quote}ingoing{close_quote}{close_quote} wave final state, which is different from the choice made in early bremsstrahlung theory. {copyright} {ital 1996 The American Physical Society.}« less

  2. On how Watson and Crick discovered what Watson and Crick had suggested: the "folk" concept of discovery rediscovered.

    PubMed

    Charpa, Ulrich

    2008-01-01

    This article opens with general and historical remarks on philosophy of science's problems with the concept of discovery. Then, drawing upon simple examples of Watson's and Crick's non-philosophical usage, I characterize phrases of the type "x discovers y" semantically. It will subsequently be shown how widespread philosophical discussion on discovery violates the semantic constraints of phrases of the type "x discovers y." Then I provide a philosophical reconstruction of "x discovers y" that is in keeping with the "folk" notion of discovery. The philosophical ingredients of this approach are taken from a certain aspect of action theory and from epistemological reliabilism. The approach draws upon the concept of superior action and connects this concept to progressive research. In contrast to normal actions, superior actions are primarily explained by competencies. This perspective includes reminders of what some nineteenth-century philosopher-scientists had advocated as a competence-oriented view on scientific research. Finally, this approach is applied to the case of Watson's and Crick's discovery.

  3. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  4. Making IBM's Computer, Watson, Human.

    PubMed

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial "self," are all incidental to its humanity.

  5. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    PubMed

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  6. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    PubMed

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  7. Critical Thinking in Adulthood.

    ERIC Educational Resources Information Center

    Fulton, Rodney D.

    Critical thinking is often defined as that which a particular instrument measures. The most prominent tests are the Watson-Glaser Critical Thinking Appraisal, the Ennis-Weir Critical Thinking Essay Test, and the Cornell Critical Thinking Tests. Watson and Glaser's (1980) view of critical thinking is "a composite of attitudes, knowledge, and…

  8. James Craig Watson (1838-1880)

    NASA Astrophysics Data System (ADS)

    Broughton, Peter

    1996-04-01

    Canadians feel a bittersweet pride when young people leave to make their fame and fortune in the United States. The life of the eminent nineteenth century astronomer, J. C. Watson, is another example from history that our brightest and best emigrate when educational and career opportunities are lacking at home.

  9. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    EPA Pesticide Factsheets

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  10. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    PubMed

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  11. Does Size Matter?

    ERIC Educational Resources Information Center

    Watson, David

    2014-01-01

    In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

  12. Extreme Scale Computing Studies

    DTIC Science & Technology

    2010-12-01

    PUBLICATION IN ACCORDANCE WITH ASSIGNED DISTRIBUTION STATEMENT. *//Signature// //Signature// KERRY HILL, Program Manager BRADLEY J ...Research Institute William Carlson Institute for Defense Analyses William Dally Stanford University Monty Denneau IBM T. J . Watson Research...for Defense Analyses William Dally, Stanford University Monty Denneau, IBM T. J . Watson Research Laboratories Paul Franzon, North Carolina State

  13. A Challenge to Watson

    ERIC Educational Resources Information Center

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  14. Validating the Watson Glaser Critical Thinking Appraisal

    ERIC Educational Resources Information Center

    Hassan, Karma El; Madhum, Ghida

    2007-01-01

    This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…

  15. Contribution of transpersonal care to cardiac patients in the postoperative period of heart surgery.

    PubMed

    Rabelo, Ana Cleide Silva; Souza, Fabíola Vládia Feire Silva; Silva, Lúcia de Fátima da

    2018-06-07

    To know the contribution of Watson's theory to nursing care for cardiac patients in the postoperative period of cardiac surgery. This is a qualitative study based on the research-care method conducted with ten patients who underwent cardiac surgery in a specialised hospital from June to August 2013, in the city of Fortaleza, Ceará, Brazil. Data were submitted to content analysis based on the Clinical Caritas Process. The results led to four thematic categories: Awareness of being cared for by another being, System of beliefs and subjectivity, Relation of support and trust, and Expression of feelings. Surgery transformed the lives of the patients related to the process of being cared for by other people. The application of Watson's theory to care for cardiac patients after heart surgery shed valuable light on the importance of transpersonal care for the expansion of nursing care.

  16. The Application of Language Acquisition Theory to Programming Concept Instruction: Chunks versus Programs from Scratch.

    ERIC Educational Resources Information Center

    Applin, Elizabeth Anne Gates

    This study explored the relationship between assignment-based teaching methods and achievement in an introductory programming course. Subjects in the study were 42 community college students in south Mississippi. All participants completed the Watson-Glaser Critical Thinking Appraisal and the Productive Environment Preferences Survey. These…

  17. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics

    PubMed Central

    2016-01-01

    Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. Objective To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. Methods The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Results Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix. Conclusions IBMWA is a new alternative for data analytics software that automates descriptive, predictive, and visual analytics. This program is very user-friendly but requires data preprocessing, statistical conceptual understanding, and domain expertise. PMID:27729304

  18. USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment. Number 25.

    DTIC Science & Technology

    1976-10-29

    is necessary to consider the problem of diffraction at a_cylindrical cavity. Some methods of solving this problem become very un- wieldy, when...applied to such a cavity of large wave dimensions, even with the aid of a digital computer. In the simpler Watson method , the series represent- ing the...potential of cylindrical waves is transformed to an integral in the complex plane and evaluated as the sum of residues. A difficulty in this method

  19. The ϱ-ππ coupling constant in lattice gauge theory

    NASA Astrophysics Data System (ADS)

    Gottlieb, Steven; MacKenzie, Paul B.; Thacker, H. B.; Weingarten, Don

    1984-01-01

    We present a method for studying hadronic transitions in lattice gauge theory which requires computer time comparable to that required by recent hadron spectrum calculations. This method is applied to a calculation of the decay ϱ-->ππ. On leave from the Department of Physics, Indiana University, Bloomington, IN 47405, USA. Address after September 1, 1983: IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598, USA.

  20. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    PubMed

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  1. Educational Technologists: Leading Change for a New Paradigm of Education

    ERIC Educational Resources Information Center

    Aslan, Sinem; Reigeluth, Charles M.

    2013-01-01

    The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

  2. Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

    ERIC Educational Resources Information Center

    Fukawa-Connelly, Timothy Patrick; Newton, Charlene

    2014-01-01

    Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

  3. Music Technology and Musical Creativity: Making Connections

    ERIC Educational Resources Information Center

    Thompson, Douglas Earl

    2012-01-01

    This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

  4. Bringing Precision Medicine to Community Oncologists.

    PubMed

    2017-01-01

    Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

  5. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    PubMed

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  7. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    PubMed

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the electrostatic energy determined with the aid of ab initio methods.

  8. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  9. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  10. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as analysis of ice cores obtained during the deployment and returned for subsequent study.

  11. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    PubMed

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 <-- S0 vibronic spectra of 2PY.U, 2PY.3MU, 2PY.1MU, and 2PY.T were measured using UV laser resonant two-photon ionization (R2PI). The spectra of the Watson-Crick and wobble isomers of 2PY.1MU were separated using UV-UV spectral hole-burning. We identify the different isomers by combining three different diagnostic tools: (1) Selective methylation of the uracil N3-H group, which allows formation of the sugar-edge isomer only, and methylation of the N1-H group, which leads to formation of the Watson-Crick and wobble isomers. (2) The experimental S1 <-- S0 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  12. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  13. Development of a New Critical Thinking Test Using Item Response Theory

    ERIC Educational Resources Information Center

    Wagner, Teresa A.; Harvey, Robert J.

    2006-01-01

    The authors describe the initial development of the Wagner Assessment Test (WAT), an instrument designed to assess critical thinking, using the 5-faceted view popularized by the Watson-Glaser Critical Thinking Appraisal (WGCTA; G. B. Watson & E. M. Glaser, 1980). The WAT was designed to reduce the degree of successful guessing relative to the…

  14. Watson for Genomics: Moving Personalized Medicine Forward.

    PubMed

    Rhrissorrakrai, Kahn; Koyama, Takahiko; Parida, Laxmi

    2016-08-01

    The confluence of genomic technologies and cognitive computing has brought us to the doorstep of widespread usage of personalized medicine. Cognitive systems, such as Watson for Genomics (WG), integrate massive amounts of new omic data with the current body of knowledge to assist physicians in analyzing and acting on patient's genomic profiles. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Racial Identification and Audience in "Roll of Thunder, Hear My Cry" and "The Watsons Go to Birmingham--1963"

    ERIC Educational Resources Information Center

    Barker, Jani L.

    2010-01-01

    Multiethnic children's literature addresses multiple audiences, providing different reading experiences and benefits for each. Using critical race theory as an interpretive tool, this article examines how two African American historical fiction novels, Mildred Taylor's "Roll of Thunder, Hear My Cry" and Christopher Paul Curtis's "The Watsons Go to…

  16. Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors

    ERIC Educational Resources Information Center

    Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.

    2005-01-01

    The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…

  17. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    ERIC Educational Resources Information Center

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  18. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    ERIC Educational Resources Information Center

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  19. A Middle-School Classroom Inquiry: Estimating the Height of a Tree

    ERIC Educational Resources Information Center

    Watson, Jane; Brown, Natalie; Wright, Suzie; Skalicky, Jane

    2011-01-01

    There is an old saying that "there is more than one way to skin a cat." Such is the case with finding the height of tall objects, a task that people have been approximating for centuries. Following an article in the "Australian Primary Mathematics Classroom" (APMC) with methods appropriate for primary students (Brown, Watson,…

  20. Eckert, Wallace John (1902-71)

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    Computer scientist and astronomer. Born in Pittsburgh, PA, Eckert was a pioneer of the use of IBM punched card equipment for astronomical calculations. As director of the US Nautical Almanac Office he introduced computer methods to calculate and print tables instead of relying on human `computers'. When, later, he became director of the Watson Scientific Computing Laboratory at Columbia Universit...

  1. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    PubMed

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  2. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  3. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    PubMed

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  4. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  5. 1400289

    NASA Image and Video Library

    2014-04-17

    Marshall Center Director Patrick Scheuermann and Dr. Lisa Watson-Morgan talk to news media at the April 17 Marshall 2014 Update. Watson-Morgan, the first woman to be named the center's chief engineer, answered questions about progress on the Space Launch System and other projects, and spoke about the importance of attracting young people to science, technology, engineering and mathematics education to maintain a "pipeline" of future engineers.

  6. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    ERIC Educational Resources Information Center

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  7. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  8. Examining Current Conceptualizations of Psychopathology With the MMPI-2/MMPI-2-RF Restructured Clinical Scales: Preliminary Findings From a Cross-Cultural Study.

    PubMed

    Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S

    2017-01-01

    Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.

  9. Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression

    PubMed Central

    Chen, Yanguang

    2016-01-01

    In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson’s statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran’s index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China’s regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test. PMID:26800271

  10. Characteristics of the Footprints of Field Lines for Variable Location of Plate for a Single-Null Divertor Tokamak with the Effects of Dipole Coil Using Method of Maps

    NASA Astrophysics Data System (ADS)

    Burton, Joni; Ali, Halima; Punjabi, Alkesh

    1996-11-01

    We determine the properties of the footprint of the magnetic field lines from the stochastic scrape-off layer of a single-null divertor tokamak including the effects of an externally placed dipole coil as the location of the divertor plate is varied. We use the Method of Maps (Punjabi A, Verma A and Boozer A, Phys Rev Lett), 69, 3322 (1992) and J Plasma Phys, 52, 91 (1994) for this investigation. The unperturbed magnetic topology is represented by the Symmetric Simple Map (Ali H, Watson M, Mayer C, Punjabi A and Boozer A, Bull Am Phys Soc), 40, 1855 (1995). The effects of the dipole coil are repesented by the Dipole Map (Ali H, Watson M, Punjabi A and Boozer A, Sherwood Mtg), paper 1C20 (1996). A single dipole coil is placed across from the X-point below the last good surface. The area of the footprint is calculated using the method of fractal dimesion. This work is supported by US DOE OFES. Joni Burton is an undergraduate mathematics major at Hampton University. She is a Ronald E. McNair Scholar at HU supported by R. E. McNair Foundation.

  11. Calculation of the Area of Stochastic Layer for a Single-Null Divertor Tokamak with the Effects of Dipole Coil Using Method of Maps

    NASA Astrophysics Data System (ADS)

    Basemore, Alphonso; Ali, Halima; Watson, Michael; Punjabi, Alkesh

    1996-11-01

    We calculate the variation in area of the stochastic scrape-off layer of a single-null divertor tokamak resulting from the effects of an externally placed dipole coil using the Method of Maps (Punjabi A, Verma A and Boozer A, Phys Rev Lett), 69, 3322 (1992) and J Plasma Phys, 52, 91 (1994). The unperturbed magnetic topology is represented by the Symmetric Simple Map (Ali H, Watson M, Mayer C, Punjabi A and Boozer A, Bull Am Phys Soc), 40, 1855 (1995). The effects of the dipole coil are repesented by the Dipole Map (Ali H, Watson M, Punjabi A and Boozer A, Sherwood Mtg), paper 1C20 (1996). A single dipole coil is placed across from the X-point below the last good surface. The strength of the dipole perturbation and the distance of the coil from last good surface are varied. The area of the stochastic layer is calculated using the method of fractal dimension. This work is supported by US DOE OFES. Alphonso Basemore is a HU CFRT Summer Fusion High School Workshop scholar from Mount Tabor High School in North Carolina. He is supported by NASA under its NASA SharpPlus Program.

  12. Use of Edible Laminate Layers in Intermediate Moisture Food Rations to Inhibit Moisture Migration

    DTIC Science & Technology

    2016-04-29

    methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on one side Watson, Inc. Dual-sided HPMC moisture...barrier film Hydroxypropyl methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on both sides...Moisture Barrier (BWMB) film #1 Pullulan*, beeswax, glycerin, propylene glycol, starch , polysorbate 80 Water soluble Watson, Inc. Pullulan BWMB film

  13. "I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"

    ERIC Educational Resources Information Center

    McNair, Jonda C.

    2008-01-01

    This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…

  14. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    ERIC Educational Resources Information Center

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  15. Visual Marking and Change Blindness: Moving Occluders and Transient Masks Neutralize Shape Changes to Ignored Objects

    ERIC Educational Resources Information Center

    Watson, Derrick G.; Kunar, Melina A.

    2010-01-01

    Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys,…

  16. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  17. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

    ERIC Educational Resources Information Center

    Willis, Derek W.

    2010-01-01

    This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

  19. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  20. Design and Applications of Noncanonical DNA Base Pairs.

    PubMed

    Jissy, A K; Datta, Ayan

    2014-01-02

    While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

  1. The web server of IBM's Bioinformatics and Pattern Discovery group: 2004 update

    PubMed Central

    Huynh, Tien; Rigoutsos, Isidore

    2004-01-01

    In this report, we provide an update on the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server, which is operational around the clock, provides access to a large number of methods that have been developed and published by the group's members. There is an increasing number of problems that these tools can help tackle; these problems range from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences, the identification—directly from sequence—of structural deviations from α-helicity and the annotation of amino acid sequences for antimicrobial activity. Additionally, annotations for more than 130 archaeal, bacterial, eukaryotic and viral genomes are now available on-line and can be searched interactively. The tools and code bundles continue to be accessible from http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/. PMID:15215340

  2. The web server of IBM's Bioinformatics and Pattern Discovery group: 2004 update.

    PubMed

    Huynh, Tien; Rigoutsos, Isidore

    2004-07-01

    In this report, we provide an update on the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server, which is operational around the clock, provides access to a large number of methods that have been developed and published by the group's members. There is an increasing number of problems that these tools can help tackle; these problems range from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences, the identification--directly from sequence--of structural deviations from alpha-helicity and the annotation of amino acid sequences for antimicrobial activity. Additionally, annotations for more than 130 archaeal, bacterial, eukaryotic and viral genomes are now available on-line and can be searched interactively. The tools and code bundles continue to be accessible from http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.

  3. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  4. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  5. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    PubMed

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  6. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Physical Chemistry of Nucleic Acids

    NASA Astrophysics Data System (ADS)

    Tinoco, Ignacio

    2002-10-01

    The Watson-Crick double helix of DNA was first revealed in 1953. Since then a wide range of physical chemical methods have been applied to DNA and to its more versatile relative RNA to determine their structures and functions. My major goal is to predict the folded structure of any RNA from its sequence. We have used bulk and single-molecule measurements of thermodynamics and kinetics, plus various spectroscopic methods (UV absorption, optical rotation, circular dichroism, circular intensity differential scattering, fluorescence, NMR) to approach this goal.

  8. Final Report on Contract N00014-85-C-0078 (IBM Thomas J. Watson Research Center)

    DTIC Science & Technology

    1990-01-01

    beam was TIME(psec) sent through the sodium cell; its peak input power was Fig. 3. Observed polarization beats (solid curves) compared 350 W, and the...that describe a new and powerful method of are obtained by ombining these two methods, L~e., by sending measuring 4)(t) and thereby obtaining the...first application of this powerful combi- frequency-swept pulse is passed through a resonant vapornation was by Shank et al.,6 who compressed 90.fsec

  9. 33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

  10. 33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

  11. 33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

  12. 33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

  13. 33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

  14. An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

    PubMed

    Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

    2011-03-07

    Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

  15. Optimal Repair And Replacement Policy For A System With Multiple Components

    DTIC Science & Technology

    2016-06-17

    Numerical Demonstration To implement the linear program, we use the Python Programming Language (PSF 2016) with the Pyomo optimization modeling language...opre.1040.0133. Hart, W.E., C. Laird, J. Watson, D.L. Woodruff. 2012. Pyomo–optimization modeling in python , vol. 67. Springer Science & Business...Media. Hart, W.E., J. Watson, D.L. Woodruff. 2011. Pyomo: modeling and solving mathematical programs in python . Mathematical Programming Computation 3(3

  16. Perception of Long-Period Complex Sounds

    DTIC Science & Technology

    1989-11-27

    Richard M. Warren AFOSR Grant No. 88-0320 M CES Guttman, N. & Julesz, B. (1963). Lower limits of auditory periodicity analysis. Journal of the Aostical...order within auditory sequences. Peretion & PsvchobhVsics, 12, 86-90. Watson, C.S., (1987). Uncertainty, informational masking, and the capacity of...immediate memory. In W.A. Yost and C.S. Watson (eds.), Auditory Processing of Camlex Sounds. New Jersey: lawrence Erlbaum Associates, pp. 267-277

  17. 33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

  18. 33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

  19. 33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

  20. 33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rebay, S.

    This work is devoted to the description of an efficient unstructured mesh generation method entirely based on the Delaunay triangulation. The distinctive characteristic of the proposed method is that point positions and connections are computed simultaneously. This result is achieved by taking advantage of the sequential way in which the Bowyer-Watson algorithm computes the Delaunay triangulation. Two methods are proposed which have great geometrical flexibility, in that they allow us to treat domains of arbitrary shape and topology and to generate arbitrarily nonuniform meshes. The methods are computationally efficient and are applicable both in two and three dimensions. 11 refs.,more » 20 figs., 1 tab.« less

  2. Dispersive approaches for three-particle final state interaction

    DOE PAGES

    Guo, Peng; Danilkin, Igor V.; Szczepaniak, Adam P.

    2015-10-30

    In this work, we presented different representations of Khuri-Treiman equation, the advantage and disadvantage of each representations are discussed. With a scattering amplitude toy model, we also studied the sensitivity of solution of KT equation to left-hand cut of toy model and to the different approximate methods. At last, we give a brief discussion of Watson's theorem when three particles in final states are involved.

  3. Finite amplitude instability of second-order fluids in plane Poiseuille flow.

    NASA Technical Reports Server (NTRS)

    Mcintire, L. V.; Lin, C. H.

    1972-01-01

    The hydrodynamic stability of plane Poiseuille flow of second-order fluids to finite amplitude disturbances is examined using the method of Stuart and Watson as extended by Reynolds and Potter. For slightly non-Newtonian fluids subcritical instabilities are predicted. No supercritical equilibrium states are expected if the entire spectrum of disturbance wavelengths is present. Possible implications with respect to the Toms phenomenon are discussed.

  4. Affordability Tradeoffs Under Uncertainty Using Epoch-Era Analysis

    DTIC Science & Technology

    2013-09-30

    Procedia Computer Science , Retrieved from: http://www.elsevier.com Bobinis, J., Haimowitz, J., Tuttle, P., & Garrison, C. (2012, October). Affordability...commercial products. Dr. Rhodes received her PhD in Systems Science from the T.J. Watson School of Engineering at Binghamton University. She serves on...components, evaluate feedback, and be adaptive to evolving system behaviors . As affordability is a concept evaluated over time, such a method can

  5. Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing

    DTIC Science & Technology

    2008-01-01

    complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING

  6. Balancing Value and Risk in Information Sharing Through Obfuscation

    DTIC Science & Technology

    2012-09-20

    California, Los Angeles Chatschik Bisdikian IBM T.J. Watson Research Center Lance M. Kaplan US Army Research Laboratory Abstract—Fast-paced data-to...AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) IBM T.J. Watson Research...giving us annotations for both the white listed activity detection as well as the black listed activity recognition . We implemented five features

  7. Neutron Diffraction Investigations of Magnetism in BiFeO3 Epitaxial Films

    DTIC Science & Technology

    2011-01-01

    magnetism;epitaxial thin film;BiFeO3 Daisuke Kan, Wangchun Chen, Shannon Watson, Songxue Chi, Ross Erwin, Garry J. McIntyre, Sylvia C. Capelli, William ...Weinheim 1567wileyonlinelibrary.comAdv. Funct. Mater. 2011, 21, 1567–1574 William Ratcliff II , * Daisuke Kan , * Wangchun Chen , Shannon Watson...15 ] S. W. Lovesey , Theory of Neutron Scattering from Condensed Matter vol. 2 Oxford , New York , 1984 . [ 16 ] W. Gavin Williams

  8. Index of Air Weather Service Technical Publications. Headquarters AWS and Subordinate Units.

    DTIC Science & Technology

    1982-07-01

    Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. 105-48 "Study of Blowing Dust in the 19th Weather...Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. "On the Origin and Climatology of Noctilucent

  9. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    PubMed Central

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  10. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  11. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    PubMed

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    PubMed

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-07-01

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that are relevant to femoral neck fracture reduction and fixation. After controlling for age, body mass index, height, and sex, we found the modified Smith-Petersen approach provided a mean of 2.36 cm (95% confidence interval [CI], 0.45-4.28 cm; p = 0.015) additional exposure without rectus femoris tenotomy (p = 0.015) and 3.33 cm (95% CI, 1.42-5.24 cm; p = 0.001) additional exposure with a tenotomy compared with the Watson-Jones approach. The labrum, femoral head, subcapital femoral neck, basicervical femoral neck, and greater trochanter were reliably visible and palpable in both approaches. The lesser trochanter was palpable in all of the modified Smith-Petersen and none of the Watson-Jones approaches (p < 0.001). All modified Smith-Petersen approaches (10 of 10) provided visualization and palpation of the medial femoral neck, whereas visualization of the medial femoral neck was only possible in one of 10 Watson-Jones approaches (p < 0.001) and palpation was possible in eight of 10 Watson-Jones versus all 10 modified Smith-Petersen approaches (p = 0.470). In the hands of surgeons experienced with both surgical approaches to the femoral neck, the modified Smith-Petersen approach, with or without rectus femoris tenotomy, provides superior exposure of the femoral neck and articular surface as well as visualization and palpation of clinically relevant proximal femoral anatomic landmarks compared with the Watson-Jones approach. Open reduction and internal fixation of a femoral neck fracture is typically performed in a young patient (< 60 years old) with the objective of obtaining anatomic reduction that would not be possible by closed manipulation, thus enhancing healing potential. In the hands of surgeons experienced in both approaches, the modified Smith-Petersen approach offers improved direct access for reduction and fixation. Higher quality reductions and fixation are expected to translate to improved healing potential and outcomes. Although our experimental results are promising, further clinical studies are needed to verify if this larger exposure area imparts increased quality of reduction, healing, and improved outcomes compared with other approaches. The learning curve for the exposure is unclear, but the approach has broad applications and is frequently used in other subspecialties such as for direct anterior THA and pediatric septic hip drainage. Surgeons treating femoral neck fractures with open reduction and fixation should familiarize themselves with the modified Smith-Petersen approach.

  13. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

  14. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  15. Contact Transfer of VX from Contaminated Grass onto Army Combat Uniform

    DTIC Science & Technology

    2017-01-01

    intervals for agricultural workers who use pesticides . The reentry intervals are based on the available toxicity data, concentrations of chemicals used...for workers using some of the more toxic organophosphate pesticides . State regulators are free to set more stringent intervals. Watson suggested...report, the RASH method that uses RPF values for pesticide exposure of agricultural workers appears to be unrealistic for extrapolating to the exposure

  16. On the Pragmatic Functions of English Rhetoric in Public Speech: A Case Study of Emma Watson's "HeForShe"

    ERIC Educational Resources Information Center

    Yuan, Bin

    2018-01-01

    The current research is mainly conducted to explore the pragmatic functions of English rhetoric in public speech. To do this, methods of close reading and case studies are adopted. The research first reveals that the boom of public speech programs helps reexamine the art of utterance, during the delivery of which English rhetoric plays an…

  17. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

    DTIC Science & Technology

    2007-10-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  18. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

    DTIC Science & Technology

    2007-01-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  19. Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer

    DTIC Science & Technology

    2000-10-01

    Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann CW: J, Schnitt S, Livingston DM: Location of BRCA1 in human breast and Distinct...Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter H. Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter H. Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ray, L.; Hoffmann, G.W.; Thaler, R.M.

    The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reactionmore » cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+/sup 208/Pb elastic scattering and compared with experimental data.« less

  1. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    PubMed

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.

  2. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  3. Molecular dynamics correctly models the unusual major conformation of the GAGU RNA internal loop and with NMR reveals an unusual minor conformation.

    PubMed

    Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H

    2018-05-01

    The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Anthropometrically estimated total body water volumes are larger than modeled urea volume in chronic hemodialysis patients: effects of age, race, and gender.

    PubMed

    Daugirdas, John T; Greene, Tom; Depner, Thomas A; Chumlea, Cameron; Rocco, Michael J; Chertow, Glenn M

    2003-09-01

    The modeled volume of urea distribution (Vm) in intermittently hemodialyzed patients is often compared with total body water (TBW) volume predicted from population studies of patient anthropometrics (Vant). Using data from the HEMO Study, we compared Vm determined by both blood-side and dialysate-side urea kinetic models with Vant as calculated by the Watson, Hume-Weyers, and Chertow anthropometric equations. Median levels of dialysate-based Vm and blood-based Vm agreed (43% and 44% of body weight, respectively). These volumes were lower than anthropometric estimates of TBW, which had median values of 52% to 55% of body weight for the three formulas evaluated. The difference between the Watson equation for TBW and modeled urea volume was greater in Caucasians (19%) than in African Americans (13%). Correlations between Vm and Vant determined by each of the three anthropometric estimation equations were similar; but Vant derived from the Watson formula had a slightly higher correlation with Vm. The difference between Vm and the anthropometric formulas was greatest with the Chertow equation, less with the Hume-Weyers formula, and least with the Watson estimate. The age term in the Watson equation for men that adjusts Vant downward with increasing age reduced an age effect on the difference between Vant and Vm in men. The findings show that kinetically derived values for V from blood-side and dialysate-side modeling are similar, and that these modeled urea volumes are lower by a substantial amount than anthropometric estimates of TBW. The higher values for anthropometry-derived TBW in hemodialyzed patients could be due to measurement errors. However, the possibility exists that TBW space is contracted in patients with end-stage renal disease (ESRD) or that the TBW space and the urea distribution space are not identical.

  5. Simple apparatus for polarization sensing of analytes

    NASA Astrophysics Data System (ADS)

    Gryczynski, Zygmunt; Gryczynski, Ignacy; Lakowicz, Joseph R.

    2000-09-01

    We describe a simple device for fluorescence sensing based on an unexpansive light source, a dual photocell and a Watson bridge. The emission is detected from two fluorescent samples, one of which changes intensity in response to the analyte. The emission from these two samples is observed through two orthogonally oriented polarizers and an analyzer polarizer. The latter polarizer is rotated to yield equal intensities from both sides of the dual photocell, as determined by a zero voltage from the Watson bridge. Using this device, we are able to measure fluorescein concentration to an accuracy near 2% at 1 (mu) M fluorescein, and pH values accurate to +/- 0.02 pH units. We also use this approach with a UV hand lamp and a glucose-sensitive protein to measure glucose concentrations near 2 (mu) M to an accuracy of +/- 0.1 (mu) M. This approach requires only simple electronics, which can be battery powered. Additionally, the method is generic, and can be applied with any fluorescent sample that displays a change in intensity. One can imagine this approach being used to develop portable point-of-care clinical devices.

  6. Nonparametric regression applied to quantitative structure-activity relationships

    PubMed

    Constans; Hirst

    2000-03-01

    Several nonparametric regressors have been applied to modeling quantitative structure-activity relationship (QSAR) data. The simplest regressor, the Nadaraya-Watson, was assessed in a genuine multivariate setting. Other regressors, the local linear and the shifted Nadaraya-Watson, were implemented within additive models--a computationally more expedient approach, better suited for low-density designs. Performances were benchmarked against the nonlinear method of smoothing splines. A linear reference point was provided by multilinear regression (MLR). Variable selection was explored using systematic combinations of different variables and combinations of principal components. For the data set examined, 47 inhibitors of dopamine beta-hydroxylase, the additive nonparametric regressors have greater predictive accuracy (as measured by the mean absolute error of the predictions or the Pearson correlation in cross-validation trails) than MLR. The use of principal components did not improve the performance of the nonparametric regressors over use of the original descriptors, since the original descriptors are not strongly correlated. It remains to be seen if the nonparametric regressors can be successfully coupled with better variable selection and dimensionality reduction in the context of high-dimensional QSARs.

  7. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    PubMed Central

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  8. Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.

    PubMed

    Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B

    2015-05-14

    G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.

  9. The Joint Chiefs of Staff and National Policy Volume III 1950-1951, The Korean War: Part One,

    DTIC Science & Technology

    1998-01-01

    National Policy Volume III 1950-1951 The Korean War Part One James F . Schnabel Robert J. Watson Office of Joint History Office of the Chairman...transferred to other du- ties, Mr. James F . Schnabel assumed responsibility for the volume and planned, Foreword researched, and wrote the...into publishable form. JAMES F . SCHNABEL ROBERT J.WATSON vm Contents 1. Korea in US Policy, 1945-1950 1 The Partition of Korea 1 Establishment

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meadows, B.T.; /Cincinnati U.

    A new approach to the analysis of three body decays is presented. Model-independent results are obtained for the S-wave K{pi} amplitude as a function of K{pi} invariant mass. These are compared with results from K{sup -}{pi}{sup +} elastic scattering, and the prediction of the Watson theorem, that the phase behavior be the same below K{eta}' threshold, is tested. Contributions from I = 1/2 and I = 3/2 are not resolved in this study. If I = 1/2 dominates, however, the Watson theorem does not describe these data well.

  11. Determination of Frontal Structure in the Mid-Atlantic Region from WSR-88D Doppler Radar Velocity Azimuth Displays

    DTIC Science & Technology

    1997-01-09

    Riordan Gerald F. Watson Steven E. Koch Chairman of Advisory Committee Dedication I would like to dedicate, first and foremost, this thesis to the Lord...Officer. Tony was promoted to the rick of Cap(alnin June 1995. While atOffut AFB, he was selected by AFIT to attend North Carolina State University to...advisory committee, Dr. Steven E. Koch (Chairman), Dr. Allen J. Riordan , and Dr. Gerald F. Watson. Their guidance and personal interest in this work

  12. Dust Cloud Models: Sensitivity of Calculated Transmittances to Variations in Input Parameters

    DTIC Science & Technology

    1981-06-01

    Artillery School ATTN: DELEW-M-STO (Dr. Steven Kovel) ATTN: ATSF- CF -R (CPT James M. Watson) White Sands Missile Range, NM 88002 Fort Sill, OK 73503 Office...STEWS-PT-AL (Laurel B. Saunders) ATTN: ATSF- CF -R White Sands Missile Range, RM 88002 Fort Sill, OK 73503 Commander Commandant US Army RAD Coordinator...Army Field Artillery School ATTN: OELEW-M-STO (Dr. Steven Kovel) ATTN: ATSF- CF -R (CPT James M. Watson) White Sands Missile Range, NM 88002 Fort Sill, OK

  13. Study of the Physics of Insulating Films as Related to the Reliability of Metal-Oxide Semiconductor Devices

    DTIC Science & Technology

    1980-11-01

    materials work and sample preparation of D.W. Dong; the technical assistance of F.L. Pesavento and J.A. Calise; the assistance in device fabrication...FILMS D.J. DiMaria R. Ghez D.W. Dong I.B.M. Thomas J. Watson Research Center Yorktown Heights, New York 10598 Technical Assistance of F.L. Pesavento and... Pesavento and J.A. Calise; the assistance with gate metallizations by the Silicon Facility and Central Scientific Services at the T.J. Watson

  14. The discovery of the structure of DNA

    NASA Astrophysics Data System (ADS)

    Squires, G. L.

    2003-04-01

    On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

  15. Flood Plain Information, Mill, Watson, and Lahaska Creeks, Bucks County, Pennsylvania.

    DTIC Science & Technology

    1975-05-01

    AD-AIOI 592 ARENGINEER DISTRICT PHI LADELPHIA P A F/6 8/8 T7LOOD PLAIN INFORMATION, MIL , WATSON, AND LAI4ASKA CREEKS, SUCK-’ETCIU) UNCLASSIFIED...will be iu LblckW V’ A PREPARED FOR THE BUCKS COUNTY PLANNING COMMISSION p BY CORPS OF ENGINEERS, U.S. ARMY PHILADELPHIA DISTRICT MAY 975 8 1 7 20 055...No. 4655 at Langhorne , Pennsylvania) ..... ................. 8 3 Peak Flows for the Intermediate Regional and Standard Project Floods

  16. Monochloramine Disinfection Kinetics of Nitrosomonas europaea by Propidium Monoazide Quantitative PCR and Live/Dead BacLight Methods▿

    PubMed Central

    Wahman, David G.; Wulfeck-Kleier, Karen A.; Pressman, Jonathan G.

    2009-01-01

    Monochloramine disinfection kinetics were determined for the pure-culture ammonia-oxidizing bacterium Nitrosomonas europaea (ATCC 19718) by two culture-independent methods, namely, Live/Dead BacLight (LD) and propidium monoazide quantitative PCR (PMA-qPCR). Both methods were first verified with mixtures of heat-killed (nonviable) and non-heat-killed (viable) cells before a series of batch disinfection experiments with stationary-phase cultures (batch grown for 7 days) at pH 8.0, 25°C, and 5, 10, and 20 mg Cl2/liter monochloramine. Two data sets were generated based on the viability method used, either (i) LD or (ii) PMA-qPCR. These two data sets were used to estimate kinetic parameters for the delayed Chick-Watson disinfection model through a Bayesian analysis implemented in WinBUGS. This analysis provided parameter estimates of 490 mg Cl2-min/liter for the lag coefficient (b) and 1.6 × 10−3 to 4.0 × 10−3 liter/mg Cl2-min for the Chick-Watson disinfection rate constant (k). While estimates of b were similar for both data sets, the LD data set resulted in a greater k estimate than that obtained with the PMA-qPCR data set, implying that the PMA-qPCR viability measure was more conservative than LD. For N. europaea, the lag phase was not previously reported for culture-independent methods and may have implications for nitrification in drinking water distribution systems. This is the first published application of a PMA-qPCR method for disinfection kinetic model parameter estimation as well as its application to N. europaea or monochloramine. Ultimately, this PMA-qPCR method will allow evaluation of monochloramine disinfection kinetics for mixed-culture bacteria in drinking water distribution systems. PMID:19561179

  17. Identifying Autocorrelation Generated by Various Error Processes in Interrupted Time-Series Regression Designs: A Comparison of AR1 and Portmanteau Tests

    ERIC Educational Resources Information Center

    Huitema, Bradley E.; McKean, Joseph W.

    2007-01-01

    Regression models used in the analysis of interrupted time-series designs assume statistically independent errors. Four methods of evaluating this assumption are the Durbin-Watson (D-W), Huitema-McKean (H-M), Box-Pierce (B-P), and Ljung-Box (L-B) tests. These tests were compared with respect to Type I error and power under a wide variety of error…

  18. Portrait of a discovery. Watson, Crick, and the double helix.

    PubMed

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Breo, D.L.

    The best-selling The Double Helix, published 20 years ago, describes the events that had led to the discovery by James Watson and Francis Crick in 1953 of the structure of deoxyribonucleic acid (DNA), the building block of genes and heredity. At the time, the 25-year-old Watson was widely perceived as arrogant, brash, gawky, and intense. Subsequent events did little to change that impression. Today, at age 61, James Dewey Watson is still an angry young man. As director since 1968 of the Cold Spring Harbor Laboratory on Long Island, NY, and as director since 1988 of the National Center formore » Human Genome Research at the National Institutes of Health (NIH), he is coordinating the attempt to decipher biology's deepest secrets: the mapping, sequencing, and defining of the estimated 50,000 to 100,000 human genes arranged over the 23 pairs of chromosomes. The results, expected by early next century, may reveal the chemical script of life and help solve the riddles of inherited genetic diseases and certain cancers.« less

  20. Role modeling excellence in clinical nursing practice.

    PubMed

    Perry, R N Beth

    2009-01-01

    Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.

  1. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    PubMed

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  2. Fragment charge difference method for estimating donor-acceptor electronic coupling: Application to DNA π-stacks

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Rösch, Notker

    2002-09-01

    The purpose of this communication is two-fold. We introduce the fragment charge difference (FCD) method to estimate the electron transfer matrix element HDA between a donor D and an acceptor A, and we apply this method to several aspects of hole transfer electronic couplings in π-stacks of DNA, including systems with several donor-acceptor sites. Within the two-state model, our scheme can be simplified to recover a convenient estimate of the electron transfer matrix element HDA=(1-Δq2)1/2(E2-E1)/2 based on the vertical excitation energy E2-E1 and the charge difference Δq between donor and acceptor. For systems with strong charge separation, Δq≳0.95, one should resort to the FCD method. As favorable feature, we demonstrate the stability of the FCD approach for systems which require an approach beyond the two-state model. On the basis of ab initio calculations of various DNA related systems, we compared three approaches for estimating the electronic coupling: the minimum splitting method, the generalized Mulliken-Hush (GMH) scheme, and the FCD approach. We studied the sensitivity of FCD and GMH couplings to the donor-acceptor energy gap and found both schemes to be quite robust; they are applicable also in cases where donor and acceptor states are off resonance. In the application to π-stacks of DNA, we demonstrated for the Watson-Crick pair dimer [(GC),(GC)] how structural changes considerably affect the coupling strength of electron hole transfer. For models of three Watson-Crick pairs, we showed that the two-state model significantly overestimates the hole transfer coupling whereas simultaneous treatment of several states leads to satisfactory results.

  3. Updating the Standard Spatial Observer for Contrast Detection

    NASA Technical Reports Server (NTRS)

    Ahumada, Albert J.; Watson, Andrew B.

    2011-01-01

    Watson and Ahmuada (2005) constructed a Standard Spatial Observer (SSO) model for foveal luminance contrast signal detection based on the Medelfest data (Watson, 1999). Here we propose two changes to the model, dropping the oblique effect from the CSF and using the cone density data of Curcio et al. (1990) to estimate the variation of sensitivity with eccentricity. Dropping the complex images, and using medians to exclude outlier data points, the SSO model now accounts for essentially all the predictable variance in the data, with an RMS prediction error of only 0.67 dB.

  4. In-phase and out-of-phase axial-torsional fatigue behavior of Haynes 188 at 760 C

    NASA Technical Reports Server (NTRS)

    Kalluri, Sreeramesh; Bonacuse, Peter J.

    1991-01-01

    Isothermal, in-phase and out-of-phase axial-torsional fatigue experiments have been conducted at 760 C on uniform gage section, thin-walled tubular specimens of a wrought cobalt-base superalloy, Haynes 188. Test-control and data acquisition were accomplished with a minicomputer. Fatigue lives of the in- and out-of-phase axial-torsional fatigue tests have been estimated with four different multiaxial fatigue life prediction models that were developed primarly for predicting axial-torsional fatigue lives at room temperature. The models investigated were: (1) the von Mises equivalent strain range; (2) the Modified Multiaxiality Factor Approach; (3) the Modified Smith-Watson-Topper Parameter; and (4) the critical shear plane method of Fatemi, Socie, and Kurath. In general, life predictions by the von Mises equivalent strain range model were within a factor of 2 for a majority of the tests and the predictions by the Modified Multiaxiality Factor Approach were within a factor of 2, while predictions of the Modified Smith-Watson-Topper Parameter and of the critical shear plane method of Fatemi, Socie, and Kurath were unconservative and conservative, respectively, by up to factors of 4. In some of the specimens tested under combined axial-torsional loading conditions, fatigue cracks initiated near extensometer indentations. Two design modifications have been proposed to the thin-walled tubular specimen to overcome this problem.

  5. Applications of the Galton Watson process to human DNA evolution and demography

    NASA Astrophysics Data System (ADS)

    Neves, Armando G. M.; Moreira, Carlos H. C.

    2006-08-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton-Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman Nbar is constrained to a small range depending on the probability p that a child is a female. Assuming that the value p≈0.488 valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable probability is 2.0492

  6. James Craig Watson, First Director of Washburn Observatory: His Obsession with the Intra-Mercurial Planet Vulcan

    NASA Astrophysics Data System (ADS)

    Sheehan, William

    1996-05-01

    The first director of the Washburn Observatory, Watson began his career at the University of Michigan, where he discovered more than a score of asteroids and planned (but did not live to carry out) the first search for a trans-Neptunian planet. He became a strong supporter of Le Verrier's hypothesis that a planet closer to the Sun than Mercury (Vulcan) was causing the anomalous advance of 38" of arc per century of Mercury's perihelion, and mounted a special search for Vulcan at the July 29, 1878 total eclipse, at Separation, Wyoming, recording two strange reddish stars near the Sun which he assumed were intra-Mercurial bodies. With the exception of Lewis Swift at Denver, Colorado, no one else confirmed his observations, and they were sharply criticized by Clinton College (New York) astronomer C. H. F. Peters. Nevertheless, Watson remained absolutely convinced of what he had seen, and his move from Ann Arbor to Madison in 1879 was partly motivated by the prospects of obtaining better instruments with which to further his search for Vulcan, which became the obsession of his later years. He was in the process of constructing an underground solar observatory from which he hoped to see stars near the Sun in broad daylight when he died, unexpectedly, in 1880. Though it is now known that Vulcan does not exist, Watson's observations at the July 1878 eclipse remain problematic; it is probable that he observed at least one and possibly two pygmy comets in the neighborhood of the Sun.

  7. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    NASA Astrophysics Data System (ADS)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  8. Early Phase Endotoxin Tolerance: A Study of the Cellular Mechanisms which Underlie a State of Acquired Refractoriness to Endotoxin-induced Toxic Manifestations

    DTIC Science & Technology

    1985-12-13

    Her leadership , help, and understanding at crltlcal times will always be remembered. Thank you for help ing me attain this great goal and captu~e a...by Braude §1 ~!- (1955) and Cremer and Watson (1957 ) to be the primary site of endotoxin localization following i.v. injection] were st imulated by...A-specif ic tr iggeri ng r eceptor on murine B lymp hocytes. Eur. J. Immunol. 8:63 . Cremer , N. and D.W. Watson. 1957. Inf luence of s tress on

  9. Biological and Nano-Technological Applications of Artificial DNAs Made Exclusively of Nonnatural C-Nucleosides with Four Types of Nonnatural Bases

    DTIC Science & Technology

    2011-08-19

    A) CD, (B) UV, (C) Tm, and (D) titration experiments of d(iG*)8/d(C)8. d(T/A*/T)n WC WC
 d(T/A/T)n Watson – Crick (WC)
 Hoogsteen
 Symmetrical A...base Figure 7. Triplex formation of the natural T/A/T which has one Watson - Crick (WC)-type and one Hoogsteen-type hydrogen-bondings, and the...Final Report for AOARD Grant FA2386-10-1-4033 “Biological and Nano-technological Applications of Artificial DNAs Made Exclusively of Nonnatutal C

  10. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  11. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    PubMed

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  12. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    PubMed

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  13. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  14. Investigation of the H7 ordinary chondrite, Watson 012: Implications for recognition and classification of Type 7 meteorites

    NASA Astrophysics Data System (ADS)

    Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina

    2014-06-01

    Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were added to the Watson 012 sample by through-flowing basaltic melt. Along with the absence of glass and granophyre, this interconnected network of coarse-grained skeletal plagioclase indicates that the sample cooled slowly at depth within the parent body. The evidence of melt flux indicates that Watson 012 formed in the presence of a gravitational gradient, and thus at significant distance from the centre of the H chondrite parent body (the gravitational gradient at the centre would be zero). Our interpretation is that incipient silicate partial melting in Watson 012 occurred when a region of radiogenically heated H6 material located at considerable depth (possibly at ∼15-20 km from surface) was heated by an additional ca. 200-300 °C in association with a large shock event. Due to insulation at depth within an already hot parent body, the post-shock temperature equilibrated and remained above the solidus long enough for widespread equilibrium-based silicate partial melting, and for melt to migrate. Although the observed melting may have been facilitated by additional heating from an impact event, this is not an example of instantaneous shock melting, which produces thermal disequilibrium at short length scales and distinctly different textures. A small number of H, L and LL chondrites have been previously classified as being of petrologic Type 7; with our new criteria to support that classification, these represent our best opportunity to explore the transition from high temperature sub-solidus metamorphism through the onset of silicate partial melting in three different parent bodies.

  15. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    PubMed

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  16. Computer aided detection in prostate cancer diagnostics: A promising alternative to biopsy? A retrospective study from 104 lesions with histological ground truth

    PubMed Central

    Thon, Anika; Teichgräber, Ulf; Tennstedt-Schenk, Cornelia; Hadjidemetriou, Stathis; Winzler, Sven; Malich, Ansgar

    2017-01-01

    Background Prostate cancer (PCa) diagnosis by means of multiparametric magnetic resonance imaging (mpMRI) is a current challenge for the development of computer-aided detection (CAD) tools. An innovative CAD-software (Watson Elementary™) was proposed to achieve high sensitivity and specificity, as well as to allege a correlate to Gleason grade. Aim/Objective To assess the performance of Watson Elementary™ in automated PCa diagnosis in our hospital´s database of MRI-guided prostate biopsies. Methods The evaluation was retrospective for 104 lesions (47 PCa, 57 benign) from 79, 64.61±6.64 year old patients using 3T T2-weighted imaging, Apparent Diffusion Coefficient (ADC) maps and dynamic contrast enhancement series. Watson Elementary™ utilizes signal intensity, diffusion properties and kinetic profile to compute a proportional Gleason grade predictor, termed Malignancy Attention Index (MAI). The analysis focused on (i) the CAD sensitivity and specificity to classify suspect lesions and (ii) the MAI correlation with the histopathological ground truth. Results The software revealed a sensitivity of 46.80% for PCa classification. The specificity for PCa was found to be 75.43% with a positive predictive value of 61.11%, a negative predictive value of 63.23% and a false discovery rate of 38.89%. CAD classified PCa and benign lesions with equal probability (P 0.06, χ2 test). Accordingly, receiver operating characteristic analysis suggests a poor predictive value for MAI with an area under curve of 0.65 (P 0.02), which is not superior to the performance of board certified observers. Moreover, MAI revealed no significant correlation with Gleason grade (P 0.60, Pearson´s correlation). Conclusion The tested CAD software for mpMRI analysis was a weak PCa biomarker in this dataset. Targeted prostate biopsy and histology remains the gold standard for prostate cancer diagnosis. PMID:29023572

  17. Watson: A new link in the IIE iron chain

    NASA Technical Reports Server (NTRS)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  18. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    PubMed

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  19. Different methods and metaphysics in early molecular genetics--a case of disparity of research?

    PubMed

    Deichmann, Ute

    2008-01-01

    The encounter between two fundamentally different approaches in seminal research in molecular biology--the problems, aims, methods and metaphysics--is delineated and analyzed. They are exemplified by the microbiologist Oswald T. Avery who, in line with the reductionist mechanistic metaphysics of Jacques Loeb, attempted to explain basic life phenomena through chemistry; and the theoretical physicist Max Delbrück who, influenced by Bohr's antimechanistic views, preferred to explain these phenomena without chemistry. Avery's and Delbrück's most important studies took place concurrently. Thus analysis of their contrasting approaches lends itself to examination of the Weltanschauungen view concerning the role of fundamental (metaphysical) assumptions in scientific change, that is, the view that empirical research cannot be neutral in regard to the worldviews of the researchers. This study shows that the initial ostensible disparity (non-integratibility) of the two approaches lasted for just a short time. Ironically it was a student of Delbrück's school, James Watson, who (with Crick) proposed a chemical model, the DNA double helix, as a solution to Delbrück's problem. The structure of DNA has not been seriously challenged over the past half century Moreover, Watson's and Crick's work did not call into question the validity of Delbrück's research, but opened it up to entirely new approaches. The case of Avery and Delbrück demonstrates that after initial obstacles were overcome the different fundamental attitudes and the resulting research practices were capable of integration.

  20. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    PubMed

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  1. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Microwave spectrum, structure and dipole moment of 4-fluorophenylacetylene (4FPA)

    NASA Astrophysics Data System (ADS)

    Jang, Heesu; Ka, Soohyun; Dikkumbura, Asela S.; Peebles, Rebecca A.; Peebles, Sean A.; Oh, Jung Jin

    2017-04-01

    Using a chirped-pulse Fourier-transform microwave (CP-FTMW) spectrometer, a 6-18 GHz spectrum of 4-fluorophenylacetylene (4FPA) was measured and only a-type R-branch transitions were observed up to J = 9. Rotational constants and quartic centrifugal distortion constants for the normal isotopic species were determined based on Watson-S reduction: A = 5652.812(22) MHz, B = 966.92885(11) MHz, C = 825.67680(11) MHz, DJ = 0.01377(60) kHz, and DJK = 0.2468(61) kHz, with other three distortion constants fixed as DK = 0.6629 kHz, d1 = 2.386 Hz, and d2 = 0.989 Hz from ab initio results. For six kinds of carbon-13 isotopic species, 10-15 transitions were detected by a resonant cavity FTMW spectrometer in natural abundance, and rotational constants of each species were also determined by fitting transition frequencies. Gaseous molecular structures of 4FPA were derived via the least-squares fitting (r0) and substitution (rs) methods, and ab initio optimization (re). They were compared to the structures of benzene derivatives having fluorine and the acetylenic group as substituents. In addition, dipole moment component of 4FPA was also determined to be μa = μtotal = 0.8935(9) D from Stark effect measurements.

  3. Symmetric Simple Map with Dipole Map for a Single-Null Divertor Tokamak

    NASA Astrophysics Data System (ADS)

    Ali, Halima; Watson, Michael; Punjabi, Alkesh; Boozer, Allen

    1996-11-01

    This investigation focuses on the effects of an externally placed dipole coil on the magnetic topology of a single-null divertor tokamak with a stochastic scrape-off layer using the Method of Maps (Punjabi A, Verma A and Boozer A, Phys Rev Lett), 69, 3322 (1992) and J Plasma Phys, 52, 91 (1994). The unperturbed magnetic topology is represented by the Symmetric Simple Map (Ali H, Watson M, Mayer C, Punjabi A and Boozer A, Bull Am Phys Soc), 40, 1855 (1995). The effect of dipole perturbation is repesented by the Dipole Map (Ali H, Watson M, Punjabi A and Boozer A, Sherwood Mtg), paper 1C20 (1996). A single dipole coil is placed across from the X-point below the last good surface. The strength of the dipole perturbation and the distance of the coil from the last good surface are varied. We observe that the dipole perturbation causes spatially intermittent chaos. This has significant implications for radiative divertor concepts as well for impurity control. We also present the detailed results on the effects of the dipole coil on the properties of the stochastic layer and the footprint of the field lines on the divertor plate. This work is supported by the US DOE OFES.

  4. Some properties of Stark states of hydrogenic atoms and ions

    NASA Astrophysics Data System (ADS)

    Hey, J. D.

    2007-10-01

    The motivation for this work is the problem of providing accurate values of the atomic transition matrix elements for the Stark components of Rydberg Rydberg transitions in atomic hydrogen and hydrogenic ions, for use in spectral line broadening calculations applicable to cool, low-density plasmas, such as those found in H II regions. Since conventional methods of calculating these transition matrix elements cannot be used for the high principal quantum numbers now easily attained in radio astronomical spectra, we attempt to show that the recurrence relation (ladder operator) method recently employed by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889 97) and Hey (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641 64) can be taken over into the parabolic coordinate system used to describe the Stark states of the atomic (ionic) radiators. The present method is therefore suggested as potentially useful for extending the work of Griem (1967 Astrophys. J. 148 547 58, 2005 Astrophys. J. 620 L133 4), Watson (2006), Stambulchik et al (2007 Phys. Rev. E 75 016401(9 pp) on Stark broadening in transitions between states of high principal quantum number, to physical conditions where the binary, impact approximation is no longer strictly applicable to both electron and ion perturbers. Another possible field of application is the study of Stark mixing transitions in 'ultracold' Rydberg atoms perturbed by long-range interactions with slow atoms and ions. Preparatory to the derivation of recurrence relations for states of different principal quantum number, a number of properties and recurrence relations are also found for states of identical principal quantum number, including the analogue in parabolic coordinates to the relations of Pasternack (1937 Proc. Natl Acad. Sci. USA 23 91 4, 250) in spherical polar coordinates.

  5. Some theoretical aspects of boundary layer stability theory

    NASA Technical Reports Server (NTRS)

    Hall, Philip

    1990-01-01

    Increased understanding in recent years of boundary layer transition has been made possible by the development of strongly nonlinear stability theories. After some twenty or so years when nonlinear stability theory was restricted to the application of the Stuart-Watson method (or less formal amplitude expansion procedures), there now exist strongly nonlinear theories which can describe processes which have an 0(1) effect on the basic state. These strongly nonlinear theories and their possible role in pushing theoretical understanding of transition ever further into the nonlinear regime are discussed.

  6. Image Discrimination Models for Object Detection in Natural Backgrounds

    NASA Technical Reports Server (NTRS)

    Ahumada, A. J., Jr.

    2000-01-01

    This paper reviews work accomplished and in progress at NASA Ames relating to visual target detection. The focus is on image discrimination models, starting with Watson's pioneering development of a simple spatial model and progressing through this model's descendents and extensions. The application of image discrimination models to target detection will be described and results reviewed for Rohaly's vehicle target data and the Search 2 data. The paper concludes with a description of work we have done to model the process by which observers learn target templates and methods for elucidating those templates.

  7. Assessing Pavlov's impact on the American conditioning enterprise.

    PubMed

    Coleman, S R

    1988-01-01

    In this article, the visibility of Pavlov and of Watson in American psychology are compared, and the periods of their respective influence are specified with greater precision than is afforded by merely impressionistic methods. The author also critically examines the possibility that the early history of the American classic-conditioning enterprise involved a succession of two phases: a Watsonian/speculative phase and a Pavlovian/empirical phase. In conclusion, the author assesses the possibility that the publication of Pavlov's Conditioned Reflexes (1927) "stimulated" scholarly work on Pavlovian conditioning, and finds this proposition lacking empirical support.

  8. Test of time: what if little Albert had escaped?

    PubMed

    Field, Andy P; Nightingale, Zoë C

    2009-04-01

    Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.

  9. Applied Meteorology Unit (AMU) Quarterly Report Fourth Quarter FY-14

    NASA Technical Reports Server (NTRS)

    Bauman, William H.; Crawford, Winifred C.; Watson, Leela R.; Shafer, Jaclyn

    2014-01-01

    Ms. Crawford completed the final report for the dual-Doppler wind field task. Dr. Bauman completed transitioning the 915-MHz and 50-MHz Doppler Radar Wind Profiler (DRWP) splicing algorithm developed at Marshall Space Flight Center (MSFC) into the AMU Upper Winds Tool. Dr. Watson completed work to assimilate data into model configurations for Wallops Flight Facility (WFF) and Kennedy Space Center/Cape Canaveral Air Force Station (KSC/CCAFS). Ms. Shafer began evaluating the a local high-resolution model she had set up previously for its ability to forecast weather elements that affect launches at KSC/CCAFS. Dr. Watson began a task to optimize the data-assimilated model she just developed to run in real time.

  10. Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

    PubMed

    Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

    2010-08-01

    Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

  11. Trauma-related guilt: conceptual development and relationship with posttraumatic stress and depressive symptoms.

    PubMed

    Browne, Kendall C; Trim, Ryan S; Myers, Ursula S; Norman, Sonya B

    2015-04-01

    Despite high prevalence and concerning associated problems, little effort has been made to conceptualize the construct of posttraumatic guilt. This investigation examined the theoretical model of trauma-related guilt proposed by Kubany and Watson (2003). This model hypothesizes that emotional and physical distress related to trauma memories partially mediates the relationship between guilt cognitions and posttraumatic guilt. Using path analysis, this investigation (a) empirically evaluated relationships hypothesized in Kubany and Watson's model, and (b) extended this conceptualization by evaluating models whereby guilt cognitions, distress, and posttraumatic guilt were related to posttraumatic stress disorder (PTSD) symptoms depression symptom severity. Participants were male U.S. Iraq and Afghanistan veterans (N = 149). Results yielded a significant indirect effect from guilt cognitions to posttraumatic guilt via distress, providing support for Kubany and Watson's model (β = .14). Findings suggested distress may be the strongest correlate of PTSD symptoms (β = .47) and depression symptoms (β = .40), and that guilt cognitions may serve to intensify the relationship between distress and posttraumatic psychopathology. Research is needed to evaluate whether distress specific to guilt cognitions operates differentially on posttraumatic guilt when compared to distress more broadly related to trauma memories. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  12. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  13. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    PubMed

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix. IBMWA is a new alternative for data analytics software that automates descriptive, predictive, and visual analytics. This program is very user-friendly but requires data preprocessing, statistical conceptual understanding, and domain expertise.

  14. Using the case study teaching method to promote college students' critical thinking skills

    NASA Astrophysics Data System (ADS)

    Terry, David Richard

    2007-12-01

    The purpose of this study was to examine general and domain-specific critical thinking skills in college students, particularly ways in which these skills might be increased through the use of the case study method of teaching. General critical thinking skills were measured using the Watson-Glaser Critical Thinking Appraisal (WGCTA) Short Form, a forty-item paper-and-pencil test designed to measure important abilities involved in critical thinking, including inference, recognition of assumptions, deduction, interpretation, and evaluation of arguments. The ability to identify claims and support those claims with evidence is also an important aspect of critical thinking. I developed a new instrument, the Claim and Evidence Assessment Tool (CEAT), to measure these skills in a domain-specific manner. Forty undergraduate students in a general science course for non-science majors at a small two-year college in the northeastern United States experienced positive changes in general critical thinking according to results obtained using the Watson-Glaser Critical Thinking Appraisal (WGCTA). In addition, the students showed cumulative improvement in their ability to identify claims and evidence, as measured by the Claim and Evidence Assessment Tool (CEAT). Mean score on the WGCTA improved from 22.15 +/- 4.59 to 23.48 +/- 4.24 (out of 40), and the mean CEAT score increased from 14.98 +/- 3.28 to 16.20 +/- 3.08 (out of 24). These increases were modest but statistically and educationally significant. No differences in claim and evidence identification were found between students who learned about specific biology topics using the case study method of instruction and those who were engaged in more traditional instruction, and the students' ability to identify claims and evidence and their factual knowledge showed little if any correlation. The results of this research were inconclusive regarding whether or not the case study teaching method promotes college students' general or domain-specific critical thinking skills, and future research addressing this issue should probably utilize larger sample sizes and a pretest-posttest randomized experimental design.

  15. The SHARPn Project on Secondary Use of Electronic Medical Record Data: Progress, Plans, and Possibilities

    PubMed Central

    Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M

    2011-01-01

    SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010. PMID:22195076

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of {sup 13}C,{sup 16}O, and {sup 18}O from Penning-trap mass spectrometry, we determine the atomic mass of {sup 17}O to be M[{sup 17}O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of {sup 17}O with the more precise result M[{sup 17}O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of {sup 17}O to better thanmore » 1 part in 10{sup 8}.« less

  17. The SHARPn project on secondary use of Electronic Medical Record data: progress, plans, and possibilities.

    PubMed

    Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M

    2011-01-01

    SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010.

  18. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.

    1995-01-01

    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  19. Kaon-nucleus scattering

    NASA Technical Reports Server (NTRS)

    Hong, Byungsik; Maung, Khin Maung; Wilson, John W.; Buck, Warren W.

    1989-01-01

    The derivations of the Lippmann-Schwinger equation and Watson multiple scattering are given. A simple optical potential is found to be the first term of that series. The number density distribution models of the nucleus, harmonic well, and Woods-Saxon are used without t-matrix taken from the scattering experiments. The parameterized two-body inputs, which are kaon-nucleon total cross sections, elastic slope parameters, and the ratio of the real to the imaginary part of the forward elastic scattering amplitude, are presented. The eikonal approximation was chosen as our solution method to estimate the total and absorptive cross sections for the kaon-nucleus scattering.

  20. Andrea Watson | NREL

    Science.gov Websites

    energy solutions for emission mitigation, international climate change strategies, and renewable energy technical decision making. Andrea's expertise lies in strategic planning, change strategies, and decision

  1. [The brain in stereotaxic coordinates (a textbook for colleges)].

    PubMed

    Budantsev, A Iu; Kisliuk, O S; Shul'govskiĭ, V V; Rykunov, D S; Iarkov, A V

    1993-01-01

    The present textbook is directed forward students of universities and medical colleges, young scientists and practicing doctors dealing with stereotaxic method. The Paxinos and Watson stereotaxic rat brain atlas (1982) is the basis of the textbook. The atlas has been transformed into computer educational program and seven laboratory works: insertion of the electrode into brain, microelectrophoresis, microinjection of drugs into brain, electrolytic destruction in the brain structures, local brain superfusion. The laboratory works are compiled so that they allow not only to study practical use of the stereotaxic method but to model simple problems involving stereotaxic surgery in the deep structures of brain. The textbook is intended for carrying by IBM PC/AT computers. The volume of the textbook is 1.7 Mbytes.

  2. Sherlock Holmes: scientific detective.

    PubMed

    Snyder, Laura J

    2004-09-01

    Sherlock Holmes was intended by his creator, Arthur Conan Doyle, to be a 'scientific detective'. Conan Doyle criticized his predecessor Edgar Allan Poe for giving his creation - Inspector Dupin - only the 'illusion' of scientific method. Conan Doyle believed that he had succeeded where Poe had failed; thus, he has Watson remark that Holmes has 'brought detection as near an exact science as it will ever be brought into the world.' By examining Holmes' methods, it becomes clear that Conan Doyle modelled them on certain images of science that were popular in mid- to late-19th century Britain. Contrary to a common view, it is also evident that rather than being responsible for the invention of forensic science, the creation of Holmes was influenced by the early development of it.

  3. Seasonal fish community variation in headwater mangrove creeks in the southwestern everglades: An examination of their role as dry-down refuges

    USGS Publications Warehouse

    Rehage, Jennifer S.; Loftus, W.F.

    2007-01-01

    The connectivity between the fish community of estuarine mangroves and that of freshwater habitats upstream remains poorly understood. In the Florida Everglades, mangrove-lined creeks link freshwater marshes to estuarine habitats downstream and may act as dry-season refuges for freshwater fishes. We examined seasonal dynamics in the fish community of ecotonal creeks in the southwestern region of Everglades National Park, specifically Rookery Branch and the North and Watson rivers. Twelve low-order creeks were sampled via electrofishing, gill nets, and minnow traps during the wet season, transition period, and dry season in 2004-2005. Catches were greater in Rookery Branch than in the North and Watson rivers, particularly during the transition period. Community composition varied seasonally in Rookery Branch, and to a greater extent for the larger species, reflecting a pulse of freshwater taxa into creeks as marshes upstream dried periodically. The pulse was short-lived, a later sample showed substantial decreases in freshwater fish numbers. No evidence of a similar influx was seen in the North and Watson rivers, which drain shorter hydroperiod marshes and exhibit higher salinities. These results suggest that head-water creeks can serve as important dry-season refugia. Increased freshwater flow resulting from Everglades restoration may enhance this connectivity. ?? 2007 Rosenstiel School of Marine and Atmospheric Science of the University of Miami.

  4. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    PubMed

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  5. Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

    2001-04-01

    Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

  6. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  7. Richard Watson.

    PubMed

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  8. The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.

    ERIC Educational Resources Information Center

    Waddell, Thomas G.; Rybolt, Thomas R.

    2003-01-01

    Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)

  9. The effectiveness of photocatalytic ionisation disinfection of filter materials.

    PubMed

    Pietrzak, Katarzyna; Gutarowska, Beata

    2013-01-01

    The purpose of this study was to determine the effectiveness of photocatalytic ionisation as a disinfection method for filter materials contaminated by microorganisms, and to assess how air relative humidity (RH), time and microbe type influence the effectiveness of this disinfection. In the quantitative analysis of a used car air filter, bacterial contamination equalled 1.2 x 10(5) cfu/cm2, fungal contamination was 3.8 x 10(6) cfu/cm2, and the isolated microorganisms were Aspergillus niger, Bacillus megaterium, Cladosporium herbarum, Cryptococcus laurenti, Micrococcus sp., Rhodotorula glutinis and Staphylococcus cohnii. In the model experiment, three isolates (C. herbarum, R. glutinis, S. cohnii) and 3 ATCC species (A. niger, E. coli, S. aureus) were used for photocatalytic ionisation disinfection. The conditions of effective photocatalytic ionisation disinfection (R > or = 99.9%) were established as 2-3 h at RH = 77% (bacteria) and 6-24 h at RH = 53% (fungi). RH has an influence on the effectiveness of the photocatalytic disinfection process; the highest effectiveness was obtained for bacteria at RH = 77%, with results 5% higher than for RH = 49%. The studies show that the sensitivity of microorganisms to photocatalytic ionisation disinfection is ordered as follows: Gram-positive bacteria (S. cohnii, S. aureus), Gram-negative bacteria (E. coli), yeasts (R. glutinis), and moulds (C. herbarum, A. niger). Of all the mathematical models used for the description of death dynamics after photocatalytic ionisation disinfection, the Chick-Watson model is the most useful, but for more resistant microorganisms, the delayed Chick-Watson model is highly recommended. It therefore seems, that the presented disinfection method of photocatalytic ionisation can be successfully used to clean filtration materials.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brauer, Carolyn S.; Pearson, John C.; Drouin, Brian J.

    The spectrum of ethyl cyanide, or propionitrile (CH{sub 3}CH{sub 2}CN), has been repeatedly observed in the interstellar medium with large column densities and surprisingly high temperatures in hot core sources. The construction of new, more sensitive, observatories accessing higher frequencies such as Herschel, ALMA, and SOFIA have made it important to extend the laboratory data for ethyl cyanide to coincide with the capabilities of the new instruments. We report extensions of the laboratory measurements of the rotational spectrum of ethyl cyanide in its ground vibrational state to 1.6 THz. A global analysis of the ground state, which includes all ofmore » the previous data and 3356 newly assigned transitions, has been fitted to within experimental error to J = 132, K = 36, using both Watson A-reduced and Watson S-reduced Hamiltonians.« less

  11. Visible contrast energy metrics for detection and discrimination

    NASA Astrophysics Data System (ADS)

    Ahumada, Albert J.; Watson, Andrew B.

    2013-03-01

    Contrast energy was proposed by Watson, Barlow, and Robson (Science, 1983) as a useful metric for representing luminance contrast target stimuli because it represents the detectability of the stimulus in photon noise for an ideal observer. We propose here the use of visible contrast energy metrics for detection and discrimination among static luminance patterns. The visibility is approximated with spatial frequency sensitivity weighting and eccentricity sensitivity weighting. The suggested weighting functions revise the Standard Spatial Observer (Watson and Ahumada, J. Vision, 2005) for luminance contrast detection , extend it into the near periphery, and provide compensation for duration. Under the assumption that the detection is limited only by internal noise, both detection and discrimination performance can be predicted by metrics based on the visible energy of the difference images.

  12. An atlas of the (near) future: cognitive computing applications for medical imaging (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    LeGrand, Anne

    2017-02-01

    The role of medical imaging in global health systems is literally fundamental. Like labs, medical images are used at one point or another in almost every high cost, high value episode of care. CT scans, mammograms, and x-rays, for example, "atlas" the body and help chart a course forward for a patient's care team. Imaging precision has improved as a result of technological advancements and breakthroughs in related medical research. Those advancements also bring with them exponential growth in medical imaging data. As IBM trains Watson to "see" medical images, Ms. Le Grand will discuss recent advances made by Watson Health and explore the potential value of "augmented intelligence" to assist healthcare providers like radiologists and cardiologists, as well as the patients they serve.

  13. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOEpatents

    Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.

    1996-01-01

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.

  14. Region 5: Indiana Adequate Letter (11/4/2005)

    EPA Pesticide Factsheets

    This is a letter from Stephen Rothblatt, Director, to Kathryn Watson regarding the redesignation petition and maintenance plan for the Jackson County and Greene County 8-hour ozone nonattainment area.

  15. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    PubMed

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was relatively robust to spelling and grammatical errors, which were frequent. Implementation of this automated MR contrast determination system as a clinical decision support tool may save considerable time and effort of the radiologist while potentially decreasing error rates, and require no change in order entry or workflow.

  16. [Sherlock Holmes as amateur physician].

    PubMed

    Madsen, S

    1998-03-30

    The medical literature contains numerous articles dealing with Sherlock Holmes and his companion Dr. Watson. Some of the articles are concerned with the medical and scientific aspects of his cases. Other articles adopt a more philosophical view: They compare the methods of the master detective with those of the physician--the ideal clinician should be as astute in his profession as the detective must be in his. It this article the author briefly reviews the abilities of Sherlock Holmes as an amateur physician. Often Holmes was brilliant, but sometimes he made serious mistakes. In one of his cases (The Adventure of the Lion's Mane) he misinterpreted common medical signs.

  17. 4. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept. 16, 1940 (A) EXTERIOR, GENERAL VIEW FROM SOUTH WEST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

  18. Nucleic acid nanomaterials: Silver-wired DNA

    NASA Astrophysics Data System (ADS)

    Auffinger, Pascal; Ennifar, Eric

    2017-10-01

    DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

  19. 3. VIEW OF WILLOW CREEK TRESTLE FROM CORNER BASELINE AVENUE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW OF WILLOW CREEK TRESTLE FROM CORNER BASELINE AVENUE AND 185TH AVENUE, FACING NORTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

  20. MMPI Indices in the Discrimination of Brain-Damaged and Schizophrenic Groups

    ERIC Educational Resources Information Center

    Holland, Terrill R.; And Others

    1975-01-01

    The results of this investigation support Watson's (1971) hypothesis that his Schizophrenia-Organicity scales might be valid discriminators of braindamaged and schizophrenic patients equated for degree of intellectual deficit. (Author)

  1. Finite-size scaling of survival probability in branching processes

    NASA Astrophysics Data System (ADS)

    Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Álvaro

    2015-04-01

    Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We derive analytically the existence of finite-size scaling for the survival probability as a function of the control parameter and the maximum number of generations, obtaining the critical exponents as well as the exact scaling function, which is G (y ) =2 y ey /(ey-1 ) , with y the rescaled distance to the critical point. Our findings are valid for any branching process of the Galton-Watson type, independently of the distribution of the number of offspring, provided its variance is finite. This proves the universal behavior of the finite-size effects in branching processes, including the universality of the metric factors. The direct relation to mean-field percolation is also discussed.

  2. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    PubMed

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  3. Watson, Swellengrebel and species sanitation: environmental and ecological aspects.

    PubMed

    Bradley, D J

    1994-08-01

    Following the discovery of mosquito transmission of malaria, the theory and practice of malaria control by general and selective removal of specific vector populations resulted particularly from Malcolm Watson's empirical work in peninsular Malaysia, first in the urban and peri-urban areas of Klang and Port Swettenham and subsequently in the rural rubber plantations, and from the work of N.H. Swellengrebel in nearby Indonesia on the taxonomy, ecology and control of anophelines. They developed the concept of species sanitation: the selective modification of the environment to render a particular anopheline of no importance as a vector in a particular situation. The lack of progress along these lines in India at that time is contrasted with that in south-east Asia. The extension of species sanitation and related concepts to other geographical areas and to other vector-borne disease situations is outlined.

  4. Base modification strategies to modulate immune stimulation by an siRNA.

    PubMed

    Valenzuela, Rachel Anne P; Suter, Scott R; Ball-Jones, Alexi A; Ibarra-Soza, José M; Zheng, Yuxuan; Beal, Peter A

    2015-01-19

    Immune stimulation triggered by siRNAs is one of the major challenges in the development of safe RNAi-based therapeutics. Within an immunostimulatory siRNA sequence, this hurdle is commonly addressed by using ribose modifications (e.g., 2'-OMe or 2'-F), which results in decreased cytokine production. However, as immune stimulation by siRNAs is a sequence-dependent phenomenon, recognition of the nucleobases by the trigger receptor(s) is also likely. Here, we use the recently published crystal structures of Toll-like receptor 8 (TLR8) bound to small-molecule agonists to generate computational models for ribonucleotide binding by this immune receptor. Our modeling suggested that modification of either the Watson-Crick or Hoogsteen face of adenosine would disrupt nucleotide/TLR8 interactions. We employed chemical synthesis to alter either the Watson-Crick or Hoogsteen face of adenosine and evaluated the effect of these modifications in an siRNA guide strand by measuring the immunostimulatory and RNA interference properties. For the siRNA guide strand tested, we found that modifying the Watson-Crick face is generally more effective at blocking TNFα production in human peripheral blood mononuclear cells (PBMCs) than modification at the Hoogsteen edge. We also observed that modifications near the 5'-end were more effective at blocking cytokine production than those placed at the 3'-end. This work advances our understanding of how chemical modifications can be used to optimize siRNA performance. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Rare disease diagnosis: A review of web search, social media and large-scale data-mining approaches.

    PubMed

    Svenstrup, Dan; Jørgensen, Henrik L; Winther, Ole

    2015-01-01

    Physicians and the general public are increasingly using web-based tools to find answers to medical questions. The field of rare diseases is especially challenging and important as shown by the long delay and many mistakes associated with diagnoses. In this paper we review recent initiatives on the use of web search, social media and data mining in data repositories for medical diagnosis. We compare the retrieval accuracy on 56 rare disease cases with known diagnosis for the web search tools google.com, pubmed.gov, omim.org and our own search tool findzebra.com. We give a detailed description of IBM's Watson system and make a rough comparison between findzebra.com and Watson on subsets of the Doctor's dilemma dataset. The recall@10 and recall@20 (fraction of cases where the correct result appears in top 10 and top 20) for the 56 cases are found to be be 29%, 16%, 27% and 59% and 32%, 18%, 34% and 64%, respectively. Thus, FindZebra has a significantly (p < 0.01) higher recall than the other 3 search engines. When tested under the same conditions, Watson and FindZebra showed similar recall@10 accuracy. However, the tests were performed on different subsets of Doctors dilemma questions. Advances in technology and access to high quality data have opened new possibilities for aiding the diagnostic process. Specialized search engines, data mining tools and social media are some of the areas that hold promise.

  6. Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

    PubMed

    Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

    2016-09-07

    One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

  7. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    PubMed

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  8. The nitrous oxide "dream" of Cora Gray: a dental anesthesia story of 1884.

    PubMed

    Christen, Arden G; Christen, Joan A

    2014-01-01

    In the September 1884 issue of Frank Leslie's Popular Monthly magazine, a fictional dramatic short story was published concerning the dental use of nitrous oxide. Entitled, "Cora Gray," it was written by the well-known American journalist and poet John Whittaker Watson (1815-1848), who authored hundreds of sentimental, tragic and dramatic poems, serials and stories concerning the destitute lives and deaths of downtrodden young women of that time. His greatest poetic effort, "Beautiful Snow," (1869) tells of a young prostitute who freezes to death in a snow bank. Watson, born in New York City, was educated at the University of New York, where he studied medicine. He also developed and used his skills as an engraver, journalist and writer. Watson obviously based his imaginative narrative on his medical knowledge of nitrous oxide and its physical and psychological side effects when inhaled. The story centers around the dreamlike romantic experiences of a 19-year-old female dental patient while she is under the effects of this gas. It explicitly depicts the administration of nitrous oxide and the resulting erotic visions and hallucinations that the young patient experiences. We make reference to other cautionary scientific writings from the late 1800s, in order to point out and clarify the potentially negative repercussions of nitrous oxide when administered to female dental patients without the presence of a third party. The ethics and propriety of anesthesia administration remain as perennial questions in dentistry to this day.

  9. Zr diffusion in titanite

    NASA Astrophysics Data System (ADS)

    Cherniak, D. J.

    2006-11-01

    Chemical diffusion of Zr under anhydrous, pO2-buffered conditions has been measured in natural titanite. The source of diffusant was either zircon powder or a ZrO2-Al2O3-titanite mixture. Experiments were run in sealed silica glass capsules with solid buffers (to buffer at NNO or QFM). Rutherford Backscattering Spectrometry (RBS) was used to measure diffusion profiles. The following Arrhenius parameters were obtained for Zr diffusion parallel to c over the temperature range 753-1,100°C under NNO-buffered conditions: D Zr = 5.33 × 10-7 exp(-325 ± 30 kJ mol-1/RT) m2 s-1 Diffusivities are similar for experiments buffered at QFM. These data suggest that titanite should be moderately retentive of Zr chemical signatures, with diffusivities slower than those for O and Pb in titanite, but faster than those for Sr and the REE. When applied in evaluation of the relative robustness of the recently developed Zr-in-titanite geothermometer (Hayden and Watson, Abstract, 16th V.M. Goldschmidt Conference 2006), these findings suggest that Zr concentrations in titanite will be less likely to be affected by later thermal disturbance than the geothermometer based on Zr concentrations in rutile (Zack et al. in Contrib Mineral Petrol 148:471-488, 2004; Watson et al. in Contrib Mineral. Petrol, 2006), but much less resistant to diffusional alteration subsequent to crystallization than the Ti-in-Zircon geothermometer (Watson and Harrison in Science 308:841-844, 2005).

  10. Rare disease diagnosis: A review of web search, social media and large-scale data-mining approaches

    PubMed Central

    Svenstrup, Dan; Jørgensen, Henrik L; Winther, Ole

    2015-01-01

    Physicians and the general public are increasingly using web-based tools to find answers to medical questions. The field of rare diseases is especially challenging and important as shown by the long delay and many mistakes associated with diagnoses. In this paper we review recent initiatives on the use of web search, social media and data mining in data repositories for medical diagnosis. We compare the retrieval accuracy on 56 rare disease cases with known diagnosis for the web search tools google.com, pubmed.gov, omim.org and our own search tool findzebra.com. We give a detailed description of IBM's Watson system and make a rough comparison between findzebra.com and Watson on subsets of the Doctor's dilemma dataset. The recall@10 and recall@20 (fraction of cases where the correct result appears in top 10 and top 20) for the 56 cases are found to be be 29%, 16%, 27% and 59% and 32%, 18%, 34% and 64%, respectively. Thus, FindZebra has a significantly (p < 0.01) higher recall than the other 3 search engines. When tested under the same conditions, Watson and FindZebra showed similar recall@10 accuracy. However, the tests were performed on different subsets of Doctors dilemma questions. Advances in technology and access to high quality data have opened new possibilities for aiding the diagnostic process. Specialized search engines, data mining tools and social media are some of the areas that hold promise. PMID:26442199

  11. Effects of polarization direction on laser-assisted free-free scattering

    NASA Astrophysics Data System (ADS)

    deHarak, B. A.; Kim, B. N.; Weaver, C. M.; Martin, N. L. S.; Siavashpouri, Mahsa; Nosarzewski, Benjamin

    2016-06-01

    This work will detail the effects of laser polarization direction (relative to the momentum transfer direction) on laser-assisted free-free scattering. Such processes play a role in the gas breakdown that occurs in electric discharges as well as providing a method for the laser heating of a plasma (Musa et al 2010 J. Phys. B: At. Mol. Opt. Phys. 43 175201, Mason 1993 Rep. Prog. Phys. 56 1275). Experimental results will be presented for electron-helium scattering in the presence of an Nd:YAG laser field (hν =1.17 eV) where the polarization direction was varied in a plane that is perpendicular to the scattering plane. To date, all of our experimental results are well described by the Kroll-Watson approximation (KWA) (Kroll and Watson 1973 Phys. Rev. A 8 804). The good agreement between our experiments and calculations using the KWA includes the case where the polarization is perpendicular to the momentum transfer direction, for which the KWA predicts vanishing cross section; other workers have found that the KWA tends to be inaccurate for cases where it predicts small cross sections (e.g. Musa et al 2010 J. Phys. B: At. Mol. Opt. Phys. 43 175201). We also present simulations of the effects that multiple scattering might have on experimental measurements. In particular, we examine conditions that are expected to be similar to those of the experiments reported by Wallbank and Holmes (Wallbank and Holmes 1993 Phys. Rev. A 48 R2515).

  12. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOEpatents

    Cantor, C.R.; Ito, Takashi; Smith, C.L.

    1996-01-09

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

  13. 14. VIEW OF CEDAR MILL CREEK TRESTLE FROM TRESTLE OVER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. VIEW OF CEDAR MILL CREEK TRESTLE FROM TRESTLE OVER CEDAR MILL CREEK ON SPUR LINE, FACING SOUTHWEST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

  14. 6. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept 16, 1940 (B) EXTERIOR, DETAIL OF ENTRANCE & ENTRANCE FRONT, FROM WEST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

  15. Resilience Metrics for the Electric Power System: A Performance-Based Approach.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vugrin, Eric D.; Castillo, Andrea R; Silva-Monroy, Cesar Augusto

    Grid resilience is a concept related to a power system's ability to continue operating and delivering power even in the event that low probability, high-consequence disruptions such as hurricanes, earthquakes, and cyber-attacks occur. Grid resilience objectives focus on managing and, ideally, minimizing potential consequences that occur as a result of these disruptions. Currently, no formal grid resilience definitions, metrics, or analysis methods have been universally accepted. This document describes an effort to develop and describe grid resilience metrics and analysis methods. The metrics and methods described herein extend upon the Resilience Analysis Process (RAP) developed by Watson et al. formore » the 2015 Quadrennial Energy Review. The extension allows for both outputs from system models and for historical data to serve as the basis for creating grid resilience metrics and informing grid resilience planning and response decision-making. This document describes the grid resilience metrics and analysis methods. Demonstration of the metrics and methods is shown through a set of illustrative use cases.« less

  16. 76 FR 14396 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-16

    .... Louis, Missouri 63166-2034: 1. The Greenwood Childrens' Trust, Brentwood, Tennessee, with Jane Allison Crewse, Brentwood, Tennessee; Ann Greenwood Watson, Owensboro, Kentucky; Helen Virginia Futvoye, Jackson...

  17. 7. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept 16, 1940 (D) EXTERIOR, PRIVY AT REAR OF LOT, VIEW FROM SOUTH EAST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

  18. 6. VIEW EAST TOWARDS LOTTSFORD BRANCH, THE AMPHITHEATRELIKE PLANTING AREA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. VIEW EAST TOWARDS LOTTSFORD BRANCH, THE AMPHITHEATRE-LIKE PLANTING AREA ON THE SOUTH SLOPE OF WATSON'S HILL - U.S. Plant Introduction Station, Landscape, 11601 Old Pond Road, Glenn Dale, Prince George's County, MD

  19. Spying on volcanoes

    NASA Astrophysics Data System (ADS)

    Watson, Matthew

    2017-07-01

    Active volcanoes can be incredibly dangerous, especially to those who live nearby, but how do you get close enough to observe one in action? Matthew Watson explains how artificial drones are providing volcanologists with insights that could one day save human lives

  20. 12. VIEW OF SWITCHES AND SPURS FROM NEAR EAST END ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. VIEW OF SWITCHES AND SPURS FROM NEAR EAST END OF CEDAR MILL CREEK TRESTLE NEAR MERLO ROAD, FACING SOUTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

  1. 13. VIEW FROM CEDAR MILL CREEK TRESTLE NEAR MERLO ROAD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. VIEW FROM CEDAR MILL CREEK TRESTLE NEAR MERLO ROAD TOWARD TRESTLE ON SPUR TRACK OVER CEDAR MILL CREEK, FACING NORTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

  2. 4. Historic American Buildings Survey, Arthur C. Haskell, Photographer. 1935. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Historic American Buildings Survey, Arthur C. Haskell, Photographer. 1935. (e) Int-Staircase from Jonathan Watson House, formerly on High St., Medford. - Colonel Isaac Royall Slave Quarters, 15 George Street, Medford, Middlesex County, MA

  3. ACHP | News | ACHP Spring Business Meeting

    Science.gov Websites

    Meeting Chairman John L. Nau, III awarded the Federal Communications Commission and the National Endowment Chairman John L. Nau, III NEH Acting Chairwoman Carole Watson receives the award from ACHP Chairman John L

  4. Graduate nurse internship program: a formalized orientation program.

    PubMed

    Phillips, Tracy; Hall, Mellisa

    2014-01-01

    The graduate nurse internship program was developed on the basis of Watson's Human Caring Theory. In this article, the author discusses how an orientation program was formalized into an internship program and how the theory was applied.

  5. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    PubMed

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  6. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Exact Derivation of a Finite-Size Scaling Law and Corrections to Scaling in the Geometric Galton-Watson Process

    PubMed Central

    Corral, Álvaro; Garcia-Millan, Rosalba; Font-Clos, Francesc

    2016-01-01

    The theory of finite-size scaling explains how the singular behavior of thermodynamic quantities in the critical point of a phase transition emerges when the size of the system becomes infinite. Usually, this theory is presented in a phenomenological way. Here, we exactly demonstrate the existence of a finite-size scaling law for the Galton-Watson branching processes when the number of offsprings of each individual follows either a geometric distribution or a generalized geometric distribution. We also derive the corrections to scaling and the limits of validity of the finite-size scaling law away the critical point. A mapping between branching processes and random walks allows us to establish that these results also hold for the latter case, for which the order parameter turns out to be the probability of hitting a distant boundary. PMID:27584596

  8. Relationships between critical thinking and attitudes toward women's roles in society.

    PubMed

    Loo, Robert; Thorpe, Karran

    2005-01-01

    This exploratory study is the first examination of the relationships between critical thinking--as measured by subscales on the Watson-Glaser Critical Thinking Appraisal Form S (WGCTA Form S; G. B. Watson & E. M. Glaser, 1994)-and attitudes toward women's roles in society--as measured by subscales on the Attitudes Toward Women Scale (AWS: J. T. Spence & R. L. Helmreich, 1972). The authors hypothesized that greater critical thinking skills would be associated with more liberal attitudes toward women's roles in society. Results from a sample of 90 nursing and management undergraduates supported the hypothesis. There were moderate correlations between scores from the WGCTA Form S Inference (.24 to .37) and Deduction (.19 to .26) subtests and scores from the AWS Freedom and Independence; Marital Relationships and Obligation; and Vocational, Educational, and Intellectual Roles subscales. These findings suggest that further research with larger samples and cross-cultural samples is warranted.

  9. Cenotes (sinkholes) of the Yucatan Peninsula, Mexico, as a habitat of adult trematodes of fish.

    PubMed

    Scholz, T; Vargas-Vázquez, J; Moravec, F; Vivas-Rodríguez, C; Mendoza-Franco, E

    1995-01-01

    Examination of a total of 581 fish specimens of 15 species from 39 cenotes (sinkholes) in the Yucatan Peninsula, southeastern Mexico, revealed the presence of 10 species of adult trematodes. These were as follows: Saccocoelioides sogandaresi Lumsden, 1963, Saccocoelioides sp. (family Haploporidae), Cichlasotrema ujati Pineda et Andrade, 1989 (Angiodictyidae), Crassicutis cichlasomae Manter, 1936 (Homalometridae), Magnivitellinum simplex Kloss, 1966 (Macroderoididae), Stunkardiella minima (Stunkard, 1938) (Acanthostomidae), Oligogonotylus manteri Watson, 1976 (Cryptogonimidae), Genarchella tropica (Manter, 1936), G. astyanactis (Watson, 1976), and G. isabellae (Lamothe-Argumedo, 1977) (Derogenidae). Saccocoelioides sogandaresi is reported from Mexico for the first time. Poecilia velifera and P. latipunctata for S. sogandaresi, Cichlasoma octofasciatum for C. cichlasomae, Cichlasoma friedrichstahli and C. meeki for O. manteri, and C. meeki, C. octofasciatum and Gobiomorus dormitor for G. isabellae represent new host records. Most species found are described and figured and their host range and distribution are discussed.

  10. Laser-induced free-free transitions in elastic electron scattering from CO2

    NASA Astrophysics Data System (ADS)

    Musa, Mohamed; MacDonald, Amy; Tidswell, Lisa; Holmes, Jim; St. Francis Xavier Laser Scattering Lab Team

    2011-03-01

    This report presents measurements of laser-induced free-free transitions of electrons scattered from CO2 molecules in the ground electronic state at incident electron energies of 3.8 and 5.8 eV under pulsed CO2 laser field. The differential cross section of free-free transitions involving absorption and emission of up to two photons were measured at various scattering angles with the polarization of the laser either parallel with or perpendicular to the the momentum change vector of the scattered electrons. The results of the parallel geometry are found to be in qualitative agreement with the predictions of the Kroll-Watson approximation within the experimental uncertainty whereas those of the perpendicular geometry show marked discrepancy with the Kroll-Watson predictions. This work was supported by the Natural Sciences and Engineering Research Council of Canada and the St. Francis Xavier University Council for Research.

  11. Nerve injury after hip arthroplasty. 5/600 cases after uncemented hip replacement, anterolateral approach versus direct lateral approach.

    PubMed

    van der Linde, M J; Tonino, A J

    1997-12-01

    In 600 consecutive uncemented total hip replacements, 2 surgical approaches were used: the direct lateral Hardinge approach in supine position (group I: 241 cases) or in a lateral position (group II: 280 cases) and the anterolateral Watson-Jones approach in supine position (group III: 79 cases). 5 patients had clinically evident peripheral nerve injuries confirmed with EMG: none in group I, 1 lesion of the nervus ischiadicus and nervus femoralis in group II and 4 nervus femoralis lesions in group III, of which 1 was combined with an obturator nerve injury. The nerve injuries were evaluated with EMG. All 4 nervus femoralis lesions recovered spontaneously, but the one patients in group II had a persistent palsy of the peroneal nerve. The anatomical basis for the higher prevalence of nervus femoralis lesions in the anterolateral Watson-Jones approach is described.

  12. Singly and Doubly Excited States of the D-Dimensional Helium Atom(Supported by DOD-ONR N00014-94-1-0998)

    NASA Astrophysics Data System (ADS)

    Carzoli, J.; Dunn, M.; Watson, D. K.

    1998-05-01

    Large order dimensional perturbation theory (DPT) has been used to study the ground and a number of excited states of two-electron atoms for the case L=0. Here we present the first application of recent work generalizing DPT to higher angular momentum.(M. Dunn, D.K. Watson, Ann. Phys. 251 (1996) 266)^,(M. Dunn, D.K. Watson, The Large Dimension Limit of Higher Angular Momentum States. Phys. Rev. A. (accepted for publication)) In this work we begin the investigation of P^o states, presenting results for the energies of some of the lowest lying states and discuss the analytic structure of these energies as functions of 1/D. We also obtain energies of corresponding D^o states with almost no additional effort by making use of interdimensional degeneracies with the P^o states.

  13. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    NASA Astrophysics Data System (ADS)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  14. Reduction of display artifacts by random sampling

    NASA Technical Reports Server (NTRS)

    Ahumada, A. J., Jr.; Nagel, D. C.; Watson, A. B.; Yellott, J. I., Jr.

    1983-01-01

    The application of random-sampling techniques to remove visible artifacts (such as flicker, moire patterns, and paradoxical motion) introduced in TV-type displays by discrete sequential scanning is discussed and demonstrated. Sequential-scanning artifacts are described; the window of visibility defined in spatiotemporal frequency space by Watson and Ahumada (1982 and 1983) and Watson et al. (1983) is explained; the basic principles of random sampling are reviewed and illustrated by the case of the human retina; and it is proposed that the sampling artifacts can be replaced by random noise, which can then be shifted to frequency-space regions outside the window of visibility. Vertical sequential, single-random-sequence, and continuously renewed random-sequence plotting displays generating 128 points at update rates up to 130 Hz are applied to images of stationary and moving lines, and best results are obtained with the single random sequence for the stationary lines and with the renewed random sequence for the moving lines.

  15. [Considering body ethics in the healthcare profession].

    PubMed

    Wang, Shin-Yun

    2014-10-01

    This article uses the theory of body phenomenology and Watson's caring theory to develop and apply body ethics to the clinical healthcare profession. This attempt is meant to facilitate deep, humanistic experiences for healthcare personnel. The analysis of body phenomenology reveals that the soul is banished from her familiar and comfortable "at-home" status when illness and pain invade the body. In such situations, the body becomes an external object that is self-alienated. This experience induces experiences such as solitude and violence. However, it also holds the potential to expose the original morality of the body. Additionally, this article discusses popular tools used in clinical ethics such as principalism and virtual-based ethics, which are based on moral reasoning and moral feeling. In contrast to these, body ethics seek a more profound and humble level of sensibility that is able to implant authenticity into the ethics. Finally, we offer some suggestions related to Watson's caring theory.

  16. Statement on nursing: a personal perspective.

    PubMed

    McCutcheon, Tonna

    2004-01-01

    Contemporary nursing is based on a conglomerate of theoretical nursing models. These models each incorporate four central concepts: person, health, environment, and nursing. By defining these concepts, nurses develop an individual framework from which they base their nursing practice. As an aspiring nurse practitioner in the gastroenterology field, I have retrospectively assessed my personal definitions of person, health, environment, and nursing. From these definitions, I am able to incorporate specific theoretical frameworks into my personal belief system, thus formulating a basis for my nursing practice. This foundation is comprised of the influence of nursing theorists Jean Watson, Sister Callista Roy, Kolcaba, Florence Nightingale, and Ida J. Orlando; the Perioperative Patient-Focused Model; Watson's Theory of Human Caring; theories regarding transpersonal human caring and healing; and feminist theories. Therefore, this article describes self-examination of nursing care by defining central nursing concepts, acknowledging the influence of nursing theorists and theories, and developing a personal framework from which I base my nursing practice.

  17. Is Watson's ``CHARGE-MODIFIED'' Reduced Mass always best for Diatomic Ions ?

    NASA Astrophysics Data System (ADS)

    Le Roy, Robert J.; Dattani, Nikesh S.

    2016-06-01

    Watson's landmark reformulation of the Born-Oppenheimer separation problem has been the basis of most combined-isotopologue analyses of diatomic spectroscopic data since 1980. One noteworthy feature of this work was his proposal that description of the dynamical behaviour of a diatomic ion with (±) charge Q, formed from atoms with isotopic masses of M_1 and M_2, should use a ``charge-modified'' reduced mass: μWat≡ M_1 M_2 /(M_1 + M_2 - Q m_e) , in which m_e is the electron mass, and this proposal seems to have been benignly accepted and adopted. The first quantitative test of this proposal was in the pioneering combined-isotopologue direct-potential-fit (CI-DPF) study of HeH^+ by Coxon and Hajigeorgiou in 1999, where they compared the quality of fit for analyses that used different choices for the definition of the reduced masses of the various isotopologues, and found that the best choice seemed to be to use conventional two-body reduced masses for (M_1 - 1/2 m_e) and (M_2 - 1/2 m_e ). This question was re-examined recently in the context of a CI-DPF study of CH^+, and a rather different conclusion was reached. The present paper combines new CI-DPF studies of HeH^+ and BeH^+ with our recent CH^+ work, and attempts to draw some general conclusions on this matter. J.K.G. Watson, J. Mol. Spectrosc. 80, 411 (1980) J.A. Coxon and P. Hajigeorgiou, J. Mol. Spectrosc. 193, 306 (1999). Y.-S. Cho and R.J. Le Roy, J. Chem. Phys. 144, 024311 (2016)

  18. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  19. Rotational Spectrum, Conformational Composition, Intramolecular Hydrogen Bonding, and Quantum Chemical Calculations of Mercaptoacetonitrile (HSCH2C≡N), a Compound of Potential Astrochemical Interest.

    PubMed

    Møllendal, Harald; Samdal, Svein; Guillemin, Jean-Claude

    2016-03-31

    The microwave spectra of mercaptoacetonitrile (HSCH2C≡N) and one deuterated species (DSCH2C≡N) were investigated in the 7.5-124 GHz spectral interval. The spectra of two conformers denoted SC and AP were assigned. The H-S-C-C chain of atoms is synclinal in SC and anti-periplanar in AP. The ground state of SC is split into two substates separated by a comparatively small energy difference resulting in closely spaced transitions with equal intensities. Several transitions of the parent species of SC deviate from Watson's Hamiltonian. Only slight improvements were obtained using a Hamiltonian that takes coupling between the two substates into account. Deviations from Watson's Hamiltonian were also observed for the parent species of AP. However, the spectrum of the deuterated species, which was investigated only for the SC conformer, fits satisfactorily to Watson's Hamiltonian. Relative intensity measurements found SC to be lower in energy than AP by 3.8(3) kJ/mol. The strength of the intramolecular hydrogen bond between the thiol and cyano groups was estimated to be ∼2.1 kJ/mol. The microwave work was augmented by quantum chemical calculations at CCSD and MP2 levels using basis sets of minimum triple-ζ quality. Mercaptoacetonitrile has astrochemical interest, and the spectra presented herein should be useful for a potential identification of this compound in the interstellar medium. Three different ways of generating mercaptoacetonitrile from compounds already found in the interstellar medium were explored by quantum chemical calculations.

  20. 6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

    PubMed Central

    Berressem, R; Engels, J W

    1995-01-01

    2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457

  1. 6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

    PubMed

    Berressem, R; Engels, J W

    1995-09-11

    2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.

  2. 'Introspectionism' and the mythical origins of scientific psychology.

    PubMed

    Costall, Alan

    2006-12-01

    According to the majority of the textbooks, the history of modern, scientific psychology can be tidily encapsulated in the following three stages. Scientific psychology began with a commitment to the study of mind, but based on the method of introspection. Watson rejected introspectionism as both unreliable and effete, and redefined psychology, instead, as the science of behaviour. The cognitive revolution, in turn, replaced the mind as the subject of study, and rejected both behaviourism and a reliance on introspection. This paper argues that all three stages of this history are largely mythical. Introspectionism was never a dominant movement within modern psychology, and the method of introspection never went away. Furthermore, this version of psychology's history obscures some deep conceptual problems, not least surrounding the modern conception of "behaviour," that continues to make the scientific study of consciousness seem so weird.

  3. Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.

    PubMed

    Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun

    2018-06-04

    Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery.

  4. Closed-form expressions for state-to-state charge-transfer differential cross sections in a modified Faddeev three-body approach

    NASA Astrophysics Data System (ADS)

    Adivi, E. Ghanbari; Brunger, M. J.; Bolorizadeh, M. A.; Campbell, L.

    2007-02-01

    The second-order Faddeev-Watson-Lovelace approximation in a modified form is applied to charge transfer from hydrogenlike target atoms by a fully stripped energetic projectile ion. The state-to-state, nlm→n'l'm' , partial transition amplitudes are calculated analytically. The method is specifically applied to the collision of protons with hydrogen atoms, where differential cross sections of different transitions are calculated for incident energies of 2.8 and 5.0MeV . It is shown that the Thomas peak is present in all transition cross sections. The partial cross sections are then summed and compared with the available forward-angle experimental data, showing good agreement.

  5. Fatigue 󈨛. Papers presented at the International Conference on Fatigue and Fatigue Threshold (3rd) Held in Charlottesville, Virginia on June 28-July 3, 1987. Volume 2.

    DTIC Science & Technology

    1987-10-15

    Region B: max b+c 𔃼/E (2N) 2b (2) al £1 = a ,(N) + ai/ f N 2 This model was originally proposed by Smith, Watson and Topper (13) for mean stress effects...relationship such as that proposed by Forman et al . (2) can be used to predict crack growth rates in this regime: da N’ AK .. (2) =-N (i-R)K -AKc *Technologv...to the specimen given by the area under the load displacement curve, Up in Figure 1. The method of J calculation is that described by Garwood et al

  6. 76 FR 64 - Safety and Health Requirements Related to Camp Cars

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-03

    ... creating an unconstitutional, ex post facto law, and that is what Congress provided with the new statutory... preempting State regulation of the hours of railroad employees. See Hill v. State of Florida ex rel. Watson...

  7. 5. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept 16, 1940 (C) EXTERIOR, VIEW FROM REAR (SOUTH EAST) SHOWING COACH HOUSE AT RIGHT. - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

  8. Caring as an Imperative for Nursing Education.

    ERIC Educational Resources Information Center

    Cook, Patricia R.; Cullen, Janice A.

    2003-01-01

    An associate nursing degree program threads caring across the curriculum using Watson's framework of interpersonal/transpersonal processes for caring and a taxonomy of affective competencies. Ways of caring are integrated into classroom and clinical experiences. (Contains 20 references.) (SK)

  9. 21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division, Continental Grain Co., P.O. Box 459..., CA 94544 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000409 Hospira Inc...

  10. Chronology and Petrology of Silicates From IIE Iron Meteorites: Evidence of a Complex Parent Body Evolution

    NASA Technical Reports Server (NTRS)

    Bogard, Donald D.; Garrison, Daniel H.; McCoy, Timothy J.

    1999-01-01

    IIE iron meteorites contain silicate inclusions whose characteristics suggest a parent body similar to that of H-chondrites. However, these silicates show a wide range of alteration, ranging from Netschadvo and Techado, whose inclusions are little altered. to highly differentiated silicates like-those in Kodaikanal, Weekeroo Station and Colomera, which have lost metal and sulfur and are enriched in feldspar. We find these inclusions to show varying degrees of shock alteration. Because only a limited amount of data on - isotopic ages of HE silicates were available, we made Ar-39 - Ar-40 age determinations of Watson, Techado, miles Colomera, and Sombrerete. Watson has an Ar-Ar age of 3.653 +/- 0.012 Gyr, similar to previously reported ages for Kodaikanal and Netschadvo. We suggest that the various determined radiometric ages of these three meteorites were probably reset by a common impact event. The space exposure ages for these three meteorites are also similar to each other and are considerably younger than exposure ages of other IIEs. Ar-39 - Ar-40 ages inferred for the other four meteorites analyzed are considerably older than Watson and are: Techado =4.49 +/- 0.01 Gyr, Miles =4.412 +/- 0.016 Gyr, Colomera =4.469 +/- 0.012 Gyr, and Sombrerete =4.535 +/- 0.005 Gyr. These ages are in fair agreement with previously reported Rb-Sr isochron ages for Colomera and Weekeroo Station. Although several mechanisms to form HE meteorites previously were suggested, it is not obvious that a single mechanism could produce a suite of meteorites with very different degrees of silicate differentiation and with isotopic ages that differ by >0.8 Gyr. We suggest that those IIEs with older isotopic ages are a product of partial melting and differentiation within the parent body, followed by mixing of silicate and metal while both were relatively hot. Netschadvo and Watson may have formed by this same process or by impact mixing about 4.5 Gyr ago, but their isotopic ages were subsequently reset by shock heating. Kodaikanal apparently is required to have formed more recently, in which case impact melting and differentiation seems the only viable process. We see no compelling reasons to believe that IIE silicate and metal derived from different parent bodies or that the parent body of IIEs was the same as that of H-chondrites.

  11. Efficacy of dialysis in peritoneal dialysis: utility of bioimpedance to calculate Kt/V and the search for a target Kt.

    PubMed

    Martínez Fernández, G; Ortega Cerrato, A; Masiá Mondéjar, J; Pérez Rodríguez, A; Llamas Fuentes, F; Gómez Roldán, C; Pérez-Martínez, Juan

    2013-04-01

    To calculate Kt/V, volume (V) is usually obtained by Watson formula, but bioimpedance spectroscopy (BIS) is a simple and applicable technique to determinate V, along with other hydration and nutrition parameters, in peritoneal dialysis (PD) patients. Dialysis efficacy can also be measured with Kt, but no experience exists in PD, so there is no reference/target value for Kt that must be achieved in these patients to be considered adequately dialyzed. We evaluated the efficacy of PD with Kt/V using Watson formula and BIS for V calculation, assessed hydration status in a PD unit by data obtained by BIS, and attempted to find a reference Kt from the Kt/V previously obtained by BIS. In this observational prospective study of 78 PD patients, we measured V using BIS (V bis) and Watson formula (V w) and calculated weekly Kt/V using both volumes (Kt/V bis/V bis and Kt/V w). With the BIS technique, we obtained and subsequently analyzed other hydration status parameters. We achieved a reference Kt, extrapolating the value desired (weekly Kt/V 1.7) to the target Kt using the simple linear regression statistical technique, basing it on the results of the previously calculated Pearson's linear correlation coefficient. Volume was 1.8 l higher by Watson formula than with BIS (p < 0.001). Weekly Kt/V bis was 2.33 ± 0.68, and mean weekly Kt/V w was 2.20 ± 0.63 (p < 0.0001); 60.25 % of patients presented overhydration according to the BIS study (OH >1.1 l). The target value of Kt for the reference weekly Kt/V bis (1.7) was 64.87 l. BIS is a simple, applicable technique for calculating V in dialysis that can be especially useful in PD patients compared with the anthropometric formulas, by the abnormally distributed body water in these patients. Other parameters obtained by BIS will serve to assess both the distribution of body volume and nutritional status in the clinical setting. The target Kt value obtained from Kt/V bis allowed us to measure the efficacy of PD in a practical way, omitting V measurement.

  12. Mentoring: Positively Influencing Job Satisfaction and Retention of New Hire Nurse Practitioners.

    PubMed

    Horner, Diane Kostrey

    The purpose of study was to determine whether mentoring based on Watson's Caring Model positively influences nurse practitioner (NP) job satisfaction. This nonexperimental mixed-methods study utilized an online survey, administered through Qualtrics containing demographic and mentoring variables. Job satisfaction results were obtained from the Misener Nurse Practitioner Job Satisfaction Scale (MNPJSS). Also, open-ended questions regarding mentoring were reported. There was a 54% response rate in which 37 of the 69 participants responded (n = 37), with statistical significance set at p < .05. All or 100% of participants reported that the mentor experience/relationship positively influenced job satisfaction. Scores from the MNPJSS ranged from 141 to 246, with a mean of 195.26 (SD = 28.29) corresponding to "minimally satisfied" or a mean of 4.44 on the 6-point scale. These results are similar to the MNPJSS score with a mean of 4.39. A mentoring experience can provide a positive environment, which can lead to increased job satisfaction. In turn, a higher level of satisfaction in the work environment can be associated with reduced turnover and improved retention and patient outcomes. Ultimately, a safer health care system will evolve and improve patient care and outcomes. Through Watson's Caring Model, a reciprocal relationship between the mentor and the mentee can provide a new NP hire a sense of community and direct availability. By experiencing a mentor relationship, job satisfaction can improve, which is a key factor in retaining NPs. As E-mentoring is a newer topic in nursing literature, further research is needed. Further studies could also review and develop one-on-one mentoring programs.

  13. HRD in Difficult Times. Symposium.

    ERIC Educational Resources Information Center

    2002

    This document contains three papers on challenges facing human resource development today. "In Difficult Times: Influences of Attitudes and Expectations Towards Training and Redeployment Opportunities in a Hospital Retraction Programme" (Sandra Watson, Jeff Hyman) presents reasons behind the low uptake of training and redeployment…

  14. 21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division, Continental Grain Co., P.O..., 24 Olney Ave., Cherry Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA...

  15. 21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division, Continental Grain Co., P.O. Box 459... Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000409 Hospira Inc., 275 North Field Dr...

  16. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  17. ‘Columbia Sunrise’ thornless trailing blackberry

    USDA-ARS?s Scientific Manuscript database

    ‘Columbia Sunrise’ is a new, very early ripening, thornless trailing blackberry (Rubus subg. Rubus Watson) cultivar from the U.S. Department of Agriculture-Agricultural Research Service (USDA-ARS) breeding program in Corvallis, OR, released in cooperation with Oregon State University’s Agricultural ...

  18. Aviation. Career Focus, Volume 3, No. 4.

    ERIC Educational Resources Information Center

    Reese, Susan

    2001-01-01

    This special section on aviation careers describes the programs of Embry-Riddle Aeronautical University, the Metro Tech Aviation Career Campus in Oklahoma City, the Aviation Technology Center at Vincennes University in Indianapolis, and the Miami-Dade Community College's Eig-Watson School of Aviation. (JOW)

  19. Sweetie Pie Thornless Blackberry

    USDA-ARS?s Scientific Manuscript database

    ‘Sweetie Pie’ is a new thornless blackberry (Rubus L. subg. Watson) cultivar developed and released by the USDA-ARS Thad Cochran Southern Horticultural Laboratory. ‘Sweetie Pie’ is a vigorous, semi-erect blackberry that produces moderate yields of sweet high quality fruit having excellent flavor, ...

  20. 75 FR 57984 - Investigations Regarding Certifications of Eligibility To Apply for Worker Adjustment Assistance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-23

    ... Cambridge, OH......... 09/08/10 09/07/10 (Workers). 74606 Watson Laboratories, Inc. Carmel, NY 09/10/10 09... Galt Temp Agency Burlington, MA........ 09/10/10 09/03/10 (State/One-Stop). 74614 IBM Global Services...

  1. QCD on the BlueGene/L Supercomputer

    NASA Astrophysics Data System (ADS)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-03-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.

  2. 78 FR 47320 - Preventing Skin Cancer Through Reduction of UV Exposure

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-05

    ..., Epidemiology and Applied Research Branch, Division of Cancer Prevention and Control, Centers for Disease... melanoma and skin cancer risk-related behaviors, conducts applied research and evaluation, and translates....regulations.gov . FOR FURTHER INFORMATION CONTACT: Meg Watson, Epidemiologist, Epidemiology and Applied...

  3. ‘Columbia Giant’ thornless trailing blackberry

    USDA-ARS?s Scientific Manuscript database

    ‘Columbia Giant’ is a new thornless, very large fruited, trailing blackberry (Rubus subg. Rubus Watson) cultivar from the U.S. Department of Agriculture-Agricultural Research Service (USDA-ARS) breeding program in Corvallis, OR, released in cooperation with Oregon State University’s Agricultural Exp...

  4. Little Albert from the Viewpoint of Abnormal Psychology Textbook Authors.

    ERIC Educational Resources Information Center

    LeUnes, Arnold

    1983-01-01

    Watson and Rayner's study of Little Albert and conditioned emotional reactions is unquestionably a classic in psychology. Observations are made on what authors of 27 college textbooks in abnormal psychology have to say or not to say about Little Albert. (RM)

  5. Macromolecules Vis-a-Vis the Traditions of Chemistry

    ERIC Educational Resources Information Center

    Flory, Paul J.

    1973-01-01

    Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…

  6. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chrisochoides, N.; Sukup, F.

    In this paper we present a parallel implementation of the Bowyer-Watson (BW) algorithm using the task-parallel programming model. The BW algorithm constitutes an ideal mesh refinement strategy for implementing a large class of unstructured mesh generation techniques on both sequential and parallel computers, by preventing the need for global mesh refinement. Its implementation on distributed memory multicomputes using the traditional data-parallel model has been proven very inefficient due to excessive synchronization needed among processors. In this paper we demonstrate that with the task-parallel model we can tolerate synchronization costs inherent to data-parallel methods by exploring concurrency in the processor level.more » Our preliminary performance data indicate that the task- parallel approach: (i) is almost four times faster than the existing data-parallel methods, (ii) scales linearly, and (iii) introduces minimum overheads compared to the {open_quotes}best{close_quotes} sequential implementation of the BW algorithm.« less

  8. Measuring the Use of ICTs in the Classroom

    ERIC Educational Resources Information Center

    Jamieson-Proctor, Romina; Watson, Glenice; Finger, Glenn; Grimbeek, Peter; Burnett, Paul C.

    2007-01-01

    In 2003, the "ICT Curriculum Integration Performance Measurement Instrument" was developed from an extensive review of the contemporary international and Australian research pertaining to the definition and measurement of ICT curriculum integration in classrooms (Proctor, Watson, & Finger, 2003). The 45-item instrument that resulted…

  9. Perceived Best Practices for Faculty Training in Distance Education

    ERIC Educational Resources Information Center

    McVey, Michael G.

    2014-01-01

    Student learning style differences have been widely researched in both traditional face-to-face and online learning environments (Irani, Scherler & Harrington, 2003;Steinbronn, 2007; Williamson & Watson, 2007; Ugur, Akkoyunlu & Kurbanoglu, 2001). After conducting a literature review of adult student learning styles and teaching method…

  10. The Nature of Paradigmatic Shifts and the Goals of Science Education.

    ERIC Educational Resources Information Center

    Wagner, Paul A.

    1983-01-01

    Explains cognitive basis for change in science paradigms using Watson-Crick DNA model to illustrate concepts of "normal" versus "revolutionary" science. Examines these concepts in light of teacher preception of science, and discusses implications for the practice of science education. (JM)

  11. Beech Bark Disease

    Treesearch

    David R. Houston; James T. O' Brien

    1983-01-01

    Beech bark disease causes significant mortality and defect in American beech, Fagus grandifolia (Ehrh.). The disease results when bark, attacked and altered by the beech scale, Cryptococcus fagisuga Lind., is invaded and killed by fungi, primarily Nectria coccinea var. faginata Lohman, Watson, and Ayers, and sometimes N. galligena Bres.

  12. Managerial Performance Issues. Symposium 24. [AHRD Conference, 2001].

    ERIC Educational Resources Information Center

    2001

    This document contains three papers on managerial performance issues. "Managerial Skill Requirements: Evidence from the Scottish Visitor Attraction Industry" (Sandra Watson, Martin McCracken) presents the findings from an exploratory study of those skills that managers in the Scottish visitor attraction sector considered most important…

  13. Dictionary of marine technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taylor, D.A.

    1989-01-01

    This book is intended to replace G. O. Watson's Dictionary of Marine Engineering and Nautical Terms (1964). It includes terms from marine and offshore engineering, naval architecture, shipbuilding, shipping, ship operation, and relevant terms from the electronics, control and computing fields. A few nautical terms are also included.

  14. Biotechnology.

    ERIC Educational Resources Information Center

    Van Vranken, Nancy S., Ed.

    1987-01-01

    The field of biotechnology, and specifically recombinant DNA technology, is transforming the way that many feel about the nature and purposes of biology. This newsletter annual supplement contains several articles addressing the topic of biotechnology and the importance that the topic should be given in science classes. James D. Watson's article,…

  15. Magnetic phase diagrams of erbium

    NASA Astrophysics Data System (ADS)

    Frazer, B. H.; Gebhardt, J. R.; Ali, N.

    1999-04-01

    The magnetic phase diagrams of erbium in the magnetic field-temperature plane have been constructed for applied magnetic fields along the a and b axes. For an a-axis applied field our H-T phase diagrams determined from magnetization and magnetoresistance data are in good agreement and consistent with that of Jehan et al. for temperatures below 50 K. A splitting of the basal plane Néel temperature (TN⊥) above 3.75 T introduces two new magnetic phases. Also a transition from a fan to a canted fan phase as suggested by Jehan et al. is observed in an increasing field below TC. Our phase diagram for a b-axis applied field constructed from magnetization data is very similar to the phase diagram of Watson and Ali using magnetoresistance measurements. However, the anomaly at 42 K reported by Watson and Ali is not observed in the present study. No splitting of the TN⊥ transition is observed in either work for a field applied along the b axis.

  16. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    NASA Astrophysics Data System (ADS)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  17. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    PubMed

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  18. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  19. Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition

    PubMed Central

    Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576

  20. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  1. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    PubMed

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  2. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  3. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  4. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  5. Tandem duplication within a Neurofibromatosis type I (NFI) gene exon in a family with features of Watson syndrome and Noonan syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tassabehji, M.; Strachan, T.; Colley, A.

    Type 1 neurofibromatosis (NF1), Watson syndrome (WS), and Noonan syndrome (NS) show some overlap in clinical manifestations. In addition, WS has been shown to be linked to markers flanking the NF1 locus and a deletion at the NF1 locus demonstrated in a WS patient. This suggests either that WS and NF1 are allelic or the phenotypes arise from mutations in very closely linked genes. Here the authors provide evidence for the former by demonstrating a mutation in the NF1 gene in a family with features of both WS and NS. The mutation is an almost perfect in-frame tandem duplication ofmore » 42 bases in exon 28 of the NF1 gene. Unlike the mutations previously described in classical NF1, which show a preponderance of null alleles, the mutation in this family would be expected to result in a mutant neurofibromin product. 31 refs., 2 figs.« less

  6. Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI

    PubMed Central

    Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.

    2010-01-01

    The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511

  7. Creating Healing Environments Through the Theory of Caring.

    PubMed

    Norman, Vivian; Rossillo, Kim; Skelton, Katie

    2016-11-01

    We describe the journey of personnel at one hospital to create a healing environment for patients and staff members at all levels through the implementation of Watson's Theory of Human Caring and her Caritas Processes (ie, loving kindness, authentic presence, spirituality, being the environment, believing in miracles). We used experiential teaching and learning to explore the nursing theory with staff members. Positive outcomes include using Caritas Processes care plans in our electronic medical record, greater ease in the understanding and application of Watson's theory, integrating a blessing for nurses during National Nurses Week, inclusion of ministry formation courses to extend the mission of the hospital's founding religious order to current and future employees, and positive patient feedback. As a result of theory application, our nurses are more open to discussing caring, authentic presence and, when appropriate, prayer in their clinical narratives and how it is affecting patients and themselves. Copyright © 2016 AORN, Inc. Published by Elsevier Inc. All rights reserved.

  8. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So, exactly the G*·T mismatch was established to play the crucial role in the spontaneous point mutagenesis.

  9. Comparing Posttraumatic Stress Disorder's Symptom Structure between Deployed and Nondeployed Veterans

    ERIC Educational Resources Information Center

    Engdahl, Ryan M.; Elhai, Jon D.; Richardson, J. Don; Frueh, B. Christopher

    2011-01-01

    We tested two empirically validated 4-factor models of posttraumatic stress disorder (PTSD) symptoms using the PTSD Checklist: King, Leskin, King, and Weathers' (1998) model including reexperiencing, avoidance, emotional numbing, and hyperarousal factors, and Simms, Watson, and Doebbeling's (2002) model including reexperiencing, avoidance,…

  10. Crafting Research from the Liminal Space

    ERIC Educational Resources Information Center

    Burns, Stuart

    2012-01-01

    Tony Watson developed an approach of "intellectual craftsmanship" within management research and writing, and appealed for the hand behind the text to be made visible. This paper considers the tensions apparent between the utility of writing and the positionality of the researcher. I explore the tensions, limitations and formational…

  11. Internet Addiction: A Logotherapeutic Approach

    ERIC Educational Resources Information Center

    Didelot, Mary J.; Hollingsworth, Lisa; Buckenmeyer, Janet A.

    2012-01-01

    Internet addiction (IA) is both the most rapidly growing addiction and the least understood addiction (Watson, 2005). For counselors, treatment issues surrounding the disease are also growing. At the forefront is the lack of understanding concerning treatment protocol to manage the challenging recovery and maintenance stages after IA behavior has…

  12. Unusual hydrogen bonding patterns in AF (aminofluorene) and AAF (acetylaminofluorene) modified DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Broyde, S.; Hingerty, B.E.; Shapiro, R.

    1989-01-01

    New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs.

  13. It's Elementary, er, Basic, Dr. Watson

    ERIC Educational Resources Information Center

    Bracey, Gerald W.

    2010-01-01

    The National Assessment Governing Board (NAGB) has stated that "the overall achievement goal for American students is performance that qualifies at the Proficient level or higher" (Loomis & Bourke, 2001, p. 2). The Institute for Educational Sciences of the U.S. Department of Education went even further, "The Proficient level…

  14. And the Winner Is … : Inter-Rater Reliability among Scholarship Assessors

    ERIC Educational Resources Information Center

    Johnston, Lucy; Schluter, Philip J.

    2017-01-01

    With increasing competition for postgraduate research scholarships, awarding processes demand attention and scrutiny. We examine inter-rater reliability for two prestigious New Zealand scholarships, the Shirtcliffe Fellowship and the Gordon Watson Scholarship. For each scholarship, five assessors (three academic; two non-academic) independently…

  15. Maurice Hugh Frederick Wilkins CBE: 15 December 1916 - 5 October 2004.

    PubMed

    Arnott, Struther; Kibble, T W B; Shallice, Tim

    2006-01-01

    Maurice Hugh Frederick Wilkins was the 'Third man of the double helix; according to the publishers who were allowed to foist this title on his late-written autobiography. Certainly it is for his role in the discover of the duplex secondary structure of DNA that he will be remembered. It might be argued that he was the first man, rather than the third, for it was his successful revival of X-ray diffraction studies of DNA and his earliest result in 1950, a pattern of a well-oriented and polycrystalline DNA of unprecedented quality, that allowed him to conclude almost immediately that the basic framework of the genetical material was simple and symmetrical, and that the symmetrical structure took the form of a helix. This same pattern, displayed at a conference in Naples six months later, was the major inspiration for the involvement of J. D. Watson (ForMemRS 1981) in modelling DNA structure in collaboration with F. H. C. Crick (FRS 1959). Crick was a personal friend of Maurice's and was more involved with studies of proteins until the progress of Maurice's research programme and Watson's enthusiastic presence in Cambridge convinced him to put nucleic acids first. The carefully crafted citation for the 1960 Lasker Award, which these three men shared in 1960, put Maurice's name first and accurately referred to '...the painstaking x-ray diffraction studies of Wilkins that provided a most important clue that was pursued in a ingenious fashion and to a logical conclusion by Crick and Watson...'. Maurice's diffraction studies of DNA were not only the alpha but also the omega of the double helix because it left to him to remedy a major flaw in the original (1953) Watson-Crick conjecture. Maurice Wilkin's early acceptance of DNA as the genetic material and his recognition that it had structures that could and should be tackled by X-ray diffraction analyses, not necessarily under his exclusive control, was important in ensuring that the essence of DNA's structure was discovered as early as it was. His success in resolving patiently and successfully all the technical problems, great and small, that arose unpredictably in the course of his work on DNA and RNA was substantial. He was less successful in defending himself against the slings and arrows that unjustly assail those involved in momentous exercises. His pacific acceptance of these misfortunes was typical of a life that had priorities beyond the laboratory and required him to do as one would be done by.

  16. Zr and Hf diffusion in rutile

    NASA Astrophysics Data System (ADS)

    Cherniak, D. J.; Manchester, J.; Watson, E. B.

    2007-09-01

    Chemical diffusion of Zr and Hf under anhydrous conditions has been measured in synthetic and natural rutile. The sources of diffusant used were hafnon or zircon powders or a hafnon-rutile mixture. Experiments were run in crimped Pt capsules in air, or in sealed silica glass capsules with solid buffers (to buffer at NNO or QFM). Rutherford Backscattering Spectrometry (RBS) was used to measure Zr and Hf diffusion profiles. From these measurements, the following Arrhenius relations were obtained: For Zr diffusion parallel to c, over the temperature range 750-1100 °C DZr¦c = 9.8 × 10 - 15 exp(- 170 ± 30 kJ mol - 1 /RT) m 2 s - 1 For Hf diffusion parallel to c, over the temperature range 800-1000 °C DHf¦c = 9.1 × 10 - 15 exp(- 169 ± 36 kJ mol - 1 /RT) m 2 s - 1 For Hf diffusion normal to c, over the temperature range 750-1050 °C DHf⊥c = 2.5 × 10 - 12 exp(- 227 ± 62 kJ mol - 1 /RT) m 2 s - 1 . Diffusivities for experiments buffered at QFM and NNO are similar to those run in air. Diffusivities in synthetic and natural rutile are likewise similar, indicating that these findings can be applied directly in determining Zr diffusivities in rutile in natural systems. These data indicate that rutile should be moderately retentive of Zr chemical signatures, with Zr diffusivities within an order of magnitude of those for Pb in rutile over most geologic conditions. When applied in evaluation of the relative robustness of the recently developed Zr-in-rutile geothermometer [T. Zack, R. Moraes, A. Kronz, Temperature dependence of Zr in rutile: empirical calibration of a rutile thermometer, Contributions to Mineralogy and Petrology 148 (2004) 471-488., E.B. Watson, D.A. Wark, J.B. Thomas, Crystallization thermometers for zircon and rutile, Contributions to Mineralogy and Petrology 151 (2006) 413-433.], these findings suggest that Zr concentrations in rutile will be somewhat more likely to be affected by later thermal disturbance than the geothermometer based on Zr concentrations in titanite [L. Hayden, E.B.Watson, D.A. Wark, A thermobarometer for sphene, Abstract, 16th V.M. Goldschmidt Conference (2006).], and much less resistant to diffusional alteration subsequent to crystallization than the Ti-in-zircon geothermometer [E.B. Watson, D.A. Wark, J.B. Thomas, Crystallization thermometers for zircon and rutile, Contributions to Mineralogy and Petrology 151 (2006) 413-433., E.B.Watson, T.M.Harrison, Zircon thermometer reveals minimum melting conditions on earliest Earth, Science 308 (2005) 841-844.].

  17. New Hires at the National Cancer Institute at Frederick | Poster

    Cancer.gov

    Forty-nine people joined the facility in September and October 2013. The National Cancer Institute welcomes… Aamir Akram Clarissa Alexander Robert Buckheit Brian Chan Kelly Dempsey Christopher Descalzi Ahmed Fahim Devikala Gurusamy Jaewoo Hong Rhushikesh Kulkarni James Shaum Dionysios Watson Yuheng Xi Yi Xiang Thomas Zengeya

  18. Student-Athletes' Perceptions of Mental Illness and Attitudes toward Help-Seeking

    ERIC Educational Resources Information Center

    Barnard, Jordan D.

    2016-01-01

    Given that there is evidence that college student-athletes may be at risk for psychological disturbances (Pinkerton, Hintz, & Barrow, 1989), and possibly underutilizing college mental health services (Watson & Kissinger, 2007), the purpose of this study was to examine attitudes toward mental illness and help seeking among college…

  19. Emergence of blackberry as a world crop

    USDA-ARS?s Scientific Manuscript database

    Once thought of as a berry consumed only from wild plants, blackberries (Rubus subgenus Rubus Watson) have now become a common fruit choice in marketing outlets, particularly in North America and the European Union. Termed the “fourth” berry by some, after the more common strawberry (Fragaria ×anana...

  20. Learning about Functions through Learner-Generated Examples

    ERIC Educational Resources Information Center

    Dinkelman, Martha O.; Cavey, Laurie O.

    2015-01-01

    In many mathematics classrooms, the teacher provides "worked examples" to demonstrate how students should perform certain algorithms or processes. Some students find it difficult to generalize from the examples that teachers provide and cannot apply what they have learned in new situations (Watson and Mason 2002). Instead, teachers might…

  1. Intonational Phrasing Is Constrained by Meaning, Not Balance

    ERIC Educational Resources Information Center

    Breen, Mara; Watson, Duane G.; Gibson, Edward

    2011-01-01

    This paper evaluates two classes of hypotheses about how people prosodically segment utterances: (1) meaning-based proposals, with a focus on Watson and Gibson's (2004) proposal, according to which speakers tend to produce boundaries before and after long constituents; and (2) balancing proposals, according to which speakers tend to produce…

  2. Comparison of Critical Thinking in Undergraduates and Graduates in Special Education

    ERIC Educational Resources Information Center

    Zascavage, Victoria; Masten, William G.; Schroeder-Steward, Jennifer; Nichols, Christopher

    2007-01-01

    This study assessed overall critical thinking ability in graduate and undergraduate students in special education at a southwestern university. A comparison of the two groups resulted in significant differences on the Watson-Glaser Critical Thinking Appraisal Form Short (WGCTA-FS) subscales for Inference, Recognition of Assumption, Deduction, and…

  3. Who Am I Here? Disrupted Identities and Gentle Shifts When Teaching in Cyberspace

    ERIC Educational Resources Information Center

    Johnson, Holly; Ehrlich, Suzanne; Watts-Taffe, Susan; Williams, Cheri

    2014-01-01

    Teacher identity has most often been studied in reference to preschool through grade 12 (P-12) teachers' professional development (Day, Kingston, Stobart, & Sammons, 2006; Trevitt & Perera, 2009; Watson, 2006), pre-service teacher development (Beauchamp & Thomas, 2009; Franzak, 2002; Freese, 2006; Hoban, 2007; Murrell, Diez,…

  4. The Power of Percent

    ERIC Educational Resources Information Center

    Watson, Jane; English, Lyn

    2013-01-01

    Jane Watson and Lyn English use a chance activity exploring expectation and variation with coin tossing to highlight the importance of understanding the part-whole relationship embodied in percentage and its power to measure and compare for different wholes, in this case different sample sizes. The purpose of this article is to raise awareness of…

  5. Group Member or Outsider: Perceptions of Undergraduates with Disabilities on Leisure Time Physical Activity

    ERIC Educational Resources Information Center

    Devine, Mary Ann

    2013-01-01

    College provides students with many opportunities to achieve academic success and enrich other aspects of their lives. Participating in campus activities can reduce stress, create social connections, promote healthy active living, and broaden civic engagement (Lindsey & Sessoms, 2006; Watson, Ayers, Zizzi, & Naoi, 2006). Studies noting…

  6. Playing Scientist

    ERIC Educational Resources Information Center

    Campbell, Ashley

    2012-01-01

    Engaging students in the study of genetics is essential to building a deep understanding of heredity, a core idea in the life sciences (NRC 2012). By integrating into the curriculum the stories of famous scientists who studied genetics (e.g., Mendel, Franklin, Watson, and Crick), teachers remind their students that science is a human endeavor.…

  7. Journal of the Society for Accelerative Learning and Teaching, 1994.

    ERIC Educational Resources Information Center

    Journal of the Society for Accelerative Learning and Teaching, 1994

    1994-01-01

    Two issues of this serial include the following articles: "Editorial Note for Semiotics Issue" (Pedro Portes); "Qualitative Postmodernism and the Nature of Teaching and Learning" (Gary Shank); "Instructional Prescriptions Can Be Hazardous to Your Pedagogy!" (Donald J. Cunningham, Bruce Allen Knight, and Kathy K. Watson); "Toward a Mutual Interplay…

  8. Nonneurocognitive Extended Consciousness

    ERIC Educational Resources Information Center

    Wojcik, Kevin; Chemero, Anthony

    2012-01-01

    One of the attributes necessary for Watson to be considered human is that it must be conscious. From Rachlin's (2012) point of view, that of teleological behaviorism, consciousness refers to the organization of behavioral complexity in which overt behavior is distributed widely over time. Consciousness is something that humans do, or achieve, in…

  9. Western flower thrips, a serious pest of floricultural crops

    Treesearch

    Karen L. Robb; Michael P. Perella

    1991-01-01

    The western flower thrips, Frankliniella occidentalis (Pergande), has recently become one of the most serious pest problems facing the ornamental industry (Robb & Parrella 1988). It is polyphagous and has been collected from plants of almost every order of the Spermatophyta in California (Watson 1923, Bailey 1933, Bryan & Smith 1956). However...

  10. Multiphase Complete Exchange: A Theoretical Analysis

    DTIC Science & Technology

    1993-08-01

    Birkhiuser, Boston, 1984. 24 [9] C-T. Ho and M. T. Raghunath . Efficient communication primitives on hy- percubes. In Proc. 6th. DMCC, pages 390-397...1991. [10] C-T. Ho and M. T. Raghunath . Efficient communication primitives on hy- percubes. Technical Report RJ 7932 (72915), IBM, T. J. Watson Center

  11. Confirmatory Factor Analysis of the Cancer Locus of Control Scale.

    ERIC Educational Resources Information Center

    Henderson, Jessica W.; Donatelle, Rebecca J.; Acock, Alan C.

    2002-01-01

    Conducted a confirmatory factor analysis of the Cancer Locus of Control scale (M. Watson and others, 1990), administered to 543 women with a history of breast cancer. Results support a three-factor model of the scale and support use of the scale to assess control dimensions. (SLD)

  12. Entering a community dialogue.

    PubMed

    Britt, Teri; Player, Kathy; Parsons, Kathleen; Stover, Deanna

    2004-01-01

    Entering a new, unstructured community is facilitated when existing members embrace the thoughts, ideas, and experiences of new members. Watson's Caring Healing Model, including the caritas conscious and transpersonal caring components, provides a framework for understanding the experience of being a new community member (e.g., a "newbie") in the Global Nursing Exchange.

  13. Barrier to Success: Community College Students Critical Thinking Skills.

    ERIC Educational Resources Information Center

    Pearson, Charlene V.

    In 1991, a study was conducted using the Watson-Glaser Critical Thinking Appraisal (CTA) to determine how well students at Rancho Santiago College (RSC), a large, multicultural community institution in Santa Ana, California, demonstrated critical thinking abilities. Written at the ninth grade reading level, the CTA attempts to assess an…

  14. A Survey of Parallel Sorting Algorithms.

    DTIC Science & Technology

    1981-12-01

    see that, in this algorithm, each Processor i, for 1 itp -2, interacts directly only with Processors i+l and i-l. Processor j 0 only interacts with...Chan76] Chandra, A.K., "Maximal Parallelism in Matrix Multiplication," IBM Report RC. 6193, Watson Research Center, Yorktown Heights, N.Y., October 1976

  15. Design Thinking for Life

    ERIC Educational Resources Information Center

    Watson, Andrew D.

    2015-01-01

    According to Vande Zande (2007), understanding the Design Process can help students become stronger critical thinkers. With this in mind, Andrew Watson decided to undertake an observational case study in which he focused directly on Design Thinking and addressed it more intentionally in his teaching. The hope was to understand how students saw…

  16. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-19

    ....214). Protests will be considered by the Commission in determining the appropriate action to be taken... must file a notice of intervention or motion to intervene, as appropriate. Such notices, motions, or... serve motions to intervene or protests on persons other than the Applicant. The Commission encourages...

  17. Pneumococcal Vaccine to Counter Emerging Infectious Disease Threat in the Military

    DTIC Science & Technology

    2001-12-01

    Medical Center. San pathogen is an even greater threat to some subpopulations in Diego, CA; Wyeth Lederle Vaccines: LT David Cute, MC USN, Erica...Butler JC. Tenover FC, Elliott JA, Facklam RR. Emergence of 43. Musher DM, Luchi MJ, Watson DA, Hamilton R, Baughn RE: Pneumococcal drug-resistant

  18. Engaging with Molecular Form to Understand Function

    ERIC Educational Resources Information Center

    Barber, Nicola C.; Stark, Louisa A.

    2014-01-01

    Cells are bustling factories with diverse and prolific arrays of molecular machinery. Remarkably, this machinery self-organizes to carry out the complex biochemical activities characteristic of life. When Watson and Crick published the structure of DNA, they noted that DNA base pairing creates a double-stranded form that provides a means of…

  19. The Development of Statistical Literacy at School

    ERIC Educational Resources Information Center

    Callingham, Rosemary; Watson, Jane M.

    2017-01-01

    Statistical literacy increasingly is considered an important outcome of schooling. There is little information, however, about appropriate expectations of students at different stages of schooling. Some progress towards this goal was made by Watson and Callingham (2005), who identified an empirical 6-level hierarchy of statistical literacy and the…

  20. Human Resource Management in Higher and Further Education.

    ERIC Educational Resources Information Center

    Warner, David, Ed.; Crosthwaite, Elaine, Ed.

    This book presents 13 papers which address human resource management in universities and colleges of further education in the United Kingdom. A list of abbreviations precedes the papers. The papers are: (1) "Setting the Scene" (Elaine Crosthwaite and David Warner); (2) "Managing Change" (David House and David Watson); (3)…

  1. Spatial Strategy Use during Logo Mastery: The Impact of Cognitive Style and Development Level.

    ERIC Educational Resources Information Center

    Easton, Charles E.; Watson, J. Allen

    1993-01-01

    Tested the Watson and Busch model of how children learn LOGO programing. Investigated second- and fifth-grade students' stage of cognitive development, stylistic preferences, and strategy usage. Field-independent children showed a marginal advantage over field-dependent children in learning to program in LOGO. (MM)

  2. Student Success. February 2007

    ERIC Educational Resources Information Center

    Online Submission, 2007

    2007-01-01

    "Student Success" is EPI's occasional e-magazine dedicated to the discussion of retaining students in higher education. This edition features an interview with Stedman Graham about his efforts to help students succeed in life. As well, EPI President Watson Scott Swail discusses Campus Climate and Students of Color, and the Best Practice showcases…

  3. Student Success. January 2006

    ERIC Educational Resources Information Center

    Online Submission, 2006

    2006-01-01

    "Student Success" is EPI's occasional e-magazine dedicated to the discussion of retaining students in higher education. In this issue: (1) Seven Guiding Questions for Student Retention (Watson Scott Swail); (2) Interview: George Kuh and the National Survey of Student Engagement (NSSE); (3) The Review: Student Success looks at a new book edited by…

  4. Predicting Success in Nursing Programs

    ERIC Educational Resources Information Center

    Crouch, Suzanne J.

    2015-01-01

    The purpose of this study was to assess the merit of the Watson-Glaser Critical Thinking Appraisal as a pre-admission criterion in conjunction with the frequently utilized admission criteria of the college prerequisite grade point average and the National League of Nursing pre-admission test. Data were collected from 192 first-year nursing…

  5. Confronting Science: The Dilemma of Genetic Testing.

    ERIC Educational Resources Information Center

    Zallen, Doris T.

    1997-01-01

    Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)

  6. The War for Yemen

    DTIC Science & Technology

    2016-03-01

    coalition in Yemen with vital approaches that can speed recovery and stability. As Sun Tzu taught, we must know the enemy and know ourselves, and that...Iranian control, and work for stability in Yemen and use that as lessons for the region. AU/ACSC/J WATSON/AY16 17 Bibliography AlAhmad, Safa

  7. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

  8. Micron-Scale Correlations Among Ti, P, Ce, and Y in Hadean Jack Hills Zircons

    NASA Astrophysics Data System (ADS)

    Hofmann, A. E.; Cavosie, A. J.; Valley, J. W.; Eiler, J. M.

    2007-12-01

    Detrital zircons and the inclusions found therein are our only mineralogical constraints on geologic events that occurred on the Hadean Earth. These zircons are commonly small (ca. <100 μm in the longest dimension) and preserve micron to sub-micron chemical zonations indicative of a dynamic petrological history. Trace elements within zircon are of particular interest because concentrations and ratios of these elements can provide information regarding chemical and physical conditions during zircon growth. In this study, we analyzed Hadean-age detrital zircons from Archean metasediment in the Jack Hills (Australia) using the Caltech Microanalysis Center Cameca NanoSIMS 50L. Trace elements analyzed included Ti, P, Ce, and Y. Ti- thermometry [1,2,3] can potentially constrain growth and/or re-equilibration temperatures of zircons; P, Ce, and Y are known to enter the zircon lattice by the coupled xenotime-type substitution mechanism: (Y, REE)3+ + P5+ = Zr4+ + Si4+ [5]. The 89Y/28Si ratio was observed to correlate with, and was used as a proxy for, cathodoluminescence (CL) banding. Growth features manifested in CL (e.g., sector, oscillatory zoning) were observed in all zircons analyzed. CL zones vary from <1 μm to several microns in width; therefore, the NanoSIMS---with a beam diameter resolved to ca. 250 nm on the sample surface when operating with an O- primary beam---is uniquely suited for this scale of analysis. Regions displaying CL banding were imaged as 20 x 20 μm areas. All elements were normalized to 28Si; 49Ti/28Si ratios were converted to [Ti] via calibration based on analyses of synthetic, high-Ti zircons (provided by B. Watson) that were independently analyzed on Caltech's JEOL JXA-8200 electron microprobe. We observe three types of relationships between trace element distribution and CL banding in the zircons imaged: 1) strong positive correlations between CL banding, P, Ce, and Ti; 2) subtle positive correlations between CL banding, P, Ce, and Ti; 3) no correlation between minor/trace elements and CL banding. Positive correlations between CL banding, 3+ cations, and [Ti] have previously been reported by Holden et al. [4]. In this study, gradients at least as sharp as a factor of ~3 in [Ti] are observed between adjacent CL bands in the strongly correlated images. These images also have the highest absolute concentrations of trace elements and display both sector and oscillatory zoning in CL. The correlations observed may be due to: temperature-dependent equilibrium partitioning of all trace elements during rapid cycles in growth temperature; episodic diffusion-limited enrichment of incompatible trace elements in the boundary layer melt adjacent to growing crystals; and/or kinetically controlled, non- equilibrium crystal-melt partitioning caused by trace element enrichments in the boundary layer melt surrounding fast-growing grains (e.g., [6]). We will discriminate between these alternatives based on quantitative relationships between relative enrichments of [Ti] and other trace elements. [1]Watson, E.B. & Harrison, T.M. (2005) Science 308, 841-844. [2]Watson, E.B., Wark, D.A., & Thomas, J.B. (2006) CMP 151, 413-433. [3]Ferry, J.M. & Watson, E.B. (2007) CMP 154, 429-437. [4] Holden, P. et al. (2005) Eos Trans. AGU 86 (52) Fall Meet. Suppl., Abstract V41F-1539. [5] Speer, J.A. (1982) Zircon. In Rev. Min. 5 (ed. P.H. Ribbe), 67-112. [6] Watson, E.B. (2004) GCA 68, 1473-1488.

  9. Virtual reality based experiential cognitive treatment of anorexia nervosa.

    PubMed

    Riva, G; Bacchetta, M; Baruffi, M; Rinaldi, S; Molinari, E

    1999-09-01

    The treatment of a 22-year old female university student diagnosed with Anorexia Nervosa is described. In the study the Experiential Cognitive Therapy (ECT) was used: a relatively short-term, integrated, patient oriented approach that focuses on individual discovery. Main characteristic of this approach is the use of Virtual Reality, a new technology that allows the user to be immersed in a computer-generated virtual world. At the end of the in-patient treatment, the subject increased her bodily awareness joined to a reduction in her level of body dissatisfaction. Moreover, the patient presented a high degree of motivation to change. The results are discussed with regard to Vitousek, Watson and Wilson (1998, Clinical Psychology Review, 18(4), 391-420) proposal of using the Socratic Method to face denial and resistance of anorectic patients.

  10. Revalidating Sherlock Holmes for a role in medical education.

    PubMed

    Levine, David

    2012-04-01

    Sir Arthur Conan Doyle endowed Sherlock Holmes with extraordinary skills that Dr Watson and others found incomprehensible until Holmes gave explanations, often in the form of memorable maxims and short monologues. Intentionally or not, Doyle left us crime-solving precepts that still inform aspects of medical practice. Experienced clinicians share with Holmes the dilemma of how to make complex, often unconscious, capability accessible to novices. Doctors still invoke Holmes's methods in clinical contexts, but the validity of some of the parallels has been challenged and quoting the more popular sayings has been equated with conceit. This paper examines how the use of selected maxims and monologues can help to link abstract principles and live context in a credible way in order to make aspects of clinical reasoning and professional behaviour more accessible and memorable.

  11. Lillie Burney Elementary School

    NASA Technical Reports Server (NTRS)

    2006-01-01

    Mississippi Rep. Percy Watson (left) talks with first-graders Savannah Jones and Levi Meyers, and Astronaut Lee Morin on Sept. 8 during the NASA Explorer School kickoff event at the Lillie Burney Elementary School in Hattiesburg, Miss. NASA Explorer Schools help promote student achievement in mathematics and science through activities using the excitement of NASA research, discoveries and missions.

  12. Horizontal cane orientation and rowcover application improve winter survival and yield of trailing 'Siskiyou' blackberry

    USDA-ARS?s Scientific Manuscript database

    Western trailing blackberries (Genus Rubus subgenus Rubus Watson) are susceptible to low temperature injury and are not grown commercially in the central or eastern United States. Seven-year-old trailing 'Siskiyou' blackberry plants were trained to the rotating cross-arm (RCA) trellis system. In w...

  13. Horizontal cane orientation and rowcover application improve winter survival and yield of trailing 'Siskiyou' blackberry

    USDA-ARS?s Scientific Manuscript database

    Western trailing blackberries (Genus Rubus subgenus Rubus Watson) are susceptible to low temperature injury and are not generally grown commercially in the central or eastern United States. Seven-year-old trailing ‘Siskiyou’ blackberry plants were trained to the rotating cross-arm (RCA) trellis sys...

  14. Key Understandings in School Mathematics: 1

    ERIC Educational Resources Information Center

    Watson, Anne

    2010-01-01

    This article is the first in a series which draws on findings from Nunes, Watson and Bryant (2009): "Key understandings in school mathematics: a report to the Nuffield Foundation." The Nuffield report is soundly based on research about how children learn some of the concepts involved in mathematics. In this series of articles the author takes key…

  15. Lillie Burney Elementary School

    NASA Image and Video Library

    2006-09-08

    Mississippi Rep. Percy Watson (left) talks with first-graders Savannah Jones and Levi Meyers, and Astronaut Lee Morin on Sept. 8 during the NASA Explorer School kickoff event at the Lillie Burney Elementary School in Hattiesburg, Miss. NASA Explorer Schools help promote student achievement in mathematics and science through activities using the excitement of NASA research, discoveries and missions.

  16. Writing Assessment's "Debilitating Inheritance": Behaviorism's Dismissal of Experience

    ERIC Educational Resources Information Center

    Wilson, Maja Joiwind

    2013-01-01

    In this project, I examine the legacy of behaviorism's dismissal of experience on contemporary writing assessment theory and practice within the field of composition studies. I use an archival study of John B. Watson's letters to Robert Mearns Yerkes to establish behaviorism's systematic denial of experience and its related constructs: mind,…

  17. A Classroom Activity to Demonstrate Self-Other Agreement in Personality Judgments

    ERIC Educational Resources Information Center

    Kaplan, Seth A.; Stachowski, Alicia A.; Bradley-Geist, Jill C.

    2012-01-01

    This article describes a classroom activity to demonstrate (dis)agreement in personality judgments, using an exercise derived from Watson's research on the accuracy of rating strangers' personalities. On the first day of class, undergraduate students in psychology courses rated their own personality and the personality of a classmate, using items…

  18. Further Validation of the Iowa Sleep Disturbances Inventory

    ERIC Educational Resources Information Center

    Koffel, Erin

    2011-01-01

    This study examined the reliability and validity of an expanded version of the Iowa Sleep Disturbances Inventory (ISDI; Koffel & Watson, 2010) in 2 samples (219 college students and 200 psychiatric patients). The expanded ISDI includes the scales Sleep Paralysis and Sleep Hallucinations. These scales, along with the Nightmares scale, help define a…

  19. Key Understandings in School Mathematics: 3

    ERIC Educational Resources Information Center

    Watson, Anne

    2010-01-01

    This article is the third in a series which draws on findings from Nunes, Watson and Bryant (2009): "Key understandings in school mathematics: a report to the Nuffield Foundation". In this article the author focuses on what learners have to understand and learn in order to do secondary mathematics well in general terms. She is assuming a…

  20. 78 FR 8504 - Combined Notice of Filings #1

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-06

    ... II Wind Farm LLC, Fowler Ridge III Wind Farm LLC, Fowler Ridge Wind Farm LLC, Goshen Phase II LLC, Long Island Solar Farm LLC, Mehoopany Wind Energy LLC, Rolling Thunder I Power Partners, LLC, Watson... Farm LLC, Burley Butte Wind Park, LLC, Camp Reed Wind Park, LLC, Golden Valley Wind Park, LL,; Milner...

  1. 77 FR 26273 - President's Council of Advisors on Science and Technology (PCAST)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-03

    ... will be available within one week of the meeting. Questions about the meeting should be directed to Dr... Officer Team Agenda 2012, and two information technology applications--IBM's Watson Project and Google's... . Closed Portion of the Meeting: PCAST may hold a closed meeting of approximately one hour with the...

  2. Allies and Competitors as Enscripted Audiences in Scientific Writing.

    ERIC Educational Resources Information Center

    Perry, Susan

    A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…

  3. The Role of Syntactic Obligatoriness in the Production of Intonational Boundaries

    ERIC Educational Resources Information Center

    Watson, Duane; Breen, Mara; Gibson, Edward

    2006-01-01

    Researchers have hypothesized that words that are highly related semantically are more likely to occur within the same intonational phrase (F. zzaq;, 1988; E. O. Selkirk, 1984). D. Watson and E. Gibson (2004) proposed that semantic closeness can be captured by using the argument/adjunct distinction, such that intonational boundaries are more…

  4. Training in the Workplace: An IBM Case Study. Contractor Report.

    ERIC Educational Resources Information Center

    Grubb, Ralph E.

    International Business Machines Corporation's (IBM) efforts to develop a corporate culture are associated with its founder, Thomas J. Watson, Sr. From the start of his association with the company in 1914, the importance of education was stressed. The expansion of the education and training organization paralleled IBM's 75-year growth. In January…

  5. J D Bernal: the sage of science

    NASA Astrophysics Data System (ADS)

    Brown, Andrew P.

    2007-02-01

    John Desmond Bernal (1901-1971) was one of the most influential and original scientists of the twentieth century. No less an authority than James Watson has stated that Bernal's genius inspired the birth of molecular biology. By examining Bernal's interactions with others, I attempt to illustrate his personality, brilliance, breadth, foibles and essential humanity.

  6. 1. General view of bridge looking north. This is the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. General view of bridge looking north. This is the only suspension bridge in Cleveland. It was designed by Wilbur J. Watson and Associates, Consulting Engineers. Sections of the Wooden deck are missing, and the bridge is no longer used. - Sidaway Avenue Footbridge, Jackowo & Garden Valley neighborhood Vicinity, Cleveland, Cuyahoga County, OH

  7. Examining the Factors of a Technology Professional Development Intervention

    ERIC Educational Resources Information Center

    Unger, Kelly L.

    2012-01-01

    In response to the ever increasing demand to compete in a global economy, the United States needs to prepare its students with the appropriate technical knowledge and communication skills to be competitive in the 21st century (Watson, 2007). Students must begin utilizing current technology tools during their K-12 educational experience and online…

  8. Ambiguity and Alignment in Academic Policies: Course Substitutions, Learning Disabilities, and Universal Design

    ERIC Educational Resources Information Center

    Galilee-Belfer, Mika

    2012-01-01

    While research on barriers to full participation for those with learning and other disabilities has focused largely on structural and institutional obstacles to work and education (Swain, French, & Cameron, 2005; Jones, 1996; Watson, 2002), the recognition of disability as a social justice issue is gaining currency (Kraus, 2008). Expensive,…

  9. Does a Business Curriculum Develop or Filter Critical Thinking?

    ERIC Educational Resources Information Center

    Coleman, B. Jay; Mason, Paul; Steagall, Jeffrey W.

    2012-01-01

    We investigate whether a business curriculum develops critical thinking ability or at least serves as a filter for critical thinking (i.e., students who cannot think critically tend not to progress toward graduation). We measure critical thinking by performance on the Watson-Glaser Critical Thinking Appraisal Short Form which was administered to a…

  10. The Development of a Scale To Measure Negative Affectivity.

    ERIC Educational Resources Information Center

    Stokes, Joseph; Levin, Ira

    Negative affectivity (NA) has been defined as a stable and pervasive individual difference characterized by a disposition to experience aversive emotional states (D. Watson and L. A. Clark, 1984). A brief self-report scale was developed to assess NA. The initial 28-item scale (which included seven items each representing nervousness/calmness,…

  11. Values of the urban wilderness

    Treesearch

    Paticia L. Winter

    2013-01-01

    Wilderness is widely supported by the American public (Campaign for America’s Wilderness 2003) and provides myriad ecosystem services and other benefits (Schuster and others 2005, Williams and Watson 2007). Wilderness services and benefits deemed important to the public include use (such as recreation) and non-usevalues (such as scenery appreciation) (Brown...

  12. 75 FR 61998 - Programs for Specific Positions and Examinations (Miscellaneous)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-07

    ...-mail at [email protected] ; or fax at (202) 606-2329. FOR FURTHER INFORMATION CONTACT: Ms. Linda Watson [email protected] . SUPPLEMENTARY INFORMATION: On March 20, 2007, OPM published a final rule at 72 FR 12947..., the potential differences between the ethical requirements that pertain to an advocate and those...

  13. Determining the Capacity of Time-Based Selection

    ERIC Educational Resources Information Center

    Watson, Derrick G.; Kunar, Melina A.

    2012-01-01

    In visual search, a set of distractor items can be suppressed from future selection if they are presented (previewed) before a second set of search items arrive. This "visual marking" mechanism provides a top-down way of prioritizing the selection of new stimuli, at the expense of old stimuli already in the field (Watson & Humphreys,…

  14. Supervision of Applied Sport Psychology in Graduate Programs in the USA

    ERIC Educational Resources Information Center

    Meir, Gily

    2018-01-01

    Supervision is a hierarchical and evaluative relationship extending over time between a supervisor and a supervisee that permits quality control of service delivery of neophyte practitioners (Bernard & Goodyear, 2009; Watson, Zizzi, Etzel, & Lubker, 2004). It is a cardinal part of the training and a requirement to become a certified…

  15. Teaching beyond "Once Upon a Time."

    ERIC Educational Resources Information Center

    Ballentine, Darcy; Hill, Lisa

    2000-01-01

    Argues that the purpose of teaching students to read includes challenging children to take up books that contain "dangerous truths." Discusses two such books: "Forged by Fire" by Sharon Draper and "The Watsons Go to Birmingham--1963" by Christopher Paul Curtis. Includes children's statements regarding why they insist on being able to read good…

  16. Monthly Record of Current Educational Publications. Bulletin, 1913, No. 1. Whole Number 508

    ERIC Educational Resources Information Center

    United States Bureau of Education, Department of the Interior, 1913

    1913-01-01

    This document contains a list of current educational publications received by the Bureau of Education. Some especially significant books listed during the past month are the following: Drever, Greek education; Parker, Textbook in the history of modern elementary education; Watson, Vives and the renascence education of women; Andrews, Introduction…

  17. The Chemical Adventures of Sherlock Holmes: The Ghost of Gordon Square.

    ERIC Educational Resources Information Center

    Waddell, Thomas G.; Rybolt, Thomas R.

    2000-01-01

    Describes a scientific mystery with an emphasis on chemical magic presented in the context of the characters Sherlock Holmes and Dr. Watson. The story contains a break where students and teachers pause to ponder and solve the mystery. Sherlock Holmes provides his solution in the paragraphs following this break. (WRM)

  18. Advanced Simulator for Combat, Transport Vehicles, Submarines, Vessels, Airplanes and Helicopters

    DTIC Science & Technology

    2004-10-01

    simulation experiments. 3.1 Road vehicles - lane change test In order to evaluate the driving dynamics and also the driving safety of road vehicles...8] L.D. Chen, Y. Papelis, G. Watson, D. Solis. NADS at the University of Iowa: A Tool for Driving Safety Research, In Proceedings of 1st Human

  19. 77 FR 59979 - Meeting of the Advisory Committee; Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-01

    ... actuarial mathematics, pension law and methodology referred to in 29 U.S.C. 1242(a)(1)(B). A determination... closed meeting of the Advisory Committee on Actuarial Examinations. DATES: The meeting will be held on... is hereby given that the Advisory Committee on Actuarial Examinations will meet at Towers Watson, 800...

  20. 75 FR 72857 - Notice of Public Hearing and Commission Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-26

    ... certain water resources projects; (2) compliance matters involving two projects; and (3) the rescission of... surface water withdrawal of up to 0.990 mgd. 10. Project Sponsor and Facility: Ultra Resources, Inc. (Pine...), Watson Township, Lycoming County, Pa. Application for surface water withdrawal of up to 0.720 mgd. 2...

  1. The Relationship between Student Engagement in Online Courses and Credit Hour Value

    ERIC Educational Resources Information Center

    York, Robyn M. B.

    2012-01-01

    There is a scarcity of information identifying whether course credit value is a reasonable assessment of university student engagement in online courses. Defining the student hour in an online environment is particularly challenging and can impact student and faculty workloads. Watson's behavioralistic theory grounded the assessments in this…

  2. Urban Schools in Urban Systems, Selected Papers.

    ERIC Educational Resources Information Center

    Gappert, Gary, Ed.

    This volume contains papers which were presented at a conference focusing on the themes of partnership and progress in urban education. The following papers are included: (1) an introduction to the volume, by Gary Gappert; (2) "Urban Education: Past, Present and Future," by Bernard G. Watson; (3) "Variables Affecting the Learning of Inner City…

  3. Student Success: The Newsletter for Higher Education Professionals, November 2007

    ERIC Educational Resources Information Center

    Online Submission, 2007

    2007-01-01

    The Educational Policy Institute's (EPI's) quarterly publication on issues relating to student success. This issue contains: (1) Opening Shots (Watson Scott Swail); (2) Deconstructing Student Departure: Lessons from Research on Canadian Community College Students (Peter Dietsche); (3) Interview with John Gardner; (4) A Story of a First-Gen: 21…

  4. 75 FR 37712 - Temporary Suspension of Certain Oil Spill Response Time Requirements To Support Deepwater Horizon...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-30

    .... (Memorandum from Rear Admiral J.A. Watson, FOSC BP Deepwater Horizon Oil Spill, to National Incident Command... Temporary Suspension of Certain Oil Spill Response Time Requirements To Support Deepwater Horizon Oil Spill... Protection Agency (EPA) temporary interim rule will suspend oil spill response time requirements, and certain...

  5. Developing Statistical Literacy with Year 9 Students: A Collaborative Research Project

    ERIC Educational Resources Information Center

    Sharma, Sashi

    2013-01-01

    Advances in technology and communication have increased the amount of statistical information delivered through everyday media. The importance of statistics in everyday life has led to calls for increased attention to statistical literacy in the mathematics curriculum (Watson 2006). Gal (2004) sees statistical literacy as the need for students to…

  6. On the Cusp: Corey Harper--University of Oregon, Eugene

    ERIC Educational Resources Information Center

    Library Journal, 2004

    2004-01-01

    A recent library school graduate, Corey Harper was nominated by his colleagues at the University of Oregon (UO) because of the key role he played in implementing digital collections. Along with technical expertise, says Watson, he brought with him "[an ability to] balance idealism with expediency, the striving for perfection with the need to…

  7. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  8. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    PubMed

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  9. A new cryptogonimid (Digenea) from the Mayan cichlid, Cichlasoma urophthalmus (Osteichthyes: Cichlidae), in several localities of the Yucatán Peninsula, Mexico.

    PubMed

    Razo-Mendivil, Ulises; Rosas-Valdez, Rogelio; Pérez-Ponce de León, Gerardo

    2008-12-01

    Oligogonotylus mayae n.sp. is described from the intestine of the Mayan cichlid Cichlasoma urophthalmus (Günther) in Ría Lagartos, Ría Celestún, and Estero Progreso, Yucatán State. This is the second species described for Oligogonotylus Watson, 1976, the other being O.manteri Watson, 1976. The new species is readily distinguished from O. manteri by the anterior extension of the vitelline follicles. In O. Manteri, Vitelline follicles are found entirely in the hindbody, extending posteriorly to mid-testicular level. Vitelline follicles in the new species extend from teh anterior margin of posterior testis to the region between the bentral sucker and the pharynx. comparison of approximately 1,850 bases of ribosomal DNA (ITS1, ITS2, 5.8S, and 28S), and 400 bases of cytochrome c oxidase subunit I (cox1) strongly supports the status of O. mayae as a new species, as compared to O. manteri collected from cichlids in other localities of Mexico, Belize, and Guatemala.

  10. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    PubMed

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Fatigue Characterization of Alloy 10: a 1300F Disk Alloy for Small Gas Turbine Engines

    NASA Technical Reports Server (NTRS)

    Gayda, John

    2000-01-01

    A detailed fatigue characterization of Alloy 10, a high strength nickel-based disk alloy, was conducted on test coupons machined from a 'pancake' forging. Smooth bar, strain controlled fatigue testing at various R-ratios was run at representative bore, 750 F, and rim, 1300 F, temperatures. This was followed by notch fatigue testing (Kt=2) run under load control. Analysis of the fatigue data using a Smith-Watson-Topper approach and finite element analysis of the notch root was employed to understand material behavior in these tests. Smooth bar fatigue data showed a significant R-ratio dependence at either test temperature which could be accounted for using a Smith-Watson-Topper parameter (SWT). In general, fatigue life was longer at 750 F than 1300 F for a given SWT. For notch fatigue tests, life was longer at 750 F than 1300 F but only at higher stresses. This was attributed to differences in alloy strength. At lower stresses, finite element analysis suggested that convergence of fatigue life at both temperatures resulted from relaxation of stresses at the notch root in the 1300 F tests.

  12. Improving RNA nearest neighbor parameters for helices by going beyond the two-state model.

    PubMed

    Spasic, Aleksandar; Berger, Kyle D; Chen, Jonathan L; Seetin, Matthew G; Turner, Douglas H; Mathews, David H

    2018-06-01

    RNA folding free energy change nearest neighbor parameters are widely used to predict folding stabilities of secondary structures. They were determined by linear regression to datasets of optical melting experiments on small model systems. Traditionally, the optical melting experiments are analyzed assuming a two-state model, i.e. a structure is either complete or denatured. Experimental evidence, however, shows that structures exist in an ensemble of conformations. Partition functions calculated with existing nearest neighbor parameters predict that secondary structures can be partially denatured, which also directly conflicts with the two-state model. Here, a new approach for determining RNA nearest neighbor parameters is presented. Available optical melting data for 34 Watson-Crick helices were fit directly to a partition function model that allows an ensemble of conformations. Fitting parameters were the enthalpy and entropy changes for helix initiation, terminal AU pairs, stacks of Watson-Crick pairs and disordered internal loops. The resulting set of nearest neighbor parameters shows a 38.5% improvement in the sum of residuals in fitting the experimental melting curves compared to the current literature set.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, X.; Patel, D.J.

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less

  14. Energy metabolism, body composition, and urea generation rate in hemodialysis patients.

    PubMed

    Sridharan, Sivakumar; Vilar, Enric; Berdeprado, Jocelyn; Farrington, Ken

    2013-10-01

    Hemodialysis (HD) adequacy is currently assessed using normalized urea clearance (Kt/V), although scaling based on Watson volume (V) may disadvantage women and men with low body weight. Alternative scaling factors such as resting energy expenditure and high metabolic rate organ mass have been suggested. The relationship between such factors and uremic toxin generation has not been established. We aimed to study the relationship between body size, energy metabolism, and urea generation rate. A cross-sectional cohort of 166 HD patients was studied. Anthropometric measurements were carried on all. Resting energy expenditure was measured by indirect calorimetry, fat-free mass by bio-impedance and total energy expenditure by combining resting energy expenditure with a questionnaire-derived physical activity data. High metabolic rate organ mass was calculated using a published equation and urea generation rate using formal urea kinetic modeling. Metabolic factors including resting energy expenditure, total energy expenditure and fat-free mass correlated better with urea generation rate than did Watson volume. Total energy expenditure and fat-free mass (but not Watson Volume) were independent predictors of urea generation rate, the model explaining 42% of its variation. Small women (

  15. Optimization of ground-water withdrawal at the old O-Field area, Aberdeen Proving Ground, Maryland

    USGS Publications Warehouse

    Banks, William S.L.; Dillow, Jonathan J.A.

    2001-01-01

    The U.S. Army disposed of chemical agents, laboratory materials, and unexploded ordnance at the Old O-Field landfill at Aberdeen Proving Ground, Maryland, beginning prior to World War II and continuing until at least the 1950?s. Soil, ground water, surface water, and wetland sediments in the Old O-Field area were contaminated by the disposal of these materials. The site is in the Atlantic Coastal Plain, and is characterized by a complex series of Pleistocene and Holocene sediments formed in various fluvial, estuarine, and marine-marginal hydrogeologic environments. A previously constructed transient finite-difference ground-water-flow model was used to simulate ground-water flow and the effects of a pump-and-treat remediation system designed to prevent contaminated ground water from flowing into Watson Creek (a tidal estuary and a tributary to the Gunpowder River). The remediation system consists of 14 extraction wells located between the Old O-Field landfill and Watson Creek.Linear programming techniques were applied to the results of the flow-model simulations to identify optimal pumping strategies for the remediation system. The optimal management objective is to minimize total withdrawal from the water-table aquifer, while adhering to the following constraints: (1) ground-water flow from the landfill should be prevented from reaching Watson Creek, (2) no extraction pump should be operated at a rate that exceeds its capacity, and (3) no extraction pump should be operated at a rate below its minimum capacity, the minimum rate at which an Old O-Field pump can function. Water withdrawal is minimized by varying the rate and frequency of pumping at each of the 14 extraction wells over time. This minimizes the costs of both pumping and water treatment, thus providing the least-cost remediation alternative while simultaneously meeting all operating constraints.The optimal strategy identified using this objective and constraint set involved operating 13 of the 14 extraction wells at rates ranging from 0.4 to 4.9 gallons per minute.

  16. Computer aided detection in prostate cancer diagnostics: A promising alternative to biopsy? A retrospective study from 104 lesions with histological ground truth.

    PubMed

    Thon, Anika; Teichgräber, Ulf; Tennstedt-Schenk, Cornelia; Hadjidemetriou, Stathis; Winzler, Sven; Malich, Ansgar; Papageorgiou, Ismini

    2017-01-01

    Prostate cancer (PCa) diagnosis by means of multiparametric magnetic resonance imaging (mpMRI) is a current challenge for the development of computer-aided detection (CAD) tools. An innovative CAD-software (Watson Elementary™) was proposed to achieve high sensitivity and specificity, as well as to allege a correlate to Gleason grade. To assess the performance of Watson Elementary™ in automated PCa diagnosis in our hospital´s database of MRI-guided prostate biopsies. The evaluation was retrospective for 104 lesions (47 PCa, 57 benign) from 79, 64.61±6.64 year old patients using 3T T2-weighted imaging, Apparent Diffusion Coefficient (ADC) maps and dynamic contrast enhancement series. Watson Elementary™ utilizes signal intensity, diffusion properties and kinetic profile to compute a proportional Gleason grade predictor, termed Malignancy Attention Index (MAI). The analysis focused on (i) the CAD sensitivity and specificity to classify suspect lesions and (ii) the MAI correlation with the histopathological ground truth. The software revealed a sensitivity of 46.80% for PCa classification. The specificity for PCa was found to be 75.43% with a positive predictive value of 61.11%, a negative predictive value of 63.23% and a false discovery rate of 38.89%. CAD classified PCa and benign lesions with equal probability (P 0.06, χ2 test). Accordingly, receiver operating characteristic analysis suggests a poor predictive value for MAI with an area under curve of 0.65 (P 0.02), which is not superior to the performance of board certified observers. Moreover, MAI revealed no significant correlation with Gleason grade (P 0.60, Pearson´s correlation). The tested CAD software for mpMRI analysis was a weak PCa biomarker in this dataset. Targeted prostate biopsy and histology remains the gold standard for prostate cancer diagnosis.

  17. How to Evaluate Phase Differences between Trial Groups in Ongoing Electrophysiological Signals

    PubMed Central

    VanRullen, Rufin

    2016-01-01

    A growing number of studies endeavor to reveal periodicities in sensory and cognitive functions, by comparing the distribution of ongoing (pre-stimulus) oscillatory phases between two (or more) trial groups reflecting distinct experimental outcomes. A systematic relation between the phase of spontaneous electrophysiological signals, before a stimulus is even presented, and the eventual result of sensory or cognitive processing for that stimulus, would be indicative of an intrinsic periodicity in the underlying neural process. Prior studies of phase-dependent perception have used a variety of analytical methods to measure and evaluate phase differences, and there is currently no established standard practice in this field. The present report intends to remediate this need, by systematically comparing the statistical power of various measures of “phase opposition” between two trial groups, in a number of real and simulated experimental situations. Seven measures were evaluated: one parametric test (circular Watson-Williams test), and three distinct measures of phase opposition (phase bifurcation index, phase opposition sum, and phase opposition product) combined with two procedures for non-parametric statistical testing (permutation, or a combination of z-score and permutation). While these are obviously not the only existing or conceivable measures, they have all been used in recent studies. All tested methods performed adequately on a previously published dataset (Busch et al., 2009). On a variety of artificially constructed datasets, no single measure was found to surpass all others, but instead the suitability of each measure was contingent on several experimental factors: the time, frequency, and depth of oscillatory phase modulation; the absolute and relative amplitudes of post-stimulus event-related potentials for the two trial groups; the absolute and relative trial numbers for the two groups; and the number of permutations used for non-parametric testing. The concurrent use of two phase opposition measures, the parametric Watson-Williams test and a non-parametric test based on summing inter-trial coherence values for the two trial groups, appears to provide the most satisfactory outcome in all situations tested. Matlab code is provided to automatically compute these phase opposition measures. PMID:27683543

  18. Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

    PubMed

    Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

    2001-11-09

    Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They provide insights into the roles of the other non-Watson-Crick base-pairs in the early stages of unfolding of the pseudoknot, which must occur to allow readthrough of the message by the ribosome. The simulations revealed several critical, highly ordered hydration sites with close to 100 % occupancies and residency times of individual water molecules of up to 5 ns. Sodium cation coordination sites with occupancies above 50 % were also observed. Copyright 2001 Academic Press.

  19. Triple-helix molecular switch-based aptasensors and DNA sensors.

    PubMed

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Determination of the Effects of Medium Composition on the Monochloramine Disinfection Kinetics of Nitrosomonas europaea by the Propidium Monoazide Quantitative PCR and Live/Dead BacLight Methods ▿

    PubMed Central

    Wahman, David G.; Schrantz, Karen A.; Pressman, Jonathan G.

    2010-01-01

    Various medium compositions (phosphate, 1 to 50 mM; ionic strength, 2.8 to 150 meq/liter) significantly affected Nitrosomonas europaea monochloramine disinfection kinetics, as determined by the Live/Dead BacLight (LD) and propidium monoazide quantitative PCR (PMA-qPCR) methods (lag coefficient, 37 to 490 [LD] and 91 to 490 [PMA-qPCR] mg·min/liter; Chick-Watson rate constant, 4.0 × 10−3 to 9.3 × 10−3 [LD] and 1.6 × 10−3 to 9.6 × 10−3 [PMA-qPCR] liter/mg·min). Two competing effects may account for the variation in disinfection kinetic parameters: (i) increasing kinetics (disinfection rate constant [k] increased, lag coefficient [b] decreased) with increasing phosphate concentration and (ii) decreasing kinetics (k decreased, b increased) with increasing ionic strength. The results support development of a standard medium for evaluating disinfection kinetics in drinking water. PMID:20952645

  1. Does Higher Education Count Less for Economic Success than for Personal Fulfillment?

    ERIC Educational Resources Information Center

    Adam, Michelle

    2006-01-01

    There are a lot of people who believe that education is the engine of prosperity. This is believed to be true, but can't be proven according to researcher Watson Scott Swail, president of the Educational Policy Institute (EPI), a nonprofit, nonpartisan, nongovernmental organization dedicated to policy-based research on educational opportunity for…

  2. Conflicting Ideologies and Language Policy in Adult ESL: Complexities of Language Socialization in a Majority-L1 Classroom

    ERIC Educational Resources Information Center

    Mori, Miki

    2014-01-01

    This study looks at how language ideologies affect and are revealed in language socialization practices in a majority-L1 adult ESL classroom, particularly looking at language use and policy. It draws on recent theories and critiques of language socialization (Bayley & Langman, 2011; Bronson & Watson-Gegeo, 2008; Garrett &…

  3. Weed management, training, and irrigation practices for organic production of trailing blackberry: I. Mature plant growth and fruit production

    USDA-ARS?s Scientific Manuscript database

    Weed management, training time, and irrigation practices were evaluated from 2013-2014 in a mature field of trailing blackberry (Rubus L. subgenus Rubus Watson) established in western Oregon. The field was planted in 2010 and certified organic in 2012, before the first harvest season. Treatments inc...

  4. Trailing blackberry genotypes differ in yield and post-harvest fruit quality during establishment in an organic production system

    USDA-ARS?s Scientific Manuscript database

    Four blackberry (Rubus L. subgenus Rubus Watson) cultivars (‘Obsidian’, ‘Black Diamond’, ‘Metolius’, ‘Onyx’) and two advanced selections (ORUS 1939-4 and ORUS 2635-1) were evaluated during the establishment years of an organic production system for fresh market. The planting was established in sprin...

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gevorkyan, S. R.; Sissakian, A. N.; Tarasov, A. V.

    The Fermi-Watson theorem is generalized to the case of two coupled channels with different masses and applied to final-state interaction inK{sub e4} decays. The impact of the considered effect on the phase of {pi}{pi} scattering is estimated and it is shown that it can be crucial for the scattering length extraction from experimental data on K{sub e4} decays.

  6. "The Treasure Within" and "Learning through Life": A Review and Prospectus

    ERIC Educational Resources Information Center

    Schuller, Tom; Watson, David

    2015-01-01

    In this article, Tom Schuller and David Watson, who were responsible for a major review of lifelong learning in the UK published in 2009, describe the main proposals from that review and compare them with the 1996 UNESCO report, "The Treasure Within". They find many points of similarity, as well as clear differences. Apart from specific…

  7. Taking a Social Turn for the Worse: The Language Socialization Paradigm for Second Language Acquisition

    ERIC Educational Resources Information Center

    Gregg, Kevin R.

    2006-01-01

    In recent years, a number of researchers in the field of second language acquisition have voiced discontent regarding the tendency of second language acquisition (SLA) research to be conducted within a framework of cognitive science (Firth and Wagner, 1997; Atkinson, 2002; Johnson, 2004). Watson-Gegeo (2004) expresses this same discontent, and…

  8. Weed management, training, and irrigation practices for organic production of trailing blackberry: III. Accumulation and removal of aboveground biomass, carbon, and nutrients

    USDA-ARS?s Scientific Manuscript database

    The effects of various production practices on biomass, C, and nutrient content, accumulation, and loss were assessed over 2 years in a mature organic trailing blackberry (Rubus L. subgenus Rubus, Watson) production system. Treatments included two irrigation options (no irrigation after harvest and ...

  9. The Academic Non-Consultation Phenomenon Revisited: A Research Agenda

    ERIC Educational Resources Information Center

    Nguyen, Nhien; Hansen, Jens Ørding

    2017-01-01

    Purpose: The purpose of this paper is to revive interest in the question, never definitively answered, which Stephen Watson raised in the title of his 2000 paper, "Why is it that management academics rarely advise on their own institutions?" It is argued that finding the answer to the question would not only be interesting in and of…

  10. Reform, Racism and the Centrality of Whiteness: Assessment, Ability and the "New Eugenics"

    ERIC Educational Resources Information Center

    Gillborn, David

    2010-01-01

    The Nobel Prize winning scientist James Watson was vilified when his views on the supposedly inherent deficiencies of black people became public. The scientific establishment, mainstream media and politicians joined a chorus of disapproval that would seem to evidence a widespread rejection of the old myths of racially ordered intelligence.…

  11. Helenistic Encomium: A Reflection on Comics and Rhetoric

    ERIC Educational Resources Information Center

    Helms, Jason

    2009-01-01

    This video reflection starts in a presentation on comics at the Thomas R. Watson Conference last October, which prompted the author to explore the etymology of cosmos and comos through an alternate reading of Gorgias' "Encomium of Helen". The author then works with comos, as revelry, to offer thoughts on comics as a form of multimodal composition…

  12. Reading Scientific Papers for Understanding: Revisiting Watson and Crick (1953)

    ERIC Educational Resources Information Center

    Kinchin, Ian M.

    2005-01-01

    The ability to use the research literature within a given field is a basic skill that students should acquire as part of their higher education studies. However, undergraduates need support in developing this skill. The use of concept maps as an aid to interrogating the literature is described here. This may help students to highlight key issues…

  13. Social Networking in an Intensive English Program Classroom: A Language Socialization Perspective

    ERIC Educational Resources Information Center

    Reinhardt, Jonathon; Zander, Victoria

    2011-01-01

    This ongoing project seeks to investigate the impact, inside and outside of class, of instruction focused on developing learner awareness of social-networking site (SNS) use in an American Intensive English Program (IEP). With language socialization as an interpretative framework (Duff, in press; Ochs, 1988; Watson-Gegeo, 2004), the project uses a…

  14. Stress-Disorder Symptoms in Vietnam and Korean War Veterans: A Commentary on Thienes-Hontos, Watson, and Kucala.

    ERIC Educational Resources Information Center

    Caroll, Edward

    1983-01-01

    Reviews a study which found that symptoms associated with posttraumatic stress disorder (PTSD) are neither unique to or common among Vietnam veteran psychiatric patients or their Korean war counterparts. Questions choice of study sample, confounding variables, and source of data. A rebuttal by the original author is included. (WAS)

  15. Affective Determinants of Anxiety and Depression Development in Children and Adolescents: An Individual Growth Curve Analysis

    ERIC Educational Resources Information Center

    De Bolle, Marleen; De Clercq, Barbara; Decuyper, Mieke; De Fruyt, Filip

    2011-01-01

    The tripartite model (in Clark and Watson, "J Abnorm Psychol" 100:316-336, 1991) comprises Negative Affect (NA), Positive Affect (PA), and Physiological Hyperarousal (PH), three temperamental-based dimensions. The current study examined the tripartite model's assumptions that (a) NA interacts with PA to predict subsequent depressive (but not…

  16. Proceedings of the Symposium on Minimum Competency Testing (Philadelphia, Pennsylvania, October 24-25, 1979).

    ERIC Educational Resources Information Center

    Mid-Atlantic Teacher Corps Network, Philadelphia, PA.

    The conference's keynote address is presented by Bernard C. Watson. Papers include: Vantage from the State Department of Education, by Robert G. Scanlon (Pennsylvania); Minimum Competency: As the Public Sees the Question, by Jacqueline Grennan Wexler; Minimum Competency Testing (MCT): A Tripartite Response from the Profession, by W. James Popham;…

  17. Developmental Needs and Early Childhood Education: Evolutionary, My Dear Watson

    ERIC Educational Resources Information Center

    Henry, Margaret

    2004-01-01

    Examining the processes of natural selection, described by Darwin in "The Origin of Species", casts light on our own species' fundamental needs and on the far greater role that early childhood educators can play in their fulfillment. The second section of this paper analyzes how our fundamental needs emerge in a sequence underpinned by the…

  18. Examining Career Readiness and Positive Affect in a Group of College Students with Disabilities: A Pilot Study

    ERIC Educational Resources Information Center

    Sears, Susann Heft; Strauser, David R.; Wong, Alex W. K.

    2014-01-01

    Data were collected from 47 college students with disabilities at a large Midwestern university using the Career Thoughts Inventory ([CTI]; Sampson, Peterson, Lenz, Reardon, Saunders, 1996) and the Positive and Negative Affect Scale ([PANAS]; Watson, Clark, & Tellegen, 1988). Initial results revealed no significant differences for CTI total,…

  19. Increasing Access to College: Extending Possibilities for All Students. SUNY Series, Frontiers in Education.

    ERIC Educational Resources Information Center

    Tierney, William G., Ed.; Hagedorn, Linda Serra, Ed.

    This collection of papers examines pre-college enrichment programs that offer a specific remedy to the problem of low income and underrepresented students' access to higher education. The 10 papers are: (1) "Pre-College Outreach Programs: A National Perspective" (Watson Scott Swail and Laura W. Perna); (2) "The Relationship between…

  20. Further Validation of the IDAS: Evidence of Convergent, Discriminant, Criterion, and Incremental Validity

    ERIC Educational Resources Information Center

    Watson, David; O'Hara, Michael W.; Chmielewski, Michael; McDade-Montez, Elizabeth A.; Koffel, Erin; Naragon, Kristin; Stuart, Scott

    2008-01-01

    The authors explicated the validity of the Inventory of Depression and Anxiety Symptoms (IDAS; D. Watson et al., 2007) in 2 samples (306 college students and 605 psychiatric patients). The IDAS scales showed strong convergent validity in relation to parallel interview-based scores on the Clinician Rating version of the IDAS; the mean convergent…

  1. Human-Computer Interaction: A Journal of Theoretical, Empirical and Methodological Issues of User Science and of System Design. Volume 7, Number 1

    DTIC Science & Technology

    1992-01-01

    Norman .................................... University of California, San Diego, CA Dan R . Olsen, Jr ........................................ Brigham...Peter G. Poison .............................................. University of Colorado, Boulder, CO James R . Rhyne ................. IBM T J Watson...and artificial intelligence, among which are: * reasoning about concurrent systems, including program verification ( Barringer , 1985), operating

  2. Prehospital Interventions Performed in a Combat Zone: A Prospective Multicenter Study of 1,003 Combat Wounded

    DTIC Science & Technology

    2012-01-01

    Howell, Maj Dean Hudson, LTC Marjorie Johnson, MAJ Colin Meghoo, MAJ Kyle Remick, MAJ Felecia Rivers, LTC James Sebesta, MAJ Leilani Siaki, Maj Adrian K... Stull , CPT Martha Swift, Capt Travis Taylor, Maj Ryan P. Tyner, Maj Gregory Watson, CPT Jennifer G. Ysmael. DISCLOSURE The views expressed in this

  3. Proceedings of the Annual California State University, San Bernardino, Reading Conference (13th, San Bernardino, CA, May 17, 1989).

    ERIC Educational Resources Information Center

    Busch, Katharine, Ed.; Atwell, Margaret, Ed.

    A compilation of conference papers highlights the active role of the learner. The titles of the papers and their authors include: "Whole Language: Celebrating the Student within the Learning Community through Literature" (Dorothy J. Watson); "Integrating the Curriculum for Better Learning and Teaching" (Stephen B. Kucer);…

  4. The Structure of Anxiety and Depression in a Normative Sample of Younger and Older Australian Adolescents

    ERIC Educational Resources Information Center

    Tully, Phillip J.; Zajac, Ian T.; Venning, Anthony J.

    2009-01-01

    It has been reported that depression and anxiety have overlapping symptoms and are conceptually interrelated. One of the most prominent theoretical developments that explain this association is Clark and Watson's tripartite model ("Journal of Abnormal Psychology," 100:316-336, 1991) that posits these two disorders and negative emotions…

  5. Glasser's Choice Theory and Purkey's Invitational Education--Allied Approaches to Counseling and Schooling

    ERIC Educational Resources Information Center

    Zeeman, Roger D.

    2006-01-01

    This article presents and compares the similar views of William Glasser, M.D., founder and president of the William Glasser Institute in Los Angeles, and author of scores of best selling books; and William Watson Purkey, Ed.D, co-founder of the International Association for Invitational Education (IAIE), Professor Emeritus at the University of…

  6. 77 FR 10604 - Qualification of Drivers; Exemption Applications; Vision

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-22

    ... renewable two-year period. They are: William M. Arbogast (FL), Cris D. Bush (TN), John E. Cain (NM), Billy C.... Ferguson (VA), Randy M. Garcia (NM), John A. Graham (PA), Henry J. Gregoire, Jr. (MN), Jason L. Hoovan (UT.... Schneider (NM), James Vickery (KY), Norman J. Watson (NC), Lewis H. West, Jr. (MA), Billy R. Wilkey (TX...

  7. Impulsively-Started Flow about Submarine-Shaped Bodies.

    DTIC Science & Technology

    1981-03-01

    extended by Goldstein and Rosenhead [7] in 1936, G6rtler [8,9] in 1944 and 1948, Schuh [10] in 1953, Watson [11] in 1955, and Wundt [12] in 1955. It...231, pp. 104-116, 1955. 12. Wundt , H., "Wachstum der Laminaren Grenzschicht an schrag angestromten Zylindren bei Anfahrt aus der Ruhe," Ing.- Arch., Vol

  8. Analyzing Individual Decision Making Versus Group Decision Making for Alternative Selection

    DTIC Science & Technology

    2008-06-01

    35 SDVF Single Dimensional Value Function . . . . . . . . . . . . . 44 ENAER Empresa Nacional de Aeronautica... de - viate further from balanced strategies than do individuals” [16]. Kocher and Sutter compared decisions by individuals and groups in beauty...Michaelsen, Watson, and Black de - termined that there have been no studies on individual versus group decision making that provided any significant

  9. Change Detection in Naturalistic Pictures among Children with Autism

    ERIC Educational Resources Information Center

    Burack, Jacob A.; Joseph, Shari; Russo, Natalie; Shore, David I.; Porporino, Mafalda; Enns, James T.

    2009-01-01

    Persons with autism often show strong reactions to changes in the environment, suggesting that they may detect changes more efficiently than typically developing (TD) persons. However, Fletcher-Watson et al. (Br J Psychol 97:537-554, 2006) reported no differences between adults with autism and TD adults with a change-detection task. In this study,…

  10. The Intersection of Language and Culture in Study Abroad: Assessment and Analysis of Study Abroad Outcomes

    ERIC Educational Resources Information Center

    Watson, Jeff R.; Wolfel, Richard

    2015-01-01

    The interconnectedness of language and culture in a study abroad environment has long been discussed in study abroad research circles. While some researchers see the relationship as complementary (Kasper & Omori, 2010; Selmeski, 2007), others go further to point out a more complex interrelationship (Kramsch, 2003; Silverstein, 2004; Watson,…

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liphardt, Jan

    In April 1953, Watson and Crick largely defined the program of 20th century biology: obtaining the blueprint of life encoded in the DNA. Fifty years later, in 2003, the sequencing of the human genome was completed. Like any major scientific breakthrough, the sequencing of the human genome raised many more questions than it answered. I'll brief you on some of the big open problems in cell and developmental biology, and I'll explain why approaches, tools, and ideas from the physical sciences are currently reshaping biological research. Super-resolution light microscopies are revealing the intricate spatial organization of cells, single-molecule methods showmore » how molecular machines function, and new probes are clarifying the role of mechanical forces in cell and tissue function. At the same time, Physics stands to gain beautiful new problems in soft condensed matter, quantum mechanics, and non-equilibrium thermodynamics.« less

  12. The influence of arene-ring size on stacking interaction with canonical base pairs

    NASA Astrophysics Data System (ADS)

    Formánek, Martin; Burda, Jaroslav V.

    2014-04-01

    Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.

  13. The Intersection of Physics and Biology

    ScienceCinema

    Liphardt, Jan

    2017-12-22

    In April 1953, Watson and Crick largely defined the program of 20th century biology: obtaining the blueprint of life encoded in the DNA. Fifty years later, in 2003, the sequencing of the human genome was completed. Like any major scientific breakthrough, the sequencing of the human genome raised many more questions than it answered. I'll brief you on some of the big open problems in cell and developmental biology, and I'll explain why approaches, tools, and ideas from the physical sciences are currently reshaping biological research. Super-resolution light microscopies are revealing the intricate spatial organization of cells, single-molecule methods show how molecular machines function, and new probes are clarifying the role of mechanical forces in cell and tissue function. At the same time, Physics stands to gain beautiful new problems in soft condensed matter, quantum mechanics, and non-equilibrium thermodynamics.

  14. Discourses of Indiscipline: An Informal Hobbesian Riposte to Cate Watson

    ERIC Educational Resources Information Center

    McManus, Michael

    2006-01-01

    Classroom battles are real and not a metaphor. Warfare is a historical and present fact of human life. Life really is a battle and conflict inevitable; injuries to the psyche are just as real as those to the body. Schools cannot step outside society. It is not Foucault but Thomas Hobbes who offers the most perceptive insight into human behaviour…

  15. Product Lifecycle Management: A Collaborative Tool for Defense Acquisitions

    DTIC Science & Technology

    2010-09-01

    by Christopher M. Schindler September 2010 Thesis Advisor: Thomas Housel Second Reader: William Solitario Approved for public release...September 2010 Author: Christopher M. Schindler Approved by: Thomas Housel, PhD Thesis Advisor William Solitario Second Reader...Ben Kassel, Randy Langmead, Michael Schwind, and Jeff Watson. I also must thank my advisors, Thomas Housel and Bill Solitario, for guiding me

  16. Response of Montia howellii (Howell's montia) to road management in California coastal timberlands

    Treesearch

    Maralyn A. Renner; James Regan; Mark Colosio

    2012-01-01

    Howell's montia (Montia howellii S. Watson), a tiny annual plant with a California Rare Plant Rank of 2.2 (rare in California but more common elsewhere), is found throughout its range in seasonally wet, natural and disturbed habitats. On Humboldt Redwood Company timberlands it occurs on native surface or lightly rocked roads and turnouts, and...

  17. Gun Control Legislation

    DTIC Science & Technology

    2010-08-27

    harassing, stalking , or threatening an intimate partner or child of such intimate partner; and (9) persons convicted of misdemeanor domestic violence...reducing violent crime and illegal gang activity. However, the committee recommendation did not include $25 million for Phase Two of the NCETR project... Gang Deterrence and Community Protection Act of 2005 (H.R. 1279) was amended with a provision offered by Representative Diane Watson that would have

  18. Lateral Mixing DRI Analysis: Submesoscale, Fine- and Microstructure Surveys of Internal Waves, Turbulence and Water-Mass Variability

    DTIC Science & Technology

    2015-09-30

    represent water-mass ( spice ) anomalies on isopycnals so serve as passive tracers. These spectra were compared with existing theories and models. 2 2...isopycnal variability of spice in the North Pacific. J. Geophys. Res. doi: 10.1002/2013JC009421. Ledwell, J.R., A.J. Watson and C.S. Law, 1998

  19. History, Reflection, and Narrative: The Professionalization of Composition, 1963-1983. Perspectives on Writing: Theory, Research, Practice. Volume 3.

    ERIC Educational Resources Information Center

    Rosner, Mary, Ed.; Boehm, Beth, Ed.; Journet, Debra, Ed.

    This collection of essays, culled from presentations at the first Thomas R. Watson Conference in Rhetoric and Composition, examines the development of composition as a profession, focusing on the period between 1963 and 1983 when composition changed in a number of crucial ways. Essays in the collection are: (1) "Composition History and…

  20. Anger and Approach: Reply to Watson (2009) and to Tomarken and Zald (2009)

    ERIC Educational Resources Information Center

    Carver, Charles S.; Harmon-Jones, Eddie

    2009-01-01

    C. S. Carver and E. Harmon-Jones reviewed evidence consistent with the idea that anger arises from a behavioral approach system. Commentary on that article by A. J. Tomarken and D. H. Zald raised questions about the many elements involved in acts of approach and limitations on what information can be provided by electroencephalograms. Commentary…

Top