Comparable Ages for the Independent Origins of Electrogenesis in African and South American Weakly Electric Fishes

PubMed Central

Lavoué, Sébastien; Miya, Masaki; Arnegard, Matthew E.; Sullivan, John P.; Hopkins, Carl D.; Nishida, Mutsumi

2012-01-01

One of the most remarkable examples of convergent evolution among vertebrates is illustrated by the independent origins of an active electric sense in South American and African weakly electric fishes, the Gymnotiformes and Mormyroidea, respectively. These groups independently evolved similar complex systems for object localization and communication via the generation and reception of weak electric fields. While good estimates of divergence times are critical to understanding the temporal context for the evolution and diversification of these two groups, their respective ages have been difficult to estimate due to the absence of an informative fossil record, use of strict molecular clock models in previous studies, and/or incomplete taxonomic sampling. Here, we examine the timing of the origins of the Gymnotiformes and the Mormyroidea using complete mitogenome sequences and a parametric Bayesian method for divergence time reconstruction. Under two different fossil-based calibration methods, we estimated similar ages for the independent origins of the Mormyroidea and Gymnotiformes. Our absolute estimates for the origins of these groups either slightly postdate, or just predate, the final separation of Africa and South America by continental drift. The most recent common ancestor of the Mormyroidea and Gymnotiformes was found to be a non-electrogenic basal teleost living more than 85 millions years earlier. For both electric fish lineages, we also estimated similar intervals (16–19 or 22–26 million years, depending on calibration method) between the appearance of electroreception and the origin of myogenic electric organs, providing rough upper estimates for the time periods during which these complex electric organs evolved de novo from skeletal muscle precursors. The fact that the Gymnotiformes and Mormyroidea are of similar age enhances the comparative value of the weakly electric fish system for investigating pathways to evolutionary novelty, as well as the influences of key innovations in communication on the process of species radiation. PMID:22606250

Visual management of large scale data mining projects.

PubMed

Shah, I; Hunter, L

2000-01-01

This paper describes a unified framework for visualizing the preparations for, and results of, hundreds of machine learning experiments. These experiments were designed to improve the accuracy of enzyme functional predictions from sequence, and in many cases were successful. Our system provides graphical user interfaces for defining and exploring training datasets and various representational alternatives, for inspecting the hypotheses induced by various types of learning algorithms, for visualizing the global results, and for inspecting in detail results for specific training sets (functions) and examples (proteins). The visualization tools serve as a navigational aid through a large amount of sequence data and induced knowledge. They provided significant help in understanding both the significance and the underlying biological explanations of our successes and failures. Using these visualizations it was possible to efficiently identify weaknesses of the modular sequence representations and induction algorithms which suggest better learning strategies. The context in which our data mining visualization toolkit was developed was the problem of accurately predicting enzyme function from protein sequence data. Previous work demonstrated that approximately 6% of enzyme protein sequences are likely to be assigned incorrect functions on the basis of sequence similarity alone. In order to test the hypothesis that more detailed sequence analysis using machine learning techniques and modular domain representations could address many of these failures, we designed a series of more than 250 experiments using information-theoretic decision tree induction and naive Bayesian learning on local sequence domain representations of problematic enzyme function classes. In more than half of these cases, our methods were able to perfectly discriminate among various possible functions of similar sequences. We developed and tested our visualization techniques on this application.

RCSLenS: The Red Cluster Sequence Lensing Survey

NASA Astrophysics Data System (ADS)

Hildebrandt, H.; Choi, A.; Heymans, C.; Blake, C.; Erben, T.; Miller, L.; Nakajima, R.; van Waerbeke, L.; Viola, M.; Buddendiek, A.; Harnois-Déraps, J.; Hojjati, A.; Joachimi, B.; Joudaki, S.; Kitching, T. D.; Wolf, C.; Gwyn, S.; Johnson, N.; Kuijken, K.; Sheikhbahaee, Z.; Tudorica, A.; Yee, H. K. C.

2016-11-01

We present the Red Cluster Sequence Lensing Survey (RCSLenS), an application of the methods developed for the Canada-France-Hawaii Telescope Lensing Survey (CFHTLenS) to the ˜785 deg2, multi-band imaging data of the Red-sequence Cluster Survey 2. This project represents the largest public, sub-arcsecond seeing, multi-band survey to date that is suited for weak gravitational lensing measurements. With a careful assessment of systematic errors in shape measurements and photometric redshifts, we extend the use of this data set to allow cross-correlation analyses between weak lensing observables and other data sets. We describe the imaging data, the data reduction, masking, multi-colour photometry, photometric redshifts, shape measurements, tests for systematic errors, and a blinding scheme to allow for more objective measurements. In total, we analyse 761 pointings with r-band coverage, which constitutes our lensing sample. Residual large-scale B-mode systematics prevent the use of this shear catalogue for cosmic shear science. The effective number density of lensing sources over an unmasked area of 571.7 deg2 and down to a magnitude limit of r ˜ 24.5 is 8.1 galaxies per arcmin2 (weighted: 5.5 arcmin-2) distributed over 14 patches on the sky. Photometric redshifts based on four-band griz data are available for 513 pointings covering an unmasked area of 383.5 deg2. We present weak lensing mass reconstructions of some example clusters as well as the full survey representing the largest areas that have been mapped in this way. All our data products are publicly available through Canadian Astronomy Data Centre at http://www.cadc-ccda.hia-iha.nrc-cnrc.gc.ca/en/community/rcslens/query.html in a format very similar to the CFHTLenS data release.

Sensitivity of human cells expressing low-fidelity or weak-catalytic-activity variants of DNA polymerase ζ to genotoxic stresses.

PubMed

Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko

2016-09-01

Translesion DNA polymerases (TLS pols) play critical roles in defense mechanisms against genotoxic agents. The defects or mutations of TLS pols are predicted to result in hypersensitivity of cells to environmental mutagens. In this study, human cells expressing DNA polymerase ζ (Pol ζ) variants with low fidelity or weak catalytic activity have been established with Nalm-6-MSH+ cells and their sensitivity to mutagenicity and cytotoxicity of benzo[a]pyrene diol epoxide (BPDE) and ultraviolet-C light (UV-C) was examined. The low-fidelity mutants were engineered by knocking-in DNA sequences that direct changes of leucine 2618 to either phenylalanine (L2618F) or methionine (L2618M) of Pol ζ. The weak-catalytic-activity mutants were generated by knocking-in DNA sequences that direct changes of either tyrosine 2779 to phenylalanine (Y2779F) or aspartate 2781 to asparagine (D2781N). In addition, a +1 frameshift mutation, i.e., CCC to CCCC, was introduced in the coding region of the TK1 gene to measure the mutant frequencies. Doubling time and spontaneous TK mutant frequencies of the established cell lines were similar to those of the wild-type cells. The low-fidelity mutants displayed, however, higher sensitivity to the mutagenicity of BPDE and UV-C than the wild-type cells although their cytotoxic sensitivity was not changed. In contrast, the weak-catalytic-activity mutants were more sensitive to the cytotoxicity of BPDE and UV-C than the wild-type cells, and displayed much higher sensitivity to the clastogenicity of BPDE than the wild-type cells in an in vitro micronucleus assay. These results indicate that human Pol ζ is involved in TLS across DNA lesions induced by BPDE and UV-C and also that the TLS plays important roles in induction of mutations, clastogenicity and in cellular survival of the damaged human cells. Similarities and differences in in vivo roles of yeast and human Pol ζ in genome integrity are discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.

PubMed Central

Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T

1996-01-01

A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992

Genetic diversity and antigenicity variation of Babesia bovis merozoite surface antigen-1 (MSA-1) in Thailand.

PubMed

Tattiyapong, Muncharee; Sivakumar, Thillaiampalam; Takemae, Hitoshi; Simking, Pacharathon; Jittapalapong, Sathaporn; Igarashi, Ikuo; Yokoyama, Naoaki

2016-07-01

Babesia bovis, an intraerythrocytic protozoan parasite, causes severe clinical disease in cattle worldwide. The genetic diversity of parasite antigens often results in different immune profiles in infected animals, hindering efforts to develop immune control methodologies against the B. bovis infection. In this study, we analyzed the genetic diversity of the merozoite surface antigen-1 (msa-1) gene using 162 B. bovis-positive blood DNA samples sourced from cattle populations reared in different geographical regions of Thailand. The identity scores shared among 93 msa-1 gene sequences isolated by PCR amplification were 43.5-100%, and the similarity values among the translated amino acid sequences were 42.8-100%. Of 23 total clades detected in our phylogenetic analysis, Thai msa-1 gene sequences occurred in 18 clades; seven among them were composed of sequences exclusively from Thailand. To investigate differential antigenicity of isolated MSA-1 proteins, we expressed and purified eight recombinant MSA-1 (rMSA-1) proteins, including an rMSA-1 from B. bovis Texas (T2Bo) strain and seven rMSA-1 proteins based on the Thai msa-1 sequences. When these antigens were analyzed in a western blot assay, anti-T2Bo cattle serum strongly reacted with the rMSA-1 from T2Bo, as well as with three other rMSA-1 proteins that shared 54.9-68.4% sequence similarity with T2Bo MSA-1. In contrast, no or weak reactivity was observed for the remaining rMSA-1 proteins, which shared low sequence similarity (35.0-39.7%) with T2Bo MSA-1. While demonstrating the high genetic diversity of the B. bovis msa-1 gene in Thailand, the present findings suggest that the genetic diversity results in antigenicity variations among the MSA-1 antigens of B. bovis in Thailand. Copyright © 2016 Elsevier B.V. All rights reserved.

FEAST: sensitive local alignment with multiple rates of evolution.

PubMed

Hudek, Alexander K; Brown, Daniel G

2011-01-01

We present a pairwise local aligner, FEAST, which uses two new techniques: a sensitive extension algorithm for identifying homologous subsequences, and a descriptive probabilistic alignment model. We also present a new procedure for training alignment parameters and apply it to the human and mouse genomes, producing a better parameter set for these sequences. Our extension algorithm identifies homologous subsequences by considering all evolutionary histories. It has higher maximum sensitivity than Viterbi extensions, and better balances specificity. We model alignments with several submodels, each with unique statistical properties, describing strongly similar and weakly similar regions of homologous DNA. Training parameters using two submodels produces superior alignments, even when we align with only the parameters from the weaker submodel. Our extension algorithm combined with our new parameter set achieves sensitivity 0.59 on synthetic tests. In contrast, LASTZ with default settings achieves sensitivity 0.35 with the same false positive rate. Using the weak submodel as parameters for LASTZ increases its sensitivity to 0.59 with high error. FEAST is available at http://monod.uwaterloo.ca/feast/.

A comparative study on the dominant factors responsible for the weaker-than-expected El Niño event in 2014

NASA Astrophysics Data System (ADS)

Li, Jianying; Liu, Boqi; Li, Jiandong; Mao, Jiangyu

2015-10-01

Anomalous warming occurred in the equatorial central-eastern Pacific in early May 2014, attracting much attention to the possible occurrence of an extreme El Niño event that year because of its similarity to the situation in early 1997. However, the subsequent variation in sea surface temperature anomalies (SSTAs) during summer 2014 in the tropical Pacific was evidently different to that in 1997, but somewhat similar to the situation of the 1990 aborted El Niño event. Based on NCEP (National Centers for Environmental Prediction) oceanic and atmospheric reanalysis data, the physical processes responsible for the strength of El Niño events are examined by comparing the dominant factors in 2014 in terms of the preceding instability of the coupled ocean-atmosphere system and westerly wind bursts (WWBs) with those in 1997 and 1990, separately. Although the unstable ocean-atmosphere system formed over the tropical Pacific in the preceding winter of 2014, the strength of the preceding instability was relatively weak. Weak oceanic eastward-propagating downwelling Kelvin waves were forced by the weak WWBs over the equatorial western Pacific in March 2014, as in February 1990. The consequent positive upper-oceanic heat content anomalies in the spring of 2014 induced only weak positive SSTAs in the central-eastern Pacific-unfavorable for the subsequent generation of summertime WWB sequences. Moreover, the equatorial western Pacific was not cooled, indicating the absence of positive Bjerknes feedback in early summer 2014. Therefore, the development of El Niño was suspended in summer 2014.

A Comparative Study on the Dominant Factors Responsible for the Weaker-than-expected El Niño Event in 2014

NASA Astrophysics Data System (ADS)

MAO, J.; Li, J.; Liu, B.; Li, J.

2015-12-01

Anomalous warming occurred in the equatorial central-eastern Pacific in early May 2014, attracting much attention to the possible occurrence of an extreme El Niño event that year because of its similarity to the situation in early 1997. However, the subsequent variation in sea surface temperature anomalies (SSTAs) during summer 2014 in the tropical Pacific was evidently different to that in 1997, but somewhat similar to the situation of the 1990 aborted El Niño event. Based on NCEP (National Centers for Environmental Prediction) oceanic and atmospheric reanalysis data, the physical processes responsible for the strength of El Niño events are examined by comparing the dominant factors in 2014 in terms of the preceding instability of the coupled ocean-atmosphere system and westerly wind bursts (WWBs) with those in 1997 and 1990, separately. Although the unstable ocean-atmosphere system formed over the tropical Pacific in the preceding winter of 2014, the strength of the preceding instability was relatively weak. Weak oceanic eastward-propagating downwelling Kelvin waves were forced by the weak WWBs over the equatorial western Pacific in March 2014, as in February 1990. The consequent positive upper-oceanic heat content anomalies in the spring of 2014 induced only weak positive SSTAs in the central-eastern Pacific-unfavorable for the subsequent generation of summertime WWB sequences. Moreover, the equatorial western Pacific was not cooled, indicating the absence of positive Bjerknes feedback in early summer 2014. Therefore, the development of El Niño was suspended in summer 2014.

Number-specific and general cognitive markers of preschoolers' math ability profiles.

PubMed

Gray, Sarah A; Reeve, Robert A

2016-07-01

Different number-specific and general cognitive markers have been claimed to underlie preschoolers' math ability. It is unclear, however, whether similar/different cognitive markers, or combinations of them, are associated with different patterns of emerging math abilities (i.e., different patterns of strength and weakness). To examine this question, 103 preschoolers (40-60 months of age) completed six math tasks (count sequence, object counting, give a number, naming numbers, ordinal relations, and arithmetic), three number-specific markers of math ability (dot enumeration, magnitude comparison, and spontaneous focusing on numerosity), and four general markers (working memory, response inhibition, attention, and vocabulary). A three-step latent profile modeling procedure identified five math ability profiles that differed in their patterns of math strengths and weaknesses; specifically, the profiles were characterized by (a) excellent math ability on all math tasks, (b) good arithmetic ability, (c) good math ability but relatively poor count sequence recitation ability, (d) average ability on all math tasks, and (e) poor ability on all math tasks. After controlling for age, only dot enumeration and spontaneous focusing on numerosity were associated with the math ability profiles, whereas vocabulary was also marginally significant, and these markers were differentially associated with different profiles; that is, different cognitive markers were associated with different patterns of strengths and weaknesses in math abilities. Findings are discussed in terms of their implications for the development of math cognition. Copyright © 2016 Elsevier Inc. All rights reserved.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

PubMed

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions

PubMed Central

Nishizawa, Manami; Nishizawa, Kazuhisa

2000-01-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273

A naturally occurring nucleotide polymorphism in the orf2/folc promoter is associated with Streptococcus suis virulence.

PubMed

de Greeff, Astrid; Buys, Herma; Wells, Jerry M; Smith, Hilde E

2014-11-12

Streptococcus suis is a major problem in the swine industry causing meningitis, arthritis and pericarditis in piglets. Pathogenesis of S. suis is poorly understood. We previously showed that introduction of a 3 kb genomic fragment from virulent serotype 2 strain 10 into a weakly virulent serotype 2 strain S735, generated a hypervirulent isolate. The 3 kb genomic fragment contained two complete open reading frames (ORF) in an operon-structure of which one ORF showed similarity to folylpolyglutamate synthetase, whereas the function of the second ORF could not be predicted based on database searches for protein similarity. In this study we demonstrate that introduction of orf2 from strain 10 into strain S735 is sufficient to dramatically increase the virulence of S735 in pigs. This increase in virulence could not be associated with changes in pro-inflammatory responses of porcine blood mononucleated cells in response to S. suis in vitro. Sequence analysis of the orf2-folC-operon of S. suis isolates 10 and S735 revealed an SNP in the -35 region of the putative promoter sequence of the operon, as well as several SNPs resulting in amino acid substitutions in the ORF2 protein. Transcript levels of orf2 and folC were significantly higher in the virulent strain 10 than in the weakly virulent strain S735 and in vitro mutagenesis of the orf2 promoter confirmed that this was due to a SNP in the predicted -35 region upstream of the orf2 promoter. In this study, we demonstrated that the stronger promoter was present in all virulent and highly virulent S. suis isolates included in our study. This highlights a correlation between high orf2 expression and virulence. Conversely, the weaker promoter was present in isolates known to be weakly pathogenic or non-pathogenic. In summary, we demonstrate the importance of orf2 in the virulence of S. suis.

Identification and analysis of multigene families by comparison of exon fingerprints.

PubMed

Brown, N P; Whittaker, A J; Newell, W R; Rawlings, C J; Beck, S

1995-06-02

Gene families are often recognised by sequence homology using similarity searching to find relationships, however, genomic sequence data provides gene architectural information not used by conventional search methods. In particular, intron positions and phases are expected to be relatively conserved features, because mis-splicing and reading frame shifts should be selected against. A fast search technique capable of detecting possible weak sequence homologies apparent at the intron/exon level of gene organization is presented for comparing spliceosomal genes and gene fragments. FINEX compares strings of exons delimited by intron/exon boundary positions and intron phases (exon fingerprint) using a global dynamic programming algorithm with a combined intron phase identity and exon size dissimilarity score. Exon fingerprints are typically two orders of magnitude smaller than their nucleic acid sequence counterparts giving rise to fast search times: a ranked search against a library of 6755 fingerprints for a typical three exon fingerprint completes in under 30 seconds on an ordinary workstation, while a worst case largest fingerprint of 52 exons completes in just over one minute. The short "sequence" length of exon fingerprints in comparisons is compensated for by the large exon alphabet compounded of intron phase types and a wide range of exon sizes, the latter contributing the most information to alignments. FINEX performs better in some searches than conventional methods, finding matches with similar exon organization, but low sequence homology. A search using a human serum albumin finds all members of the multigene family in the FINEX database at the top of the search ranking, despite very low amino acid percentage identities between family members. The method should complement conventional sequence searching and alignment techniques, offering a means of identifying otherwise hard to detect homologies where genomic data are available.

Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure.

PubMed

Hong, Soon Gyu; Cramer, Robert A; Lawrence, Christopher B; Pryor, Barry M

2005-02-01

A gene for the Alternaria major allergen, Alt a 1, was amplified from 52 species of Alternaria and related genera, and sequence information was used for phylogenetic study. Alt a 1 gene sequences evolved 3.8 times faster and contained 3.5 times more parsimony-informative sites than glyceraldehyde-3-phosphate dehydrogenase (gpd) sequences. Analyses of Alt a 1 gene and gpd exon sequences strongly supported grouping of Alternaria spp. and related taxa into several species-groups described in previous studies, especially the infectoria, alternata, porri, brassicicola, and radicina species-groups and the Embellisia group. The sonchi species-group was newly suggested in this study. Monophyly of the Nimbya group was moderately supported, and monophyly of the Ulocladium group was weakly supported. Relationships among species-groups and among closely related species of the same species-group were not fully resolved. However, higher resolution could be obtained using Alt a 1 sequences or a combined dataset than using gpd sequences alone. Despite high levels of variation in amino acid sequences, results of in silico prediction of protein secondary structure for Alt a 1 demonstrated a high degree of structural similarity for most of the species suggesting a conservation of function.

Common Amino Acid Subsequences in a Universal Proteome—Relevance for Food Science

PubMed Central

Minkiewicz, Piotr; Darewicz, Małgorzata; Iwaniak, Anna; Sokołowska, Jolanta; Starowicz, Piotr; Bucholska, Justyna; Hrynkiewicz, Monika

2015-01-01

A common subsequence is a fragment of the amino acid chain that occurs in more than one protein. Common subsequences may be an object of interest for food scientists as biologically active peptides, epitopes, and/or protein markers that are used in comparative proteomics. An individual bioactive fragment, in particular the shortest fragment containing two or three amino acid residues, may occur in many protein sequences. An individual linear epitope may also be present in multiple sequences of precursor proteins. Although recent recommendations for prediction of allergenicity and cross-reactivity include not only sequence identity, but also similarities in secondary and tertiary structures surrounding the common fragment, local sequence identity may be used to screen protein sequence databases for potential allergens in silico. The main weakness of the screening process is that it overlooks allergens and cross-reactivity cases without identical fragments corresponding to linear epitopes. A single peptide may also serve as a marker of a group of allergens that belong to the same family and, possibly, reveal cross-reactivity. This review article discusses the benefits for food scientists that follow from the common subsequences concept. PMID:26340620

Sequence variants in ARHGAP15, COLQ and FAM155A associate with diverticular disease and diverticulitis

PubMed Central

Sigurdsson, Snaevar; Alexandersson, Kristjan F.; Sulem, Patrick; Feenstra, Bjarke; Gudmundsdottir, Steinunn; Halldorsson, Gisli H.; Olafsson, Sigurgeir; Sigurdsson, Asgeir; Rafnar, Thorunn; Thorgeirsson, Thorgeir; Sørensen, Erik; Nordholm-Carstensen, Andreas; Burcharth, Jakob; Andersen, Jens; Jørgensen, Henrik Stig; Possfelt-Møller, Emma; Ullum, Henrik; Thorleifsson, Gudmar; Masson, Gisli; Thorsteinsdottir, Unnur; Melbye, Mads; Gudbjartsson, Daniel F.; Stefansson, Tryggvi; Jonsdottir, Ingileif; Stefansson, Kari

2017-01-01

Diverticular disease is characterized by pouches (that is, diverticulae) due to weakness in the bowel wall, which can become infected and inflamed causing diverticulitis, with potentially severe complications. Here, we test 32.4 million sequence variants identified through whole-genome sequencing (WGS) of 15,220 Icelanders for association with diverticular disease (5,426 cases) and its more severe form diverticulitis (2,764 cases). Subsequently, 16 sequence variants are followed up in a diverticular disease sample from Denmark (5,970 cases, 3,020 controls). In the combined Icelandic and Danish data sets we observe significant association of intronic variants in ARHGAP15 (Rho GTPase-activating protein 15; rs4662344-T: P=1.9 × 10−18, odds ratio (OR)=1.23) and COLQ (collagen-like tail subunit of asymmetric acetylcholinesterase; rs7609897-T: P=1.5 × 10−10, OR=0.87) with diverticular disease and in FAM155A (family with sequence similarity 155A; rs67153654-A: P=3.0 × 10−11, OR=0.82) with diverticulitis. These are the first loci shown to associate with diverticular disease in a genome-wide study. PMID:28585551

Does similarity in call structure or foraging ecology explain interspecific information transfer in wild Myotis bats?

PubMed

Hügel, Theresa; van Meir, Vincent; Muñoz-Meneses, Amanda; Clarin, B-Markus; Siemers, Björn M; Goerlitz, Holger R

2017-01-01

Animals can gain important information by attending to the signals and cues of other animals in their environment, with acoustic information playing a major role in many taxa. Echolocation call sequences of bats contain information about the identity and behaviour of the sender which is perceptible to close-by receivers. Increasing evidence supports the communicative function of echolocation within species, yet data about its role for interspecific information transfer is scarce. Here, we asked which information bats extract from heterospecific echolocation calls during foraging. In three linked playback experiments, we tested in the flight room and field if foraging Myotis bats approached the foraging call sequences of conspecifics and four heterospecifics that were similar in acoustic call structure only (acoustic similarity hypothesis), in foraging ecology only (foraging similarity hypothesis), both, or none. Compared to the natural prey capture rate of 1.3 buzzes per minute of bat activity, our playbacks of foraging sequences with 23-40 buzzes/min simulated foraging patches with significantly higher profitability. In the flight room, M. capaccinii only approached call sequences of conspecifics and of the heterospecific M. daubentonii with similar acoustics and foraging ecology. In the field, M. capaccinii and M. daubentonii only showed a weak positive response to those two species. Our results confirm information transfer across species boundaries and highlight the importance of context on the studied behaviour, but cannot resolve whether information transfer in trawling Myotis is based on acoustic similarity only or on a combination of similarity in acoustics and foraging ecology. Animals transfer information, both voluntarily and inadvertently, and within and across species boundaries. In echolocating bats, acoustic call structure and foraging ecology are linked, making echolocation calls a rich source of information about species identity, ecology and activity of the sender, which receivers might exploit to find profitable foraging grounds. We tested in three lab and field experiments if information transfer occurs between bat species and if bats obtain information about ecology from echolocation calls. Myotis capaccinii/daubentonii bats approached call playbacks, but only those from con- and heterospecifics with similar call structure and foraging ecology, confirming interspecific information transfer. Reactions differed between lab and field, emphasising situation-dependent differences in animal behaviour, the importance of field research, and the need for further studies on the underlying mechanism of information transfer and the relative contributions of acoustic and ecological similarity.

Erroneous and veridical recall are not two sides of the same coin: Evidence from semantic distraction in free recall.

PubMed

Marsh, John E; Hughes, Robert W; Sörqvist, Patrik; Beaman, C Philip; Jones, Dylan M

2015-11-01

Two experiments examined the extent to which erroneous recall blocks veridical recall using, as a vehicle for study, the disruptive impact of distractors that are semantically similar to a list of words presented for free recall. Instructing participants to avoid erroneous recall of to-be-ignored spoken distractors attenuated their recall but this did not influence the disruptive effect of those distractors on veridical recall (Experiment 1). Using an externalized output-editing procedure-whereby participants recalled all items that came to mind and identified those that were erroneous-the usual between-sequences semantic similarity effect on erroneous and veridical recall was replicated but the relationship between the rate of erroneous and veridical recall was weak (Experiment 2). The results suggest that forgetting is not due to veridical recall being blocked by similar events. (c) 2015 APA, all rights reserved).

Erroneous and Veridical Recall Are Not Two Sides of the Same Coin: Evidence From Semantic Distraction in Free Recall

PubMed Central

2015-01-01

Two experiments examined the extent to which erroneous recall blocks veridical recall using, as a vehicle for study, the disruptive impact of distractors that are semantically similar to a list of words presented for free recall. Instructing participants to avoid erroneous recall of to-be-ignored spoken distractors attenuated their recall but this did not influence the disruptive effect of those distractors on veridical recall (Experiment 1). Using an externalized output-editing procedure—whereby participants recalled all items that came to mind and identified those that were erroneous—the usual between-sequences semantic similarity effect on erroneous and veridical recall was replicated but the relationship between the rate of erroneous and veridical recall was weak (Experiment 2). The results suggest that forgetting is not due to veridical recall being blocked by similar events. PMID:25938326

On the topological stability of continuous functions in certain spaces related to Fourier series

NASA Astrophysics Data System (ADS)

Lebedev, Vladimir V.

2010-04-01

We show that the following properties of a continuous function f on the circle \\mathbb T are equivalent: the sequence \\widehat{f\\circ h} of the Fourier coefficients of the superposition f\\circ h belongs to the weak l^1 for every homeomorphism h of the circle onto itself; f is a function of bounded quadratic variation. We obtain similar results for spaces of functions whose sequence of Fourier coefficients belongs to the weak l^p, 1, for spaces A_p of functions f with \\widehat{f}\\in l^p, for the Sobolev spaces W_2^\\lambda, and for other spaces of functions on \\mathbb T. Under rather general assumptions on a space \\mathbb X of functions on the circle, we give a necessary condition for a given continuous function f to stay in \\mathbb X for every change of variable. We also consider the multidimensional case, which is essentially different from the one-dimensional case. In particular, we show that if p<2 and f is a continuous function on the torus \\mathbb T^d, d\\ge2, such that f\\circ h\\in A_p(\\mathbb T^d) for every homeomorphism h\\colon \\mathbb T^d\\to\\mathbb T^d, then f is constant.

Thermodynamics and NMR studies on Duck, Heron and Human HBV encapsidation signals

PubMed Central

Girard, Frederic C.; Ottink, Otmar M.; Ampt, Kirsten A.M.; Tessari, Marco; Wijmenga, Sybren S.

2007-01-01

Hepatitis B virus (HBV) replication is initiated by binding of its reverse transcriptase (P) to the apical stem-loop (AL) and primer loop (PL) of epsilon, a highly conserved RNA element at the 5′-end of the RNA pregenome. Mutation studies on duck/heron and human in vitro systems have shown similarities but also differences between their P–epsilon interaction. Here, NMR and UV thermodynamic data on AL (and PL) from these three species are presented. The stabilities of the duck and heron ALs were found to be similar, and much lower than that of human. NMR data show that this low stability stems from an 11-nt internal bulge destabilizing the stem of heron AL. In duck, although structured at low temperature, this region also forms a weak point as its imino resonances broaden to disappearance between 30 and 35°C well below the overall AL melting temperature. Surprisingly, the duck- and heron ALs were both found to be capped by a stable well-structured UGUU tetraloop. All avian ALs are expected to adhere to this because of their conserved sequence. Duck PL is stable and structured and, in view of sequence similarities, the same is expected for heron - and human PL. PMID:17430968

Purification, characterization and sequence analysis of Omp50,a new porin isolated from Campylobacter jejuni.

PubMed Central

Bolla, J M; Dé, E; Dorez, A; Pagès, J M

2000-01-01

A novel pore-forming protein identified in Campylobacter was purified by ion-exchange chromatography and named Omp50 according to both its molecular mass and its outer membrane localization. We observed a pore-forming ability of Omp50 after re-incorporation into artificial membranes. The protein induced cation-selective channels with major conductance values of 50-60 pS in 1 M NaCl. N-terminal sequencing allowed us to identify the predicted coding sequence Cj1170c from the Campylobacter jejuni genome database as the corresponding gene in the NCTC 11168 genome sequence. The gene, designated omp50, consists of a 1425 bp open reading frame encoding a deduced 453-amino acid protein with a calculated pI of 5.81 and a molecular mass of 51169.2 Da. The protein possessed a 20-amino acid leader sequence. No significant similarity was found between Omp50 and porin protein sequences already determined. Moreover, the protein showed only weak sequence identity with the major outer-membrane protein (MOMP) of Campylobacter, correlating with the absence of antigenic cross-reactivity between these two proteins. Omp50 is expressed in C. jejuni and Campylobacter lari but not in Campylobacter coli. The gene, however, was detected in all three species by PCR. According to its conformation and functional properties, the protein would belong to the family of outer-membrane monomeric porins. PMID:11104668

Higher criticism approach to detect rare variants using whole genome sequencing data

PubMed Central

2014-01-01

Because of low statistical power of single-variant tests for whole genome sequencing (WGS) data, the association test for variant groups is a key approach for genetic mapping. To address the features of sparse and weak genetic effects to be detected, the higher criticism (HC) approach has been proposed and theoretically has proven optimal for detecting sparse and weak genetic effects. Here we develop a strategy to apply the HC approach to WGS data that contains rare variants as the majority. By using Genetic Analysis Workshop 18 "dose" genetic data with simulated phenotypes, we assess the performance of HC under a variety of strategies for grouping variants and collapsing rare variants. The HC approach is compared with the minimal p-value method and the sequence kernel association test. The results show that the HC approach is preferred for detecting weak genetic effects. PMID:25519367

Structural implications of weak Ca2+ block in Drosophila cyclic nucleotide–gated channels

PubMed Central

Lam, Yee Ling; Zeng, Weizhong; Derebe, Mehabaw Getahun

2015-01-01

Calcium permeability and the concomitant calcium block of monovalent ion current (“Ca2+ block”) are properties of cyclic nucleotide–gated (CNG) channel fundamental to visual and olfactory signal transduction. Although most CNG channels bear a conserved glutamate residue crucial for Ca2+ block, the degree of block displayed by different CNG channels varies greatly. For instance, the Drosophila melanogaster CNG channel shows only weak Ca2+ block despite the presence of this glutamate. We previously constructed a series of chimeric channels in which we replaced the selectivity filter of the bacterial nonselective cation channel NaK with a set of CNG channel filter sequences and determined that the resulting NaK2CNG chimeras displayed the ion selectivity and Ca2+ block properties of the parent CNG channels. Here, we used the same strategy to determine the structural basis of the weak Ca2+ block observed in the Drosophila CNG channel. The selectivity filter of the Drosophila CNG channel is similar to that of most other CNG channels except that it has a threonine at residue 318 instead of a proline. We constructed a NaK chimera, which we called NaK2CNG-Dm, which contained the Drosophila selectivity filter sequence. The high resolution structure of NaK2CNG-Dm revealed a filter structure different from those of NaK and all other previously investigated NaK2CNG chimeric channels. Consistent with this structural difference, functional studies of the NaK2CNG-Dm chimeric channel demonstrated a loss of Ca2+ block compared with other NaK2CNG chimeras. Moreover, mutating the corresponding threonine (T318) to proline in Drosophila CNG channels increased Ca2+ block by 16 times. These results imply that a simple replacement of a threonine for a proline in Drosophila CNG channels has likely given rise to a distinct selectivity filter conformation that results in weak Ca2+ block. PMID:26283200

Structural implications of weak Ca2+ block in Drosophila cyclic nucleotide-gated channels.

PubMed

Lam, Yee Ling; Zeng, Weizhong; Derebe, Mehabaw Getahun; Jiang, Youxing

2015-09-01

Calcium permeability and the concomitant calcium block of monovalent ion current ("Ca(2+) block") are properties of cyclic nucleotide-gated (CNG) channel fundamental to visual and olfactory signal transduction. Although most CNG channels bear a conserved glutamate residue crucial for Ca(2+) block, the degree of block displayed by different CNG channels varies greatly. For instance, the Drosophila melanogaster CNG channel shows only weak Ca(2+) block despite the presence of this glutamate. We previously constructed a series of chimeric channels in which we replaced the selectivity filter of the bacterial nonselective cation channel NaK with a set of CNG channel filter sequences and determined that the resulting NaK2CNG chimeras displayed the ion selectivity and Ca(2+) block properties of the parent CNG channels. Here, we used the same strategy to determine the structural basis of the weak Ca(2+) block observed in the Drosophila CNG channel. The selectivity filter of the Drosophila CNG channel is similar to that of most other CNG channels except that it has a threonine at residue 318 instead of a proline. We constructed a NaK chimera, which we called NaK2CNG-Dm, which contained the Drosophila selectivity filter sequence. The high resolution structure of NaK2CNG-Dm revealed a filter structure different from those of NaK and all other previously investigated NaK2CNG chimeric channels. Consistent with this structural difference, functional studies of the NaK2CNG-Dm chimeric channel demonstrated a loss of Ca(2+) block compared with other NaK2CNG chimeras. Moreover, mutating the corresponding threonine (T318) to proline in Drosophila CNG channels increased Ca(2+) block by 16 times. These results imply that a simple replacement of a threonine for a proline in Drosophila CNG channels has likely given rise to a distinct selectivity filter conformation that results in weak Ca(2+) block. © 2015 Lam et al.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Stellar activity with LAMOST - II. Chromospheric activity in open clusters

NASA Astrophysics Data System (ADS)

Fang, Xiang-Song; Zhao, Gang; Zhao, Jing-Kun; Bharat Kumar, Yerra

2018-05-01

We use the LAMOST spectra of member stars in Pleiades, M34, Praesepe, and Hyades to study how chromospheric activity varies as a function of mass and rotation at different age. We measured excess equivalent widths of H α, H β, and Ca II K based on estimated chromospheric contributions from old and inactive field dwarfs, and excess luminosities are obtained by normalizing bolometric luminosity, for more than 700 late-type stars in these open clusters. Results indicate two activity sequences in cool spot coverage and H α excess emission among GK dwarfs in Pleiades and M dwarfs in Praesepe and Hyades, paralleling with well-known rotation sequences. A weak dependence of chromospheric emission on rotation exists among ultrafast rotators in saturated regime with Rossby number Ro ≲ 0.1. In the unsaturated regime, chromospheric and coronal emission show similar dependence on Ro, but with a shift towards larger Ro, indicating chromospheric emission gets easily saturated than coronal emission, and/or convective turnover time-scales based on X-ray data do not work well with chromospheric emission. More interestingly, our analysis shows fully convective slow rotators obey the rotation-chromospheric activity relation similar to hotter stars, confirming the previous finding. We found correlations among H α, H β, and Ca II K emissions, in which H α losses are more important than Ca II K for cooler and more active stars. In addition, a weak correlation is seen between chromospheric emission and photospheric activity that shows dependence on stellar spectral type and activity level, which provides some clues on how spot configuration varies as a function of mass and activity level.

Desulfovibrio tunisiensis sp. nov., a novel weakly halotolerant, sulfate-reducing bacterium isolated from exhaust water of a Tunisian oil refinery.

PubMed

Ben Ali Gam, Zouhaier; Oueslati, Ridha; Abdelkafi, Slim; Casalot, Laurence; Tholozan, Jean Luc; Labat, Marc

2009-05-01

A novel weakly halotolerant, sulfate-reducing bacterium, designated strain RB22(T), was isolated from exhaust water of a Tunisian oil refinery. Cells of strain RB22(T) were Gram-negative, motile, vibrio-shaped or sigmoid and non-spore-forming, and occurred singly or in chains. Strain RB22(T) grew between 15 and 45 degrees C (optimum, 37 degrees C) and at pH 4.5 to 9 (optimum, pH 7). NaCl was not required for growth, but the strain tolerated high NaCl concentrations (up to 70 g l(-1)) with an optimum of 40 g l(-1). Sulfate, thiosulfate, sulfite and elemental sulfur served as electron acceptors, but not fumarate. Nitrate and nitrite were not reduced. Strain RB22(T) utilized lactate, formate, fumarate, succinate, glycerol, H(2)+CO(2) and methanol as substrates. The DNA G+C content was found to be 59.6 mol%. Phylogenetic analysis based on the 16S rRNA gene revealed that the isolate was a member of the genus Desulfovibrio, with no close relatives at the species level (16S rRNA gene sequence similarity of less than 95 %). Strain RB22(T) exhibited levels of 16S rRNA gene sequence similarity of 94.6 and 94.12 % to the type strains of the closely related species Desulfovibrio aespoeensis and Desulfovibrio dechloracetivorans, respectively. On the basis of genotypic and phylogenetic characteristics, and significant phenotypic differences, we suggest that strain RB22(T) represents a novel species, for which the name Desulfovibrio tunisiensis sp. nov. is proposed. The type strain is RB22(T) (=NCIMB 14400(T)=JCM 15076(T)=DSM 19275(T)).

Scarabaecin, a novel cysteine-containing antifungal peptide from the rhinoceros beetle, Oryctes rhinoceros.

PubMed

Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru

2003-07-25

A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.

Conservation of the C-type lectin fold for massive sequence variation in a Treponema diversity-generating retroelement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le Coq, Johanne; Ghosh, Partho

2012-06-19

Anticipatory ligand binding through massive protein sequence variation is rare in biological systems, having been observed only in the vertebrate adaptive immune response and in a phage diversity-generating retroelement (DGR). Earlier work has demonstrated that the prototypical DGR variable protein, major tropism determinant (Mtd), meets the demands of anticipatory ligand binding by novel means through the C-type lectin (CLec) fold. However, because of the low sequence identity among DGR variable proteins, it has remained unclear whether the CLec fold is a general solution for DGRs. We have addressed this problem by determining the structure of a second DGR variable protein,more » TvpA, from the pathogenic oral spirochete Treponema denticola. Despite its weak sequence identity to Mtd ({approx}16%), TvpA was found to also have a CLec fold, with predicted variable residues exposed in a ligand-binding site. However, this site in TvpA was markedly more variable than the one in Mtd, reflecting the unprecedented approximate 10{sup 20} potential variability of TvpA. In addition, similarity between TvpA and Mtd with formylglycine-generating enzymes was detected. These results provide strong evidence for the conservation of the formylglycine-generating enzyme-type CLec fold among DGRs as a means of accommodating massive sequence variation.« less

Conservation of the C-type lectin fold for massive sequence variation in a Treponema diversity-generating retroelement

PubMed Central

Le Coq, Johanne; Ghosh, Partho

2011-01-01

Anticipatory ligand binding through massive protein sequence variation is rare in biological systems, having been observed only in the vertebrate adaptive immune response and in a phage diversity-generating retroelement (DGR). Earlier work has demonstrated that the prototypical DGR variable protein, major tropism determinant (Mtd), meets the demands of anticipatory ligand binding by novel means through the C-type lectin (CLec) fold. However, because of the low sequence identity among DGR variable proteins, it has remained unclear whether the CLec fold is a general solution for DGRs. We have addressed this problem by determining the structure of a second DGR variable protein, TvpA, from the pathogenic oral spirochete Treponema denticola. Despite its weak sequence identity to Mtd (∼16%), TvpA was found to also have a CLec fold, with predicted variable residues exposed in a ligand-binding site. However, this site in TvpA was markedly more variable than the one in Mtd, reflecting the unprecedented approximate 1020 potential variability of TvpA. In addition, similarity between TvpA and Mtd with formylglycine-generating enzymes was detected. These results provide strong evidence for the conservation of the formylglycine-generating enzyme-type CLec fold among DGRs as a means of accommodating massive sequence variation. PMID:21873231

Conservation of the C-type lectin fold for massive sequence variation in a Treponema diversity-generating retroelement.

PubMed

Le Coq, Johanne; Ghosh, Partho

2011-08-30

Anticipatory ligand binding through massive protein sequence variation is rare in biological systems, having been observed only in the vertebrate adaptive immune response and in a phage diversity-generating retroelement (DGR). Earlier work has demonstrated that the prototypical DGR variable protein, major tropism determinant (Mtd), meets the demands of anticipatory ligand binding by novel means through the C-type lectin (CLec) fold. However, because of the low sequence identity among DGR variable proteins, it has remained unclear whether the CLec fold is a general solution for DGRs. We have addressed this problem by determining the structure of a second DGR variable protein, TvpA, from the pathogenic oral spirochete Treponema denticola. Despite its weak sequence identity to Mtd (∼16%), TvpA was found to also have a CLec fold, with predicted variable residues exposed in a ligand-binding site. However, this site in TvpA was markedly more variable than the one in Mtd, reflecting the unprecedented approximate 10(20) potential variability of TvpA. In addition, similarity between TvpA and Mtd with formylglycine-generating enzymes was detected. These results provide strong evidence for the conservation of the formylglycine-generating enzyme-type CLec fold among DGRs as a means of accommodating massive sequence variation.

Helical Antifreeze Proteins Have Independently Evolved in Fishes on Four Occasions

PubMed Central

Graham, Laurie A.; Hobbs, Rod S.; Fletcher, Garth L.; Davies, Peter L.

2013-01-01

Alanine-rich α-helical (type I) antifreeze proteins (AFPs) are produced by a variety of fish species from three different orders to protect against freezing in icy seawater. Interspersed amongst and within these orders are fishes making AFPs that are completely different in both sequence and structure. The origin of this variety of types I, II, III and antifreeze glycoproteins (AFGPs) has been attributed to adaptation following sea-level glaciations that occurred after the divergence of most of the extant families of fish. The presence of similar types of AFPs in distantly related fishes has been ascribed to lateral gene transfer in the case of the structurally complex globular type II lectin-like AFPs and to convergent evolution for the AFGPs, which consist of a well-conserved tripeptide repeat. In this paper, we examine the genesis of the type I AFPs, which are intermediate in complexity. These predominantly α-helical peptides share many features, such as putative capping structures, Ala-richness and amphipathic character. We have added to the type I repertoire by cloning additional sequences from sculpin and have found that the similarities between the type I AFPs of the four distinct groups of fishes are not borne out at the nucleotide level. Both the non-coding sequences and the codon usage patterns are strikingly different. We propose that these AFPs arose via convergence from different progenitor helices with a weak affinity for ice and that their similarity is dictated by the propensity of specific amino acids to form helices and to align water on one side of the helix into an ice-like pattern. PMID:24324684

HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

PubMed

Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

2011-03-10

Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de.

HMMerThread: Detecting Remote, Functional Conserved Domains in Entire Genomes by Combining Relaxed Sequence-Database Searches with Fold Recognition

PubMed Central

Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

2011-01-01

Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de. PMID:21423752

Purification, characterization, and sequencing of antimicrobial peptides, Cy-AMP1, Cy-AMP2, and Cy-AMP3, from the Cycad (Cycas revoluta) seeds.

PubMed

Yokoyama, Seiya; Kato, Kouji; Koba, Atsuko; Minami, Yuji; Watanabe, Keiichi; Yagi, Fumio

2008-12-01

Novel antimicrobial peptides (AMP), designated Cy-AMP1, Cy-AMP2, and Cy-AMP3, were purified from seeds of the cycad (Cycas revoluta) by a CM cellulofine column, ion-exchange HPLC on SP COSMOGEL, and reverse-phase HPLC. They had molecular masses of 4583.2 Da, 4568.9 Da and 9275.8 Da, respectively, by MALDI-TOF MS analysis. Half of the amino acid residues of Cy-AMP1 and Cy-AMP2 were cysteine, glycine and proline, and their sequences were similar. The sequence of Cy-AMP3 showed high homology to various lipid transfer proteins. For Cy-AMP1 and Cy-AMP2, the concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic fungi, Gram-positive and Gram-negative bacteria were 7.0-8.9 microg/ml. The Cy-AMP3 had weak antimicrobial activity. The structural and antimicrobial characteristics of Cy-AMP1 and Cy-AMP2 indicated that they are a novel type of antimicrobial peptide belonging to a plant defensin family.

Sequence-specific binding of counterions to B-DNA

PubMed Central

Denisov, Vladimir P.; Halle, Bertil

2000-01-01

Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

Working Memory Replay Prioritizes Weakly Attended Events.

PubMed

Jafarpour, Anna; Penny, Will; Barnes, Gareth; Knight, Robert T; Duzel, Emrah

2017-01-01

One view of working memory posits that maintaining a series of events requires their sequential and equal mnemonic replay. Another view is that the content of working memory maintenance is prioritized by attention. We decoded the dynamics for retaining a sequence of items using magnetoencephalography, wherein participants encoded sequences of three stimuli depicting a face, a manufactured object, or a natural item and maintained them in working memory for 5000 ms. Memory for sequence position and stimulus details were probed at the end of the maintenance period. Decoding of brain activity revealed that one of the three stimuli dominated maintenance independent of its sequence position or category; and memory was enhanced for the selectively replayed stimulus. Analysis of event-related responses during the encoding of the sequence showed that the selectively replayed stimuli were determined by the degree of attention at encoding. The selectively replayed stimuli had the weakest initial encoding indexed by weaker visual attention signals at encoding. These findings do not rule out sequential mnemonic replay but reveal that attention influences the content of working memory maintenance by prioritizing replay of weakly encoded events. We propose that the prioritization of weakly encoded stimuli protects them from interference during the maintenance period, whereas the more strongly encoded stimuli can be retrieved from long-term memory at the end of the delay period.

Soft X-ray observations of pre-main sequence stars in the chamaeleon dark cloud

NASA Technical Reports Server (NTRS)

Feigelson, Eric D.; Kriss, Gerard A.

1987-01-01

Einstein IPC observations of the nearby Chamaeleon I star forming cloud show 22 well-resolved soft X-ray sources in a 1x2 deg region. Twelve are associated with H-alpha emission line pre-main sequence (PMS) stars, and four with optically selected PMS stars. Several X-ray sources have two or more PMS stars in their error circles. Optical spectra were obtained at CTIO of possible stellar counterparts of the remaining X-ray sources. They reveal 5 probable new cloud members, K7-MO stars with weak or absent emission lines. These naked X-ray selected PMS stars are similar to those found in the Taurus-Auriga cloud. The spatial distributions and H-R diagrams of the X-ray and optically selected PMS stars in the cloud are very similar. Luminosity functions indicate the Chamaeleon stars are on average approximately 5 times more X-ray luminous than Pleiad dwarfs. A significant correlation between L sub x and optical magnitude suggests this trend may continue within the PMS phase of stellar evolution. The relation of increasing X-ray luminosity with decreasing stellar ages is thus extended to stellar ages as young as 1 million years.

32-channel single photon counting module for ultrasensitive detection of DNA sequences

NASA Astrophysics Data System (ADS)

Gudkov, Georgiy; Dhulla, Vinit; Borodin, Anatoly; Gavrilov, Dmitri; Stepukhovich, Andrey; Tsupryk, Andrey; Gorbovitski, Boris; Gorfinkel, Vera

2006-10-01

We continue our work on the design and implementation of multi-channel single photon detection systems for highly sensitive detection of ultra-weak fluorescence signals, for high-performance, multi-lane DNA sequencing instruments. A fiberized, 32-channel single photon detection (SPD) module based on single photon avalanche diode (SPAD), model C30902S-DTC, from Perkin Elmer Optoelectronics (PKI) has been designed and implemented. Unavailability of high performance, large area SPAD arrays and our desire to design high performance photon counting systems drives us to use individual diodes. Slight modifications in our quenching circuit has doubled the linear range of our system from 1MHz to 2MHz, which is the upper limit for these devices and the maximum saturation count rate has increased to 14 MHz. The detector module comprises of a single board computer PC-104 that enables data visualization, recording, processing, and transfer. Very low dark count (300-1000 counts/s), robust, efficient, simple data collection and processing, ease of connectivity to any other application demanding similar requirements and similar performance results to the best commercially available single photon counting module (SPCM from PKI) are some of the features of this system.

Increased taxon sampling reveals thousands of hidden orthologs in flatworms

PubMed Central

2017-01-01

Gains and losses shape the gene complement of animal lineages and are a fundamental aspect of genomic evolution. Acquiring a comprehensive view of the evolution of gene repertoires is limited by the intrinsic limitations of common sequence similarity searches and available databases. Thus, a subset of the gene complement of an organism consists of hidden orthologs, i.e., those with no apparent homology to sequenced animal lineages—mistakenly considered new genes—but actually representing rapidly evolving orthologs or undetected paralogs. Here, we describe Leapfrog, a simple automated BLAST pipeline that leverages increased taxon sampling to overcome long evolutionary distances and identify putative hidden orthologs in large transcriptomic databases by transitive homology. As a case study, we used 35 transcriptomes of 29 flatworm lineages to recover 3427 putative hidden orthologs, some unidentified by OrthoFinder and HaMStR, two common orthogroup inference algorithms. Unexpectedly, we do not observe a correlation between the number of putative hidden orthologs in a lineage and its “average” evolutionary rate. Hidden orthologs do not show unusual sequence composition biases that might account for systematic errors in sequence similarity searches. Instead, gene duplication with divergence of one paralog and weak positive selection appear to underlie hidden orthology in Platyhelminthes. By using Leapfrog, we identify key centrosome-related genes and homeodomain classes previously reported as absent in free-living flatworms, e.g., planarians. Altogether, our findings demonstrate that hidden orthologs comprise a significant proportion of the gene repertoire in flatworms, qualifying the impact of gene losses and gains in gene complement evolution. PMID:28400424

Attenuation of harmonic noise in vibroseis data using Simulated Annealing

NASA Astrophysics Data System (ADS)

Sharma, S. P.; Tildy, Peter; Iranpour, Kambiz; Scholtz, Peter

2009-04-01

Processing of high productivity vibroseis seismic data (such as slip-sweep acquisition records) suffers from the well known disadvantage of harmonic distortion. Harmonic distortions are observed after cross-correlation of the recorded seismic signal with the pilot sweep and affect the signals in negative time (before the actual strong reflection event). Weak reflection events of the earlier sweeps falling in the negative time window of the cross-correlation sequence are being masked by harmonic distortions. Though the amplitude of the harmonic distortion is small (up to 10-20 %) compared to the fundamental amplitude of the reflection events, but it is significant enough to mask weak reflected signals. Elimination of harmonic noise due to source signal distortion from the cross-correlated seismic trace is a challenging task since the application of vibratory sources started and it still needs improvement. An approach has been worked out that minimizes the level of harmonic distortion by designing the signal similar to the harmonic distortion. An arbitrary length filter is optimized using the Simulated Annealing global optimization approach to design a harmonic signal. The approach deals with the convolution of a ratio trace (ratio of the harmonics with respect to the fundamental sweep) with the correlated "positive time" recorded signal and an arbitrary filter. Synthetic data study has revealed that this procedure of designing a signal similar to the desired harmonics using convolution of a suitable filter with theoretical ratio of harmonics with fundamental sweep helps in reducing the problem of harmonic distortion. Once we generate a similar signal for a vibroseis source using an optimized filter, then, this filter could be used to generate harmonics, which can be subtracted from the main cross-correlated trace to get the better, undistorted image of the subsurface. Designing the predicted harmonics to reduce the energy in the trace by considering weak reflection and observed harmonics together yields the desired result (resolution of weak reflected signal from the harmonic distortion). As optimization steps proceeds forward it is possible to observe from the difference plots of desired and predicted harmonics how weak reflections evolved from the harmonic distortion gradually during later iterations of global optimization. The procedure is applied in resolving weak reflections from a number of traces considered together. For a more precise design of harmonics SA procedure needs longer computation time which is impractical to deal with voluminous seismic data. However, the objective of resolving weak reflection signal in the strong harmonic noise can be achieved with fast computation using faster cooling schedule and less number of iterations and number of moves in simulated annealing procedure. This process could help in reducing the harmonics distortion and achieving the objective of resolving the lost weak reflection events in the cross-correlated seismic traces. Acknowledgements: The research was supported under the European Marie Curie Host Fellowships for Transfer of Knowledge (TOK) Development Host Scheme (contract no. MTKD-CT-2006-042537).

Stratigraphy of the layered terrain in Valles Marineris, Mars

NASA Technical Reports Server (NTRS)

Komatsu, G.; Strom, Roger G.

1991-01-01

The layered terrain in Valles Marineris provides information about its origin and the geologic history of this canyon system. Whether the terrain is sedimentary material deposited in a dry or lacustrine environment, or volcanic material related to the tectonics of the canyon is still controversial. However, recent studies of Gangis Layered Terrain suggests a cyclic sequence of deposition and erosion under episodic lacustrine conditions. The stratigraphic studies are extended to four other occurrences of layered terrains in Valles Marineris in an attempt to correlate and distinguish between depositional environments. The Juvantae Chasma, Hebes Chasma, Ophir and Candor Chasmata, Melas Chasma, and Gangis Layered Terrain were examined. Although there are broad similarities among the layered terrains, no two deposits are exactly alike. This suggests that there was no synchronized regional depositional processes to form all the layered deposits. However, the similar erosional style of the lower massive weakly bedded unit in Hebes, Gangis, and Ophir-Candor suggests it may have been deposited under similar circumstances.

Experimental investigation of measurement-induced disturbance and time symmetry in quantum physics

NASA Astrophysics Data System (ADS)

Curic, D.; Richardson, M. C.; Thekkadath, G. S.; Flórez, J.; Giner, L.; Lundeen, J. S.

2018-04-01

Unlike regular time evolution governed by the Schrödinger equation, standard quantum measurement appears to violate time-reversal symmetry. Measurement creates random disturbances (e.g., collapse) that prevent back-tracing the quantum state of the system. The effect of these disturbances is explicit in the results of subsequent measurements. In this way, the joint result of sequences of measurements depends on the order in time in which those measurements are performed. One might expect that if the disturbance could be eliminated this time-ordering dependence would vanish. Following a recent theoretical proposal [Bednorz, Franke, and Belzig, New J. Phys. 15, 023043 (2013), 10.1088/1367-2630/15/2/023043], we experimentally investigate this dependence for a kind of measurement that creates an arbitrarily small disturbance: weak measurement. We perform various sequences of a set of polarization weak measurements on photons. We experimentally demonstrate that, although the weak measurements are minimally disturbing, their time ordering affects the outcome of the measurement sequence for quantum systems.

AKARI OBSERVATION OF THE NORTH ECLIPTIC POLE (NEP) SUPERCLUSTER AT z = 0.087: MID-INFRARED VIEW OF TRANSITION GALAXIES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ko, Jongwan; Im, Myungshin; Lee, Hyung Mok

2012-02-01

We present the mid-infrared (MIR) properties of galaxies within a supercluster in the north ecliptic pole region at z {approx} 0.087 observed with the AKARI satellite. We use data from the AKARI NEP-Wide (5.4 deg{sup 2}) IR survey and the CLusters of galaxies EVoLution studies (CLEVL) mission program. We show that near-IR (3 {mu}m)-mid-IR (11 {mu}m) color can be used as an indicator of the specific star formation rate and the presence of intermediate-age stellar populations. From the MIR observations, we find that red-sequence galaxies consist not only of passively evolving red early-type galaxies, but also of (1) 'weak-SFGs' (disk-dominatedmore » star-forming galaxies that have star formation rates lower by {approx}4 Multiplication-Sign than blue-cloud galaxies) and (2) 'intermediate-MXGs' (bulge-dominated galaxies showing stronger MIR dust emission than normal red early-type galaxies). These two populations can be a set of transition galaxies from blue, star-forming, late-type galaxies evolving into red, quiescent, early-type ones. We find that the weak-SFGs are predominant at intermediate masses (10{sup 10} M{sub Sun} < M{sub *} < 10{sup 10.5} M{sub Sun }) and are typically found in local densities similar to the outskirts of galaxy clusters. As much as 40% of the supercluster member galaxies in this mass range can be classified as weak-SFGs, but their proportion decreases to <10% at larger masses (M{sub *} > 10{sup 10.5} M{sub Sun }) at any galaxy density. The fraction of the intermediate-MXG among red-sequence galaxies at 10{sup 10} M{sub Sun} < M{sub *} < 10{sup 11} M{sub Sun} also decreases as the density and mass increase. In particular, {approx}42% of the red-sequence galaxies with early-type morphologies are classified as intermediate-MXGs at intermediate densities. These results suggest that the star formation activity is strongly dependent on the stellar mass, but that the morphological transformation is mainly controlled by the environment.« less

Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

PubMed Central

Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

2017-01-01

ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

Working Memory Replay Prioritizes Weakly Attended Events

PubMed Central

Penny, Will; Knight, Robert T.; Duzel, Emrah

2017-01-01

Abstract One view of working memory posits that maintaining a series of events requires their sequential and equal mnemonic replay. Another view is that the content of working memory maintenance is prioritized by attention. We decoded the dynamics for retaining a sequence of items using magnetoencephalography, wherein participants encoded sequences of three stimuli depicting a face, a manufactured object, or a natural item and maintained them in working memory for 5000 ms. Memory for sequence position and stimulus details were probed at the end of the maintenance period. Decoding of brain activity revealed that one of the three stimuli dominated maintenance independent of its sequence position or category; and memory was enhanced for the selectively replayed stimulus. Analysis of event-related responses during the encoding of the sequence showed that the selectively replayed stimuli were determined by the degree of attention at encoding. The selectively replayed stimuli had the weakest initial encoding indexed by weaker visual attention signals at encoding. These findings do not rule out sequential mnemonic replay but reveal that attention influences the content of working memory maintenance by prioritizing replay of weakly encoded events. We propose that the prioritization of weakly encoded stimuli protects them from interference during the maintenance period, whereas the more strongly encoded stimuli can be retrieved from long-term memory at the end of the delay period. PMID:28824955

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

PubMed

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

PubMed Central

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation.

PubMed

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.

The Effects of Family, Dentition and Dental Caries on the Salivary Microbiome

PubMed Central

Foxman, Betsy; Luo, Ting; Srinivasan, Usha; Ramadugu, Kirtana; Wen, Ai; Goldberg, Deborah; Shedden, Kerby; Crout, Richard; McNeil, Daniel W.; Weyant, Robert; Marazita, Mary L.

2016-01-01

Background Family members share genes, environment and microbial communities. If there is a strong effect of family on the salivary microbiota, controlling for family will enhance identification of microbial communities associated with cariogenesis. The current study was designed to assess the similarity of the salivary microbiome among families and the association between the salivary microbiome and dental decay taking age into account. Methods We selected families (n= 49) participating in the cohort study of oral health conducted by the Center for Oral Health Research in Appalachia (COHRA). All families where at least two children and at least one parent gave a saliva sample (n=173) were included. Saliva samples were collected at least one hour after eating or drinking. Following DNA extraction, the V6 region of the 16s rRNA gene was sequenced. Paired ends were joined using FLASH, sequences were de-multiplexed and filtered using QIIME 1.9.0, and taxonomy was assigned using the RDP Classifier and sequences aligned with the CORE database using PyNAST. Results The salivary microbiome changed with age and was more similar within families than between families. There was no difference in the diversity of the salivary microbiome by dental decay. After taking into account age and family, signals of dental decay were weak in the saliva, whether examined at the phyla, genus or operational taxonomic level. Conclusions The salivary microbiome does not appear to be a good indicator of dental caries. PMID:27157862

Contrasting phylogeographic patterns in Sphagnum fimbriatum and Sphagnum squarrosum (Bryophyta, Sphagnopsida) in Europe.

PubMed

Szövényi, Péter; Hock, Zsófia; Urmi, Edwin; Schneller, Jakob J

2006-01-01

The chloroplast phylogeography of two peat mosses (Sphagnum fimbriatum and Sphagnum squarrosum) with similar distributions but different life history characteristics was investigated in Europe. Our main aim was to test whether similar distributions reflect similar phylogeographic and phylodemographic processes. Accessions covering the European distributions of the species were collected and approx. 2000 bp of the chloroplast genome of each species was sequenced. Maximum parsimony, statistical parsimony and phylodemographic analyses were used to address the question of whether these species with similar distributions show evidence of similar phylogeographic and phylodemographic processes. The chloroplast haplotypes of the currently spreading species S. fimbriatum showed strong geographic structure, whereas those of S. squarrosum, which has stable historical population sizes, showed only very weak geographic affinity and were widely distributed. We hypothesize that S. fimbriatum survived the last glaciations along the Atlantic coast of Europe, whereas S. squarrosum had numerous, scattered refugia in Europe. The dominance of one haplotype of S. fimbriatum across almost all of Europe suggests rapid colonization after the last glacial maximum. We hypothesize that high colonizing ability is an inherent characteristic of the species and its recent expansion in Europe is a response to climate change.

Emergence of spike correlations in periodically forced excitable systems

NASA Astrophysics Data System (ADS)

Reinoso, José A.; Torrent, M. C.; Masoller, Cristina

2016-09-01

In sensory neurons the presence of noise can facilitate the detection of weak information-carrying signals, which are encoded and transmitted via correlated sequences of spikes. Here we investigate the relative temporal order in spike sequences induced by a subthreshold periodic input in the presence of white Gaussian noise. To simulate the spikes, we use the FitzHugh-Nagumo model and to investigate the output sequence of interspike intervals (ISIs), we use the symbolic method of ordinal analysis. We find different types of relative temporal order in the form of preferred ordinal patterns that depend on both the strength of the noise and the period of the input signal. We also demonstrate a resonancelike behavior, as certain periods and noise levels enhance temporal ordering in the ISI sequence, maximizing the probability of the preferred patterns. Our findings could be relevant for understanding the mechanisms underlying temporal coding, by which single sensory neurons represent in spike sequences the information about weak periodic stimuli.

The carbohydrate-binding module (CBM)-like sequence is crucial for rice CWA1/BC1 function in proper assembly of secondary cell wall materials.

PubMed

Sato, Kanna; Ito, Sachiko; Fujii, Takeo; Suzuki, Ryu; Takenouchi, Sachi; Nakaba, Satoshi; Funada, Ryo; Sano, Yuzou; Kajita, Shinya; Kitano, Hidemi; Katayama, Yoshihiro

2010-11-01

We recently reported that the cwa1 mutation disturbed the deposition and assembly of secondary cell wall materials in the cortical fiber of rice internodes. Genetic analysis revealed that cwa1 is allelic to bc1, which encodes glycosylphosphatidylinositol (GPI)-anchored COBRA-like protein with the highest homology to Arabidopsis COBRA-like 4 (COBL4) and maize Brittle Stalk 2 (Bk2). Our results suggested that CWA1/BC1 plays a role in assembling secondary cell wall materials at appropriate sites, enabling synthesis of highly ordered secondary cell wall structure with solid and flexible internodes in rice. The N-terminal amino acid sequence of CWA1/BC1, as well as its orthologs (COBL4, Bk2) and other BC1-like proteins in rice, shows weak similarity to a family II carbohydrate-binding module (CBM2) of several bacterial cellulases. To investigate the importance of the CBM-like sequence of CWA1/BC1 in the assembly of secondary cell wall materials, Trp residues in the CBM-like sequence, which is important for carbohydrate binding, were substituted for Val residues and introduced into the cwa1 mutant. CWA1/BC1 with the mutated sequence did not complement the abnormal secondary cell walls seen in the cwa1 mutant, indicating that the CBM-like sequence is essential for the proper function of CWA1/BC1, including assembly of secondary cell wall materials.

A multi-wavelength study of pre-main sequence stars in the Taurus-Auriga star-forming region

NASA Astrophysics Data System (ADS)

Guenther, E. W.; Stelzer, B.; Neuhäuser, R.; Hillwig, T. C.; Durisen, R. H.; Menten, K. M.; Greimel, R.; Barwig, H.; Englhauser, J.; Robb, R. M.

2000-05-01

Although many lowmass pre-main sequence stars are strong X-ray sources, the origin of the X-ray emission is not well known. Since these objects are variable at all frequencies, simultaneous observations in X-rays and in other wavelengths are able to constrain the properties of the X-ray emitting regions. In this paper, we report quasi-simultaneous observations in X-rays, the optical, and the radio regime for classical and weak-line T Tauri stars from the Taurus-Auriga star-forming region. We find that all detected T Tauri stars show significant night-to-night variations of the X-ray emission. For three of the stars, FM Tau and CW Tau, both classical T Tauri stars, and V773 Tau, a weak-line T Tauri star, the variations are especially large. From observations taken simultaneously, we also find that there is some correspondence between the strength of Hα and the X-ray brightness in V773 Tau. The lack of a strong correlation leads us to conclude that the X-ray emission of V773 Tau is not a superposition of flares. However, we suggest that a weak correlation occurs because chromospherically active regions and regions of strong X-ray emission are generally related. V773 Tau was detected at 8.46 GHz as a weakly circularly polarised but highly variable source. We also find that the X-ray emission and the equivalent width of Hα remained unchanged, while large variations of the flux density in the radio regime were observed. This clearly indicates that the emitting regions are different. Using optical spectroscopy we detected a flare in Hα and event which showed a flare-like light-curve of the continuum brightness in FM Tau. However, ROSAT did not observe the field at the times of these flares. Nevertheless, an interesting X-ray event was observed in V773 Tau, during which the flux increased for about 8 hours and then decreased back to the same level in 5 hours. We interpret this as a long-duration event similar to those seen on the sun and other active stars. In the course of the observations, we discovered a new weak-line T Tauri star, GSC-1839-5674. Results are also presented for several other stars in the ROSAT field.

Chaotic system detection of weak seismic signals

NASA Astrophysics Data System (ADS)

Li, Y.; Yang, B. J.; Badal, J.; Zhao, X. P.; Lin, H. B.; Li, R. L.

2009-09-01

When the signal-to-noise (S/N) ratio is less than -3 dB or even 0 dB, seismic events are generally difficult to identify from a common shot record. To overcome this type of problem we present a method to detect weak seismic signals based on the oscillations described by a chaotic dynamic system in phase space. The basic idea is that a non-linear chaotic oscillator is strongly immune to noise. Such a dynamic system is less influenced by noise, but it is more sensitive to periodic signals, changing from a chaotic state to a large-scale periodic phase state when excited by a weak signal. With the purpose of checking the possible contamination of the signal by noise, we have performed a numerical experiment with an oscillator controlled by the Duffing-Holmes equation, taking a distorted Ricker wavelet sequence as input signal. In doing so, we prove that the oscillator system is able to reach a large-scale periodic phase state in a strong noise environment. In the case of a common shot record with low S/N ratio, the onsets reflected from a same interface are similar to one other and can be put on a single trace with a common reference time and the periodicity of the so-generated signal follows as a consequence of moveout at a particular scanning velocity. This operation, which is called `horizontal dynamic correction' and leads to a nearly periodic signal, is implemented on synthetic wavelet sequences taking various sampling arrival times and scanning velocities. Thereafter, two tests, both in a noisy ambient of -3.7 dB, are done using a chaotic oscillator: the first demonstrates the capability of the method to really detect a weak seismic signal; the second takes care of the fundamental weakness of the dynamic correction coming from the use of a particular scanning velocity, which is investigated from the effect caused by near-surface lateral velocity variation on the periodicity of the reconstructed seismic signal. Finally, we have developed an application of the method to real data acquired in seismic prospecting and then converted into pseudo-periodic signals, which has allowed us to discriminate fuzzy waveforms as multiples, thus illustrating in practice the performance of our working scheme.

Prelude and Fugue, predicting local protein structure, early folding regions and structural weaknesses.

PubMed

Kwasigroch, Jean Marc; Rooman, Marianne

2006-07-15

Prelude&Fugue are bioinformatics tools aiming at predicting the local 3D structure of a protein from its amino acid sequence in terms of seven backbone torsion angle domains, using database-derived potentials. Prelude(&Fugue) computes all lowest free energy conformations of a protein or protein region, ranked by increasing energy, and possibly satisfying some interresidue distance constraints specified by the user. (Prelude&)Fugue detects sequence regions whose predicted structure is significantly preferred relative to other conformations in the absence of tertiary interactions. These programs can be used for predicting secondary structure, tertiary structure of short peptides, flickering early folding sequences and peptides that adopt a preferred conformation in solution. They can also be used for detecting structural weaknesses, i.e. sequence regions that are not optimal with respect to the tertiary fold. http://babylone.ulb.ac.be/Prelude_and_Fugue.

Entropy and long-range memory in random symbolic additive Markov chains

NASA Astrophysics Data System (ADS)

Melnik, S. S.; Usatenko, O. V.

2016-06-01

The goal of this paper is to develop an estimate for the entropy of random symbolic sequences with elements belonging to a finite alphabet. As a plausible model, we use the high-order additive stationary ergodic Markov chain with long-range memory. Supposing that the correlations between random elements of the chain are weak, we express the conditional entropy of the sequence by means of the symbolic pair correlation function. We also examine an algorithm for estimating the conditional entropy of finite symbolic sequences. We show that the entropy contains two contributions, i.e., the correlation and the fluctuation. The obtained analytical results are used for numerical evaluation of the entropy of written English texts and DNA nucleotide sequences. The developed theory opens the way for constructing a more consistent and sophisticated approach to describe the systems with strong short-range and weak long-range memory.

Entropy and long-range memory in random symbolic additive Markov chains.

PubMed

Melnik, S S; Usatenko, O V

2016-06-01

The goal of this paper is to develop an estimate for the entropy of random symbolic sequences with elements belonging to a finite alphabet. As a plausible model, we use the high-order additive stationary ergodic Markov chain with long-range memory. Supposing that the correlations between random elements of the chain are weak, we express the conditional entropy of the sequence by means of the symbolic pair correlation function. We also examine an algorithm for estimating the conditional entropy of finite symbolic sequences. We show that the entropy contains two contributions, i.e., the correlation and the fluctuation. The obtained analytical results are used for numerical evaluation of the entropy of written English texts and DNA nucleotide sequences. The developed theory opens the way for constructing a more consistent and sophisticated approach to describe the systems with strong short-range and weak long-range memory.

Development of renormalization group analysis of turbulence

NASA Technical Reports Server (NTRS)

Smith, L. M.

1990-01-01

The renormalization group (RG) procedure for nonlinear, dissipative systems is now quite standard, and its applications to the problem of hydrodynamic turbulence are becoming well known. In summary, the RG method isolates self similar behavior and provides a systematic procedure to describe scale invariant dynamics in terms of large scale variables only. The parameterization of the small scales in a self consistent manner has important implications for sub-grid modeling. This paper develops the homogeneous, isotropic turbulence and addresses the meaning and consequence of epsilon-expansion. The theory is then extended to include a weak mean flow and application of the RG method to a sequence of models is shown to converge to the Navier-Stokes equations.

Effects of low-intensity pulsed electromagnetic fields on the early development of sea urchins.

PubMed Central

Falugi, C; Grattarola, M; Prestipino, G

1987-01-01

The effects of weak electromagnetic signals on the early development of the sea urchin Paracentrotus lividus have been studied. The duration and repetition of the pulses were similar to those used for bone healing in clinical practice. A sequence of pulses, applied for a time ranging from 2 to 4 h, accelerates the cleavages of sea urchin embryo cells. This effect can be quantitatively assessed by determining the time shifts induced by the applied electromagnetic field on the completion of the first and second cleavages in a population of fertilized eggs. The exposed embryos were allowed to develop up to the pluteus stage, showing no abnormalities. Images FIGURE 3 FIGURE 4 PMID:3607217

Functional Screening of Metagenome and Genome Libraries for Detection of Novel Flavonoid-Modifying Enzymes

PubMed Central

Rabausch, U.; Juergensen, J.; Ilmberger, N.; Böhnke, S.; Fischer, S.; Schubach, B.; Schulte, M.

2013-01-01

The functional detection of novel enzymes other than hydrolases from metagenomes is limited since only a very few reliable screening procedures are available that allow the rapid screening of large clone libraries. For the discovery of flavonoid-modifying enzymes in genome and metagenome clone libraries, we have developed a new screening system based on high-performance thin-layer chromatography (HPTLC). This metagenome extract thin-layer chromatography analysis (META) allows the rapid detection of glycosyltransferase (GT) and also other flavonoid-modifying activities. The developed screening method is highly sensitive, and an amount of 4 ng of modified flavonoid molecules can be detected. This novel technology was validated against a control library of 1,920 fosmid clones generated from a single Bacillus cereus isolate and then used to analyze more than 38,000 clones derived from two different metagenomic preparations. Thereby we identified two novel UDP glycosyltransferase (UGT) genes. The metagenome-derived gtfC gene encoded a 52-kDa protein, and the deduced amino acid sequence was weakly similar to sequences of putative UGTs from Fibrisoma and Dyadobacter. GtfC mediated the transfer of different hexose moieties and exhibited high activities on flavones, flavonols, flavanones, and stilbenes and also accepted isoflavones and chalcones. From the control library we identified a novel macroside glycosyltransferase (MGT) with a calculated molecular mass of 46 kDa. The deduced amino acid sequence was highly similar to sequences of MGTs from Bacillus thuringiensis. Recombinant MgtB transferred the sugar residue from UDP-glucose effectively to flavones, flavonols, isoflavones, and flavanones. Moreover, MgtB exhibited high activity on larger flavonoid molecules such as tiliroside. PMID:23686272

Analysis of 10,000 ESTs from lymphocytes of the cynomolgus monkey to improve our understanding of its immune system

PubMed Central

Chen, Wei-Hua; Wang, Xue-Xia; Lin, Wei; He, Xiao-Wei; Wu, Zhen-Qiang; Lin, Ying; Hu, Song-Nian; Wang, Xiao-Ning

2006-01-01

Background The cynomolgus monkey (Macaca fascicularis) is one of the most widely used surrogate animal models for an increasing number of human diseases and vaccines, especially immune-system-related ones. Towards a better understanding of the gene expression background upon its immunogenetics, we constructed a cDNA library from Epstein-Barr virus (EBV)-transformed B lymphocytes of a cynomolgus monkey and sequenced 10,000 randomly picked clones. Results After processing, 8,312 high-quality expressed sequence tags (ESTs) were generated and assembled into 3,728 unigenes. Annotations of these uniquely expressed transcripts demonstrated that out of the 2,524 open reading frame (ORF) positive unigenes (mitochondrial and ribosomal sequences were not included), 98.8% shared significant similarities (E-value less than 1e-10) with the NCBI nucleotide (nt) database, while only 67.7% (E-value less than 1e-5) did so with the NCBI non-redundant protein (nr) database. Further analysis revealed that 90.0% of the unigenes that shared no similarities to the nr database could be assigned to human chromosomes, in which 75 did not match significantly to any cynomolgus monkey and human ESTs. The mapping regions to known human genes on the human genome were described in detail. The protein family and domain analysis revealed that the first, second and fourth of the most abundantly expressed protein families were all assigned to immunoglobulin and major histocompatibility complex (MHC)-related proteins. The expression profiles of these genes were compared with that of homologous genes in human blood, lymph nodes and a RAMOS cell line, which demonstrated expression changes after transformation with EBV. The degree of sequence similarity of the MHC class I and II genes to the human reference sequences was evaluated. The results indicated that class I molecules showed weak amino acid identities (<90%), while class II showed slightly higher ones. Conclusion These results indicated that the genes expressed in the cynomolgus monkey could be used to identify novel protein-coding genes and revise those incomplete or incorrect annotations in the human genome by comparative methods, since the old world monkeys and humans share high similarities at the molecular level, especially within coding regions. The identification of multiple genes involved in the immune response, their sequence variations to the human homologues, and their responses to EBV infection could provide useful information to improve our understanding of the cynomolgus monkey immune system. PMID:16618371

The permeability of endplate channels to monovalent and divalent metal cations

PubMed Central

1980-01-01

The relative permeability of endplate channels to monovalent and divalent metal ions was determined from reversal potentials. Thallium is the most permeant ion with a permeability ratio relative to Na+ of 2.5. The selectivity among alkali metals is weak with a sequence, Cs+ greater than Rb+ greater than K+ greater than Na+ greater than Li+, and permeability ratios of 1.4, 1.3, 1.1, 1.0, and 0.9. The selectivity among divalent ions is also weak, with a sequence for alkaline earths of Mg++ greater than Ca++ greater than Ba++ greater than Sr++. The transition metal ions Mn++, Co++, Ni++, Zn++, and Cd++ are also permeant. Permeability ratios for divalent ions decreased as the concentration of divalent ion was increased in a manner consistent with the negative surface potential theory of Lewis (1979 J. Physiol. (Lond.). 286: 417--445). With 20 mM XCl2 and 85.5 mM glucosamine.HCl in the external solution, the apparent permeability ratios for the alkaline earth cations (X++) are in the range 0.18--0.25. Alkali metal ions see the endplate channel as a water-filled, neutral pore without high-field-strength sites inside. Their permeability sequence is the same as their aqueous mobility sequence. Divalent ions, however, have a permeability sequence almost opposite from their mobility sequence and must experience some interaction with groups in the channel. In addition, the concentrations of monovalent and divalent ions are increased near the channel mouth by a weak negative surface potential. PMID:6247423

Morphology and phylogeny of Bryophryoides ocellatus n. g., n. sp. (Ciliophora, Colpodea) from in situ soil percolates of Idaho, U.S.A.

PubMed

Bourland, William A; Wendell, Laura; Hampikian, Greg; Vďačný, Peter

2014-02-01

We describe the morphology and 18S rDNA phylogeny of Bryophryoides ocellatus n. g., n. sp., a bryophryid ciliate inhabiting in situ soil percolates from Idaho, U.S.A. The new genus is distinguished from other bryophryid genera by a combination of the following features: (1) kreyellid (irregularly meshed) silverline pattern, (2) polymorphic adoral organelles in the preoral suture, (3) absence of vestibular kineties. In phylogenetic analyses, Bryophryoides ocellatus is most closely related to Bryophrya gemmea. The 18S rDNA sequence pairwise distance of 2% between these genera, while similar to that between many colpodidan species, exceeds that between some colpodidan genera (e.g. Mykophagophrys and Pseudoplatyophrya, 1.1%), further supporting establishment of the new genus. Topology hypothesis testing strongly supports the monophyly of the Colpodida including the bryophryids. Despite weak nodal support, tests of topology constraints narrowly reject the non-monophyly of the sequenced Bryophryidae (Bryophrya+Bryophryoides+Notoxoma). Likewise, the monophyletic origin of the sequenced Bryophryidae is indicated in the phylogenetic networks though with low support. Copyright © 2013 Elsevier GmbH. All rights reserved.

A new titinopathy

PubMed Central

De Cid, Rafael; Ben Yaou, Rabah; Roudaut, Carinne; Charton, Karine; Baulande, Sylvain; Leturcq, France; Romero, Norma Beatriz; Malfatti, Edoardo; Beuvin, Maud; Vihola, Anna; Criqui, Audrey; Nelson, Isabelle; Nectoux, Juliette; Ben Aim, Laurène; Caloustian, Christophe; Olaso, Robert; Udd, Bjarne; Bonne, Gisèle; Eymard, Bruno

2015-01-01

Objective: To identify the genetic defects present in 3 families with muscular dystrophy, contractures, and calpain 3 deficiency. Methods: We performed targeted exome sequencing on one patient presenting a deficiency in calpain 3 on Western blot but for which mutations in the gene had been excluded. The identification of a homozygous truncating mutation in the M-line part of titin prompted us to sequence this region in 2 additional patients presenting similar clinical and biochemical characteristics. Results: The 3 patients shared similar features: coexistence of limb-girdle weakness and early-onset diffuse joint contractures without cardiomyopathy. The biopsies showed rimmed vacuoles, a dystrophic pattern, and secondary reduction in calpain 3. We identified a novel homozygous mutation in the exon Mex3 of the TTN gene in the first patient. At protein level, this mutation introduces a stop codon at the level of Mex3. Interestingly, we identified truncating mutations in both alleles in the same region of the TTN gene in patients from 2 additional families. Molecular protein analyses confirm loss of the C-ter part of titin. Conclusions: Our study broadens the phenotype of titinopathies with the report of a new clinical entity with prominent contractures and no cardiac abnormality and where the recessive mutations lead to truncation of the M-line titin and secondary calpain 3 deficiency. PMID:26581302

Seroprevalence and molecular characterization of Chlamydia abortus in frozen fetal and placental tissues of aborting ewes in northeastern Algeria.

PubMed

Hireche, Sana; Ababneh, Mustafa Mohammed Kheir; Bouaziz, Omar; Boussena, Sabrina

2016-02-01

Enzootic abortion of ewes is one of the most serious health problems in sheep flocks worldwide. It has a significant economic impact because abortion, decrease in milk production and weak lambs. Besides, the bacteria is zoonotic. A cross-sectional study was conducted to determine the seroprevalence and risk factors associated with Chlamydia abortus infection in 552 ewes in Constantine using a C. abortus-specific indirect ELISA kit. Chlamydial DNA was investigated in ten ovine fetuses and eight placentas using PCR- restriction fragment length polymorphism (RFLP) and DNA sequencing. The study concluded that 7.2 % of ewes were seropositive and 33.3 % of sheep flocks had at least one seropositive ewe. Adjacent farmworker visits (OR = 7.667, 95 % CI (OR) = 2.307; 27.203) was defined as a risk factor. Deliveries of weak lambs (OR = 2.920, 95 % CI (OR) = 1.022; 8.342) and septicemia in lambs (OR = 9.971, 95 % CI (OR) = 2.383; 41.713) were significantly associated with chlamydial infection. PCR-RFLP analysis revealed positive signals to C. abortus in six fetuses and four placentas. Sequencing of the omp2 gene revealed that the Algerian strain is 96 % similar with C. abortus FAS strain. C. abortus plays a major role in abortion in northeastern Algeria. Appropriate control measures must be implemented to reduce economic losses and to avoid human contamination.

Moebius Sequence and Autism Spectrum Disorders--Less Frequently Associated than Formerly Thought

ERIC Educational Resources Information Center

Briegel, Wolfgang; Schimek, Martina; Kamp-Becker, Inge

2010-01-01

Moebius sequence is a rare congenital disorder usually defined as a combination of facial weakness with impairment of ocular abduction. It is questionable, whether there is a strong association of the sequence with autism spectrum disorders (ASDs) as suggested in some earlier case reports and studies. Twenty-two participants with Moebius sequence…

Identification of differentially methylated sites with weak methylation effect

USDA-ARS?s Scientific Manuscript database

DNA methylation is an epigenetic alteration crucial for regulating stress responses. Identifying large-scale DNA methylation at single nucleotide resolution is made possible by whole genome bisulfite sequencing. An essential task following the generation of bisulfite sequencing data is to detect dif...

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

CaMV-35S promoter sequence-specific DNA methylation in lettuce.

PubMed

Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

2016-01-01

We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

Analysis of eight out genes in a cluster required for pectic enzyme secretion by Erwinia chrysanthemi: sequence comparison with secretion genes from other gram-negative bacteria.

PubMed Central

Lindeberg, M; Collmer, A

1992-01-01

Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461

Genomewide Analysis of the Antimicrobial Peptides in Python bivittatus and Characterization of Cathelicidins with Potent Antimicrobial Activity and Low Cytotoxicity.

PubMed

Kim, Dayeong; Soundrarajan, Nagasundarapandian; Lee, Juyeon; Cho, Hye-Sun; Choi, Minkyeung; Cha, Se-Yeoun; Ahn, Byeongyong; Jeon, Hyoim; Le, Minh Thong; Song, Hyuk; Kim, Jin-Hoi; Park, Chankyu

2017-09-01

In this study, we sought to identify novel antimicrobial peptides (AMPs) in Python bivittatus through bioinformatic analyses of publicly available genome information and experimental validation. In our analysis of the python genome, we identified 29 AMP-related candidate sequences. Of these, we selected five cathelicidin-like sequences and subjected them to further in silico analyses. The results showed that these sequences likely have antimicrobial activity. The sequences were named Pb-CATH1 to Pb-CATH5 according to their sequence similarity to previously reported snake cathelicidins. We predicted their molecular structure and then chemically synthesized the mature peptide for three putative cathelicidins and subjected them to biological activity tests. Interestingly, all three peptides showed potent antimicrobial effects against Gram-negative bacteria but very weak activity against Gram-positive bacteria. Remarkably, ΔPb-CATH4 showed potent activity against antibiotic-resistant clinical isolates and also was observed to possess very low hemolytic activity and cytotoxicity. ΔPb-CATH4 also showed considerable serum stability. Electron microscopic analysis indicated that ΔPb-CATH4 exerts its effects via toroidal pore preformation. Structural comparison of the cathelicidins identified in this study to previously reported ones revealed that these Pb-CATHs are representatives of a new group of reptilian cathelicidins lacking the acidic connecting domain. Furthermore, Pb-CATH4 possesses a completely different mature peptide sequence from those of previously described reptilian cathelicidins. These new AMPs may be candidates for the development of alternatives to or complements of antibiotics to control multidrug-resistant pathogens. Copyright © 2017 American Society for Microbiology.

Genomewide Analysis of the Antimicrobial Peptides in Python bivittatus and Characterization of Cathelicidins with Potent Antimicrobial Activity and Low Cytotoxicity

PubMed Central

Kim, Dayeong; Soundrarajan, Nagasundarapandian; Lee, Juyeon; Cho, Hye-sun; Choi, Minkyeung; Cha, Se-Yeoun; Ahn, Byeongyong; Jeon, Hyoim; Le, Minh Thong; Song, Hyuk; Kim, Jin-Hoi

2017-01-01

ABSTRACT In this study, we sought to identify novel antimicrobial peptides (AMPs) in Python bivittatus through bioinformatic analyses of publicly available genome information and experimental validation. In our analysis of the python genome, we identified 29 AMP-related candidate sequences. Of these, we selected five cathelicidin-like sequences and subjected them to further in silico analyses. The results showed that these sequences likely have antimicrobial activity. The sequences were named Pb-CATH1 to Pb-CATH5 according to their sequence similarity to previously reported snake cathelicidins. We predicted their molecular structure and then chemically synthesized the mature peptide for three putative cathelicidins and subjected them to biological activity tests. Interestingly, all three peptides showed potent antimicrobial effects against Gram-negative bacteria but very weak activity against Gram-positive bacteria. Remarkably, ΔPb-CATH4 showed potent activity against antibiotic-resistant clinical isolates and also was observed to possess very low hemolytic activity and cytotoxicity. ΔPb-CATH4 also showed considerable serum stability. Electron microscopic analysis indicated that ΔPb-CATH4 exerts its effects via toroidal pore preformation. Structural comparison of the cathelicidins identified in this study to previously reported ones revealed that these Pb-CATHs are representatives of a new group of reptilian cathelicidins lacking the acidic connecting domain. Furthermore, Pb-CATH4 possesses a completely different mature peptide sequence from those of previously described reptilian cathelicidins. These new AMPs may be candidates for the development of alternatives to or complements of antibiotics to control multidrug-resistant pathogens. PMID:28630199

Compassion, pride, and social intuitions of self-other similarity.

PubMed

Oveis, Christopher; Horberg, E J; Keltner, Dacher

2010-04-01

Compassion and pride serve contrasting social functions: Compassion motivates care-taking behavior, whereas pride enables the signaling and negotiation of rank within social hierarchies. Across 3 studies, compassion was associated with increased perceived self-other similarity, particularly to weak or vulnerable others. In contrast, pride was associated with an enhanced sense of similarity to strong others, and a decreased sense of similarity to weak others. These findings were obtained using trait measures (Study 1) and experimental inductions (Studies 2 and 3) of compassion and pride, examining the sense of similarity to strong or weak groups (Studies 1 and 2) and unfamiliar individuals (Study 3). The influences of compassion and pride on perceived self-other similarity could not be accounted for by positive mood, nor was this effect constrained by the ingroup status of the target group or individual. Discussion focuses on the contributions these findings make to an understanding of compassion and pride.

The effects of family, dentition, and dental caries on the salivary microbiome.

PubMed

Foxman, Betsy; Luo, Ting; Srinivasan, Usha; Ramadugu, Kirtana; Wen, Ai; Goldberg, Deborah; Shedden, Kerby; Crout, Richard; McNeil, Daniel W; Weyant, Robert; Marazita, Mary L

2016-05-01

Family members share genes, environment, and microbial communities. If there is a strong effect of family on the salivary microbiota, controlling for family will enhance identification of microbial communities associated with cariogenesis. The present study was designed to assess the similarity of the salivary microbiome among families and the association between the salivary microbiome and dental decay taking age into account. We selected families (n = 49) participating in the cohort study of oral health conducted by the Center for Oral Health Research in Appalachia. All families where at least two children and at least one parent gave a saliva sample (n = 173) were included. Saliva samples were collected at least 1 hour after eating or drinking. After DNA extraction, the V6 region of the 16s rRNA gene was sequenced. Paired ends were joined using fast length adjustment of short reads, sequences were demultiplexed and filtered using Quantitative Insights Into Microbial Ecology 1.9.0, and taxonomy was assigned using the Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) classifier and sequences aligned with the CORE database using PyNAST. The salivary microbiome changed with age and was more similar within families than between families. There was no difference in the diversity of the salivary microbiome by dental decay. After taking into account age and family, signals of dental decay were weak in the saliva, whether examined at the phyla, genus, or operational taxonomic level. The salivary microbiome does not appear to be a good indicator of dental caries. Copyright © 2016 Elsevier Inc. All rights reserved.

Gaseous Viscous Peeling of Linearly Elastic Substrates

NASA Astrophysics Data System (ADS)

Elbaz, Shai; Jacob, Hila; Gat, Amir

2017-11-01

We study pressure-driven propagation of gas into a micron-scale gap between two linearly elastic substrates. Applying the lubrication approximation, the governing nonlinear evolution equation describes the interaction between elasticity and viscosity, as well as weak rarefaction and low-Mach-number compressibility, characteristic to gaseous microflows. Several physical limits allow simplification of the evolution equation and enable solution by self-similarity. During the peeling process the flow-field transitions between the different limits and the respective approximate solutions. The sequence of limits occurring during the propagation dynamics can be related to the thickness of the prewetting layer of the configuration at rest, yielding an approximate description of the entire peeling dynamics. The results are validated by numerical solutions of the evolution equation. Israel Science Foundation 818/13.

The zero age main sequence of WIMP burners

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fairbairn, Malcolm; Scott, Pat; Edsjoe, Joakim

2008-02-15

We modify a stellar structure code to estimate the effect upon the main sequence of the accretion of weakly-interacting dark matter onto stars and its subsequent annihilation. The effect upon the stars depends upon whether the energy generation rate from dark matter annihilation is large enough to shut off the nuclear burning in the star. Main sequence weakly-interacting massive particles (WIMP) burners look much like proto-stars moving on the Hayashi track, although they are in principle completely stable. We make some brief comments about where such stars could be found, how they might be observed and more detailed simulations whichmore » are currently in progress. Finally we comment on whether or not it is possible to link the paradoxically hot, young stars found at the galactic center with WIMP burners.« less

Complete Chloroplast Genome Sequences of Important Oilseed Crop Sesamum indicum L

PubMed Central

Yi, Dong-Keun; Kim, Ki-Joong

2012-01-01

Sesamum indicum is an important crop plant species for yielding oil. The complete chloroplast (cp) genome of S. indicum (GenBank acc no. JN637766) is 153,324 bp in length, and has a pair of inverted repeat (IR) regions consisting of 25,141 bp each. The lengths of the large single copy (LSC) and the small single copy (SSC) regions are 85,170 bp and 17,872 bp, respectively. Comparative cp DNA sequence analyses of S. indicum with other cp genomes reveal that the genome structure, gene order, gene and intron contents, AT contents, codon usage, and transcription units are similar to the typical angiosperm cp genomes. Nucleotide diversity of the IR region between Sesamum and three other cp genomes is much lower than that of the LSC and SSC regions in both the coding region and noncoding region. As a summary, the regional constraints strongly affect the sequence evolution of the cp genomes, while the functional constraints weakly affect the sequence evolution of cp genomes. Five short inversions associated with short palindromic sequences that form step-loop structures were observed in the chloroplast genome of S. indicum. Twenty-eight different simple sequence repeat loci have been detected in the chloroplast genome of S. indicum. Almost all of the SSR loci were composed of A or T, so this may also contribute to the A-T richness of the cp genome of S. indicum. Seven large repeated loci in the chloroplast genome of S. indicum were also identified and these loci are useful to developing S. indicum-specific cp genome vectors. The complete cp DNA sequences of S. indicum reported in this paper are prerequisite to modifying this important oilseed crop by cp genetic engineering techniques. PMID:22606240

Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

PubMed

Soares, René Arderius; Passaglia, Luciane Maria Pereira

2010-10-01

Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

Despite sequence homologies to gluten, salivary proline-rich proteins do not elicit immune responses central to the pathogenesis of celiac disease.

PubMed

Tian, Na; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Marietta, Eric V; Murray, Joseph A; Schuppan, Detlef; Helmerhorst, Eva J

2015-12-01

Celiac disease (CD) is an inflammatory disorder triggered by ingested gluten, causing immune-mediated damage to the small-intestinal mucosa. Gluten proteins are strikingly similar in amino acid composition and sequence to proline-rich proteins (PRPs) in human saliva. On the basis of this feature and their shared destination in the gastrointestinal tract, we hypothesized that salivary PRPs may modulate gluten-mediated immune responses in CD. Parotid salivary secretions were collected from CD patients, refractory CD patients, non-CD patients with functional gastrointestinal complaints, and healthy controls. Structural similarities of PRPs with gluten were probed with anti-gliadin antibodies. Immune responses to PRPs were investigated toward CD patient-derived peripheral blood mononuclear cells and in a humanized transgenic HLA-DQ2/DQ8 mouse model for CD. Anti-gliadin antibodies weakly cross-reacted with the abundant salivary amylase but not with PRPs. Likewise, the R5 antibody, recognizing potential antigenic gluten epitopes, showed negligible reactivity to salivary proteins from all groups. Inflammatory responses in peripheral blood mononuclear cells were provoked by gliadins whereas responses to PRPs were similar to control levels, and PRPs did not compete with gliadins in immune stimulation. In vivo, PRP peptides were well tolerated and nonimmunogenic in the transgenic HLA-DQ2/DQ8 mouse model. Collectively, although structurally similar to dietary gluten, salivary PRPs were nonimmunogenic in CD patients and in a transgenic HLA-DQ2/DQ8 mouse model for CD. It is possible that salivary PRPs play a role in tolerance induction to gluten early in life. Deciphering the structural basis for the lack of immunogenicity of salivary PRPs may further our understanding of the toxicity of gluten. Copyright © 2015 the American Physiological Society.

Whole-genome sequencing in bacteriology: state of the art

PubMed Central

Dark, Michael J

2013-01-01

Over the last ten years, genome sequencing capabilities have expanded exponentially. There have been tremendous advances in sequencing technology, DNA sample preparation, genome assembly, and data analysis. This has led to advances in a number of facets of bacterial genomics, including metagenomics, clinical medicine, bacterial archaeology, and bacterial evolution. This review examines the strengths and weaknesses of techniques in bacterial genome sequencing, upcoming technologies, and assembly techniques, as well as highlighting recent studies that highlight new applications for bacterial genomics. PMID:24143115

Synthetic oligonucleotide separations by mixed-mode reversed-phase/weak anion-exchange liquid chromatography.

PubMed

Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael

2014-08-08

Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.

Ionic selectivity of native ATP-activated (P2X) receptor channels in dissociated neurones from rat parasympathetic ganglia

PubMed Central

Liu, Dong-Mei; Adams, David J

2001-01-01

The relative permeability of the native P2X receptor channel to monovalent and divalent inorganic and organic cations was determined from reversal potential measurements of ATP-evoked currents in parasympathetic neurones dissociated from rat submandibular ganglia using the dialysed whole-cell patch clamp technique. The P2X receptor-channel exhibited weak selectivity among the alkali metals with a selectivity sequence of Na+ > Li+ > Cs+ > Rb+ > K+, and permeability ratios relative to Cs+ (PX/PCs) ranging from 1.11 to 0.86. The selectivity for the divalent alkaline earth cations was also weak with the sequence Ca2+ > Sr2+ > Ba2+ > Mn2+ > Mg2+. ATP-evoked currents were strongly inhibited when the extracellular divalent cation concentration was increased. The calculated permeability ratios of different ammonium cations are higher than those of the alkali metal cations. The permeability sequence obtained for the saturated organic cations is inversely correlated with the size of the cation. The unsaturated organic cations have a higher permeability than that predicted by molecular size. Acidification to pH 6.2 increased the ATP-induced current amplitude twofold, whereas alkalization to 8.2 and 9.2 markedly reduced current amplitude. Cell dialysis with either anti-P2X2 and/or anti-P2X4 but not anti-P2X1 antibodies attenuated the ATP-evoked current amplitude. Taken together, these data are consistent with homomeric and/or heteromeric P2X2 and P2X4 receptor subtypes expressed in rat submandibular neurones. The permeability ratios for the series of monovalent organic cations, with the exception of unsaturated cations, were approximately related to the ionic size. The relative permeabilities of the monovalent inoganic and organic cations tested are similar to those reported previously for cloned rat P2X2 receptors expressed in mammalian cells. PMID:11454961

Overproduction, purification, and ATPase activity of the Escherichia coli RuvB protein involved in DNA repair.

PubMed Central

Iwasaki, H; Shiba, T; Makino, K; Nakata, A; Shinagawa, H

1989-01-01

The ruvA and ruvB genes of Escherichia coli constitute an operon which belongs to the SOS regulon. Genetic evidence suggests that the products of the ruv operon are involved in DNA repair and recombination. To begin biochemical characterization of these proteins, we developed a plasmid system that overproduced RuvB protein to 20% of total cell protein. Starting from the overproducing system, we purified RuvB protein. The purified RuvB protein behaved like a monomer in gel filtration chromatography and had an apparent relative molecular mass of 38 kilodaltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which agrees with the value predicted from the DNA sequence. The amino acid sequence of the amino-terminal region of the purified protein was analyzed, and the sequence agreed with the one deduced from the DNA sequence. Since the deduced sequence of RuvB protein contained the consensus sequence for ATP-binding proteins, we examined the ATP-binding and ATPase activities of the purified RuvB protein. RuvB protein had a stronger affinity to ADP than to ATP and weak ATPase activity. The results suggest that the weak ATPase activity of RuvB protein is at least partly due to end product inhibition by ADP. Images PMID:2529252

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

PubMed

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-02-11

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

PubMed Central

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-01-01

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

Characterization by Deep Sequencing of Prunus virus T, a Novel Tepovirus Infecting Prunus Species.

PubMed

Marais, Armelle; Faure, Chantal; Mustafayev, Eldar; Barone, Maria; Alioto, Daniela; Candresse, Thierry

2015-01-01

Double-stranded RNAs purified from a cherry tree collected in Italy and a plum tree collected in Azerbaijan were submitted to deep sequencing. Contigs showing weak but significant identity with various members of the family Betaflexiviridae were reconstructed. Sequence comparisons led to the conclusion that the viral isolates identified in the analyzed Prunus plants belong to the same viral species. Their genome organization is similar to that of some members of the family Betaflexiviridae, with three overlapping open reading frames (RNA polymerase, movement protein, and capsid protein). Phylogenetic analyses of the deduced encoded proteins showed a clustering with the sole member of the genus Tepovirus, Potato virus T (PVT). Given these results, the name Prunus virus T (PrVT) is proposed for the new virus. It should be considered as a new member of the genus Tepovirus, even if the level of nucleotide identity with PVT is borderline with the genus demarcation criteria for the family Betaflexiviridae. A reverse-transcription polymerase chain reaction detection assay was developed and allowed the identification of two other PrVT isolates and an estimate of 1% prevalence in the large Prunus collection screened. Due to the mixed infection status of all hosts identified to date, it was not possible to correlate the presence of PrVT with specific symptoms.

Binding Site Turnover Produces Pervasive Quantitative Changes in Transcription Factor Binding between Closely Related Drosophila Species

PubMed Central

Trapnell, Cole; Davidson, Stuart; Pachter, Lior; Chu, Hou Cheng; Tonkin, Leath A.; Biggin, Mark D.; Eisen, Michael B.

2010-01-01

Changes in gene expression play an important role in evolution, yet the molecular mechanisms underlying regulatory evolution are poorly understood. Here we compare genome-wide binding of the six transcription factors that initiate segmentation along the anterior-posterior axis in embryos of two closely related species: Drosophila melanogaster and Drosophila yakuba. Where we observe binding by a factor in one species, we almost always observe binding by that factor to the orthologous sequence in the other species. Levels of binding, however, vary considerably. The magnitude and direction of the interspecies differences in binding levels of all six factors are strongly correlated, suggesting a role for chromatin or other factor-independent forces in mediating the divergence of transcription factor binding. Nonetheless, factor-specific quantitative variation in binding is common, and we show that it is driven to a large extent by the gain and loss of cognate recognition sequences for the given factor. We find only a weak correlation between binding variation and regulatory function. These data provide the first genome-wide picture of how modest levels of sequence divergence between highly morphologically similar species affect a system of coordinately acting transcription factors during animal development, and highlight the dominant role of quantitative variation in transcription factor binding over short evolutionary distances. PMID:20351773

Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.

PubMed Central

Trapani, J A; Klein, J L; White, P C; Dupont, B

1988-01-01

A cDNA clone encoding a human serine esterase gene was isolated from a library constructed from poly(A)+ RNA of allogeneically stimulated, interleukin 2-expanded peripheral blood mononuclear cells. The clone, designated HSE26.1, represents a full-length copy of a 0.9-kilobase mRNA present in human cytotoxic cells but absent from a wide variety of noncytotoxic cell lines. Clone HSE26.1 contains an 892-base-pair sequence, including a single 741-base-pair open reading frame encoding a putative 247-residue polypeptide. The first 20 amino acids of the polypeptide form a leader sequence. The mature protein is predicted to have an unglycosylated Mr of approximately equal to 26,000 and contains a single potential site for N-linked glycosylation. The nucleotide and predicted amino acid sequences of clone HSE26.1 are homologous with all murine and human serine esterases cloned thus far but are most similar to mouse granzyme B (70% nucleotide and 68% amino acid identity). HSE26.1 protein is expressed weakly in unstimulated peripheral blood mononuclear cells but is strongly induced within 6-hr incubation in medium containing phytohemagglutinin. The data suggest that the protein encoded by HSE26.1 plays a role in cell-mediated cytotoxicity. Images PMID:3261871

Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification.

PubMed

Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

2015-05-01

Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification

PubMed Central

Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

2015-01-01

Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913

Hidden Markov models and other machine learning approaches in computational molecular biology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baldi, P.

1995-12-31

This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. Computational tools are increasingly needed to process the massive amounts of data, to organize and classify sequences, to detect weak similarities, to separate coding from non-coding regions, and reconstruct the underlying evolutionary history. The fundamental problem in machine learning is the same as in scientific reasoning in general, as well as statistical modeling: to come up with a good model for the data. In thismore » tutorial four classes of models are reviewed. They are: Hidden Markov models; artificial Neural Networks; Belief Networks; and Stochastic Grammars. When dealing with DNA and protein primary sequences, Hidden Markov models are one of the most flexible and powerful alignments and data base searches. In this tutorial, attention is focused on the theory of Hidden Markov Models, and how to apply them to problems in molecular biology.« less

Gene end-like sequences within the 3' non-coding region of the Nipah virus genome attenuate viral gene transcription.

PubMed

Sugai, Akihiro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

2017-08-01

The regulation of transcription during Nipah virus (NiV) replication is poorly understood. Using a bicistronic minigenome system, we investigated the involvement of non-coding regions (NCRs) in the transcriptional re-initiation efficiency of NiV RNA polymerase. Reporter assays revealed that attenuation of NiV gene expression was not constant at each gene junction, and that the attenuating property was controlled by the 3' NCR. However, this regulation was independent of the gene-end, gene-start and intergenic regions. Northern blot analysis indicated that regulation of viral gene expression by the phosphoprotein (P) and large protein (L) 3' NCRs occurred at the transcription level. We identified uridine-rich tracts within the L 3' NCR that are similar to gene-end signals. These gene-end-like sequences were recognized as weak transcription termination signals by the viral RNA polymerase, thereby reducing downstream gene transcription. Thus, we suggest that NiV has a unique mechanism of transcriptional regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Episodic weakness due to mitochondrial DNA MT-ATP6/8 mutations.

PubMed

Auré, Karine; Dubourg, Odile; Jardel, Claude; Clarysse, Lucie; Sternberg, Damien; Fournier, Emmanuel; Laforêt, Pascal; Streichenberger, Nathalie; Petiot, Philippe; Gervais-Bernard, Hélène; Vial, Christophe; Bedat-Millet, Anne-Laure; Drouin-Garraud, Valérie; Bouillaud, Frédéric; Vandier, Christophe; Fontaine, Bertrand; Lombès, Anne

2013-11-19

To report that homoplasmic deleterious mutations in the mitochondrial DNA MT-ATP6/8 genes may be responsible for acute episodes of limb weakness mimicking periodic paralysis due to channelopathies and dramatically responding to acetazolamide. Mitochondrial DNA sequencing and restriction PCR, oxidative phosphorylation functional assays, reactive oxygen species metabolism, and patch-clamp technique in cultured skin fibroblasts. Occurrence of a typical MELAS (mitochondrial encephalopathy with lactic acidosis and stroke-like episodes) syndrome in a single member of a large pedigree with episodic weakness associated with a later-onset distal motor neuropathy led to the disclosure of 2 deleterious mitochondrial DNA mutations. The MT-ATP6 m.9185T>C p.Leu220Pro mutation, previously associated with Leigh syndrome, was present in all family members, while the MT-TL1 m.3271T>C mutation, a known cause of MELAS syndrome, was observed in the sole patient with MELAS presentation. Significant defect of complexes V and I as well as oxidative stress were observed in both primary fibroblasts and cybrid cells with 100% m.9185T>C mutation. Permanent plasma membrane depolarization and altered permeability to K(+) in fibroblasts provided a link with the paralysis episodes. Screening of 9 patients, based on their clinical phenotype, identified 4 patients with similar deleterious MT-ATP6 mutations (twice m.9185T>C and once m.9176T>C or m.8893T>C). A fifth patient presented with an original potentially deleterious MT-ATP8 mutation (m.8403T>C). All mutations were associated with almost-normal complex V activity but significant oxidative stress and permanent plasma membrane depolarization. Homoplasmic mutations in the MT-ATP6/8 genes may cause episodic weakness responding to acetazolamide treatment.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Manisha; Jamieson, Cara; Lui, Christina

β-catenin is a key mediator of Wnt signaling and its deregulated nuclear accumulation can drive cancer progression. While the central armadillo (Arm) repeats of β-catenin stimulate nuclear entry, the N- and C-terminal “tail” sequences are thought to regulate turnover and transactivation. We show here that the N- and C-tails are also potent transport sequences. The unstructured tails of β-catenin, when individually fused to a GFP-reporter, could enter and exit the nucleus rapidly in live cells. Proximity ligation assays and pull-down assays identified a weak interaction between the tail sequences and the FG-repeats of nucleoporins, consistent with a possible direct translocationmore » of β-catenin through the nuclear pore complex. Extensive alanine mutagenesis of the tail sequences revealed that nuclear translocation of β-catenin was dependent on specific uniformly distributed patches of hydrophobic residues, whereas the mutagenesis of acidic amino acids had no effect. Moreover, the mutation of hydrophobic patches within the N-tail and C-tail of full length β-catenin reduced nuclear transport rate and diminished its ability to activate transcription. We propose that the tail sequences can contribute to β-catenin transport and suggest a possible similar role for hydrophobic unstructured regions in other proteins. - Highlights: • We show that the N- and C-tails of beta-catenin possess nuclear transport activity. • Nuclear transport of the N- or C-tails requires specific hydrophobic amino acids. • Mutagenesis of the N-terminus diminished nuclear entry of full-length beta-catenin. • We propose the N-tail contributes to beta-catenin nuclear entry and transactivation.« less

Geochemical study of the Umkondo dolerites and lavas in the Chimanimani and Chipinge Districts (eastern Zimbabwe) and their regional implications

NASA Astrophysics Data System (ADS)

Munyanyiwa, Hubert

1999-02-01

The Umkondo Group is a supracrustal sequence cropping out in eastern Zimbabwe in the Nyanga, Chimanimani and Chipinge Districts. In these areas the sequence has been divided into a weakly metamorphosed and deformed unit of argillaceous, arenaceous and carbonate rocks (Zimbabwe facies) in the west, and a strongly deformed and medium- to high-grade metamorphosed sequence of mainly quartzites and metapelites (Mozambique facies) in the east. The two sequences were tectonically juxtaposed during the Neoproterozoic Pan-African Mozambique Belt deformation. The Zimbabwe facies sedimentary rocks are intruded by extensive dolerite sills and minor interlayered basalts flows. The mafic rocks are sub-alkaline continental tholeiites. They have low mg numbers associated with low Cr, Cu, Ni and Co, which indicate that the parental magma underwent some differentiation processes en route to the surface. They are LREE enriched with ( {La}/{Yb}N = 5.0-7.6 , high Ce/Yb (>10) and {La}/{Nb} (>0.5) values, and exhibit troughs at Nb, Sr, Ti and P on a MORB-normalised, multi-element spider diagram. These chemical characteristics, together with the large areal extent of the Umkondo dolerites and basalts, suggest that the Umkondo mafic igneous suite was once widespread and formed part of a continental flood basalt province. This is supported by the depositional environment (shallow water platform type setting) of the sedimentary sequence into which the mafic rocks were emplaced. The widespread occurrence of the Umkondo igneous event is further supported by the similarity in palæomagnetic poles of a number of mafic units in southern Africa.

Bosons with Synthetic Rashba Spin-Orbit Coupling at Finite Power

NASA Astrophysics Data System (ADS)

Anderson, Brandon; Clark, Charles

2013-05-01

Isotropic spin-orbit couplings, such as Rashba in two dimensions, have a continuous symmetry that produces a large degeneracy in the momentum-space dispersion. This degeneracy leads to an enhanced density-of-states, producing novel phases in systems of bosonic atoms. This model is idealistic, however, in that the symmetry of the lasers will weakly break the continuous symmetry to a discrete one in experimental manifestations. This perturbation typically scales inversely with the optical power, and only at infinite power will ideal symmetry be restored. In this talk, we consider the effects of this weak symmetry breaking in a system of bosons at finite power with synthetic Rashba coupling. We solve the mean-field equations and find new phases, such as a stripe phase with a larger symmetry group. We then consider the experimentally relevant scheme where the spin-orbit fields are turned on adiabatically from an initial spin-polarized state. At intermediate power, stripe phases are found, while at sufficiently high power it appears that the system quenches to phases similar to that of the ideal limit. Techniques for optimizing the adiabatic ramping sequence are discussed. NSF PFC Grant PHY-0822671 and by the ARO under the DARPA OLE program.

An Inquiry-Based Quantitative Reasoning Course for Business Students

ERIC Educational Resources Information Center

Piercey, Victor; Militzer, Erin

2017-01-01

Quantitative Reasoning for Business is a two-semester sequence that serves as an alternative to elementary and intermediate algebra for first-year business students with weak mathematical preparation. Students who take the sequence have been retained at a higher rate and demonstrated a larger reduction in math anxiety than those who take the…

A Characterization of Banach Spaces Containing l1

PubMed Central

Rosenthal, Haskell P.

1974-01-01

It is proved that a Banach space contains a subspace isomorphic to l1 if (and only if) it has a bounded sequence with no weak-Cauchy subsequence. The proof yields that a sequence of subsets of a given set has a subsequence that is either convergent or Boolean independent. PMID:16592162

New dye-labeled terminators for improved DNA sequencing patterns.

PubMed Central

Rosenblum, B B; Lee, L G; Spurgeon, S L; Khan, S H; Menchen, S M; Heiner, C R; Chen, S M

1997-01-01

We have used two new dye sets for automated dye-labeled terminator DNA sequencing. One set consists of four, 4,7-dichlororhodamine dyes (d-rhodamines). The second set consists of energy-transfer dyes that use the 5-carboxy-d-rhodamine dyes as acceptor dyes and the 5- or 6-carboxy isomers of 4'-aminomethylfluorescein as the donor dye. Both dye sets utilize a new linker between the dye and the nucleotide, and both provide more even peak heights in terminator sequencing than the dye-terminators consisting of unsubstituted rhodamine dyes. The unsubstituted rhodamine terminators produced electropherograms in which weak G peaks are observed after A peaks and occasionally C peaks. The number of weak G peaks has been reduced or eliminated with the new dye terminators. The general improvement in peak evenness improves accuracy for the automated base-calling software. The improved signal-to-noise ratio of the energy-transfer dye-labeled terminators combined with more even peak heights results in successful sequencing of high molecular weight DNA templates such as bacterial artificial chromosome DNA. PMID:9358158

Quantum-state transfer through long-range correlated disordered channels

NASA Astrophysics Data System (ADS)

Almeida, Guilherme M. A.; de Moura, Francisco A. B. F.; Lyra, Marcelo L.

2018-05-01

We study quantum-state transfer in XX spin-1/2 chains where both communicating spins are weakly coupled to a channel featuring disordered on-site magnetic fields. Fluctuations are modeled by long-range correlated sequences with self-similar profile obeying a power-law spectrum. We show that the channel is able to perform almost perfect quantum-state transmissions even in the presence of significant amounts of disorder provided the degree of those correlations is strong enough, with the cost of having long transfer times and unavoidable timing errors. Still, we show that the lack of mirror symmetry in the channel does not affect much the likelihood of having high-quality outcomes. Our results suggest that coexistence between localized and delocalized states can diminish effects of static perturbations in solid-state devices for quantum communication.

Processes and subdivisions in diogenites, a multivariate statistical analysis

NASA Technical Reports Server (NTRS)

Harriott, T. A.; Hewins, R. H.

1984-01-01

Multivariate statistical techniques used on diogenite orthopyroxene analyses show the relationships that occur within diogenites and the two orthopyroxenite components (class I and II) in the polymict diogenite Garland. Cluster analysis shows that only Peckelsheim is similar to Garland class I (Fe-rich) and the other diogenites resemble Garland class II. The unique diogenite Y 75032 may be related to type I by fractionation. Factor analysis confirms the subdivision and shows that Fe does not correlate with the weakly incompatible elements across the entire pyroxene composition range, indicating that igneous fractionation is not the process controlling total diogenite composition variation. The occurrence of two groups of diogenites is interpreted as the result of sampling or mixing of two main sequences of orthopyroxene cumulates with slightly different compositions.

A generalized global alignment algorithm.

PubMed

Huang, Xiaoqiu; Chao, Kun-Mao

2003-01-22

Homologous sequences are sometimes similar over some regions but different over other regions. Homologous sequences have a much lower global similarity if the different regions are much longer than the similar regions. We present a generalized global alignment algorithm for comparing sequences with intermittent similarities, an ordered list of similar regions separated by different regions. A generalized global alignment model is defined to handle sequences with intermittent similarities. A dynamic programming algorithm is designed to compute an optimal general alignment in time proportional to the product of sequence lengths and in space proportional to the sum of sequence lengths. The algorithm is implemented as a computer program named GAP3 (Global Alignment Program Version 3). The generalized global alignment model is validated by experimental results produced with GAP3 on both DNA and protein sequences. The GAP3 program extends the ability of standard global alignment programs to recognize homologous sequences of lower similarity. The GAP3 program is freely available for academic use at http://bioinformatics.iastate.edu/aat/align/align.html.

Cell type-specific termination of transcription by transposable element sequences.

PubMed

Conley, Andrew B; Jordan, I King

2012-09-30

Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the extent to which TE sequences actually terminate transcription of human gene across the genome remains an open question. Using high-throughput sequencing data, we have characterized over 9,000 distinct TE-derived sequences that provide transcription termination sites for 5,747 human genes across eight different cell types. Rarefaction curve analysis suggests that there may be twice as many TE-derived termination sites (TE-TTS) genome-wide among all human cell types. The local chromatin environment for these TE-TTS is similar to that seen for 3' UTR canonical TTS and distinct from the chromatin environment of other intragenic TE sequences. However, those TE-TTS located within the introns of human genes were found to be far more cell type-specific than the canonical TTS. TE-TTS were much more likely to be found in the sense orientation than other intragenic TE sequences of the same TE family and TE-TTS in the sense orientation terminate transcription more efficiently than those found in the antisense orientation. Alu sequences were found to provide a large number of relatively weak TTS, whereas LTR elements provided a smaller number of much stronger TTS. TE sequences provide numerous termination sites to human genes, and TE-derived TTS are particularly cell type-specific. Thus, TE sequences provide a powerful mechanism for the diversification of transcriptional profiles between cell types and among evolutionary lineages, since most TE-TTS are evolutionarily young. The extent of transcription termination by TEs seen here, along with the preference for sense-oriented TE insertions to provide TTS, is consistent with the observed antisense orientation bias of human TEs.

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

Fine-scale genetic structure and cryptic associations reveal evidence of kin-based sociality in the African forest elephant.

PubMed

Schuttler, Stephanie G; Philbrick, Jessica A; Jeffery, Kathryn J; Eggert, Lori S

2014-01-01

Spatial patterns of relatedness within animal populations are important in the evolution of mating and social systems, and have the potential to reveal information on species that are difficult to observe in the wild. This study examines the fine-scale genetic structure and connectivity of groups within African forest elephants, Loxodonta cyclotis, which are often difficult to observe due to forest habitat. We tested the hypothesis that genetic similarity will decline with increasing geographic distance, as we expect kin to be in closer proximity, using spatial autocorrelation analyses and Tau K(r) tests. Associations between individuals were investigated through a non-invasive genetic capture-recapture approach using network models, and were predicted to be more extensive than the small groups found in observational studies, similar to fission-fusion sociality found in African savanna (Loxodonta africana) and Asian (Elephas maximus) species. Dung samples were collected in Lopé National Park, Gabon in 2008 and 2010 and genotyped at 10 microsatellite loci, genetically sexed, and sequenced at the mitochondrial DNA control region. We conducted analyses on samples collected at three different temporal scales: a day, within six-day sampling sessions, and within each year. Spatial autocorrelation and Tau K(r) tests revealed genetic structure, but results were weak and inconsistent between sampling sessions. Positive spatial autocorrelation was found in distance classes of 0-5 km, and was strongest for the single day session. Despite weak genetic structure, individuals within groups were significantly more related to each other than to individuals between groups. Social networks revealed some components to have large, extensive groups of up to 22 individuals, and most groups were composed of individuals of the same matriline. Although fine-scale population genetic structure was weak, forest elephants are typically found in groups consisting of kin and based on matrilines, with some individuals having more associates than observed from group sizes alone.

An Aryl Hydrocarbon Receptor from the Salamander Ambystoma mexicanum Exhibits Low Sensitivity to 2,3,7,8-Tetrachlorodibenzo-p-dioxin.

PubMed

Shoots, Jenny; Fraccalvieri, Domenico; Franks, Diana G; Denison, Michael S; Hahn, Mark E; Bonati, Laura; Powell, Wade H

2015-06-02

Structural features of the aryl hydrocarbon receptor (AHR) can underlie species- and population-specific differences in its affinity for 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). These differences often explain variations in TCDD toxicity. Frogs are relatively insensitive to dioxin, and Xenopus AHRs bind TCDD with low affinity. Weak TCDD binding results from the combination of three residues in the ligand-binding domain: A354 and A370, and N325. Here we sought to determine whether this mechanism of weak TCDD binding is shared by other amphibian AHRs. We isolated an AHR cDNA from the Mexican axolotl (Ambystoma mexicanum). The encoded polypeptide contains identical residues at positions that confer low TCDD affinity to X. laevis AHRs (A364, A380, and N335), and homology modeling predicts they protrude into the binding cavity. Axolotl AHR bound one-tenth the TCDD of mouse AHR in velocity sedimentation analysis, and in transactivation assays, the EC50 for TCDD was 23 nM, similar to X. laevis AHR1β (27 nM) and greater than AHR containing the mouse ligand-binding domain (0.08 nM). Sequence, modeled structure, and function indicate that axolotl AHR binds TCDD weakly, predicting that A. mexicanum lacks sensitivity toTCDD toxicity. We hypothesize that this characteristic of axolotl and Xenopus AHRs arose in a common ancestor of the Caudata and Anura.

Detecting Earthquakes over a Seismic Network using Single-Station Similarity Measures

NASA Astrophysics Data System (ADS)

Bergen, Karianne J.; Beroza, Gregory C.

2018-03-01

New blind waveform-similarity-based detection methods, such as Fingerprint and Similarity Thresholding (FAST), have shown promise for detecting weak signals in long-duration, continuous waveform data. While blind detectors are capable of identifying similar or repeating waveforms without templates, they can also be susceptible to false detections due to local correlated noise. In this work, we present a set of three new methods that allow us to extend single-station similarity-based detection over a seismic network; event-pair extraction, pairwise pseudo-association, and event resolution complete a post-processing pipeline that combines single-station similarity measures (e.g. FAST sparse similarity matrix) from each station in a network into a list of candidate events. The core technique, pairwise pseudo-association, leverages the pairwise structure of event detections in its network detection model, which allows it to identify events observed at multiple stations in the network without modeling the expected move-out. Though our approach is general, we apply it to extend FAST over a sparse seismic network. We demonstrate that our network-based extension of FAST is both sensitive and maintains a low false detection rate. As a test case, we apply our approach to two weeks of continuous waveform data from five stations during the foreshock sequence prior to the 2014 Mw 8.2 Iquique earthquake. Our method identifies nearly five times as many events as the local seismicity catalog (including 95% of the catalog events), and less than 1% of these candidate events are false detections.

Sequence-similar, structure-dissimilar protein pairs in the PDB.

PubMed

Kosloff, Mickey; Kolodny, Rachel

2008-05-01

It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).

Using a Weak CN Spectral Feature as a Marker for Massive AGB Stars in the Andromeda Galaxy

NASA Astrophysics Data System (ADS)

Guhathakurta, Puragra; Kamath, Anika; Sales, Alyssa; Sarukkai, Atmika; Hays, Jon; PHAT Collaboration; SPLASH Collaboration

2017-01-01

The Panchromatic Hubble Andromeda Treasury (PHAT) survey has produced six-filter photometry at near-ultraviolet, optical and nearly infrared wavelengths (F275W, F336W, F475W, F814W, F110W and F160W) for over 100 million stars in the disk of the of the Andromeda galaxy (M31). As part of the Spectroscopic and Photometric Landscape of Andromeda's Stellar Halo (SPLASH) survey, medium resolution (R ~ 2000) spectra covering the wavelength range 4500-9500A were obtained for over 5000 relatively bright stars from the PHAT source catalog using the Keck II 10-meter telescope and DEIMOS spectrograph. While searching for carbon stars in the spectroscopic data set, we discovered a rare population of stars that show a weak CN spectral absorption feature at ~7900A (much weaker than the CN feature in typical carbon stars) along with other spectral absorption features like TiO and the Ca triplet that are generally not present/visible in carbon star spectra but that are typical for normal stars with oxygen rich atmospheres. These 150 or so "weak CN" stars appear to be fairly localized in six-filter space (i.e., in various color-color and color-magnitude diagrams) but are generally offset from carbon stars. Comparison to PARSEC model stellar tracks indicates that these weak CN stars are probably massive (5-10 Msun) asymptotic giant branch (AGB) stars in a relatively short-lived core helium burning phase of their evolution. Careful spectroscopic analysis indicates that the details of the CN spectral feature are about 3-4x weaker in weak CN stars than in carbon stars. The kinematics of weak CN stars are similar to those of other young stars (e.g., massive main sequence stars) and reflect the well ordered rotation of M31's disk.This research project is funded in part by NASA/STScI and the National Science Foundation. Much of this work was carried out by high school students and undergraduates under the auspices of the Science Internship Program and LAMAT program at the University of California Santa Cruz.

Weak value controversy

NASA Astrophysics Data System (ADS)

Vaidman, L.

2017-10-01

Recent controversy regarding the meaning and usefulness of weak values is reviewed. It is argued that in spite of recent statistical arguments by Ferrie and Combes, experiments with anomalous weak values provide useful amplification techniques for precision measurements of small effects in many realistic situations. The statistical nature of weak values is questioned. Although measuring weak values requires an ensemble, it is argued that the weak value, similarly to an eigenvalue, is a property of a single pre- and post-selected quantum system. This article is part of the themed issue `Second quantum revolution: foundational questions'.

Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

PubMed

Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

2014-02-01

Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Polymerase ribozyme efficiency increased by G/T-rich DNA oligonucleotides

PubMed Central

Yao, Chengguo; Müller, Ulrich F.

2011-01-01

The RNA world hypothesis states that the early evolution of life went through a stage where RNA served as genome and as catalyst. The replication of RNA world organisms would have been facilitated by ribozymes that catalyze RNA polymerization. To recapitulate an RNA world in the laboratory, a series of RNA polymerase ribozymes was developed previously. However, these ribozymes have a polymerization efficiency that is too low for self-replication, and the most efficient ribozymes prefer one specific template sequence. The limiting factor for polymerization efficiency is the weak sequence-independent binding to its primer/template substrate. Most of the known polymerase ribozymes bind an RNA heptanucleotide to form the P2 duplex on the ribozyme. By modifying this heptanucleotide, we were able to significantly increase polymerization efficiency. Truncations at the 3′-terminus of this heptanucleotide increased full-length primer extension by 10-fold, on a specific template sequence. In contrast, polymerization on several different template sequences was improved dramatically by replacing the RNA heptanucleotide with DNA oligomers containing randomized sequences of 15 nt. The presence of G and T in the random sequences was sufficient for this effect, with an optimal composition of 60% G and 40% T. Our results indicate that these DNA sequences function by establishing many weak and nonspecific base-pairing interactions to the single-stranded portion of the template. Such low-specificity interactions could have had important functions in an RNA world. PMID:21622900

How weak values emerge in joint measurements on cloned quantum systems.

PubMed

Hofmann, Holger F

2012-07-13

A statistical analysis of optimal universal cloning shows that it is possible to identify an ideal (but nonpositive) copying process that faithfully maps all properties of the original Hilbert space onto two separate quantum systems, resulting in perfect correlations for all observables. The joint probabilities for noncommuting measurements on separate clones then correspond to the real parts of the complex joint probabilities observed in weak measurements on a single system, where the measurements on the two clones replace the corresponding sequence of weak measurement and postselection. The imaginary parts of weak measurement statics can be obtained by replacing the cloning process with a partial swap operation. A controlled-swap operation combines both processes, making the complete weak measurement statistics accessible as a well-defined contribution to the joint probabilities of fully resolved projective measurements on the two output systems.

Application of discrete Fourier inter-coefficient difference for assessing genetic sequence similarity.

PubMed

King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach

2014-01-01

Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.

Relations between Shannon entropy and genome order index in segmenting DNA sequences.

PubMed

Zhang, Yi

2009-04-01

Shannon entropy H and genome order index S are used in segmenting DNA sequences. Zhang [Phys. Rev. E 72, 041917 (2005)] found that the two schemes are equivalent when a DNA sequence is converted to a binary sequence of S (strong H bond) and W (weak H bond). They left the mathematical proof to mathematicians who are interested in this issue. In this paper, a possible mathematical explanation is given. Moreover, we find that Chargaff parity rule 2 is the necessary condition of the equivalence, and the equivalence disappears when a DNA sequence is regarded as a four-symbol sequence. At last, we propose that S-2(-H) may be related to species evolution.

COMOC 2: Two-dimensional aerodynamics sequence, computer program user's guide

NASA Technical Reports Server (NTRS)

Manhardt, P. D.; Orzechowski, J. A.; Baker, A. J.

1977-01-01

The COMOC finite element fluid mechanics computer program system is applicable to diverse problem classes. The two dimensional aerodynamics sequence was established for solution of the potential and/or viscous and turbulent flowfields associated with subsonic flight of elementary two dimensional isolated airfoils. The sequence is constituted of three specific flowfield options in COMOC for two dimensional flows. These include the potential flow option, the boundary layer option, and the parabolic Navier-Stokes option. By sequencing through these options, it is possible to computationally construct a weak-interaction model of the aerodynamic flowfield. This report is the user's guide to operation of COMOC for the aerodynamics sequence.

NuSTAR Discovery of a Possible Black Hole HMXB and Cygnus X-1 Progenitor

NASA Astrophysics Data System (ADS)

Grindlay, Jonathan E.; Hailey, Charles James; Zhang, Shuo; Mori, Kaya; Gomez, Sebastian; Hong, Jaesub; Tomsick, John

2017-01-01

We report on NuSTAR observations of HD96670, a single line spectroscopic binary in the Carina OB association. We selected this source as a possible BH-HMXB candidate based on its 5.53d orbital period and 0.10 Msun mass function, both similar to Cyg X-1. HD96670 is a O8.5V main sequence star, and if its secondary were a BH, and its O star evolves to a O9Ib star like that in Cyg X-1, it would be high luminosity BH-HXMB. HD96670 is detected as a soft source in RASS and in the XMM slew survey. With a 150 ksec exposure with NuSTAR, we found a best-fit power law spectrum with photon index 2.4 - 2.6 and factor of ~2 variability. The mean Lx ~ 5 x 10^32 (5 - 30 keV) is consistent with that expected for accretion from the weak wind that late-type main sequence O stars usually show for plausible assumptions for the secondary if it is a ~5Msun BH. In the poster by Gomez and Grindlay, we show the detailed photometry and spectroscopy and PHOEBE modelling which point to the secondary indeed being a 5 Msun object, either an accreting BH or possibly a B8V star for which the X-ray spectrum would be expected to not show the hard PL component. Additional X-ray observations at or near the optically determined phase of inferiour vs. superior conjunction will resolve the nature of the secondary. If it is indeed a BH, this points the way to a much larger population of low-luminosity (Weak Wind) BH-LMXBs, with longer lifetimes, than the presently explored systems which all (but one) have super-giant donors.

Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

PubMed

Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

2017-01-01

Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

Model-free aftershock forecasts constructed from similar sequences in the past

NASA Astrophysics Data System (ADS)

van der Elst, N.; Page, M. T.

2017-12-01

The basic premise behind aftershock forecasting is that sequences in the future will be similar to those in the past. Forecast models typically use empirically tuned parametric distributions to approximate past sequences, and project those distributions into the future to make a forecast. While parametric models do a good job of describing average outcomes, they are not explicitly designed to capture the full range of variability between sequences, and can suffer from over-tuning of the parameters. In particular, parametric forecasts may produce a high rate of "surprises" - sequences that land outside the forecast range. Here we present a non-parametric forecast method that cuts out the parametric "middleman" between training data and forecast. The method is based on finding past sequences that are similar to the target sequence, and evaluating their outcomes. We quantify similarity as the Poisson probability that the observed event count in a past sequence reflects the same underlying intensity as the observed event count in the target sequence. Event counts are defined in terms of differential magnitude relative to the mainshock. The forecast is then constructed from the distribution of past sequences outcomes, weighted by their similarity. We compare the similarity forecast with the Reasenberg and Jones (RJ95) method, for a set of 2807 global aftershock sequences of M≥6 mainshocks. We implement a sequence-specific RJ95 forecast using a global average prior and Bayesian updating, but do not propagate epistemic uncertainty. The RJ95 forecast is somewhat more precise than the similarity forecast: 90% of observed sequences fall within a factor of two of the median RJ95 forecast value, whereas the fraction is 85% for the similarity forecast. However, the surprise rate is much higher for the RJ95 forecast; 10% of observed sequences fall in the upper 2.5% of the (Poissonian) forecast range. The surprise rate is less than 3% for the similarity forecast. The similarity forecast may be useful to emergency managers and non-specialists when confidence or expertise in parametric forecasting may be lacking. The method makes over-tuning impossible, and minimizes the rate of surprises. At the least, this forecast constitutes a useful benchmark for more precisely tuned parametric forecasts.

Low geomagnetic field intensity in the Matuyama Chron: palaeomagnetic study of a lava sequence from Afar depression, East Africa

NASA Astrophysics Data System (ADS)

Ahn, Hyeon-Seon; Kidane, Tesfaye; Yamamoto, Yuhji; Otofuji, Yo-ichiro

2016-01-01

Palaeointensity variation is investigated for an inferred time period spanning from 2.34 to 1.96 Ma. Twenty-nine consecutive lava flows are sampled along cliffs 350 m high generated by normal faulting on the Dobi section of Afar depression, Ethiopia. Magnetostratigraphy and K-Ar measurements indicate a lava sequence of R-N-R-N geomagnetic field polarities in ascending order; the lower normal polarity is identified as the Réunion Subchron. Reliability of palaeomagnetic data is ascertained through careful thermal demagnetization and by the reversal test. The Tsunakawa-Shaw method yielded 70 successful palaeointensity results from 24 lava flows and gave 11 acceptable mean palaeointensities. Reliability in palaeointensity data is ascertained by the similar values obtained by the IZZI-Thellier method and thus 11 reliable mean values are obtained from our combined results. After the older reverse polarity with the field intensity of 19.6 ± 7.8 μT, an extremely low palaeointensity period with an average of 6.4 μT is shown to occur prior to the Réunion Subchron. During the Réunion Subchron, the dipole field strength is shown to have returned to an average of 19.5 μT, followed by second extreme low of 3.6 μT and rejuvenation with 17.1 ± 5.3 μT in the younger reverse polarity. This `W-shape' palaeointensity variation is characterized by occurrences of two extremely weak fields lower than 8 μT prior to and during the Réunion Subchron and a relatively weak time-averaged field of approximately 15 μT. This feature is also found in sedimentary cores from the Ontong Java Plateau and the north Atlantic, indicative of a possibly global geomagnetic field phenomenon rather than a local effect on Ethiopia. Furthermore, we estimate a weak virtual axial dipole moment of 3.66 (±1.85) × 1022 Am2 during early stage of the Matuyama Chron (inferred time period of 2.34-1.96 Ma).

Investigating Correlation between Protein Sequence Similarity and Semantic Similarity Using Gene Ontology Annotations.

PubMed

Ikram, Najmul; Qadir, Muhammad Abdul; Afzal, Muhammad Tanvir

2018-01-01

Sequence similarity is a commonly used measure to compare proteins. With the increasing use of ontologies, semantic (function) similarity is getting importance. The correlation between these measures has been applied in the evaluation of new semantic similarity methods, and in protein function prediction. In this research, we investigate the relationship between the two similarity methods. The results suggest absence of a strong correlation between sequence and semantic similarities. There is a large number of proteins with low sequence similarity and high semantic similarity. We observe that Pearson's correlation coefficient is not sufficient to explain the nature of this relationship. Interestingly, the term semantic similarity values above 0 and below 1 do not seem to play a role in improving the correlation. That is, the correlation coefficient depends only on the number of common GO terms in proteins under comparison, and the semantic similarity measurement method does not influence it. Semantic similarity and sequence similarity have a distinct behavior. These findings are of significant effect for future works on protein comparison, and will help understand the semantic similarity between proteins in a better way.

Genome sequence of the highly weak-acid-tolerant Zygosaccharomyces bailii IST302, amenable to genetic manipulations and physiological studies.

PubMed

Palma, Margarida; Münsterkötter, Martin; Peça, João; Güldener, Ulrich; Sá-Correia, Isabel

2017-06-01

Zygosaccharomyces bailii is one of the most problematic spoilage yeast species found in the food and beverage industry particularly in acidic products, due to its exceptional resistance to weak acid stress. This article describes the annotation of the genome sequence of Z. bailii IST302, a strain recently proven to be amenable to genetic manipulations and physiological studies. The work was based on the annotated genomes of strain ISA1307, an interspecies hybrid between Z. bailii and a closely related species, and the Z. bailii reference strain CLIB 213T. The resulting genome sequence of Z. bailii IST302 is distributed through 105 scaffolds, comprising a total of 5142 genes and a size of 10.8 Mb. Contrasting with CLIB 213T, strain IST302 does not form cell aggregates, allowing its manipulation in the laboratory for genetic and physiological studies. Comparative cell cycle analysis with the haploid and diploid Saccharomyces cerevisiae strains BY4741 and BY4743, respectively, suggests that Z. bailii IST302 is haploid. This is an additional trait that makes this strain attractive for the functional analysis of non-essential genes envisaging the elucidation of mechanisms underlying its high tolerance to weak acid food preservatives, or the investigation and exploitation of the potential of this resilient yeast species as cell factory. © FEMS 2017.

Vascular endothelial growth factor from Trimeresurus jerdonii venom specifically binds to VEGFR-2.

PubMed

Zhong, Shurong; Wu, Jianbo; Cui, Yunpeng; Li, Rui; Zhu, Shaowen; Rong, Mingqiang; Lu, Qiumin; Lai, Ren

2015-09-01

Vascular endothelial growth factors (VEGFs) play important roles in angiogenesis. In this study, a vascular endothelial growth factor named TjsvVEGF was purified from the venom of Trimeresurus jerdonii by gel filtration, affinity, ion-exchange and high-performance liquid chromatography. TjsvVEGF was a homodimer with an apparent molecular mass of 29 kDa. The cDNA encoding TjsvVEGF was obtained by PCR. The open reading frame of the cloned TjsvVEGF was composed of 432 bp coding for a signal peptide of 24 amino acid residues and a mature protein of 119 amino acid residues. Compared with other snake venom VEGFs, the nucleotide and deduced protein sequences of the cloned TjsvVEGF were conserved. TjsvVEGF showed low heparin binding activity and strong capillary permeability increasing activity. The KD of TjsvVEGF to VEFGR-2 is 413 pM. However, the binding of TjsvVEGF to VEGFR-1 is too weak to detect. Though TjsvVEGF had high sequence identities (about 90%) with Crotalinae VEGFs, the receptor preference of TjsvVEGF was similar to Viperinae VEGFs which had lower sequence identities (about 60%) with it. TjsvVEGF might serve as a useful tool for the study of structure-function relationships of VEGFs and their receptors. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3

PubMed Central

Turrini, Francesco M.; Li, Yen-Hsing; Low, Philip S.

2016-01-01

Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein–protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO4) with Kd = 14 nM; (iii) binding of cdb3-PO4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO4; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3–ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties. PMID:27856737

Lactobacillus wasatchensis sp. nov., a non-starter lactic acid bacteria isolated from aged Cheddar cheese.

PubMed

Oberg, Craig J; Oberg, Taylor S; Culumber, Michele D; Ortakci, Fatih; Broadbent, Jeffery R; McMahon, Donald J

2016-01-01

A Gram-stain positive, rod-shaped, non-spore-forming strain (WDC04T), which may be associated with late gas production in cheese, was isolated from aged Cheddar cheese following incubation on MRS agar (pH 5.2) at 6 °C for 35 days. Strain WDC04T had 97 % 16S rRNA gene sequence similarity with Lactobacillus hokkaidonensis DSM 26202T, Lactobacillus oligofermentans 533, 'Lactobacillus danicus' 9M3, Lactobacillus suebicus CCUG 32233T and Lactobacillus vaccinostercus DSM 20634T. API 50 CH carbohydrate fermentation panels indicated strain WDC04T could only utilize one of the 50 substrates tested, ribose, although it does slowly utilize galactose. In the API ZYM system, strain WDC04T was positive for leucine arylamidase, valine arylamidase, cysteine arylamidase (weakly), naphthol-AS-BI-phosphohydrolase and β-galactosidase activities. Total genomic DNA was sequenced from strain WDC04T using a whole-genome shotgun strategy on a 454 GS Titanium pyrosequencer. The sequence was assembled into a 1.90 Mbp draft genome consisting of 105 contigs with preliminary genome annotation performed using the RAST algorithm (rast.nmpdr.org). Genome analysis confirmed the pentose phosphate pathway for ribose metabolism as well as galactose, N-acetylglucosamine, and glycerol fermentation pathways. Genomic analysis places strain WDC04T in the obligately heterofermentative group of lactobacilli and metabolic results confirm this conclusion. The result of genome sequencing, along with 16S rRNA gene sequence analysis, indicates WDC04T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus wasatchensis sp. nov. is proposed. The type strain is WDC04T ( = DSM 29958T = LMG 28678T).

Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

PubMed

Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

2016-11-29

Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

Method and apparatus for biological sequence comparison

DOEpatents

Marr, T.G.; Chang, W.I.

1997-12-23

A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

Method and apparatus for biological sequence comparison

DOEpatents

Marr, Thomas G.; Chang, William I-Wei

1997-01-01

A method and apparatus for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence.

Persistence of collective behavior at high spin in the N = 88 nucleus Tb 153

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hartley, D. J.; Riley, M. A.; Wang, X.

Excited states in the N = 88 nucleus Tb-153 were observed up to spin similar to 40 in an experiment utilizing the Gammasphere array. The Tb-153 states were populated in a weak alpha 4n evaporation channel of the Cl-37 + Sn-124 reaction. Two previously known sequences were extended to higher spins, and a new decoupled structure was identified. The pi h(11/2) band was observed in the spin region where other N = 88 isotopes exhibit effects of prolate to oblate shape changes leading to band termination along the yrast line, whereas Tb-153 displays a persistent collective behavior. However, minor perturbationsmore » of the very highest state in both signatures of this h(11/2) band are observed, which perhaps signal the start of the transition towards band termination.« less

Görtler instability of the axisymmetric boundary layer along a cone

NASA Astrophysics Data System (ADS)

ITOH, Nobutake

2014-10-01

Exact partial differential equations are derived to describe Görtler instability, caused by a weakly concave wall, of axisymmetric boundary layers with similar velocity profiles that are decomposed into a sequence of ordinary differential systems on the assumption that the solution can be expanded into inverse powers of local Reynolds number. The leading terms of the series solution are determined by solving a non-parallel version of Görtler’s eigenvalue problem and lead to a neutral stability curve and finite values of critical Görtler number and wave number for stationary and longitudinal vortices. Higher-order terms of the series solution indicate Reynolds-number dependence of Görtler instability and a limited validity of Görtler’s approximation based on the leading terms only. The present formulation is simply applicable to two-dimensional boundary layers of similar profiles, and critical Görtler number and wave number of the Blasius boundary layer on a flat plate are given by G2c = 1.23 and β2c = 0.288, respectively, if the momentum thickness is chosen as the reference length.

Hydroxamic acids as weak base indicators: protonation in strong acid media.

PubMed

García, B; Ibeas, S; Hoyuelos, F J; Leal, J M; Secco, F; Venturini, M

2001-11-30

The protonation equilibria of N-phenylbenzohydroxamic, benzohydroxamic, salicylhydroxamic, and N-p-tolylcinnamohydroxamic acids have been studied at 25 degrees C in concentrated sulfuric, hydrochloric, and perchloric acid media; the UV-vis spectral measurements were analyzed using the Hammett equation and the Bunnett-Olsen and excess acidity methods. The medium effects observed in the UV spectral curves were corrected with the Cox-Yates and vector analysis methods. The H(A) acidity function based on benzamides provided the best results. The range of variation of the solvation coefficient m is similar to that of amides, this indicating similar solvation requirements for amides and hydroxamic acids. For the same substrate, the observed variations of pK(BH)(+) with the mineral acid used was justified by formation of solvent-separated ion pairs; for the same mineral acid, the observed changes in pK(BH)(+) can be explained by the solvation of BH(+). The change of the pK(BH)(+) values was in reasonably good agreement with the sequence of the catalytic efficiency of the mineral acids used, HCl > H(2)SO(4) > HClO(4).

Sequence information signal processor

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1999-01-01

An electronic circuit is used to compare two sequences, such as genetic sequences, to determine which alignment of the sequences produces the greatest similarity. The circuit includes a linear array of series-connected processors, each of which stores a single element from one of the sequences and compares that element with each successive element in the other sequence. For each comparison, the processor generates a scoring parameter that indicates which segment ending at those two elements produces the greatest degree of similarity between the sequences. The processor uses the scoring parameter to generate a similar scoring parameter for a comparison between the stored element and the next successive element from the other sequence. The processor also delivers the scoring parameter to the next processor in the array for use in generating a similar scoring parameter for another pair of elements. The electronic circuit determines which processor and alignment of the sequences produce the scoring parameter with the highest value.

Detecting earthquakes over a seismic network using single-station similarity measures

NASA Astrophysics Data System (ADS)

Bergen, Karianne J.; Beroza, Gregory C.

2018-06-01

New blind waveform-similarity-based detection methods, such as Fingerprint and Similarity Thresholding (FAST), have shown promise for detecting weak signals in long-duration, continuous waveform data. While blind detectors are capable of identifying similar or repeating waveforms without templates, they can also be susceptible to false detections due to local correlated noise. In this work, we present a set of three new methods that allow us to extend single-station similarity-based detection over a seismic network; event-pair extraction, pairwise pseudo-association, and event resolution complete a post-processing pipeline that combines single-station similarity measures (e.g. FAST sparse similarity matrix) from each station in a network into a list of candidate events. The core technique, pairwise pseudo-association, leverages the pairwise structure of event detections in its network detection model, which allows it to identify events observed at multiple stations in the network without modeling the expected moveout. Though our approach is general, we apply it to extend FAST over a sparse seismic network. We demonstrate that our network-based extension of FAST is both sensitive and maintains a low false detection rate. As a test case, we apply our approach to 2 weeks of continuous waveform data from five stations during the foreshock sequence prior to the 2014 Mw 8.2 Iquique earthquake. Our method identifies nearly five times as many events as the local seismicity catalogue (including 95 per cent of the catalogue events), and less than 1 per cent of these candidate events are false detections.

Processing of a nine-component near-offset VSP for seismic anisotropy

DOE Office of Scientific and Technical Information (OSTI.GOV)

MacBeth, C.; Li, X.Y.; Zeng, X.

1997-03-01

A convolutional sequence of matrix operators is offered as a convenient deterministic scheme for processing a multicomponent vertical seismic profile (VSP). This sequence is applied to a nine-component near-offset VSP recorded at the Conoco borehole test facility, Kay County, Oklahoma. These data are corrected for tool spin and near-surface anisotropy together with source coupling or imbalance. After wave-field separation using a standard f-k filter, each source and receiver pair for the upgoing waves is adjusted to a common reference depth using a matrix operator based on the downgoing wavefield. The up- and downgoing waves are then processed for anisotropy bymore » a similarity transformation, to separate the qS1 and qS2 waves, from which the anisotropic properties are estimated. These estimates reveal a strong (apparent) vertical birefringence in the near-surface, but weak or moderate values for the majority of the subsurface. The target zone consists of a thin sandstone and deeper shale layer, both of which possess a strong vertical birefringence. The sandstone corresponds to a zone of known fluid flow. An observed qS2 attenuation and polarization change in the shale suggest it contains large fractures.« less

Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space

PubMed Central

Karnik, Rahul; Beer, Michael A.

2015-01-01

The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs. PMID:26465884

Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

PubMed

Karnik, Rahul; Beer, Michael A

2015-01-01

The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

High-throughput sequencing reveals circular substrates for an archaeal RNA ligase

PubMed Central

Becker, Hubert F.; Héliou, Alice; Djaout, Kamel; Lestini, Roxane; Regnier, Mireille; Myllykallio, Hannu

2017-01-01

ABSTRACT It is only recently that the abundant presence of circular RNAs (circRNAs) in all kingdoms of Life, including the hyperthermophilic archaeon Pyrococcus abyssi, has emerged. This led us to investigate the physiologic significance of a previously observed weak intramolecular ligation activity of Pab1020 RNA ligase. Here we demonstrate that this enzyme, despite sharing significant sequence similarity with DNA ligases, is indeed an RNA-specific polynucleotide ligase efficiently acting on physiologically significant substrates. Using a combination of RNA immunoprecipitation assays and RNA-seq, our genome-wide studies revealed 133 individual circRNA loci in P. abyssi. The large majority of these loci interacted with Pab1020 in cells and circularization of selected C/D Box and 5S rRNA transcripts was confirmed biochemically. Altogether these studies revealed that Pab1020 is required for RNA circularization. Our results further suggest the functional speciation of an ancestral NTase domain and/or DNA ligase toward RNA ligase activity and prompt for further characterization of the widespread functions of circular RNAs in prokaryotes. Detailed insight into the cellular substrates of Pab1020 may facilitate the development of new biotechnological applications e.g. in ligation of preadenylated adaptors to RNA molecules. PMID:28277897

Saturation scanning of ubiquitin variants reveals a common hot spot for binding to USP2 and USP21.

PubMed

Leung, Isabel; Dekel, Ayelet; Shifman, Julia M; Sidhu, Sachdev S

2016-08-02

A detailed understanding of the molecular mechanisms whereby ubiquitin (Ub) recognizes enzymes in the Ub proteasome system is crucial for understanding the biological function of Ub. Many structures of Ub complexes have been solved and, in most cases, reveal a large structural epitope on a common face of the Ub molecule. However, owing to the generally weak nature of these interactions, it has been difficult to map in detail the functional contributions of individual Ub side chains to affinity and specificity. Here we took advantage of Ub variants (Ubvs) that bind tightly to particular Ub-specific proteases (USPs) and used phage display and saturation scanning mutagenesis to comprehensively map functional epitopes within the structural epitopes. We found that Ubvs that bind to USP2 or USP21 contain a remarkably similar core functional epitope, or "hot spot," consisting mainly of positions that are conserved as the wild type sequence, but also some positions that prefer mutant sequences. The Ubv core functional epitope contacts residues that are conserved in the human USP family, and thus it is likely important for the interactions of Ub across many family members.

Schemes of detecting nuclear spin correlations by dynamical decoupling based quantum sensing

NASA Astrophysics Data System (ADS)

Ma, Wen-Long Ma; Liu, Ren-Bao

Single-molecule sensitivity of nuclear magnetic resonance (NMR) and angstrom resolution of magnetic resonance imaging (MRI) are the highest challenges in magnetic microscopy. Recent development in dynamical decoupling (DD) enhanced diamond quantum sensing has enabled NMR of single nuclear spins and nanoscale NMR. Similar to conventional NMR and MRI, current DD-based quantum sensing utilizes the frequency fingerprints of target nuclear spins. Such schemes, however, cannot resolve different nuclear spins that have the same noise frequency or differentiate different types of correlations in nuclear spin clusters. Here we show that the first limitation can be overcome by using wavefunction fingerprints of target nuclear spins, which is much more sensitive than the ''frequency fingerprints'' to weak hyperfine interaction between the targets and a sensor, while the second one can be overcome by a new design of two-dimensional DD sequences composed of two sets of periodic DD sequences with different periods, which can be independently set to match two different transition frequencies. Our schemes not only offer an approach to breaking the resolution limit set by ''frequency gradients'' in conventional MRI, but also provide a standard approach to correlation spectroscopy for single-molecule NMR.

Joint cosmic microwave background and weak lensing analysis: constraints on cosmological parameters.

PubMed

Contaldi, Carlo R; Hoekstra, Henk; Lewis, Antony

2003-06-06

We use cosmic microwave background (CMB) observations together with the red-sequence cluster survey weak lensing results to derive constraints on a range of cosmological parameters. This particular choice of observations is motivated by their robust physical interpretation and complementarity. Our combined analysis, including a weak nucleosynthesis constraint, yields accurate determinations of a number of parameters including the amplitude of fluctuations sigma(8)=0.89+/-0.05 and matter density Omega(m)=0.30+/-0.03. We also find a value for the Hubble parameter of H(0)=70+/-3 km s(-1) Mpc(-1), in good agreement with the Hubble Space Telescope key-project result. We conclude that the combination of CMB and weak lensing data provides some of the most powerful constraints available in cosmology today.

Remarks on High Reynolds Numbers Hydrodynamics and the Inviscid Limit

NASA Astrophysics Data System (ADS)

Constantin, Peter; Vicol, Vlad

2018-04-01

We prove that any weak space-time L^2 vanishing viscosity limit of a sequence of strong solutions of Navier-Stokes equations in a bounded domain of R^2 satisfies the Euler equation if the solutions' local enstrophies are uniformly bounded. We also prove that t-a.e. weak L^2 inviscid limits of solutions of 3D Navier-Stokes equations in bounded domains are weak solutions of the Euler equation if they locally satisfy a scaling property of their second-order structure function. The conditions imposed are far away from boundaries, and wild solutions of Euler equations are not a priori excluded in the limit.

An Exploration of Rhythmic Grouping of Speech Sequences by French- and German-Learning Infants

PubMed Central

Abboub, Nawal; Boll-Avetisyan, Natalie; Bhatara, Anjali; Höhle, Barbara; Nazzi, Thierry

2016-01-01

Rhythm in music and speech can be characterized by a constellation of several acoustic cues. Individually, these cues have different effects on rhythmic perception: sequences of sounds alternating in duration are perceived as short-long pairs (weak-strong/iambic pattern), whereas sequences of sounds alternating in intensity or pitch are perceived as loud-soft, or high-low pairs (strong-weak/trochaic pattern). This perceptual bias—called the Iambic-Trochaic Law (ITL)–has been claimed to be an universal property of the auditory system applying in both the music and the language domains. Recent studies have shown that language experience can modulate the effects of the ITL on rhythmic perception of both speech and non-speech sequences in adults, and of non-speech sequences in 7.5-month-old infants. The goal of the present study was to explore whether language experience also modulates infants’ grouping of speech. To do so, we presented sequences of syllables to monolingual French- and German-learning 7.5-month-olds. Using the Headturn Preference Procedure (HPP), we examined whether they were able to perceive a rhythmic structure in sequences of syllables that alternated in duration, pitch, or intensity. Our findings show that both French- and German-learning infants perceived a rhythmic structure when it was cued by duration or pitch but not intensity. Our findings also show differences in how these infants use duration and pitch cues to group syllable sequences, suggesting that pitch cues were the easier ones to use. Moreover, performance did not differ across languages, failing to reveal early language effects on rhythmic perception. These results contribute to our understanding of the origin of rhythmic perception and perceptual mechanisms shared across music and speech, which may bootstrap language acquisition. PMID:27378887

Estimation of pairwise sequence similarity of mammalian enhancers with word neighbourhood counts.

PubMed

Göke, Jonathan; Schulz, Marcel H; Lasserre, Julia; Vingron, Martin

2012-03-01

The identity of cells and tissues is to a large degree governed by transcriptional regulation. A major part is accomplished by the combinatorial binding of transcription factors at regulatory sequences, such as enhancers. Even though binding of transcription factors is sequence-specific, estimating the sequence similarity of two functionally similar enhancers is very difficult. However, a similarity measure for regulatory sequences is crucial to detect and understand functional similarities between two enhancers and will facilitate large-scale analyses like clustering, prediction and classification of genome-wide datasets. We present the standardized alignment-free sequence similarity measure N2, a flexible framework that is defined for word neighbourhoods. We explore the usefulness of adding reverse complement words as well as words including mismatches into the neighbourhood. On simulated enhancer sequences as well as functional enhancers in mouse development, N2 is shown to outperform previous alignment-free measures. N2 is flexible, faster than competing methods and less susceptible to single sequence noise and the occurrence of repetitive sequences. Experiments on the mouse enhancers reveal that enhancers active in different tissues can be separated by pairwise comparison using N2. N2 represents an improvement over previous alignment-free similarity measures without compromising speed, which makes it a good candidate for large-scale sequence comparison of regulatory sequences. The software is part of the open-source C++ library SeqAn (www.seqan.de) and a compiled version can be downloaded at http://www.seqan.de/projects/alf.html. Supplementary data are available at Bioinformatics online.

TaqMan Real-Time PCR Assays To Assess Arbuscular Mycorrhizal Responses to Field Manipulation of Grassland Biodiversity: Effects of Soil Characteristics, Plant Species Richness, and Functional Traits▿ †

PubMed Central

König, Stephan; Wubet, Tesfaye; Dormann, Carsten F.; Hempel, Stefan; Renker, Carsten; Buscot, François

2010-01-01

Large-scale (temporal and/or spatial) molecular investigations of the diversity and distribution of arbuscular mycorrhizal fungi (AMF) require considerable sampling efforts and high-throughput analysis. To facilitate such efforts, we have developed a TaqMan real-time PCR assay to detect and identify AMF in environmental samples. First, we screened the diversity in clone libraries, generated by nested PCR, of the nuclear ribosomal DNA internal transcribed spacer (ITS) of AMF in environmental samples. We then generated probes and forward primers based on the detected sequences, enabling AMF sequence type-specific detection in TaqMan multiplex real-time PCR assays. In comparisons to conventional clone library screening and Sanger sequencing, the TaqMan assay approach provided similar accuracy but higher sensitivity with cost and time savings. The TaqMan assays were applied to analyze the AMF community composition within plots of a large-scale plant biodiversity manipulation experiment, the Jena Experiment, primarily designed to investigate the interactive effects of plant biodiversity on element cycling and trophic interactions. The results show that environmental variables hierarchically shape AMF communities and that the sequence type spectrum is strongly affected by previous land use and disturbance, which appears to favor disturbance-tolerant members of the genus Glomus. The AMF species richness of disturbance-associated communities can be largely explained by richness of plant species and plant functional groups, while plant productivity and soil parameters appear to have only weak effects on the AMF community. PMID:20418424

Evaluation of spiral acquisition variants for functional imaging of human superior colliculus at 3T field strength.

PubMed

Singh, Vimal; Pfeuffer, Josef; Zhao, Tiejun; Ress, David

2018-04-01

High-resolution functional magnetic resonance imaging of human subcortical brain structures is challenging because of their deep location in the cranium, and their comparatively weak blood oxygen level dependent responses to strong stimuli. Magnetic resonance imaging data for subcortical brain regions exhibit both low signal-to-noise ratio and low functional contrast-to-noise ratio. To overcome these challenges, this work evaluates the use of dual-echo spiral variants that combine outward and inward trajectories. Specifically, in-in, in-out, and out-out combinations are evaluated. For completeness, single-echo spiral-in and parallel-receive-accelerated echo-planar-imaging sequences are also evaluated. Sequence evaluation was based on comparison of functional contrast-to-noise ratio within retinotopically predefined regions of interest. Superior colliculus was chosen as sample subcortical brain region because it exhibits a strong visual response. All sequences were compared relative to a single-echo spiral-out trajectory to establish a within-session reference. In superior colliculus, the dual-echo out-out outperformed the reference trajectory by 55% in contrast-to-noise ratio, while all other trajectories had performance similar to the reference. The sequences were also compared in early visual cortex. Here, both dual-echo spiral out-out and in-out outperformed the reference by ∼25%. Dual-echo spiral variants offer improved contrast-to-noise ratio performance for high-resolution imaging for both superior colliculus and cortex. Magn Reson Med 79:1931-1940, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Depolarization Diffusion During Weak Suprathreshold Stimulation of Cardiac Tissue

DTIC Science & Technology

2001-10-25

DEPOLARIZATION DIFFUSION DURING WEAK SUPRATHRESHOLD STIMULATION OF CARDIAC TISSUE Vladimir Nikolski, Aleksandre Sambelashvili, and Igor R. Efimov...the depolarized regions. Such an activation pattern appears similar to break activation. The effect of the depolarization diffusion from depolarized...Subtitle Depolarization Diffusion During Weak Suprathreshold Stimulation of Cardiac Tissue Contract Number Grant Number Program Element Number Author(s

Multiple maternal origins and weak phylogeographic structure in domestic goats

PubMed Central

Luikart, Gordon; Gielly, Ludovic; Excoffier, Laurent; Vigne, Jean-Denis; Bouvet, Jean; Taberlet, Pierre

2001-01-01

Domestic animals have played a key role in human history. Despite their importance, however, the origins of most domestic species remain poorly understood. We assessed the phylogenetic history and population structure of domestic goats by sequencing a hypervariable segment (481 bp) of the mtDNA control region from 406 goats representing 88 breeds distributed across the Old World. Phylogeographic analysis revealed three highly divergent goat lineages (estimated divergence >200,000 years ago), with one lineage occurring only in eastern and southern Asia. A remarkably similar pattern exists in cattle, sheep, and pigs. These results, combined with recent archaeological findings, suggest that goats and other farm animals have multiple maternal origins with a possible center of origin in Asia, as well as in the Fertile Crescent. The pattern of goat mtDNA diversity suggests that all three lineages have undergone population expansions, but that the expansion was relatively recent for two of the lineages (including the Asian lineage). Goat populations are surprisingly less genetically structured than cattle populations. In goats only ≈10% of the mtDNA variation is partitioned among continents. In cattle the amount is ≥50%. This weak structuring suggests extensive intercontinental transportation of goats and has intriguing implications about the importance of goats in historical human migrations and commerce. PMID:11344314

Focal mechanisms and moment magnitudes of micro-earthquakes in central Brazil by waveform inversion with quality assessment and inference of the local stress field

NASA Astrophysics Data System (ADS)

Carvalho, Juraci; Barros, Lucas Vieira; Zahradník, Jiří

2016-11-01

This paper documents an investigation on the use of full waveform inversion to retrieve focal mechanisms of 11 micro-earthquakes (Mw 0.8 to 1.4). The events represent aftershocks of a 5.0 mb earthquake that occurred on October 8, 2010 close to the city of Mara Rosa in the state of Goiás, Brazil. The main contribution of the work lies in demonstrating the feasibility of waveform inversion of such weak events. The inversion was made possible thanks to recordings available at 8 temporary seismic stations in epicentral distances of less than 8 km, at which waveforms can be successfully modeled at relatively high frequencies (1.5-2.0 Hz). On average, the fault-plane solutions obtained are in agreement with a composite focal mechanism previously calculated from first-motion polarities. They also agree with the fault geometry inferred from precise relocation of the Mara Rosa aftershock sequence. The focal mechanisms provide an estimate of the local stress field. This paper serves as a pilot study for similar investigations in intraplate regions where the stress-field investigations are difficult due to rare earthquake occurrences, and where weak events must be studied with a detailed quality assessment.

Is the phonological similarity effect in working memory due to proactive interference?

PubMed

Baddeley, Alan D; Hitch, Graham J; Quinlan, Philip T

2018-04-12

Immediate serial recall of verbal material is highly sensitive to impairment attributable to phonological similarity. Although this has traditionally been interpreted as a within-sequence similarity effect, Engle (2007) proposed an interpretation based on interference from prior sequences, a phenomenon analogous to that found in the Peterson short-term memory (STM) task. We use the method of serial reconstruction to test this in an experiment contrasting the standard paradigm in which successive sequences are drawn from the same set of phonologically similar or dissimilar words and one in which the vowel sound on which similarity is based is switched from trial to trial, a manipulation analogous to that producing release from PI in the Peterson task. A substantial similarity effect occurs under both conditions although there is a small advantage from switching across similar sequences. There is, however, no evidence for the suggestion that the similarity effect will be absent from the very first sequence tested. Our results support the within-sequence similarity rather than a between-list PI interpretation. Reasons for the contrast with the classic Peterson short-term forgetting task are briefly discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Evaluating arguments during instigations of defence motivation and accuracy motivation.

PubMed

Liu, Cheng-Hong

2017-05-01

When people evaluate the strength of an argument, their motivations are likely to influence the evaluation. However, few studies have specifically investigated the influences of motivational factors on argument evaluation. This study examined the effects of defence and accuracy motivations on argument evaluation. According to the compatibility between the advocated positions of arguments and participants' prior beliefs and the objective strength of arguments, participants evaluated four types of arguments: compatible-strong, compatible-weak, incompatible-strong, and incompatible-weak arguments. Experiment 1 revealed that participants possessing a high defence motivation rated compatible-weak arguments as stronger and incompatible-strong ones as weaker than participants possessing a low defence motivation. However, the strength ratings between the high and low defence groups regarding both compatible-strong and incompatible-weak arguments were similar. Experiment 2 revealed that when participants possessed a high accuracy motivation, they rated compatible-weak arguments as weaker and incompatible-strong ones as stronger than when they possessed a low accuracy motivation. However, participants' ratings on both compatible-strong and incompatible-weak arguments were similar when comparing high and low accuracy conditions. The results suggest that defence and accuracy motivations are two major motives influencing argument evaluation. However, they primarily influence the evaluation results for compatible-weak and incompatible-strong arguments, but not for compatible-strong and incompatible-weak arguments. © 2016 The British Psychological Society.

Structure at every scale: A semantic network account of the similarities between unrelated concepts.

PubMed

De Deyne, Simon; Navarro, Daniel J; Perfors, Amy; Storms, Gert

2016-09-01

Similarity plays an important role in organizing the semantic system. However, given that similarity cannot be defined on purely logical grounds, it is important to understand how people perceive similarities between different entities. Despite this, the vast majority of studies focus on measuring similarity between very closely related items. When considering concepts that are very weakly related, little is known. In this article, we present 4 experiments showing that there are reliable and systematic patterns in how people evaluate the similarities between very dissimilar entities. We present a semantic network account of these similarities showing that a spreading activation mechanism defined over a word association network naturally makes correct predictions about weak similarities, whereas, though simpler, models based on direct neighbors between word pairs derived using the same network cannot. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

DsaV methyltransferase and its isoschizomers contain a conserved segment that is similar to the segment in Hhai methyltransferase that is in contact with DNA bases.

PubMed Central

Gopal, J; Yebra, M J; Bhagwat, A S

1994-01-01

The methyltransferase (MTase) in the DsaV restriction--modification system methylates within 5'-CCNGG sequences. We have cloned the gene for this MTase and determined its sequence. The predicted sequence of the MTase protein contains sequence motifs conserved among all cytosine-5 MTases and is most similar to other MTases that methylate CCNGG sequences, namely M.ScrFI and M.SsoII. All three MTases methylate the internal cytosine within their recognition sequence. The 'variable' region within the three enzymes that methylate CCNGG can be aligned with the sequences of two enzymes that methylate CCWGG sequences. Remarkably, two segments within this region contain significant similarity with the region of M.HhaI that is known to contact DNA bases. These alignments suggest that many cytosine-5 MTases are likely to interact with DNA using a similar structural framework. Images PMID:7971279

BLAST and FASTA similarity searching for multiple sequence alignment.

PubMed

Pearson, William R

2014-01-01

BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

Super-resolution biomolecular crystallography with low-resolution data.

PubMed

Schröder, Gunnar F; Levitt, Michael; Brunger, Axel T

2010-04-22

X-ray diffraction plays a pivotal role in the understanding of biological systems by revealing atomic structures of proteins, nucleic acids and their complexes, with much recent interest in very large assemblies like the ribosome. As crystals of such large assemblies often diffract weakly (resolution worse than 4 A), we need methods that work at such low resolution. In macromolecular assemblies, some of the components may be known at high resolution, whereas others are unknown: current refinement methods fail as they require a high-resolution starting structure for the entire complex. Determining the structure of such complexes, which are often of key biological importance, should be possible in principle as the number of independent diffraction intensities at a resolution better than 5 A generally exceeds the number of degrees of freedom. Here we introduce a method that adds specific information from known homologous structures but allows global and local deformations of these homology models. Our approach uses the observation that local protein structure tends to be conserved as sequence and function evolve. Cross-validation with R(free) (the free R-factor) determines the optimum deformation and influence of the homology model. For test cases at 3.5-5 A resolution with known structures at high resolution, our method gives significant improvements over conventional refinement in the model as monitored by coordinate accuracy, the definition of secondary structure and the quality of electron density maps. For re-refinements of a representative set of 19 low-resolution crystal structures from the Protein Data Bank, we find similar improvements. Thus, a structure derived from low-resolution diffraction data can have quality similar to a high-resolution structure. Our method is applicable to the study of weakly diffracting crystals using X-ray micro-diffraction as well as data from new X-ray light sources. Use of homology information is not restricted to X-ray crystallography and cryo-electron microscopy: as optical imaging advances to subnanometre resolution, it can use similar tools.

Immunochemical and structural analysis of the O polysaccharides of Salmonella zuerich [1,9,27,(46)

PubMed Central

Nghiêm, H O; Himmelspach, K; Mayer, H

1992-01-01

Salmonella zuerich [1,9,27,(46)] has been shown to exhibit two levels of structural heterogeneity. The bacterium carries two distinct O-polysaccharide molecules with and without O:factor 1. Both sets of molecules (1+ and 1-) carry the two O:factors 27 and 46 on the same O chain, but they are expressed unevenly; in contrast to factor 27, O:factor 46 is always weakly expressed. Part of this weak expression was thought to be due to strong inhibition of factor 46 by factor 1. In this study, serological analysis gave more detailed information on the sizes of the different O:factor epitopes. Structural analysis of S. zuerich O polysaccharides showed that they are constructed of the expected chemical sequences characteristic of factors 1, 9, 27, and 46. No modification in the sugar sequence could account for the weak expression of O:factor 46. Factors 27 and 46 are present on oligosaccharides carrying either an alpha-Man (factor 27) or a beta-Man (factor 46) residue. In S. zuerich, the alpha-Man configuration is predominant, corroborating the expression of strong factor 27 and weak factor 46 on the bacteria. Questions raised by the existence of such heterogeneous O polysaccharides on the specificity of the O chain polymerase, as well as the place of S. zuerich in Salmonella evolution, are dicussed in this paper. PMID:1372315

The sweet spots in human communication.

PubMed

Salem, Philip

2011-07-01

In baseball, the sweet spot is a special place on a bat where the batter can hit the ball with the most power. It is the place where the performances of the batter and pitcher collide with maximum effect. It is the place where the dynamic tension between opponents leads to transformation. The dynamic tension in all living systems is between similarity and difference. Chaos and complexity scholars recognized this tension as amounts of information. When the amounts of information were high, but not too high, the system moved to the edge of chaos, to the complexity regime, to strange attractors, or to chaos, depending on the model. The sweet spot is that range of relative variety, just the proper mix of similarity and difference, leading to transformation. This essay contains a model of human communication as an emergent social process with its own sweet spots. The essay also includes a description of current literature highlighting tensions between similarity and difference, and there is an exploration of the potential to move from one basin of attraction to another. The primary constraints on finding communication sweet spots are paradigmatic - adopting a process orientation, discovering the proper parameters, bracketing sequences to define initial conditions, and understanding the strengths and weaknesses of various modeling techniques.

[Prospects for applications in human health of nanopore-based sequencing].

PubMed

Audebert, Christophe; Hot, David; Caboche, Ségolène

2018-04-01

High throughput sequencing has opened up new clinical opportunities moving towards a medicine of precision. Oncology, infectious diseases or human genomics, many applications have been developed in recent years. The introduction of a third generation of nanopore-based sequencing technology, addressing some of the weaknesses of the previous generation, heralds a new revolution. Portability, real time, long reads and marginal investment costs, these promising new technologies point to a new shift of paradigm. What are the perspectives opened up by nanopores for clinical applications? © 2018 médecine/sciences – Inserm.

Toward a More Flexible Web-Based Framework for Multidisciplinary Design

NASA Technical Reports Server (NTRS)

Rogers, J. L.; Salas, A. O.

1999-01-01

In today's competitive environment, both industry and government agencies are under pressure to reduce the time and cost of multidisciplinary design projects. New tools have been introduced to assist in this process by facilitating the integration of and communication among diverse disciplinary codes. One such tool, a framework for multidisciplinary design, is defined as a hardware-software architecture that enables integration, execution, and communication among diverse disciplinary processes. An examination of current frameworks reveals weaknesses in various areas, such as sequencing, monitoring, controlling, and displaying the design process. The objective of this research is to explore how Web technology can improve these areas of weakness and lead toward a more flexible framework. This article describes a Web-based system that optimizes and controls the execution sequence of design processes in addition to monitoring the project status and displaying the design results.

A new div-curl result. Applications to the homogenization of elliptic systems and to the weak continuity of the Jacobian

NASA Astrophysics Data System (ADS)

Briane, M.; Casado Díaz, J.

2016-04-01

In this paper a new div-curl result is established in an open set Ω of RN, N ≥ 2, for the product σn ṡηn of two sequences of vector-valued functions σn, ηn such that σn is bounded in Lp(Ω)N, ηn is bounded in Lq(Ω)N, with 1 / p + 1 / q = 1 + 1 / (N - 1), and such that divσn, curlηn are compact in suitable spaces. The new assumption is that the product converges weakly in W - 1 , 1 (Ω). The approach is also new in the topic, and is based on a compactness result for bounded sequences in W 1 , q (Ω) through a suitable selection of annuli on which the gradients are not too high, in the spirit of [26,32] and using the imbedding of W 1 , q into Lp‧ for the unit sphere of RN. The div-curl result is applied to the homogenization of equi-coercive systems whose coefficients are equi-bounded in Lρ (Ω) for some ρ >N-1/2 if N > 2, or in L1 (Ω) if N = 2. It also allows us to prove a weak continuity result for the Jacobian for bounded sequences in W 1 , N - 1 (Ω) satisfying an alternative assumption to the L∞-strong estimate of [8]. Two examples show the sharpness of the results.

Managing Safety and Operations: The Effect of Joint Management System Practices on Safety and Operational Outcomes.

PubMed

Tompa, Emile; Robson, Lynda; Sarnocinska-Hart, Anna; Klassen, Robert; Shevchenko, Anton; Sharma, Sharvani; Hogg-Johnson, Sheilah; Amick, Benjamin C; Johnston, David A; Veltri, Anthony; Pagell, Mark

2016-03-01

The aim of this study was to determine whether management system practices directed at both occupational health and safety (OHS) and operations (joint management system [JMS] practices) result in better outcomes in both areas than in alternative practices. Separate regressions were estimated for OHS and operational outcomes using data from a survey along with administrative records on injuries and illnesses. Organizations with JMS practices had better operational and safety outcomes than organizations without these practices. They had similar OHS outcomes as those with operations-weak practices, and in some cases, better outcomes than organizations with safety-weak practices. They had similar operational outcomes as those with safety-weak practices, and better outcomes than those with operations-weak practices. Safety and operations appear complementary in organizations with JMS practices in that there is no penalty for either safety or operational outcomes.

An improved model for whole genome phylogenetic analysis by Fourier transform.

PubMed

Yin, Changchuan; Yau, Stephen S-T

2015-10-07

DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

SIMAP—the database of all-against-all protein sequence similarities and annotations with new interfaces and increased coverage

PubMed Central

Arnold, Roland; Goldenberg, Florian; Mewes, Hans-Werner; Rattei, Thomas

2014-01-01

The Similarity Matrix of Proteins (SIMAP, http://mips.gsf.de/simap/) database has been designed to massively accelerate computationally expensive protein sequence analysis tasks in bioinformatics. It provides pre-calculated sequence similarities interconnecting the entire known protein sequence universe, complemented by pre-calculated protein features and domains, similarity clusters and functional annotations. SIMAP covers all major public protein databases as well as many consistently re-annotated metagenomes from different repositories. As of September 2013, SIMAP contains >163 million proteins corresponding to ∼70 million non-redundant sequences. SIMAP uses the sensitive FASTA search heuristics, the Smith–Waterman alignment algorithm, the InterPro database of protein domain models and the BLAST2GO functional annotation algorithm. SIMAP assists biologists by facilitating the interactive exploration of the protein sequence universe. Web-Service and DAS interfaces allow connecting SIMAP with any other bioinformatic tool and resource. All-against-all protein sequence similarity matrices of project-specific protein collections are generated on request. Recent improvements allow SIMAP to cover the rapidly growing sequenced protein sequence universe. New Web-Service interfaces enhance the connectivity of SIMAP. Novel tools for interactive extraction of protein similarity networks have been added. Open access to SIMAP is provided through the web portal; the portal also contains instructions and links for software access and flat file downloads. PMID:24165881

Analyses of Evolutionary Characteristics of the Hemagglutinin-Esterase Gene of Influenza C Virus during a Period of 68 Years Reveals Evolutionary Patterns Different from Influenza A and B Viruses.

PubMed

Furuse, Yuki; Matsuzaki, Yoko; Nishimura, Hidekazu; Oshitani, Hitoshi

2016-11-26

Infections with the influenza C virus causing respiratory symptoms are common, particularly among children. Since isolation and detection of the virus are rarely performed, compared with influenza A and B viruses, the small number of available sequences of the virus makes it difficult to analyze its evolutionary dynamics. Recently, we reported the full genome sequence of 102 strains of the virus. Here, we exploited the data to elucidate the evolutionary characteristics and phylodynamics of the virus compared with influenza A and B viruses. Along with our data, we obtained public sequence data of the hemagglutinin-esterase gene of the virus; the dataset consists of 218 unique sequences of the virus collected from 14 countries between 1947 and 2014. Informatics analyses revealed that (1) multiple lineages have been circulating globally; (2) there have been weak and infrequent selective bottlenecks; (3) the evolutionary rate is low because of weak positive selection and a low capability to induce mutations; and (4) there is no significant positive selection although a few mutations affecting its antigenicity have been induced. The unique evolutionary dynamics of the influenza C virus must be shaped by multiple factors, including virological, immunological, and epidemiological characteristics.

Analyses of Evolutionary Characteristics of the Hemagglutinin-Esterase Gene of Influenza C Virus during a Period of 68 Years Reveals Evolutionary Patterns Different from Influenza A and B Viruses

PubMed Central

Furuse, Yuki; Matsuzaki, Yoko; Nishimura, Hidekazu; Oshitani, Hitoshi

2016-01-01

Infections with the influenza C virus causing respiratory symptoms are common, particularly among children. Since isolation and detection of the virus are rarely performed, compared with influenza A and B viruses, the small number of available sequences of the virus makes it difficult to analyze its evolutionary dynamics. Recently, we reported the full genome sequence of 102 strains of the virus. Here, we exploited the data to elucidate the evolutionary characteristics and phylodynamics of the virus compared with influenza A and B viruses. Along with our data, we obtained public sequence data of the hemagglutinin-esterase gene of the virus; the dataset consists of 218 unique sequences of the virus collected from 14 countries between 1947 and 2014. Informatics analyses revealed that (1) multiple lineages have been circulating globally; (2) there have been weak and infrequent selective bottlenecks; (3) the evolutionary rate is low because of weak positive selection and a low capability to induce mutations; and (4) there is no significant positive selection although a few mutations affecting its antigenicity have been induced. The unique evolutionary dynamics of the influenza C virus must be shaped by multiple factors, including virological, immunological, and epidemiological characteristics. PMID:27898037

Optimized protocols for cardiac magnetic resonance imaging in patients with thoracic metallic implants.

PubMed

Olivieri, Laura J; Cross, Russell R; O'Brien, Kendall E; Ratnayaka, Kanishka; Hansen, Michael S

2015-09-01

Cardiac magnetic resonance (MR) imaging is a valuable tool in congenital heart disease; however patients frequently have metal devices in the chest from the treatment of their disease that complicate imaging. Methods are needed to improve imaging around metal implants near the heart. Basic sequence parameter manipulations have the potential to minimize artifact while limiting effects on image resolution and quality. Our objective was to design cine and static cardiac imaging sequences to minimize metal artifact while maintaining image quality. Using systematic variation of standard imaging parameters on a fluid-filled phantom containing commonly used metal cardiac devices, we developed optimized sequences for steady-state free precession (SSFP), gradient recalled echo (GRE) cine imaging, and turbo spin-echo (TSE) black-blood imaging. We imaged 17 consecutive patients undergoing routine cardiac MR with 25 metal implants of various origins using both standard and optimized imaging protocols for a given slice position. We rated images for quality and metal artifact size by measuring metal artifact in two orthogonal planes within the image. All metal artifacts were reduced with optimized imaging. The average metal artifact reduction for the optimized SSFP cine was 1.5+/-1.8 mm, and for the optimized GRE cine the reduction was 4.6+/-4.5 mm (P < 0.05). Quality ratings favored the optimized GRE cine. Similarly, the average metal artifact reduction for the optimized TSE images was 1.6+/-1.7 mm (P < 0.05), and quality ratings favored the optimized TSE imaging. Imaging sequences tailored to minimize metal artifact are easily created by modifying basic sequence parameters, and images are superior to standard imaging sequences in both quality and artifact size. Specifically, for optimized cine imaging a GRE sequence should be used with settings that favor short echo time, i.e. flow compensation off, weak asymmetrical echo and a relatively high receiver bandwidth. For static black-blood imaging, a TSE sequence should be used with fat saturation turned off and high receiver bandwidth.

Elastin-like Polypeptide (ELP) Charge Influences Self-Assembly of ELP-mCherry Fusion Proteins.

PubMed

Mills, Carolyn E; Michaud, Zachary; Olsen, Bradley D

2018-05-23

Self-assembly of protein-polymer bioconjugates presents an elegant strategy for controlling nanostructure and orientation of globular proteins in functional materials. Recent work has shown that genetic fusion of globular protein mCherry to an elastin-like polypeptide (ELP) yields similar self-assembly behavior to these protein-polymer bioconjugates. In the context of studying protein-polymer bioconjugate self-assembly, the mutability of the ELP sequence allows several different properties of the ELP block to be tuned orthogonally while maintaining consistent polypeptide backbone chemistry. This work uses this ELP sequence tunability in combination with the precise control offered by genetic engineering of an amino acid sequence to generate a library of four novel ELP sequences that are used to study the combined effect of charge and hydrophobicity on ELP-mCherry fusion protein self-assembly. Concentrated solution self-assembly is studied by small-angle X-ray scattering (SAXS) and depolarized light scattering (DPLS). These experiments show that fusions containing a negatively charged ELP block do not assemble at all, and fusions with a charge balanced ELP block exhibit a weak propensity for assembly. By comparison, the fusion containing an uncharged ELP block starts to order at 40 wt % in solution and at all concentrations measured has sharper, more intense SAXS peaks than other fusion proteins. These experiments show that charge character of the ELP block is a stronger predictor of self-assembly behavior than the hydrophobicity of the ELP block. Dilute solution small-angle neutron scattering (SANS) on the ELPs alone suggests that all ELPs used in this study (including the uncharged ELP) adopt dilute solution conformations similar to those of traditional polymers, including polyampholytes and polyelectrolytes. Finally, dynamic light scattering studies on ELP-mCherry blends shows that there is no significant complexation between the charged ELPs and mCherry. Therefore, it is proposed that the superior self-assembly of fusion proteins containing uncharged ELP block is due to effective repulsions between charged and uncharged blocks due to local charge correlation effects and, in the case of anionic ELPs, repulsion between like charges within the ELP block.

Mesorhizobium wenxiniae sp. nov., isolated from chickpea (Cicer arietinum L.) in China.

PubMed

Zhang, Junjie; Guo, Chen; Chen, Wenfeng; de Lajudie, Philippe; Zhang, Zhiyan; Shang, Yimin; Wang, En Tao

2018-06-01

Three chickpea rhizobial strains (WYCCWR 10195 T =S1-3-7, WYCCWR 10198=S1-4-3 and WYCCWR 10200=S1-5-1) isolated from Northwest China formed a group affiliated to Mesorhizobium based on 16S rRNA gene sequence comparison. To clarify their species status, multilocus sequence analysis and average nucleotide identity (ANI) values of whole genome sequences between the novel group and the type strains of the related species were further performed. Similarities of 95.7-96.6 % in the concatenated sequences of atpD-recA-glnII and 91.9-93.1 % of ANI values to the closest-related species Mesorhizobium muleiense, Mesorhizobium mediterraneum and Mesorhizobium temperatum demonstrated the novel group a unique genospecies. The most abundant fatty acid in cells of WYCCWR 10195 T were C19 : 0 cyclo ω8c (51.4 %), followed by C18 : 1 ω7c 11-methyl (9.5 %) and C16 : 0 (9.3 %). Its genome size was 6.37 Mbp, comprising 6633 predicted genes with a DNA G+C content of 61.9 mol%. The similarities of 99.0-99.8 % for the nodC gene and 98.3-99.44 % for the nifH gene to those of the chickpea rhizobial species and nodulation with Cicer arietinum L. confirmed the strains of the new genospecies as symbiovar ciceri. The weak utilization of most of the tested sugars/organic acids and non-utilization of l(+)-rhamnose, l-cysteine and l-glycine as sole carbon source, tolerance to 1 % (w/v) NaCl, resistance to 5 µg ml -1 chloromycetin and non-hydrolysis of l-tyrosine distinguished the novel group from the related species and supported this group as a novel species, for which the name Mesorhizobium wenxiniae sp. nov. is proposed, with WYCCWR 10195 T (=S1-3-7=HAMBI 3692 T =LMG 30254 T ) as the type strain.

Functional characterization of rainbow trout (Oncorhynchus mykiss) Abcg2a (Bcrp) transporter.

PubMed

Zaja, Roko; Popović, Marta; Lončar, Jovica; Smital, Tvrtko

2016-12-01

ABCG2 (BCRP - breast cancer resistance protein) belongs to the ATP-binding cassette (ABC) superfamily. It plays an important role in the disposition and elimination of xeno- and endobiotics and/or their metabolites in mammals. Likewise, the protective role of ABC transporters, including Abcg2, has been reported for aquatic organisms. In our previous study we have cloned the full gene sequence of rainbow trout (Oncorhynchus mykiss) Abcg2a and showed its high expression in liver and primary hepatocytes. Based on those insights, the main goal of this study was to perform a detailed functional characterization of trout Abcg2a using insect ovary cells (Spodoptera frugiperda, Sf9) as a heterologous expression system. Membrane vesicles preparations from Sf9 cells were used for the ATPase assay determinations and basic biochemical properties of fish Abcg2a versus human ABCG2 have been compared. A series of 39 physiologically and/or environmentally relevant substances was then tested on interaction with trout Abcg2a and human ABCG2. Correlation analysis reveals highly similar pattern of activation and inhibition. Significant activation of trout Abcg2a ATPase was observed for prazosin, doxorubicine, sildenafil, furosemid, propranolol, fenofibrate and pheophorbide. Pesticides showed either a weak activation (malathione) or strong (endosulfan) to weak (chlorpyrifos, fenoxycarb, DDE) inhibition of trout Abcg2a ATPase while the highest activation was obtained for benzo(a)pyrene, curcumine and testosterone. In conclusion, data from this study offer the first characterization of fish Abcg2a, reveal potent interactors among physiologically or environmentally relevant substances and point to similarities regarding strengths and interactor preferences between human ABCG2 and fish Abcg2a. Copyright © 2016 Elsevier Inc. All rights reserved.

Cross-correlating Planck tSZ with RCSLenS weak lensing: implications for cosmology and AGN feedback

NASA Astrophysics Data System (ADS)

Hojjati, Alireza; Tröster, Tilman; Harnois-Déraps, Joachim; McCarthy, Ian G.; van Waerbeke, Ludovic; Choi, Ami; Erben, Thomas; Heymans, Catherine; Hildebrandt, Hendrik; Hinshaw, Gary; Ma, Yin-Zhe; Miller, Lance; Viola, Massimo; Tanimura, Hideki

2017-10-01

We present measurements of the spatial mapping between (hot) baryons and the total matter in the Universe, via the cross-correlation between the thermal Sunyaev-Zeldovich (tSZ) map from Planck and the weak gravitational lensing maps from the Red Cluster Sequence Lensing Survey (RCSLenS). The cross-correlations are performed on the map level where all the sources (including diffuse intergalactic gas) contribute to the signal. We consider two configuration-space correlation function estimators, ξy-κ and ξ ^ {y-γ t}, and a Fourier-space estimator, C_{ℓ}^{y-κ}, in our analysis. We detect a significant correlation out to 3° of angular separation on the sky. Based on statistical noise only, we can report 13σ and 17σ detections of the cross-correlation using the configuration-space y-κ and y-γt estimators, respectively. Including a heuristic estimate of the sampling variance yields a detection significance of 7σ and 8σ, respectively. A similar level of detection is obtained from the Fourier-space estimator, C_{ℓ}^{y-κ}. As each estimator probes different dynamical ranges, their combination improves the significance of the detection. We compare our measurements with predictions from the cosmo-OverWhelmingly Large Simulations suite of cosmological hydrodynamical simulations, where different galactic feedback models are implemented. We find that a model with considerable active galactic nuclei (AGN) feedback that removes large quantities of hot gas from galaxy groups and Wilkinson Microwave Anisotropy Probe 7-yr best-fitting cosmological parameters provides the best match to the measurements. All baryonic models in the context of a Planck cosmology overpredict the observed signal. Similar cosmological conclusions are drawn when we employ a halo model with the observed 'universal' pressure profile.

Interactions of Plakoglobin and [beta]-Catenin with Desmosomal Cadherins BASIS OF SELECTIVE EXCLUSION OF [alpha]- AND [beta]-CATENIN FROM DESMOSOMES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Hee-Jung; Gross, Julia C.; Pokutta, Sabine

2009-11-18

Plakoglobin and {beta}-catenin are homologous armadillo repeat proteins found in adherens junctions, where they interact with the cytoplasmic domain of classical cadherins and with {alpha}-catenin. Plakoglobin, but normally not {beta}-catenin, is also a structural constituent of desmosomes, where it binds to the cytoplasmic domains of the desmosomal cadherins, desmogleins and desmocollins. Here, we report structural, biophysical, and biochemical studies aimed at understanding the molecular basis of selective exclusion of {beta}-catenin and {alpha}-catenin from desmosomes. The crystal structure of the plakoglobin armadillo domain bound to phosphorylated E-cadherin shows virtually identical interactions to those observed between {beta}-catenin and E-cadherin. Trypsin sensitivity experimentsmore » indicate that the plakoglobin arm domain by itself is more flexible than that of {beta}-catenin. Binding of plakoglobin and {beta}-catenin to the intracellular regions of E-cadherin, desmoglein1, and desmocollin1 was measured by isothermal titration calorimetry. Plakoglobin and {beta}-catenin bind strongly and with similar thermodynamic parameters to E-cadherin. In contrast, {beta}-catenin binds to desmoglein-1 more weakly than does plakoglobin. {beta}-Catenin and plakoglobin bind with similar weak affinities to desmocollin-1. Full affinity binding of desmoglein-1 requires sequences C-terminal to the region homologous to the catenin-binding domain of classical cadherins. Although pulldown assays suggest that the presence of N- and C-terminal {beta}-catenin 'tails' that flank the armadillo repeat region reduces the affinity for desmosomal cadherins, calorimetric measurements show no significant effects of the tails on binding to the cadherins. Using purified proteins, we show that desmosomal cadherins and {alpha}-catenin compete directly for binding to plakoglobin, consistent with the absence of {alpha}-catenin in desmosomes.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiraishi, Nobuhiro; Ishida, Yo-ichi; Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp

Nuclear VCP-like 2 (NVL2) is a chaperone-like nucleolar ATPase of the AAA (ATPase associated with diverse cellular activities) family, which exhibits a high level of amino acid sequence similarity with the cytosolic AAA-ATPase VCP/p97. These proteins generally act on macromolecular complexes to stimulate energy-dependent release of their constituents. We previously showed that NVL2 interacts with RNA processing/degradation machinery containing an RNA helicase MTR4/DOB1 and an exonuclease complex, nuclear exosome, and involved in the biogenesis of 60S ribosomal subunits. These observations implicate NVL2 as a remodeling factor for the MTR4-exosome complex during the maturation of pre-ribosomal particles. Here, we used amore » proteomic screen and identified a WD repeat-containing protein 74 (WDR74) as a factor that specifically dissociates from this complex depending on the ATPase activity of NVL2. WDR74 shows weak amino acid sequence similarity with the yeast ribosome biogenesis protein Nsa1 and is co-localized with NVL2 in the nucleolus. Knockdown of WDR74 decreases 60S ribosome levels. Taken together, our results suggest that WDR74 is a novel regulatory protein of the MTR4-exsosome complex whose interaction is regulated by NVL2 and is involved in ribosome biogenesis. - Highlights: • WDR74 accumulates in MTR4-exosome complex upon expression of dominant-negative NVL2. • WDR74 is co-localized with NVL2 in the nucleolus. • WDR74, along with NVL2, is involved in the synthesis of 60S ribosomal subunits.« less

Proteiniborus ethanoligenes gen. nov., sp. nov., an anaerobic protein-utilizing bacterium.

PubMed

Niu, Lili; Song, Lei; Dong, Xiuzhu

2008-01-01

A novel anaerobic, mesophilic, protein-utilizing bacterial strain, GW(T), was isolated from the mesophilic hydrogen-producing granular sludge used to treat food industry wastewater. The strain was a Gram-positive, non-spore-forming and non-motile rod. Growth of the strain was observed at 20-48 degrees C and at pH 6.4-10.0. The strain used yeast extract and peptone as carbon and energy sources. Weak growth was also observed with tryptone and Casamino acids as carbon and energy sources. The strain used none of the tested carbohydrates, alcohols or fatty acids. The fermentation products in peptone-yeast broth included ethanol, acetic acid, hydrogen and carbon dioxide. Gelatin was not hydrolysed. Nitrate was reduced. Indole was produced. NH(3) and H(2)S were not produced. The DNA G+C content of strain GW(T) was 38.0 mol%. The predominant cellular fatty acids were the saturated fatty acids C(14:0) (15.58%), C(16:0) (25.40%) and C(18:0) (12.03%). Phylogenetic analysis based on 16S rRNA gene sequence similarity revealed that strain GW(T) represented a new branch within cluster XII of the Clostridium subphylum, with <89.6% 16S rRNA gene sequence similarities to all described species. On the basis of polyphasic evidence from this study, strain GW(T) represents a new genus and novel species, for which the name Proteiniborus ethanoligenes gen. nov., sp. nov. is proposed. The type strain is GW(T) (=CGMCC 1.5055(T)=JCM 14574(T)).

Streptomyces songpinggouensis sp. nov., a Novel Actinomycete Isolated from Soil in Sichuan, China.

PubMed

Guan, Xuejiao; Li, Wenchao; Liu, Chongxi; Jin, Pinjiao; Guo, Siyu; Wang, Xiangjing; Xiang, Wensheng

2016-12-01

During a screening for novel and biotechnologically useful actinobacteria, a novel actinobacteria with weak antifungal activity, designated strain NEAU-Spg19 T , was isolated from a soil sample collected from pine forest in Songpinggou, Sichuan, southwest China. The strain was characterized using a polyphasic taxonomic approach which confirmed that it belongs to the genus Streptomyces. Growth occurred at a temperature range of 10-30 °C, pH 5.0-11.0 and NaCl concentrations of 0-5 %. The cell wall peptidoglycan consisted of LL-diaminopimelic acid and glycine. The major menaquinones were MK-9(H 6 ), MK-9(H 8 ) and MK-9(H 4 ). The phospholipid profile contained diphosphatidylglycerol (DPG), phosphatidylethanolamine and phosphatidylinositol. The major fatty acids were iso-C 15:0 , iso-C 16:0 , and C 16:0 . 16S rRNA gene sequence similarity studies showed that strain NEAU-Spg19 T belongs to the genus Streptomyces with the highest sequence similarities to Streptomyces tauricus JCM 4837 T (98.6 %) and Streptomyces rectiviolaceus JCM 9092 T (98.3 %). Some physiological and biochemical properties and low DNA-DNA relatedness values enabled the strain to be differentiated from S. tauricus JCM 4837 T and S. rectiviolaceus JCM 9092 T . Hence, on the basis of phenotypic and genetic analyses, it is proposed that strain NEAU-Spg19 T represents a novel species of the genus Streptomyces, for which the name Streptomyces songpinggouensis sp. nov. is proposed. The type strain is NEAU-Spg19 T (=CGMCC 4.7140 T =DSM 42141 T ).

A Deep-Coverage Tomato BAC Library and Prospects Toward Development of an STC Framework for Genome Sequencing

PubMed Central

Budiman, Muhammad A.; Mao, Long; Wood, Todd C.; Wing, Rod A.

2000-01-01

Recently a new strategy using BAC end sequences as sequence-tagged connectors (STCs) was proposed for whole-genome sequencing projects. In this study, we present the construction and detailed characterization of a 15.0 haploid genome equivalent BAC library for the cultivated tomato, Lycopersicon esculentum cv. Heinz 1706. The library contains 129,024 clones with an average insert size of 117.5 kb and a chloroplast content of 1.11%. BAC end sequences from 1490 ends were generated and analyzed as a preliminary evaluation for using this library to develop an STC framework to sequence the tomato genome. A total of 1205 BAC end sequences (80.9%) were obtained, with an average length of 360 high-quality bases, and were searched against the GenBank database. Using a cutoff expectation value of <10−6, and combining the results from BLASTN, BLASTX, and TBLASTX searches, 24.3% of the BAC end sequences were similar to known sequences, of which almost half (48.7%) share sequence similarities to retrotransposons and 7% to known genes. Some of the transposable element sequences were the first reported in tomato, such as sequences similar to maize transposon Activator (Ac) ORF and tobacco pararetrovirus-like sequences. Interestingly, there were no BAC end sequences similar to the highly repeated TGRI and TGRII elements. However, the majority (70.3%) of STCs did not share significant sequence similarities to any sequences in GenBank at either the DNA or predicted protein levels, indicating that a large portion of the tomato genome is still unknown. Our data demonstrate that this BAC library is suitable for developing an STC database to sequence the tomato genome. The advantages of developing an STC framework for whole-genome sequencing of tomato are discussed. [The BAC end sequences described in this paper have been deposited in the GenBank data library under accession nos. AQ367111–AQ368361.] PMID:10645957

The Effects of Within-Sequence Acoustic Similarity on the Short-Term Retention of Consonants and Words

ERIC Educational Resources Information Center

Marcer, D.; And Others

1977-01-01

Compares the rates of forgetting of five-item sequences of acoustically similar and dissimilar consonants and words in the absence of proactive and retroactive interference in order to test whether within sequence similarity rather than stimulus length would have a greater influence on retention. (Author/RK)

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Bat Accelerated Regions Identify a Bat Forelimb Specific Enhancer in the HoxD Locus

PubMed Central

Mason, Mandy K.; VanderMeer, Julia E.; Zhao, Jingjing; Eckalbar, Walter L.; Logan, Malcolm; Illing, Nicola; Pollard, Katherine S.; Ahituv, Nadav

2016-01-01

The molecular events leading to the development of the bat wing remain largely unknown, and are thought to be caused, in part, by changes in gene expression during limb development. These expression changes could be instigated by variations in gene regulatory enhancers. Here, we used a comparative genomics approach to identify regions that evolved rapidly in the bat ancestor, but are highly conserved in other vertebrates. We discovered 166 bat accelerated regions (BARs) that overlap H3K27ac and p300 ChIP-seq peaks in developing mouse limbs. Using a mouse enhancer assay, we show that five Myotis lucifugus BARs drive gene expression in the developing mouse limb, with the majority showing differential enhancer activity compared to the mouse orthologous BAR sequences. These include BAR116, which is located telomeric to the HoxD cluster and had robust forelimb expression for the M. lucifugus sequence and no activity for the mouse sequence at embryonic day 12.5. Developing limb expression analysis of Hoxd10-Hoxd13 in Miniopterus natalensis bats showed a high-forelimb weak-hindlimb expression for Hoxd10-Hoxd11, similar to the expression trend observed for M. lucifugus BAR116 in mice, suggesting that it could be involved in the regulation of the bat HoxD complex. Combined, our results highlight novel regulatory regions that could be instrumental for the morphological differences leading to the development of the bat wing. PMID:27019019

Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).

PubMed

Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F

1996-05-01

Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.

SSAW: A new sequence similarity analysis method based on the stationary discrete wavelet transform.

PubMed

Lin, Jie; Wei, Jing; Adjeroh, Donald; Jiang, Bing-Hua; Jiang, Yue

2018-05-02

Alignment-free sequence similarity analysis methods often lead to significant savings in computational time over alignment-based counterparts. A new alignment-free sequence similarity analysis method, called SSAW is proposed. SSAW stands for Sequence Similarity Analysis using the Stationary Discrete Wavelet Transform (SDWT). It extracts k-mers from a sequence, then maps each k-mer to a complex number field. Then, the series of complex numbers formed are transformed into feature vectors using the stationary discrete wavelet transform. After these steps, the original sequence is turned into a feature vector with numeric values, which can then be used for clustering and/or classification. Using two different types of applications, namely, clustering and classification, we compared SSAW against the the-state-of-the-art alignment free sequence analysis methods. SSAW demonstrates competitive or superior performance in terms of standard indicators, such as accuracy, F-score, precision, and recall. The running time was significantly better in most cases. These make SSAW a suitable method for sequence analysis, especially, given the rapidly increasing volumes of sequence data required by most modern applications.

T cell receptor repertoires of mice and humans are clustered in similarity networks around conserved public CDR3 sequences

PubMed Central

Madi, Asaf; Poran, Asaf; Shifrut, Eric; Reich-Zeliger, Shlomit; Greenstein, Erez; Zaretsky, Irena; Arnon, Tomer; Laethem, Francois Van; Singer, Alfred; Lu, Jinghua; Sun, Peter D; Cohen, Irun R; Friedman, Nir

2017-01-01

Diversity of T cell receptor (TCR) repertoires, generated by somatic DNA rearrangements, is central to immune system function. However, the level of sequence similarity of TCR repertoires within and between species has not been characterized. Using network analysis of high-throughput TCR sequencing data, we found that abundant CDR3-TCRβ sequences were clustered within networks generated by sequence similarity. We discovered a substantial number of public CDR3-TCRβ segments that were identical in mice and humans. These conserved public sequences were central within TCR sequence-similarity networks. Annotated TCR sequences, previously associated with self-specificities such as autoimmunity and cancer, were linked to network clusters. Mechanistically, CDR3 networks were promoted by MHC-mediated selection, and were reduced following immunization, immune checkpoint blockade or aging. Our findings provide a new view of T cell repertoire organization and physiology, and suggest that the immune system distributes its TCR sequences unevenly, attending to specific foci of reactivity. DOI: http://dx.doi.org/10.7554/eLife.22057.001 PMID:28731407

Strong foreshock signal preceding the L'Aquila (Italy) earthquake (M_w~6.3) of 6~April~2009

NASA Astrophysics Data System (ADS)

Papadopoulos, G. A.; Charalampakis, M.; Fokaefs, A.; Minadakis, G.

2010-01-01

We used the earthquake catalogue of INGV extending from 1 January 2006 to 30 June 2009 to detect significant changes before and after the 6 April 2009 L'Aquila mainshock (Mw=6.3) in the seismicity rate, r (events/day), and in b-value. The statistical z-test and Utsu-test were applied to identify significant changes. From the beginning of 2006 up to the end of October 2008 the activity was relatively stable and remained in the state of background seismicity (r=1.14, b=1.09). From 28 October 2008 up to 26 March 2009, r increased significantly to 2.52 indicating weak foreshock sequence; the b-value did not changed significantly. The weak foreshock sequence was spatially distributed within the entire seismogenic area. In the last 10 days before the mainshock, strong foreshock signal became evident in space (dense epicenter concentration in the hanging-wall of the Paganica fault), in time (drastic increase of r to 21.70 events/day) and in size (b-value dropped significantly to 0.68). The significantly high seismicity rate and the low b-value in the entire foreshock sequence make a substantial difference from the background seismicity. Also, the b-value of the strong foreshock stage (last 10 days before mainshock) was significantly lower than that in the aftershock sequence. Our results indicate the important value of the foreshock sequences for the prediction of the mainshock.

Identification of Differentially Methylated Sites with Weak Methylation Effects

PubMed Central

Tran, Hong; Zhu, Hongxiao; Wu, Xiaowei; Kim, Gunjune; Clarke, Christopher R.; Larose, Hailey; Haak, David C.; Westwood, James H.; Zhang, Liqing

2018-01-01

Deoxyribonucleic acid (DNA) methylation is an epigenetic alteration crucial for regulating stress responses. Identifying large-scale DNA methylation at single nucleotide resolution is made possible by whole genome bisulfite sequencing. An essential task following the generation of bisulfite sequencing data is to detect differentially methylated cytosines (DMCs) among treatments. Most statistical methods for DMC detection do not consider the dependency of methylation patterns across the genome, thus possibly inflating type I error. Furthermore, small sample sizes and weak methylation effects among different phenotype categories make it difficult for these statistical methods to accurately detect DMCs. To address these issues, the wavelet-based functional mixed model (WFMM) was introduced to detect DMCs. To further examine the performance of WFMM in detecting weak differential methylation events, we used both simulated and empirical data and compare WFMM performance to a popular DMC detection tool methylKit. Analyses of simulated data that replicated the effects of the herbicide glyphosate on DNA methylation in Arabidopsis thaliana show that WFMM results in higher sensitivity and specificity in detecting DMCs compared to methylKit, especially when the methylation differences among phenotype groups are small. Moreover, the performance of WFMM is robust with respect to small sample sizes, making it particularly attractive considering the current high costs of bisulfite sequencing. Analysis of empirical Arabidopsis thaliana data under varying glyphosate dosages, and the analysis of monozygotic (MZ) twins who have different pain sensitivities—both datasets have weak methylation effects of <1%—show that WFMM can identify more relevant DMCs related to the phenotype of interest than methylKit. Differentially methylated regions (DMRs) are genomic regions with different DNA methylation status across biological samples. DMRs and DMCs are essentially the same concepts, with the only difference being how methylation information across the genome is summarized. If methylation levels are determined by grouping neighboring cytosine sites, then they are DMRs; if methylation levels are calculated based on single cytosines, they are DMCs. PMID:29419727

Social interactions between live and artificial weakly electric fish: Electrocommunication and locomotor behavior of Mormyrus rume proboscirostris towards a mobile dummy fish

PubMed Central

Kirschbaum, Frank; von der Emde, Gerhard

2017-01-01

Mormyrid weakly electric fish produce short, pulse-type electric organ discharges for actively probing their environment and to communicate with conspecifics. Animals emit sequences of pulse-trains that vary in overall frequency and temporal patterning and can lead to time-locked interactions with the discharge activity of other individuals. Both active electrolocation and electrocommunication are additionally accompanied by stereotypical locomotor patterns. However, the concrete roles of electrical and locomotor patterns during social interactions in mormyrids are not well understood. Here we used a mobile fish dummy that was emitting different types of electrical playback sequences to study following behavior and interaction patterns (electrical and locomotor) between individuals of weakly electric fish. We confronted single individuals of Mormyrus rume proboscirostris with a mobile dummy fish designed to attract fish from a shelter and recruit them into an open area by emitting electrical playbacks of natural discharge sequences. We found that fish were reliably recruited by the mobile dummy if it emitted electrical signals and followed it largely independently of the presented playback patterns. While following the dummy, fish interacted with it spatially by displaying stereotypical motor patterns, as well as electrically, e.g. through discharge regularizations and by synchronizing their own discharge activity to the playback. However, the overall emission frequencies of the dummy were not adopted by the following fish. Instead, social signals based on different temporal patterns were emitted depending on the type of playback. In particular, double pulses were displayed in response to electrical signaling of the dummy and their expression was positively correlated with an animals' rank in the dominance hierarchy. Based on additional analysis of swimming trajectories and stereotypical locomotor behavior patterns, we conclude that the reception and emission of electrical communication signals play a crucial role in mediating social interactions in mormyrid weakly electric fish. PMID:28902915

Mesoarchean Banded Iron Formation sequences in Dixon Island-Cleaverville Formation, Pilbara Australia: Oxygenic signal from DXCL project

NASA Astrophysics Data System (ADS)

Kiyokawa, S.; Ito, T.; Ikehara, M.; Yamaguchi, K. E.; Naraoka, H.; Onoue, T.; Horie, K.; Sakamoto, R.; Aihara, Y.; Miki, T.

2013-12-01

The 3.2-3.1 Ga Dixon island-Cleaverville formations are well-preserved Banded Iron Formation (BIF) within hydrothermal oceanic sequence at oceanic island arc setting (Kiyokawa et al., 2002, 2006, 2012). The stratigraphy of the Dixon Island (3195+15Ma) -Cleaverville (3108+13Ma) formations shows the well preserved environmental condition at the Mesoarchean ocean floor. The stratigraphy of these formations are formed about volcano-sedimentary sequences with hydrothermal chert, black shale and banded iron formation to the top. Based on the scientific drilling of DXCL project at 2007 and 2011, detail lithology between BIF sequence was clearly understood. Four drilling holes had been done at coastal sites; the Dixon Island Formation is DX site (100m) and the Cleaverville Formation is CL2 (40m), CL1 (60m) and CL3 (200m) sites and from stratigraphic bottom to top. Coarsening and thickening upward black shale-BIF sequences are well preserved of the stratigraphy form the core samples. The Dixon Island Formation consists komatiite-rhyolite sequences with many hydrothermal veins and very fine laminated cherty rocks above them. The Cleaverville Formation contains black shale, fragments-bearing pyroclastic beds, white chert, greenish shale and BIF. The CL3 core, which drilled through BIF, shows siderite-chert beds above black shale identified before magnetite lamination bed. U-Pb SHRIMP data of the tuff in lower Dixon Island Formation is 3195+15 Ma and the pyroclastic sequence below the Cleaverville BIF is 3108+13 Ma. Sedimentation rate of these sequence is 2-8 cm/ 1000year. The hole section of the organic carbon rich black shales below BIF are similar amount of organic content and 13C isotope (around -30per mill). There are very weak sulfur MIF signal (less 0.2%) in these black shale sequence. Our result show that thick organic rich sediments may be triggered to form iron rich siderite and magnetite iron beds. The stratigraphy in this sequence quite resemble to other Iron formation (eg. Hamersley BIF). So we investigate that the Cleaverville iron formation, which is one of the best well known Mesoarchean iron formation, was already started cyanobacteria oxygen production system to used pre-syn iron sedimentation at anoxic oceanic condition.

Identification of the centromeric repeat in the threespine stickleback fish (Gasterosteus aculeatus).

PubMed

Cech, Jennifer N; Peichel, Catherine L

2015-12-01

Centromere sequences exist as gaps in many genome assemblies due to their repetitive nature. Here we take an unbiased approach utilizing centromere protein A (CENP-A) chomatin immunoprecipitation followed by high-throughput sequencing to identify the centromeric repeat sequence in the threespine stickleback fish (Gasterosteus aculeatus). A 186-bp, AT-rich repeat was validated as centromeric using both fluorescence in situ hybridization (FISH) and immunofluorescence combined with FISH (IF-FISH) on interphase nuclei and metaphase spreads. This repeat hybridizes strongly to the centromere on all chromosomes, with the exception of weak hybridization to the Y chromosome. Together, our work provides the first validated sequence information for the threespine stickleback centromere.

Ultra-weak sector, Higgs boson mass, and the dilaton

DOE PAGES

Allison, Kyle; Hill, Christopher T.; Ross, Graham G.

2014-09-26

The Higgs boson mass may arise from a portal coupling to a singlet fieldmore » $$\\sigma$$ which has a very large VEV $$f \\gg m_\\text{Higgs}$$. This requires a sector of "ultra-weak" couplings $$\\zeta_i$$, where $$\\zeta_i \\lesssim m_\\text{Higgs}^2 / f^2$$. Ultra-weak couplings are technically naturally small due to a custodial shift symmetry of $$\\sigma$$ in the $$\\zeta_i \\rightarrow 0$$ limit. The singlet field $$\\sigma$$ has properties similar to a pseudo-dilaton. We engineer explicit breaking of scale invariance in the ultra-weak sector via a Coleman-Weinberg potential, which requires hierarchies amongst the ultra-weak couplings.« less

Sodium in weak G-band giants

NASA Technical Reports Server (NTRS)

Drake, Jeremy J.; Lambert, David L.

1994-01-01

Sodium abundances have been determined for eight weak G-band giants whose atmospheres are greatly enriched with products of the CN-cycling H-burning reactions. Systematic errors are minimized by comparing the weak G-band giants to a sample of similar but normal giants. If, further, Ca is selected as a reference element, model atmosphere-related errors should largely be removed. For the weak-G-band stars (Na/Ca) = 0.16 +/- 0.01, which is just possibly greater than the result (Na/Ca) = 0.10 /- 0.03 from the normal giants. This result demonstrates that the atmospheres of the weak G-band giants are not seriously contaminated with products of ON cycling.

Mouse Vk gene classification by nucleic acid sequence similarity.

PubMed

Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

1989-01-01

Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

RATIONAL APPROXIMATIONS TO GENERALIZED HYPERGEOMETRIC FUNCTIONS.

DTIC Science & Technology

Under weak restrictions on the various free parameters, general theorems for rational representations of the generalized hypergeometric functions...and certain Meijer G-functions are developed. Upon specialization, these theorems yield a sequency of rational approximations which converge to the

A Web-Based Monitoring System for Multidisciplinary Design Projects

NASA Technical Reports Server (NTRS)

Rogers, James L.; Salas, Andrea O.; Weston, Robert P.

1998-01-01

In today's competitive environment, both industry and government agencies are under pressure to reduce the time and cost of multidisciplinary design projects. New tools have been introduced to assist in this process by facilitating the integration of and communication among diverse disciplinary codes. One such tool, a framework for multidisciplinary computational environments, is defined as a hardware and software architecture that enables integration, execution, and communication among diverse disciplinary processes. An examination of current frameworks reveals weaknesses in various areas, such as sequencing, displaying, monitoring, and controlling the design process. The objective of this research is to explore how Web technology, integrated with an existing framework, can improve these areas of weakness. This paper describes a Web-based system that optimizes and controls the execution sequence of design processes; and monitors the project status and results. The three-stage evolution of the system with increasingly complex problems demonstrates the feasibility of this approach.

A Web-Based System for Monitoring and Controlling Multidisciplinary Design Projects

NASA Technical Reports Server (NTRS)

Salas, Andrea O.; Rogers, James L.

1997-01-01

In today's competitive environment, both industry and government agencies are under enormous pressure to reduce the time and cost of multidisciplinary design projects. A number of frameworks have been introduced to assist in this process by facilitating the integration of and communication among diverse disciplinary codes. An examination of current frameworks reveals weaknesses in various areas such as sequencing, displaying, monitoring, and controlling the design process. The objective of this research is to explore how Web technology, in conjunction with an existing framework, can improve these areas of weakness. This paper describes a system that executes a sequence of programs, monitors and controls the design process through a Web-based interface, and visualizes intermediate and final results through the use of Java(Tm) applets. A small sample problem, which includes nine processes with two analysis programs that are coupled to an optimizer, is used to demonstrate the feasibility of this approach.

Flag-based detection of weak gas signatures in long-wave infrared hyperspectral image sequences

NASA Astrophysics Data System (ADS)

Marrinan, Timothy; Beveridge, J. Ross; Draper, Bruce; Kirby, Michael; Peterson, Chris

2016-05-01

We present a flag manifold based method for detecting chemical plumes in long-wave infrared hyperspectral movies. The method encodes temporal and spatial information related to a hyperspectral pixel into a flag, or nested sequence of linear subspaces. The technique used to create the flags pushes information about the background clutter, ambient conditions, and potential chemical agents into the leading elements of the flags. Exploiting this temporal information allows for a detection algorithm that is sensitive to the presence of weak signals. This method is compared to existing techniques qualitatively on real data and quantitatively on synthetic data to show that the flag-based algorithm consistently performs better on data when the SINRdB is low, and beats the ACE and MF algorithms in probability of detection for low probabilities of false alarm even when the SINRdB is high.

Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.

PubMed

Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice

2007-04-01

A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.

Mechanism of Nucleic Acid Chaperone Function of Retroviral Nuceleocapsid (NC) Proteins

NASA Astrophysics Data System (ADS)

Rouzina, Ioulia; Vo, My-Nuong; Stewart, Kristen; Musier-Forsyth, Karin; Cruceanu, Margareta; Williams, Mark

2006-03-01

Recent studies have highlighted two main activities of HIV-1 NC protein contributing to its function as a universal nucleic acid chaperone. Firstly, it is the ability of NC to weakly destabilize all nucleic acid,(NA), secondary structures, thus resolving the kinetic traps for NA refolding, while leaving the annealed state stable. Secondly, it is the ability of NC to aggregate NA, facilitating the nucleation step of bi-molecular annealing by increasing the local NA concentration. In this work we use single molecule DNA stretching and gel-based annealing assays to characterize these two chaperone activities of NC by using various HIV-1 NC mutants and several other retroviral NC proteins. Our results suggest that two NC functions are associated with its zinc fingers and cationic residues, respectively. NC proteins from other retroviruses have similar activities, although expressed to a different degree. Thus, NA aggregating ability improves, and NA duplex destabilizing activity decreases in the sequence: MLV NC, HIV NC, RSV NC. In contrast, HTLV NC protein works very differently from other NC proteins, and similarly to typical single stranded NA binding proteins. These features of retroviral NCs co-evolved with the structure of their genomes.

Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

PubMed

Mackey, Aaron J; Pearson, William R

2004-10-01

Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

Correlation between protein sequence similarity and x-ray diffraction quality in the protein data bank.

PubMed

Lu, Hui-Meng; Yin, Da-Chuan; Ye, Ya-Jing; Luo, Hui-Min; Geng, Li-Qiang; Li, Hai-Sheng; Guo, Wei-Hong; Shang, Peng

2009-01-01

As the most widely utilized technique to determine the 3-dimensional structure of protein molecules, X-ray crystallography can provide structure of the highest resolution among the developed techniques. The resolution obtained via X-ray crystallography is known to be influenced by many factors, such as the crystal quality, diffraction techniques, and X-ray sources, etc. In this paper, the authors found that the protein sequence could also be one of the factors. We extracted information of the resolution and the sequence of proteins from the Protein Data Bank (PDB), classified the proteins into different clusters according to the sequence similarity, and statistically analyzed the relationship between the sequence similarity and the best resolution obtained. The results showed that there was a pronounced correlation between the sequence similarity and the obtained resolution. These results indicate that protein structure itself is one variable that may affect resolution when X-ray crystallography is used.

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

K2 and K2*: efficient alignment-free sequence similarity measurement based on Kendall statistics.

PubMed

Lin, Jie; Adjeroh, Donald A; Jiang, Bing-Hua; Jiang, Yue

2018-05-15

Alignment-free sequence comparison methods can compute the pairwise similarity between a huge number of sequences much faster than sequence-alignment based methods. We propose a new non-parametric alignment-free sequence comparison method, called K2, based on the Kendall statistics. Comparing to the other state-of-the-art alignment-free comparison methods, K2 demonstrates competitive performance in generating the phylogenetic tree, in evaluating functionally related regulatory sequences, and in computing the edit distance (similarity/dissimilarity) between sequences. Furthermore, the K2 approach is much faster than the other methods. An improved method, K2*, is also proposed, which is able to determine the appropriate algorithmic parameter (length) automatically, without first considering different values. Comparative analysis with the state-of-the-art alignment-free sequence similarity methods demonstrates the superiority of the proposed approaches, especially with increasing sequence length, or increasing dataset sizes. The K2 and K2* approaches are implemented in the R language as a package and is freely available for open access (http://community.wvu.edu/daadjeroh/projects/K2/K2_1.0.tar.gz). yueljiang@163.com. Supplementary data are available at Bioinformatics online.

Molecular cloning, expression analysis and functional characterization of interleukin-22 in So-iny mullet, Liza haematocheila.

PubMed

Qi, Zhitao; Zhang, Qihuan; Wang, Zisheng; Zhao, Weihong; Chen, Shannan; Gao, Qian

2015-02-01

In the present study, interleukin-22 (IL-22) from So-iny mullet (Liza haematocheila) was identified, and its tissue expression in both healthy and Streptococcus dysgalactiae-infected fish was examined. The full length cDNA sequence of mullet IL-22 was 1070bp, containing an open reading frame of 555bp. The deduced amino acid sequence shared high similarity (45.1-67.9%) with IL-22 from other fish species. Mullet IL-22 also contained an IL-10 family signature and four cysteine residues that were well conserved in other vertebrate IL-22 molecules. Mullet IL-22 mRNA was highly expressed in kidney, moderately expressed in liver and gut, and relatively weakly expressed in spleen, and its expression was significantly up-regulated in all the examined tissues following S. dysgalactiae infection. Furthermore, recombinant mullet IL-22 protein was shown to promote the expression of β-defensin in the four tissues and to increase the survival rate of the fish infected with S. dysgalactiae. Our results suggest mullet IL-22 plays an important role in the immune defense against bacterial infection and has the potential to be used to treat bacterial diseases in fish. Copyright © 2014 Elsevier Ltd. All rights reserved.

Structures of Bacterial Biosynthetic Arginine Decarboxylases

DOE Office of Scientific and Technical Information (OSTI.GOV)

F Forouhar; S Lew; J Seetharaman

2011-12-31

Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. Themore » TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.« less

PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

PubMed Central

Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

2015-01-01

The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

Pitch chroma discrimination, generalization, and transfer tests of octave equivalence in humans.

PubMed

Hoeschele, Marisa; Weisman, Ronald G; Sturdy, Christopher B

2012-11-01

Octave equivalence occurs when notes separated by an octave (a doubling in frequency) are judged as being perceptually similar. Considerable evidence points to the importance of the octave in music and speech. Yet, experimental demonstration of octave equivalence has been problematic. Using go/no-go operant discrimination and generalization, we studied octave equivalence in humans. In Experiment 1, we found that a procedure that failed to show octave equivalence in European starlings also failed in humans. In Experiment 2, we modified the procedure to control for the effects of pitch height perception by training participants in Octave 4 and testing in Octave 5. We found that the pattern of responding developed by discrimination training in Octave 4 generalized to Octave 5. We replicated and extended our findings in Experiment 3 by adding a transfer phase: Participants were trained with either the same or a reversed pattern of rewards in Octave 5. Participants transferred easily to the same pattern of reward in Octave 5 but struggled to learn the reversed pattern. We provided minimal instruction, presented no ordered sequences of notes, and used only sine-wave tones, but participants nonetheless constructed pitch chroma information from randomly ordered sequences of notes. Training in music weakly hindered octave generalization but moderately facilitated both positive and negative transfer.

Are Africans, Europeans, and Asians different "races"? A guided-inquiry lab for introducing undergraduate students to genetic diversity and preparing them to study natural selection.

PubMed

Kalinowski, Steven T; Andrews, Tessa M; Leonard, Mary J; Snodgrass, Meagan

2012-01-01

Many students do not recognize that individual organisms within populations vary, and this may make it difficult for them to recognize the essential role variation plays in natural selection. Also, many students have weak scientific reasoning skills, and this makes it difficult for them to recognize misconceptions they might have. This paper describes a 2-h laboratory for college students that introduces them to genetic diversity and gives them practice using hypothetico-deductive reasoning. In brief, the lab presents students with DNA sequences from Africans, Europeans, and Asians, and asks students to determine whether people from each continent qualify as distinct "races." Comparison of the DNA sequences shows that people on each continent are not more similar to one another than to people on other continents, and therefore do not qualify as distinct races. Ninety-four percent of our students reported that the laboratory was interesting, and 79% reported that it was a valuable learning experience. We developed and used a survey to measure the extent to which students recognized variation and its significance within populations and showed that the lab increased student awareness of variation. We also showed that the lab improved the ability of students to construct hypothetico-deductive arguments.

Detecting long tandem duplications in genomic sequences.

PubMed

Audemard, Eric; Schiex, Thomas; Faraut, Thomas

2012-05-08

Detecting duplication segments within completely sequenced genomes provides valuable information to address genome evolution and in particular the important question of the emergence of novel functions. The usual approach to gene duplication detection, based on all-pairs protein gene comparisons, provides only a restricted view of duplication. In this paper, we introduce ReD Tandem, a software using a flow based chaining algorithm targeted at detecting tandem duplication arrays of moderate to longer length regions, with possibly locally weak similarities, directly at the DNA level. On the A. thaliana genome, using a reference set of tandem duplicated genes built using TAIR,(a) we show that ReD Tandem is able to predict a large fraction of recently duplicated genes (dS  <  1) and that it is also able to predict tandem duplications involving non coding elements such as pseudo-genes or RNA genes. ReD Tandem allows to identify large tandem duplications without any annotation, leading to agnostic identification of tandem duplications. This approach nicely complements the usual protein gene based which ignores duplications involving non coding regions. It is however inherently restricted to relatively recent duplications. By recovering otherwise ignored events, ReD Tandem gives a more comprehensive view of existing evolutionary processes and may also allow to improve existing annotations.

LORETA indicates frequency-specific suppressions of current sources within the cerebrums of blindfolded subjects from patterns of blue light flashes applied over the skull.

PubMed

Karbowski, Lukasz M; Saroka, Kevin S; Murugan, Nirosha J; Persinger, Michael A

2015-10-01

An array of eight cloistered (completely covered) 470-nm LEDs was attached to the right caudal scalp of subjects while each sat blindfolded within a darkened chamber. The LEDs were activated by a computer-generated complex (frequency-modulated) temporal pattern that, when applied as weak magnetic fields, has elicited sensed presences and changes in LORETA (low-resolution electromagnetic tomography) configurations. Serial 5-min on to 5-min off presentations of the blue light (10,000lx) resulted in suppression of gamma activity within the right cuneus (including the extrastriate area), beta activity within the left angular and right superior temporal regions, and alpha power within the right parahippocampal region. The effect required about 5min to emerge followed by a transient asymptote for about 15 to 20min when diminished current source density was evident even during no light conditions. Subjective experiences, as measured by our standard exit questionnaire, reflected sensations similar to those reported when the pattern was presented as a weak magnetic field. Given previous evidence that photon flux density of this magnitude can penetrate the skull, these results suggest that properly configured LEDs that generate physiologically patterned light sequences might be employed as noninvasive methods to explore the dynamic characteristics of cerebral activity in epileptic and nonepileptic brains. Copyright © 2015 Elsevier Inc. All rights reserved.

Insights to Galaxy Evolution Utilizing a Multivariate Comparison of Circumgalactic OVI and MgII

NASA Astrophysics Data System (ADS)

Lewis, James; Churchill, Christopher; Nielsen, Nikole; Kacprzak, Glenn; Muzahid, Sowgat; Charlton, Jane

2018-01-01

We present a promising multivariate method to categorize inter-related astronomical data in meaningful ways. We use data from the MAGIICAT and "Multiphase Galaxy Halos" surveys and limit our sample to those galaxies which are imaged with the Hubble Space Telescope and for which the Circumgalactic Medium (CGM) is measured using high-resolution quasar spectra (HIRES/COS). Utilizing the method to categorize data about the CGM and its host galaxy yields distinct categories of CGM-galaxy pairs that imply a common fate for the outflows of MgII and OVI in redder galaxies. The analysis reveals a lack of circumgalactic OVI in lower mass, bluer (younger) galaxies, and that as the blue galaxies gain mass and age along the green valley strong OVI appears in the CGM predominately along the minor axes. But as the galaxies continue to gain mass and age into the red sequence strong OVI gas is found primarily along the major axes. Furthermore, we find a population of low mass red galaxies in which only weak, uniform, circumgalactic OVI is found. Incorporating our multivariate results for circumgalactic MgII, including evidence for quenching of star formation via weak circumgalactic MgII preferentially found along the minor axes of redder galaxies, and invoking the similarity of OVI column densities and kinematic spreads along the major and minor axes, we infer that OVI is ancient gas in the CGM.

The structured ancestral selection graph and the many-demes limit.

PubMed

Slade, Paul F; Wakeley, John

2005-02-01

We show that the unstructured ancestral selection graph applies to part of the history of a sample from a population structured by restricted migration among subpopulations, or demes. The result holds in the limit as the number of demes tends to infinity with proportionately weak selection, and we have also made the assumptions of island-type migration and that demes are equivalent in size. After an instantaneous sample-size adjustment, this structured ancestral selection graph converges to an unstructured ancestral selection graph with a mutation parameter that depends inversely on the migration rate. In contrast, the selection parameter for the population is independent of the migration rate and is identical to the selection parameter in an unstructured population. We show analytically that estimators of the migration rate, based on pairwise sequence differences, derived under the assumption of neutrality should perform equally well in the presence of weak selection. We also modify an algorithm for simulating genealogies conditional on the frequencies of two selected alleles in a sample. This permits efficient simulation of stronger selection than was previously possible. Using this new algorithm, we simulate gene genealogies under the many-demes ancestral selection graph and identify some situations in which migration has a strong effect on the time to the most recent common ancestor of the sample. We find that a similar effect also increases the sensitivity of the genealogy to selection.

Advances in DNA sequencing technologies for high resolution HLA typing.

PubMed

Cereb, Nezih; Kim, Hwa Ran; Ryu, Jaejun; Yang, Soo Young

2015-12-01

This communication describes our experience in large-scale G group-level high resolution HLA typing using three different DNA sequencing platforms - ABI 3730 xl, Illumina MiSeq and PacBio RS II. Recent advances in DNA sequencing technologies, so-called next generation sequencing (NGS), have brought breakthroughs in deciphering the genetic information in all living species at a large scale and at an affordable level. The NGS DNA indexing system allows sequencing multiple genes for large number of individuals in a single run. Our laboratory has adopted and used these technologies for HLA molecular testing services. We found that each sequencing technology has its own strengths and weaknesses, and their sequencing performances complement each other. HLA genes are highly complex and genotyping them is quite challenging. Using these three sequencing platforms, we were able to meet all requirements for G group-level high resolution and high volume HLA typing. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

More on the Cause-Effect Sequence

NASA Astrophysics Data System (ADS)

Janik, Jerzy A.

2007-06-01

Does every event have a cause? An answer is not simple. The notion of cause contains a particular being y acting on being x plus everything that may be called the boundary conditions. These may form necessary and suffcient conditions giving rise to a strong cause, or only necessary conditions, giving rise to a weak cause. These matters are discussed in this article with particular attention being paid to the argumentation of Thomas Aquinas known as prima via. Prima via is the analysis of a cause-effect sequence which leads (according to Thomas) to a First Cause (First Mover). It seems that the extrapolation of the cause-effect sequence to infinity is permissible from the logical point of view. But the possibility of weak causes seems to destroy the cause-effect "line". Here it is perhaps useful to "escape" to the metaphysical abstraction which looks at things sub ratione entitatis. If we ignore space and time (which is characteristic of this abstraction) we are led to believe that the IS of cause is finally unavoidable, which means that from the vantage point of this abstraction, i.e. from the point of view of IS, all causes are strong.

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Next-Generation Sequence Analysis of the Genome of RFHVMn, the Macaque Homolog of Kaposi's Sarcoma (KS)-Associated Herpesvirus, from a KS-Like Tumor of a Pig-Tailed Macaque

PubMed Central

Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung

2013-01-01

The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218

Application of transcerebral, weak (1 microT) complex magnetic fields and mystical experiences: are they generated by field-induced dimethyltryptamine release from the pineal organ?

PubMed

Hill, D R; Persinger, M A

2003-12-01

During the last 15 years weak, complex magnetic fields have been applied across the two cerebral hemispheres at the level of the temporoparietal lobes of more than 500 volunteers. Most of these subjects have reported visual, vestibular, and proprioceptive sensations as well as experiences of detachment from the body of 'sentient beings'. Similar but more intense experiences were reported by Strassman in 2001 for volunteers who were injected with N,n-dimethyltryptamine, a compound Strassman hypothesized as the primary mediator of these experiences. If this speculation is valid, then subjects who are exposed to the very weak, complex fields known to elicit similar experiences should display significant increases in the metabolites of this compound within their blood.

Using SQL Databases for Sequence Similarity Searching and Analysis.

PubMed

Pearson, William R; Mackey, Aaron J

2017-09-13

Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Asymptotic response of observables from divergent weak-coupling expansions: a fractional-calculus-assisted Padé technique.

PubMed

Dhatt, Sharmistha; Bhattacharyya, Kamal

2012-08-01

Appropriate constructions of Padé approximants are believed to provide reasonable estimates of the asymptotic (large-coupling) amplitude and exponent of an observable, given its weak-coupling expansion to some desired order. In many instances, however, sequences of such approximants are seen to converge very poorly. We outline here a strategy that exploits the idea of fractional calculus to considerably improve the convergence behavior. Pilot calculations on the ground-state perturbative energy series of quartic, sextic, and octic anharmonic oscillators reveal clearly the worth of our endeavor.

Early Cretaceous Ductile Deformation of Marbles from the Western Hills of Beijing, North China Craton

NASA Astrophysics Data System (ADS)

Feng, H.; Liu, J.

2017-12-01

During the Early Cretaceous tectonic lithosphere extension, the pre-mesozoic rocks from the Western Hills in the central part of the North China Craton suffered from weak metamorphism but intense shear deformation. The prominent features of the deformation structures are the coexisting layer-parallel shear zones and intrafolia folds, and the along-strike thickness variations of the marble layers from the highly sheared Mesoproterozoic Jing'eryu Formation. Platy marbles are well-developed in the thinner layers, while intrafolia folds are often observed in the thicker layers. Most folds are tight recumbent folds and their axial planes are parallel to the foliations and layerings of the marbles. The folds are A-type folds with hinges being always paralleling to the stretching lineations consistently oriented at 130°-310° directions throughout the entire area. SPO and microstructural analyses of the sheared marbles suggest that the thicker layers suffered from deformations homogeneously, while strain localization can be distinguished in the thinner layers. Calcite twin morphology and CPO analysis indicate that the deformation of marbles from both thinner and thicker layers happened at temperatures of 300 to 500°C. The above analysis suggests that marbles in the thicker layers experienced a progressive sequence of thermodynamic events: 1) regional metamorphism, 2) early ductile deformation dominated by relatively higher temperature conditions, during which all the mineral particles elongated and oriented limitedly and the calcite grains are deformed mainly by mechanical twinning, and 3) late superimposition of relatively lower temperature deformation and recrystallization, which superposed the early deformation, and made the calcites finely granulated, elongated and oriented by dynamical recrystallization along with other grains. Marbles from the thinner layers, however, experienced a similar, but different sequence of thermo-dynamic events, i.e. regional metamorphism, early ductile deformation and weak superimposition by subsequent deformation, which caused the development of the strain localization. It is also shown that the intensity of progressive superimposition deformation contributed to the thinning and thickening of the marble layers.

Genomic characterization and expression profiles upon bacterial infection of a novel cystatin B homologue from disk abalone (Haliotis discus discus).

PubMed

Premachandra, H K A; Wan, Qiang; Elvitigala, Don Anushka Sandaruwan; De Zoysa, Mahanama; Choi, Cheol Young; Whang, Ilson; Lee, Jehee

2012-12-01

Cystatins are a large family of cysteine proteinase inhibitors which are involved in diverse biological and pathological processes. In the present study, we identified a gene related to cystatin superfamily, AbCyt B, from disk abalone Haliotis discus discus by expressed sequence tag (EST) analysis and BAC library screening. The complete cDNA sequence of AbCyt B is comprised of 1967 nucleotides with a 306 bp open reading frame (ORF) encoding for 101 amino acids. The amino acid sequence consists of a single cystatin-like domain, which has a cysteine proteinase inhibitor signature, a conserved Gly in N-terminal region, QVVAG motif and a variant of PW motif. No signal peptide, disulfide bonds or carbohydrate side chains were identified. Analysis of deduced amino acid sequence revealed that AbCyt B shares up to 44.7% identity and 65.7% similarity with the cystatin B genes from other organisms. The genomic sequence of AbCyt B is approximately 8.4 Kb, consisting of three exons and two introns. Phylogenetic tree analysis showed that AbCyt B was closely related to the cystatin B from pacific oyster (Crassostrea gigas) under the family 1.Functional analysis of recombinant AbCyt B protein exhibited inhibitory activity against the papain, with almost 84% inhibition at a concentration of 3.5 μmol/L. In tissue expression analysis, AbCyt B transcripts were expressed abundantly in the hemocyte, gill, mantle, and digestive tract, while weakly in muscle, testis, and hepatopancreas. After the immune challenge with Vibrio parahemolyticus, the AbCyt B showed significant (P<0.05) up-regulation of relative mRNA expression in gill and hemocytes at 24 and 6 h of post infection, respectively. These results collectively suggest that AbCyst B is a potent inhibitor of cysteine proteinases and is also potentially involved in immune responses against invading bacterial pathogens in abalone. Copyright © 2012 Elsevier Ltd. All rights reserved.

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment

PubMed Central

2013-01-01

Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200

Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

PubMed

Nagar, Anurag; Hahsler, Michael

2013-01-01

Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.

SIMAP--a comprehensive database of pre-calculated protein sequence similarities, domains, annotations and clusters.

PubMed

Rattei, Thomas; Tischler, Patrick; Götz, Stefan; Jehl, Marc-André; Hoser, Jonathan; Arnold, Roland; Conesa, Ana; Mewes, Hans-Werner

2010-01-01

The prediction of protein function as well as the reconstruction of evolutionary genesis employing sequence comparison at large is still the most powerful tool in sequence analysis. Due to the exponential growth of the number of known protein sequences and the subsequent quadratic growth of the similarity matrix, the computation of the Similarity Matrix of Proteins (SIMAP) becomes a computational intensive task. The SIMAP database provides a comprehensive and up-to-date pre-calculation of the protein sequence similarity matrix, sequence-based features and sequence clusters. As of September 2009, SIMAP covers 48 million proteins and more than 23 million non-redundant sequences. Novel features of SIMAP include the expansion of the sequence space by including databases such as ENSEMBL as well as the integration of metagenomes based on their consistent processing and annotation. Furthermore, protein function predictions by Blast2GO are pre-calculated for all sequences in SIMAP and the data access and query functions have been improved. SIMAP assists biologists to query the up-to-date sequence space systematically and facilitates large-scale downstream projects in computational biology. Access to SIMAP is freely provided through the web portal for individuals (http://mips.gsf.de/simap/) and for programmatic access through DAS (http://webclu.bio.wzw.tum.de/das/) and Web-Service (http://mips.gsf.de/webservices/services/SimapService2.0?wsdl).

SCPRED: accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences.

PubMed

Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

2008-05-01

Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods.

SCPRED: Accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences

PubMed Central

Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

2008-01-01

Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods. PMID:18452616

Computational Identification Of CDR3 Sequence Archetypes Among Immunoglobulin Sequences in Chronic Lymphocytic Leukemia

PubMed Central

Messmer, Bradley T; Raphael, Benjamin J; Aerni, Sarah J; Widhopf, George F; Rassenti, Laura Z; Gribben, John G; Kay, Neil E; Kipps, Thomas J

2009-01-01

The leukemia cells of unrelated patients with chronic lymphocytic leukemia (CLL) display a restricted repertoire of immunoglobulin (Ig) gene rearrangements with preferential usage of certain Ig gene segments. We developed a computational method to rigorously quantify biases in Ig sequence similarity in large patient databases and to identify groups of patients with unusual levels of sequence similarity. We applied our method to sequences from 1577 CLL patients through the CLL Research Consortium (CRC), and identified 67 similarity groups into which roughly 20% of all patients could be assigned. Immunoglobulin light chain class was highly correlated within all groups and light chain gene usage was similar within sets. Surprisingly, over 40% of the identified groups were composed of somatically mutated genes. This study significantly expands the evidence that antigen selection shapes the Ig repertoire in CLL. PMID:18640719

Computational identification of CDR3 sequence archetypes among immunoglobulin sequences in chronic lymphocytic leukemia.

PubMed

Messmer, Bradley T; Raphael, Benjamin J; Aerni, Sarah J; Widhopf, George F; Rassenti, Laura Z; Gribben, John G; Kay, Neil E; Kipps, Thomas J

2009-03-01

The leukemia cells of unrelated patients with chronic lymphocytic leukemia (CLL) display a restricted repertoire of immunoglobulin (Ig) gene rearrangements with preferential usage of certain Ig gene segments. We developed a computational method to rigorously quantify biases in Ig sequence similarity in large patient databases and to identify groups of patients with unusual levels of sequence similarity. We applied our method to sequences from 1577 CLL patients through the CLL Research Consortium (CRC), and identified 67 similarity groups into which roughly 20% of all patients could be assigned. Immunoglobulin light chain class was highly correlated within all groups and light chain gene usage was similar within sets. Surprisingly, over 40% of the identified groups were composed of somatically mutated genes. This study significantly expands the evidence that antigen selection shapes the Ig repertoire in CLL.

Mean convergence theorems and weak laws of large numbers for weighted sums of random variables under a condition of weighted integrability

NASA Astrophysics Data System (ADS)

Ordóñez Cabrera, Manuel; Volodin, Andrei I.

2005-05-01

From the classical notion of uniform integrability of a sequence of random variables, a new concept of integrability (called h-integrability) is introduced for an array of random variables, concerning an array of constantsE We prove that this concept is weaker than other previous related notions of integrability, such as Cesàro uniform integrability [Chandra, Sankhya Ser. A 51 (1989) 309-317], uniform integrability concerning the weights [Ordóñez Cabrera, Collect. Math. 45 (1994) 121-132] and Cesàro [alpha]-integrability [Chandra and Goswami, J. Theoret. ProbabE 16 (2003) 655-669]. Under this condition of integrability and appropriate conditions on the array of weights, mean convergence theorems and weak laws of large numbers for weighted sums of an array of random variables are obtained when the random variables are subject to some special kinds of dependence: (a) rowwise pairwise negative dependence, (b) rowwise pairwise non-positive correlation, (c) when the sequence of random variables in every row is [phi]-mixing. Finally, we consider the general weak law of large numbers in the sense of Gut [Statist. Probab. Lett. 14 (1992) 49-52] under this new condition of integrability for a Banach space setting.

Comparative Genomics of Bacillus species and its Relevance in Industrial Microbiology.

PubMed

Sharma, Archana; Satyanarayana, T

2013-01-01

With the advent of high throughput sequencing platforms and relevant analytical tools, the rate of microbial genome sequencing has accelerated which has in turn led to better understanding of microbial molecular biology and genetics. The complete genome sequences of important industrial organisms provide opportunities for human health, industry, and the environment. Bacillus species are the dominant workhorses in industrial fermentations. Today, genome sequences of several Bacillus species are available, and comparative genomics of this genus helps in understanding their physiology, biochemistry, and genetics. The genomes of these bacterial species are the sources of many industrially important enzymes and antibiotics and, therefore, provide an opportunity to tailor enzymes with desired properties to suit a wide range of applications. A comparative account of strengths and weaknesses of the different sequencing platforms are also highlighted in the review.

Community detection in sequence similarity networks based on attribute clustering

DOE PAGES

Chowdhary, Janamejaya; Loeffler, Frank E.; Smith, Jeremy C.

2017-07-24

Networks are powerful tools for the presentation and analysis of interactions in multi-component systems. A commonly studied mesoscopic feature of networks is their community structure, which arises from grouping together similar nodes into one community and dissimilar nodes into separate communities. Here in this paper, the community structure of protein sequence similarity networks is determined with a new method: Attribute Clustering Dependent Communities (ACDC). Sequence similarity has hitherto typically been quantified by the alignment score or its expectation value. However, pair alignments with the same score or expectation value cannot thus be differentiated. To overcome this deficiency, the method constructs,more » for pair alignments, an extended alignment metric, the link attribute vector, which includes the score and other alignment characteristics. Rescaling components of the attribute vectors qualitatively identifies a systematic variation of sequence similarity within protein superfamilies. The problem of community detection is then mapped to clustering the link attribute vectors, selection of an optimal subset of links and community structure refinement based on the partition density of the network. ACDC-predicted communities are found to be in good agreement with gold standard sequence databases for which the "ground truth" community structures (or families) are known. ACDC is therefore a community detection method for sequence similarity networks based entirely on pair similarity information. A serial implementation of ACDC is available from https://cmb.ornl.gov/resources/developments« less

An approach to large scale identification of non-obvious structural similarities between proteins

PubMed Central

Cherkasov, Artem; Jones, Steven JM

2004-01-01

Background A new sequence independent bioinformatics approach allowing genome-wide search for proteins with similar three dimensional structures has been developed. By utilizing the numerical output of the sequence threading it establishes putative non-obvious structural similarities between proteins. When applied to the testing set of proteins with known three dimensional structures the developed approach was able to recognize structurally similar proteins with high accuracy. Results The method has been developed to identify pathogenic proteins with low sequence identity and high structural similarity to host analogues. Such protein structure relationships would be hypothesized to arise through convergent evolution or through ancient horizontal gene transfer events, now undetectable using current sequence alignment techniques. The pathogen proteins, which could mimic or interfere with host activities, would represent candidate virulence factors. The developed approach utilizes the numerical outputs from the sequence-structure threading. It identifies the potential structural similarity between a pair of proteins by correlating the threading scores of the corresponding two primary sequences against the library of the standard folds. This approach allowed up to 64% sensitivity and 99.9% specificity in distinguishing protein pairs with high structural similarity. Conclusion Preliminary results obtained by comparison of the genomes of Homo sapiens and several strains of Chlamydia trachomatis have demonstrated the potential usefulness of the method in the identification of bacterial proteins with known or potential roles in virulence. PMID:15147578

Community detection in sequence similarity networks based on attribute clustering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chowdhary, Janamejaya; Loeffler, Frank E.; Smith, Jeremy C.

Networks are powerful tools for the presentation and analysis of interactions in multi-component systems. A commonly studied mesoscopic feature of networks is their community structure, which arises from grouping together similar nodes into one community and dissimilar nodes into separate communities. Here in this paper, the community structure of protein sequence similarity networks is determined with a new method: Attribute Clustering Dependent Communities (ACDC). Sequence similarity has hitherto typically been quantified by the alignment score or its expectation value. However, pair alignments with the same score or expectation value cannot thus be differentiated. To overcome this deficiency, the method constructs,more » for pair alignments, an extended alignment metric, the link attribute vector, which includes the score and other alignment characteristics. Rescaling components of the attribute vectors qualitatively identifies a systematic variation of sequence similarity within protein superfamilies. The problem of community detection is then mapped to clustering the link attribute vectors, selection of an optimal subset of links and community structure refinement based on the partition density of the network. ACDC-predicted communities are found to be in good agreement with gold standard sequence databases for which the "ground truth" community structures (or families) are known. ACDC is therefore a community detection method for sequence similarity networks based entirely on pair similarity information. A serial implementation of ACDC is available from https://cmb.ornl.gov/resources/developments« less

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Memory Profiles in Children with Mild Intellectual Disabilities: Strengths and Weaknesses

ERIC Educational Resources Information Center

Van der Molen, Mariet J.; Van Luit, Johannes E. H.; Jongmans, Marian J.; Van der Molen, Maurits W.

2009-01-01

Strengths and weaknesses in short-term memory (STM) and working memory (WM) were identified in children with mild intellectual disabilities (MID) by comparing their performance to typically developing children matched on chronological age (CA children) and to younger typically developing children with similar mental capacities (MA children).…

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Augmented brain function by coordinated reset stimulation with slowly varying sequences.

PubMed

Zeitler, Magteld; Tass, Peter A

2015-01-01

Several brain disorders are characterized by abnormally strong neuronal synchrony. Coordinated Reset (CR) stimulation was developed to selectively counteract abnormal neuronal synchrony by desynchronization. For this, phase resetting stimuli are delivered to different subpopulations in a timely coordinated way. In neural networks with spike timing-dependent plasticity CR stimulation may eventually lead to an anti-kindling, i.e., an unlearning of abnormal synaptic connectivity and abnormal synchrony. The spatiotemporal sequence by which all stimulation sites are stimulated exactly once is called the stimulation site sequence, or briefly sequence. So far, in simulations, pre-clinical and clinical applications CR was applied either with fixed sequences or rapidly varying sequences (RVS). In this computational study we show that appropriate repetition of the sequence with occasional random switching to the next sequence may significantly improve the anti-kindling effect of CR. To this end, a sequence is applied many times before randomly switching to the next sequence. This new method is called SVS CR stimulation, i.e., CR with slowly varying sequences. In a neuronal network with strong short-range excitatory and weak long-range inhibitory dynamic couplings SVS CR stimulation turns out to be superior to CR stimulation with fixed sequences or RVS.

Augmented brain function by coordinated reset stimulation with slowly varying sequences

PubMed Central

Zeitler, Magteld; Tass, Peter A.

2015-01-01

Several brain disorders are characterized by abnormally strong neuronal synchrony. Coordinated Reset (CR) stimulation was developed to selectively counteract abnormal neuronal synchrony by desynchronization. For this, phase resetting stimuli are delivered to different subpopulations in a timely coordinated way. In neural networks with spike timing-dependent plasticity CR stimulation may eventually lead to an anti-kindling, i.e., an unlearning of abnormal synaptic connectivity and abnormal synchrony. The spatiotemporal sequence by which all stimulation sites are stimulated exactly once is called the stimulation site sequence, or briefly sequence. So far, in simulations, pre-clinical and clinical applications CR was applied either with fixed sequences or rapidly varying sequences (RVS). In this computational study we show that appropriate repetition of the sequence with occasional random switching to the next sequence may significantly improve the anti-kindling effect of CR. To this end, a sequence is applied many times before randomly switching to the next sequence. This new method is called SVS CR stimulation, i.e., CR with slowly varying sequences. In a neuronal network with strong short-range excitatory and weak long-range inhibitory dynamic couplings SVS CR stimulation turns out to be superior to CR stimulation with fixed sequences or RVS. PMID:25873867

Local alignment of two-base encoded DNA sequence

PubMed Central

Homer, Nils; Merriman, Barry; Nelson, Stanley F

2009-01-01

Background DNA sequence comparison is based on optimal local alignment of two sequences using a similarity score. However, some new DNA sequencing technologies do not directly measure the base sequence, but rather an encoded form, such as the two-base encoding considered here. In order to compare such data to a reference sequence, the data must be decoded into sequence. The decoding is deterministic, but the possibility of measurement errors requires searching among all possible error modes and resulting alignments to achieve an optimal balance of fewer errors versus greater sequence similarity. Results We present an extension of the standard dynamic programming method for local alignment, which simultaneously decodes the data and performs the alignment, maximizing a similarity score based on a weighted combination of errors and edits, and allowing an affine gap penalty. We also present simulations that demonstrate the performance characteristics of our two base encoded alignment method and contrast those with standard DNA sequence alignment under the same conditions. Conclusion The new local alignment algorithm for two-base encoded data has substantial power to properly detect and correct measurement errors while identifying underlying sequence variants, and facilitating genome re-sequencing efforts based on this form of sequence data. PMID:19508732

Distinctive Features of Surface Winds over Indian Ocean Between Strong and Weak Indian Summer Monsoons: Implications With Respect To Regional Rainfall Change in India

NASA Astrophysics Data System (ADS)

Zheng, Y.; Bourassa, M. A.; Ali, M. M.

2017-12-01

This observational study focuses on characterizing the surface winds in the Arabian Sea (AS), the Bay of Bengal (BoB), and the southern Indian Ocean (SIO) with special reference to the strong and weak Indian summer monsoon rainfall (ISMR) using the latest daily gridded rainfall dataset provided by the Indian Meteorological Department (IMD) and the Cross-Calibrated Multi-Platform (CCMP) gridded wind product version 2.0 produced by Remote Sensing System (RSS) over the overlapped period 1991-2014. The potential links between surface winds and Indian regional rainfall are also examined. Results indicate that the surface wind speeds in AS and BoB during June-August are almost similar during strong ISMRs and weak ISMRs, whereas significant discrepancies are observed during September. By contrast, the surface wind speeds in SIO during June-August are found to be significantly different between strong and weak ISMRs, where they are similar during September. The significant differences in monthly mean surface wind convergence between strong and weak ISMRs are not coherent in space in the three regions. However, the probability density function (PDF) distributions of daily mean area-averaged values are distinctive between strong and weak ISMRs in the three regions. The correlation analysis indicates the area-averaged surface wind speeds in AS and the area-averaged wind convergence in BoB are highly correlated with regional rainfall for both strong and weak ISMRs. The wind convergence in BoB during strong ISMRs is relatively better correlated with regional rainfall than during weak ISMRs. The surface winds in SIO do not greatly affect Indian rainfall in short timescales, however, they will ultimately affect the strength of monsoon circulation by modulating Indian Ocean Dipole (IOD) mode via atmosphere-ocean interactions.

Exploring Dance Movement Data Using Sequence Alignment Methods

PubMed Central

Chavoshi, Seyed Hossein; De Baets, Bernard; Neutens, Tijs; De Tré, Guy; Van de Weghe, Nico

2015-01-01

Despite the abundance of research on knowledge discovery from moving object databases, only a limited number of studies have examined the interaction between moving point objects in space over time. This paper describes a novel approach for measuring similarity in the interaction between moving objects. The proposed approach consists of three steps. First, we transform movement data into sequences of successive qualitative relations based on the Qualitative Trajectory Calculus (QTC). Second, sequence alignment methods are applied to measure the similarity between movement sequences. Finally, movement sequences are grouped based on similarity by means of an agglomerative hierarchical clustering method. The applicability of this approach is tested using movement data from samba and tango dancers. PMID:26181435

The limits of protein sequence comparison?

PubMed Central

Pearson, William R; Sierk, Michael L

2010-01-01

Modern sequence alignment algorithms are used routinely to identify homologous proteins, proteins that share a common ancestor. Homologous proteins always share similar structures and often have similar functions. Over the past 20 years, sequence comparison has become both more sensitive, largely because of profile-based methods, and more reliable, because of more accurate statistical estimates. As sequence and structure databases become larger, and comparison methods become more powerful, reliable statistical estimates will become even more important for distinguishing similarities that are due to homology from those that are due to analogy (convergence). The newest sequence alignment methods are more sensitive than older methods, but more accurate statistical estimates are needed for their full power to be realized. PMID:15919194

Genome-wide DNA polymorphism in the indica rice varieties RGD-7S and Taifeng B as revealed by whole genome re-sequencing.

PubMed

Fu, Chong-Yun; Liu, Wu-Ge; Liu, Di-Lin; Li, Ji-Hua; Zhu, Man-Shan; Liao, Yi-Long; Liu, Zhen-Rong; Zeng, Xue-Qin; Wang, Feng

2016-03-01

Next-generation sequencing technologies provide opportunities to further understand genetic variation, even within closely related cultivars. We performed whole genome resequencing of two elite indica rice varieties, RGD-7S and Taifeng B, whose F1 progeny showed hybrid weakness and hybrid vigor when grown in the early- and late-cropping seasons, respectively. Approximately 150 million 100-bp pair-end reads were generated, which covered ∼86% of the rice (Oryza sativa L. japonica 'Nipponbare') reference genome. A total of 2,758,740 polymorphic sites including 2,408,845 SNPs and 349,895 InDels were detected in RGD-7S and Taifeng B, respectively. Applying stringent parameters, we identified 961,791 SNPs and 46,640 InDels between RGD-7S and Taifeng B (RGD-7S/Taifeng B). The density of DNA polymorphisms was 256.8 SNPs and 12.5 InDels per 100 kb for RGD-7S/Taifeng B. Copy number variations (CNVs) were also investigated. In RGD-7S, 1989 of 2727 CNVs were overlapped in 218 genes, and 1231 of 2010 CNVs were annotated in 175 genes in Taifeng B. In addition, we verified a subset of InDels in the interval of hybrid weakness genes, Hw3 and Hw4, and obtained some polymorphic InDel markers, which will provide a sound foundation for cloning hybrid weakness genes. Analysis of genomic variations will also contribute to understanding the genetic basis of hybrid weakness and heterosis.

Comparison of Bacterial Community Composition of Primary and Persistent Endodontic Infections Using Pyrosequencing.

PubMed

Tzanetakis, Giorgos N; Azcarate-Peril, M Andrea; Zachaki, Sophia; Panopoulos, Panos; Kontakiotis, Evangelos G; Madianos, Phoebus N; Divaris, Kimon

2015-08-01

Elucidating the microbial ecology of endodontic infections (EIs) is a necessary step in developing effective intracanal antimicrobials. The aim of the present study was to investigate the bacterial composition of symptomatic and asymptomatic primary and persistent infections in a Greek population using high-throughput sequencing methods. 16S amplicon pyrosequencing of 48 root canal bacterial samples was conducted, and sequencing data were analyzed using an oral microbiome-specific and a generic (Greengenes) database. Bacterial abundance and diversity were examined by EI type (primary or persistent), and statistical analysis was performed by using non-parametric and parametric tests accounting for clustered data. Bacteroidetes was the most abundant phylum in both infection groups. Significant, albeit weak associations of bacterial diversity were found, as measured by UniFrac distances with infection type (analyses of similarity, R = 0.087, P = .005) and symptoms (analyses of similarity, R = 0.055, P = .047). Persistent infections were significantly enriched for Proteobacteria and Tenericutes compared with primary ones; at the genus level, significant differences were noted for 14 taxa, including increased enrichment of persistent infections for Lactobacillus, Streptococcus, and Sphingomonas. More but less abundant phyla were identified using the Greengenes database; among those, Cyanobacteria (0.018%) and Acidobacteria (0.007%) were significantly enriched among persistent infections. Persistent infections showed higher phylogenetic diversity (PD) (asymptomatic: PD = 9.2, standard error [SE] = 1.3; symptomatic: PD = 8.2, SE = 0.7) compared with primary infections (asymptomatic: PD = 5.9, SE = 0.8; symptomatic: PD = 7.4, SE = 1.0). The present study revealed a high bacterial diversity of EI and suggests that persistent infections may have more diverse bacterial communities than primary infections. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Analysis of ParB-centromere interactions by multiplex SPR imaging reveals specific patterns for binding ParB in six centromeres of Burkholderiales chromosomes and plasmids

PubMed Central

Pillet, Flavien; Passot, Fanny Marie

2017-01-01

Bacterial centromeres–also called parS, are cis-acting DNA sequences which, together with the proteins ParA and ParB, are involved in the segregation of chromosomes and plasmids. The specific binding of ParB to parS nucleates the assembly of a large ParB/DNA complex from which ParA—the motor protein, segregates the sister replicons. Closely related families of partition systems, called Bsr, were identified on the chromosomes and large plasmids of the multi-chromosomal bacterium Burkholderia cenocepacia and other species from the order Burkholeriales. The centromeres of the Bsr partition families are 16 bp palindromes, displaying similar base compositions, notably a central CG dinucleotide. Despite centromeres bind the cognate ParB with a narrow specificity, weak ParB-parS non cognate interactions were nevertheless detected between few Bsr partition systems of replicons not belonging to the same genome. These observations suggested that Bsr partition systems could have a common ancestry but that evolution mostly erased the possibilities of cross-reactions between them, in particular to prevent replicon incompatibility. To detect novel similarities between Bsr partition systems, we have analyzed the binding of six Bsr parS sequences and a wide collection of modified derivatives, to their cognate ParB. The study was carried out by Surface Plasmon Resonance imaging (SPRi) mulitplex analysis enabling a systematic survey of each nucleotide position within the centromere. We found that in each parS some positions could be changed while maintaining binding to ParB. Each centromere displays its own pattern of changes, but some positions are shared more or less widely. In addition from these changes we could speculate evolutionary links between these centromeres. PMID:28562673

Analysis of ParB-centromere interactions by multiplex SPR imaging reveals specific patterns for binding ParB in six centromeres of Burkholderiales chromosomes and plasmids.

PubMed

Pillet, Flavien; Passot, Fanny Marie; Pasta, Franck; Anton Leberre, Véronique; Bouet, Jean-Yves

2017-01-01

Bacterial centromeres-also called parS, are cis-acting DNA sequences which, together with the proteins ParA and ParB, are involved in the segregation of chromosomes and plasmids. The specific binding of ParB to parS nucleates the assembly of a large ParB/DNA complex from which ParA-the motor protein, segregates the sister replicons. Closely related families of partition systems, called Bsr, were identified on the chromosomes and large plasmids of the multi-chromosomal bacterium Burkholderia cenocepacia and other species from the order Burkholeriales. The centromeres of the Bsr partition families are 16 bp palindromes, displaying similar base compositions, notably a central CG dinucleotide. Despite centromeres bind the cognate ParB with a narrow specificity, weak ParB-parS non cognate interactions were nevertheless detected between few Bsr partition systems of replicons not belonging to the same genome. These observations suggested that Bsr partition systems could have a common ancestry but that evolution mostly erased the possibilities of cross-reactions between them, in particular to prevent replicon incompatibility. To detect novel similarities between Bsr partition systems, we have analyzed the binding of six Bsr parS sequences and a wide collection of modified derivatives, to their cognate ParB. The study was carried out by Surface Plasmon Resonance imaging (SPRi) mulitplex analysis enabling a systematic survey of each nucleotide position within the centromere. We found that in each parS some positions could be changed while maintaining binding to ParB. Each centromere displays its own pattern of changes, but some positions are shared more or less widely. In addition from these changes we could speculate evolutionary links between these centromeres.

Lithologically controlled strength variation and the Himalayan megathrust geometry: an analogue modeling approach

NASA Astrophysics Data System (ADS)

Ghosh, Subhajit; Das, Animesh; Bose, Santanu; Mandal, Nibir

2017-04-01

A moment magnitude (Mw) 7.8 earthquake associated with a Mw 7.3 aftershock hit the Gorkha region near Kathmandu, Nepal on April 25, 2015. The rupture propagated eastward for about 140 km and caused thousands of deaths. The focal mechanism of the Gorkha earthquake shows thrust sense over the mid-crustal steeply dipping ramp on the basal décollement known as the Main Himalayan Thrust (MHT). The MHT is the largest and fastest slipping continental megathrust over which the southward tapering Himalayan thrust wedge similar to the accretionary wedges is moving. The MHT ramps up to the surface beneath the Siwalik group of rocks as the Main Frontal Thrust (MFT). Below the MFT the basal décollement is flat until it reaches the mid-crustal ramp ( 20°) below the Himalayan klippen and then again it becomes flat. This geometry of the décollement is consistent with the balanced cross sections, microseismic data, magnetotelluric images, INDEPTH seismic reflection profile, present day stress distribution and fits well with the prominent topographic break (physiographic transition) in the Lesser Himalaya. Lithologically stratified sedimentary sequences in the upper crust are mechanically heterogeneous. It has been long known that the mechanical properties of the stratigraphic succession influence the resultant structural architecture of the fold and thrust belts. The rheologically weak stratigraphic horizon generally contains the basal décollement due to its relatively low frictional strength. Hence, any vertical or lateral change in frictional property may control the effective strength and the positions of the décollement in space. In the present study, we used non-cohesive sand and mica dust layers as analogue materials for simulating the strong and weak layers respectively in the sandbox apparatus. Experimental results with relatively high basal friction (μ=0.46) show that such a weak horizon at a shallow depth perturbs the sequential thrust progression, and forces a thrust to localize in the close vicinity of the weak zone, splaying from the basal décollement. Eventually, the weak horizon starts to deform by accumulating shear strain along it, leading to a new detachment at a shallow depth. At this stage, entire shallow part of the sandpack lying over the weak layer is deformed by closely-spaced imbricate thrusts. Extrapolating the model results to the natural prototype, we propose that the unmetamorphosed coal-shale-sand stone-black shale horizons below the Siwaliks as a key mechanical attribute to the basal décollement shift and the consequent flat-ramp-flat geometry of the MHT.

Ideonella azotifigens sp. nov., an aerobic diazotroph of the Betaproteobacteria isolated from grass rhizosphere soil, and emended description of the genus Ideonella.

PubMed

Noar, Jesse D; Buckley, Daniel H

2009-08-01

Strain 1a22T, a nitrogen-fixing bacterium, was isolated from soil associated with the rhizosphere of a perennial grass growing in a fallow agricultural field in Ithaca, New York, USA. Analysis of the 16S rRNA gene sequence placed the strain in the Rubrivivax-Roseateles-Leptothrix-Azohydromonas-Aquincola-Ideonella branch of the Betaproteobacteria and the closest characterized relative was the type strain of Ideonella dechloratans (97.7% 16S rRNA sequence similarity). Cells of strain 1a22T were Gram-negative, motile, straight rods, which formed polyhydroxybutyrate-like granules and were positive for oxidase and weakly positive for catalase. Cells were chemo-organotrophic, unable to grow by reduction of chlorate or nitrate and grew exclusively through aerobic respiration. Growth with mannitol on N-free solid media caused the strain to produce copious amounts of slime. The G+C content of the genomic DNA was 67.4 mol%. The major cellular fatty acids were C16:1 cis-9 and C16:0 and cells contained significant amounts of the hydroxy fatty acids C10:0 3-OH, C12:0 2-OH and C12:0 3-OH. Based on DNA-DNA hybridization studies, 16S rRNA gene sequence analysis, fatty acid analysis, and morphological and physiological characteristics, strain 1a22T represents a novel species in the genus Ideonella, for which the name Ideonella azotifigens sp. nov. is proposed. The type strain of Ideonella azotifigens is 1a22T (=JCM 15503T=DSM 21438T).

Telomere formation on macronuclear chromosomes of Oxytricha trifallax and O. fallax: alternatively processed regions have multiple telomere addition sites

PubMed Central

Williams, Kevin R; Doak, Thomas G; Herrick, Glenn

2002-01-01

Background Ciliates employ massive chromatid breakage and de novo telomere formation during generation of the somatic macronucleus. Positions flanking the 81-MAC locus are reproducibly cut. But those flanking the Common Region are proposed to often escape cutting, generating three nested macronuclear chromosomes, two retaining "arms" still appended to the Common Region. Arm-distal positions must differ (in cis) from the Common Region flanks. Results The Common-Region-flanking positions also differ from the arm-distal positions in that they are "multi-TAS" regions: anchored PCR shows heterogeneous patterns of telomere addition sites, but arm-distal sites do not. The multi-TAS patterns are reproducible, but are sensitive to the sequence of the allele being processed. Thus, random degradation following chromatid cutting does not create this heterogeneity; these telomere addition sites also must be dictated by cis-acting sequences. Conclusions Most ciliates show such micro-heterogeneity in the precise positions of telomere addition sites. Telomerase is believed to be tightly associated with, and act in concert with, the chromatid-cutting nuclease: heterogeneity must be the result of intervening erosion activity. Our "weak-sites" hypothesis explains the correlation between alternative chromatid cutting at the Common Region boundaries and their multi-TAS character: when the chromatid-breakage machine encounters either a weak binding site or a weak cut site at these regions, then telomerase dissociates prematurely, leaving the new end subject to erosion by an exonuclease, which pauses at cis-acting sequences; telomerase eventually heals these resected termini. Finally, we observe TAS positioning influenced by trans-allelic interactions, reminiscent of transvection. PMID:12199911

Duffy blood group phenotype-genotype correlations using high-resolution melting analysis PCR and microarray reveal complex cases including a new null FY*A allele: the role for sequencing in genotyping algorithms.

PubMed

Lopez, G H; Morrison, J; Condon, J A; Wilson, B; Martin, J R; Liew, Y-W; Flower, R L; Hyland, C A

2015-10-01

Duffy blood group phenotypes can be predicted by genotyping for single nucleotide polymorphisms (SNPs) responsible for the Fy(a) /Fy(b) polymorphism, for weak Fy(b) antigen, and for the red cell null Fy(a-b-) phenotype. This study correlates Duffy phenotype predictions with serotyping to assess the most reliable procedure for typing. Samples, n = 155 (135 donors and 20 patients), were genotyped by high-resolution melt PCR and by microarray. Samples were in three serology groups: 1) Duffy patterns expected n = 79, 2) weak and equivocal Fy(b) patterns n = 29 and 3) Fy(a-b-) n = 47 (one with anti-Fy3 antibody). Discrepancies were observed for five samples. For two, SNP genotyping predicted weak Fy(b) expression discrepant with Fy(b-) (Group 1 and 3). For three, SNP genotyping predicted Fy(a) , discrepant with Fy(a-b-) (Group 3). DNA sequencing identified silencing mutations in these FY*A alleles. One was a novel FY*A 719delG. One, the sample with the anti-Fy3, was homozygous for a 14-bp deletion (FY*01N.02); a true null. Both the high-resolution melting analysis and SNP microarray assays were concordant and showed genotyping, as well as phenotyping, is essential to ensure 100% accuracy for Duffy blood group assignments. Sequencing is important to resolve phenotype/genotype conflicts which here identified alleles, one novel, that carry silencing mutations. The risk of alloimmunisation may be dependent on this zygosity status. © 2015 International Society of Blood Transfusion.

An early illness recognition framework using a temporal Smith Waterman algorithm and NLP.

PubMed

Hajihashemi, Zahra; Popescu, Mihail

2013-01-01

In this paper we propose a framework for detecting health patterns based on non-wearable sensor sequence similarity and natural language processing (NLP). In TigerPlace, an aging in place facility from Columbia, MO, we deployed 47 sensor networks together with a nursing electronic health record (EHR) system to provide early illness recognition. The proposed framework utilizes sensor sequence similarity and NLP on EHR nursing comments to automatically notify the physician when health problems are detected. The reported methodology is inspired by genomic sequence annotation using similarity algorithms such as Smith Waterman (SW). Similarly, for each sensor sequence, we associate health concepts extracted from the nursing notes using Metamap, a NLP tool provided by Unified Medical Language System (UMLS). Since sensor sequences, unlike genomics ones, have an associated time dimension we propose a temporal variant of SW (TSW) to account for time. The main challenges presented by our framework are finding the most suitable time sequence similarity and aggregation of the retrieved UMLS concepts. On a pilot dataset from three Tiger Place residents, with a total of 1685 sensor days and 626 nursing records, we obtained an average precision of 0.64 and a recall of 0.37.

Clustering and visualizing similarity networks of membrane proteins.

PubMed

Hu, Geng-Ming; Mai, Te-Lun; Chen, Chi-Ming

2015-08-01

We proposed a fast and unsupervised clustering method, minimum span clustering (MSC), for analyzing the sequence-structure-function relationship of biological networks, and demonstrated its validity in clustering the sequence/structure similarity networks (SSN) of 682 membrane protein (MP) chains. The MSC clustering of MPs based on their sequence information was found to be consistent with their tertiary structures and functions. For the largest seven clusters predicted by MSC, the consistency in chain function within the same cluster is found to be 100%. From analyzing the edge distribution of SSN for MPs, we found a characteristic threshold distance for the boundary between clusters, over which SSN of MPs could be properly clustered by an unsupervised sparsification of the network distance matrix. The clustering results of MPs from both MSC and the unsupervised sparsification methods are consistent with each other, and have high intracluster similarity and low intercluster similarity in sequence, structure, and function. Our study showed a strong sequence-structure-function relationship of MPs. We discussed evidence of convergent evolution of MPs and suggested applications in finding structural similarities and predicting biological functions of MP chains based on their sequence information. © 2015 Wiley Periodicals, Inc.

Predicted secondary structure similarity in the absence of primary amino acid sequence homology: hepatitis B virus open reading frames.

PubMed Central

Schaeffer, E; Sninsky, J J

1984-01-01

Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

PubMed

Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Hernández-Laín, Aurelio; Coca-Robinot, David; Rivera, Henry; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, MiguelÁngel; Martínez-Azorín, Francisco

2016-02-29

Whole-exome sequencing (WES) was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase (CK), deficiency of mitochondrial complex III and depletion of mtDNA. With WES data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in Thymidine kinase 2 gene (TK2; NM_004614.4:c.323C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes (MDS). This patient presents an atypical TK2 related-myopathic form of MDS, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in MDS and expanded the phenotypic spectrum.

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

PubMed

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

Origin of 12 micrometer Emission Across Galaxy Populations from Wise and ADSS Surveys

NASA Technical Reports Server (NTRS)

Donso, E.; Yan, Lin; Tsai, C.; Eisenhardt, P; Stern, D.; Assef, R. J.; Leisawitz, D.; Jarrett, T. H.; Stanford, S. A.

2012-01-01

We cross-matched Wide-field Infrared Survey Explorer sources brighter than 1 mJy at 12 micron with the Sloan Digital Sky Survey galaxy spectroscopic catalog to produce a sample of approx. 10(exp 5) galaxies at z = 0.08, the largest of its kind. This sample is dominated (70%) by star-forming (SF) galaxies from the blue sequence, with total IR luminosities in the range approx 10(exp 8)-10(exp 12) Solar L. We identify which stellar populations are responsible for most of the 12 micron emission. We find that most (approx 80%) of the 12 micron emission in SF galaxies is produced by stellar populations younger than 0.6 Gyr. In contrast, the 12 micron emission in weak active galactic nuclei (AGNs; L [O iii] < 10(exo 7) solar L ) is produced by older stars, with ages of approx 1-3 Gyr. We find that L(sub 12 micron) linearly correlates with stellar mass for SF galaxies. At fixed 12 micron luminosity, weak AGNs deviate toward higher masses since they tend to be hosted by massive, early-type galaxies with older stellar populations. SF galaxies and weak AGNs follow different L(sub 12 micron) - SFR (star formation rate) relations, with weak AGNs showing excess 12 micron emission at low SFR (0.02-1 solar M /yr). This is likely due to dust grains heated by older stars. While the specific star formation rate (SSFR) of SF galaxies is nearly constant, the SSFR of weak AGNs decreases by approx 3 orders of magnitude, reflecting the very different star formation efficiencies between SF galaxies and massive, early-type galaxies. Stronger type II AGNs in our sample (L(sub [O iii]) > 10(exp 7) solar L ), act as an extension of massive SF galaxies, connecting the SF and weak AGN sequences. This suggests a picture where galaxies form stars normally until an AGN (possibly after a starburst episode) starts to gradually quench the SF activity. We also find that 4.6-12 micron color is a useful first-order indicator of SF activity in a galaxy when no other data are available.

Ultrasound Imaging of Muscle Contraction of the Tibialis Anterior in Patients with Facioscapulohumeral Dystrophy.

PubMed

Gijsbertse, Kaj; Goselink, Rianne; Lassche, Saskia; Nillesen, Maartje; Sprengers, André; Verdonschot, Nico; van Alfen, Nens; de Korte, Chris

2017-11-01

A need exists for biomarkers to diagnose, quantify and longitudinally follow facioscapulohumeral muscular dystrophy (FSHD) and many other neuromuscular disorders. Furthermore, the pathophysiological mechanisms leading to muscle weakness in most neuromuscular disorders are not completely understood. Dynamic ultrasound imaging (B-mode image sequences) in combination with speckle tracking is an easy, applicable and patient-friendly imaging tool to visualize and quantify muscle deformation. This dynamic information provides insight in the pathophysiological mechanisms and may help to distinguish the various stages of diseased muscle in FSHD. In this proof-of-principle study, we applied a speckle tracking technique to 2-D ultrasound image sequences to quantify the deformation of the tibialis anterior muscle in patients with FSHD and in healthy controls. The resulting deformation patterns were compared with muscle ultrasound echo intensity analysis (a measure of fat infiltration and dystrophy) and clinical outcome measures. Of the four FSHD patients, two patients had severe peroneal weakness and two patients had mild peroneal weakness on clinical examination. We found a markedly varied muscle deformation pattern between these groups: patients with severe peroneal weakness showed a different motion pattern of the tibialis anterior, with overall less displacement of the central tendon region, while healthy patients showed a non-uniform displacement pattern, with the central aponeurosis showing the largest displacement. Hence, dynamic muscle ultrasound of the tibialis anterior muscle in patients with FSHD revealed a distinctively different tissue deformation pattern among persons with and without tibialis anterior weakness. These findings could clarify the understanding of the pathophysiology of muscle weakness in FSHD patients. In addition, the change in muscle deformation shows good correlation with clinical measures and quantitative muscle ultrasound measurements. In conclusion, dynamic ultrasound in combination with speckle tracking allows the study of the effects of muscle pathology in relation to strength, force transmission and movement generation. Although further research is required, this technique can develop into a biomarker to quantify muscle disease severity. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Sampling Daphnia's expressed genes: preservation, expansion and invention of crustacean genes with reference to insect genomes

PubMed Central

Colbourne, John K; Eads, Brian D; Shaw, Joseph; Bohuski, Elizabeth; Bauer, Darren J; Andrews, Justen

2007-01-01

Background Functional and comparative studies of insect genomes have shed light on the complement of genes, which in part, account for shared morphologies, developmental programs and life-histories. Contrasting the gene inventories of insects to those of the nematodes provides insight into the genomic changes responsible for their diversification. However, nematodes have weak relationships to insects, as each belongs to separate animal phyla. A better outgroup to distinguish lineage specific novelties would include other members of Arthropoda. For example, crustaceans are close allies to the insects (together forming Pancrustacea) and their fascinating aquatic lifestyle provides an important comparison for understanding the genetic basis of adaptations to life on land versus life in water. Results This study reports on the first characterization of cDNA libraries and sequences for the model crustacean Daphnia pulex. We analyzed 1,546 ESTs of which 1,414 represent approximately 787 nuclear genes, by measuring their sequence similarities with insect and nematode proteomes. The provisional annotation of genes is supported by expression data from microarray studies described in companion papers. Loci expected to be shared between crustaceans and insects because of their mutual biological features are identified, including genes for reproduction, regulation and cellular processes. We identify genes that are likely derived within Pancrustacea or lost within the nematodes. Moreover, lineage specific gene family expansions are identified, which suggest certain biological demands associated with their ecological setting. In particular, up to seven distinct ferritin loci are found in Daphnia compared to three in most insects. Finally, a substantial fraction of the sampled gene transcripts shares no sequence similarity with those from other arthropods. Genes functioning during development and reproduction are comparatively well conserved between crustaceans and insects. By contrast, genes that were responsive to environmental conditions (metal stress) and not sex-biased included the greatest proportion of genes with no matches to insect proteomes. Conclusion This study along with associated microarray experiments are the initial steps in a coordinated effort by the Daphnia Genomics Consortium to build the necessary genomic platform needed to discover genes that account for the phenotypic diversity within the genus and to gain new insights into crustacean biology. This effort will soon include the first crustacean genome sequence. PMID:17612412

Sequence-dependent nucleosome sliding in rotation-coupled and uncoupled modes revealed by molecular simulations

PubMed Central

Tan, Cheng; Takada, Shoji

2017-01-01

While nucleosome positioning on eukaryotic genome play important roles for genetic regulation, molecular mechanisms of nucleosome positioning and sliding along DNA are not well understood. Here we investigated thermally-activated spontaneous nucleosome sliding mechanisms developing and applying a coarse-grained molecular simulation method that incorporates both long-range electrostatic and short-range hydrogen-bond interactions between histone octamer and DNA. The simulations revealed two distinct sliding modes depending on the nucleosomal DNA sequence. A uniform DNA sequence showed frequent sliding with one base pair step in a rotation-coupled manner, akin to screw-like motions. On the contrary, a strong positioning sequence, the so-called 601 sequence, exhibits rare, abrupt transitions of five and ten base pair steps without rotation. Moreover, we evaluated the importance of hydrogen bond interactions on the sliding mode, finding that strong and weak bonds favor respectively the rotation-coupled and -uncoupled sliding movements. PMID:29194442

Characterization of DNA-protein interactions using high-throughput sequencing data from pulldown experiments

NASA Astrophysics Data System (ADS)

Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf

Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.

Lactobacillus heilongjiangensis sp. nov., isolated from Chinese pickle.

PubMed

Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng

2013-11-01

A Gram-stain-positive bacterial strain, S4-3(T), was isolated from traditional pickle in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, pheS gene sequence analysis, rpoA gene sequence analysis, dnaK gene sequence analysis, fatty acid methyl ester (FAME) analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain S4-3(T) showed 97.9-98.7 % 16S rRNA gene sequence similarities, 84.4-94.1 % pheS gene sequence similarities and 94.4-96.9 % rpoA gene sequence similarities to the type strains of Lactobacillus nantensis, Lactobacillus mindensis, Lactobacillus crustorum, Lactobacillus futsaii, Lactobacillus farciminis and Lactobacillus kimchiensis. dnaK gene sequence similarities between S4-3(T) and Lactobacillus nantensis LMG 23510(T), Lactobacillus mindensis LMG 21932(T), Lactobacillus crustorum LMG 23699(T), Lactobacillus futsaii JCM 17355(T) and Lactobacillus farciminis LMG 9200(T) were 95.4, 91.5, 90.4, 91.7 and 93.1 %, respectively. Based upon the data obtained in the present study, a novel species, Lactobacillus heilongjiangensis sp. nov., is proposed and the type strain is S4-3(T) ( = LMG 26166(T) = NCIMB 14701(T)).

FRESCO: Referential compression of highly similar sequences.

PubMed

Wandelt, Sebastian; Leser, Ulf

2013-01-01

In many applications, sets of similar texts or sequences are of high importance. Prominent examples are revision histories of documents or genomic sequences. Modern high-throughput sequencing technologies are able to generate DNA sequences at an ever-increasing rate. In parallel to the decreasing experimental time and cost necessary to produce DNA sequences, computational requirements for analysis and storage of the sequences are steeply increasing. Compression is a key technology to deal with this challenge. Recently, referential compression schemes, storing only the differences between a to-be-compressed input and a known reference sequence, gained a lot of interest in this field. In this paper, we propose a general open-source framework to compress large amounts of biological sequence data called Framework for REferential Sequence COmpression (FRESCO). Our basic compression algorithm is shown to be one to two orders of magnitudes faster than comparable related work, while achieving similar compression ratios. We also propose several techniques to further increase compression ratios, while still retaining the advantage in speed: 1) selecting a good reference sequence; and 2) rewriting a reference sequence to allow for better compression. In addition,we propose a new way of further boosting the compression ratios by applying referential compression to already referentially compressed files (second-order compression). This technique allows for compression ratios way beyond state of the art, for instance,4,000:1 and higher for human genomes. We evaluate our algorithms on a large data set from three different species (more than 1,000 genomes, more than 3 TB) and on a collection of versions of Wikipedia pages. Our results show that real-time compression of highly similar sequences at high compression ratios is possible on modern hardware.

Identification and Analysis of a Gene from Calendula officinalis Encoding a Fatty Acid Conjugase

PubMed Central

Qiu, Xiao; Reed, Darwin W.; Hong, Haiping; MacKenzie, Samuel L.; Covello, Patrick S.

2001-01-01

Two homologous cDNAs, CoFad2 and CoFac2, were isolated from a Calendula officinalis developing seed by a polymerase chain reaction-based cloning strategy. Both sequences share similarity to FAD2 desaturases and FAD2-related enzymes. In C. officinalis plants CoFad2 was expressed in all tissues tested, whereas CoFac2 expression was specific to developing seeds. Expression of CoFad2 cDNA in yeast (Saccharomyces cerevisiae) indicated it encodes a Δ12 desaturase that introduces a double bond at the 12 position of 16:1(9Z) and 18:1(9Z). Expression of CoFac2 in yeast revealed that the encoded enzyme acts as a fatty acid conjugase converting 18:2(9Z, 12Z) to calendic acid 18:3(8E, 10E, 12Z). The enzyme also has weak activity on the mono-unsaturates 16:1(9Z) and 18:1(9Z) producing compounds with the properties of 8,10 conjugated dienes. PMID:11161042

3-D model-based vehicle tracking.

PubMed

Lou, Jianguang; Tan, Tieniu; Hu, Weiming; Yang, Hao; Maybank, Steven J

2005-10-01

This paper aims at tracking vehicles from monocular intensity image sequences and presents an efficient and robust approach to three-dimensional (3-D) model-based vehicle tracking. Under the weak perspective assumption and the ground-plane constraint, the movements of model projection in the two-dimensional image plane can be decomposed into two motions: translation and rotation. They are the results of the corresponding movements of 3-D translation on the ground plane (GP) and rotation around the normal of the GP, which can be determined separately. A new metric based on point-to-line segment distance is proposed to evaluate the similarity between an image region and an instantiation of a 3-D vehicle model under a given pose. Based on this, we provide an efficient pose refinement method to refine the vehicle's pose parameters. An improved EKF is also proposed to track and to predict vehicle motion with a precise kinematics model. Experimental results with both indoor and outdoor data show that the algorithm obtains desirable performance even under severe occlusion and clutter.

Theory and simulation of DNA-coated colloids: a guide for rational design.

PubMed

Angioletti-Uberti, Stefano; Mognetti, Bortolo M; Frenkel, Daan

2016-03-07

By exploiting the exquisite selectivity of DNA hybridization, DNA-coated colloids (DNACCs) can be made to self-assemble in a wide variety of structures. The beauty of this system stems largely from its exceptional versatility and from the fact that a proper choice of the grafted DNA sequences yields fine control over the colloidal interactions. Theory and simulations have an important role to play in the optimal design of self assembling DNACCs. At present, the powerful model-based design tools are not widely used, because the theoretical literature is fragmented and the connection between different theories is often not evident. In this Perspective, we aim to discuss the similarities and differences between the different models that have been described in the literature, their underlying assumptions, their strengths and their weaknesses. Using the tools described in the present Review, it should be possible to move towards a more rational design of novel self-assembling structures of DNACCs and, more generally, of systems where ligand-receptor are used to control interactions.

Efficient Wide Baseline Structure from Motion

NASA Astrophysics Data System (ADS)

Michelini, Mario; Mayer, Helmut

2016-06-01

This paper presents a Structure from Motion approach for complex unorganized image sets. To achieve high accuracy and robustness, image triplets are employed and (an approximate) camera calibration is assumed to be known. The focus lies on a complete linking of images even in case of large image distortions, e.g., caused by wide baselines, as well as weak baselines. A method for embedding image descriptors into Hamming space is proposed for fast image similarity ranking. The later is employed to limit the number of pairs to be matched by a wide baseline method. An iterative graph-based approach is proposed formulating image linking as the search for a terminal Steiner minimum tree in a line graph. Finally, additional links are determined and employed to improve the accuracy of the pose estimation. By this means, loops in long image sequences are implicitly closed. The potential of the proposed approach is demonstrated by results for several complex image sets also in comparison with VisualSFM.

Highly alloyed Ni-W substrates for low AC loss applications

NASA Astrophysics Data System (ADS)

Gaitzsch, Uwe; Hänisch, Jens; Hühne, Ruben; Rodig, Christian; Freudenberger, Jens; Holzapfel, Bernhard; Schultz, Ludwig

2013-08-01

Cube texture formation has been studied in Ni-W alloys with a W content of 9 at.% and above. These alloys show a low magnetization at 77 K and below, and are therefore excellent candidates for use as substrates of coated conductors in AC applications. The application of a modified deformation and annealing sequence leads to a highly textured surface of Ni9W and Ni9.5W tapes with cube texture fractions above 96%. YBCO (YBa2Cu3O7-δ) layers obtained on these substrates using a standard buffer architecture showed a critical current density exceeding 1.5 MA cm-2 at 77 K, similar to those for films on commercial Ni5W tapes. In contrast, only a weak cube texture was achieved in Ni10W tapes. The rolling texture of this alloy showed a significantly increased Goss component, which could not be reduced by applying intermediate annealing treatments. The influence of this texture on the cube texture formation will be discussed in detail.

Assessing pathogenicity for novel mutation/sequence variants: the value of healthy older individuals.

PubMed

Zatz, Mayana; Pavanello, Rita de Cassia M; Lourenço, Naila Cristina V; Cerqueira, Antonia; Lazar, Monize; Vainzof, Mariz

2012-12-01

Improvement in DNA technology is increasingly revealing unexpected/unknown mutations in healthy persons and generating anxiety due to their still unknown health consequences. We report a 44-year-old healthy father of a 10-year-old daughter with bilateral coloboma and hearing loss, but without muscle weakness, in whom a whole-genome CGH revealed a deletion of exons 38-44 in the dystrophin gene. This mutation was inherited from her asymptomatic father, who was further clinically and molecularly evaluated for prognosis and genetic counseling (GC). This deletion was never identified by us in 982 Duchenne/Becker patients. To assess whether the present case represents a rare case of non-penetrance, and aiming to obtain more information for prognosis and GC, we suggested that healthy older relatives submit their DNA for analysis, to which several complied. Mutation analysis revealed that his mother, brother, and 56-year-old maternal uncle also carry the 38-44 deletion, suggesting it an unlikely cause of muscle weakness. Genome sequencing will disclose mutations and variants whose health impact are still unknown, raising important problems in interpreting results, defining prognosis, and discussing GC. We suggest that, in addition to family history, keeping the DNA of older relatives could be very informative, in particular for those interested in having their genome sequenced.

Detection of Plasmodium sp. in capybara.

PubMed

dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin

2009-07-07

In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".

Sequence Similarity Presenter: a tool for the graphic display of similarities of long sequences for use in presentations.

PubMed

Fröhlich, K U

1994-04-01

A new method for the presentation of alignments of long sequences is described. The degree of identity for the aligned sequences is averaged for sections of a fixed number of residues. The resulting values are converted to shades of gray, with white corresponding to lack of identity and black corresponding to perfect identity. A sequence alignment is represented as a bar filled with varying shades of gray. The display is compact and allows for a fast and intuitive recognition of the distribution of regions with a high similarity. It is well suited for the presentation of alignments of long sequences, e.g. of protein superfamilies, in plenary lectures. The method is implemented as a HyperCard stack for Apple Macintosh computers. Several options for the modification of the output are available (e.g. background reduction, size of the summation window, consideration of amino acid similarity, inclusion of graphic markers to indicate specific domains). The output is a PostScript file which can be printed, imported as EPS or processed further with Adobe Illustrator.

Radiative Energy Loss by Galactic Cosmic Rays

NASA Technical Reports Server (NTRS)

Ahern, Sean C.; Norbury, John W.; Tripathi, R. K.

2002-01-01

Interactions between galactic cosmic rays and matter are a primary focus of the NASA radiation problem. The electromagnetic forces involved are for the most part well documented. Building on previous research, this study investigated the relative importance of the weak forces that occur when a cosmic ray impinges on different types of materials. For the familiar electromagnetic case, it is known that energy lost in the form of radiation is more significant than that lost via contact collisions the rate at which the energy is lost is also well understood. Similar results were derived for the weak force case. It was found that radiation is also the dominant mode of energy loss in weak force interactions and that weak force effects are indeed relatively weak compared to electromagnetic effects.

Weak- versus strong-disorder superfluid—Bose glass transition in one dimension

NASA Astrophysics Data System (ADS)

Doggen, Elmer V. H.; Lemarié, Gabriel; Capponi, Sylvain; Laflorencie, Nicolas

2017-11-01

Using large-scale simulations based on matrix product state and quantum Monte Carlo techniques, we study the superfluid to Bose glass transition for one-dimensional attractive hard-core bosons at zero temperature, across the full regime from weak to strong disorder. As a function of interaction and disorder strength, we identify a Berezinskii-Kosterlitz-Thouless critical line with two different regimes. At small attraction where critical disorder is weak compared to the bandwidth, the critical Luttinger parameter Kc takes its universal Giamarchi-Schulz value Kc=3 /2 . Conversely, a nonuniversal Kc>3 /2 emerges for stronger attraction where weak-link physics is relevant. In this strong-disorder regime, the transition is characterized by self-similar power-law-distributed weak links with a continuously varying characteristic exponent α .

75 FR 36414 - Federal Travel Regulation (FTR); Directions for Reporting Other Than Coach-Class Accommodations...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-25

... GENERAL SERVICES ADMINISTRATION [Docket 2010-009; Sequence 3] Federal Travel Regulation (FTR); Directions for Reporting Other Than Coach-Class Accommodations for Employees on Official Travel AGENCY... Accountability Office (GAO) report, Premium Class Travel: Internal Control Weaknesses Governmentwide Led to...

DNA methylation profiling using HpaII tiny fragment enrichment by ligation-mediated PCR (HELP)

PubMed Central

Suzuki, Masako; Greally, John M.

2010-01-01

The HELP assay is a technique that allows genome-wide analysis of cytosine methylation. Here we describe the assay, its relative strengths and weaknesses, and the transition of the assay from a microarray to massively-parallel sequencing-based foundation. PMID:20434563

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.

PubMed

Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H

2017-04-15

Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification

PubMed Central

Sinclair, Robert M.; Ravantti, Janne J.

2017-01-01

ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979

Human Treponema pallidum 11q/j isolate belongs to subsp. endemicum but contains two loci with a sequence in TP0548 and TP0488 similar to subsp. pertenue and subsp. pallidum, respectively

PubMed Central

Mikalová, Lenka; Strouhal, Michal; Oppelt, Jan; Grange, Philippe Alain; Janier, Michel; Benhaddou, Nadjet; Dupin, Nicolas; Šmajs, David

2017-01-01

Background Treponema pallidum subsp. endemicum (TEN) is the causative agent of endemic syphilis (bejel). An unusual human TEN 11q/j isolate was obtained from a syphilis-like primary genital lesion from a patient that returned to France from Pakistan. Methodology/Principal findings The TEN 11q/j isolate was characterized using nested PCR followed by Sanger sequencing and/or direct Illumina sequencing. Altogether, 44 chromosomal regions were analyzed. Overall, the 11q/j isolate clustered with TEN strains Bosnia A and Iraq B as expected from previous TEN classification of the 11q/j isolate. However, the 11q/j sequence in a 505 bp-long region at the TP0488 locus was similar to Treponema pallidum subsp. pallidum (TPA) strains, but not to TEN Bosnia A and Iraq B sequences, suggesting a recombination event at this locus. Similarly, the 11q/j sequence in a 613 bp-long region at the TP0548 locus was similar to Treponema pallidum subsp. pertenue (TPE) strains, but not to TEN sequences. Conclusions/Significance A detailed analysis of two recombinant loci found in the 11q/j clinical isolate revealed that the recombination event occurred just once, in the TP0488, with the donor sequence originating from a TPA strain. Since TEN Bosnia A and Iraq B were found to contain TPA-like sequences at the TP0548 locus, the recombination at TP0548 took place in a treponeme that was an ancestor to both TEN Bosnia A and Iraq B. The sequence of 11q/j isolate in TP0548 represents an ancestral TEN sequence that is similar to yaws-causing treponemes. In addition to the importance of the 11q/j isolate for reconstruction of the TEN phylogeny, this case emphasizes the possible role of TEN strains in development of syphilis-like lesions. PMID:28263990

The HMMER Web Server for Protein Sequence Similarity Search.

PubMed

Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

2017-12-08

Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Exploiting sequence similarity to validate the sensitivity of SNP arrays in detecting fine-scaled copy number variations.

PubMed

Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam

2010-04-15

High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE PAGES

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

2016-05-03

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Anticholinesterase-Responsive Weakness in the Canine Similar to Myasthenia Gravis of Man.

DTIC Science & Technology

1976-01-01

eyelids, ears , and facial fea- subcutaneous injection of 2 mg of atropine. A tures .18’21 ’25 Difficult prehension~ dysphagia , chok- evident within...acological t esting is very diagnostic but Ia, ’ weakness was noticed at the same t imenot witIu ~u t hazard . Ant icholines lerase given to a . esophageal

Weakly stationary noise filtering of satellite-acquired imagery

NASA Technical Reports Server (NTRS)

Palgen, J. J. O.; Tamches, I.; Deutsch, E. S.

1971-01-01

A type of weakly stationary noise called herringbone noise was observed in satellite imagery. The characteristics of this noise are described; a model for its simulation was developed. The model is used to degrade pictorial data for comparison with similar noise degraded Nimbus data. Two filtering methods are defined and evaluated. A user's application demonstration is discussed.

Peptide deformylases from Vibrio parahaemolyticus phage and bacteria display similar deformylase activity and inhibitor binding clefts.

PubMed

Grzela, Renata; Nusbaum, Julien; Fieulaine, Sonia; Lavecchia, Francesco; Desmadril, Michel; Nhiri, Naima; Van Dorsselaer, Alain; Cianferani, Sarah; Jacquet, Eric; Meinnel, Thierry; Giglione, Carmela

2018-02-01

Unexpected peptide deformylase (PDF) genes were recently retrieved in numerous marine phage genomes. While various hypotheses dealing with the occurrence of these intriguing sequences have been made, no further characterization and functional studies have been described thus far. In this study, we characterize the bacteriophage Vp16 PDF enzyme, as representative member of the newly identified C-terminally truncated viral PDFs. We show here that conditions classically used for bacterial PDFs lead to an enzyme exhibiting weak activity. Nonetheless, our integrated biophysical and biochemical approaches reveal specific effects of pH and metals on Vp16 PDF stability and activity. A novel purification protocol taking in account these data allowed strong improvement of Vp16 PDF specific activity to values similar to those of bacterial PDFs. We next show that Vp16 PDF is as sensitive to the natural inhibitor compound of PDFs, actinonin, as bacterial PDFs. Comparison of the 3D structures of Vp16 and E. coli PDFs bound to actinonin also reveals that both PDFs display identical substrate binding mode. We conclude that bacteriophage Vp16 PDF protein has functional peptide deformylase activity and we suggest that encoded phage PDFs might be important for viral fitness. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET).

PubMed Central

Price, M A; Rogers, A E; Treisman, R

1995-01-01

A transcription factor ternary complex composed of Serum Response Factor (SRF) and Ternary Complex Factor (TCF) mediates the response of the c-fos Serum Response Element (SRE) to growth factors and mitogens. Three Ets domain proteins, Elk-1, SAP-1 and ERP/NET, have been reported to have the properties of TCF. Here we compare Elk-1 and SAP-1a with the human ERP/NET homologue SAP-2. All three TCF RNAs are ubiquitously expressed at similar relative levels. All three proteins contain conserved regions that interact with SRF and the c-fos SRE with comparable efficiency, but in vitro complex formation by SAP-2 is strongly inhibited by its C-terminal sequences. Similarly, only Elk-1 and SAP-1a efficiently bind the c-fos SRE in vivo; ternary complex formation by SAP-2 is weak and is substantially unaffected by serum stimulation or v-ras co-expression. All three TCFs contain C-terminal transcriptional activation domains that are phosphorylated following growth factor stimulation. Activation requires conserved S/T-P motifs found in all the TCF family members. Each TCF activation domain can be phosphorylated in vitro by partially purified ERK2, and ERK activation in vivo is sufficient to potentiate transcriptional activation. Images PMID:7540136

Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET).

PubMed

Price, M A; Rogers, A E; Treisman, R

1995-06-01

A transcription factor ternary complex composed of Serum Response Factor (SRF) and Ternary Complex Factor (TCF) mediates the response of the c-fos Serum Response Element (SRE) to growth factors and mitogens. Three Ets domain proteins, Elk-1, SAP-1 and ERP/NET, have been reported to have the properties of TCF. Here we compare Elk-1 and SAP-1a with the human ERP/NET homologue SAP-2. All three TCF RNAs are ubiquitously expressed at similar relative levels. All three proteins contain conserved regions that interact with SRF and the c-fos SRE with comparable efficiency, but in vitro complex formation by SAP-2 is strongly inhibited by its C-terminal sequences. Similarly, only Elk-1 and SAP-1a efficiently bind the c-fos SRE in vivo; ternary complex formation by SAP-2 is weak and is substantially unaffected by serum stimulation or v-ras co-expression. All three TCFs contain C-terminal transcriptional activation domains that are phosphorylated following growth factor stimulation. Activation requires conserved S/T-P motifs found in all the TCF family members. Each TCF activation domain can be phosphorylated in vitro by partially purified ERK2, and ERK activation in vivo is sufficient to potentiate transcriptional activation.

Amino terminal sequence of heavy and light chains from ratfish immunoglobulin.

PubMed

De Ioannes, A E; Aguila, H L

1989-01-01

The ratfish, Callorhinchus callorhinchus, a representative of the Holocephali, has a natural serum hemagglutinin (Mr 960,000), composed of heavy (Mr 71,000), light (Mr 22,500), and J (Mr 16,000) chains. To approach the mechanisms that generate diversity at this level of evolution, the amino terminal sequence of the heavy and light chains was determined by automated microsequencing. The chains are unblocked and have modest internal sequence heterogeneity. The heavy chains show sequence similarity with the terminal region of the heavy chain from the horned shark, Heterodontus francisci, and other species. In contrast to the heavy chain, the ratfish light chains display low sequence similarity with their shark kappa counterparts. However, their similarity with the variable region of the chicken lambda light chains is about 75%.

Analysis of xylem formation in pine by cDNA sequencing

NASA Technical Reports Server (NTRS)

Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.;

Exome sequencing identifies a novel SMCHD1 mutation in facioscapulohumeral muscular dystrophy 2.

PubMed

Mitsuhashi, Satomi; Boyden, Steven E; Estrella, Elicia A; Jones, Takako I; Rahimov, Fedik; Yu, Timothy W; Darras, Basil T; Amato, Anthony A; Folkerth, Rebecca D; Jones, Peter L; Kunkel, Louis M; Kang, Peter B

2013-12-01

FSHD2 is a rare form of facioscapulohumeral muscular dystrophy (FSHD) characterized by the absence of a contraction in the D4Z4 macrosatellite repeat region on chromosome 4q35 that is the hallmark of FSHD1. However, hypomethylation of this region is common to both subtypes. Recently, mutations in SMCHD1 combined with a permissive 4q35 allele were reported to cause FSHD2. We identified a novel p.Lys275del SMCHD1 mutation in a family affected with FSHD2 using whole-exome sequencing and linkage analysis. This mutation alters a highly conserved amino acid in the ATPase domain of SMCHD1. Subject III-11 is a male who developed asymmetrical muscle weakness characteristic of FSHD at 13 years. Physical examination revealed marked bilateral atrophy at biceps brachii, bilateral scapular winging, some asymmetrical weakness at tibialis anterior and peroneal muscles, and mild lower facial weakness. Biopsy of biceps brachii in subject II-5, the father of III-11, demonstrated lobulated fibers and dystrophic changes. Endomysial and perivascular inflammation was found, which has been reported in FSHD1 but not FSHD2. Given the previous report of SMCHD1 mutations in FSHD2 and the clinical presentations consistent with the FSHD phenotype, we conclude that the SMCHD1 mutation is the likely cause of the disease in this family. Copyright © 2013 Elsevier B.V. All rights reserved.

SW#db: GPU-Accelerated Exact Sequence Similarity Database Search.

PubMed

Korpar, Matija; Šošić, Martin; Blažeka, Dino; Šikić, Mile

2015-01-01

In recent years we have witnessed a growth in sequencing yield, the number of samples sequenced, and as a result-the growth of publicly maintained sequence databases. The increase of data present all around has put high requirements on protein similarity search algorithms with two ever-opposite goals: how to keep the running times acceptable while maintaining a high-enough level of sensitivity. The most time consuming step of similarity search are the local alignments between query and database sequences. This step is usually performed using exact local alignment algorithms such as Smith-Waterman. Due to its quadratic time complexity, alignments of a query to the whole database are usually too slow. Therefore, the majority of the protein similarity search methods prior to doing the exact local alignment apply heuristics to reduce the number of possible candidate sequences in the database. However, there is still a need for the alignment of a query sequence to a reduced database. In this paper we present the SW#db tool and a library for fast exact similarity search. Although its running times, as a standalone tool, are comparable to the running times of BLAST, it is primarily intended to be used for exact local alignment phase in which the database of sequences has already been reduced. It uses both GPU and CPU parallelization and was 4-5 times faster than SSEARCH, 6-25 times faster than CUDASW++ and more than 20 times faster than SSW at the time of writing, using multiple queries on Swiss-prot and Uniref90 databases.

Using Nazarov Electrocyclization to Stage Chemoselective [1,2]-Migrations: Stereoselective Synthesis of Functionalized Cyclopentenones

PubMed Central

Lebœuf, David; Huang, Jie; Gandon, Vincent

2012-01-01

Highly functionalized cyclopentenones are prepared stereospecifically based on a chemoselective copper(II)-mediated Nazarov/Wagner-Meerwein rearrangement sequence. After the initial 4π electrocyclization, this reaction involves two sequential [1,2]-migrations depending upon both migratory ability and steric bulk of the substituents at C1 and C5. This sequence can be achieved by using a catalytic quantity of copper(II) in combination with a weak Lewis acid. The mechanism of the reaction is also supported by DFT computations. PMID:21953873

High processivity polymerases

DOEpatents

Shamoo, Yousif; Sun, Siyang

2014-06-10

Chimeric proteins comprising a sequence nonspecific single-stranded nucleic-acid-binding domain joined to a catalytic nucleic-acid-modifying domain are provided. Methods comprising contacting a nucleic acid molecule with a chimeric protein, as well as systems comprising a nucleic acid molecule, a chimeric protein, and an aqueous solution are also provided. The joining of sequence nonspecific single-stranded nucleic-acid-binding domain and a catalytic nucleic-acid-modifying domain in chimeric proteins, among other things, may prevent the separation of the two domains due to their weak association and thereby enhances processivity while maintaining fidelity.

Network analysis reveals seasonal variation of co-occurrence correlations between Cyanobacteria and other bacterioplankton.

PubMed

Zhao, Dayong; Shen, Feng; Zeng, Jin; Huang, Rui; Yu, Zhongbo; Wu, Qinglong L

2016-12-15

Association network approaches have recently been proposed as a means for exploring the associations between bacterial communities. In the present study, high-throughput sequencing was employed to investigate the seasonal variations in the composition of bacterioplankton communities in six eutrophic urban lakes of Nanjing City, China. Over 150,000 16S rRNA sequences were derived from 52 water samples, and correlation-based network analyses were conducted. Our results demonstrated that the architecture of the co-occurrence networks varied in different seasons. Cyanobacteria played various roles in the ecological networks during different seasons. Co-occurrence patterns revealed that members of Cyanobacteria shared a very similar niche and they had weak positive correlations with other phyla in summer. To explore the effect of environmental factors on species-species co-occurrence networks and to determine the most influential environmental factors, the original positive network was simplified by module partitioning and by calculating module eigengenes. Module eigengene analysis indicated that temperature only affected some Cyanobacteria; the rest were mainly affected by nitrogen associated factors throughout the year. Cyanobacteria were dominant in summer which may result from strong co-occurrence patterns and suitable living conditions. Overall, this study has improved our understanding of the roles of Cyanobacteria and other bacterioplankton in ecological networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation, phylogeny and evolution of the SymRK gene in the legume genus Lupinus L.

PubMed

Mahé, Frédéric; Markova, Dragomira; Pasquet, Rémy; Misset, Marie-Thérèse; Aïnouche, Abdelkader

2011-07-01

SymRK is one of the key genes involved in initial steps of legume symbiotic association with fungi (mycorrhization) and nitrogen-fixing bacteria (nodulation). A large portion of the sequence encoding the extracellular domain of SYMRK was obtained for 38 lupine accessions and 2 outgroups in order to characterize this region, to evaluate its phylogenetic utility, and to examine whether its molecular evolutionary pattern is correlated with rhizobial diversity and specificity in Lupinus. The data suggested that, in Lupinus, SymRK is a single copy gene that shows good phylogenetic potential. Accordingly, SymRK provided additional support to previous molecular phylogenies, and shed additional light on relationships within the Old World group of Lupinus, especially among the African species. Similar to results of other studies, analyses of SymRK sequences were unable to resolve placement of the Florida unifoliolate lineage, whose relationship was weakly supported to either the Old or the New World lupines. Our data are consistent with strong purifying selection operating on SymRK in Lupinus, preserving rather than diversifying its function. Thus, although SymRK was demonstrated to be a vital gene in the early stages of the root-bacterial symbiotic associations, no evidence from present analyses indicate that this gene is involved in changes in rhizobial specificity in Lupinus. Copyright © 2011 Elsevier Inc. All rights reserved.

PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

PubMed

Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

2015-07-01

The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Are Africans, Europeans, and Asians Different “Races”? A Guided-Inquiry Lab for Introducing Undergraduate Students to Genetic Diversity and Preparing Them to Study Natural Selection

PubMed Central

Kalinowski, Steven T.; Andrews, Tessa M.; Leonard, Mary J.; Snodgrass, Meagan

2012-01-01

Many students do not recognize that individual organisms within populations vary, and this may make it difficult for them to recognize the essential role variation plays in natural selection. Also, many students have weak scientific reasoning skills, and this makes it difficult for them to recognize misconceptions they might have. This paper describes a 2-h laboratory for college students that introduces them to genetic diversity and gives them practice using hypothetico-deductive reasoning. In brief, the lab presents students with DNA sequences from Africans, Europeans, and Asians, and asks students to determine whether people from each continent qualify as distinct “races.” Comparison of the DNA sequences shows that people on each continent are not more similar to one another than to people on other continents, and therefore do not qualify as distinct races. Ninety-four percent of our students reported that the laboratory was interesting, and 79% reported that it was a valuable learning experience. We developed and used a survey to measure the extent to which students recognized variation and its significance within populations and showed that the lab increased student awareness of variation. We also showed that the lab improved the ability of students to construct hypothetico-deductive arguments. PMID:22665587

Special discontinuities in nonlinearly elastic media

NASA Astrophysics Data System (ADS)

Chugainova, A. P.

2017-06-01

Solutions of a nonlinear hyperbolic system of equations describing weakly nonlinear quasitransverse waves in a weakly anisotropic elastic medium are studied. The influence of small-scale processes of dissipation and dispersion is investigated. The small-scale processes determine the structure of discontinuities (shocks) and a set of discontinuities with a stationary structure. Among the discontinuities with a stationary structure, there are special ones that, in addition to relations following from conservation laws, satisfy additional relations required for the existence of their structure. In the phase plane, the structure of such discontinuities is represented by an integral curve joining two saddles. Special discontinuities lead to nonunique self-similar solutions of the Riemann problem. Asymptotics of non-self-similar problems for equations with dissipation and dispersion are found numerically. These asymptotics correspond to self-similar solutions of the problems.

Structures in the transition zone of the northeast South China Sea: serpentinite dome vs mantle exhumation, or evidence of Mesozoic active subduction transferring to Cenozoic passive extension?

NASA Astrophysics Data System (ADS)

Sun, Z.; Zhou, D.

2013-12-01

Complete sedimentary sequences and weak erosion make the transition zone of the South China Sea the optimal place to study the entire evolution history of marginal sea basins, as well as the transition mechanism from active subduction to passive extension. 2D long cable seismic profiles revealed that both Baiyun and Liwan sag in the northeast South China Sea margin were lack of large controlling faults, especially in Liwan sag, syn-rift sequences waved above the basement. Dome-like uplifts(serpetinite uplifts?) or diapirs(?) came from below the basement, caused the syn-rift sequences pushed up around 36Ma(T80). Gravity inversion based on seismic reflection indicated that the dome has a lower density and a lower layer velocity than normal crust. Also around the Continent-Ocean Boundary (COB), a small segment similar to the lower crust was exposed. Between this exposed segment and the Cenozoic oceanic crust, mantle seems to be exhumed along the breakup point. Between the COB and roughly the shelf break, high velocity lower crust was discriminated in the northeast continental margin. Structures in northeast South China Sea seems having many similarities with Newfoundland-Iberia margin, by serpentinite(?) dome and exhumed mantle, although spreading rate here is intermediate. In fact, regional background suggests that there might be another interpretation: transition from Mesozoic subduction to Cenozoic extension occurred through paleo oceanic crust breakup in the northeast, which in turn retained Mesozoic subduction system beneath the northeast continental margin. Confined with magnetic anomaly, Bouguer gravity gradient anomaly, and well drilling lithological evidences, Cenozoic Baiyun sag developed upon Mesozoic fore-arc, while Cenozoic Liwan sag developed upon Mesozoic accretionary prism. The high velocity lower crust was caused by both remnant subducted slab and by Oceanic-Continent interaction due to subduction. There might also be serpentinite dome and exhumed mantle, but may be caused by extension and breakup of paleo oceanic slab, not the depth-dependent extension. IODP drillings are needed to test all these scientific conjectures.

Large-Scale Sequencing of Two Regions in Human Chromosome 7q22: Analysis of 650 kb of Genomic Sequence around the EPO and CUTL1 Loci Reveals 17 Genes

PubMed Central

Glöckner, Gernot; Scherer, Stephen; Schattevoy, Ruben; Boright, Andrew; Weber, Jacqueline; Tsui, Lap-Chee; Rosenthal, André

1998-01-01

We have sequenced and annotated two genomic regions located in the Giemsa negative band q22 of human chromosome 7. The first region defined by the erythropoietin (EPO) locus is 228 kb in length and contains 13 genes. Whereas 3 genes (GNB2, EPO, PCOLCE) were known previously on the mRNA level, we have been able to identify 10 novel genes using a newly developed automatic annotation tool RUMMAGE-DP, which comprises >26 different programs mainly for exon prediction, homology searches, and compositional and repeat analysis. For precise annotation we have also resequenced ESTs identified to the region and assembled them to build large cDNAs. In addition, we have investigated the differential splicing of genes. Using these tools we annotated 4 of the 10 genes as a zonadhesin, a transferrin homolog, a nucleoporin-like gene, and an actin gene. Two genes showed weak similarity to an insulin-like receptor and a neuronal protein with a leucine-rich amino-terminal domain. Four predicted genes (CDS1–CDS4) CDS that have been confirmed on the mRNA level showed no similarity to known proteins and a potential function could not be assigned. The second region in 7q22 defined by the CUTL1 (CCAAT displacement protein and its splice variant) locus is 416 kb in length and contains three known genes, including PMSL12, APS, CUTL1, and a novel gene (CDS5). The CUTL1 locus, consisting of two splice variants (CDP and CASP), occupies >300 kb. Based on the G,C profile an isochore switch can be defined between the CUTL1 gene and the APS and PMSL12 genes. [Clones 37G3, 164c7, and 235f8 are deposited in GenBank under accession no. AF053356; clone 123e15, accession no. AF024533; 186d2, accession no. AF024534; 46f6, accession no. AF006752; 50h2, accession no. AF047825; and 76h2, accession no. AF030453] PMID:9799793

Forecast in foreign exchange markets

NASA Astrophysics Data System (ADS)

Baviera, R.; Pasquini, M.; Serva, M.; Vergni, D.; Vulpiani, A.

2001-04-01

We perform a statistical study of weak efficiency in Deutschemark/US dollar exchange rates using high frequency data. The presence of correlations in the returns sequence implies the possibility of a statistical forecast of market behavior. We show the existence of correlations and how information theory can be relevant in this context.

Previously unknown and highly divergent ssDNA viruses populate the oceans.

PubMed

Labonté, Jessica M; Suttle, Curtis A

2013-11-01

Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.

Discrimination of germline V genes at different sequencing lengths and mutational burdens: A new tool for identifying and evaluating the reliability of V gene assignment.

PubMed

Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri

2015-12-01

Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

Prediction of Protein Structural Classes for Low-Similarity Sequences Based on Consensus Sequence and Segmented PSSM.

PubMed

Liang, Yunyun; Liu, Sanyang; Zhang, Shengli

2015-01-01

Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.

Diversity of virus-host systems in hypersaline Lake Retba, Senegal.

PubMed

Sime-Ngando, Télesphore; Lucas, Soizick; Robin, Agnès; Tucker, Kimberly Pause; Colombet, Jonathan; Bettarel, Yvan; Desmond, Elie; Gribaldo, Simonetta; Forterre, Patrick; Breitbart, Mya; Prangishvili, David

2011-08-01

Remarkable morphological diversity of virus-like particles was observed by transmission electron microscopy in a hypersaline water sample from Lake Retba, Senegal. The majority of particles morphologically resembled hyperthermophilic archaeal DNA viruses isolated from extreme geothermal environments. Some hypersaline viral morphotypes have not been previously observed in nature, and less than 1% of observed particles had a head-and-tail morphology, which is typical for bacterial DNA viruses. Culture-independent analysis of the microbial diversity in the sample suggested the dominance of extremely halophilic archaea. Few of the 16S sequences corresponded to known archeal genera (Haloquadratum, Halorubrum and Natronomonas), whereas the majority represented novel archaeal clades. Three sequences corresponded to a new basal lineage of the haloarchaea. Bacteria belonged to four major phyla, consistent with the known diversity in saline environments. Metagenomic sequencing of DNA from the purified virus-like particles revealed very few similarities to the NCBI non-redundant database at either the nucleotide or amino acid level. Some of the identifiable virus sequences were most similar to previously described haloarchaeal viruses, but no sequence similarities were found to archaeal viruses from extreme geothermal environments. A large proportion of the sequences had similarity to previously sequenced viral metagenomes from solar salterns. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

A survey and evaluations of histogram-based statistics in alignment-free sequence comparison.

PubMed

Luczak, Brian B; James, Benjamin T; Girgis, Hani Z

2017-12-06

Since the dawn of the bioinformatics field, sequence alignment scores have been the main method for comparing sequences. However, alignment algorithms are quadratic, requiring long execution time. As alternatives, scientists have developed tens of alignment-free statistics for measuring the similarity between two sequences. We surveyed tens of alignment-free k-mer statistics. Additionally, we evaluated 33 statistics and multiplicative combinations between the statistics and/or their squares. These statistics are calculated on two k-mer histograms representing two sequences. Our evaluations using global alignment scores revealed that the majority of the statistics are sensitive and capable of finding similar sequences to a query sequence. Therefore, any of these statistics can filter out dissimilar sequences quickly. Further, we observed that multiplicative combinations of the statistics are highly correlated with the identity score. Furthermore, combinations involving sequence length difference or Earth Mover's distance, which takes the length difference into account, are always among the highest correlated paired statistics with identity scores. Similarly, paired statistics including length difference or Earth Mover's distance are among the best performers in finding the K-closest sequences. Interestingly, similar performance can be obtained using histograms of shorter words, resulting in reducing the memory requirement and increasing the speed remarkably. Moreover, we found that simple single statistics are sufficient for processing next-generation sequencing reads and for applications relying on local alignment. Finally, we measured the time requirement of each statistic. The survey and the evaluations will help scientists with identifying efficient alternatives to the costly alignment algorithm, saving thousands of computational hours. The source code of the benchmarking tool is available as Supplementary Materials. © The Author 2017. Published by Oxford University Press.

Early Warning Signals for Regime Transition in the Stable Boundary Layer: A Model Study

NASA Astrophysics Data System (ADS)

van Hooijdonk, I. G. S.; Moene, A. F.; Scheffer, M.; Clercx, H. J. H.; van de Wiel, B. J. H.

2017-02-01

The evening transition is investigated in an idealized model for the nocturnal boundary layer. From earlier studies it is known that the nocturnal boundary layer may manifest itself in two distinct regimes, depending on the ambient synoptic conditions: strong-wind or overcast conditions typically lead to weakly stable, turbulent nights; clear-sky and weak-wind conditions, on the other hand, lead to very stable, weakly turbulent conditions. Previously, the dynamical behaviour near the transition between these regimes was investigated in an idealized setting, relying on Monin-Obukhov (MO) similarity to describe turbulent transport. Here, we investigate a similar set-up, using direct numerical simulation; in contrast to MO-based models, this type of simulation does not need to rely on turbulence closure assumptions. We show that previous predictions are verified, but now independent of turbulence parametrizations. Also, it appears that a regime shift to the very stable state is signaled in advance by specific changes in the dynamics of the turbulent boundary layer. Here, we show how these changes may be used to infer a quantitative estimate of the transition point from the weakly stable boundary layer to the very stable boundary layer. In addition, it is shown that the idealized, nocturnal boundary-layer system shares important similarities with generic non-linear dynamical systems that exhibit critical transitions. Therefore, the presence of other, generic early warning signals is tested as well. Indeed, indications are found that such signals are present in stably stratified turbulent flows.

Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins

PubMed Central

Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie

2005-01-01

Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486

Query-seeded iterative sequence similarity searching improves selectivity 5–20-fold

PubMed Central

Li, Weizhong; Lopez, Rodrigo

2017-01-01

Abstract Iterative similarity search programs, like psiblast, jackhmmer, and psisearch, are much more sensitive than pairwise similarity search methods like blast and ssearch because they build a position specific scoring model (a PSSM or HMM) that captures the pattern of sequence conservation characteristic to a protein family. But models are subject to contamination; once an unrelated sequence has been added to the model, homologs of the unrelated sequence will also produce high scores, and the model can diverge from the original protein family. Examination of alignment errors during psiblast PSSM contamination suggested a simple strategy for dramatically reducing PSSM contamination. psiblast PSSMs are built from the query-based multiple sequence alignment (MSA) implied by the pairwise alignments between the query model (PSSM, HMM) and the subject sequences in the library. When the original query sequence residues are inserted into gapped positions in the aligned subject sequence, the resulting PSSM rarely produces alignment over-extensions or alignments to unrelated sequences. This simple step, which tends to anchor the PSSM to the original query sequence and slightly increase target percent identity, can reduce the frequency of false-positive alignments more than 20-fold compared with psiblast and jackhmmer, with little loss in search sensitivity. PMID:27923999

Importance of weak minerals on earthquake mechanics

NASA Astrophysics Data System (ADS)

Kaneki, S.; Hirono, T.

2017-12-01

The role of weak minerals such as smectite and talc on earthquake mechanics is one of the important issues, and has been debated for recent several decades. Traditionally weak minerals in fault have been reported to weaken fault strength causing from its low frictional resistance. Furthermore, velocity-strengthening behavior of such weak mineral (talc) is considered to responsible for fault creep (aseismic slip) in the San Andreas fault. In contrast, recent studies reported that large amount of weak smectite in the Japan Trench could facilitate gigantic seismic slip during the 2011 Tohoku-oki earthquake. To investigate the role of weak minerals on rupture propagation process and magnitude of slip, we focus on the frictional properties of carbonaceous materials (CMs), which is the representative weak materials widely distributed in and around the convergent boundaries. Field observation and geochemical analyses revealed that graphitized CMs-layer is distributed along the slip surface of a fossil plate-subduction fault. Laboratory friction experiments demonstrated that pure quartz, bulk mixtures with bituminous coal (1 wt.%), and quartz with layered coal samples exhibited almost similar frictional properties (initial, yield, and dynamic friction). However, mixtures of quartz (99 wt.%) and layered graphite (1 wt.%) showed significantly lower initial and yield friction coefficient (0.31 and 0.50, respectively). Furthermore, the stress ratio S, defined as (yield stress-initial stress)/(initial stress-dynamic stress), increased in layered graphite samples (1.97) compared to quartz samples (0.14). Similar trend was observed in smectite-rich fault gouge. By referring the reported results of dynamic rupture propagation simulation using S ratio of 1.4 (typical value for the Japan Trench) and 2.0 (this study), we confirmed that higher S ratio results in smaller slip distance by approximately 20 %. On the basis of these results, we could conclude that weak minerals have lower initial/yield strength and higher S ratio, and thus restrain magnitude of slip during earthquake.

mrtailor: a tool for PDB-file preparation for the generation of external restraints.

PubMed

Gruene, Tim

2013-09-01

Model building starting from, for example, a molecular-replacement solution with low sequence similarity introduces model bias, which can be difficult to detect, especially at low resolution. The program mrtailor removes low-similarity regions from a template PDB file according to sequence similarity between the target sequence and the template sequence and maps the target sequence onto the PDB file. The modified PDB file can be used to generate external restraints for low-resolution refinement with reduced model bias and can be used as a starting point for model building and refinement. The program can call ProSMART [Nicholls et al. (2012), Acta Cryst. D68, 404-417] directly in order to create external restraints suitable for REFMAC5 [Murshudov et al. (2011), Acta Cryst. D67, 355-367]. Both a command-line version and a GUI exist.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Weak nanoscale chaos and anomalous relaxation in DNA

NASA Astrophysics Data System (ADS)

Mazur, Alexey K.

2017-06-01

Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

Weak nanoscale chaos and anomalous relaxation in DNA.

PubMed

Mazur, Alexey K

2017-06-01

Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Big and slow: phylogenetic estimates of molecular evolution in baleen whales (suborder mysticeti).

PubMed

Jackson, J A; Baker, C S; Vant, M; Steel, D J; Medrano-González, L; Palumbi, S R

2009-11-01

Baleen whales are the largest animals that have ever lived. To develop an improved estimation of substitution rate for nuclear and mitochondrial DNA for this taxon, we implemented a relaxed-clock phylogenetic approach using three fossil calibration dates: the divergence between odontocetes and mysticetes approximately 34 million years ago (Ma), between the balaenids and balaenopterids approximately 28 Ma, and the time to most recent common ancestor within the Balaenopteridae approximately 12 Ma. We examined seven mitochondrial genomes, a large number of mitochondrial control region sequences (219 haplotypes for 465 bp) and nine nuclear introns representing five species of whales, within which multiple species-specific alleles were sequenced to account for within-species diversity (1-15 for each locus). The total data set represents >1.65 Mbp of mitogenome and nuclear genomic sequence. The estimated substitution rate for the humpback whale control region (3.9%/million years, My) was higher than previous estimates for baleen whales but slow relative to other mammal species with similar generation times (e.g., human-chimp mean rate > 20%/My). The mitogenomic third codon position rate was also slow relative to other mammals (mean estimate 1%/My compared with a mammalian average of 9.8%/My for the cytochrome b gene). The mean nuclear genomic substitution rate (0.05%/My) was substantially slower than average synonymous estimates for other mammals (0.21-0.37%/My across a range of studies). The nuclear and mitogenome rate estimates for baleen whales were thus roughly consistent with an 8- to 10-fold slowing due to a combination of large body size and long generation times. Surprisingly, despite the large data set of nuclear intron sequences, there was only weak and conflicting support for alternate hypotheses about the phylogeny of balaenopterid whales, suggesting that interspecies introgressions or a rapid radiation has obscured species relationships in the nuclear genome.

454 Pyrosequencing to Describe Microbial Eukaryotic Community Composition, Diversity and Relative Abundance: A Test for Marine Haptophytes

PubMed Central

Egge, Elianne; Bittner, Lucie; Andersen, Tom; Audic, Stéphane; de Vargas, Colomban; Edvardsen, Bente

2013-01-01

Next generation sequencing of ribosomal DNA is increasingly used to assess the diversity and structure of microbial communities. Here we test the ability of 454 pyrosequencing to detect the number of species present, and assess the relative abundance in terms of cell numbers and biomass of protists in the phylum Haptophyta. We used a mock community consisting of equal number of cells of 11 haptophyte species and compared targeting DNA and RNA/cDNA, and two different V4 SSU rDNA haptophyte-biased primer pairs. Further, we tested four different bioinformatic filtering methods to reduce errors in the resulting sequence dataset. With sequencing depth of 11000–20000 reads and targeting cDNA with Haptophyta specific primers Hap454 we detected all 11 species. A rarefaction analysis of expected number of species recovered as a function of sampling depth suggested that minimum 1400 reads were required here to recover all species in the mock community. Relative read abundance did not correlate to relative cell numbers. Although the species represented with the largest biomass was also proportionally most abundant among the reads, there was generally a weak correlation between proportional read abundance and proportional biomass of the different species, both with DNA and cDNA as template. The 454 sequencing generated considerable spurious diversity, and more with cDNA than DNA as template. With initial filtering based only on match with barcode and primer we observed 100-fold more operational taxonomic units (OTUs) at 99% similarity than the number of species present in the mock community. Filtering based on quality scores, or denoising with PyroNoise resulted in ten times more OTU99% than the number of species. Denoising with AmpliconNoise reduced the number of OTU99% to match the number of species present in the mock community. Based on our analyses, we propose a strategy to more accurately depict haptophyte diversity using 454 pyrosequencing. PMID:24069303

Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.

PubMed

Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H

2014-05-01

Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).

Adhesive Proteins of Stalked and Acorn Barnacles Display Homology with Low Sequence Similarities

PubMed Central

Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie

2014-01-01

Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins ‘sticky’ has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7–16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18–26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa). PMID:25295513

Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

PubMed

Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie

2014-01-01

Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa).

Diatom ooze as weak layer for submarine mega-slides off Northwest Africa: Evidence from core-seismic integration in the Cap Blanc Slide area

NASA Astrophysics Data System (ADS)

Urlaub, Morelia; Geersen, Jacob; Krastel, Sebastian; Schwenk, Tilmann

2017-04-01

The continental slope off Northwest Africa has experienced at least four mega-landslides, each affecting over 20,000 km2 of seafloor. Although the landslides lie more than 400 km apart, they have many similar characteristics, including stepped headwall patterns and several bedding-parallel glide planes at slope angles of <2°. This morphology suggests that failures took place along multiple mechanically weak sedimentary layers that are present at different stratigraphic depths. From all Northwest African mega-landslides the Cap Blanc Slide, situated off the coasts of Mauretania and West Sahara, offers an unprecedented possibility to advance our understanding of landslide causes. ODP site 658 (Leg 108) was drilled within the evacuation area of the slide, recovering its glide plane. In addition, site 658 also recovered the glide plane and the overlying undisturbed sedimentary sequence of a younger slope failure, which took place within the evacuation are of the main Cap Blanc Slide at some distance to the borehole. We use core-seismic integration to characterize the glide planes as well as to determine the timing of slope failures. The sediments just above both glide planes have particularly high biogenic opal contents owing to the presence of large amounts of diatom microfossils. Diatoms are hollow structures of microfossil skeletons, which contain large amounts of bound and intraskeletal water. When a critical stress level is exceeded during compaction, the microfossil shells break. The stored water is released causing a sudden increase in pore pressure, which may facilitate slope failure. We therefore suggest that diatom oozes acted as weak layers in the case of the Cap Blanc Slide. Pronounced biogenic opal maxima occur during glacial terminations and are expected all along the Northwest African continental margin. We thus hypothesize that mega-slides off Northwest Africa, and potentially also at other continental margins, are preconditioned by episodically high deposition of biogenic opal.

From the Blazar Sequence to the Blazar Envelope: Revisiting the Relativistic Jet Dichotomy in Radio-Loud AGN

NASA Technical Reports Server (NTRS)

Meyer, Eileen T.; Fossati, Giovanini; Georganopoulos, Markos; Lister, Matthew L.

2012-01-01

We revisit the concept of a blazar sequence that relates the synchrotron peak frequency (Vpeak) in blazars with synchrotron peak luminosity (Lpeak, in vLv) using a large sample of radio-loud AGN. We present observational evidence that the blazar sequence is formed from two populations in the synchrotron Vpeak - Lpeak plane, each forming an upper edge to an envelope of progressively misaligned blazars, and connecting to an adjacent group of radio galaxies having jets viewed at much larger angles to the line of sight. When binned by jet kinetic power (Lkin; as measured through a scaling relationship with extended radio power), we find that radio core dominance decreases with decreasing synchrotron Lpeak, revealing that sources in the envelope are generally more misaligned. We find population-based evidence of velocity gradients in jets at low kinetic powers (approximately 10(exp 42) - 10(exp 44.5) erg s(exp -1)), corresponding to FR I radio galaxies and most BL Lacs. These low jet power 'weak jet' sources, thought to exhibit radiatively inefficient accretion, are distinguished from the population of non-decelerating, low synchrotron-peaking (LSP) blazars and FR II radio galaxies ('strong' jets) which are thought to exhibit radiatively efficient accretion. The two-population interpretation explains the apparent contradiction of the existence of highly core-dominated, low-power blazars at both low and high synchrotron peak frequencies, and further implies that most intermediate synchrotron peak (ISP) sources are not intermediate in intrinsic jet power between LSP and high synchrotron-peaking (HSP) sources, but are more misaligned versions of HSP sources with similar jet powers.

Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

NASA Astrophysics Data System (ADS)

He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

2013-11-01

The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

The mean star formation rates of unobscured QSOs: searching for evidence of suppressed or enhanced star formation

NASA Astrophysics Data System (ADS)

Stanley, F.; Alexander, D. M.; Harrison, C. M.; Rosario, D. J.; Wang, L.; Aird, J. A.; Bourne, N.; Dunne, L.; Dye, S.; Eales, S.; Knudsen, K. K.; Michałowski, M. J.; Valiante, E.; De Zotti, G.; Furlanetto, C.; Ivison, R.; Maddox, S.; Smith, M. W. L.

2017-12-01

We investigate the mean star formation rates (SFRs) in the host galaxies of ∼3000 optically selected quasi-stellar objects (QSOs) from the Sloan Digital Sky Survey within the Herschel-ATLAS fields, and a radio-luminous subsample covering the redshift range of z = 0.2-2.5. Using Wide-field Infrared Survey Explorer (WISE) and Herschel photometry (12-500 μm) we construct composite spectral energy distributions (SEDs) in bins of redshift and active galactic nucleus (AGN) luminosity. We perform SED fitting to measure the mean infrared luminosity due to star formation, removing the contamination from AGN emission. We find that the mean SFRs show a weak positive trend with increasing AGN luminosity. However, we demonstrate that the observed trend could be due to an increase in black hole (BH) mass (and a consequent increase of inferred stellar mass) with increasing AGN luminosity. We compare to a sample of X-ray selected AGN and find that the two populations have consistent mean SFRs when matched in AGN luminosity and redshift. On the basis of the available virial BH masses, and the evolving BH mass to stellar mass relationship, we find that the mean SFRs of our QSO sample are consistent with those of main sequence star-forming galaxies. Similarly the radio-luminous QSOs have mean SFRs that are consistent with both the overall QSO sample and with star-forming galaxies on the main sequence. In conclusion, on average QSOs reside on the main sequence of star-forming galaxies, and the observed positive trend between the mean SFRs and AGN luminosity can be attributed to BH mass and redshift dependencies.

Emulating weak localization using a solid-state quantum circuit.

PubMed

Chen, Yu; Roushan, P; Sank, D; Neill, C; Lucero, Erik; Mariantoni, Matteo; Barends, R; Chiaro, B; Kelly, J; Megrant, A; Mutus, J Y; O'Malley, P J J; Vainsencher, A; Wenner, J; White, T C; Yin, Yi; Cleland, A N; Martinis, John M

2014-10-14

Quantum interference is one of the most fundamental physical effects found in nature. Recent advances in quantum computing now employ interference as a fundamental resource for computation and control. Quantum interference also lies at the heart of sophisticated condensed matter phenomena such as Anderson localization, phenomena that are difficult to reproduce in numerical simulations. Here, employing a multiple-element superconducting quantum circuit, with which we manipulate a single microwave photon, we demonstrate that we can emulate the basic effects of weak localization. By engineering the control sequence, we are able to reproduce the well-known negative magnetoresistance of weak localization as well as its temperature dependence. Furthermore, we can use our circuit to continuously tune the level of disorder, a parameter that is not readily accessible in mesoscopic systems. Demonstrating a high level of control, our experiment shows the potential for employing superconducting quantum circuits as emulators for complex quantum phenomena.

Effective Identification of Similar Patients Through Sequential Matching over ICD Code Embedding.

PubMed

Nguyen, Dang; Luo, Wei; Venkatesh, Svetha; Phung, Dinh

2018-04-11

Evidence-based medicine often involves the identification of patients with similar conditions, which are often captured in ICD (International Classification of Diseases (World Health Organization 2013)) code sequences. With no satisfying prior solutions for matching ICD-10 code sequences, this paper presents a method which effectively captures the clinical similarity among routine patients who have multiple comorbidities and complex care needs. Our method leverages the recent progress in representation learning of individual ICD-10 codes, and it explicitly uses the sequential order of codes for matching. Empirical evaluation on a state-wide cancer data collection shows that our proposed method achieves significantly higher matching performance compared with state-of-the-art methods ignoring the sequential order. Our method better identifies similar patients in a number of clinical outcomes including readmission and mortality outlook. Although this paper focuses on ICD-10 diagnosis code sequences, our method can be adapted to work with other codified sequence data.

Mass loss from pre-main-sequence accretion disks. I - The accelerating wind of FU Orionis

NASA Technical Reports Server (NTRS)

Calvet, Nuria; Hartmann, Lee; Kenyon, Scott J.

1993-01-01

We present evidence that the wind of the pre-main-sequence object FU Orionis arises from the surface of the luminous accretion disk. A disk wind model calculated assuming radiative equilibrium explains the differential behavior of the observed asymmetric absorption-line profiles. The model predicts that strong lines should be asymmetric and blueshifted, while weak lines should be symmetric and double-peaked due to disk rotation, in agreement with observations. We propose that many blueshifted 'shell' absorption features are not produced in a true shell of material, but rather form in a differentially expanding wind that is rapidly rotating. The inference of rapid rotation supports the proposal that pre-main-sequence disk winds are rotationally driven.

Unraveling systematic inventory of Echinops (Asteraceae) with special reference to nrDNA ITS sequence-based molecular typing of Echinops abuzinadianus.

PubMed

Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O

2015-10-02

The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.

Nucleotide sequence of the Saccharomyces cerevisiae PUT4 proline-permease-encoding gene: similarities between CAN1, HIP1 and PUT4 permeases.

PubMed

Vandenbol, M; Jauniaux, J C; Grenson, M

1989-11-15

The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.

BAG3 myofibrillar myopathy presenting with cardiomyopathy.

PubMed

Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

2015-05-01

Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

String Mining in Bioinformatics

NASA Astrophysics Data System (ADS)

Abouelhoda, Mohamed; Ghanem, Moustafa

Sequence analysis is a major area in bioinformatics encompassing the methods and techniques for studying the biological sequences, DNA, RNA, and proteins, on the linear structure level. The focus of this area is generally on the identification of intra- and inter-molecular similarities. Identifying intra-molecular similarities boils down to detecting repeated segments within a given sequence, while identifying inter-molecular similarities amounts to spotting common segments among two or multiple sequences. From a data mining point of view, sequence analysis is nothing but string- or pattern mining specific to biological strings. For a long time, this point of view, however, has not been explicitly embraced neither in the data mining nor in the sequence analysis text books, which may be attributed to the co-evolution of the two apparently independent fields. In other words, although the word "data-mining" is almost missing in the sequence analysis literature, its basic concepts have been implicitly applied. Interestingly, recent research in biological sequence analysis introduced efficient solutions to many problems in data mining, such as querying and analyzing time series [49,53], extracting information from web pages [20], fighting spam mails [50], detecting plagiarism [22], and spotting duplications in software systems [14].

String Mining in Bioinformatics

NASA Astrophysics Data System (ADS)

Abouelhoda, Mohamed; Ghanem, Moustafa

Sequence analysis is a major area in bioinformatics encompassing the methods and techniques for studying the biological sequences, DNA, RNA, and proteins, on the linear structure level. The focus of this area is generally on the identification of intra- and inter-molecular similarities. Identifying intra-molecular similarities boils down to detecting repeated segments within a given sequence, while identifying inter-molecular similarities amounts to spotting common segments among two or multiple sequences. From a data mining point of view, sequence analysis is nothing but string- or pattern mining specific to biological strings. For a long time, this point of view, however, has not been explicitly embraced neither in the data mining nor in the sequence analysis text books, which may be attributed to the co-evolution of the two apparently independent fields. In other words, although the word “data-mining” is almost missing in the sequence analysis literature, its basic concepts have been implicitly applied. Interestingly, recent research in biological sequence analysis introduced efficient solutions to many problems in data mining, such as querying and analyzing time series [49,53], extracting information from web pages [20], fighting spam mails [50], detecting plagiarism [22], and spotting duplications in software systems [14].

Markov model plus k-word distributions: a synergy that produces novel statistical measures for sequence comparison.

PubMed

Dai, Qi; Yang, Yanchun; Wang, Tianming

2008-10-15

Many proposed statistical measures can efficiently compare biological sequences to further infer their structures, functions and evolutionary information. They are related in spirit because all the ideas for sequence comparison try to use the information on the k-word distributions, Markov model or both. Motivated by adding k-word distributions to Markov model directly, we investigated two novel statistical measures for sequence comparison, called wre.k.r and S2.k.r. The proposed measures were tested by similarity search, evaluation on functionally related regulatory sequences and phylogenetic analysis. This offers the systematic and quantitative experimental assessment of our measures. Moreover, we compared our achievements with these based on alignment or alignment-free. We grouped our experiments into two sets. The first one, performed via ROC (receiver operating curve) analysis, aims at assessing the intrinsic ability of our statistical measures to search for similar sequences from a database and discriminate functionally related regulatory sequences from unrelated sequences. The second one aims at assessing how well our statistical measure is used for phylogenetic analysis. The experimental assessment demonstrates that our similarity measures intending to incorporate k-word distributions into Markov model are more efficient.

The prognosis of self-reported paresthesia and weakness in disc-related sciatica.

PubMed

Grøvle, L; Haugen, A J; Natvig, B; Brox, J I; Grotle, M

2013-11-01

To explore how patients with sciatica rate the 'bothersomeness' of paresthesia (tingling and numbness) and weakness as compared with leg pain during 2 years of follow-up. Observational cohort study including 380 patients with sciatica and lumbar disc herniation referred to secondary care. Using the Sciatica Bothersomeness Index paresthesia, weakness and leg pain were rated on a scale from 0 to 6. A symptom score of 4-6 was defined as bothersome. Along with leg pain, the bothersomeness of paresthesia and weakness both improved during follow-up. Those who received surgery (n = 121) reported larger improvements in both symptoms than did those who were treated without surgery. At 2 years, 18.2% of the patients reported bothersome paresthesia, 16.6% reported bothersome leg pain, and 11.5% reported bothersome weakness. Among patients with no or little leg pain, 6.7% reported bothersome paresthesia and 5.1% bothersome weakness. During 2 years of follow-up, patients considered paresthesia more bothersome than weakness. At 2 years, the percentage of patients who reported bothersome paresthesia was similar to the percentage who reported bothersome leg pain. Based on patients' self-report, paresthesia and weakness are relevant aspects of disc-related sciatica.

Comparison of topological clustering within protein networks using edge metrics that evaluate full sequence, full structure, and active site microenvironment similarity.

PubMed

Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S

2015-09-01

The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

Comparison of topological clustering within protein networks using edge metrics that evaluate full sequence, full structure, and active site microenvironment similarity

PubMed Central

Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S

2015-01-01

The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

SeqAPASS (Sequence Alignment to Predict Across Species Susceptibility) software and documentation

EPA Science Inventory

SeqAPASS is a software application facilitates rapid and streamlined, yet transparent, comparisons of the similarity of toxicologically-significant molecular targets across species. The present application facilitates analysis of primary amino acid sequence similarity (including ...

Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae), a mammalian family that experienced rapid speciation.

PubMed

Yu, Li; Li, Yi-Wei; Ryder, Oliver A; Zhang, Ya-Ping

2007-10-24

Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt) gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other difficult phylogenetic issues. Although the whole mitochondrial DNA sequence based phylogeny is robust, it remains in conflict with phylogenetic relationships suggested by analysis of limited nuclear-encoded data, a situation that will require gathering more nuclear DNA sequence information.

Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae), a mammalian family that experienced rapid speciation

PubMed Central

Yu, Li; Li, Yi-Wei; Ryder, Oliver A; Zhang, Ya-Ping

2007-01-01

Background Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt) gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. Results This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Conclusion Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other difficult phylogenetic issues. Although the whole mitochondrial DNA sequence based phylogeny is robust, it remains in conflict with phylogenetic relationships suggested by analysis of limited nuclear-encoded data, a situation that will require gathering more nuclear DNA sequence information. PMID:17956639

GWFASTA: server for FASTA search in eukaryotic and microbial genomes.

PubMed

Issac, Biju; Raghava, G P S

2002-09-01

Similarity searches are a powerful method for solving important biological problems such as database scanning, evolutionary studies, gene prediction, and protein structure prediction. FASTA is a widely used sequence comparison tool for rapid database scanning. Here we describe the GWFASTA server that was developed to assist the FASTA user in similarity searches against partially and/or completely sequenced genomes. GWFASTA consists of more than 60 microbial genomes, eight eukaryote genomes, and proteomes of annotatedgenomes. Infact, it provides the maximum number of databases for similarity searching from a single platform. GWFASTA allows the submission of more than one sequence as a single query for a FASTA search. It also provides integrated post-processing of FASTA output, including compositional analysis of proteins, multiple sequences alignment, and phylogenetic analysis. Furthermore, it summarizes the search results organism-wise for prokaryotes and chromosome-wise for eukaryotes. Thus, the integration of different tools for sequence analyses makes GWFASTA a powerful toolfor biologists.

Molecular sled sequences are common in mammalian proteins.

PubMed

Xiong, Kan; Blainey, Paul C

2016-03-18

Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Multiple alignment-free sequence comparison

PubMed Central

Ren, Jie; Song, Kai; Sun, Fengzhu; Deng, Minghua; Reinert, Gesine

2013-01-01

Motivation: Recently, a range of new statistics have become available for the alignment-free comparison of two sequences based on k-tuple word content. Here, we extend these statistics to the simultaneous comparison of more than two sequences. Our suite of statistics contains, first, and , extensions of statistics for pairwise comparison of the joint k-tuple content of all the sequences, and second, , and , averages of sums of pairwise comparison statistics. The two tasks we consider are, first, to identify sequences that are similar to a set of target sequences, and, second, to measure the similarity within a set of sequences. Results: Our investigation uses both simulated data as well as cis-regulatory module data where the task is to identify cis-regulatory modules with similar transcription factor binding sites. We find that although for real data, all of our statistics show a similar performance, on simulated data the Shepp-type statistics are in some instances outperformed by star-type statistics. The multiple alignment-free statistics are more sensitive to contamination in the data than the pairwise average statistics. Availability: Our implementation of the five statistics is available as R package named ‘multiAlignFree’ at be http://www-rcf.usc.edu/∼fsun/Programs/multiAlignFree/multiAlignFreemain.html. Contact: reinert@stats.ox.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23990418

Investigating Student Understanding for a Statistical Analysis of Two Thermally Interacting Solids

NASA Astrophysics Data System (ADS)

Loverude, Michael E.

2010-10-01

As part of an ongoing research and curriculum development project for upper-division courses in thermal physics, we have developed a sequence of tutorials in which students apply statistical methods to examine the behavior of two interacting Einstein solids. In the sequence, students begin with simple results from probability and develop a means for counting the states in a single Einstein solid. The students then consider the thermal interaction of two solids, and observe that the classical equilibrium state corresponds to the most probable distribution of energy between the two solids. As part of the development of the tutorial sequence, we have developed several assessment questions to probe student understanding of various aspects of this system. In this paper, we describe the strengths and weaknesses of student reasoning, both qualitative and quantitative, to assess the readiness of students for one tutorial in the sequence.

Computational tools for copy number variation (CNV) detection using next-generation sequencing data: features and perspectives.

PubMed

Zhao, Min; Wang, Qingguo; Wang, Quan; Jia, Peilin; Zhao, Zhongming

2013-01-01

Copy number variation (CNV) is a prevalent form of critical genetic variation that leads to an abnormal number of copies of large genomic regions in a cell. Microarray-based comparative genome hybridization (arrayCGH) or genotyping arrays have been standard technologies to detect large regions subject to copy number changes in genomes until most recently high-resolution sequence data can be analyzed by next-generation sequencing (NGS). During the last several years, NGS-based analysis has been widely applied to identify CNVs in both healthy and diseased individuals. Correspondingly, the strong demand for NGS-based CNV analyses has fuelled development of numerous computational methods and tools for CNV detection. In this article, we review the recent advances in computational methods pertaining to CNV detection using whole genome and whole exome sequencing data. Additionally, we discuss their strengths and weaknesses and suggest directions for future development.

Computational tools for copy number variation (CNV) detection using next-generation sequencing data: features and perspectives

PubMed Central

2013-01-01

Copy number variation (CNV) is a prevalent form of critical genetic variation that leads to an abnormal number of copies of large genomic regions in a cell. Microarray-based comparative genome hybridization (arrayCGH) or genotyping arrays have been standard technologies to detect large regions subject to copy number changes in genomes until most recently high-resolution sequence data can be analyzed by next-generation sequencing (NGS). During the last several years, NGS-based analysis has been widely applied to identify CNVs in both healthy and diseased individuals. Correspondingly, the strong demand for NGS-based CNV analyses has fuelled development of numerous computational methods and tools for CNV detection. In this article, we review the recent advances in computational methods pertaining to CNV detection using whole genome and whole exome sequencing data. Additionally, we discuss their strengths and weaknesses and suggest directions for future development. PMID:24564169

Cross-correlation of weak lensing and gamma rays: implications for the nature of dark matter

NASA Astrophysics Data System (ADS)

Tröster, Tilman; Camera, Stefano; Fornasa, Mattia; Regis, Marco; van Waerbeke, Ludovic; Harnois-Déraps, Joachim; Ando, Shin'ichiro; Bilicki, Maciej; Erben, Thomas; Fornengo, Nicolao; Heymans, Catherine; Hildebrandt, Hendrik; Hoekstra, Henk; Kuijken, Konrad; Viola, Massimo

2017-05-01

We measure the cross-correlation between Fermi gamma-ray photons and over 1000 deg2 of weak lensing data from the Canada-France-Hawaii Telescope Lensing Survey (CFHTLenS), the Red Cluster Sequence Lensing Survey (RCSLenS), and the Kilo Degree Survey (KiDS). We present the first measurement of tomographic weak lensing cross-correlations and the first application of spectral binning to cross-correlations between gamma rays and weak lensing. The measurements are performed using an angular power spectrum estimator while the covariance is estimated using an analytical prescription. We verify the accuracy of our covariance estimate by comparing it to two internal covariance estimators. Based on the non-detection of a cross-correlation signal, we derive constraints on weakly interacting massive particle (WIMP) dark matter. We compute exclusion limits on the dark matter annihilation cross-section <σannv>, decay rate Γdec and particle mass mDM. We find that in the absence of a cross-correlation signal, tomography does not significantly improve the constraining power of the analysis. Assuming a strong contribution to the gamma-ray flux due to small-scale clustering of dark matter and accounting for known astrophysical sources of gamma rays, we exclude the thermal relic cross-section for particle masses of mDM ≲ 20 GeV.

A discrete artificial bee colony algorithm for detecting transcription factor binding sites in DNA sequences.

PubMed

Karaboga, D; Aslan, S

2016-04-27

The great majority of biological sequences share significant similarity with other sequences as a result of evolutionary processes, and identifying these sequence similarities is one of the most challenging problems in bioinformatics. In this paper, we present a discrete artificial bee colony (ABC) algorithm, which is inspired by the intelligent foraging behavior of real honey bees, for the detection of highly conserved residue patterns or motifs within sequences. Experimental studies on three different data sets showed that the proposed discrete model, by adhering to the fundamental scheme of the ABC algorithm, produced competitive or better results than other metaheuristic motif discovery techniques.

An assessment of catalytic residue 3D ensembles for the prediction of enzyme function.

PubMed

Žváček, Clemens; Friedrichs, Gerald; Heizinger, Leonhard; Merkl, Rainer

2015-11-04

The central element of each enzyme is the catalytic site, which commonly catalyzes a single biochemical reaction with high specificity. It was unclear to us how often sites that catalyze the same or highly similar reactions evolved on different, i. e. non-homologous protein folds and how similar their 3D poses are. Both similarities are key criteria for assessing the usability of pose comparison for function prediction. We have analyzed the SCOP database on the superfamily level in order to estimate the number of non-homologous enzymes possessing the same function according to their EC number. 89% of the 873 substrate-specific functions (four digit EC number) assigned to mono-functional, single-domain enzymes were only found in one superfamily. For a reaction-specific grouping (three digit EC number), this value dropped to 35%, indicating that in approximately 65% of all enzymes the same function evolved in two or more non-homologous proteins. For these isofunctional enzymes, structural similarity of the catalytic sites may help to predict function, because neither high sequence similarity nor identical folds are required for a comparison. To assess the specificity of catalytic 3D poses, we compiled the redundancy-free set ENZ_SITES, which comprises 695 sites, whose composition and function are well-defined. We compared their poses with the help of the program Superpose3D and determined classification performance. If the sites were from different superfamilies, the number of true and false positive predictions was similarly high, both for a coarse and a detailed grouping of enzyme function. Moreover, classification performance did not improve drastically, if we additionally used homologous sites to predict function. For a large number of enzymatic functions, dissimilar sites evolved that catalyze the same reaction and it is the individual substrate that determines the arrangement of the catalytic site and its local environment. These substrate-specific requirements turn the comparison of catalytic residues into a weak classifier for the prediction of enzyme function.

Weak Lensing from Space I: Instrumentation and Survey Strategy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rhodes, Jason; Refregier, Alexandre; Massey, Richard

A wide field space-based imaging telescope is necessary to fully exploit the technique of observing dark matter via weak gravitational lensing. This first paper in a three part series outlines the survey strategies and relevant instrumental parameters for such a mission. As a concrete example of hardware design, we consider the proposed Supernova/Acceleration Probe (SNAP). Using SNAP engineering models, we quantify the major contributions to this telescope's Point Spread Function (PSF). These PSF contributions are relevant to any similar wide field space telescope. We further show that the PSF of SNAP or a similar telescope will be smaller than currentmore » ground-based PSFs, and more isotropic and stable over time than the PSF of the Hubble Space Telescope. We outline survey strategies for two different regimes - a ''wide'' 300 square degree survey and a ''deep'' 15 square degree survey that will accomplish various weak lensing goals including statistical studies and dark matter mapping.« less

Whole genome sequencing in the prevention and control of Staphylococcus aureus infection.

PubMed

Price, J R; Didelot, X; Crook, D W; Llewelyn, M J; Paul, J

2013-01-01

Staphylococcus aureus remains a leading cause of hospital-acquired infection but weaknesses inherent in currently available typing methods impede effective infection prevention and control. The high resolution offered by whole genome sequencing has the potential to revolutionise our understanding and management of S. aureus infection. To outline the practicalities of whole genome sequencing and discuss how it might shape future infection control practice. We review conventional typing methods and compare these with the potential offered by whole genome sequencing. In contrast with conventional methods, whole genome sequencing discriminates down to single nucleotide differences and allows accurate characterisation of transmission events and outbreaks and additionally provides information about the genetic basis of phenotypic characteristics, including antibiotic susceptibility and virulence. However, translating its potential into routine practice will depend on affordability, acceptable turnaround times and on creating a reliable standardised bioinformatic infrastructure. Whole genome sequencing has the potential to provide a universal test that facilitates outbreak investigation, enables the detection of emerging strains and predicts their clinical importance. Copyright © 2012 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Using He I λ10830 to Diagnose Mass Flows Around Herbig Ae/Be Stars

NASA Astrophysics Data System (ADS)

Cauley, Paul W.; Johns-Krull, Christopher M.

2015-01-01

The pre-main sequence Herbig Ae/Be stars (HAEBES) are the intermediate mass cousins of the low mass T Tauri stars (TTSs). However, it is not clear that the same accretion and mass outflow mechanisms operate identically in both mass regimes. Classical TTSs (CTTSs) accrete material from their disks along stellar magnetic field lines in a scenario called magnetospheric accretion. Magnetospheric accretion requires a strong stellar dipole field in order to truncate the inner gas disk. These fields are either absent or very weak on a large majority of HAEBES, challenging the view that magnetospheric accretion is the dominant accretion mechanism. If magnetospheric accretion does not operate similarly around HAEBES as it does around CTTSs, then strong magnetocentrifugal outflows, which are directly linked to accretion and are ubiquitous around CTTSs, may be driven less efficiently from HAEBE systems. Here we present high resolution spectroscopic observations of the He I λ10830 line in a sample of 48 HAEBES. He I λ10830 is an excellent tracer of both mass infall and outflow which is directly manifested as red and blue-shifted absorption in the profile morphologies. These features, among others, are common in our sample. The occurrence of both red and blue-shifted absorption profiles is less frequent, however, than is found in CTTSs. Statistical contingency tests confirm this difference at a significant level. In addition, we find strong evidence for smaller disk truncation radii in the objects displaying red-shifted absorption profiles. This is expected for HAEBES experiencing magnetospheric accretion based on their large rotation rates and weak magnetic field strengths. Finally, the low incidence of blue-shifted absorption in our sample compared to CTTSs and the complete lack of simultaneous red and blue-shifted absorption features suggests that magnetospheric accretion in HAEBES is less efficient at driving strong outflows. The stellar wind-like outflows that are observed are likely driven, at least in part, by boundary layer accretion. The smaller (or absent) disk truncation radii in HAEBES may have consequences for the frequency of planets in close orbits around main sequence B and A stars.

Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

PubMed

Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

2018-01-01

The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the digenic nature of the disease.

An exonic missense mutation c.28G>A is associated with weak B blood group by affecting RNA splicing of the ABO gene.

PubMed

Cai, Xiaohong; Qian, Chengrui; Wu, Wenman; Lei, Hang; Ding, Qiulan; Zou, Wei; Xiang, Dong; Wang, Xuefeng

2017-09-01

The amino acid substitutions caused by ABO gene mutations are usually predicted to impact glycosyltransferase's function or its biosynthesis. Here we report an ABO exonic missense mutation that affects B-antigen expression by decreasing the mRNA level of the ABO gene rather than the amino acid change. Serologic studies including plasma total GTB transfer capacity were performed. The exon sequences of the ABO gene were analyzed by Sanger sequencing. B 310 cDNA with c.28G>A (p.G10R) mutation was expressed in HeLa cells and total GTB transfer capacity in cell supernatant was measured. Flow cytometry was performed on these HeLa cells after transfection, and agglutination of Hela-B weak cells was also examined. The mRNA of the ABO gene was analyzed by direct sequencing and real-time reverse transcriptase-polymerase chain reaction. A minigene construct was prepared to evaluate the potential of splicing. While plasma total GTB transfer capacity was undetectable in this B 3 -like individual, the relative percentage of antigen-expressing cells and mean fluorescence index of the B weak red blood cells (RBCs) were 19 and 14% of normal B RBCs, respectively. There was no significant difference of total GTB transfer capacity in cell supernatant and B-antigen expression on cell surfaces between HeLa cells transfected with B 310 cDNA and B cDNA. The mRNA expression level of B 310 in peripheral whole blood was significantly reduced. The amount of splicing is significantly lower in c.28G>A construct compared to that in wild-type construct after transfection in K562 cells. ABO c.28G>A mutation may cause B 3 -like subgroup by affecting RNA splicing of the ABO gene. © 2017 AABB.

3D Micro-tomography on Aggregates from the 2014- 2015 Eruption of Hunga Tonga-Hunga Ha'apai Volcano

NASA Astrophysics Data System (ADS)

Colombier, M.; Scheu, B.; Cronin, S. J.; Tost, M.; Dobson, K. J.; Dingwell, D. B.

2016-12-01

In December 2014- January 2015, a surtseyan eruption at Hunga Tonga-Hunga Ha'apai volcano (Tonga) formed a new island. Three main eruptive phases were distinguished by observation and deposits: (i) mound and cone construction, involving collapse of 300-600 m-high wet tephra jets, grain flows, slope-remobilisation and energetic surges, with little or no convective plume (ii) The upper cone-building phase with lower jets (mainly <300 m) but greater ash production (weak, steam-rich plumes to 6 km) and weak surges, and (iii) final phase with weak surge, fall and ballistic deposits with more vesicular pyroclasts producing proximal capping deposits. Most sampled deposits contain ash, lapilli and bombs, and lapilli-sized aggregates are ubiquitous. We used high-resolution 3D X-ray microcomputed tomography (XCT) to quantify the grain size distribution (GSD) and porosity by sampling multiple stratigraphic units within the main eruptive sequences. We visualized and quantified the internal structure of the aggregates to understand the evolution of this surtseyan eruption. We present here an overview of the textural information: porosity, vesicle size distribution and morphology as well as the variability of the aggregation features. Aggregates from the fall deposits of the early wet phase are mostly loosely packed, poorly-structured ash clusters. Aggregates from the early surge sequence and the main cone building phase dominantly exhibit a central particle coated by ash cluster material. Vesicles in the particles from the early fall deposits tend to be smaller and more isolated than in the particles from the surge sequence and the main cone building phase. The GSD of aggregates obtained by XCT is highly valuable to correct the total GSD of volcaniclastic deposits. The strong variations in the aggregation features across the eruption suggest a range of different formation and deposition mechanisms related to varying degrees of magma-water-interaction, which changed the morphology and textural properties of the individual particles.

Transverse signal decay under the weak field approximation: Theory and validation.

PubMed

Berman, Avery J L; Pike, G Bruce

2018-07-01

To derive an expression for the transverse signal time course from systems in the motional narrowing regime, such as water diffusing in blood. This was validated in silico and experimentally with ex vivo blood samples. A closed-form solution (CFS) for transverse signal decay under any train of refocusing pulses was derived using the weak field approximation. The CFS was validated via simulations of water molecules diffusing in the presence of spherical perturbers, with a range of sizes and under various pulse sequences. The CFS was compared with more conventional fits assuming monoexponential decay, including chemical exchange, using ex vivo blood Carr-Purcell-Meiboom-Gill data. From simulations, the CFS was shown to be valid in the motional narrowing regime and partially into the intermediate dephasing regime, with increased accuracy with increasing Carr-Purcell-Meiboom-Gill refocusing rate. In theoretical calculations of the CFS, fitting for the transverse relaxation rate (R 2 ) gave excellent agreement with the weak field approximation expression for R 2 for Carr-Purcell-Meiboom-Gill sequences, but diverged for free induction decay. These same results were confirmed in the ex vivo analysis. Transverse signal decay in the motional narrowing regime can be accurately described analytically. This theory has applications in areas such as tissue iron imaging, relaxometry of blood, and contrast agent imaging. Magn Reson Med 80:341-350, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Systemic Lupus Erythematosus: Molecular Mimicry between Anti-dsDNA CDR3 Idiotype, Microbial and Self Peptides-As Antigens for Th Cells.

PubMed

Aas-Hanssen, Kristin; Thompson, Keith M; Bogen, Bjarne; Munthe, Ludvig A

2015-01-01

Systemic lupus erythematosus (SLE) is marked by a T helper (Th) cell-dependent B cell hyperresponsiveness, with frequent germinal center reactions, and gammaglobulinemia. A feature of SLE is the finding of IgG autoantibodies specific for dsDNA. The specificity of the Th cells that drive the expansion of anti-dsDNA B cells is unresolved. However, anti-microbial, anti-histone, and anti-idiotype Th cell responses have been hypothesized to play a role. It has been entirely unclear if these seemingly disparate Th cell responses and hypotheses could be related or unified. Here, we describe that H chain CDR3 idiotypes from IgG(+) B cells of lupus mice have sequence similarities with both microbial and self peptides. Matched sequences were more frequent within the mutated CDR3 repertoire and when sequences were derived from lupus mice with expanded anti-dsDNA B cells. Analyses of histone sequences showed that particular histone peptides were similar to VDJ junctions. Moreover, lupus mice had Th cell responses toward histone peptides similar to anti-dsDNA CDR3 sequences. The results suggest that Th cells in lupus may have multiple cross-reactive specificities linked to the IgVH CDR3 Id-peptide sequences as well as similar DNA-associated protein motifs.

Dali server update.

PubMed

Holm, Liisa; Laakso, Laura M

2016-07-08

The Dali server (http://ekhidna2.biocenter.helsinki.fi/dali) is a network service for comparing protein structures in 3D. In favourable cases, comparing 3D structures may reveal biologically interesting similarities that are not detectable by comparing sequences. The Dali server has been running in various places for over 20 years and is used routinely by crystallographers on newly solved structures. The latest update of the server provides enhanced analytics for the study of sequence and structure conservation. The server performs three types of structure comparisons: (i) Protein Data Bank (PDB) search compares one query structure against those in the PDB and returns a list of similar structures; (ii) pairwise comparison compares one query structure against a list of structures specified by the user; and (iii) all against all structure comparison returns a structural similarity matrix, a dendrogram and a multidimensional scaling projection of a set of structures specified by the user. Structural superimpositions are visualized using the Java-free WebGL viewer PV. The structural alignment view is enhanced by sequence similarity searches against Uniprot. The combined structure-sequence alignment information is compressed to a stack of aligned sequence logos. In the stack, each structure is structurally aligned to the query protein and represented by a sequence logo. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

A plasma membrane sucrose-binding protein that mediates sucrose uptake shares structural and sequence similarity with seed storage proteins but remains functionally distinct.

PubMed

Overvoorde, P J; Chao, W S; Grimes, H D

1997-06-20

Photoaffinity labeling of a soybean cotyledon membrane fraction identified a sucrose-binding protein (SBP). Subsequent studies have shown that the SBP is a unique plasma membrane protein that mediates the linear uptake of sucrose in the presence of up to 30 mM external sucrose when ectopically expressed in yeast. Analysis of the SBP-deduced amino acid sequence indicates it lacks sequence similarity with other known transport proteins. Data presented here, however, indicate that the SBP shares significant sequence and structural homology with the vicilin-like seed storage proteins that organize into homotrimers. These similarities include a repeated sequence that forms the basis of the reiterated domain structure characteristic of the vicilin-like protein family. In addition, analytical ultracentrifugation and nonreducing SDS-polyacrylamide gel electrophoresis demonstrate that the SBP appears to be organized into oligomeric complexes with a Mr indicative of the existence of SBP homotrimers and homodimers. The structural similarity shared by the SBP and vicilin-like proteins provides a novel framework to explore the mechanistic basis of SBP-mediated sucrose uptake. Expression of the maize Glb protein (a vicilin-like protein closely related to the SBP) in yeast demonstrates that a closely related vicilin-like protein is unable to mediate sucrose uptake. Thus, despite sequence and structural similarities shared by the SBP and the vicilin-like protein family, the SBP is functionally divergent from other members of this group.

Identification of Protective Brucella Antigens and their Expressions in Vaccinia Virus to Prevent Disease in Animals and Humans.

DTIC Science & Technology

1996-05-01

see figure appendix; B. abortus sequence in similarity arrangement with secD of E.coli, H. influenzae, M. leprae and S. coelicalor). Highly related...low similarity (E. coil and M. leprae approx 13.5% similarity). The Brucella and E. coil sequences were 25% similar (see figures appendix). In E...1987. Micobacterial growth inhibition by interferon-g activated bone marrow macrophages and differential susceptibility among strains of Mycobacterium

SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

PubMed

Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

2015-01-01

Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

Correlating low-similarity peptide sequences and allergenic epitopes.

PubMed

Kanduc, D

2008-01-01

Although a high number of allergenic peptide epitopes has been experimentally identified and defined, the molecular basis and the precise mechanisms underlying peptide allergenicity are unknown. This issue was analyzed exploring the relationship between peptide allergenicity and sequence similarity to the human proteome. The structured analysis of the data reported in literature put into evidence that the most part of IgE-binding epitopes are (or harbor) pentapeptide unit(s) with no/low similarity to the human proteome, this way suggesting that no or low sequence similarity to the host proteome might represent a minimum common denominator identifying allergenic peptides. The present literature analysis might be of relevance in devising and designing short amino acid modules to be used for blocking pathogenic IgE.

Biosequence Similarity Search on the Mercury System

PubMed Central

Krishnamurthy, Praveen; Buhler, Jeremy; Chamberlain, Roger; Franklin, Mark; Gyang, Kwame; Jacob, Arpith; Lancaster, Joseph

2007-01-01

Biosequence similarity search is an important application in modern molecular biology. Search algorithms aim to identify sets of sequences whose extensional similarity suggests a common evolutionary origin or function. The most widely used similarity search tool for biosequences is BLAST, a program designed to compare query sequences to a database. Here, we present the design of BLASTN, the version of BLAST that searches DNA sequences, on the Mercury system, an architecture that supports high-volume, high-throughput data movement off a data store and into reconfigurable hardware. An important component of application deployment on the Mercury system is the functional decomposition of the application onto both the reconfigurable hardware and the traditional processor. Both the Mercury BLASTN application design and its performance analysis are described. PMID:18846267

Domain similarity based orthology detection.

PubMed

Bitard-Feildel, Tristan; Kemena, Carsten; Greenwood, Jenny M; Bornberg-Bauer, Erich

2015-05-13

Orthologous protein detection software mostly uses pairwise comparisons of amino-acid sequences to assert whether two proteins are orthologous or not. Accordingly, when the number of sequences for comparison increases, the number of comparisons to compute grows in a quadratic order. A current challenge of bioinformatic research, especially when taking into account the increasing number of sequenced organisms available, is to make this ever-growing number of comparisons computationally feasible in a reasonable amount of time. We propose to speed up the detection of orthologous proteins by using strings of domains to characterize the proteins. We present two new protein similarity measures, a cosine and a maximal weight matching score based on domain content similarity, and new software, named porthoDom. The qualities of the cosine and the maximal weight matching similarity measures are compared against curated datasets. The measures show that domain content similarities are able to correctly group proteins into their families. Accordingly, the cosine similarity measure is used inside porthoDom, the wrapper developed for proteinortho. porthoDom makes use of domain content similarity measures to group proteins together before searching for orthologs. By using domains instead of amino acid sequences, the reduction of the search space decreases the computational complexity of an all-against-all sequence comparison. We demonstrate that representing and comparing proteins as strings of discrete domains, i.e. as a concatenation of their unique identifiers, allows a drastic simplification of search space. porthoDom has the advantage of speeding up orthology detection while maintaining a degree of accuracy similar to proteinortho. The implementation of porthoDom is released using python and C++ languages and is available under the GNU GPL licence 3 at http://www.bornberglab.org/pages/porthoda .

Identification and Small Molecule Inhibition of an Activating Transcription Factor 4 (ATF4)-dependent Pathway to Age-related Skeletal Muscle Weakness and Atrophy*

PubMed Central

Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Murry, Daryl J.; Fox, Daniel K.; Bongers, Kale S.; Lira, Vitor A.; Meyerholz, David K.; Talley, John J.; Adams, Christopher M.

2015-01-01

Aging reduces skeletal muscle mass and strength, but the underlying molecular mechanisms remain elusive. Here, we used mouse models to investigate molecular mechanisms of age-related skeletal muscle weakness and atrophy as well as new potential interventions for these conditions. We identified two small molecules that significantly reduce age-related deficits in skeletal muscle strength, quality, and mass: ursolic acid (a pentacyclic triterpenoid found in apples) and tomatidine (a steroidal alkaloid derived from green tomatoes). Because small molecule inhibitors can sometimes provide mechanistic insight into disease processes, we used ursolic acid and tomatidine to investigate the pathogenesis of age-related muscle weakness and atrophy. We found that ursolic acid and tomatidine generate hundreds of small positive and negative changes in mRNA levels in aged skeletal muscle, and the mRNA expression signatures of the two compounds are remarkably similar. Interestingly, a subset of the mRNAs repressed by ursolic acid and tomatidine in aged muscle are positively regulated by activating transcription factor 4 (ATF4). Based on this finding, we investigated ATF4 as a potential mediator of age-related muscle weakness and atrophy. We found that a targeted reduction in skeletal muscle ATF4 expression reduces age-related deficits in skeletal muscle strength, quality, and mass, similar to ursolic acid and tomatidine. These results elucidate ATF4 as a critical mediator of age-related muscle weakness and atrophy. In addition, these results identify ursolic acid and tomatidine as potential agents and/or lead compounds for reducing ATF4 activity, weakness, and atrophy in aged skeletal muscle. PMID:26338703

Identification and Small Molecule Inhibition of an Activating Transcription Factor 4 (ATF4)-dependent Pathway to Age-related Skeletal Muscle Weakness and Atrophy.

PubMed

Ebert, Scott M; Dyle, Michael C; Bullard, Steven A; Dierdorff, Jason M; Murry, Daryl J; Fox, Daniel K; Bongers, Kale S; Lira, Vitor A; Meyerholz, David K; Talley, John J; Adams, Christopher M

2015-10-16

Aging reduces skeletal muscle mass and strength, but the underlying molecular mechanisms remain elusive. Here, we used mouse models to investigate molecular mechanisms of age-related skeletal muscle weakness and atrophy as well as new potential interventions for these conditions. We identified two small molecules that significantly reduce age-related deficits in skeletal muscle strength, quality, and mass: ursolic acid (a pentacyclic triterpenoid found in apples) and tomatidine (a steroidal alkaloid derived from green tomatoes). Because small molecule inhibitors can sometimes provide mechanistic insight into disease processes, we used ursolic acid and tomatidine to investigate the pathogenesis of age-related muscle weakness and atrophy. We found that ursolic acid and tomatidine generate hundreds of small positive and negative changes in mRNA levels in aged skeletal muscle, and the mRNA expression signatures of the two compounds are remarkably similar. Interestingly, a subset of the mRNAs repressed by ursolic acid and tomatidine in aged muscle are positively regulated by activating transcription factor 4 (ATF4). Based on this finding, we investigated ATF4 as a potential mediator of age-related muscle weakness and atrophy. We found that a targeted reduction in skeletal muscle ATF4 expression reduces age-related deficits in skeletal muscle strength, quality, and mass, similar to ursolic acid and tomatidine. These results elucidate ATF4 as a critical mediator of age-related muscle weakness and atrophy. In addition, these results identify ursolic acid and tomatidine as potential agents and/or lead compounds for reducing ATF4 activity, weakness, and atrophy in aged skeletal muscle. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Bacterial and archaeal phylogenetic diversity of a cold sulfur-rich spring on the shoreline of Lake Erie, Michigan

USGS Publications Warehouse

Chaudhary, A.; Haack, S.K.; Duris, J.W.; Marsh, T.L.

2009-01-01

Studies of sulfidic springs have provided new insights into microbial metabolism, groundwater biogeochemistry, and geologic processes. We investigated Great Sulphur Spring on the western shore of Lake Erie and evaluated the phylogenetic affiliations of 189 bacterial and 77 archaeal 16S rRNA gene sequences from three habitats: the spring origin (11-m depth), bacterial-algal mats on the spring pond surface, and whitish filamentous materials from the spring drain. Water from the spring origin water was cold, pH 6.3, and anoxic (H2, 5.4 nM; CH4, 2.70 ??M) with concentrations of S2- (0.03 mM), SO42- (14.8 mM), Ca2+ (15.7 mM), and HCO3- (4.1 mM) similar to those in groundwater from the local aquifer. No archaeal and few bacterial sequences were >95% similar to sequences of cultivated organisms. Bacterial sequences were largely affiliated with sulfur-metabolizing or chemolithotrophic taxa in Beta-, Gamma-, Delta-, and Epsilonproteobacteria. Epsilonproteobacteria sequences similar to those obtained from other sulfidic environments and a new clade of Cyanobacteria sequences were particularly abundant (16% and 40%, respectively) in the spring origin clone library. Crenarchaeota sequences associated with archaeal-bacterial consortia in whitish filaments at a German sulfidic spring were detected only in a similar habitat at Great Sulphur Spring. This study expands the geographic distribution of many uncultured Archaea and Bacteria sequences to the Laurentian Great Lakes, indicates possible roles for epsilonproteobacteria in local aquifer chemistry and karst formation, documents new oscillatorioid Cyanobacteria lineages, and shows that uncultured, cold-adapted Crenarchaeota sequences may comprise a significant part of the microbial community of some sulfidic environments. Copyright ?? 2009, American Society for Microbiology. All Rights Reserved.

An intact SAM-dependent methyltransferase fold is encoded by the human endothelin-converting enzyme-2 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tempel, W.; Wu, H.; Dombrovsky, L.

2010-08-17

A recent survey of protein expression patterns in patients with Alzheimer's disease (AD) has identified ece2 (chromosome: 3; Locations: 3q27.1) as the most significantly downregulated gene within the tested group. ece2 encodes endothelin-converting enzyme ECE2, a metalloprotease with a role in neuropeptide processing. Deficiency in the highly homologous ECE1 has earlier been linked to increased levels of AD-related {beta}-amyloid peptide in mice, consistent with a role for ECE in the degradation of that peptide. Initially, ECE2 was presumed to resemble ECE1, in that it comprises a single transmembrane region of {approx}20 residues flanked by a small amino-terminal cytosolic segment andmore » a carboxy-terminal lumenar peptidase domain. The carboxy-terminal domain has significant sequence similarity to both neutral endopeptidase, for which an X-ray structure has been determined, and Kell blood group protein. After their initial discovery, multiple isoforms of ECE1 and ECE2 were discovered, generated by alternative splicing of multiple exons. The originally described ece2 transcript, RefSeq NM{_}174046, contains the amino-terminal cytosolic portion followed by the transmembrane region and peptidase domain (Fig. 1, isoform B). Another ece2 transcript, available from the Mammalian Gene Collection under MGC2408 (Fig. 1, isoform C), RefSeq accession NM{_}032331, is predicted to be translated into a 255 residue peptide with low but detectable sequence similarity to known S-adenosyl-L-methionine (SAM)-dependent methyltransferases (SAM-MTs), such as the hypothetical protein TT1324 from Thermus thermophilis, PDB code 2GS9, which shares 30% amino acid sequence identity with ECE2 over 138 residues of the sequence. Intriguingly, another 'elongated' ece2 transcript (Fig. 1, isoform A) (RefSeq NM{_}014693) contains an amino-terminal portion of the putative SAM-MT domain, the transmembrane domain, and the protease domain. This suggests the possibility for coexistence of the putative SAM-MT and protease domains in a single polypeptide and their transmembrane interplay. Although sequence conservation across the SAM-MT family is weak, the structural fold is highly conserved. The most conserved part of this fold is the SAM-binding subdomain, which is shared between MGC2408 and hypothetical protein TT1324. Typically, the SAM-binding subdomain is flanked by a variable Nterminal extension and, at the C-terminus, by a substrate- binding subdomain, which varies enormously in size but preserves a conserved topology with three antiparallel b-strands. The 'elongated' transcript of ece2 lacks this substrate-binding subdomain. To test the hypothesis that the 255 residue ece2 gene product MGC2408 represents a complete SAM-MT fold, we have determined a crystal structure of this protein in the presence of SAH.« less

PhyloTreePruner: A Phylogenetic Tree-Based Approach for Selection of Orthologous Sequences for Phylogenomics.

PubMed

Kocot, Kevin M; Citarella, Mathew R; Moroz, Leonid L; Halanych, Kenneth M

2013-01-01

Molecular phylogenetics relies on accurate identification of orthologous sequences among the taxa of interest. Most orthology inference programs available for use in phylogenomics rely on small sets of pre-defined orthologs from model organisms or phenetic approaches such as all-versus-all sequence comparisons followed by Markov graph-based clustering. Such approaches have high sensitivity but may erroneously include paralogous sequences. We developed PhyloTreePruner, a software utility that uses a phylogenetic approach to refine orthology inferences made using phenetic methods. PhyloTreePruner checks single-gene trees for evidence of paralogy and generates a new alignment for each group containing only sequences inferred to be orthologs. Importantly, PhyloTreePruner takes into account support values on the tree and avoids unnecessarily deleting sequences in cases where a weakly supported tree topology incorrectly indicates paralogy. A test of PhyloTreePruner on a dataset generated from 11 completely sequenced arthropod genomes identified 2,027 orthologous groups sampled for all taxa. Phylogenetic analysis of the concatenated supermatrix yielded a generally well-supported topology that was consistent with the current understanding of arthropod phylogeny. PhyloTreePruner is freely available from http://sourceforge.net/projects/phylotreepruner/.

Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

PubMed

Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

1995-04-01

Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

Exploring the sequence-structure protein landscape in the glycosyltransferase family

PubMed Central

Zhang, Ziding; Kochhar, Sunil; Grigorov, Martin

2003-01-01

To understand the molecular basis of glycosyltransferases’ (GTFs) catalytic mechanism, extensive structural information is required. Here, fold recognition methods were employed to assign 3D protein shapes (folds) to the currently known GTF sequences, available in public databases such as GenBank and Swissprot. First, GTF sequences were retrieved and classified into clusters, based on sequence similarity only. Intracluster sequence similarity was chosen sufficiently high to ensure that the same fold is found within a given cluster. Then, a representative sequence from each cluster was selected to compose a subset of GTF sequences. The members of this reduced set were processed by three different fold recognition methods: 3D-PSSM, FUGUE, and GeneFold. Finally, the results from different fold recognition methods were analyzed and compared to sequence-similarity search methods (i.e., BLAST and PSI-BLAST). It was established that the folds of about 70% of all currently known GTF sequences can be confidently assigned by fold recognition methods, a value which is higher than the fold identification rate based on sequence comparison alone (48% for BLAST and 64% for PSI-BLAST). The identified folds were submitted to 3D clustering, and we found that most of the GTF sequences adopt the typical GTF A or GTF B folds. Our results indicate a lack of evidence that new GTF folds (i.e., folds other than GTF A and B) exist. Based on cases where fold identification was not possible, we suggest several sequences as the most promising targets for a structural genomics initiative focused on the GTF protein family. PMID:14500887

Quantifying the Relationships among Drug Classes

PubMed Central

Hert, Jérôme; Keiser, Michael J.; Irwin, John J.; Oprea, Tudor I.; Shoichet, Brian K.

2009-01-01

The similarity of drug targets is typically measured using sequence or structural information. Here, we consider chemo-centric approaches that measure target similarity on the basis of their ligands, asking how chemoinformatics similarities differ from those derived bioinformatically, how stable the ligand networks are to changes in chemoinformatics metrics, and which network is the most reliable for prediction of pharmacology. We calculated the similarities between hundreds of drug targets and their ligands and mapped the relationship between them in a formal network. Bioinformatics networks were based on the BLAST similarity between sequences, while chemoinformatics networks were based on the ligand-set similarities calculated with either the Similarity Ensemble Approach (SEA) or a method derived from Bayesian statistics. By multiple criteria, bioinformatics and chemoinformatics networks differed substantially, and only occasionally did a high sequence similarity correspond to a high ligand-set similarity. In contrast, the chemoinformatics networks were stable to the method used to calculate the ligand-set similarities and to the chemical representation of the ligands. Also, the chemoinformatics networks were more natural and more organized, by network theory, than their bioinformatics counterparts: ligand-based networks were found to be small-world and broad-scale. PMID:18335977

A galaxy of folds.

PubMed

Alva, Vikram; Remmert, Michael; Biegert, Andreas; Lupas, Andrei N; Söding, Johannes

2010-01-01

Many protein classification systems capture homologous relationships by grouping domains into families and superfamilies on the basis of sequence similarity. Superfamilies with similar 3D structures are further grouped into folds. In the absence of discernable sequence similarity, these structural similarities were long thought to have originated independently, by convergent evolution. However, the growth of databases and advances in sequence comparison methods have led to the discovery of many distant evolutionary relationships that transcend the boundaries of superfamilies and folds. To investigate the contributions of convergent versus divergent evolution in the origin of protein folds, we clustered representative domains of known structure by their sequence similarity, treating them as point masses in a virtual 2D space which attract or repel each other depending on their pairwise sequence similarities. As expected, families in the same superfamily form tight clusters. But often, superfamilies of the same fold are linked with each other, suggesting that the entire fold evolved from an ancient prototype. Strikingly, some links connect superfamilies with different folds. They arise from modular peptide fragments of between 20 and 40 residues that co-occur in the connected folds in disparate structural contexts. These may be descendants of an ancestral pool of peptide modules that evolved as cofactors in the RNA world and from which the first folded proteins arose by amplification and recombination. Our galaxy of folds summarizes, in a single image, most known and many yet undescribed homologous relationships between protein superfamilies, providing new insights into the evolution of protein domains.

Using Video Game Telemetry Data to Research Motor Chunking, Action Latencies, and Complex Cognitive-Motor Skill Learning.

PubMed

Thompson, Joseph J; McColeman, C M; Stepanova, Ekaterina R; Blair, Mark R

2017-04-01

Many theories of complex cognitive-motor skill learning are built on the notion that basic cognitive processes group actions into easy-to-perform sequences. The present work examines predictions derived from laboratory-based studies of motor chunking and motor preparation using data collected from the real-time strategy video game StarCraft 2. We examined 996,163 action sequences in the telemetry data of 3,317 players across seven levels of skill. As predicted, the latency to the first action (thought to be the beginning of a chunked sequence) is delayed relative to the other actions in the group. Other predictions, inspired by the memory drum theory of Henry and Rogers, received only weak support. Copyright © 2017 Cognitive Science Society, Inc.

Gene flow connects coastal populations of a habitat specialist, the Clapper Rail Rallus crepitans

USGS Publications Warehouse

Coster, Stephanie S.; Welsh, Amy B.; Costanzo, Gary R.; Harding, Sergio R.; Anderson, James T.; Katzner, Todd

2018-01-01

Examining population genetic structure can reveal patterns of reproductive isolation or population mixing and inform conservation management. Some avian species are predicted to exhibit minimal genetic differentiation among populations as a result of the species high mobility, with habitat specialists tending to show greater fine‐scale genetic structure. To explore the relationship between habitat specialization and gene flow, we investigated the genetic structure of a saltmarsh specialist with high potential mobility across a wide geographic range of fragmented habitat. Little variation among mitochondrial sequences (620 bp from ND2) was observed among 149 individual Clapper Rails Rallus crepitans sampled along the Atlantic coast of North America, with the majority of individuals at all sampling sites sharing a single haplotype. Genotyping of nine microsatellite loci across 136 individuals revealed moderate genetic diversity, no evidence of bottlenecks, and a weak pattern of genetic differentiation that increased with geographic distance. Multivariate analyses, Bayesian clustering and an AMOVA all suggested a lack of genetic structuring across the North American Atlantic coast, with all individuals grouped into a single interbreeding population. Spatial autocorrelation analyses showed evidence of weak female philopatry and a lack of male philopatry. We conclude that high gene flow connecting populations of this habitat specialist may result from the interaction of ecological and behavioral factors that promote dispersal and limit natal philopatry and breeding‐site fidelity. As climate change threatens saltmarshes, the genetic diversity and population connectivity of Clapper Rails may promote resilience of their populations. This finding helps inform about potential fates of other similarly behaving saltmarsh specialists on the Atlantic coast.

Recombinant expression and antigenic properties of a 32-kilodalton extracellular alkaline protease, representing a possible virulence factor from Aspergillus fumigatus.

PubMed Central

Moser, M; Menz, G; Blaser, K; Crameri, R

1994-01-01

A 32-kDa nonglycosylated alkaline protease (EC 3.4.1.14) with elastolytic activity, secreted by the opportunistic pathogen Aspergillus fumigatus ATCC 42202, is suggested to be a virulence factor of this fungus. The enzyme is a serine protease of the subtilisin family, and its cDNA nucleotide sequence has recently been reported. We have cloned the cDNA encoding the mature protease into a high-level Escherichia coli expression plasmid and produced the recombinant protease as a fusion protein with a six-adjacent-histidine affinity tag at the carboxy terminus. Subsequently, the recombinant protease was purified to homogeneity, with affinity chromatography yielding 30 to 40 mg of recombinant protease per liter of E. coli culture. Refolded recombinant protease, in comparison with native protease, demonstrated weak enzymatic activity but similar immunochemical characteristics as analyzed by antigen-specific enzyme-linked immunosorbent assay (ELISA), competition ELISA, and immunoblotting assays. To assess the allergenic potential of the protease, sera from patients with allergic bronchopulmonary aspergillosis and sera from healthy control individuals were analyzed by ELISA and immunoblotting techniques. Sera from patients with allergic bronchopulmonary aspergillosis did not have protease-specific immunoglobulin E (IgE) antibodies and, remarkably, did not show significantly elevated protease-specific IgG antibody levels compared with those in sera from healthy control individuals. This suggests that the alkaline protease from A. fumigatus does not elicit IgE antibodies and has weak immunogenicity, a property which may explain fungus persistence in allergic individuals. Images PMID:8112866

Host associations and beta diversity of fungal endophyte communities in New Guinea rainforest trees.

PubMed

Vincent, J B; Weiblen, G D; May, G

2016-02-01

Processes shaping the distribution of foliar fungal endophyte species remain poorly understood. Despite increasing evidence that these cryptic fungal symbionts of plants mediate interactions with pathogens and herbivores, there remain basic questions regarding the extent to which dispersal limitation and host specificity might shape fungal endophyte community composition in rainforests. To assess the relative importance of spatial pattern and host specificity, we isolated fungi from a sample of mapped trees in lowland Papua New Guinea. Sequences of the internal transcribed spacer (ITS) region were obtained for 2079 fungal endophytes from three sites and clustered into molecular operational taxonomic units (MOTUs) at 95% similarity. Multivariate analyses suggest that host affinity plays a significant role in structuring endophyte community composition whereas there was no evidence of endophyte spatial pattern at the scale of tens to hundreds of metres. Differences in endophyte communities between sampled trees were weakly correlated with variation in foliar traits but not with tree species relatedness. The dominance of relatively few generalist endophytes and the presence of a large number of rare MOTUs was a consistent observation at three sites separated by hundreds of kilometres and regional turnover was low. Host specificity appears to play a relatively weak but more important role than dispersal limitation in shaping the distribution of fungal endophyte communities in New Guinea forests. Our results suggest that in the absence of strong ecological gradients and host turnover, beta diversity of endophyte communities could be low in large areas of contiguous forest. © 2015 John Wiley & Sons Ltd.

Unified Approximations: A New Approach for Monoprotic Weak Acid-Base Equilibria

ERIC Educational Resources Information Center

Pardue, Harry; Odeh, Ihab N.; Tesfai, Teweldemedhin M.

2004-01-01

The unified approximations reduce the conceptual complexity by combining solutions for a relatively large number of different situations into just two similar sets of processes. Processes used to solve problems by either the unified or classical approximations require similar degrees of understanding of the underlying chemical processes.

A Study of Attrition and the Use of Student Learning Communities in the Computer Science Introductory Programming Sequence

ERIC Educational Resources Information Center

Howles, Trudy

2009-01-01

Student attrition and low graduation rates are critical problems in computer science education. Disappointing graduation rates and declining student interest have caught the attention of business leaders, researchers and universities. With weak graduation rates and little interest in scientific computing, many are concerned about the USA's ability…

Weak values of spin and momentum in atomic systems.

NASA Astrophysics Data System (ADS)

Flack, Robert; Hiley, Basil; Barker, Peter; Monachello, Vincenzo; Morley, Joel

2017-04-01

Weak values have a long history and were first considered by Landau and London in connection with superfluids. Hirschfelder called them sub-observables and Dirac anticipatied them when discussing non-commutative geometry in quantum mechanics. The idea of a weak value has returned to prominence due to Aharonov, Albert and Vaidman showing how they can be measured. They are not eigenvalues of the system and can not be measured by a collapse of the wave function with the traditional Von Neumann (strong) measurement which is a single stage process. In contrast the weak measurement process has three stages; preselection, weak stage and finally a post selection. Although weak values have been observed using photons and neutrons, we are building two experiments to observe weak values of spin and momentum in atomic systems. For spin we are following the method outlined by Duck et al which is a variant on the original Stern-Gerlach experiment using a metastable, 23S1 , form of helium. For momentum we are using a method similar to that used by Kocsis with excited argon atoms in the 3P2 state, passing through a 2-slit interferometer. The design, simulation and re John Fetzer Memorial Trust.

Sequence composition and environment effects on residue fluctuations in protein structures

NASA Astrophysics Data System (ADS)

Ruvinsky, Anatoly M.; Vakser, Ilya A.

2010-10-01

Structure fluctuations in proteins affect a broad range of cell phenomena, including stability of proteins and their fragments, allosteric transitions, and energy transfer. This study presents a statistical-thermodynamic analysis of relationship between the sequence composition and the distribution of residue fluctuations in protein-protein complexes. A one-node-per-residue elastic network model accounting for the nonhomogeneous protein mass distribution and the interatomic interactions through the renormalized inter-residue potential is developed. Two factors, a protein mass distribution and a residue environment, were found to determine the scale of residue fluctuations. Surface residues undergo larger fluctuations than core residues in agreement with experimental observations. Ranking residues over the normalized scale of fluctuations yields a distinct classification of amino acids into three groups: (i) highly fluctuating-Gly, Ala, Ser, Pro, and Asp, (ii) moderately fluctuating-Thr, Asn, Gln, Lys, Glu, Arg, Val, and Cys, and (iii) weakly fluctuating-Ile, Leu, Met, Phe, Tyr, Trp, and His. The structural instability in proteins possibly relates to the high content of the highly fluctuating residues and a deficiency of the weakly fluctuating residues in irregular secondary structure elements (loops), chameleon sequences, and disordered proteins. Strong correlation between residue fluctuations and the sequence composition of protein loops supports this hypothesis. Comparing fluctuations of binding site residues (interface residues) with other surface residues shows that, on average, the interface is more rigid than the rest of the protein surface and Gly, Ala, Ser, Cys, Leu, and Trp have a propensity to form more stable docking patches on the interface. The findings have broad implications for understanding mechanisms of protein association and stability of protein structures.

Identification of Mycobacterium spp. of veterinary importance using rpoB gene sequencing

PubMed Central

2011-01-01

Background Studies conducted on Mycobacterium spp. isolated from human patients indicate that sequencing of a 711 bp portion of the rpoB gene can be useful in assigning a species identity, particularly for members of the Mycobacterium avium complex (MAC). Given that MAC are important pathogens in livestock, companion animals, and zoo/exotic animals, we were interested in evaluating the use of rpoB sequencing for identification of Mycobacterium isolates of veterinary origin. Results A total of 386 isolates, collected over 2008 - June 2011 from 378 animals (amphibians, reptiles, birds, and mammals) underwent PCR and sequencing of a ~ 711 bp portion of the rpoB gene; 310 isolates (80%) were identified to the species level based on similarity at ≥ 98% with a reference sequence. The remaining 76 isolates (20%) displayed < 98% similarity with reference sequences and were assigned to a clade based on their location in a neighbor-joining tree containing reference sequences. For a subset of 236 isolates that received both 16S rRNA and rpoB sequencing, 167 (70%) displayed a similar species/clade assignation for both sequencing methods. For the remaining 69 isolates, species/clade identities were different with each sequencing method. Mycobacterium avium subsp. hominissuis was the species most frequently isolated from specimens from pigs, cervids, companion animals, cattle, and exotic/zoo animals. Conclusions rpoB sequencing proved useful in identifying Mycobacterium isolates of veterinary origin to clade, species, or subspecies levels, particularly for assemblages (such as the MAC) where 16S rRNA sequencing alone is not adequate to demarcate these taxa. rpoB sequencing can represent a cost-effective identification tool suitable for routine use in the veterinary diagnostic laboratory. PMID:22118247

On the necessity of dissecting sequence similarity scores into segment-specific contributions for inferring protein homology, function prediction and annotation

PubMed Central

2014-01-01

Background Protein sequence similarities to any types of non-globular segments (coiled coils, low complexity regions, transmembrane regions, long loops, etc. where either positional sequence conservation is the result of a very simple, physically induced pattern or rather integral sequence properties are critical) are pertinent sources for mistaken homologies. Regretfully, these considerations regularly escape attention in large-scale annotation studies since, often, there is no substitute to manual handling of these cases. Quantitative criteria are required to suppress events of function annotation transfer as a result of false homology assignments. Results The sequence homology concept is based on the similarity comparison between the structural elements, the basic building blocks for conferring the overall fold of a protein. We propose to dissect the total similarity score into fold-critical and other, remaining contributions and suggest that, for a valid homology statement, the fold-relevant score contribution should at least be significant on its own. As part of the article, we provide the DissectHMMER software program for dissecting HMMER2/3 scores into segment-specific contributions. We show that DissectHMMER reproduces HMMER2/3 scores with sufficient accuracy and that it is useful in automated decisions about homology for instructive sequence examples. To generalize the dissection concept for cases without 3D structural information, we find that a dissection based on alignment quality is an appropriate surrogate. The approach was applied to a large-scale study of SMART and PFAM domains in the space of seed sequences and in the space of UniProt/SwissProt. Conclusions Sequence similarity core dissection with regard to fold-critical and other contributions systematically suppresses false hits and, additionally, recovers previously obscured homology relationships such as the one between aquaporins and formate/nitrite transporters that, so far, was only supported by structure comparison. PMID:24890864

Characterization of minimal sequences associated with self-similar interval exchange maps

NASA Astrophysics Data System (ADS)

Cobo, Milton; Gutiérrez-Romo, Rodolfo; Maass, Alejandro

2018-04-01

The construction of affine interval exchange maps (IEMs) with wandering intervals that are semi-conjugate to a given self-similar IEM is strongly related to the existence of the so-called minimal sequences associated with local potentials, which are certain elements of the substitution subshift arising from the given IEM. In this article, under the condition called unique representation property, we characterize such minimal sequences for potentials coming from non-real eigenvalues of the substitution matrix. We also give conditions on the slopes of the affine extensions of a self-similar IEM that determine whether it exhibits a wandering interval or not.

Biogeographic patterns of soil diazotrophic communities across six forests in the North America.

PubMed

Tu, Qichao; Deng, Ye; Yan, Qingyun; Shen, Lina; Lin, Lu; He, Zhili; Wu, Liyou; Van Nostrand, Joy D; Buzzard, Vanessa; Michaletz, Sean T; Enquist, Brian J; Weiser, Michael D; Kaspari, Michael; Waide, Robert B; Brown, James H; Zhou, Jizhong

2016-06-01

Soil diazotrophs play important roles in ecosystem functioning by converting atmospheric N2 into biologically available ammonium. However, the diversity and distribution of soil diazotrophic communities in different forests and whether they follow biogeographic patterns similar to macroorganisms still remain unclear. By sequencing nifH gene amplicons, we surveyed the diversity, structure and biogeographic patterns of soil diazotrophic communities across six North American forests (126 nested samples). Our results showed that each forest harboured markedly different soil diazotrophic communities and that these communities followed traditional biogeographic patterns similar to plant and animal communities, including the taxa-area relationship (TAR) and latitudinal diversity gradient. Significantly higher community diversity and lower microbial spatial turnover rates (i.e. z-values) were found for rainforests (~0.06) than temperate forests (~0.1). The gradient pattern of TARs and community diversity was strongly correlated (r(2)  > 0.5) with latitude, annual mean temperature, plant species richness and precipitation, and weakly correlated (r(2)  < 0.25) with pH and soil moisture. This study suggests that even microbial subcommunities (e.g. soil diazotrophs) follow general biogeographic patterns (e.g. TAR, latitudinal diversity gradient), and indicates that the metabolic theory of ecology and habitat heterogeneity may be the major underlying ecological mechanisms shaping the biogeographic patterns of soil diazotrophic communities. © 2016 John Wiley & Sons Ltd.

Genetic relationships among some subspecies of the Peregrine Falcon (Falco peregrinus L.), inferred from mitochondrial DNA control-region sequences

USGS Publications Warehouse

White, Clayton M.; Sonsthagen, Sarah A.; Sage, George K.; Anderson, Clifford; Talbot, Sandra L.

2013-01-01

The ability to successfully colonize and persist in diverse environments likely requires broad morphological and behavioral plasticity and adaptability, and this may partly explain why the Peregrine Falcon (Falco peregrinus) exhibits a large range of morphological characteristics across their global distribution. Regional and local differences within Peregrine Falcons were sufficiently variable that ∼75 subspecies have been described; many were subsumed, and currently 19 are generally recognized. We used sequence information from the control region of the mitochondrial genome to test for concordance between genetic structure and representatives of 12 current subspecies and from two areas where subspecies distributions overlap. Haplotypes were broadly shared among subspecies, and all geographic locales shared a widely distributed common haplotype (FalconCR2). Haplotypes were distributed in a star-like phylogeny, consistent with rapid expansion of a recently derived species, with observed genetic patterns congruent with incomplete lineage sorting and/or differential rates of evolution on morphology and neutral genetic characters. Hierarchical analyses of molecular variance did not uncover genetic partitioning at the continental level, despite strong population-level structure (FST = 0.228). Similar analyses found weak partitioning, albeit significant, among subspecies (FCT = 0.138). All reconstructions placed the hierofalcons' (Gyrfalcon [F. rusticolus] and Saker Falcon [F. cherrug]) haplotypes in a well-supported clade either basal or unresolved with respect to the Peregrine Falcon. In addition, haplotypes representing Taita Falcon (F. fasciinucha) were placed within the Peregrine Falcon clade.

Constraining the strength of megathrusts from fault geometries and application to the Alpine collision zone

NASA Astrophysics Data System (ADS)

Dielforder, Armin

2017-09-01

Using Coulomb wedge solutions, we show that the effective strength of megathrusts (μb‧) can be determined from the geometry of out-of-sequence thrusts cutting through an accretionary or orogenic wedge. The method is first tested on central Chilean margin for which it yields a frictional strength of μb‧ = 0.053 (+ 0.043 / - 0.024). The inferred value agrees well with previous strength estimates and with the tectonic response of the central Chilean wedge to 2010 Mw 8.8 Maule earthquake. We then use the approach to constrain the strength of the collision megathrust of the central European Alps ∼30-20 million years ago. We find that the collision megathrust had a strength of μb‧ = 0.065 (+ 0.035 / - 0.026), which is similarly low than the strength of subduction megathrusts. The result is integrated into a static force balance model to examine potential implications of a weak megathrust for the Alpine orogeny. The model results suggest that the Alpine megathrust supported a mean maximum elevation of ∼2,000 m and that growth of the wedge up to this elevation supported a switch from contractional to extensional tectonics in the interior of the Alps around 20 Ma. Finally, using the example of the Himalayas, we show how the strength of megathrusts may be also derived from the geometry of crustal ramps, which provides a valuable alternative if details on out-of-sequence thrusts are missing.

Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene.

PubMed

Mollereau, C; Simons, M J; Soularue, P; Liners, F; Vassart, G; Meunier, J C; Parmentier, M

1996-08-06

Nociceptin (orphanin FQ), the newly discovered natural agonist of opioid receptor-like (ORL1) receptor, is a neuropeptide that is endowed with pronociceptive activity in vivo. Nociceptin is derived from a larger precursor, prepronociceptin (PPNOC), whose human, mouse, and rat genes we have now isolated. The PPNOC gene is highly conserved in the three species and displays organizational features that are strikingly similar to those of the genes of preproenkephalin, preprodynorphin, and preproopiomelanocortin, the precursors to endogenous opioid peptides, suggesting the four genes belong to the same family-i.e., have a common evolutionary origin. The PPNOC gene encodes a single copy of nociceptin as well as of other peptides whose sequence is strictly conserved across murine and human species; hence it is likely to be neurophysiologically significant. Northern blot analysis shows that the PPNOC gene is predominantly transcribed in the central nervous system (brain and spinal cord) and, albeit weakly, in the ovary, the sole peripheral organ expressing the gene. By using a radiation hybrid cell line panel, the PPNOC gene was mapped to the short arm of human chromosome 8 (8p21), between sequence-tagged site markers WI-5833 and WI-1172, in close proximity of the locus encoding the neurofilament light chain NEFL. Analysis of yeast artificial chromosome clones belonging to the WC8.4 contig covering the 8p21 region did not allow to detect the presence of the gene on these yeast artificial chromosomes, suggesting a gap in the coverage within this contig.

Three-dimensional reconstructions of the bacteriophage CUS-3 virion reveal a conserved coat protein I-domain but a distinct tailspike receptor-binding domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parent, Kristin N., E-mail: kparent@msu.edu; Tang, Jinghua; Cardone, Giovanni

CUS-3 is a short-tailed, dsDNA bacteriophage that infects serotype K1 Escherichia coli. We report icosahedrally averaged and asymmetric, three-dimensional, cryo-electron microscopic reconstructions of the CUS-3 virion. Its coat protein structure adopts the “HK97-fold” shared by other tailed phages and is quite similar to that in phages P22 and Sf6 despite only weak amino acid sequence similarity. In addition, these coat proteins share a unique extra external domain (“I-domain”), suggesting that the group of P22-like phages has evolved over a very long time period without acquiring a new coat protein gene from another phage group. On the other hand, the morphologymore » of the CUS-3 tailspike differs significantly from that of P22 or Sf6, but is similar to the tailspike of phage K1F, a member of the extremely distantly related T7 group of phages. We conclude that CUS-3 obtained its tailspike gene from a distantly related phage quite recently. - Highlights: • Asymmetric and symmetric three-dimensional reconstructions of phage CUS-3 are presented. • CUS-3 major capsid protein has a conserved I-domain, which is found in all three categories of “P22-like phage”. • CUS-3 has very different tailspike receptor binding domain from those of P22 and Sf6. • The CUS-3 tailspike likely was acquired by horizontal gene transfer.« less

Weak and strong coupling equilibration in nonabelian gauge theories

NASA Astrophysics Data System (ADS)

Keegan, Liam; Kurkela, Aleksi; Romatschke, Paul; van der Schee, Wilke; Zhu, Yan

2016-04-01

We present a direct comparison studying equilibration through kinetic theory at weak coupling and through holography at strong coupling in the same set-up. The set-up starts with a homogeneous thermal state, which then smoothly transitions through an out-of-equilibrium phase to an expanding system undergoing boost-invariant flow. This first apples-to-apples comparison of equilibration provides a benchmark for similar equilibration processes in heavy-ion collisions, where the equilibration mechanism is still under debate. We find that results at weak and strong coupling can be smoothly connected by simple, empirical power-laws for the viscosity, equilibration time and entropy production of the system.

Genome Sequences of Akhmeta Virus, an Early Divergent Old World Orthopoxvirus.

PubMed

Gao, Jinxin; Gigante, Crystal; Khmaladze, Ekaterine; Liu, Pengbo; Tang, Shiyuyun; Wilkins, Kimberly; Zhao, Kun; Davidson, Whitni; Nakazawa, Yoshinori; Maghlakelidze, Giorgi; Geleishvili, Marika; Kokhreidze, Maka; Carroll, Darin S; Emerson, Ginny; Li, Yu

2018-05-12

Annotated whole genome sequences of three isolates of the Akhmeta virus (AKMV), a novel species of orthopoxvirus (OPXV), isolated from the Akhmeta and Vani regions of the country Georgia, are presented and discussed. The AKMV genome is similar in genomic content and structure to that of the cowpox virus (CPXV), but a lower sequence identity was found between AKMV and Old World OPXVs than between other known species of Old World OPXVs. Phylogenetic analysis showed that AKMV diverged prior to other Old World OPXV. AKMV isolates formed a monophyletic clade in the OPXV phylogeny, yet the sequence variability between AKMV isolates was higher than between the monkeypox virus strains in the Congo basin and West Africa. An AKMV isolate from Vani contained approximately six kb sequence in the left terminal region that shared a higher similarity with CPXV than with other AKMV isolates, whereas the rest of the genome was most similar to AKMV, suggesting recombination between AKMV and CPXV in a region containing several host range and virulence genes.

Phonotactics, Neighborhood Activation, and Lexical Access for Spoken Words

PubMed Central

Vitevitch, Michael S.; Luce, Paul A.; Pisoni, David B.; Auer, Edward T.

2012-01-01

Probabilistic phonotactics refers to the relative frequencies of segments and sequences of segments in spoken words. Neighborhood density refers to the number of words that are phonologically similar to a given word. Despite a positive correlation between phonotactic probability and neighborhood density, nonsense words with high probability segments and sequences are responded to more quickly than nonsense words with low probability segments and sequences, whereas real words occurring in dense similarity neighborhoods are responded to more slowly than real words occurring in sparse similarity neighborhoods. This contradiction may be resolved by hypothesizing that effects of probabilistic phonotactics have a sublexical focus and that effects of similarity neighborhood density have a lexical focus. The implications of this hypothesis for models of spoken word recognition are discussed. PMID:10433774

Don't Panic! Closed String Tachyons in ALE Spacetimes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silverstein, Eva M

2001-08-20

We consider closed string tachyons localized at the fixed points of noncompact nonsupersymmetric orbifolds. We argue that tachyon condensation drives these orbifolds to flat space or supersymmetric ALE spaces. The decay proceeds via an expanding shell of dilaton gradients and curvature which interpolates between two regions of distinct angular geometry. The string coupling remains weak throughout. For small tachyon VEVs, evidence comes from quiver theories on D-branes probes, in which deformations by twisted couplings smoothly connect non-supersymmetric orbifolds to supersymmetric orbifolds of reduced order. For large tachyon VEVs, evidence comes from worldsheet RG flow and spacetime gravity. For C{sup 2}/Z{submore » n}, we exhibit infinite sequences of transitions producing SUSY ALE spaces via twisted closed string condensation from non-supersymmetric ALE spaces. In a T-dual description this provides a mechanism for creating NS5-branes via closed string tachyon condensation similar to the creation of D-branes via open string tachyon condensation. We also apply our results to recent duality conjectures involving fluxbranes and the type 0 string.« less

Comparative Analysis of Two Flavonol Synthases from Different-Colored Onions Provides Insight into Flavonoid Biosynthesis.

PubMed

Park, Sangkyu; Kim, Da-Hye; Lee, Jong-Yeol; Ha, Sun-Hwa; Lim, Sun-Hyung

2017-07-05

We isolated cDNAs encoding flavonol synthase (FLS) from the red onion "H6" (AcFLS-H6) and the yellow onion "Hwangryongball" (AcFLS-HRB). We found three amino acid variations between the two sequences. Kinetic analysis with recombinant proteins revealed that AcFLS-HRB exhibited approximately 2-fold higher catalytic efficiencies than AcFLS-H6 for dihydroflavonol substrates and that both proteins preferred dihydroquercetin to dihydrokaempferol. The expression patterns of flavonoid biosynthesis genes corresponded to the accumulation patterns of flavonoid aglycones in both onions. Whereas the other flavonoid biosynthesis genes were weakly expressed in the HRB sheath compared to that of H6, the expression of FLS was similar in both onions. This relatively enhanced FLS expression, along with the higher activity of AcFLS-HRB, could increase the quercetin production in the HRB sheath. The quercetin content was approximately 12-fold higher than the cyanidin content in the H6 sheath, suggesting that FLS has priority in the competition between FLS and dihydroflavonol 4-reductase (DFR) for their substrate dihydroquercetin.

Relative strengths of the calf muscles based on MRI volume measurements.

PubMed

Jeng, Clifford L; Thawait, Gaurav K; Kwon, John Y; Machado, Antonio; Boyle, James W; Campbell, John; Carrino, John A

2012-05-01

In 1985, Silver et al. published a cadaver study which determined the relative order of strength of the muscles in the calf. Muscle strength, which is proportional to volume, was obtained by dissecting out the individual muscles, weighing them, and then multiplying by the specific gravity. No similar studies have been performed using {\\it in vivo} measurements of muscle volume. Ten normal subjects underwent 3-Tesla MRI's of both lower extremities using non-fat-saturated T2 SPACE sequences. The volume for each muscle was determined by tracing the muscle contour on sequential axial images and then interpolating the volume using imaging software. The results from this study differ from Silver's original article. The lateral head of the gastrocnemius was found to be stronger than the tibialis anterior muscle. The FHL and EDL muscles were both stronger than the peroneus longus. There was no significant difference in strength between the peroneus longus and brevis muscles. This revised order of muscle strengths in the calf based on in vivo MRI findings may assist surgeons in determining the optimal tendons to transfer in order to address muscle weakness and deformity.

Interplay of confinement and surface energetics in the interaction of water with a metal–organic framework

DOE PAGES

Wu, Di; Guo, Xiaofeng; Sun, Hui; ...

2016-03-24

Here, the enthalpy of water adsorption (Δh) on the metal–organic framework (MOF) HKUST-1 has been determined directly by calorimetry. The most exothermic value of Δh [–119.4 ± 0.5 kJ/(mol of water)] occurs at zero coverage and perhaps represents water confinement in the smallest (4-Å) cages. An intermediate Δh value of –50.2 ± 1.8 kJ/(mol of water) at higher loading probably corresponds to the binding of water on the available Cu nodes and subsequent filling of the largest (11-Å) pores. The weakest interactions take place in the medium (10-Å) cages, showing weak inclusion of water clusters in a limited hydrophobic environment.more » By combining ethanol adsorption calorimetry, mathematical analysis of the slope of the water adsorption isotherm, and the differential enthalpy of water adsorption curve, we are able not only to develop an approach to separate energetically multistage guest–host interactions in complex MOF architectures but also to distinguish a sequence of interactions with very similar energetic effects.« less

Protein-protein interaction network-based detection of functionally similar proteins within species.

PubMed

Song, Baoxing; Wang, Fen; Guo, Yang; Sang, Qing; Liu, Min; Li, Dengyun; Fang, Wei; Zhang, Deli

2012-07-01

Although functionally similar proteins across species have been widely studied, functionally similar proteins within species showing low sequence similarity have not been examined in detail. Identification of these proteins is of significant importance for understanding biological functions, evolution of protein families, progression of co-evolution, and convergent evolution and others which cannot be obtained by detection of functionally similar proteins across species. Here, we explored a method of detecting functionally similar proteins within species based on graph theory. After denoting protein-protein interaction networks using graphs, we split the graphs into subgraphs using the 1-hop method. Proteins with functional similarities in a species were detected using a method of modified shortest path to compare these subgraphs and to find the eligible optimal results. Using seven protein-protein interaction networks and this method, some functionally similar proteins with low sequence similarity that cannot detected by sequence alignment were identified. By analyzing the results, we found that, sometimes, it is difficult to separate homologous from convergent evolution. Evaluation of the performance of our method by gene ontology term overlap showed that the precision of our method was excellent. Copyright © 2012 Wiley Periodicals, Inc.

Fibonacci chain polynomials: Identities from self-similarity

NASA Technical Reports Server (NTRS)

Lang, Wolfdieter

1995-01-01

Fibonacci chains are special diatomic, harmonic chains with uniform nearest neighbor interaction and two kinds of atoms (mass-ratio r) arranged according to the self-similar binary Fibonacci sequence ABAABABA..., which is obtained by repeated substitution of A yields AB and B yields A. The implications of the self-similarity of this sequence for the associated orthogonal polynomial systems which govern these Fibonacci chains with fixed mass-ratio r are studied.

Characterization of kinetoplast DNA from Phytomonas serpens.

PubMed

Sá-Carvalho, D; Perez-Morga, D; Traub-Cseko, Y M

1993-01-01

The restriction enzyme digestion of kinetoplast DNA from four Phytomonas serpens isolates shows an overall similar band pattern. One minicircle from isolate 30T was cloned and sequenced, showing low levels of homology but the same general features and organization as described for minicircles of other trypanosomatids. Extensive regions of the minicircle are composed by G and T on the H strand. These regions are very repetitive and similar to regions in a minicircle of Crithidia oncopelti and to telomeric sequences of Saccharomyces cerevisiae. Conserved Sequence Block 3, present in all trypanosomatids, is one nucleotide different from the consensus in P. serpens and provides a basis to differentiate P. serpens from other trypanosomatids. Electron microscopy of kinetoplast DNA evidenced a network with organization similar to other trypanosomatids and the measurement of minicircles confirmed the size of about 1.45 kb of the sequenced minicircle.

X-ray versus infrared selection of distant galaxy clusters: a case study using the XMM-LSS and SpARCS cluster samples

NASA Astrophysics Data System (ADS)

Willis, J. P.; Ramos-Ceja, M. E.; Muzzin, A.; Pacaud, F.; Yee, H. K. C.; Wilson, G.

2018-07-01

We present a comparison of two samples of z> 0.8 galaxy clusters selected using different wavelength-dependent techniques and examine the physical differences between them. We consider 18 clusters from the X-ray-selected XMM Large Scale Structure (LSS) distant cluster survey and 92 clusters from the optical-mid-infrared (MIR)-selected Spitzer Adaptation of the Red Sequence Cluster survey (SpARCS) cluster survey. Both samples are selected from the same approximately 9 sq deg sky area and we examine them using common XMM-Newton, Spitizer Wide-Area Infrared Extra-galactic (SWIRE) survey, and Canada-France-Hawaii Telescope Legacy Survey data. Clusters from each sample are compared employing aperture measures of X-ray and MIR emission. We divide the SpARCS distant cluster sample into three sub-samples: (i) X-ray bright, (ii) X-ray faint, MIR bright, and (iii) X-ray faint, MIR faint clusters. We determine that X-ray- and MIR-selected clusters display very similar surface brightness distributions of galaxy MIR light. In addition, the average location and amplitude of the galaxy red sequence as measured from stacked colour histograms is very similar in the X-ray- and MIR-selected samples. The sub-sample of X-ray faint, MIR bright clusters displays a distribution of brightest cluster galaxy-barycentre position offsets which extends to higher values than all other samples. This observation indicates that such clusters may exist in a more disturbed state compared to the majority of the distant cluster population sampled by XMM-LSS and SpARCS. This conclusion is supported by stacked X-ray images for the X-ray faint, MIR bright cluster sub-sample that display weak, centrally concentrated X-ray emission, consistent with a population of growing clusters accreting from an extended envelope of material.

Evolution of novel wood decay mechanisms in Agaricales revealed by the genome sequences of Fistulina hepatica and Cylindrobasidium torrendii

DOE PAGES

Floudas, Dimitrios; Held, Benjamin W.; Riley, Robert; ...

2015-02-12

Wood decay mechanisms in Agaricomycotina have been traditionally separated in two categories termed white and brown rot. Recently the accuracy of such a dichotomy has been questioned. In this paper, we present the genome sequences of the white-rot fungus Cylindrobasidium torrendii and the brown-rot fungus Fistulina hepatica both members of Agaricales, combining comparative genomics and wood decay experiments. C. torrendii is closely related to the white-rot root pathogen Armillaria mellea, while F. hepatica is related to Schizophyllum commune, which has been reported to cause white rot. Our results suggest that C. torrendii and S. commune are intermediate between white-rot andmore » brown-rot fungi, but at the same time they show characteristics of decay that resembles soft rot. Both species cause weak wood decay and degrade all wood components but leave the middle lamella intact. Their gene content related to lignin degradation is reduced, similar to brown-rot fungi, but both have maintained a rich array of genes related to carbohydrate degradation, similar to white-rot fungi. These characteristics appear to have evolved from white-rot ancestors with stronger ligninolytic ability. F. hepatica shows characteristics of brown rot both in terms of wood decay genes found in its genome and the decay that it causes. However, genes related to cellulose degradation are still present, which is a plesiomorphic characteristic shared with its white-rot ancestors. Four wood degradation-related genes, homologs of which are frequently lost in brown-rot fungi, show signs of pseudogenization in the genome of F. hepatica. These results suggest that transition toward a brown-rot lifestyle could be an ongoing process in F. hepatica. Finally, our results reinforce the idea that wood decay mechanisms are more diverse than initially thought and that the dichotomous separation of wood decay mechanisms in Agaricomycotina into white rot and brown rot should be revisited.« less

Molecular Phylogeny of the Small Ermine Moth Genus Yponomeuta (Lepidoptera, Yponomeutidae) in the Palaearctic

PubMed Central

Turner, Hubert; Lieshout, Niek; Van Ginkel, Wil E.; Menken, Steph B. J.

2010-01-01

Background The small ermine moth genus Yponomeuta (Lepidoptera, Yponomeutidae) contains 76 species that are specialist feeders on hosts from Celastraceae, Rosaceae, Salicaceae, and several other plant families. The genus is a model for studies in the evolution of phytophagous insects and their host-plant associations. Here, we reconstruct the phylogeny to provide a solid framework for these studies, and to obtain insight into the history of host-plant use and the biogeography of the genus. Methodology/Principal Findings DNA sequences from an internal transcribed spacer region (ITS-1) and from the 16S rDNA (16S) and cytochrome oxidase (COII) mitochondrial genes were collected from 20–23 (depending on gene) species and two outgroup taxa to reconstruct the phylogeny of the Palaearctic members of this genus. Sequences were analysed using three different phylogenetic methods (parsimony, likelihood, and Bayesian inference). Conclusions/Significance Roughly the same patterns are retrieved irrespective of the method used, and they are similar among the three genes. Monophyly is well supported for a clade consisting of the Japanese (but not the Dutch) population of Yponomeuta sedellus and Y. yanagawanus, a Y. kanaiellus–polystictus clade, and a Rosaceae-feeding, western Palaearctic clade (Y. cagnagellus–irrorellus clade). Within these clades, relationships are less well supported, and the patterns between the different gene trees are not so similar. The position of the remaining taxa is also variable among the gene trees and rather weakly supported. The phylogenetic information was used to elucidate patterns of biogeography and resource use. In the Palaearctic, the genus most likely originated in the Far East, feeding on Celastraceae, dispersing to the West concomitant with a shift to Rosaceae and further to Salicaceae. The association of Y. cagnagellus with Euonymus europaeus (Celastraceae), however, is a reversal. The only oligophagous species, Y. padellus, belongs to the derived western Palaearctic clade, evidence that specialisation is reversible. PMID:20360968

Supermassive black holes and central star clusters: Connection with the host galaxy kinematics and color

NASA Astrophysics Data System (ADS)

Zasov, A. V.; Cherepashchuk, A. M.

2013-11-01

The relationship between the masses of the central, supermassive black holes ( M bh) and of the nuclear star clusters ( M nc) of disk galaxies with various parameters galaxies are considered: the rotational velocity at R = 2 kpc V (2), the maximum rotational velocity V max, the indicative dynamical mass M 25, the integrated mass of the stellar population M *, and the integrated color index B-V. The rotational velocities andmasses of the central objects were taken from the literature. Themass M nc correlatesmore closely with the kinematic parameters and the disk mass than M bh, including with the velocity V max, which is closely related to the virial mass of the dark halo. On average, lenticular galaxies are characterized by higher masses M bh compared to other types of galaxies with similar characteristics. The dependence of the blackhole mass on the color index is bimodal: galaxies of the red group (red-sequence) with B-V >0.6-0.7 which are mostly early-type galaxies with weak star formation, differ appreciably from blue galaxies, which have higher values of M nc and M bh. At the dependences we consider between the masses of the central objects and the parameters of the host galaxies (except for the dependence of M bh on the central velocity dispersion), the red-group galaxies have systematically higher M bh values, even when the host-galaxy parameters are similar. In contrast, in the case of nuclear star clusters, the blue and red galaxies form unified sequences. The results agree with scenarios in which most red-group galaxies form as a result of the partial or complete loss of interstellar gas in a stage of high nuclear activity in galaxies whose central black-hole masses exceed 106-107 M ⊙ (depending on the mass of the galaxy itself). The bulk of disk galaxies with M bh > 107 M ⊙ are lenticular galaxies (types S0, E/S0) whose disks are practically devoid of gas.

Evolution of novel wood decay mechanisms in Agaricales revealed by the genome sequences of Fistulina hepatica and Cylindrobasidium torrendii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Floudas, Dimitrios; Held, Benjamin W.; Riley, Robert

Wood decay mechanisms in Agaricomycotina have been traditionally separated in two categories termed white and brown rot. Recently the accuracy of such a dichotomy has been questioned. In this paper, we present the genome sequences of the white-rot fungus Cylindrobasidium torrendii and the brown-rot fungus Fistulina hepatica both members of Agaricales, combining comparative genomics and wood decay experiments. C. torrendii is closely related to the white-rot root pathogen Armillaria mellea, while F. hepatica is related to Schizophyllum commune, which has been reported to cause white rot. Our results suggest that C. torrendii and S. commune are intermediate between white-rot andmore » brown-rot fungi, but at the same time they show characteristics of decay that resembles soft rot. Both species cause weak wood decay and degrade all wood components but leave the middle lamella intact. Their gene content related to lignin degradation is reduced, similar to brown-rot fungi, but both have maintained a rich array of genes related to carbohydrate degradation, similar to white-rot fungi. These characteristics appear to have evolved from white-rot ancestors with stronger ligninolytic ability. F. hepatica shows characteristics of brown rot both in terms of wood decay genes found in its genome and the decay that it causes. However, genes related to cellulose degradation are still present, which is a plesiomorphic characteristic shared with its white-rot ancestors. Four wood degradation-related genes, homologs of which are frequently lost in brown-rot fungi, show signs of pseudogenization in the genome of F. hepatica. These results suggest that transition toward a brown-rot lifestyle could be an ongoing process in F. hepatica. Finally, our results reinforce the idea that wood decay mechanisms are more diverse than initially thought and that the dichotomous separation of wood decay mechanisms in Agaricomycotina into white rot and brown rot should be revisited.« less

Evolution of novel wood decay mechanisms in Agaricales revealed by the genome sequences of Fistulina hepatica and Cylindrobasidium torrendii

PubMed Central

Floudas, Dimitrios; Held, Benjamin W.; Riley, Robert; Nagy, Laszlo G.; Koehler, Gage; Ransdell, Anthony S.; Younus, Hina; Chow, Julianna; Chiniquy, Jennifer; Lipzen, Anna; Tritt, Andrew; Sun, Hui; Haridas, Sajeet; LaButti, Kurt; Ohm, Robin A.; Kües, Ursula; Blanchette, Robert A.; Grigoriev, Igor V.; Minto, Robert E.; Hibbett, David S.

2015-01-01

Wood decay mechanisms in Agaricomycotina have been traditionally separated in two categories termed white and brown rot. Recently the accuracy of such a dichotomy has been questioned. Here, we present the genome sequences of the white rot fungus Cylindrobasidium torrendii and the brown rot fungus Fistulina hepatica both members of Agaricales, combining comparative genomics and wood decay experiments. Cylindrobasidium torrendii is closely related to the white-rot root pathogen Armillaria mellea, while F. hepatica is related to Schizophyllum commune, which has been reported to cause white rot. Our results suggest that C. torrendii and S. commune are intermediate between white-rot and brown-rot fungi, but at the same time they show characteristics of decay that resembles soft rot. Both species cause weak wood decay and degrade all wood components but leave the middle lamella intact. Their gene content related to lignin degradation is reduced, similar to brown-rot fungi, but both have maintained a rich array of genes related to carbohydrate degradation, similar to white-rot fungi. These characteristics appear to have evolved from white-rot ancestors with stronger ligninolytic ability. Fistulina hepatica shows characteristics of brown rot both in terms of wood decay genes found in its genome and the decay that it causes. However, genes related to cellulose degradation are still present, which is a plesiomorphic characteristic shared with its white-rot ancestors. Four wood degradation-related genes, homologs of which are frequently lost in brown-rot fungi, show signs of pseudogenization in the genome of F. hepatica. These results suggest that transition towards a brown rot lifestyle could be an ongoing process in F. hepatica. Our results reinforce the idea that wood decay mechanisms are more diverse than initially thought and that the dichotomous separation of wood decay mechanisms in Agaricomycotina into white rot and brown rot should be revisited. PMID:25683379

Discovery of high-affinity BCL6-binding peptide and its structure-activity relationship

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakamoto, Kotaro; Sogabe, Satoshi; Kamada, Yusuke

B cell lymphoma 6 (BCL6) is a transcriptional repressor that interacts with its corepressors BcoR and SMRT. Since this protein-protein interaction (PPI) induces activation and differentiation of B lymphocytes, BCL6 has been an attractive drug target for potential autoimmune disease treatments. Here we report a novel BCL6 inhibitory peptide, F1324 (Ac-LWYTDIRMSWRVP-OH), which we discovered using phage display technology; we also discuss this peptide's structure-activity relationship (SAR). For BCL6(5-129) binding, K{sub D} and IC{sub 50} values of F1324 were 0.57 nM and 1 nM according to the results of an SPR analysis and cell-free ELISA assay, respectively. In contrast, BcoR(Arg498-514Pro) and SMRT(Leu1422-Arg1438) exhibitedmore » relatively weak micromole-order binding to BCL6. Furthermore, Fusion protein AcGFP-F1324 transiently expressed in HEK293T cells inhibited intracellular PPI in cell-based M2H assay. By examination of the truncation and fragmentation of F1324, the C-terminal sequence WRVP, which is similar to the BcoR(509-512) sequence WVVP, was identified as being critical for BCL6 binding. In addition, subsequent single-crystal X-ray diffraction analysis of F1324/BCL6(5-129) complex revealed that the high affinity of F1324 was caused by effective interaction of its side chains while its main chain structure was similar to that of BcoR(Arg498-514Pro). To our knowledge, F1324 is the strongest BCL6-binding peptide yet reported. - Highlights: • F1324 was discovered as 5000-times higher affinity peptide to BCL6 than that of BcoR(R498-P514). • X-ray crystal structure analysis revealed the binding mode. • To our knowledge, F1324 is the strongest BCL6-binding and -inhibition peptide so far.« less

Evolution of novel wood decay mechanisms in Agaricales revealed by the genome sequences of Fistulina hepatica and Cylindrobasidium torrendii.

PubMed

Floudas, Dimitrios; Held, Benjamin W; Riley, Robert; Nagy, Laszlo G; Koehler, Gage; Ransdell, Anthony S; Younus, Hina; Chow, Julianna; Chiniquy, Jennifer; Lipzen, Anna; Tritt, Andrew; Sun, Hui; Haridas, Sajeet; LaButti, Kurt; Ohm, Robin A; Kües, Ursula; Blanchette, Robert A; Grigoriev, Igor V; Minto, Robert E; Hibbett, David S

2015-03-01

Wood decay mechanisms in Agaricomycotina have been traditionally separated in two categories termed white and brown rot. Recently the accuracy of such a dichotomy has been questioned. Here, we present the genome sequences of the white-rot fungus Cylindrobasidium torrendii and the brown-rot fungus Fistulina hepatica both members of Agaricales, combining comparative genomics and wood decay experiments. C. torrendii is closely related to the white-rot root pathogen Armillaria mellea, while F. hepatica is related to Schizophyllum commune, which has been reported to cause white rot. Our results suggest that C. torrendii and S. commune are intermediate between white-rot and brown-rot fungi, but at the same time they show characteristics of decay that resembles soft rot. Both species cause weak wood decay and degrade all wood components but leave the middle lamella intact. Their gene content related to lignin degradation is reduced, similar to brown-rot fungi, but both have maintained a rich array of genes related to carbohydrate degradation, similar to white-rot fungi. These characteristics appear to have evolved from white-rot ancestors with stronger ligninolytic ability. F. hepatica shows characteristics of brown rot both in terms of wood decay genes found in its genome and the decay that it causes. However, genes related to cellulose degradation are still present, which is a plesiomorphic characteristic shared with its white-rot ancestors. Four wood degradation-related genes, homologs of which are frequently lost in brown-rot fungi, show signs of pseudogenization in the genome of F. hepatica. These results suggest that transition toward a brown-rot lifestyle could be an ongoing process in F. hepatica. Our results reinforce the idea that wood decay mechanisms are more diverse than initially thought and that the dichotomous separation of wood decay mechanisms in Agaricomycotina into white rot and brown rot should be revisited. Copyright © 2015 Elsevier Inc. All rights reserved.

PoPMuSiC 2.1: a web server for the estimation of protein stability changes upon mutation and sequence optimality.

PubMed

Dehouck, Yves; Kwasigroch, Jean Marc; Gilis, Dimitri; Rooman, Marianne

2011-05-13

The rational design of modified proteins with controlled stability is of extreme importance in a whole range of applications, notably in the biotechnological and environmental areas, where proteins are used for their catalytic or other functional activities. Future breakthroughs in medical research may also be expected from an improved understanding of the effect of naturally occurring disease-causing mutations on the molecular level. PoPMuSiC-2.1 is a web server that predicts the thermodynamic stability changes caused by single site mutations in proteins, using a linear combination of statistical potentials whose coefficients depend on the solvent accessibility of the mutated residue. PoPMuSiC presents good prediction performances (correlation coefficient of 0.8 between predicted and measured stability changes, in cross validation, after exclusion of 10% outliers). It is moreover very fast, allowing the prediction of the stability changes resulting from all possible mutations in a medium size protein in less than a minute. This unique functionality is user-friendly implemented in PoPMuSiC and is particularly easy to exploit. Another new functionality of our server concerns the estimation of the optimality of each amino acid in the sequence, with respect to the stability of the structure. It may be used to detect structural weaknesses, i.e. clusters of non-optimal residues, which represent particularly interesting sites for introducing targeted mutations. This sequence optimality data is also expected to have significant implications in the prediction and the analysis of particular structural or functional protein regions. To illustrate the interest of this new functionality, we apply it to a dataset of known catalytic sites, and show that a much larger than average concentration of structural weaknesses is detected, quantifying how these sites have been optimized for function rather than stability. The freely available PoPMuSiC-2.1 web server is highly useful for identifying very rapidly a list of possibly relevant mutations with the desired stability properties, on which subsequent experimental studies can be focused. It can also be used to detect sequence regions corresponding to structural weaknesses, which could be functionally important or structurally delicate regions, with obvious applications in rational protein design.

A putative carbohydrate-binding domain of the lactose-binding Cytisus sessilifolius anti-H(O) lectin has a similar amino acid sequence to that of the L-fucose-binding Ulex europaeus anti-H(O) lectin.

PubMed

Konami, Y; Yamamoto, K; Osawa, T; Irimura, T

1995-04-01

The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).

Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

PubMed

Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

2016-09-21

With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.

Comprehensive comparison of three commercial human whole-exome capture platforms.

PubMed

Asan; Xu, Yu; Jiang, Hui; Tyler-Smith, Chris; Xue, Yali; Jiang, Tao; Wang, Jiawei; Wu, Mingzhi; Liu, Xiao; Tian, Geng; Wang, Jun; Wang, Jian; Yang, Huangming; Zhang, Xiuqing

2011-09-28

Exome sequencing, which allows the global analysis of protein coding sequences in the human genome, has become an effective and affordable approach to detecting causative genetic mutations in diseases. Currently, there are several commercial human exome capture platforms; however, the relative performances of these have not been characterized sufficiently to know which is best for a particular study. We comprehensively compared three platforms: NimbleGen's Sequence Capture Array and SeqCap EZ, and Agilent's SureSelect. We assessed their performance in a variety of ways, including number of genes covered and capture efficacy. Differences that may impact on the choice of platform were that Agilent SureSelect covered approximately 1,100 more genes, while NimbleGen provided better flanking sequence capture. Although all three platforms achieved similar capture specificity of targeted regions, the NimbleGen platforms showed better uniformity of coverage and greater genotype sensitivity at 30- to 100-fold sequencing depth. All three platforms showed similar power in exome SNP calling, including medically relevant SNPs. Compared with genotyping and whole-genome sequencing data, the three platforms achieved a similar accuracy of genotype assignment and SNP detection. Importantly, all three platforms showed similar levels of reproducibility, GC bias and reference allele bias. We demonstrate key differences between the three platforms, particularly advantages of solutions over array capture and the importance of a large gene target set.

Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.

PubMed

Šatović, Eva; Plohl, Miroslav

2017-10-01

Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.

Enhanced smartcard-based password-authenticated key agreement using extended chaotic maps.

PubMed

Lee, Tian-Fu; Hsiao, Chia-Hung; Hwang, Shi-Han; Lin, Tsung-Hung

2017-01-01

A smartcard based password-authenticated key agreement scheme enables a legal user to log in to a remote authentication server and access remote services through public networks using a weak password and a smart card. Lin recently presented an improved chaotic maps-based password-authenticated key agreement scheme that used smartcards to eliminate the weaknesses of the scheme of Guo and Chang, which does not provide strong user anonymity and violates session key security. However, the improved scheme of Lin does not exhibit the freshness property and the validity of messages so it still fails to withstand denial-of-service and privileged-insider attacks. Additionally, a single malicious participant can predetermine the session key such that the improved scheme does not exhibit the contributory property of key agreements. This investigation discusses these weaknesses and proposes an enhanced smartcard-based password-authenticated key agreement scheme that utilizes extended chaotic maps. The session security of this enhanced scheme is based on the extended chaotic map-based Diffie-Hellman problem, and is proven in the real-or-random and the sequence of games models. Moreover, the enhanced scheme ensures the freshness of communicating messages by appending timestamps, and thereby avoids the weaknesses in previous schemes.

Enhanced smartcard-based password-authenticated key agreement using extended chaotic maps

PubMed Central

Lee, Tian-Fu; Hsiao, Chia-Hung; Hwang, Shi-Han

2017-01-01

A smartcard based password-authenticated key agreement scheme enables a legal user to log in to a remote authentication server and access remote services through public networks using a weak password and a smart card. Lin recently presented an improved chaotic maps-based password-authenticated key agreement scheme that used smartcards to eliminate the weaknesses of the scheme of Guo and Chang, which does not provide strong user anonymity and violates session key security. However, the improved scheme of Lin does not exhibit the freshness property and the validity of messages so it still fails to withstand denial-of-service and privileged-insider attacks. Additionally, a single malicious participant can predetermine the session key such that the improved scheme does not exhibit the contributory property of key agreements. This investigation discusses these weaknesses and proposes an enhanced smartcard-based password-authenticated key agreement scheme that utilizes extended chaotic maps. The session security of this enhanced scheme is based on the extended chaotic map-based Diffie-Hellman problem, and is proven in the real-or-random and the sequence of games models. Moreover, the enhanced scheme ensures the freshness of communicating messages by appending timestamps, and thereby avoids the weaknesses in previous schemes. PMID:28759615

A search for strong, ordered magnetic fields in Herbig Ae/Be stars

NASA Astrophysics Data System (ADS)

Wade, G. A.; Bagnulo, S.; Drouin, D.; Landstreet, J. D.; Monin, D.

2007-04-01

The origin of magnetic fields in intermediate- and high-mass stars is fundamentally a mystery. Clues towards solving this basic astrophysical problem can likely be found at the pre-main-sequence (PMS) evolutionary stage. With this work, we perform the largest and most sensitive search for magnetic fields in PMS Herbig Ae/Be (HAeBe) stars. We seek to determine whether strong, ordered magnetic fields, similar to those of main-sequence Ap/Bp stars, can be detected in these objects, and if so, to determine the intensities, geometrical characteristics, and statistical incidence of such fields. 68 observations of 50 HAeBe stars have been obtained in circularly polarized light using the FORS1 spectropolarimeter at the ESO VLT. An analysis of both Balmer and metallic lines reveals the possible presence of weak longitudinal magnetic fields in photospheric lines of two HAeBe stars, HD 101412 and BF Ori. Results for two additional stars, CPD-53 295 and HD 36112, are suggestive of the presence of magnetic fields, but no firm conclusions can be drawn based on the available data. The intensity of the longitudinal fields detected in HD 101412 and BF Ori suggest that they correspond to globally ordered magnetic fields with surface intensities of order 1 kG. On the other hand, no magnetic field is detected in 4 other HAeBe stars in our sample in which magnetic fields had previously been confirmed. Monte Carlo simulations of the longitudinal field measurements of the undetected stars allow us to place an upper limit of about 300 G on the general presence of aligned magnetic dipole magnetic fields, and of about 500 G on perpendicular dipole fields. Taking into account the results of our survey and other published results, we find that the observed bulk incidence of magnetic HAeBe stars in our sample is 8-12 per cent, in good agreement with that of magnetic main-sequence stars of similar masses. We also find that the rms longitudinal field intensity of magnetically detected HAeBe stars is about 200 G, similar to that of Ap stars and consistent with magnetic flux conservation during stellar evolution. These results are all in agreement with the hypothesis that the magnetic fields of main-sequence Ap/Bp stars are fossils, which already exist within the stars at the PMS stage. Finally, we explore the ability of our new magnetic data to constrain magnetospheric accretion in Herbig Ae/Be stars, showing that our magnetic data are not consistent with the general occurrence in HAeBe stars of magnetospheric accretion as described by the theories of Königl and Shu et al.. Based on observations from the ESO telescopes at the La Silla Paranal Observatory under programme ID 072.C-0447, DDT-272.C-5063, 074.C-0442. E-mail: wade-g@rmc.ca

Analysis of sequence repeats of proteins in the PDB.

PubMed

Mary Rajathei, David; Selvaraj, Samuel

2013-12-01

Internal repeats in protein sequences play a significant role in the evolution of protein structure and function. Applications of different bioinformatics tools help in the identification and characterization of these repeats. In the present study, we analyzed sequence repeats in a non-redundant set of proteins available in the Protein Data Bank (PDB). We used RADAR for detecting internal repeats in a protein, PDBeFOLD for assessing structural similarity, PDBsum for finding functional involvement and Pfam for domain assignment of the repeats in a protein. Through the analysis of sequence repeats, we found that identity of the sequence repeats falls in the range of 20-40% and, the superimposed structures of the most of the sequence repeats maintain similar overall folding. Analysis sequence repeats at the functional level reveals that most of the sequence repeats are involved in the function of the protein through functionally involved residues in the repeat regions. We also found that sequence repeats in single and two domain proteins often contained conserved sequence motifs for the function of the domain. Copyright © 2013 Elsevier Ltd. All rights reserved.

Agrin mutations lead to a congenital myasthenic syndrome with distal muscle weakness and atrophy.

PubMed

Nicole, Sophie; Chaouch, Amina; Torbergsen, Torberg; Bauché, Stéphanie; de Bruyckere, Elodie; Fontenille, Marie-Joséphine; Horn, Morten A; van Ghelue, Marijke; Løseth, Sissel; Issop, Yasmin; Cox, Daniel; Müller, Juliane S; Evangelista, Teresinha; Stålberg, Erik; Ioos, Christine; Barois, Annie; Brochier, Guy; Sternberg, Damien; Fournier, Emmanuel; Hantaï, Daniel; Abicht, Angela; Dusl, Marina; Laval, Steven H; Griffin, Helen; Eymard, Bruno; Lochmüller, Hanns

2014-09-01

Congenital myasthenic syndromes are a clinically and genetically heterogeneous group of rare diseases resulting from impaired neuromuscular transmission. Their clinical hallmark is fatigable muscle weakness associated with a decremental muscle response to repetitive nerve stimulation and frequently related to postsynaptic defects. Distal myopathies form another clinically and genetically heterogeneous group of primary muscle disorders where weakness and atrophy are restricted to distal muscles, at least initially. In both congenital myasthenic syndromes and distal myopathies, a significant number of patients remain genetically undiagnosed. Here, we report five patients from three unrelated families with a strikingly homogenous clinical entity combining congenital myasthenia with distal muscle weakness and atrophy reminiscent of a distal myopathy. MRI and neurophysiological studies were compatible with mild myopathy restricted to distal limb muscles, but decrement (up to 72%) in response to 3 Hz repetitive nerve stimulation pointed towards a neuromuscular transmission defect. Post-exercise increment (up to 285%) was observed in the distal limb muscles in all cases suggesting presynaptic congenital myasthenic syndrome. Immunofluorescence and ultrastructural analyses of muscle end-plate regions showed synaptic remodelling with denervation-reinnervation events. We performed whole-exome sequencing in two kinships and Sanger sequencing in one isolated case and identified five new recessive mutations in the gene encoding agrin. This synaptic proteoglycan with critical function at the neuromuscular junction was previously found mutated in more typical forms of congenital myasthenic syndrome. In our patients, we found two missense mutations residing in the N-terminal agrin domain, which reduced acetylcholine receptors clustering activity of agrin in vitro. Our findings expand the spectrum of congenital myasthenic syndromes due to agrin mutations and show an unexpected correlation between the mutated gene and the associated phenotype. This provides a good rationale for examining patients with apparent distal myopathy for a neuromuscular transmission disorder and agrin mutations. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

What is a melody? On the relationship between pitch and brightness of timbre.

PubMed

Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel

2013-01-01

Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners' task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities.

Superposed orogenic collision and core-complex formation at the present contact between the Dinarides and the Pannonian basin: The Bukulja and Cer Mountains in central and western Serbia

NASA Astrophysics Data System (ADS)

Matenco, Liviu; Toljic, Marinko; Ducea, Mihai; Stojadinovic, Uros

2010-05-01

Formation of large extensional detachments during orogenic collapse can follow inherited weakness zones such as major asymmetries given by pre-existing subduction zones active during mountain building processes. This is valid in particular in low-topography foreland coupling orogens of Mediterranean type where large amounts of deformation is concentrated in their lower plates, favoring weakness zones activated during a subsequent phase of extensional collapse. One good place to study the orogenic collapse post-dating major collision is the NE margin of the Dinarides in central and western Serbia, where Cretaceous-Eocene shortening and collision was recorded in the Alpine Tethys Sava zone between the European-derived Dacia and Tisza mega-units and the lower Adriatic plate. This is the same place where the Pannonian basin formed as a Miocene back-arc basin in response to a different subduction and roll-back taking place along the external Carpathians. A lineament of Paleogene and Miocene plutons is observed at the northern and eastern margin of the Dinarides, interpreted to be the product of both syn- to post-orogenic subduction magmatism and of decompressional melting during the Pannonian extension. Two of these plutons, Cer and Bukulja, located in western and respectively central Serbia, are intruded in the Jadar-Kopaonik composite thrust sheet, part of the lower Adriatic plate, near the contact with the main suture formed during the Cretaceous-Eocene subduction of the Sava zone. The Lower Miocene age (19-17Ma) Bukulja intrusion is a S-type granite with rare aplitic veins (Cvetkovic et al., 2007). The Cer intrusive complex is a S type two mica granite of around 16Ma in age with an older I-type quartz monzonite component (Koroneos et al. in press). Both granitoids are intruded into the Jadar-Kopaonik metamorphic series, which are in direct contact along the northern, eastern and southern flank with non-metamorphosed, mainly clastic sediments of Cretaceous-Miocene in age and, in the case of Bukulja, with serpentinized ophiolites. The metamorphic sequences are generally characterized by a Paleozoic age meta-sedimentary basement and a meta-sedimentary and meta-volcanic sequence. In the case of Bukulja, a succession of contrasting metamorphosed lithologies has been observed such as sandstones, black limestones, shallow water white limestones, basic volcanic sequences, deep nodular limestones and turbiditic sequences. The lower part of the sequence represents a metamorphosed Triassic sequence similar to what has been defined as the Kopaonik and Studenica series in southern Serbia. This part of the sequence is characterized by at least 3 successive stages of folding, asymmetric folds with WSW-ward vergence and NNE-SSW upright folds being affected by vertical flattening folds associated with extension (see also Marovic et al., 2007). The upper part of the sequence, which is the only part outcropping along the eastern flank of the Cer granitoid, is made up by metamorphosed distal turbidites which have been palinologically dated in Bukulja as Upper Cretaceous in age. This is the metamorphosed equivalent of the Upper Cretaceous - Eocene "flysch"-type of deposits commonly observed elsewhere in the main Sava subduction zone. These rocks are overprinted with a pervasive and strong extensional milonitic foliation indicating top-100 movement of the hanging-wall and are in direct contact with non-metamorphosed, but similar Upper Cretaceous distal turbidites. This suggests a large-scale tectonic omission along the eastern flanks of the Bukulja and Cer detachment. In the case of Bukulja, the extension was associated with the formation of the Early Miocene Morava basin in the detachment hanging-wall, which is an endemic lacustrine precursor of the much larger Middle-Late Miocene Pannonian basin. These finding points towards a bi-modal evolution of the internal Dinarides in central and western Serbia near the present-day contact with the Pannonian basin. An Upper Cretaceous-Eocene phase of top-WSW shortening and metamorphism in the Sava zone and its subducting lower Adriatic plate was subsequently followed by massive core-complex exhumation and top-E directed extension during initiation of the Carpathians back-arc extension. Interestingly, the newly defined extensional detachments accompanying the Pannonian extension closely follow the pre-existing subduction zone and its associated duplications in the lower orogenic plate. This conclusion is compatible with observations in other areas of the Dinarides, such as the Prosara-Motajica in Bosnia/Croatia or Kopaonik-Studenica in southern Serbia (Schefer et al., 2008; Ustaszewski et al., 2009).

ATMOSPHERIC COMPOSITION OF WEAK G BAND STARS: CNO AND Li ABUNDANCES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adamczak, Jens; Lambert, David L., E-mail: adamczak@astro.as.utexas.edu

We determined the chemical composition of a large sample of weak G band stars-a rare class of G and K giants of intermediate mass with unusual abundances of C, N, and Li. We have observed 24 weak G band stars with the 2.7 m Harlan J. Smith Telescope at the McDonald Observatory and derived spectroscopic abundances for C, N, O, and Li, as well as for selected elements from Na-Eu. The results show that the atmospheres of weak G band stars are highly contaminated with CN-cycle products. The C underabundance is about a factor of 20 larger than for normalmore » giants and the {sup 12}C/{sup 13}C ratio approaches the CN-cycle equilibrium value. In addition to the striking CN-cycle signature the strong N overabundance may indicate the presence of partially ON-cycled material in the atmospheres of the weak G band stars. The exact mechanism responsible for the transport of the elements to the surface has yet to be identified but could be induced by rapid rotation of the main sequence progenitors of the stars. The unusually high Li abundances in some of the stars are an indicator for Li production by the Cameron-Fowler mechanism. A quantitative prediction of a weak G band star's Li abundance is complicated by the strong temperature sensitivity of the mechanism and its participants. In addition to the unusual abundances of CN-cycle elements and Li, we find an overabundance of Na that is in accordance with the NeNa chain running in parallel with the CN cycle. Apart from these peculiarities, the element abundances in a weak G band star's atmosphere are consistent with those of normal giants.« less

Atmospheric Composition of Weak G Band Stars: CNO and Li Abundances

NASA Astrophysics Data System (ADS)

Adamczak, Jens; Lambert, David L.

2013-03-01

We determined the chemical composition of a large sample of weak G band stars—a rare class of G and K giants of intermediate mass with unusual abundances of C, N, and Li. We have observed 24 weak G band stars with the 2.7 m Harlan J. Smith Telescope at the McDonald Observatory and derived spectroscopic abundances for C, N, O, and Li, as well as for selected elements from Na-Eu. The results show that the atmospheres of weak G band stars are highly contaminated with CN-cycle products. The C underabundance is about a factor of 20 larger than for normal giants and the 12C/13C ratio approaches the CN-cycle equilibrium value. In addition to the striking CN-cycle signature the strong N overabundance may indicate the presence of partially ON-cycled material in the atmospheres of the weak G band stars. The exact mechanism responsible for the transport of the elements to the surface has yet to be identified but could be induced by rapid rotation of the main sequence progenitors of the stars. The unusually high Li abundances in some of the stars are an indicator for Li production by the Cameron-Fowler mechanism. A quantitative prediction of a weak G band star's Li abundance is complicated by the strong temperature sensitivity of the mechanism and its participants. In addition to the unusual abundances of CN-cycle elements and Li, we find an overabundance of Na that is in accordance with the NeNa chain running in parallel with the CN cycle. Apart from these peculiarities, the element abundances in a weak G band star's atmosphere are consistent with those of normal giants.

Do Accretion Disks Exist in High Energy Astrophysics?

NASA Astrophysics Data System (ADS)

Coppi, B.

2006-10-01

The familiar concept of an accretion disk is based on its gas dynamic description where, in particular, the vertical equilibrium is maintained by the (weak) vertical component of the gravitational force due to the central object. When a plasma structure differentially rotating around the same kind of object is considered in which the magnetic field diffusion due to finite resistivity is realistically weak, a radially periodic sequence of pairs of opposite current channels is found. Moreover, the vertical confinement of the structure is maintained by the resulting Lorentz force rather than by gravity. Thus, a ``Lorentz compression'' occurs. In addition, sequences of plasma rings^2 rather than disks emerge. (Note that H. Alfvén had proposed that planetary rings may be ``fossils'' of pre- existing envisioned plasma rings. Moreover, a large ring is the most prominent feature emerging from the high resolution X- ray image of the Crab). The ``seed'' magnetic field in which the structure is immersed is considerably smaller than that produced by the internal toroidal currents. The magnetic pressure is of the order of the plasma pressure. Thus, ring sequence configurations can be suitable for the emergence of a jet from their center. Two coupled non-linear equations have been solved, representing the vertical and the horizontal equilibrium conditions for the structure.*Sponsored in part by the U.S. D.O.E. B. Coppi, Phys. Plasmas 12, 057301, (2005) B. Coppi and F. Rousseau, Ap. J. 641 (1), 458 (2006)

Influenza Research in the Eastern Mediterranean Region: A Review

PubMed Central

Khan, Wasiq; El Rifay, Amira S.; Malik, Mamun; Kayali, Ghazi

2017-01-01

Given the importance of influenza infections in the Eastern Mediterranean Region (EMR), we conducted a comprehensive literature review to analyze the status of influenza research in the region from 2012. Influenza research has gained more momentum recently with the emergence of H5N1 and new virus strains. Research covering epidemiological, veterinary, and basic science aspects is growing. More sequences were being generated per year, not only for diagnostic purposes but also for research. We included gray literature publications in our search and found several graduate student dissertations from Egypt, which were published on an online portal. However, the search revealed some weaknesses, mostly in the areas of study design and the lack of surveillance studies. Another weakness was the fact that the publications originated from very few countries, mainly Egypt and Iran. Although improving, influenza research in the EMR remains weak. We recommend encouraging countries in the EMR to conduct more influenza research using stronger methodologies. PMID:29026466

PipeOnline 2.0: automated EST processing and functional data sorting.

PubMed

Ayoubi, Patricia; Jin, Xiaojing; Leite, Saul; Liu, Xianghui; Martajaja, Jeson; Abduraham, Abdurashid; Wan, Qiaolan; Yan, Wei; Misawa, Eduardo; Prade, Rolf A

2002-11-01

Expressed sequence tags (ESTs) are generated and deposited in the public domain, as redundant, unannotated, single-pass reactions, with virtually no biological content. PipeOnline automatically analyses and transforms large collections of raw DNA-sequence data from chromatograms or FASTA files by calling the quality of bases, screening and removing vector sequences, assembling and rewriting consensus sequences of redundant input files into a unigene EST data set and finally through translation, amino acid sequence similarity searches, annotation of public databases and functional data. PipeOnline generates an annotated database, retaining the processed unigene sequence, clone/file history, alignments with similar sequences, and proposed functional classification, if available. Functional annotation is automatic and based on a novel method that relies on homology of amino acid sequence multiplicity within GenBank records. Records are examined through a function ordered browser or keyword queries with automated export of results. PipeOnline offers customization for individual projects (MyPipeOnline), automated updating and alert service. PipeOnline is available at http://stress-genomics.org.

galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.

PubMed

Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M

2004-06-12

The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se

Settling the score: variant prioritization and Mendelian disease

PubMed Central

Eilbeck, Karen; Quinlan, Aaron; Yandell, Mark

2018-01-01

When investigating Mendelian disease using exome or genome sequencing, distinguishing disease-causing genetic variants from the multitude of candidate variants is a complex, multidimensional task. Many prioritization tools and online interpretation resources exist, and professional organizations have offered clinical guidelines for review and return of prioritization results. In this Review, we describe the strengths and weaknesses of widely used computational approaches, explain their roles in the diagnostic and discovery process and discuss how they can inform (and misinform) expert reviewers. We place variant prioritization in the wider context of gene prioritization, burden testing and genotype–phenotype association, and we discuss opportunities and challenges introduced by whole-genome sequencing. PMID:28804138

Ternary metal-rich sulfide with a layered structure

DOEpatents

Franzen, Hugo F.; Yao, Xiaoqiang

1993-08-17

A ternary Nb-Ta-S compound is provided having the atomic formula, Nb.sub.1.72 Ta.sub.3.28 S.sub.2, and exhibiting a layered structure in the sequence S-M3-M2-M1-M2-M3-S wherein S represents sulfur layers and M1, M2, and M3 represent Nb/Ta mixed metal layers. This sequence generates seven sheets stacked along the [001] direction of an approximate body centered cubic crystal structure with relatively weak sulfur-to-sulfur van der Waals type interactions between adjacent sulfur sheets and metal-to-metal bonding within and between adjacent mixed metal sheets.

Uranium minerals in Oligocene gypsum near Chadron, Dawes County, Nebraska

USGS Publications Warehouse

Dunham, R.J.

1955-01-01

Carnotite, sabugalite [HAI(UO2)4(PO4)4 • 16H2O] and autunite occur in the basal 25 feet of a 270-foot sequence of nonmarine bedded gypsum and gypsiferous clay in the Brule formation of Oligocene age about 12 miles northeast of Chadron in northeastern Dawes County, Nebraska. Uranium minerals are visible at only two localities and are associated with carbonaceous matter. Elsewhere the basal 25 feet of the gypsum sequence is interbedded with carbonate rocks and is weakly but persistently uraniferous. Uranium probably was emplaced from above by uranyl solutions rich in sulfate.

Sequence information signal processor for local and global string comparisons

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1997-01-01

A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

An Alignment-Free Algorithm in Comparing the Similarity of Protein Sequences Based on Pseudo-Markov Transition Probabilities among Amino Acids

PubMed Central

Li, Yushuang; Yang, Jiasheng; Zhang, Yi

2016-01-01

In this paper, we have proposed a novel alignment-free method for comparing the similarity of protein sequences. We first encode a protein sequence into a 440 dimensional feature vector consisting of a 400 dimensional Pseudo-Markov transition probability vector among the 20 amino acids, a 20 dimensional content ratio vector, and a 20 dimensional position ratio vector of the amino acids in the sequence. By evaluating the Euclidean distances among the representing vectors, we compare the similarity of protein sequences. We then apply this method into the ND5 dataset consisting of the ND5 protein sequences of 9 species, and the F10 and G11 datasets representing two of the xylanases containing glycoside hydrolase families, i.e., families 10 and 11. As a result, our method achieves a correlation coefficient of 0.962 with the canonical protein sequence aligner ClustalW in the ND5 dataset, much higher than those of other 5 popular alignment-free methods. In addition, we successfully separate the xylanases sequences in the F10 family and the G11 family and illustrate that the F10 family is more heat stable than the G11 family, consistent with a few previous studies. Moreover, we prove mathematically an identity equation involving the Pseudo-Markov transition probability vector and the amino acids content ratio vector. PMID:27918587

Sequence Alignment to Predict Across Species Susceptibility ...

EPA Pesticide Factsheets

Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev

Molecular studies on larvae of Pseudoterranova parasite of Trichiurus lepturus Linnaeus, 1758 and Pomatomus saltatrix (Linnaeus, 1766) off Brazilian waters.

PubMed

Borges, Juliana N; Cunha, Luiz F G; Miranda, Daniele F; Monteiro-Neto, Cassiano; Santos, Cláudia P

2015-12-01

Pseudoterranova larvae parasitizing cutlassfish Trichiurus lepturus and bluefish Pomatomus saltatrix from Southwest Atlantic coast of Brazil were studied in this work by morphological, ultrastructural and molecular approaches. The genetic analysis were performed for the ITS2 intergenic region specific for Pseudoterranova decipiens, the partial 28S (LSU) of ribosomal DNA and the mtDNA cox-1 region. We obtained results for the 28S region and mtDNA cox-1 that was amplified using the polymerase chain reaction and sequenced to evaluate the phylogenetic relationships between sequences of this study and sequences from the GenBank. The morphological profile indicated that all the nine specimens collected from both fish were L3 larvae of Pseudoterranova sp. The genetic profile confirmed the generic level but due to the absence of similar sequences for adult parasites on GenBank for the regions amplifyied, it was not possible to identify them to the species level. The sequences obtained presented 89% of similarity with Pseudoterranova decipiens (28S sequences) and Contracaecum osculatum B (mtDNA cox-1). The low similarity allied to the fact that the amplification with the specific primer for P. decipiens didn't occur, lead us to conclude that our sequences don't belong to P. decipiens complex.

Visualizing and Clustering Protein Similarity Networks: Sequences, Structures, and Functions.

PubMed

Mai, Te-Lun; Hu, Geng-Ming; Chen, Chi-Ming

2016-07-01

Research in the recent decade has demonstrated the usefulness of protein network knowledge in furthering the study of molecular evolution of proteins, understanding the robustness of cells to perturbation, and annotating new protein functions. In this study, we aimed to provide a general clustering approach to visualize the sequence-structure-function relationship of protein networks, and investigate possible causes for inconsistency in the protein classifications based on sequences, structures, and functions. Such visualization of protein networks could facilitate our understanding of the overall relationship among proteins and help researchers comprehend various protein databases. As a demonstration, we clustered 1437 enzymes by their sequences and structures using the minimum span clustering (MSC) method. The general structure of this protein network was delineated at two clustering resolutions, and the second level MSC clustering was found to be highly similar to existing enzyme classifications. The clustering of these enzymes based on sequence, structure, and function information is consistent with each other. For proteases, the Jaccard's similarity coefficient is 0.86 between sequence and function classifications, 0.82 between sequence and structure classifications, and 0.78 between structure and function classifications. From our clustering results, we discussed possible examples of divergent evolution and convergent evolution of enzymes. Our clustering approach provides a panoramic view of the sequence-structure-function network of proteins, helps visualize the relation between related proteins intuitively, and is useful in predicting the structure and function of newly determined protein sequences.

Experimental generation and computational modeling of intracellular pH gradients in cardiac myocytes.

PubMed

Swietach, Pawel; Leem, Chae-Hun; Spitzer, Kenneth W; Vaughan-Jones, Richard D

2005-04-01

It is often assumed that pH(i) is spatially uniform within cells. A double-barreled microperfusion system was used to apply solutions of weak acid (acetic acid, CO(2)) or base (ammonia) to localized regions of an isolated ventricular myocyte (guinea pig). A stable, longitudinal pH(i) gradient (up to 1 pH(i) unit) was observed (using confocal imaging of SNARF-1 fluorescence). Changing the fractional exposure of the cell to weak acid/base altered the gradient, as did changing the concentration and type of weak acid/base applied. A diffusion-reaction computational model accurately simulated this behavior of pH(i). The model assumes that H(i)(+) movement occurs via diffusive shuttling on mobile buffers, with little free H(+) diffusion. The average diffusion constant for mobile buffer was estimated as 33 x 10(-7) cm(2)/s, consistent with an apparent H(i)(+) diffusion coefficient, D(H)(app), of 14.4 x 10(-7) cm(2)/s (at pH(i) 7.07), a value two orders of magnitude lower than for H(+) ions in water but similar to that estimated recently from local acid injection via a cell-attached glass micropipette. We conclude that, because H(i)(+) mobility is so low, an extracellular concentration gradient of permeant weak acid readily induces pH(i) nonuniformity. Similar concentration gradients for weak acid (e.g., CO(2)) occur across border zones during regional myocardial ischemia, raising the possibility of steep pH(i) gradients within the heart under some pathophysiological conditions.

STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

PubMed Central

Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

2013-01-01

The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

A coarse-grained biophysical model of sequence evolution and the population size dependence of the speciation rate

PubMed Central

Khatri, Bhavin S.; Goldstein, Richard A.

2015-01-01

Speciation is fundamental to understanding the huge diversity of life on Earth. Although still controversial, empirical evidence suggests that the rate of speciation is larger for smaller populations. Here, we explore a biophysical model of speciation by developing a simple coarse-grained theory of transcription factor-DNA binding and how their co-evolution in two geographically isolated lineages leads to incompatibilities. To develop a tractable analytical theory, we derive a Smoluchowski equation for the dynamics of binding energy evolution that accounts for the fact that natural selection acts on phenotypes, but variation arises from mutations in sequences; the Smoluchowski equation includes selection due to both gradients in fitness and gradients in sequence entropy, which is the logarithm of the number of sequences that correspond to a particular binding energy. This simple consideration predicts that smaller populations develop incompatibilities more quickly in the weak mutation regime; this trend arises as sequence entropy poises smaller populations closer to incompatible regions of phenotype space. These results suggest a generic coarse-grained approach to evolutionary stochastic dynamics, allowing realistic modelling at the phenotypic level. PMID:25936759

Sequence-specific procedural learning deficits in children with specific language impairment.

PubMed

Hsu, Hsinjen Julie; Bishop, Dorothy V M

2014-05-01

This study tested the procedural deficit hypothesis of specific language impairment (SLI) by comparing children's performance in two motor procedural learning tasks and an implicit verbal sequence learning task. Participants were 7- to 11-year-old children with SLI (n = 48), typically developing age-matched children (n = 20) and younger typically developing children matched for receptive grammar (n = 28). In a serial reaction time task, the children with SLI performed at the same level as the grammar-matched children, but poorer than age-matched controls in learning motor sequences. When tested with a motor procedural learning task that did not involve learning sequential relationships between discrete elements (i.e. pursuit rotor), the children with SLI performed comparably with age-matched children and better than younger grammar-matched controls. In addition, poor implicit learning of word sequences in a verbal memory task (the Hebb effect) was found in the children with SLI. Together, these findings suggest that SLI might be characterized by deficits in learning sequence-specific information, rather than generally weak procedural learning. © 2014 The Authors. Developmental Science Published by John Wiley & Sons Ltd.

Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.

PubMed

Kijima, T E; Innan, Hideki

2013-11-01

A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

PubMed

Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

2013-01-01

Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

Detection of phosphorylation states by intermolecular sensitization of lanthanide-peptide conjugates.

PubMed

Pazos, Elena; Goličnik, Marko; Mascareñas, José L; Vázquez, M Eugenio

2012-10-04

The luminescence of a designed peptide equipped with a coordinatively-unsaturated lanthanide complex is modulated by the phosphorylation state of a serine residue in the sequence. While the phosphorylated state is weakly emissive, even in the presence of an external antenna, removal of the phosphate allows coordination of the sensitizer to the metal, yielding a highly emissive supramolecular complex.

Transitivity in the Process of Intransitive Clauses: A Category-Based Prediction in Low-Intermediate Learners of English

ERIC Educational Resources Information Center

Dekydtspotter, Laurent; Seo, Hyun-Kyoung

2017-01-01

We document weak garden paths after intransitive verbs, modulated by intransitivity type, in the treatment of DP[subscript 1] V[subscript intransitive] DP[subscript 2] V[subscript 2] sequences as in "As the journalist arrived the editor postponed the meeting" in first language (L1) and second language (L2) sentence processing. In a…

Purification and characterization of the restriction endonuclease RsrI, an isoschizomer of EcoRI.

PubMed

Greene, P J; Ballard, B T; Stephenson, F; Kohr, W J; Rodriguez, H; Rosenberg, J M; Boyer, H W

1988-08-15

Rhodobacter sphaeroides strain 630 produces restriction enzyme RsrI which is an isoschizomer of EcoRI. We have purified this enzyme and initiated a comparison with the EcoRI endonuclease. The properties of RsrI are consistent with a reaction mechanism similar to that of EcoRI: the position of cleavage within the -GAATTC-site is identical, the MgCl2 optimum for the cleavage is identical, and the pH profile is similar. Methylation of the substrate sequence by the EcoRI methylase protects the site from cleavage by the RsrI endonuclease. RsrI cross-reacts strongly with anti-EcoRI serum indicating three-dimensional structural similarities. We have determined the sequence of 34 N terminal amino acids for RsrI and this sequence possesses significant similarity to the EcoRI N terminus.

Isolation and characterization of a novel acidic matrix protein hic22 from the nacreous layer of the freshwater mussel, Hyriopsis cumingii.

PubMed

Liu, X J; Jin, C; Wu, L M; Dong, S J; Zeng, S M; Li, J L

2016-07-29

Matrix proteins that either weakly acidic or unusually highly acidic have important roles in shell biomineralization. In this study, we have identified and characterized hic22, a weakly acidic matrix protein, from the nacreous layer of Hyriopsis cumingii. Total protein was extracted from the nacre using 5 M EDTA and hic22 was purified using a DEAE-sepharose column. The N-terminal amino acid sequence of hic22 was determined and the complete cDNA encoding hic22 was cloned and sequenced by rapid amplification of cDNA ends-polymerase chain reaction. Finally, the localization and distribution of hic22 was determined by in situ hybridization. Our results revealed that hic22 encodes a 22-kDa protein composed of 185 amino acids. Tissue expression analysis and in situ hybridization indicated that hic22 is expressed in the dorsal epithelial cells of the mantle pallial; moreover, significant expression levels of hic22 were observed after the early formation of the pearl sac (days 19-77), implying that hic22 may play an important role in biomineralization of the nacreous layer.

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

Molecular characterization of a novel Nucleorhabdovirus from black currant identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence similarities to several nucleorhabdoviruses were identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genomic sequence of this new nucleorhabdovirus is 14,432 nucleotides. Its genomic organization is typical of nucleorh...

rpoB Gene Sequencing for Identification of Corynebacterium Species

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2004-01-01

The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

Benchmark Dataset for Whole Genome Sequence Compression.

PubMed

C L, Biji; S Nair, Achuthsankar

2017-01-01

The research in DNA data compression lacks a standard dataset to test out compression tools specific to DNA. This paper argues that the current state of achievement in DNA compression is unable to be benchmarked in the absence of such scientifically compiled whole genome sequence dataset and proposes a benchmark dataset using multistage sampling procedure. Considering the genome sequence of organisms available in the National Centre for Biotechnology and Information (NCBI) as the universe, the proposed dataset selects 1,105 prokaryotes, 200 plasmids, 164 viruses, and 65 eukaryotes. This paper reports the results of using three established tools on the newly compiled dataset and show that their strength and weakness are evident only with a comparison based on the scientifically compiled benchmark dataset. The sample dataset and the respective links are available @ https://sourceforge.net/projects/benchmarkdnacompressiondataset/.

[Cloning and sequence analysis of 55 K protein of egg drop syndrome virus].

PubMed

Zhu, L; Jin, Q; Zeng, L

1999-06-30

For understanding the characteristics of genomic structure of egg drop syndrome virus(EDSV). Nucleic acid was extracted using routine method from weak virulent strain AA-2 of EDSV isolated from Chinese sick hens. Construction of the whole genomic library was by hydrolysis with Hind III, strand encoding 55 K gene locating in Hind III--A segment was sequenced and analyzed. The open reading frame has a length of 1,014 nt and codes a polypeptide of 337 amino acids with molecular weight of 38,200. Analysis of the amino acid sequence revealed a homology from 25.5%-32.4% to the 55 K protein of human adenovirus types 2, 12, 40, canine adenovirus and fowl adenoviruses of group 1, whereas to ovine adenovirus is 46.4%. The genomic structure of EDSV has some relationship with adenoviruses.

Impact of cultivation on characterisation of species composition of soil bacterial communities.

PubMed

McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

2001-03-01

The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

AlignMe—a membrane protein sequence alignment web server

PubMed Central

Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.

2014-01-01

We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425

Algorithm, applications and evaluation for protein comparison by Ramanujan Fourier transform.

PubMed

Zhao, Jian; Wang, Jiasong; Hua, Wei; Ouyang, Pingkai

2015-12-01

The amino acid sequence of a protein determines its chemical properties, chain conformation and biological functions. Protein sequence comparison is of great importance to identify similarities of protein structures and infer their functions. Many properties of a protein correspond to the low-frequency signals within the sequence. Low frequency modes in protein sequences are linked to the secondary structures, membrane protein types, and sub-cellular localizations of the proteins. In this paper, we present Ramanujan Fourier transform (RFT) with a fast algorithm to analyze the low-frequency signals of protein sequences. The RFT method is applied to similarity analysis of protein sequences with the Resonant Recognition Model (RRM). The results show that the proposed fast RFT method on protein comparison is more efficient than commonly used discrete Fourier transform (DFT). RFT can detect common frequencies as significant feature for specific protein families, and the RFT spectrum heat-map of protein sequences demonstrates the information conservation in the sequence comparison. The proposed method offers a new tool for pattern recognition, feature extraction and structural analysis on protein sequences. Copyright © 2015 Elsevier Ltd. All rights reserved.

Computationally predicted IgE epitopes of walnut allergens contribute to cross-reactivity with peanuts

USDA-ARS?s Scientific Manuscript database

Cross reactivity between peanuts and tree nuts implies that similar IgE epitopes are present in their proteins. To determine whether walnut sequences similar to known peanut IgE binding sequences, according to the property distance (PD) scale implemented in the Structural Database of Allergenic Prot...

Sequenced Integration and the Identification of a Problem-Solving Approach through a Learning Process

ERIC Educational Resources Information Center

Cormas, Peter C.

2016-01-01

Preservice teachers (N = 27) in two sections of a sequenced, methodological and process integrated mathematics/science course solved a levers problem with three similar learning processes and a problem-solving approach, and identified a problem-solving approach through one different learning process. Similar learning processes used included:…

Quasi-steady-state air plasma channel produced by a femtosecond laser pulse sequence

PubMed Central

Lu, Xin; Chen, Shi-You; Ma, Jing-Long; Hou, Lei; Liao, Guo-Qian; Wang, Jin-Guang; Han, Yu-Jing; Liu, Xiao-Long; Teng, Hao; Han, Hai-Nian; Li, Yu-Tong; Chen, Li-Ming; Wei, Zhi-Yi; Zhang, Jie

2015-01-01

A long air plasma channel can be formed by filamentation of intense femtosecond laser pulses. However, the lifetime of the plasma channel produced by a single femtosecond laser pulse is too short (only a few nanoseconds) for many potential applications based on the conductivity of the plasma channel. Therefore, prolonging the lifetime of the plasma channel is one of the key challenges in the research of femtosecond laser filamentation. In this study, a unique femtosecond laser source was developed to produce a high-quality femtosecond laser pulse sequence with an interval of 2.9 ns and a uniformly distributed single-pulse energy. The metre scale quasi-steady-state plasma channel with a 60–80 ns lifetime was formed by such pulse sequences in air. The simulation study for filamentation of dual femtosecond pulses indicated that the plasma channel left by the previous pulse was weakly affected the filamentation of the next pulse in sequence under our experimental conditions. PMID:26493279

Children's concepts of physical illness: a review and critique of the cognitive-developmental literature.

PubMed

Burbach, D J; Peterson, L

1986-01-01

Cognitive-developmental studies relevant to children's concepts of physical illness are reviewed and critiqued. Although numerous methodological weaknesses make firm conclusions difficult, most data appear to suggest that children's concepts of illness do evolve in a systematic and predictable sequence consistent with Piaget's theory of cognitive development. Methodological weaknesses identified include poor description of samples, assessment instruments, and procedures; lack of control over potential observer bias, expectancy effects, and other confounding variables; and minimal attention to reliability and validity issues. Increased methodological rigor and a further explication of the specific and unique ways in which children's concepts of illness develop over the course of cognitive development could substantially increase the value of these studies for professionals in pediatric health care settings.

Sirius PSB: a generic system for analysis of biological sequences.

PubMed

Koh, Chuan Hock; Lin, Sharene; Jedd, Gregory; Wong, Limsoon

2009-12-01

Computational tools are essential components of modern biological research. For example, BLAST searches can be used to identify related proteins based on sequence homology, or when a new genome is sequenced, prediction models can be used to annotate functional sites such as transcription start sites, translation initiation sites and polyadenylation sites and to predict protein localization. Here we present Sirius Prediction Systems Builder (PSB), a new computational tool for sequence analysis, classification and searching. Sirius PSB has four main operations: (1) Building a classifier, (2) Deploying a classifier, (3) Search for proteins similar to query proteins, (4) Preliminary and post-prediction analysis. Sirius PSB supports all these operations via a simple and interactive graphical user interface. Besides being a convenient tool, Sirius PSB has also introduced two novelties in sequence analysis. Firstly, genetic algorithm is used to identify interesting features in the feature space. Secondly, instead of the conventional method of searching for similar proteins via sequence similarity, we introduced searching via features' similarity. To demonstrate the capabilities of Sirius PSB, we have built two prediction models - one for the recognition of Arabidopsis polyadenylation sites and another for the subcellular localization of proteins. Both systems are competitive against current state-of-the-art models based on evaluation of public datasets. More notably, the time and effort required to build each model is greatly reduced with the assistance of Sirius PSB. Furthermore, we show that under certain conditions when BLAST is unable to find related proteins, Sirius PSB can identify functionally related proteins based on their biophysical similarities. Sirius PSB and its related supplements are available at: http://compbio.ddns.comp.nus.edu.sg/~sirius.

RNA sequencing confirms similarities between PPI-responsive oesophageal eosinophilia and eosinophilic oesophagitis.

PubMed

Peterson, K A; Yoshigi, M; Hazel, M W; Delker, D A; Lin, E; Krishnamurthy, C; Consiglio, N; Robson, J; Yandell, M; Clayton, F

2018-06-04

Although current American guidelines distinguish proton pump inhibitor-responsive oesophageal eosinophilia (PPI-REE) from eosinophilic oesophagitis (EoE), these entities are broadly similar. While two microarray studies showed that they have similar transcriptomes, more extensive RNA sequencing studies have not been done previously. To determine whether RNA sequencing identifies genetic markers distinguishing PPI-REE from EoE. We retrospectively examined 13 PPI-REE and 14 EoE biopsies, matched for tissue eosinophil content, and 14 normal controls. Patients and controls were not PPI-treated at the time of biopsy. We did RNA sequencing on formalin-fixed, paraffin-embedded tissue, with differential expression confirmation by quantitative polymerase chain reaction (PCR). We validated the use of formalin-fixed, paraffin-embedded vs RNAlater-preserved tissue, and compared our formalin-fixed, paraffin-embedded EoE results to a prior EoE study. By RNA sequencing, no genes were differentially expressed between the EoE and PPI-REE groups at the false discovery rate (FDR) ≤0.01 level. Compared to normal controls, 1996 genes were differentially expressed in the PPI-REE group and 1306 genes in the EoE group. By less stringent criteria, only MAPK8IP2 was differentially expressed between PPI-REE and EoE (FDR = 0.029, 2.2-fold less in EoE than in PPI-REE), with similar results by PCR. KCNJ2, which was differentially expressed in a prior study, was similar in the EoE and PPI-REE groups by both RNA sequencing and real-time PCR. Eosinophilic oesophagitis and PPI-REE have comparable transcriptomes, confirming that they are part of the same disease continuum. © 2018 John Wiley & Sons Ltd.

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

CROSS-DISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Characteristics of alternating current hopping conductivity in DNA sequences

NASA Astrophysics Data System (ADS)

Ma, Song-Shan; Xu, Hui; Wang, Huan-You; Guo, Rui

2009-08-01

This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of øac(ω) ~ ω2 ln2(1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p >= 0.5, the conductivity increases with the increase of p.

Weak and strong coupling equilibration in nonabelian gauge theories

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keegan, Liam; Kurkela, Aleksi; Romatschke, Paul

2016-04-06

In this study, we present a direct comparison studying equilibration through kinetic theory at weak coupling and through holography at strong coupling in the same set-up. The set-up starts with a homogeneous thermal state, which then smoothly transitions through an out-of-equilibrium phase to an expanding system undergoing boost-invariant flow. This first apples-to-apples comparison of equilibration provides a benchmark for similar equilibration processes in heavy-ion collisions, where the equilibration mechanism is still under debate. We find that results at weak and strong coupling can be smoothly connected by simple, empirical power-laws for the viscosity, equilibration time and entropy production of themore » system.« less

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Comparative analysis of the feline immunoglobulin repertoire.

PubMed

Steiniger, Sebastian C J; Glanville, Jacob; Harris, Douglas W; Wilson, Thomas L; Ippolito, Gregory C; Dunham, Steven A

2017-03-01

Next-Generation Sequencing combined with bioinformatics is a powerful tool for analyzing the large number of DNA sequences present in the expressed antibody repertoire and these data sets can be used to advance a number of research areas including antibody discovery and engineering. The accurate measurement of the immune repertoire sequence composition, diversity and abundance is important for understanding the repertoire response in infections, vaccinations and cancer immunology and could also be useful for elucidating novel molecular targets. In this study 4 individual domestic cats (Felis catus) were subjected to antibody repertoire sequencing with total number of sequences generated 1079863 for VH for IgG, 1050824 VH for IgM, 569518 for VK and 450195 for VL. Our analysis suggests that a similar VDJ expression patterns exists across all cats. Similar to the canine repertoire, the feline repertoire is dominated by a single subgroup, namely VH3. The antibody paratope of felines showed similar amino acid variation when compared to human, mouse and canine counterparts. All animals show a similarly skewed VH CDR-H3 profile and, when compared to canine, human and mouse, distinct differences are observed. Our study represents the first attempt to characterize sequence diversity in the expressed feline antibody repertoire and this demonstrates the utility of using NGS to elucidate entire antibody repertoires from individual animals. These data provide significant insight into understanding the feline immune system function. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Sequence similarities and evolutionary relationships of microbial, plant and animal alpha-amylases.

PubMed

Janecek, S

1994-09-01

Amino acid sequence comparison of 37 alpha-amylases from microbial, plant and animal sources was performed to identify their mutual sequence similarities in addition to the five already described conserved regions. These sequence regions were examined from structure/function and evolutionary perspectives. An unrooted evolutionary tree of alpha-amylases was constructed on a subset of 55 residues from the alignment of sequence similarities along with conserved regions. The most important new information extracted from the tree was as follows: (a) the close evolutionary relationship of Alteromonas haloplanctis alpha-amylase (thermolabile enzyme from an antarctic psychrotroph) with the already known group of homologous alpha-amylases from streptomycetes, Thermomonospora curvata, insects and mammals, and (b) the remarkable 40.1% identity between starch-saccharifying Bacillus subtilis alpha-amylase and the enzyme from the ruminal bacterium Butyrivibrio fibrisolvens, an alpha-amylase with an unusually large polypeptide chain (943 residues in the mature enzyme). Due to a very high degree of similarity, the whole amino acid sequences of three groups of alpha-amylases, namely (a) fungi and yeasts, (b) plants, and (c) A. haloplanctis, streptomycetes, T. curvata, insects and mammals, were aligned independently and their unrooted distance trees were calculated using these alignments. Possible rooting of the trees was also discussed. Based on the knowledge of the location of the five disulfide bonds in the structure of pig pancreatic alpha-amylase, the possible disulfide bridges were established for each of these groups of homologous alpha-amylases.

Complete nucleotide sequence of the freshwater unicellular cyanobacterium Synechococcus elongatus PCC 6301 chromosome: gene content and organization.

PubMed

Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru

2007-01-01

The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).

Rhythm sensitivity in macaque monkeys

PubMed Central

Selezneva, Elena; Deike, Susann; Knyazeva, Stanislava; Scheich, Henning; Brechmann, André; Brosch, Michael

2013-01-01

This study provides evidence that monkeys are rhythm sensitive. We composed isochronous tone sequences consisting of repeating triplets of two short tones and one long tone which humans perceive as repeating triplets of two weak and one strong beat. This regular sequence was compared to an irregular sequence with the same number of randomly arranged short and long tones with no such beat structure. To search for indication of rhythm sensitivity we employed an oddball paradigm in which occasional duration deviants were introduced in the sequences. In a pilot study on humans we showed that subjects more easily detected these deviants when they occurred in a regular sequence. In the monkeys we searched for spontaneous behaviors the animals executed concomitant with the deviants. We found that monkeys more frequently exhibited changes of gaze and facial expressions to the deviants when they occurred in the regular sequence compared to the irregular sequence. In addition we recorded neuronal firing and local field potentials from 175 sites of the primary auditory cortex during sequence presentation. We found that both types of neuronal signals differentiated regular from irregular sequences. Both signals were stronger in regular sequences and occurred after the onset of the long tones, i.e., at the position of the strong beat. Local field potential responses were also significantly larger for the durational deviants in regular sequences, yet in a later time window. We speculate that these temporal pattern-selective mechanisms with a focus on strong beats and their deviants underlie the perception of rhythm in the chosen sequences. PMID:24046732

Querying Event Sequences by Exact Match or Similarity Search: Design and Empirical Evaluation

PubMed Central

Wongsuphasawat, Krist; Plaisant, Catherine; Taieb-Maimon, Meirav; Shneiderman, Ben

2012-01-01

Specifying event sequence queries is challenging even for skilled computer professionals familiar with SQL. Most graphical user interfaces for database search use an exact match approach, which is often effective, but near misses may also be of interest. We describe a new similarity search interface, in which users specify a query by simply placing events on a blank timeline and retrieve a similarity-ranked list of results. Behind this user interface is a new similarity measure for event sequences which the users can customize by four decision criteria, enabling them to adjust the impact of missing, extra, or swapped events or the impact of time shifts. We describe a use case with Electronic Health Records based on our ongoing collaboration with hospital physicians. A controlled experiment with 18 participants compared exact match and similarity search interfaces. We report on the advantages and disadvantages of each interface and suggest a hybrid interface combining the best of both. PMID:22379286

Complete mitochondrial genome sequence of Indian medium carp, Labeo gonius (Hamilton, 1822) and its comparison with other related carp species.

PubMed

Behera, Bijay Kumar; Kumari, Kavita; Baisvar, Vishwamitra Singh; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Jena, J K

2017-01-01

In the present study, the complete mitochondrial genome sequence of Labeo gonius is reported using PGM sequencer (Ion Torrent). The complete mitogenome of L. gonius is obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP) which is 16 614 bp in length. The mitogenome of L. gonius comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNA genes, and D-loop as control region along with gene order and organization, being similar to most of other fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of Labeo fimbriatus, as reported earlier. The phylogenetic analysis of Cypriniformes depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of L. gonius would be helpful in understanding the population genetics, phylogenetics, and evolution of Indian Carps.

Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

PubMed

Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

2006-07-01

The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

Molecular evidence for piroplasms in wild Reeves' muntjac (Muntiacus reevesi) in China.

PubMed

Yang, Ji-fei; Li, You-quan; Liu, Zhi-jie; Liu, Jun-long; Guan, Gui-quan; Chen, Ze; Luo, Jian-xun; Wang, Xiao-long; Yin, Hong

2014-10-01

DNA from liver samples of 17 free-ranging wild Reeves' muntjac (Muntiacus reevesi) was used for PCR amplification of piropalsm 18S rRNA gene. Of 17 samples, 14 (82.4%) showed a specific PCR product which were cloned and sequenced. BLAST analysis of the sequences obtained showed similarities to Babesia sp., Theileria capreoli, Theileria uilenbergi and Theileria sp. BO302-SE. Phylogenetic analysis showed that the Babesia sp. detected in the present study was distantly separated from known Babesia species of wild and domestic animals. Six sequences showed 100% similarity to T. capreoli while five sequences were separated from all known Theileria species and constituted an independent clade with Theileria sp. BO302-SE derived from roe deer in Italy; two sequences were close to T. uilenbergi with 97% similarity. This is the first description of hemoparasite infection in free-ranging wild Reeves' muntjac in China. Our results indicate that wild Reeves' muntjac may play an important reservoir role for hemoparasites. Crown Copyright © 2014. Published by Elsevier Ireland Ltd. All rights reserved.

What is a melody? On the relationship between pitch and brightness of timbre

PubMed Central

Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel

2014-01-01

Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners’ task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities. PMID:24478638

Foreshock Patterns Preceding Great Earthquakes in the Subduction Zone of Chile

NASA Astrophysics Data System (ADS)

Papadopoulos, G. A.; Minadakis, G.

2016-10-01

Foreshock activity is considered as one of the most promising precursory changes for the main shock prediction in the short term. Averaging over several foreshock sequences has shown that foreshocks are characterized by distinct 3D patterns: their epicenters move towards the main shock epicenter, event count accelerates, and b-value drops. However, these space-time-size patterns were verified so far only in a very few individual cases mainly due to inadequate seismicity catalogue data. We have investigated 3D foreshock patterns before the M w 8.8 Maule in 27 February 2010, M w 8.1 Iquique in 1 April 2014, and M w 8.4 Illapel in 16 September 2015 great earthquakes in the Chile subduction zone. To avoid biased results, no a priori spatiotemporal definitions of foreshocks were inserted. The procedure was based on pattern recognition from statistically significant seismicity changes in the three domains. The pattern recognition in one domain was independent of the pattern recognition in another domain. We found and verified with two independent catalogue data sets (CSN, IPOC) that within a critical area of ca. 65 km from the main shock epicenter, the 2014 event was preceded by distinct foreshock 3D patterns. A nearly weak foreshock stage (20 January-14 March 2014) was followed by a main-strong stage (15 March-1 April 2014) highly significant in all domains, although foreshock activity slightly decreased in about the last 5 days. Seismic moment release also accelerated in the last stage due to the occurrence of a cluster of very strong foreshock events. Foreshock activity very likely occurred in the hanging-wall fault domain on the South American Plate overriding Nazca Plate. The 2014 foreshock activity was quite similar to the one preceding the 6 Apr. 2009 L' Aquila (Italy) M w 6.3 earthquake associated with normal faulting. Using the 2014 earthquake as a reference event, we observed that similar foreshock 3D patterns preceded the 2010 and 2015 earthquakes within critical distances of about 170 and 50 km, respectively. However, the foreshock activities were only weak in both the cases likely because of poor catalogue completeness.

The complete CDS of the prion protein (PRNP) gene of African lion (Panthera leo).

PubMed

Maj, Andrzej; Spellman, Garth M; Sarver, Shane K

2008-04-01

We provide the complete PRNP CDS sequence for the African lion, which is different from the previously published sequence and more similar to other carnivore sequences. The newly obtained prion protein sequence differs from the domestic cat sequence at three amino acid positions and contains only four octapeptide repeats. We recommend that this sequence be used as the reference sequence for future studies of the PRNP gene for this species.

PaperBLAST: Text Mining Papers for Information about Homologs

DOE PAGES

Price, Morgan N.; Arkin, Adam P.

2017-08-15

Large-scale genome sequencing has identified millions of protein-coding genes whose function is unknown. Many of these proteins are similar to characterized proteins from other organisms, but much of this information is missing from annotation databases and is hidden in the scientific literature. To make this information accessible, PaperBLAST uses EuropePMC to search the full text of scientific articles for references to genes. PaperBLAST also takes advantage of curated resources (Swiss-Prot, GeneRIF, and EcoCyc) that link protein sequences to scientific articles. PaperBLAST’s database includes over 700,000 scientific articles that mention over 400,000 different proteins. Given a protein of interest, PaperBLAST quicklymore » finds similar proteins that are discussed in the literature and presents snippets of text from relevant articles or from the curators. With the recent explosion of genome sequencing data, there are now millions of uncharacterized proteins. If a scientist becomes interested in one of these proteins, it can be very difficult to find information as to its likely function. Often a protein whose sequence is similar, and which is likely to have a similar function, has been studied already, but this information is not available in any database. To help find articles about similar proteins, PaperBLAST searches the full text of scientific articles for protein identifiers or gene identifiers, and it links these articles to protein sequences. Then, given a protein of interest, it can quickly find similar proteins in its database by using standard software (BLAST), and it can show snippets of text from relevant papers. We hope that PaperBLAST will make it easier for biologists to predict proteins’ functions.« less

PaperBLAST: Text Mining Papers for Information about Homologs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Price, Morgan N.; Arkin, Adam P.

Large-scale genome sequencing has identified millions of protein-coding genes whose function is unknown. Many of these proteins are similar to characterized proteins from other organisms, but much of this information is missing from annotation databases and is hidden in the scientific literature. To make this information accessible, PaperBLAST uses EuropePMC to search the full text of scientific articles for references to genes. PaperBLAST also takes advantage of curated resources (Swiss-Prot, GeneRIF, and EcoCyc) that link protein sequences to scientific articles. PaperBLAST’s database includes over 700,000 scientific articles that mention over 400,000 different proteins. Given a protein of interest, PaperBLAST quicklymore » finds similar proteins that are discussed in the literature and presents snippets of text from relevant articles or from the curators. With the recent explosion of genome sequencing data, there are now millions of uncharacterized proteins. If a scientist becomes interested in one of these proteins, it can be very difficult to find information as to its likely function. Often a protein whose sequence is similar, and which is likely to have a similar function, has been studied already, but this information is not available in any database. To help find articles about similar proteins, PaperBLAST searches the full text of scientific articles for protein identifiers or gene identifiers, and it links these articles to protein sequences. Then, given a protein of interest, it can quickly find similar proteins in its database by using standard software (BLAST), and it can show snippets of text from relevant papers. We hope that PaperBLAST will make it easier for biologists to predict proteins’ functions.« less

PaperBLAST: Text Mining Papers for Information about Homologs

PubMed Central

Arkin, Adam P.

2017-01-01

ABSTRACT Large-scale genome sequencing has identified millions of protein-coding genes whose function is unknown. Many of these proteins are similar to characterized proteins from other organisms, but much of this information is missing from annotation databases and is hidden in the scientific literature. To make this information accessible, PaperBLAST uses EuropePMC to search the full text of scientific articles for references to genes. PaperBLAST also takes advantage of curated resources (Swiss-Prot, GeneRIF, and EcoCyc) that link protein sequences to scientific articles. PaperBLAST’s database includes over 700,000 scientific articles that mention over 400,000 different proteins. Given a protein of interest, PaperBLAST quickly finds similar proteins that are discussed in the literature and presents snippets of text from relevant articles or from the curators. PaperBLAST is available at http://papers.genomics.lbl.gov/. IMPORTANCE With the recent explosion of genome sequencing data, there are now millions of uncharacterized proteins. If a scientist becomes interested in one of these proteins, it can be very difficult to find information as to its likely function. Often a protein whose sequence is similar, and which is likely to have a similar function, has been studied already, but this information is not available in any database. To help find articles about similar proteins, PaperBLAST searches the full text of scientific articles for protein identifiers or gene identifiers, and it links these articles to protein sequences. Then, given a protein of interest, it can quickly find similar proteins in its database by using standard software (BLAST), and it can show snippets of text from relevant papers. We hope that PaperBLAST will make it easier for biologists to predict proteins’ functions. PMID:28845458