Sample records for weaker binding sites

  1. Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

    PubMed

    Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

    2012-10-31

    Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

  2. Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities Are Predicted for C-2 Analogues in the Colchicine Site

    PubMed Central

    2011-01-01

    3,5-Dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogues were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structure–activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design. PMID:22611477

  3. Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities are Predicted for C-2 Analogs in the Colchicine Site.

    PubMed

    Da, Chenxiao; Telang, Nakul; Barelli, Peter; Jia, Xin; Gupton, John T; Mooberry, Susan L; Kellogg, Glen E

    2012-01-12

    3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogs were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structural-activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design.

  4. DFT investigation of the interaction of gold nanoclusters with poly(amidoamine) PAMAM G0 dendrimer

    NASA Astrophysics Data System (ADS)

    Camarada, M. B.

    2016-06-01

    The interaction between PAMAM G0 and gold nanoclusters Aun (n = 2, 4, 6, and 8) was studied theoretically at DFT level. Different coordination sites were explored, including internal and superficial coordination. All stable complexes exhibited external interaction with the amine or carbonyl site, while the core site coordination was not favored. The more stable binding of Aun was registered with the terminal amine group, while the binding at the amide site was relatively weaker. The vertical first ionization potential, electron affinity, Fermi level, and the HOMO-LUMO gap of PAMAM and Aun-PAMAM G0 complexes were also analyzed.

  5. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  6. Size and molecular flexibility affect the binding of ellagitannins to bovine serum albumin.

    PubMed

    Dobreva, Marina A; Green, Rebecca J; Mueller-Harvey, Irene; Salminen, Juha-Pekka; Howlin, Brendan J; Frazier, Richard A

    2014-09-17

    Binding to bovine serum albumin of monomeric (vescalagin and pedunculagin) and dimeric ellagitannins (roburin A, oenothein B, and gemin A) was investigated by isothermal titration calorimetry and fluorescence spectroscopy, which indicated two types of binding sites. Stronger and more specific sites exhibited affinity constants, K1, of 10(4)-10(6) M(-1) and stoichiometries, n1, of 2-13 and dominated at low tannin concentrations. Weaker and less-specific binding sites had K2 constants of 10(3)-10(5) M(-1) and stoichiometries, n2, of 16-30 and dominated at higher tannin concentrations. Binding to stronger sites appeared to be dependent on tannin flexibility and the presence of free galloyl groups. Positive entropies for all but gemin A indicated that hydrophobic interactions dominated during complexation. This was supported by an exponential relationship between the affinity, K1, and the modeled hydrophobic accessible surface area and by a linear relationship between K1 and the Stern-Volmer quenching constant, K(SV).

  7. Bacillus thuringiensis Cry1A toxin-binding glycoconjugates present on the brush border membrane and in the peritrophic membrane of the Douglas-fir tussock moth are peritrophins

    Treesearch

    Algimantas P. Valaitis; John D. Podgwaite

    2013-01-01

    Bacillus thuringiensis (Bt) Cry1A toxin-binding sites in the Douglas fir tussock moth (DFTM) larval gut were localized using immunofluorescence microscopy. Cry1Aa, Cry1Ab and Cry1Ac all bound strongly to the DFTM peritrophic membrane (PM); weaker binding of the Cry1A toxins was observed along the apical brush border of the midgut epithelium....

  8. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  9. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  10. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed Central

    Brierley, I; Hoggett, J G

    1992-01-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. Images Fig. 1. Fig. 3. Fig. 4. PMID:1322129

  11. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  12. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  13. Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

    PubMed

    Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

    2015-05-19

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

  14. Molecular mechanism of the allosteric regulation of the αγ heterodimer of human NAD-dependent isocitrate dehydrogenase

    PubMed Central

    Ma, Tengfei; Peng, Yingjie; Huang, Wei; Ding, Jianping

    2017-01-01

    Human NAD-dependent isocitrate dehydrogenase catalyzes the decarboxylation of isocitrate (ICT) into α-ketoglutarate in the Krebs cycle. It exists as the α2βγ heterotetramer composed of the αβ and αγ heterodimers. Previously, we have demonstrated biochemically that the α2βγ heterotetramer and αγ heterodimer can be allosterically activated by citrate (CIT) and ADP. In this work, we report the crystal structures of the αγ heterodimer with the γ subunit bound without or with different activators. Structural analyses show that CIT, ADP and Mg2+ bind adjacent to each other at the allosteric site. The CIT binding induces conformational changes at the allosteric site, which are transmitted to the active site through the heterodimer interface, leading to stabilization of the ICT binding at the active site and thus activation of the enzyme. The ADP binding induces no further conformational changes but enhances the CIT binding through Mg2+-mediated interactions, yielding a synergistic activation effect. ICT can also bind to the CIT-binding subsite, which induces similar conformational changes but exhibits a weaker activation effect. The functional roles of the key residues are verified by mutagenesis, kinetic and structural studies. Our structural and functional data together reveal the molecular mechanism of the allosteric regulation of the αγ heterodimer. PMID:28098230

  15. Effects of glycation on meloxicam binding to human serum albumin

    NASA Astrophysics Data System (ADS)

    Trynda-Lemiesz, Lilianna; Wiglusz, Katarzyna

    2011-05-01

    The current study reports a binding of meloxicam a pharmacologically important new generation, non-steroidal anti-inflammatory drug to glycated form of the human serum albumin (HSA). The interaction of the meloxicam with nonglycated and glycated albumin has been studied at pH 7.4 in 0.05 M sodium phosphate buffer with 0.1 M NaCl, using fluorescence quenching technique and circular dichroism spectroscopy. Results of the present study have shown that the meloxicam could bind both forms of albumin glycated and nonglycated at a site, which was close to the tryptophan residues. Similarly, how for native albumin glycated form has had one high affinity site for the drug with association constants of the order of 10 5 M -1. The glycation process of the HSA significantly has affected the impact of the meloxicam on the binding of other ligands such as warfarin and bilirubin. The affinity of the glycated albumin for bilirubin as for native albumin has been reduced by meloxicam but observed effect was weaker by half (about 20%) compared with nonglycated albumin. In contrast to the native albumin meloxicam binding to glycated form of the protein only slightly affected the binding of warfarin. It seemed possible that the effects on warfarin binding might be entirely attributable to the Lys 199 modification which was in site I.

  16. Crystallographic Fragment Based Drug Discovery: Use of a Brominated Fragment Library Targeting HIV Protease

    PubMed Central

    Tiefenbrunn, Theresa; Forli, Stefano; Happer, Meaghan; Gonzalez, Ana; Tsai, Yingssu; Soltis, Michael; Elder, John H.; Olson, Arthur J.; Stout, C. David

    2013-01-01

    A library of 68 brominated fragments was screened against a new crystal form of inhibited HIV-1 protease in order to probe surface sites in soaking experiments. Often fragments are weak binders with partial occupancy, resulting in weak, difficult-to-fit electron density. The use of a brominated fragment library addresses this challenge, as bromine can be located unequivocally via anomalous scattering. Data collection was carried out in an automated fashion using AutoDrug at SSRL. Novel hits were identified in the known surface sites: 3-bromo-2,6-dimethoxybenzoic acid (Br6) in the flap site, and 1-bromo-2-naphthoic acid (Br27) in the exosite, expanding the chemistry of known fragments for development of higher affinity potential allosteric inhibitors. At the same time, mapping the binding sites of a number of weaker binding Br-fragments provides further insight into the nature of these surface pockets. PMID:23998903

  17. A novel methodological approach for the analysis of host-ligand interactions.

    PubMed

    Strat, Daniela; Missailidis, Sotiris; Drake, Alex F

    2007-02-02

    Traditional analysis of drug-binding data relies upon the Scatchard formalism. These methods rely upon the fitting of a linear equation providing intercept and gradient data that relate to physical properties, such as the binding constant, cooperativity coefficients and number of binding sites. However, the existence of different binding modes with different binding constants makes the implementation of these models difficult. This article describes a novel approach to the binding model of host-ligand interactions by using a derived analytical function describing the observed signal. The benefit of this method is that physically significant parameters, that is, binding constants and number of binding sites, are automatically derived by the use of a minimisation routine. This methodology was utilised to analyse the interactions between a novel antitumour agent and DNA. An optical spectroscopy study confirms that the pentacyclic acridine derivative (DH208) binds to nucleic acids. Two binding modes can be identified: a stronger one that involves intercalation and a weaker one that involves oriented outer-sphere binding. In both cases the plane of the bound acridine ring is parallel to the nucleic acid bases, orthogonal to the phosphate backbone. Ultraviolet (UV) and circular dichroism (CD) data were fitted using the proposed model. The binding constants and the number of binding sites derived from the model remained consistent across the different techniques used. The different wavelengths at which the measurements were made maintained the coherence of the results.

  18. Histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and alters HagB-induced chemokine responses

    NASA Astrophysics Data System (ADS)

    Borgwardt, Derek S.; Martin, Aaron D.; van Hemert, Jonathan R.; Yang, Jianyi; Fischer, Carol L.; Recker, Erica N.; Nair, Prashant R.; Vidva, Robinson; Chandrashekaraiah, Shwetha; Progulske-Fox, Ann; Drake, David; Cavanaugh, Joseph E.; Vali, Shireen; Zhang, Yang; Brogden, Kim A.

    2014-01-01

    Histatins are human salivary gland peptides with anti-microbial and anti-inflammatory activities. In this study, we hypothesized that histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and attenuates HagB-induced chemokine responses in human myeloid dendritic cells. Histatin 5 bound to immobilized HagB in a surface plasmon resonance (SPR) spectroscopy-based biosensor system. SPR spectroscopy kinetic and equilibrium analyses, protein microarray studies, and I-TASSER structural modeling studies all demonstrated two histatin 5 binding sites on HagB. One site had a stronger affinity with a KD1 of 1.9 μM and one site had a weaker affinity with a KD2 of 60.0 μM. Binding has biological implications and predictive modeling studies and exposure of dendritic cells both demonstrated that 20.0 μM histatin 5 attenuated (p < 0.05) 0.02 μM HagB-induced CCL3/MIP-1α, CCL4/MIP-1β, and TNFα responses. Thus histatin 5 is capable of attenuating chemokine responses, which may help control oral inflammation.

  19. Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

    PubMed Central

    Chang, F. N.; Flaks, Joel G.

    1972-01-01

    The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236

  20. ADP Regulates SNF1, the Saccharomyces cerevisiae Homolog of AMP-Activated Protein Kinase

    PubMed Central

    Mayer, Faith V.; Heath, Richard; Underwood, Elizabeth; Sanders, Matthew J.; Carmena, David; McCartney, Rhonda R.; Leiper, Fiona C.; Xiao, Bing; Jing, Chun; Walker, Philip A.; Haire, Lesley F.; Ogrodowicz, Roksana; Martin, Stephen R.; Schmidt, Martin C.; Gamblin, Steven J.; Carling, David

    2011-01-01

    Summary The SNF1 protein kinase complex plays an essential role in regulating gene expression in response to the level of extracellular glucose in budding yeast. SNF1 shares structural and functional similarities with mammalian AMP-activated protein kinase. Both kinases are activated by phosphorylation on a threonine residue within the activation loop segment of the catalytic subunit. Here we show that ADP is the long-sought metabolite that activates SNF1 in response to glucose limitation by protecting the enzyme against dephosphorylation by Glc7, its physiologically relevant protein phosphatase. We also show that the regulatory subunit of SNF1 has two ADP binding sites. The tighter site binds AMP, ADP, and ATP competitively with NADH, whereas the weaker site does not bind NADH, but is responsible for mediating the protective effect of ADP on dephosphorylation. Mutagenesis experiments suggest that the general mechanism by which ADP protects against dephosphorylation is strongly conserved between SNF1 and AMPK. PMID:22019086

  1. Ligand deconstruction: Why some fragment binding positions are conserved and others are not

    PubMed Central

    Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

    2015-01-01

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

  2. Dynamic Nuclear Polarization Study of Inhibitor Binding to the M218–60 Proton Transporter from Influenza A

    PubMed Central

    Andreas, Loren B.; Barnes, Alexander B.; Corzilius, Björn; Chou, James J.; Miller, Eric A.; Caporini, Marc; Rosay, Melanie; Griffin, Robert G

    2013-01-01

    We demonstrate the use of dynamic nuclear polarization (DNP) to elucidate ligand binding to a membrane protein using dipolar recoupling magic angle spinning (MAS) NMR. In particular, we detect drug binding in the proton transporter M218–60 from influenza A using recoupling experiments at room temperature and with cryogenic DNP. The results indicate that the pore binding site of rimantadine is correlated with previously reported widespread chemical shift changes, suggesting functional binding in the pore. Futhermore, the 15N labeled ammonium of rimantadine was observed near A30 13Cβ and G34 13Cα suggesting a possible hydrogen bond to A30 Carbonyl. Cryogenic DNP was required to observe the weaker external binding site(s) in a ZF-TEDOR spectrum. This approach is generally applicable, particularly for weakly bound ligands, in which case the application of MAS NMR dipolar recoupling requires the low temperatures to quench dynamic exchange processes. For the fully protonated samples investigated, we observed DNP signal enhancements of ~10 at 400 MHz using only 4–6 mM of the polarizing agent TOTAPOL. At 600 MHz and with DNP, we measured a distance between the drug and the protein to a precision of 0.2 Å. PMID:23480101

  3. Structure-based affinity maturation of a chimeric anti-ricin antibody C4C13.

    PubMed

    Luo, Longlong; Luo, Qun; Guo, Leiming; Lv, Ming; Lin, Zhou; Geng, Jing; Li, Xinying; Li, Yan; Shen, Beifen; Qiao, Chunxia; Feng, Jiannan

    2014-01-01

    Ricin is a highly lethal toxin. Anti-ricin chimeric monoclonal antibody (mAb) C4C13 was prepared in our lab; however, its binding affinity was much weaker than that of the parent antibody 4C13. In this study, based on the computer-guided homology modeling and conformational optimization methods, the 3-D structure of C4C13 variable regions Fv was constructed and optimized. Using molecular docking and dynamics simulation methods, the 3-D complex structure of ricin and C4C13 Fv was obtained. Considering the orientation property, surface electrostatic distribution, residues chemical and physical character and intermolecular hydrogen bond, the binding mode and key residues were predicted. According to C4C13 Fv fragment and ricin complementary binding surface, electrostatic attraction periphery and van der Waals interaction interface, three mutants (i.e., M1 (N(H102)F, W(H103)Y); M2 (W(H103)Y) and M3 (R(L90)G)) were designed, in which M1 and M2 were predicted to possess higher antigen-binding activity than C4C13, while M3 was weaker. The relative affinity assays by ELISA showed that M1 and M2 mutations had higher affinity (9.6 and 18.3 nmol/L) than C4C13 (130 nmol/L) and M3 had weaker affinity (234.5 nmol/L) than C4C13. The results showed that the modeling complex structure of the antigen (ricin) and antibody (C4C13) is reasonable. Our work offered affinity maturated antibodies by site mutations, which were beneficial for valuable anti-ricin antibody design and preparation in future.

  4. Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

    PubMed

    Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

    2010-01-01

    The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

  5. ITC-derived binding affinity may be biased due to titrant (nano)-aggregation. Binding of halogenated benzotriazoles to the catalytic domain of human protein kinase CK2

    PubMed Central

    Winiewska, Maria; Bugajska, Ewa

    2017-01-01

    The binding of four bromobenzotriazoles to the catalytic subunit of human protein kinase CK2 was assessed by two complementary methods: Microscale Thermophoresis (MST) and Isothermal Titration Calorimetry (ITC). New algorithm proposed for the global analysis of MST pseudo-titration data enabled reliable determination of binding affinities for two distinct sites, a relatively strong one with the Kd of the order of 100 nM and a substantially weaker one (Kd > 1 μM). The affinities for the strong binding site determined for the same protein-ligand systems using ITC were in most cases approximately 10-fold underestimated. The discrepancy was assigned directly to the kinetics of ligand nano-aggregates decay occurring upon injection of the concentrated ligand solution to the protein sample. The binding affinities determined in the reverse ITC experiment, in which ligands were titrated with a concentrated protein solution, agreed with the MST-derived data. Our analysis suggests that some ITC-derived Kd values, routinely reported together with PDB structures of protein-ligand complexes, may be biased due to the uncontrolled ligand (nano)-aggregation, which may occur even substantially below the solubility limit. PMID:28273138

  6. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  7. Effect of enzymatic deamidation of soy protein by protein-glutaminase on the flavor-binding properties of the protein under aqueous conditions.

    PubMed

    Suppavorasatit, Inthawoot; Cadwallader, Keith R

    2012-08-15

    The effect of the enzymatic deamidation by protein-glutaminase (PG) on flavor-binding properties of soy protein isolate (SPI) under aqueous conditions was evaluated by a modified equilibrium dialysis (ultrafiltration) technique. Binding parameters, such as number of binding sites (n) and binding constants (K), were derived from Klotz plots. The partial deamidation of SPI by PG (43.7% degree of deamidation) decreased overall flavor-binding affinity (nK) at 25 °C for both vanillin and maltol by approximately 9- and 4-fold, respectively. The thermodynamic parameters of binding indicated that the flavor-protein interactions were spontaneous (negative ΔG°) and that the driving force of the interactions shifted from entropy to enthalpy driven as a result of deamidation. Deamidation of soy protein caused a change in the mechanism of binding from hydrophobic interactions or covalent bonding (Schiff base formation) to weaker van der Waals forces or hydrogen bonding.

  8. Crystallographic fragment-based drug discovery: use of a brominated fragment library targeting HIV protease.

    PubMed

    Tiefenbrunn, Theresa; Forli, Stefano; Happer, Meaghan; Gonzalez, Ana; Tsai, Yingssu; Soltis, Michael; Elder, John H; Olson, Arthur J; Stout, Charles D

    2014-02-01

    A library of 68 brominated fragments was screened against a new crystal form of inhibited HIV-1 protease in order to probe surface sites in soaking experiments. Often, fragments are weak binders with partial occupancy, resulting in weak, difficult-to-fit electron density. The use of a brominated fragment library addresses this challenge, as bromine can be located unequivocally via anomalous scattering. Data collection was carried out in an automated fashion using AutoDrug at SSRL. Novel hits were identified in the known surface sites: 3-bromo-2,6-dimethoxybenzoic acid (Br6) in the flap site and 1-bromo-2-naphthoic acid (Br27) in the exosite, expanding the chemistry of known fragments for development of higher affinity potential allosteric inhibitors. At the same time, mapping the binding sites of a number of weaker binding Br-fragments provides further insight into the nature of these surface pockets. © 2013 John Wiley & Sons A/S.

  9. Effects of nano red elemental selenium on sodium currents in rat dorsal root ganglion neurons.

    PubMed

    Yuan, Huijun; Lin, Jiarui; Lan, Tonghan

    2006-01-01

    Nano red elemental selenium (Nano-Se), was demonstrated to be useful in medical and scientific researches. Here, we investigated the effects of Nano-Se on sodium currents on rat dorsal root ganglion neurons (DRG), using the whole-cell patch clamp method. Nano-Se reversibly decrease the I(Na)(TTX-S) in a concentration-dependent, time-dependent and open-channel block manners without affecting I(Na)(TTX-R). It shifted the steady-state activation and inactivation curves for I(Na) to more negative potentials. In the research of recovery from inactivation, the recovery time constant is longer in the present of Nano-Se. Nano-Se had a weaker inhibitory effect on I(Na), compared with marked decrease caused by selenite which indicated that Nano-Se is less neurotoxic than selenite in short-term/large dose treatments and had similar bio availability to sodium selenite. The results of interaction between the effects of Nano-Se and selenite on sodium currents indicated a negative allosteric interaction between the selenite binding site and the Nano-Se binding site or that they have the same competitive binding site.

  10. microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

    PubMed

    Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

    2017-02-01

    We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

  11. CC-1065 functional analogues possessing different electron-withdrawing substituents and leaving groups: synthesis, kinetics, and sequence specificity of reaction with DNA and biological evaluation.

    PubMed

    Wang, Y; Gupta, R; Huang, L; Lown, J W

    1993-12-24

    Antitumor agent CC-1065 functional analogues possessing different electron-withdrawing substituents and leaving groups have been synthesized. The extent and the relative rates of DNA cleavage following alkylation by these CPI structures and thermal treatment were determined independently by an ethidium binding assay and by agarose gel electrophoresis experiments. The anticipated preferential covalent binding to adenine sites within the minor groove was confirmed by sequencing determination of selected agents on high-resolution gels. Certain of the synthetic agents, unlike CC-1065, also bind covalently to G sites with weaker intensity. The cytotoxicities of these compounds were also determined against KB cells in vitro. Compounds bearing a bromo or nitro group in the benzene ring and a methylsulfonyl as a leaving group are 10 and 5 times more potent than their unsubstituted counterparts, respectively. Compounds bearing a methylsulfonyl as a leaving group are more potent than those bearing a chlorine.

  12. Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

    PubMed Central

    Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

    2012-01-01

    One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

  13. Structural Studies of a Rationally Selected Multi-Drug Resistant HIV-1 Protease Reveal Synergistic Effect of Distal Mutations on Flap Dynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agniswamy, Johnson; Louis, John M.; Roche, Julien

    We report structural analysis of HIV protease variant PRS17 which was rationally selected by machine learning to represent wide classes of highly drug-resistant variants. Crystal structures were solved of PRS17 in the inhibitor-free form and in complex with antiviral inhibitor, darunavir. Despite its 17 mutations, PRS17 has only one mutation (V82S) in the inhibitor/substrate binding cavity, yet exhibits high resistance to all clinical inhibitors. PRS17 has none of the major mutations (I47V, I50V, I54ML, L76V and I84V) associated with darunavir resistance, but has 10,000-fold weaker binding affinity relative to the wild type PR. Comparable binding affinity of 8000-fold weaker thanmore » PR is seen for drug resistant mutant PR20, which bears 3 mutations associated with major resistance to darunavir (I47V, I54L and I84V). Inhibitor-free PRS17 shows an open flap conformation with a curled tip correlating with G48V flap mutation. NMR studies on inactive PRS17 D25N unambiguously confirm that the flaps adopt mainly an open conformation in solution very similar to that in the inhibitor-free crystal structure. In PRS17, the hinge loop cluster of mutations, E35D, M36I and S37D, contributes to the altered flap dynamics by a mechanism similar to that of PR20. An additional K20R mutation anchors an altered conformation of the hinge loop. Flap mutations M46L and G48V in PRS17/DRV complex alter the Phe53 conformation by steric hindrance between the side chains. Unlike the L10F mutation in PR20, L10I in PRS17 does not break the inter-subunit ion pair or diminish the dimer stability, consistent with a very low dimer dissociation constant comparable to that of wild type PR. Distal mutations A71V, L90M and I93L propagate alterations to the catalytic site of PRS17. PRS17 exhibits a molecular mechanism whereby mutations act synergistically to alter the flap dynamics resulting in significantly weaker binding yet maintaining active site contacts with darunavir.« less

  14. Interactions of tea tannins and condensed tannins with proteins.

    PubMed

    Frazier, Richard A; Deaville, Eddie R; Green, Rebecca J; Stringano, Elisabetta; Willoughby, Ian; Plant, John; Mueller-Harvey, Irene

    2010-01-20

    Binding parameters for the interactions of four types of tannins: tea catechins, grape seed proanthocyanidins, mimosa 5-deoxy proanthocyanidins, and sorghum procyanidins (mDP=17), with gelatin and bovine serum albumin (BSA) have been determined from isothermal titration calorimetry data. Equilibrium binding constants determined for the interaction with gelatin were in the range 10(4) to 10(6) M(-1) and in the order: sorghum procyanidins > grape seed proanthocyanidins > mimosa 5-deoxy proanthocyanidins > tea catechins. Interaction with BSA was generally weaker, with equilibrium binding constants of < or =10(3)M(-1) for grape seed proanthocyanidins, mimosa 5-deoxy proanthocyanidins and tea catechins, and 10(4)M(-1) for the sorghum procyanidins. In all cases the interactions with proteins were exothermic and involved multiple binding sites on the protein. The data are discussed in relation to the structures and the known nutritional effects of the condensed tannins.

  15. Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases*

    PubMed Central

    Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

    2015-01-01

    Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (PIntr) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a 14C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site −3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. PMID:26468285

  16. Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases.

    PubMed

    Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

    2015-11-27

    Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (P(Intr)) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a (14)C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site -3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Characterization of the catalytic and noncatalytic ADP binding sites of the F1-ATPase from the thermophilic bacterium, PS3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshida, M.; Allison, W.S.

    1986-05-05

    Two classes of ADP binding sites at 20 degrees C have been characterized in the F1-ATPase from the thermophilic bacterium, PS3 (TF1). One class is comprised of three sites which saturate with (/sup 3/H)ADP in less than 10 s with a Kd of 10 microM which, once filled, exchange rapidly with medium ADP. The binding of ADP to these sites is dependent on Mg2+. (/sup 3/H)ADP bound to these sites is removed by repeated gel filtrations on centrifuge columns equilibrated with ADP free medium. The other class is comprised of a single site which saturates with (/sup 3/H)ADP in 30more » min with a Kd of 30 microM. (/sup 3/H)ADP bound to this site does not exchange with medium ADP nor does it dissociate on gel filtration through centrifuge columns equilibrated with ADP free medium. Binding of (/sup 3/H)ADP to this site is weaker in the presence of Mg2+ where the Kd for ADP is about 100 microM. (/sup 3/H)ADP dissociated from this site when ATP plus Mg2+ was added to the complex while it remained bound in the presence of ATP alone or in the presence of ADP, Pi, or ADP plus Pi with or without added Mg2+. Significant amounts of ADP in the 1:1 TF1.ADP complex were converted to ATP in the presence of Pi, Mg2+, and 50% dimethyl sulfoxide. Enzyme-bound ATP synthesis was abolished by chemical modification of a specific glutamic acid residue by dicyclohexylcarbodiimide, but not by modification of a specific tyrosine residue with 7-chloro-4-nitrobenzofurazan. Difference circular dichroism spectra revealed that the three Mg2+ -dependent, high affinity ADP binding sites that were not stable to gel filtration were on the alpha subunits and that the single ADP binding site that was stable to gel filtration was on one of the three beta subunits.« less

  18. Structural aspects of inotropic bipyridine binding. Crystal structure determination to 1.9 A of the human serum transthyretin-milrinone complex.

    PubMed

    Wojtczak, A; Luft, J R; Cody, V

    1993-03-25

    The crystal structure of human transthyretin (TTR) complexed with milrinone (2-methyl-5-cyano-3,4'-bipyridin-6(1H)-one), a positive inotropic cardiac agent, has been refined to R = 17.4% for 8-1.9-A resolution data. This report provides the first detailed description of protein interactions for an inotropic bipyridine agent which is an effective thyroid hormone binding competitor to transthyretin. Milrinone is bound along the 2-fold axis in the binding site with its substituted pyridone ring located deep within the channel of the two identical binding domains of the TTR tetramer. In this orientation the 5-cyano group occupies the same site as the 3'-iodine in the TTR complex with 3,3'-diiodothyronine (Wojtczak, A., Luft, J., and Cody, V. (1992) J. Biol. Chem. 267, 353-357), which is 3.5 A deeper in the channel than thyroxine (Blake, C. C. F., and Oately, S. J., (1977) Nature 268, 115-120). These structural results confirm computer modeling studies of milrinone structural homology with thyroxine and its TTR binding interactions and explain the effectiveness of milrinone competition for thyroxine binding to TTR. To understand the weaker binding affinity of the parent inotropic drug, amrinone (5-amino-3,4'-bipyridin-6(1H)-one), modeling studies of its TTR binding were carried out which indicate that the 5-amino group cannot participate in strong interactions with TTR and the lack of the 2-methyl further weakens amrinone binding.

  19. A two-metal ion mechanism operates in the hammerhead ribozyme-mediated cleavage of an RNA substrate

    PubMed Central

    Lott, William B.; Pontius, Brian W.; von Hippel, Peter H.

    1998-01-01

    Evidence for a two-metal ion mechanism for cleavage of the HH16 hammerhead ribozyme is provided by monitoring the rate of cleavage of the RNA substrate as a function of La3+ concentration in the presence of a constant concentration of Mg2+. We show that a bell-shaped curve of cleavage activation is obtained as La3+ is added in micromolar concentrations in the presence of 8 mM Mg2+, with a maximal rate of cleavage being attained in the presence of 3 μM La3+. These results show that two-metal ion binding sites on the ribozyme regulate the rate of the cleavage reaction and, on the basis of earlier estimates of the Kd values for Mg2+ of 3.5 mM and >50 mM, that these sites bind La3+ with estimated Kd values of 0.9 and >37.5 μM, respectively. Furthermore, given the very different effects of these metal ions at the two binding sites, with displacement of Mg2+ by La3+ at the stronger (relative to Mg2+) binding site activating catalysis and displacement of Mg2+ by La3+ at the weaker (relative to Mg2+) (relative to Mg2+) binding site inhibiting catalysis, we show that the metal ions at these two sites play very different roles. We argue that the metal ion at binding site 1 coordinates the attacking 2′-oxygen species in the reaction and lowers the pKa of the attached proton, thereby increasing the concentration of the attacking alkoxide nucleophile in an equilibrium process. In contrast, the role of the metal ion at binding site 2 is to catalyze the reaction by absorbing the negative charge that accumulates at the leaving 5′-oxygen in the transition state. We suggest structural reasons why the Mg2+–La3+ ion combination is particularly suited to demonstrating these different roles of the two-metal ions in the ribozyme cleavage reaction. PMID:9435228

  20. Comparison of S-adsorption on (111) and (100) facets of Cu nanoclusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boschen, Jeffery S.; Lee, Jiyoung; Windus, Theresa L.

    2016-10-31

    In order to gain insight into the nature of chemical bonding of sulfur atoms on coinage metal surfaces, we compare the adsorption energy and structural parameters for sulfur at four-fold hollow (4fh) sites on (100) facets and at three-fold hollow (3fh) sites on (111) facets of Cu nanoclusters. Consistent results are obtained from localized atomic orbital and plane-wave based density functional theory using the same functionals. PBE and its hybrid counterpart (PBE0 or HSE06) also give similar results. 4fh sites are preferred over 3fh sites with stronger bonding by ~0.6 eV for nanocluster sizes above ~280 atoms. However, for smallermore » sizes there are strong variations in the binding strength and the extent of the binding site preference. In addition, we show that suitable averaging over clusters of different sizes, or smearing the occupancy of orbitals, provide useful strategies to aid assessment of the behavior in extended surface systems. From site-projected density of states analysis using the smearing technique, we show that S adsorbed on a 4fh site has similar bonding interactions with the substrate as that on a 3fh site, but with much weaker antibonding interactions.« less

  1. The role of ω-subunit of Escherichia coli RNA polymerase in stress response.

    PubMed

    Bhardwaj, Neerupma; Syal, Kirtimaan; Chatterji, Dipankar

    2018-05-01

    ppGpp, an alarmone for stringent response, plays an important role in the reprogramming of the transcription complex at the time of stress. In Escherichia coli, ppGpp mediates its action by binding to at least two different sites on RNA polymerase (RNAP). One of the sites to which ppGpp binds to RNAP is at the β'-ω interface; however, the underlying molecular mechanism and the physiological relevance of ppGpp binding to this site remain unclear. In this study, we have performed UV cross-linking experiments using 32 P azido-labeled ppGpp to probe its association with RNAP in the absence and presence of ω, and observed weaker binding of ppGpp to the RNAP without ω. Furthermore, we followed the binding kinetics of ppGpp to RNAP with and without ω by isothermal titration calorimetry and found it to be concurrent with the cross-linking results. Native ω is intrinsically disordered, and we have used a previously characterized structured mutant of ω, which affects the plasticity of the active site of RNAP. Results show that the flexibility conferred by the unstructured ω is a prerequisite for ppGpp binding to RNAP. We have analyzed the stress-associated phenotypes in an E. coli strain devoid of ω (∆rpoZ). ppGpp levels in ∆rpoZ strain were found to be similar to that of the wild-type strain. Interestingly, when the ∆rpoZ strain of E. coli was transferred after nutritional stress to an enriched media, the recovery of growth was compromised. We have identified a new phenotype of ∆rpoZ strain corresponding to defect in biofilm formation in minimal media. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  2. Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

    PubMed Central

    Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

    2009-01-01

    Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

  3. In-Silico Analysis of Amotosalen Hydrochloride Binding to CD-61 of Platelets.

    PubMed

    Chaudhary, Hammad Tufail

    2016-11-01

    To determine the docking of Amotosalen hydrochloride (AH) at CD-61 of platelets, and to suggest the cause of bleeding in AH treated platelets transfusion. Descriptive study. Medical College, Taif University, Taif, Saudi Arabia, from October 2014 to May 2015. The study was carried out in-silico. PDB (protein data bank) code of Tirofiban bound to CD-61 was 2vdm. CD-61 was docked with Tirofiban using online docking tools, i.e. Patchdock and Firedock. Then, Amotosalen hydrochloride and CD-61 were also docked. Best docking poses to active sites of 2vdm were found. Ligplot of interactions of ligands and CD-61 were obtained. Then comparison of hydrogen bonds, hydrogen bond lengths, and hydrophobic bonds of 2vdm molecule and best poses of docking results were done. Patchdock and Firedock results of best poses were also analysed using SPSS version 16. More amino acids were involved in hydrogen and hydrophobic bonds in Patchdock and Firedock docking of Amotosalen hydrochloride with CD-61 than Patchdock and Firedock docking of CD-61 with Tirofiban. The binding energy was more in latter than former. Amotosalen hydrochloride binds to the active site of CD-61 with weaker binding force. Haemorrhage seen in Amotosalen hydrochloride-treated platelets might be due to binding of Amotosalen hydrochloride to CD-61.

  4. CD and MCD spectroscopic studies of the two Dps miniferritin proteins from Bacillus anthracis: role of O2 and H2O2 substrates in reactivity of the diiron catalytic centers.

    PubMed

    Schwartz, Jennifer K; Liu, Xiaofeng S; Tosha, Takehiko; Diebold, Adrienne; Theil, Elizabeth C; Solomon, Edward I

    2010-12-14

    DNA protection during starvation (Dps) proteins are miniferritins found in bacteria and archaea that provide protection from uncontrolled Fe(II)/O radical chemistry; thus the catalytic sites are targets for antibiotics against pathogens, such as anthrax. Ferritin protein cages synthesize ferric oxymineral from Fe(II) and O(2)/H(2)O(2), which accumulates in the large central cavity; for Dps, H(2)O(2) is the more common Fe(II) oxidant contrasting with eukaryotic maxiferritins that often prefer dioxygen. To better understand the differences in the catalytic sites of maxi- versus miniferritins, we used a combination of NIR circular dichroism (CD), magnetic circular dichroism (MCD), and variable-temperature, variable-field MCD (VTVH MCD) to study Fe(II) binding to the catalytic sites of the two Bacillus anthracis miniferritins: one in which two Fe(II) react with O(2) exclusively (Dps1) and a second in which both O(2) or H(2)O(2) can react with two Fe(II) (Dps2). Both result in the formation of iron oxybiomineral. The data show a single 5- or 6-coordinate Fe(II) in the absence of oxidant; Fe(II) binding to Dps2 is 30× more stable than Dps1; and the lower limit of K(D) for binding a second Fe(II), in the absence of oxidant, is 2-3 orders of magnitude weaker than for the binding of the single Fe(II). The data fit an equilibrium model where binding of oxidant facilitates formation of the catalytic site, in sharp contrast to eukaryotic M-ferritins where the binuclear Fe(II) centers are preformed before binding of O(2). The two different binding sequences illustrate the mechanistic range possible for catalytic sites of the family of ferritins.

  5. Zinc Bioavailability from Phytate-Rich Foods and Zinc Supplements. Modeling the Effects of Food Components with Oxygen, Nitrogen, and Sulfur Donor Ligands.

    PubMed

    Tang, Ning; Skibsted, Leif H

    2017-10-04

    Aqueous solubility of zinc phytate (K sp = (2.6 ± 0.2) × 10 -47 mol 7 /L 7 ), essential for zinc bioavailability from plant foods, was found to decrease with increasing temperature corresponding to ΔH dis of -301 ± 22 kJ/mol and ΔS dis of -1901 ± 72 J/(mol K). Binding of zinc to phytate was found to be exothermic for the stronger binding site and endothermic for the weaker binding site. The solubility of the slightly soluble zinc citrate and insoluble zinc phytate was found to be considerably enhanced by the food components with oxygen donor, nitrogen donor, and sulfur donor ligands. The driving force for the enhanced solubility is mainly due to the complex formation between zinc and the investigated food components rather than ligand exchange and ternary complex formation as revealed by quantum mechanical calculations and isothermal titration calorimetry. Histidine and citrate are promising ligands for improving zinc absorption from phytate-rich foods.

  6. Dynamics of 1α,25-dihydroxyvitamin D3-dependent chromatin accessibility of early vitamin D receptor target genes.

    PubMed

    Seuter, Sabine; Pehkonen, Petri; Heikkinen, Sami; Carlberg, Carsten

    2013-12-01

    The signaling cascade of the transcription factor vitamin D receptor (VDR) is triggered by its specific ligand 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3). In this study we demonstrate that in THP-1 human monocytic leukemia cells 87.4% of the 1034 most prominent genome-wide VDR binding sites co-localize with loci of open chromatin. At 165 of them 1α,25(OH)2D3 strongly increases chromatin accessibility and has at further 217 sites weaker effects. Interestingly, VDR binding sites in 1α,25(OH)2D3-responsive chromatin regions are far more often composed of direct repeats with 3 intervening nucleotides (DR3s) than those in ligand insensitive regions. DR3-containing VDR sites are enriched in the neighborhood of genes that are involved in controling cellular growth, while non-DR3 VDR binding is often found close to genes related to immunity. At the example of six early VDR target genes we show that the slope of their 1α,25(OH)2D3-induced transcription correlates with the basal chromatin accessibility of their major VDR binding regions. However, the chromatin loci controlling these genes are indistinguishable in their VDR association kinetics. Taken together, ligand responsive chromatin loci represent dynamically regulated contact points of VDR with the genome, from where it controls early 1α,25(OH)2D3 target genes. © 2013.

  7. The properties of small Ag clusters bound to DNA bases.

    PubMed

    Soto-Verdugo, Víctor; Metiu, Horia; Gwinn, Elisabeth

    2010-05-21

    We study the binding of neutral silver clusters, Ag(n) (n=1-6), to the DNA bases adenine (A), cytosine (C), guanine (G), and thymine (T) and the absorption spectra of the silver cluster-base complexes. Using density functional theory (DFT), we find that the clusters prefer to bind to the doubly bonded ring nitrogens and that binding to T is generally much weaker than to C, G, and A. Ag(3) and Ag(4) make the stronger bonds. Bader charge analysis indicates a mild electron transfer from the base to the clusters for all bases, except T. The donor bases (C, G, and A) bind to the sites on the cluster where the lowest unoccupied molecular orbital has a pronounced protrusion. The site where cluster binds to the base is controlled by the shape of the higher occupied states of the base. Time-dependent DFT calculations show that different base-cluster isomers may have very different absorption spectra. In particular, we find new excitations in base-cluster molecules, at energies well below those of the isolated components, and with strengths that depend strongly on the orientations of planar clusters with respect to the base planes. Our results suggest that geometric constraints on binding, imposed by designed DNA structures, may be a feasible route to engineering the selection of specific cluster-base assemblies.

  8. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    PubMed Central

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  9. Structural and biochemical characterization of the inhibitor complexes of XMRV protease

    PubMed Central

    Li, Mi; Gustchina, Alla; Matúz, Krisztina; Tözsér, Jozsef; Namwong, Sirilak; Goldfarb, Nathan E.; Dunn, Ben M.; Wlodawer, Alexander

    2012-01-01

    Summary Interactions between the protease (PR) encoded by the xenotropic murine leukemia virus-related virus (XMRV) and a number of potential inhibitors have been investigated by biochemical and structural techniques. It was observed that several inhibitors used clinically against HIV PR exhibit nanomolar or even subnanomolar values of Ki, depending on exact experimental conditions. TL-3, a universal inhibitor of retroviral proteases, as well as some inhibitors originally shown to inhibit plasmepsins were also quite potent, whereas inhibition by pepstatin A was considerably weaker. Crystal structures of the complexes of XMRV PR with TL-3, amprenavir, and pepstatin A were solved at high resolution and compared to the structures of these inhibitors complexed with other retropepsins. Whereas TL-3 and amprenavir bind in a predictable manner spanning the substrate-binding site of the enzyme, two molecules of pepstatin A bind simultaneously in an unprecedented manner, leaving the catalytic water molecule in place. PMID:21951660

  10. Epithelial chloride channel. Development of inhibitory ligands

    PubMed Central

    1987-01-01

    Chloride channels are present in the majority of epithelial cells, where they mediate absorption or secretion of NaCl. Although the absorptive and secretory channels are well characterized in terms of their electrophysiological behavior, there is a lack of pharmacological ligands that can aid us in further functional and eventually molecular characterization. To obtain such ligands, we prepared membrane vesicles from bovine kidney cortex and apical membrane vesicles from trachea and found that they contain a chloride transport process that is electrically conductive. This conductance was reduced by preincubating the vesicles in media containing ATP or ATP-gamma-S, but not beta- methylene ATP, which suggests that the membranes contain a kinase that can close the channels. We then screened compounds derived from three classes: indanyloxyacetic acid (IAA), anthranilic acid (AA), and ethacrynic acid. We identified potent inhibitors from the IAA and the AA series. We tritiated IAA-94 and measured binding of this ligand to the kidney cortex membrane vesicles and found a high-affinity binding site whose dissociation constant (0.6 microM) was similar to the inhibition constant (1 microM). There was a good correlation between the inhibitory potency of several IAA derivatives and their efficacy in displacing [3H]IAA-94 from its binding site. Further, other chloride channel inhibitors, including AA derivatives, ethacrynic acid, bumetanide, and DIDS, also displaced the ligand from its binding site. A similar conductance was found in apical membrane vesicles from bovine trachea that was also inhibited by IAA-94 and AA-130B, but the inhibitory effects of these compounds were weaker than their effects on the renal cortex channel. The two drugs were also less potent in displacing [3H]IAA-94 from the tracheal binding site. PMID:2450168

  11. Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

    PubMed

    Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

    2008-05-15

    Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

  12. Important Aspects of Post-Prandial Antidiabetic Drug, Acarbose.

    PubMed

    Singla, Rajeev Kumar; Singh, Radha; Dubey, Ashok Kumar

    2016-01-01

    Acarbose, a well known and efficacious α-amylase and α-glucosidase inhibitor, is a postprandial acting antidiabetic drug. DNS-based α-amylase inhibitory assays showed that use of acarbose at concentrations above 125 µg/ml resulted in release of reducing sugar in the reaction, an unexpected observation. Objective of the present study was to design experimental strategies to address this unusual finding. Acarbose was found to be susceptible to thermo-lysis. Further, besides being an inhibitor, it could also be hydrolyzed by porcine pancreatic α-amylase, but had weaker affinity for α - amylase compared to starch. GRIP docking was done for the mechanistic analysis of the active site in the enzyme for substrate, inhibitor and, inhibitor's metabolite (K2). Interaction between acarbose and α-amylase involved significant hydrogen binding compared to that of starch, producing a stronger enzyme-inhibitor complex. Further, docking analysis led us to predict the site on α-amylase where the inhibitor (acarbose) bound more tightly, which possibly affected the binding and hydrolysis of starch exerting its effective anti-diabetic function.

  13. Binding of pixantrone to DNA at CpA dinucleotide sequences and bulge structures.

    PubMed

    Konda, Shyam K; Wang, Haiqiang; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

    2015-06-07

    The binding of the anti-cancer drug pixantrone to three oligonucleotide sequences, d(TCATATGA)2, d(CCGAGAATTCCGG)2 {double bulge = DB} and the non-self complementary d(TACGATGAGTA) : d(TACCATCGTA) {single bulge = SB}, has been studied by NMR spectroscopy and molecular modelling. The upfield shifts observed for the aromatic resonances of pixantrone upon addition of the drug to each oligonucleotide confirmed the drug bound by intercalation. For the duplex sequence d(TCATATGA)2, NOEs were observed from the pixantrone aromatic H7/8 and aliphatic Ha/Hb protons to the H6/H8 and H1' protons of the C2, A3, T6 and G7 nucleotides, demonstrating that pixantrone preferentially binds at the symmetric CpA sites. However, weaker NOEs observed to various protons from the T4 and A5 residues indicated alternative minor binding sites. NOEs from the H7/H8 and Ha/Hb protons to both major (H6/H8) and minor groove (H1') protons indicated approximately equal proportions of intercalation was from the major and minor groove at the CpA sites. Intermolecular NOEs were observed between the H7/H8 and H4 protons of pixantrone and the A4H1' and G3H1' protons of the oligonucleotide that contains two symmetrically related bulge sites (DB), indicative of binding at the adenine bulge sites. For the oligonucleotide that only contains a single bulge site (SB), NOEs were observed from pixantrone protons to the SB G7H1', A8H1' and G9H1' protons, confirming that the drug bound selectively at the adenine bulge site. A molecular model of pixantrone-bound SB could be constructed with the drug bound from the minor groove at the A8pG9 site that was consistent with the observed NMR data. The results demonstrate that pixantrone preferentially intercalates at adenine bulge sites, compared to duplex DNA, and predominantly from the minor groove.

  14. Synaptosomal binding of 125I-labelled daboiatoxin, a new PLA2 neurotoxin from the venom of Daboia russelli siamensis.

    PubMed

    Maung-Maung-Thwin; Gopalakrishnakone, P; Yuen, R; Tan, C H

    1996-02-01

    Daboiatoxin (DbTx), the PLA2 neurotoxin from Daboia russelli siamensis venom, was shown to bind specifically and saturably to rat cerebrocortical synaptosomes and synaptic membrane fragments. Two families of binding sites were detected by equilibrium binding analysis in the presence and absence of Ca2+. Scatchard analysis of biphasic plateaus revealed Kdl 5 nM and Bmax1, 6 pmoles/mg protein, and Kd2 80 nM and Bmax2 20 pmoles/mg protein, respectively, for the high- and low-affinity binding sites. The binding of 125I-DbTx to synaptosomes did not show marked dependence on Ca2+, Mg2+, Co2+ and Sr2+. Native DbTx was the only strong competitor to 125I-DbTx synaptosomal binding (IC50 12.5 nM, KI 5.5 nM). Two other crotalid PLA2 neurotoxins, crotoxin CB and mojave toxin basic subunit, and nontoxic C. Atrox PLA2 enzyme, were relatively weaker inhibitors, while two viperid PLA2 neurotoxins, ammodytoxin A and VRV PL V, were very weak inhibitors. Crotoxin CA was a poor inhibitor even at microM concentrations, whereas no inhibitory effect at all was observed with crotoxin CACB, ammodytoxin C, VRV PL VIIIa, taipoxin, beta-bungarotoxin, or with PLA2 enzymes from N. naja venom, E. schistosa venom, bee venom and porcine pancreas. All other pharmacologically active ligands examined (epinephrine, norepinephrine, histamine, choline, dopamine, serotonin, GABA, naloxone, WB-4101, atropine, hexamethonium and alpha-bun-garotoxin) also failed to interfere with 125I-DbTx binding. As those competitors that showed partial inhibition were effective only at microM concentration range compared to the Kd (5 nM) of 125I-DbTx synaptosomal binding, DbTx could well recognize a different neuronal binding site. Rabbit anti-DbTx polyclonal antisera completely blocked the specific binding. When a range of Ca2+ and K+ channels modulators were examined, Ca2+ channel blockers (omega-conotoxins GVIA and MVIIC, taicatoxin, calciseptine and nitrendiprene) did not affect the binding even at high concentrations, while charybdotoxin was the only K+ channel effector that could partially displace 125I-DbTx synaptosomal binding amongst the K+ channel blockers tested (apamin, dendrotoxin-I, iberiotoxin, MCD-peptide, 4-aminopyridine and tetraethylammonium), suggesting that neither K+ nor Ca2+ channels are associated with DbTx binding sites.

  15. Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

    2010-07-23

    Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

  16. Structural Basis for the ABO Blood-Group Dependence of Plasmodium falciparum Rosetting

    PubMed Central

    Hessel, Audrey; Raynal, Bertrand; England, Patrick; Cohen, Jacques H.; Bertrand, Olivier; Peyrard, Thierry; Bentley, Graham A.; Lewit-Bentley, Anita; Mercereau-Puijalon, Odile

    2012-01-01

    The ABO blood group influences susceptibility to severe Plasmodium falciparum malaria. Recent evidence indicates that the protective effect of group O operates by virtue of reduced rosetting of infected red blood cells (iRBCs) with uninfected RBCs. Rosetting is mediated by a subgroup of PfEMP1 adhesins, with RBC binding being assigned to the N-terminal DBL1α1 domain. Here, we identify the ABO blood group as the main receptor for VarO rosetting, with a marked preference for group A over group B, which in turn is preferred to group O RBCs. We show that recombinant NTS-DBL1α1 and NTS-DBL1α1-CIDR1γ reproduce the VarO-iRBC blood group preference and document direct binding to blood group trisaccharides by surface plasmon resonance. More detailed RBC subgroup analysis showed preferred binding to group A1, weaker binding to groups A2 and B, and least binding to groups Ax and O. The 2.8 Å resolution crystal structure of the PfEMP1-VarO Head region, NTS-DBL1α1-CIDR1γ, reveals extensive contacts between the DBL1α1 and CIDR1γ and shows that the NTS-DBL1α1 hinge region is essential for RBC binding. Computer docking of the blood group trisaccharides and subsequent site-directed mutagenesis localized the RBC-binding site to the face opposite to the heparin-binding site of NTS-DBLα1. RBC binding involves residues that are conserved between rosette-forming PfEMP1 adhesins, opening novel opportunities for intervention against severe malaria. By deciphering the structural basis of blood group preferences in rosetting, we provide a link between ABO blood grouppolymorphisms and rosette-forming adhesins, consistent with the selective role of falciparum malaria on human genetic makeup. PMID:22807674

  17. Redox potential tuning through differential quinone binding in the photosynthetic reaction center of Rhodobacter sphaeroides

    DOE PAGES

    Vermaas, Josh V.; Taguchi, Alexander T.; Dikanov, Sergei A.; ...

    2015-03-03

    Ubiquinone forms an integral part of the electron transport chain in cellular respiration and photosynthesis across a vast number of organisms. Prior experimental results have shown that the photosynthetic reaction center (RC) from Rhodobacter sphaeroides is only fully functional with a limited set of methoxy-bearing quinones, suggesting that specific interactions with this substituent are required to drive electron transport and the formation of quinol. The nature of these interactions has yet to be determined. Through parameterization of a CHARMM-compatible quinone force field and subsequent molecular dynamics simulations of the quinone-bound RC, in this paper we have investigated and characterized themore » interactions of the protein with the quinones in the Q A and Q B sites using both equilibrium simulation and thermodynamic integration. In particular, we identify a specific interaction between the 2-methoxy group of ubiquinone in the Q B site and the amide nitrogen of GlyL225 that we implicate in locking the orientation of the 2-methoxy group, thereby tuning the redox potential difference between the quinones occupying the Q A and Q B sites. Finally, disruption of this interaction leads to weaker binding in a ubiquinone analogue that lacks a 2-methoxy group, a finding supported by reverse electron transfer electron paramagnetic resonance experiments of the Q A–Q B– biradical and competitive binding assays.« less

  18. Redox potential tuning through differential quinone binding in the photosynthetic reaction center of Rhodobacter sphaeroides.

    PubMed

    Vermaas, Josh V; Taguchi, Alexander T; Dikanov, Sergei A; Wraight, Colin A; Tajkhorshid, Emad

    2015-03-31

    Ubiquinone forms an integral part of the electron transport chain in cellular respiration and photosynthesis across a vast number of organisms. Prior experimental results have shown that the photosynthetic reaction center (RC) from Rhodobacter sphaeroides is only fully functional with a limited set of methoxy-bearing quinones, suggesting that specific interactions with this substituent are required to drive electron transport and the formation of quinol. The nature of these interactions has yet to be determined. Through parameterization of a CHARMM-compatible quinone force field and subsequent molecular dynamics simulations of the quinone-bound RC, we have investigated and characterized the interactions of the protein with the quinones in the Q(A) and Q(B) sites using both equilibrium simulation and thermodynamic integration. In particular, we identify a specific interaction between the 2-methoxy group of ubiquinone in the Q(B) site and the amide nitrogen of GlyL225 that we implicate in locking the orientation of the 2-methoxy group, thereby tuning the redox potential difference between the quinones occupying the Q(A) and Q(B) sites. Disruption of this interaction leads to weaker binding in a ubiquinone analogue that lacks a 2-methoxy group, a finding supported by reverse electron transfer electron paramagnetic resonance experiments of the Q(A)⁻Q(B)⁻ biradical and competitive binding assays.

  19. Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

    PubMed

    Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

    2012-08-01

    CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

  20. CYP2E1 hydroxylation of aniline involves negative cooperativity.

    PubMed

    Hartman, Jessica H; Knott, Katie; Miller, Grover P

    2014-02-01

    CYP2E1 plays a role in the metabolic activation and elimination of aniline, yet there are conflicting reports on its mechanism of action, and hence relevance, in aniline metabolism. Based on our work with similar compounds, we hypothesized that aniline binds two CYP2E1 sites during metabolism resulting in cooperative reaction kinetics and tested this hypothesis through rigorous in vitro studies. The kinetic profile for recombinant CYP2E1 demonstrated significant negative cooperativity based on a fit of data to the Hill equation (n=0.56). Mechanistically, the data were best explained through a two-binding site cooperative model in which aniline binds with high affinity (K(s)=30 μM) followed by a second weaker binding event (K(ss)=1100 uM) resulting in a threefold increase in the oxidation rate. Binding sites for aniline were confirmed by inhibition studies with 4-methylpyrazole. Inhibitor phenotyping experiments with human liver microsomes validated the central role for CYP2E1 in aniline hydroxylation and indicated minor roles for CYP2A6 and CYP2C9. Importantly, inhibition of minor metabolic pathways resulted in a kinetic profile for microsomal CYP2E1 that replicated the preferred mechanism and parameters observed with the recombinant enzyme. Scaled modeling of in vitro CYP2E1 metabolism of aniline to in vivo clearance, especially at low aniline levels, led to significant deviations from the traditional model based on non-cooperative, Michaelis-Menten kinetics. These findings provide a critical mechanistic perspective on the potential importance of CYP2E1 in the metabolic activation and elimination of aniline as well as the first experimental evidence of a negatively cooperative metabolic reaction catalyzed by CYP2E1. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. A Water‐Soluble Tetraazaperopyrene Dye as Strong G‐Quadruplex DNA Binder

    PubMed Central

    Hahn, Lena

    2016-01-01

    Abstract The interactions of the water‐soluble tetraazaperopyrene dye 1 with ct‐DNA, duplex‐[(dAdT)12 ⋅(dAdT)12], duplex‐[(dGdC)12 ⋅(dGdC)12] as well as with two G‐quadruplex‐forming sequences, namely the human telomeric 22AG and the promotor sequence c‐myc, were investigated by means of UV/visible and fluorescence spectroscopy, isothermal titration calorimetry (ITC) and molecular docking studies. Dye 1 exhibits a high affinity for G‐quadruplex structures over duplex DNA structures. Furthermore, the ligand shows promising G‐quadruplex discrimination, with an affinity towards c‐myc of 2×107  m −1 (i.e., K d=50 nm), which is higher than for 22AG (4×106  m −1). The ITC data reveal that compound 1 interacts with c‐myc in a stoichiometric ratio of 1:1 but also indicate the presence of two identical lower affinity secondary binding sites per quadruplex. In 22AG, there are two high affinity binding sites per quadruplex, that is, one on each side, with a further four weaker binding sites. For both quadruplex structures, the high affinity interactions between compound 1 and the quadruplex‐forming nucleic acid structures are weakly endothermic. Molecular docking studies suggest an end‐stacking binding mode for compound 1 interacting with quadruplex structures, and a higher affinity for the parallel conformation of c‐myc than for the mixed‐hybrid conformation of 22AG. In addition, docking studies also suggest that the reduced affinity for duplex DNA structures is due to the non‐viability of an intercalative binding mode. PMID:26997208

  2. Multiple Mechanisms of Zinc-Mediated Inhibition for the Apoptotic Caspases-3, -6, -7, and -8.

    PubMed

    Eron, Scott J; MacPherson, Derek J; Dagbay, Kevin B; Hardy, Jeanne A

    2018-05-18

    Zinc is emerging as a widely used and important biological regulatory signal. Cellular zinc levels are tightly regulated by a complex array of zinc importers and exporters to control processes such as apoptotic cell death. While caspase inhibition by zinc has been reported previously, the reported inhibition constants were too weak to suggest a critical biological role for zinc-mediated inhibition. In this work, we have adopted a method of assessing available zinc. This allowed assessment of accurate inhibition constants for apoptotic caspases, caspase-3, -6, -7, and -8. Each of these caspases are inhibited by zinc at intracellular levels but with widely differing inhibition constants and different zinc binding stoichiometries. Caspase-3, -6, and -8 appear to be constitutively inhibited by typical zinc levels, and this inhibition must be lifted to allow activation. The inhibition constant for caspase-7 (76 nM) is much weaker than for the other apoptotic caspases (2.6-6.9 nM) suggesting that caspase-7 is not inactivated by normal zinc concentrations but can be inhibited under conditions of zinc stress. Caspase-3, -7, and -8 were found to bind three, one, and two zincs, respectively. In each of these caspases, zinc was present in the active site, in contrast to caspase-6, which binds one zinc allosterically. The most notable new mechanism to emerge from this work is for zinc-mediated inhibition of caspase-8. Zinc binds caspase-8 directly at the active site and at a second site. Zinc binding inhibits formation of the caspase-8 dimer, the activated form of the enzyme. Together these findings suggest that zinc plays a critical role in regulation of apoptosis by direct inactivation of caspases, in a manner that is unique for each caspase.

  3. Nature differences of humic acids fractions induced by extracted sequence as explanatory factors for binding characteristics of heavy metals.

    PubMed

    Shi, Wenjing; Lü, Changwei; He, Jiang; En, He; Gao, Manshu; Zhao, Boyi; Zhou, Bin; Zhou, Haijun; Liu, Hualin; Zhang, Yu

    2018-06-15

    The composition and structure of Humic acid (HA) is so heterogeneous that it brings significant barriers to investigate the interaction between HA and heavy metal ions. The isolation of HA with relatively homogeneity is a key to reveal the binding mechanisms between HA and heavy metals. In this work, ten HA fractions (HAs) were obtained by sequential alkali extraction procedure and nature differences of the extracted HAs were considered as explanatory factors for binding characteristics of Cu 2+ , Pb 2+ and Cd 2+ . The results indicate that more large molecular weight (MW) HA subunits, less carboxyl and phenolic group contents, weaker aromaticity and polarity were measured with increasing extractions, inducing weaker binding capacity of HAs. Ligand binding and bi-Langmuir models indicated that the sorption capacity and binding affinity of earlier extracted HAs were higher than the latter ones. The peak area changes at 3427, 1599, and 619 cm -1 pre- and post-adsorption in FTIR spectra suggested carboxyl, phenolic and nitrogen-containing groups were involved in the adsorption process. At the same time, the peak area difference between HAs and HAs-metal (ΔS) of phenolic groups were 8.22-20.50, 6.81-21.11 and 10.66-19.80% for Cu 2+ , Pb 2+ and Cd 2+ , respectively, ΔS of carboxyl groups 6.64-17.03, 8.96-16.82 and 9.45-17.85% for Cu 2+ , Pb 2+ and Cd 2+ , respectively, ΔS of nitrogen-containing groups 0.33-0.48, 0.20-1.38 and 0.31-0.59% for Cu 2+ , Pb 2+ and Cd 2+ , respectively. ΔS of phenolic and carboxyl groups were larger than those of nitrogen-containing groups, implying that these two groups were the predominant binding sites suppliers for metal ions, which were also supported by the results of correlation analysis. This work is helpful to insight the environmental impacts of natural organic matter and the fate of heavy metals in natural environment. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Fluorescent TEM-1 β-lactamase with wild-type activity as a rapid drug sensor for in vitro drug screening

    PubMed Central

    Cheong, Wing-Lam; Tsang, Ming-San; So, Pui-Kin; Chung, Wai-Hong; Leung, Yun-Chung; Chan, Pak-Ho

    2014-01-01

    We report the development of a novel fluorescent drug sensor from the bacterial drug target TEM-1 β-lactamase through the combined strategy of Val216→Cys216 mutation and fluorophore labelling for in vitro drug screening. The Val216 residue in TEM-1 is replaced with a cysteine residue, and the environment-sensitive fluorophore fluorescein-5-maleimide is specifically attached to the Cys216 residue in the V216C mutant for sensing drug binding at the active site. The labelled V216C mutant has wild-type catalytic activity and gives stronger fluorescence when β-lactam antibiotics bind to the active site. The labelled V216C mutant can differentiate between potent and impotent β-lactam antibiotics and can distinguish active-site binders from non-binders (including aggregates formed by small molecules in aqueous solution) by giving characteristic time-course fluorescence profiles. Mass spectrometric, molecular modelling and trypsin digestion results indicate that drug binding at the active site is likely to cause the fluorescein label to stay away from the active site and experience weaker fluorescence quenching by the residues around the active site, thus making the labelled V216C mutant to give stronger fluorescence in the drug-bound state. Given the ancestor's role of TEM-1 in the TEM family, the fluorescent TEM-1 drug sensor represents a good model to demonstrate the general combined strategy of Val216→Cys216 mutation and fluorophore labelling for fabricating tailor-made fluorescent drug sensors from other clinically significant TEM-type β-lactamase variants for in vitro drug screening. PMID:25074398

  5. Yeast hexokinase: substrate-induced association--dissociation reactions in the binding of glucose to hexokinase P-II.

    PubMed

    Hoggett, J G; Kellett, G L

    1976-06-15

    A method is described for the purification of native hexokinases P-I and P-II from yeast using preparative isoelectric focussing to separate the isozymes. The binding of glucose to hexokinase P-II, and the effect of this on the monomer--dimer association--dissociation reaction have been investigated quantitatively by a combination of titrations of intrinsic protein fluorescence and equilibrium ultracentrifugation. Association constants for the monomer-dimer reaction decreased with increasing pH, ionic strength and concentration of glucose. Saturating concentrations of glucose did not bring about complete dissociation of the enzyme showing that both sites were occupired in the dimer. At pH 8.0 and high ionic strength, where the enzyme existed as monomer, the dissociation constant of the enzyme-glucose complex was 3 X 10(-4) mol 1(-1) and was independent of the concentration of enzyme. Binding to the dimeric form at low pH and ionic strength (I=0.02 mol 1(-1), pH less than 7.5) was also independent of enzyme concentration (in the range 10-1000 mug ml-1) but was much weaker. The process could be described by a single dissociation constant, showing that the two available sites on the dimer were equivalent and non-cooperative; values of the intrinsic dissociation constant varied from 2.5 X 10(-3) mol 1(-1) at pH 7.0 to 6 X 10(-3) at pH 6.5. Under intermediate conditions (pH 7.0, ionic strength=0.15 mol 1(-1)), where monomer and dimer coexisted, the binding of glucose showed weak positive cooperatively (Hill coefficient 1.2); in addition, the binding was dependent upon the concentration of enzyme in the direction of stronger binding at lower concentrations. The results show that the phenomenon of half-sites reactivity observed in the binding of glucose to crystalline hexokinase P-II does not occur in solution; the simplest explanation of our finding the two sites to be equivalent is that the dimer results from the homologous association of two identical subunits.

  6. The origins of femtomolar protein-ligand binding: hydrogen-bond cooperativity and desolvation energetics in the biotin-(strept)avidin binding site.

    PubMed

    DeChancie, Jason; Houk, K N

    2007-05-02

    The unusually strong reversible binding of biotin by avidin and streptavidin has been investigated by density functional and MP2 ab initio quantum mechanical methods. The solvation of biotin by water has also been studied through QM/MM/MC calculations. The ureido moiety of biotin in the bound state hydrogen bonds to five residues, three to the carbonyl oxygen and one for each--NH group. These five hydrogen bonds act cooperatively, leading to stabilization that is larger than the sum of individual hydrogen-bonding energies. The charged aspartate is the key residue that provides the driving force for cooperativity in the hydrogen-bonding network for both avidin and streptavidin by greatly polarizing the urea of biotin. If the residue is removed, the network is disrupted, and the attenuation of the energetic contributions from the neighboring residues results in significant reduction of cooperative interactions. Aspartate is directly hydrogen-bonded with biotin in streptavidin and is one residue removed in avidin. The hydrogen-bonding groups in streptavidin are computed to give larger cooperative hydrogen-bonding effects than avidin. However, the net gain in electrostatic binding energy is predicted to favor the avidin-bicyclic urea complex due to the relatively large penalty for desolvation of the streptavidin binding site (specifically expulsion of bound water molecules). QM/MM/MC calculations involving biotin and the ureido moiety in aqueous solution, featuring PDDG/PM3, show that water interactions with the bicyclic urea are much weaker than (strept)avidin interactions due to relatively low polarization of the urea group in water.

  7. The neonatal Fc receptor (FcRn) binds independently to both sites of the IgG homodimer with identical affinity.

    PubMed

    Abdiche, Yasmina Noubia; Yeung, Yik Andy; Chaparro-Riggers, Javier; Barman, Ishita; Strop, Pavel; Chin, Sherman Michael; Pham, Amber; Bolton, Gary; McDonough, Dan; Lindquist, Kevin; Pons, Jaume; Rajpal, Arvind

    2015-01-01

    The neonatal Fc receptor (FcRn) is expressed by cells of epithelial, endothelial and myeloid lineages and performs multiple roles in adaptive immunity. Characterizing the FcRn/IgG interaction is fundamental to designing therapeutic antibodies because IgGs with moderately increased binding affinities for FcRn exhibit superior serum half-lives and efficacy. It has been hypothesized that 2 FcRn molecules bind an IgG homodimer with disparate affinities, yet their affinity constants are inconsistent across the literature. Using surface plasmon resonance biosensor assays that eliminated confounding experimental artifacts, we present data supporting an alternate hypothesis: 2 FcRn molecules saturate an IgG homodimer with identical affinities at independent sites, consistent with the symmetrical arrangement of the FcRn/Fc complex observed in the crystal structure published by Burmeister et al. in 1994. We find that human FcRn binds human IgG1 with an equilibrium dissociation constant (KD) of 760 ± 60 nM (N = 14) at 25°C and pH 5.8, and shows less than 25% variation across the other human subtypes. Human IgG1 binds cynomolgus monkey FcRn with a 2-fold higher affinity than human FcRn, and binds both mouse and rat FcRn with a 10-fold higher affinity than human FcRn. FcRn/IgG interactions from multiple species show less than a 2-fold weaker affinity at 37°C than at 25°C and appear independent of an IgG's variable region. Our in vivo data in mouse and rat models demonstrate that both affinity and avidity influence an IgG's serum half-life, which should be considered when choosing animals, especially transgenic systems, as surrogates.

  8. CO 2 Dynamics in Pure and Mixed-Metal MOFs with Open Metal Sites

    DOE PAGES

    Marti, Robert M.; Howe, Joshua D.; Morelock, Cody R.; ...

    2017-09-22

    Metal–organic frameworks (MOFs), such as MOF-74, can have open metal sites to which adsorbates such as CO 2 preferentially bind. 13C NMR of 13CO 2 is highly informative about the binding sites present in Mg-MOF-74. We used this technique to investigate loadings between ~0.88 and 1.15 molecules of CO 2 per metal in Mg-MOF-74 at 295 K. 13C lineshapes recorded as a function of loading can be understood in terms of the dependence of the CO 2 NMR frequency on the angle (θ) with respect to the CO 2 axis and the channel of the MOF, reflected in the Legendremore » polynomial, P 2. In the fast motion limit, the NMR spectra reveal the time-averaged value of P 2, where θ is the angle between the instantaneous CO 2 axis and the channel axis. DFT calculations were used to determine a weighted average of P 2 in this regime and are in good agreement with experimental data. Static variable temperature 13C NMR from cryogenic temperatures to room temperature was used to investigate 13CO 2 binding in Mg-MOF-74 loaded at two levels (~0.88 and 1.08 molecules of CO 2 per metal), revealing temperature-dependent lineshapes. We have investigated the effect of partial substitution of Cd for Mg in Mg-MOF-74 on the 13CO 2 variable temperature NMR spectra. The chemical shift anisotropy (CSA) that leads to characteristic lineshapes of 13C indicates that incorporation of Cd leads to weaker binding energies for adsorbed CO 2.« less

  9. Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

    PubMed

    Yamasu, K; Wilt, F H

    1999-02-01

    The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

  10. Modulation by bicuculline and penicillin of the block by t-butyl-bicyclo-phosphorothionate (TBPS) of GABAA-receptor mediated Cl−-current responses in rat striatal neurones

    PubMed Central

    Behrends, Jan C

    2000-01-01

    T-butyl-bicyclo-phosphorothionate (TBPS) is a prototypical representative of the cage-convulsants which act through a use-dependent block of the GABAA-receptor-ionophore complex. Using current recordings from cultured neurones of rat striatum the manner was investigated in which two antagonists, bicuculline and penicillin, presumably acting at the agonist binding site and in the ionic channel, respectively, modify the rate of block by TBPS. Penicillin (5 or 10 mM) did not slow the rate of block by TBPS, but produced a significant enhancement of block rate, which, however, was inversely related to the degree of antagonism by penicillin of the GABA-induced current. Bicuculline (10 μM) reduced the rate of block by TBPS. However, this effect was 3 fold weaker than its GABA-antagonistic action. The slowing of block rate and the current antagonism exhibited a biphasic, positive-negative relationship. Co-application of bicuculline (100 μM) in a concentration that produced nearly complete antagonism and TBPS (10 μM) resulted in a marked (∼40%) reduction of subsequent GABA response amplitudes compatible with a direct, bicuculline-induced conformational change in the receptor required for the binding of and block by TBPS. The lack of protection afforded by the channel blocker penicillin as well as the lack of correlation between bicuculline antagonism of the Cl−-current and its efficiency in protecting against TBPS block is evidence against an open channel blocking mechanism for TBPS. TBPS does, therefore, not appear to gain access to its binding site via the open pore but through alternative routes regulated from the agonist binding site. PMID:10694249

  11. CO 2 Dynamics in Pure and Mixed-Metal MOFs with Open Metal Sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marti, Robert M.; Howe, Joshua D.; Morelock, Cody R.

    Metal–organic frameworks (MOFs), such as MOF-74, can have open metal sites to which adsorbates such as CO 2 preferentially bind. 13C NMR of 13CO 2 is highly informative about the binding sites present in Mg-MOF-74. We used this technique to investigate loadings between ~0.88 and 1.15 molecules of CO 2 per metal in Mg-MOF-74 at 295 K. 13C lineshapes recorded as a function of loading can be understood in terms of the dependence of the CO 2 NMR frequency on the angle (θ) with respect to the CO 2 axis and the channel of the MOF, reflected in the Legendremore » polynomial, P 2. In the fast motion limit, the NMR spectra reveal the time-averaged value of P 2, where θ is the angle between the instantaneous CO 2 axis and the channel axis. DFT calculations were used to determine a weighted average of P 2 in this regime and are in good agreement with experimental data. Static variable temperature 13C NMR from cryogenic temperatures to room temperature was used to investigate 13CO 2 binding in Mg-MOF-74 loaded at two levels (~0.88 and 1.08 molecules of CO 2 per metal), revealing temperature-dependent lineshapes. We have investigated the effect of partial substitution of Cd for Mg in Mg-MOF-74 on the 13CO 2 variable temperature NMR spectra. The chemical shift anisotropy (CSA) that leads to characteristic lineshapes of 13C indicates that incorporation of Cd leads to weaker binding energies for adsorbed CO 2.« less

  12. Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

    PubMed

    Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2016-03-14

    Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

  13. The cellular RNA-binding protein EAP recognizes a conserved stem-loop in the Epstein-Barr virus small RNA EBER 1.

    PubMed Central

    Toczyski, D P; Steitz, J A

    1993-01-01

    EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232

  14. Anticancer and antiviral effects and inactivation of S-adenosyl-L-homocysteine hydrolase with 5'-carboxaldehydes and oximes synthesized from adenosine and sugar-modified analogues.

    PubMed

    Wnuk, S F; Yuan, C S; Borchardt, R T; Balzarini, J; De Clercq, E; Robins, M J

    1997-05-23

    Selectively protected adenine nucleosides were converted into 5'-carboxaldehyde analogues by Moffatt oxidation (dimethyl sulfoxide/dicyclohexylcarbodiimide/dichloroacetic acid) or with the Dess-Martin periodinane reagent. Hydrolysis of a 5'-fluoro-5'-S-methyl-5'-thio (alpha-fluoro thioether) arabinosyl derivative also gave the 5'-carboxaldehyde. Treatment of 5'-carboxaldehydes with hydroxylamine [or O-(methyl, ethyl, and benzyl)hydroxylamine] hydrochloride gave E/Z oximes. Treatment of purified oximes with aqueous trifluoroacetic acid and acetone effected trans-oximation to provide clean samples of 5'-carboxaldehydes. Adenosine (Ado)-5'-carboxaldehyde and its 4'-epimer are potent inhibitors of S-adenosyl-L-homocysteine (AdoHcy) hydrolase. They bind efficiently to the enzyme and undergo oxidation at C3' to give 3'-keto analogues with concomitant reduction of the NAD+ cofactor to give an inactive, tightly bound NADH-enzyme complex (type I cofactor-depletion inhibition). Potent type I inhibition was observed with 5'-carboxaldehydes that contain a ribo cis-2',3'-glycol. Their oxime derivatives are "proinhibitors" that undergo enzyme-catalyzed hydrolysis to release the inhibitors at the active site. The 2'-deoxy and 2'-epimeric (arabinosyl) analogues were much weaker inhibitors, and the 3'-deoxy compounds bind very weakly. Ado-5'-carboxaldehyde oxime had potent cytotoxicity in tumor cell lines and was toxic to normal human cells. Analogues had weaker cytotoxic and antiviral potencies, and the 3'-deoxy compounds were essentially devoid of cytotoxic and antiviral activity.

  15. Andrographolide sodium bisulphite-induced inactivation of urease: inhibitory potency, kinetics and mechanism.

    PubMed

    Mo, Zhi-Zhun; Wang, Xiu-Fen; Zhang, Xie; Su, Ji-Yan; Chen, Hai-Ming; Liu, Yu-Hong; Zhang, Zhen-Biao; Xie, Jian-Hui; Su, Zi-Ren

    2015-07-16

    The inhibitory effect of andrographolide sodium bisulphite (ASB) on jack bean urease (JBU) and Helicobacter pylori urease (HPU) was performed to elucidate the inhibitory potency, kinetics and mechanism of inhibition in 20 mM phosphate buffer, pH 7.0, 2 mM EDTA, 25 °C. The ammonia formations, indicator of urease activity, were examined using modified spectrophotometric Berthelot (phenol-hypochlorite) method. The inhibitory effect of ASB was characterized with IC50 values. Lineweaver-Burk and Dixon plots for JBU inhibition of ASB was constructed from the kinetic data. SH-blocking reagents and competitive active site Ni2+ binding inhibitors were employed for mechanism study. Molecular docking technique was used to provide some information on binding conformations as well as confirm the inhibition mode. The IC50 of ASB against JBU and HPU was 3.28±0.13 mM and 3.17±0.34 mM, respectively. The inhibition proved to be competitive and concentration- dependent in a slow-binding progress. The rapid formation of initial ASB-JBU complex with an inhibition constant of Ki=2.86×10(-3) mM was followed by a slow isomerization into the final complex with an overall inhibition constant of Ki*=1.33×10(-4) mM. The protective experiment proved that the urease active site is involved in the binding of ASB. Thiol reagents (L-cysteine and dithiothreithol) strongly protect the enzyme from the loss of enzymatic activity, while boric acid and fluoride show weaker protection, indicating that the active-site sulfhydryl group of JBU was potentially involved in the blocking process. Moreover, inhibition of ASB proved to be reversible since ASB-inactivated JBU could be reactivated by dithiothreitol application. Molecular docking assay suggested that ASB made contacts with the important sulfhydryl group Cys-592 residue and restricted the mobility of the active-site flap. ASB was a competitive inhibitor targeting thiol groups of urease in a slow-binding manner both reversibly and concentration-dependently, serving as a promising urease inhibitor for the treatment of urease-related diseases.

  16. Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

    PubMed

    Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

    2018-01-22

    An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Computational investigation of the HIV-1 Rev multimerization using molecular dynamics simulations and binding free energy calculations.

    PubMed

    Venken, Tom; Daelemans, Dirk; De Maeyer, Marc; Voet, Arnout

    2012-06-01

    The HIV Rev protein mediates the nuclear export of viral mRNA, and is thereby essential for the production of late viral proteins in the replication cycle. Rev forms a large organized multimeric protein-protein complex for proper functioning. Recently, the three-dimensional structures of a Rev dimer and tetramer have been resolved and provide the basis for a thorough structural analysis of the binding interaction. Here, molecular dynamics (MD) and binding free energy calculations were performed to elucidate the forces thriving dimerization and higher order multimerization of the Rev protein. It is found that despite the structural differences between each crystal structure, both display a similar behavior according to our calculations. Our analysis based on a molecular mechanics-generalized Born surface area (MM/GBSA) and a configurational entropy approach demonstrates that the higher order multimerization site is much weaker than the dimerization site. In addition, a quantitative hot spot analysis combined with a mutational analysis reveals the most contributing amino acid residues for protein interactions in agreement with experimental results. Additional residues were found in each interface, which are important for the protein interaction. The investigation of the thermodynamics of the Rev multimerization interactions performed here could be a further step in the development of novel antiretrovirals using structure based drug design. Moreover, the variability of the angle between each Rev monomer as measured during the MD simulations suggests a role of the Rev protein in allowing flexibility of the arginine rich domain (ARM) to accommodate RNA binding. Copyright © 2012 Wiley Periodicals, Inc.

  18. The Free Energy Landscape of Small Molecule Unbinding

    PubMed Central

    Huang, Danzhi; Caflisch, Amedeo

    2011-01-01

    The spontaneous dissociation of six small ligands from the active site of FKBP (the FK506 binding protein) is investigated by explicit water molecular dynamics simulations and network analysis. The ligands have between four (dimethylsulphoxide) and eleven (5-diethylamino-2-pentanone) non-hydrogen atoms, and an affinity for FKBP ranging from 20 to 0.2 mM. The conformations of the FKBP/ligand complex saved along multiple trajectories (50 runs at 310 K for each ligand) are grouped according to a set of intermolecular distances into nodes of a network, and the direct transitions between them are the links. The network analysis reveals that the bound state consists of several subbasins, i.e., binding modes characterized by distinct intermolecular hydrogen bonds and hydrophobic contacts. The dissociation kinetics show a simple (i.e., single-exponential) time dependence because the unbinding barrier is much higher than the barriers between subbasins in the bound state. The unbinding transition state is made up of heterogeneous positions and orientations of the ligand in the FKBP active site, which correspond to multiple pathways of dissociation. For the six small ligands of FKBP, the weaker the binding affinity the closer to the bound state (along the intermolecular distance) are the transition state structures, which is a new manifestation of Hammond behavior. Experimental approaches to the study of fragment binding to proteins have limitations in temporal and spatial resolution. Our network analysis of the unbinding simulations of small inhibitors from an enzyme paints a clear picture of the free energy landscape (both thermodynamics and kinetics) of ligand unbinding. PMID:21390201

  19. The free energy landscape of small molecule unbinding.

    PubMed

    Huang, Danzhi; Caflisch, Amedeo

    2011-02-01

    The spontaneous dissociation of six small ligands from the active site of FKBP (the FK506 binding protein) is investigated by explicit water molecular dynamics simulations and network analysis. The ligands have between four (dimethylsulphoxide) and eleven (5-diethylamino-2-pentanone) non-hydrogen atoms, and an affinity for FKBP ranging from 20 to 0.2 mM. The conformations of the FKBP/ligand complex saved along multiple trajectories (50 runs at 310 K for each ligand) are grouped according to a set of intermolecular distances into nodes of a network, and the direct transitions between them are the links. The network analysis reveals that the bound state consists of several subbasins, i.e., binding modes characterized by distinct intermolecular hydrogen bonds and hydrophobic contacts. The dissociation kinetics show a simple (i.e., single-exponential) time dependence because the unbinding barrier is much higher than the barriers between subbasins in the bound state. The unbinding transition state is made up of heterogeneous positions and orientations of the ligand in the FKBP active site, which correspond to multiple pathways of dissociation. For the six small ligands of FKBP, the weaker the binding affinity the closer to the bound state (along the intermolecular distance) are the transition state structures, which is a new manifestation of Hammond behavior. Experimental approaches to the study of fragment binding to proteins have limitations in temporal and spatial resolution. Our network analysis of the unbinding simulations of small inhibitors from an enzyme paints a clear picture of the free energy landscape (both thermodynamics and kinetics) of ligand unbinding.

  20. Regulation of pokemon 1 activity by sumoylation.

    PubMed

    Roh, Hee-Eun; Lee, Min-Nyung; Jeon, Bu-Nam; Choi, Won-Il; Kim, Yoo-Jin; Yu, Mi-Young; Hur, Man-Wook

    2007-01-01

    Pokemon 1 is a proto-oncogenic transcriptional regulator that contains a POZ domain at the N-terminus and four Kruppel-like zinc fingers at the C-terminus. Pokemon 1 plays an important role in adipogenesis, osteogenesis, oncogenesis, and transcription of NF-kB responsive genes. Recent reports have shown that biological activities of transcription factors are regulated by sumolylation. We investigated whether Pokemon 1 is post-translationally modified by sumoylation and whether the modification affects Pokemon 1's transcriptional properties. We found that Pokemon 1 is sumoylated in vitro and in vivo. Upon careful analysis of the amino acid sequence of Pokemon 1, we found ten potential sumoylation sites located at lysines 61, 354, 371, 379, 383, 396, 486, 487, 536 and 539. We mutated each of these amino acids into arginine and tested whether the mutation could affect the transcriptional properties of Pokemon 1 on the Pokemon 1 responsive genes, such as ADH5/FDH and pG5-FRE-Luc. Wild-type Pokemon 1 potently represses transcription of ADH5/FDH. Most of the mutants, however, were weaker transcription repressors and repressed transcription 1.3-3.3 fold less effective. Although potential sumoylation sites were located close to the DNA binding domain or the nuclear localization sequence, the mutations did not alter nuclear localization or DNA binding activity. In addition, on the pG5-FRE-Luc test promoter construct, ectopic SUMO-1 repressed transcription in the presence of Pokemon 1. The sumoylation target lysine residue at amino acid 61, which is located in the middle of the POZ-domain, is important because K61R mutation resulted in a much weaker molecular interaction with corepressors. Our data suggest that Pokemon 1's activity as a transcription factor may involve sumoylation, and that sumoylation might be important in the regulation of transcription by Pokemon 1.

  1. Price To Be Paid for Two-Metal Catalysis: Magnesium Ions That Accelerate Chemistry Unavoidably Limit Product Release from a Protein Kinase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jacobsen, Douglas M.; Bao, Zhao-Qin; O'’Brien, Patrick

    Incorporation of divalent metal ions into an active site is a fundamental catalytic tool used by diverse enzymes. Divalent cations are used by protein kinases to both stabilize ATP binding and accelerate chemistry. Kinetic analysis establishes that Cyclin-dependent kinase 2 (CDK2) requires simultaneous binding of two Mg 2+ ions for catalysis of phosphoryl transfer. This tool, however, comes with a price: the rate-acceleration effects are opposed by an unavoidable rate-limiting consequence of the use of two Mg 2+ ions by CDK2. The essential metal ions stabilize ADP product binding and limit the overall rate of the reaction. We demonstrate thatmore » product release is rate limiting for activated CDK2 and evaluate the effects of the two catalytically essential Mg 2+ ions on the stability of the ADP product within the active site. We present two new crystal structures of CDK2 bound to ADP showing how the phosphate groups can be coordinated by either one or two Mg 2+ ions, with the occupancy of one site in a weaker equilibrium. Molecular dynamics simulations indicate that ADP phosphate mobility is more restricted when ADP is coordinated by two Mg 2+ ions compared to one. The structural similarity between the rigid ADP·2Mg product and the cooperatively assembled transition state provides a mechanistic rational for the rate-limiting ADP release that is observed. We demonstrate that although the simultaneous binding of two Mg 2+ ions is essential for efficient phosphoryl transfer, the presence of both Mg 2+ ions in the active site also cooperatively increases ADP affinity and opposes its release. Evolution of protein kinases must have involved careful tuning of the affinity for the second Mg 2+ ion in order to balance the needs to stabilize the chemical transition state and allow timely product release. The link between Mg 2+ site affinity and activity presents a chemical handle that may be used by regulatory factors as well as explain some mutational effects.« less

  2. Epitope mapping and immunological characterization of a major allergen TBa in tartary buckwheat.

    PubMed

    Ren, Xiaoxia; Zhang, Xin; Li, Yuying; Wang, Zhuanhua

    2010-09-01

    Predicted by an antigenic program, full-length tartary buckwheat allergen (TBa) is divided into six fragments: E1, E2, E12, E3, E4 and E34. Immunological assays revealed that E1 has the greatest binding activity to patients' serum IgE. Five mutants of E1 gene (L39R, L42R, L47R, V52R and L54R) were constructed using site-directed mutagenesis and each protein was expressed in Escherichia coli BL21. Following purification by Ni(2+) affinity chromatography, ELISA and dot-blot were performed for wild type E1 and its mutants using sera from buckwheat allergic patients and healthy controls. Mutants L42R, L47R, and L54R had weaker IgE binding activity to patient's sera than wild-type E1 implying that Leu42, Leu47, and Leu54 might be involved in the allergic activity of TBa.

  3. von Willebrand factor (VWF) propeptide binding to VWF D'D3 domain attenuates platelet activation and adhesion.

    PubMed

    Madabhushi, Sri R; Shang, Chengwei; Dayananda, Kannayakanahalli M; Rittenhouse-Olson, Kate; Murphy, Mary; Ryan, Thomas E; Montgomery, Robert R; Neelamegham, Sriram

    2012-05-17

    Noncovalent association between the von Willebrand factor (VWF) propeptide (VWFpp) and mature VWF aids N-terminal multimerization and protein compartmentalization in storage granules. This association is currently thought to dissipate after secretion into blood. In the present study, we examined this proposition by quantifying the affinity and kinetics of VWFpp binding to mature VWF using surface plasmon resonance and by developing novel anti-VWF D'D3 mAbs. Our results show that the only binding site for VWFpp in mature VWF is in its D'D3 domain. At pH 6.2 and 10mM Ca(2+), conditions mimicking intracellular compartments, VWFpp-VWF binding occurs with high affinity (K(D) = 0.2nM, k(off) = 8 × 10(-5) s(-1)). Significant, albeit weaker, binding (K(D) = 25nM, k(off) = 4 × 10(-3) s(-1)) occurs under physiologic conditions of pH 7.4 and 2.5mM Ca(2+). This interaction was also observed in human plasma (K(D) = 50nM). The addition of recombinant VWFpp in both flow-chamber-based platelet adhesion assays and viscometer-based shear-induced platelet aggregation and activation studies reduced platelet adhesion and activation partially. Anti-D'D3 mAb DD3.1, which blocks VWFpp binding to VWF-D'D3, also abrogated platelet adhesion, as shown by shear-induced platelet aggregation and activation studies. Our data demonstrate that VWFpp binding to mature VWF occurs in the circulation, which can regulate the hemostatic potential of VWF by reducing VWF binding to platelet GpIbα.

  4. Comparative Analysis of the Flax Immune Receptors L6 and L7 Suggests an Equilibrium-Based Switch Activation Model

    PubMed Central

    Chen, Chunhong; Newell, Kim; Lawrence, Gregory J.; Ellis, Jeffrey G.; Anderson, Peter A.; Dodds, Peter N.

    2016-01-01

    NOD-like receptors (NLRs) are central components of the plant immune system. L6 is a Toll/interleukin-1 receptor (TIR) domain-containing NLR from flax (Linum usitatissimum) conferring immunity to the flax rust fungus. Comparison of L6 to the weaker allele L7 identified two polymorphic regions in the TIR and the nucleotide binding (NB) domains that regulate both effector ligand-dependent and -independent cell death signaling as well as nucleotide binding to the receptor. This suggests that a negative functional interaction between the TIR and NB domains holds L7 in an inactive/ADP-bound state more tightly than L6, hence decreasing its capacity to adopt the active/ATP-bound state and explaining its weaker activity in planta. L6 and L7 variants with a more stable ADP-bound state failed to bind to AvrL567 in yeast two-hybrid assays, while binding was detected to the signaling active variants. This contrasts with current models predicting that effectors bind to inactive receptors to trigger activation. Based on the correlation between nucleotide binding, effector interaction, and immune signaling properties of L6/L7 variants, we propose that NLRs exist in an equilibrium between ON and OFF states and that effector binding to the ON state stabilizes this conformation, thereby shifting the equilibrium toward the active form of the receptor to trigger defense signaling. PMID:26744216

  5. Pre-folding IkappaBalpha alters control of NF-kappaB signaling.

    PubMed

    Truhlar, Stephanie M E; Mathes, Erika; Cervantes, Carla F; Ghosh, Gourisankar; Komives, Elizabeth A

    2008-06-27

    Transcription complex components frequently show coupled folding and binding but the functional significance of this mode of molecular recognition is unclear. IkappaBalpha binds to and inhibits the transcriptional activity of NF-kappaB via its ankyrin repeat (AR) domain. The beta-hairpins in ARs 5-6 in IkappaBalpha are weakly-folded in the free protein, and their folding is coupled to NF-kappaB binding. Here, we show that introduction of two stabilizing mutations in IkappaBalpha AR 6 causes ARs 5-6 to fold cooperatively to a conformation similar to that in NF-kappaB-bound IkappaBalpha. Free IkappaBalpha is degraded by a proteasome-dependent but ubiquitin-independent mechanism, and this process is slower for the pre-folded mutants both in vitro and in cells. Interestingly, the pre-folded mutants bind NF-kappaB more weakly, as shown by both surface plasmon resonance and isothermal titration calorimetry in vitro and immunoprecipitation experiments from cells. One consequence of the weaker binding is that resting cells containing these mutants show incomplete inhibition of NF-kappaB activation; they have significant amounts of nuclear NF-kappaB. Additionally, the weaker binding combined with the slower rate of degradation of the free protein results in reduced levels of nuclear NF-kappaB upon stimulation. These data demonstrate clearly that the coupled folding and binding of IkappaBalpha is critical for its precise control of NF-kappaB transcriptional activity.

  6. The “gating” residues Ile199 and Tyr326 in human monoamine oxidase B function in substrate and inhibitor recognition

    PubMed Central

    Milczek, Erika M.; Binda, Claudia; Rovida, Stefano; Mattevi, Andrea; Edmondson, Dale E.

    2011-01-01

    Summary The major structural difference between human monoamine oxidases A (MAO A) and B (MAO B) is that MAO A has a monopartite substrate cavity of ~550 Å3 volume and MAO B contains a dipartite cavity structure with volumes of ~290 Å3 (entrance cavity) and ~400 Å3 (substrate cavity). Ile199 and Tyr326 side chains separate these two cavities in MAO B. To probe the function of these gating residues, Ile199Ala and Ile199Ala Tyr326Ala mutant forms of MAO B were investigated. Structural data on the Ile199Ala MAO B mutant show no alterations in active site geometries compared to WT enzyme while the Ile199Ala-Tyr326Ala MAO B mutant exhibits alterations in residues 100–103 which are part of the loop gating the entrance to the active site. Both mutant enzymes exhibit catalytic properties with increased amine KM but unaltered kcat values. The altered KM values on mutation are attributed to the influence of the cavity structure in the binding and subsequent deprotonation of the amine substrate. Both mutant enzymes exhibit weaker binding affinities relative to WT enzyme for small reversible inhibitors. Ile199Ala MAO B exhibits an increase in binding affinity for reversible MAO B specific inhibitors which bridge both cavities. The Ile199Ala-Tyr326Ala double mutant exhibits inhibitor binding properties more similar to those of MAO A than to MAO B. These results demonstrate the bipartite cavity structure in MAO B plays an important role in substrate and inhibitor recognition to distinguish its specificities from those of MAO A and provides insights into specific reversible inhibitor design for these membrane-bound enzymes. PMID:21978362

  7. Probing the energetics of dissociation of carbonic anhydrase-ligand complexes in the gas phase.

    PubMed Central

    Gao, J; Wu, Q; Carbeck, J; Lei, Q P; Smith, R D; Whitesides, G M

    1999-01-01

    This paper describes the use of electrospray ionization-Fourier transform ion cyclotron mass spectrometry (ESI-FTICR-MS) to study the relative stabilities of noncovalent complexes of carbonic anhydrase II (CAII, EC 4.2.1.1) and benzenesulfonamide inhibitors in the gas phase. Sustained off-resonance irradiation collision-induced dissociation (SORI-CID) was used to determine the energetics of dissociation of these CAII-sulfonamide complexes in the gas phase. When two molecules of a benzenesulfonamide (1) were bound simultaneously to one molecule of CAII, one of them was found to exhibit significantly weaker binding (DeltaE50 = 0.4 V, where E50 is defined as the amplitude of sustained off-resonance irradiation when 50% of the protein-ligand complexes are dissociated). In solution, the benzenesulfonamide group coordinates as an anion to a Zn(II) ion bound at the active site of the enzyme. The gas phase stability of the complex with the weakly bound inhibitor was the same as that of the inhibitor complexed with apoCAII (i.e., CAII with the Zn(II) ion removed from the binding site). These results indicate that specific interactions between the sulfonamide group on the inhibitor and the Zn(II) ion on CAII were preserved in the gas phase. Experiments also showed a higher gas phase stability for the complex of para-NO2-benzenesulfonamide-CAII than that for ortho-NO2-benzenesulfonamide-CAII complex. This result further suggests that steric interactions of the inhibitors with the binding pocket of CAII parallel those in solution. Overall, these results are consistent with the hypothesis that CAII retains, at least partially, the structure of its binding pocket in the gas phase on the time scale (seconds to minutes) of the ESI-FTICR measurements. PMID:10354450

  8. Structure and function of CYP108D1 from Novosphingobium aromaticivorans DSM12444: an aromatic hydrocarbon-binding P450 enzyme.

    PubMed

    Bell, Stephen G; Yang, Wen; Yorke, Jake A; Zhou, Weihong; Wang, Hui; Harmer, Jeffrey; Copley, Rachel; Zhang, Aili; Zhou, Ruimin; Bartlam, Mark; Rao, Zihe; Wong, Luet Lok

    2012-03-01

    CYP108D1 from Novosphingobium aromaticivorans DSM12444 binds a range of aromatic hydrocarbons such as phenanthrene, biphenyl and phenylcyclohexane. Its structure, which is reported here at 2.2 Å resolution, is closely related to that of CYP108A1 (P450terp), an α-terpineol-oxidizing enzyme. The compositions and structures of the active sites of these two enzymes are very similar; the most significant changes are the replacement of Glu77 and Thr103 in CYP108A1 by Thr79 and Val105 in CYP108D1. Other residue differences lead to a larger and more hydrophobic access channel in CYP108D1. These structural features are likely to account for the weaker α-terpineol binding by CYP108D1 and, when combined with the presence of three hydrophobic phenylalanine residues in the active site, promote the binding of aromatic hydrocarbons. The haem-proximal surface of CYP108D1 shows a different charge distribution and topology to those of CYP101D1, CYP101A1 and CYP108A1, including a pronounced kink in the proximal loop of CYP108D1, which may result in poor complementarity with the [2Fe-2S] ferredoxins Arx, putidaredoxin and terpredoxin that are the respective redox partners of these three P450 enzymes. The unexpectedly low reduction potential of phenylcyclohexane-bound CYP108D1 (-401 mV) may also contribute to the low activity observed with these ferredoxins. CYP108D1 appears to function as an aromatic hydrocarbon hydroxylase that requires a different electron-transfer cofactor protein.

  9. YC-1 BINDING TO THE BETA SUBUNIT OF SOLUBLE GUANYLYL CYCLASE OVERCOMES ALLOSTERIC INHIBITION BY THE ALPHA SUBUNIT

    PubMed Central

    Purohit, Rahul; Fritz, Bradley G.; The, Juliana; Issaian, Aaron; Weichsel, Andrzej; David, Cynthia L.; Campbell, Eric; Hausrath, Andrew C.; Rassouli-Taylor, Leida; Garcin, Elsa D.; Gage, Matthew J.; Montfort, William R.

    2014-01-01

    Soluble guanylate cyclase (sGC) is a heterodimeric heme protein and the primary nitric oxide receptor. NO binding stimulates cyclase activity, leading to regulation of cardiovascular physiology and making sGC an attractive target for drug discovery. YC-1 and related compounds stimulate sGC both independently and synergistically with NO and CO binding; however, where the compounds bind and how they work remains unknown. Using linked-equilibria binding measurements, surface plasmon resonance, and domain truncations in Manduca sexta and bovine sGC, we demonstrate that YC-1 binds near or directly to the heme-containing domain of the beta subunit. In the absence of CO, YC-1 binds with Kd = 9–21 μM, depending on construct. In the presence of CO, these values decrease to 0.6–1.1 μM. Pfizer compound 25 bound ~10-fold weaker than YC-1 in the absence of CO whereas compound BAY 41–2272 bound particularly tightly in the presence of CO (Kd = 30–90 nM). Additionally, we found that CO binding is much weaker to heterodimeric sGC proteins (Kd = 50–100 μM) than to the isolated heme domain (Kd = 0.2 μM for Manduca beta H-NOX/PAS). YC-1 greatly enhanced CO binding to heterodimeric sGC, as expected (Kd = ~1 μM). These data indicate the alpha subunit induces a heme pocket conformation with lower affinity for CO and NO. YC-1 family compounds bind near the heme domain, overcoming the alpha subunit effect and inducing a heme pocket conformation with high affinity. We propose this high-affinity conformation is required for the full-length protein to achieve high catalytic activity. PMID:24328155

  10. Interrogating the relationship between rat in vivo tissue distribution and drug property data for >200 structurally unrelated molecules

    PubMed Central

    Harrell, Andrew W; Sychterz, Caroline; Ho, May Y; Weber, Andrew; Valko, Klara; Negash, Kitaw

    2015-01-01

    The ability to explain distribution patterns from drug physicochemical properties and binding characteristics has been explored for more than 200 compounds by interrogating data from quantitative whole body autoradiography studies (QWBA). These in vivo outcomes have been compared to in silico and in vitro drug property data to determine the most influential properties governing drug distribution. Consistent with current knowledge, in vivo distribution was most influenced by ionization state and lipophilicity which in turn affected phospholipid and plasma protein binding. Basic and neutral molecules were generally better distributed than acidic counterparts demonstrating weaker plasma protein and stronger phospholipid binding. The influence of phospholipid binding was particularly evident in tissues with high phospholipid content like spleen and lung. Conversely, poorer distribution of acidic drugs was associated with stronger plasma protein and weaker phospholipid binding. The distribution of a proportion of acidic drugs was enhanced, however, in tissues known to express anionic uptake transporters such as the liver and kidney. Greatest distribution was observed into melanin containing tissues of the eye, most likely due to melanin binding. Basic molecules were consistently better distributed into parts of the eye and skin containing melanin than those without. The data, therefore, suggest that drug binding to macromolecules strongly influences the distribution of total drug for a large proportion of molecules in most tissues. Reducing lipophilicity, a strategy often used in discovery to optimize pharmacokinetic properties such as absorption and clearance, also decreased the influence of nonspecific binding on drug distribution. PMID:26516585

  11. Active site residues critical for flavin binding and 5,6-dimethylbenzimidazole biosynthesis in the flavin destructase enzyme BluB.

    PubMed

    Yu, Ta-Yi; Mok, Kenny C; Kennedy, Kristopher J; Valton, Julien; Anderson, Karen S; Walker, Graham C; Taga, Michiko E

    2012-06-01

    The "flavin destructase" enzyme BluB catalyzes the unprecedented conversion of flavin mononucleotide (FMN) to 5,6-dimethylbenzimidazole (DMB), a component of vitamin B(12). Because of its unusual chemistry, the mechanism of this transformation has remained elusive. This study reports the identification of 12 mutant forms of BluB that have severely reduced catalytic function, though most retain the ability to bind flavin. The "flavin destructase" BluB is an unusual enzyme that fragments the flavin cofactor FMNH(2) in the presence of oxygen to produce 5,6-dimethylbenzimidazole (DMB), the lower axial ligand of vitamin B(12) (cobalamin). Despite the similarities in sequence and structure between BluB and the nitroreductase and flavin oxidoreductase enzyme families, BluB is the only enzyme known to fragment a flavin isoalloxazine ring. To explore the catalytic residues involved in this unusual reaction, mutants of BluB impaired in DMB biosynthesis were identified in a genetic screen in the bacterium Sinorhizobium meliloti. Of the 16 unique point mutations identified in the screen, the majority were located in conserved residues in the active site or in the unique "lid" domain proposed to shield the active site from solvent. Steady-state enzyme assays of 12 purified mutant proteins showed a significant reduction in DMB synthesis in all of the mutants, with eight completely defective in DMB production. Ten of these mutants have weaker binding affinities for both oxidized and reduced FMN, though only two have a significant effect on complex stability. These results implicate several conserved residues in BluB's unique ability to fragment FMNH(2) and demonstrate the sensitivity of BluB's active site to structural perturbations. This work lays the foundation for mechanistic studies of this enzyme and further advances our understanding of the structure-function relationship of BluB. Copyright © 2012 The Protein Society.

  12. Regulation of mRNA abundance by polypyrimidine tract-binding protein-controlled alternate 5' splice site choice.

    PubMed

    Hamid, Fursham M; Makeyev, Eugene V

    2014-11-01

    Alternative splicing (AS) provides a potent mechanism for increasing protein diversity and modulating gene expression levels. How alternate splice sites are selected by the splicing machinery and how AS is integrated into gene regulation networks remain important questions of eukaryotic biology. Here we report that polypyrimidine tract-binding protein 1 (Ptbp1/PTB/hnRNP-I) controls alternate 5' and 3' splice site (5'ss and 3'ss) usage in a large set of mammalian transcripts. A top scoring event identified by our analysis was the choice between competing upstream and downstream 5'ss (u5'ss and d5'ss) in the exon 18 of the Hps1 gene. Hps1 is essential for proper biogenesis of lysosome-related organelles and loss of its function leads to a disease called type 1 Hermansky-Pudlak Syndrome (HPS). We show that Ptbp1 promotes preferential utilization of the u5'ss giving rise to stable mRNAs encoding a full-length Hps1 protein, whereas bias towards d5'ss triggered by Ptbp1 down-regulation generates transcripts susceptible to nonsense-mediated decay (NMD). We further demonstrate that Ptbp1 binds to pyrimidine-rich sequences between the u5'ss and d5'ss and activates the former site rather than repressing the latter. Consistent with this mechanism, u5'ss is intrinsically weaker than d5'ss, with a similar tendency observed for other genes with Ptbp1-induced u5'ss bias. Interestingly, the brain-enriched Ptbp1 paralog Ptbp2/nPTB/brPTB stimulated the u5'ss utilization but with a considerably lower efficiency than Ptbp1. This may account for the tight correlation between Hps1 with Ptbp1 expression levels observed across mammalian tissues. More generally, these data expand our understanding of AS regulation and uncover a post-transcriptional strategy ensuring co-expression of a subordinate gene with its master regulator through an AS-NMD tracking mechanism.

  13. Nickel Ligation of the N-Terminal Amine of HypA Is Required for Urease Maturation in Helicobacter pylori.

    PubMed

    Hu, Heidi Q; Johnson, Ryan C; Merrell, D Scott; Maroney, Michael J

    2017-02-28

    The human pathogen Helicobacter pylori requires nickel for colonization of the acidic environment of the stomach. HypA, a Ni metallochaperone that is typically associated with hydrogenase maturation, is also required for urease maturation and acid survival of H. pylori. There are two proposed Ni site structures for HypA; one is a paramagnetic six-coordinate site characterized by X-ray absorption spectroscopy (XAS) in unmodified HypA, while another is a diamagnetic four-coordinate planar site characterized by solution nuclear magnetic resonance in an N-terminally modified HypA construct. To determine the role of the N-terminal amine in Ni binding of HypA, an N-terminal extension variant, L2*-HypA, in which a leucine residue was inserted into the second position of the amino acid sequence in the proposed Ni-binding motif, was characterized in vitro and in vivo. Structural characterization of the Ni site using XAS showed a coordination change from six-coordinate in wild-type HypA (WT-HypA) to five-coordinate pyramidal in L2*-HypA, which was accompanied by the loss of two N/O donor protein ligands and the addition of an exogenous bromide ligand from the buffer. The magnetic properties of the Ni sites in WT-HypA compared to those of the Ni sites in L2*-HypA confirmed that a spin-state change from high to low spin accompanied this change in structure. The L2*-HypA H. pylori strain was shown to be acid sensitive and deficient in urease activity in vivo. In vitro characterization showed that L2*-HypA did not disrupt the HypA-UreE interaction that is essential for urease maturation but was at least 20-fold weaker in Ni binding than WT-HypA. Characterization of the L2*-HypA variant clearly demonstrates that the N-terminal amine of HypA is involved in proper Ni coordination and is necessary for urease activity and acid survival.

  14. Nickel Ligation of the N-Terminal Amine of HypA Is Required for Urease Maturation in Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Heidi Q.; Johnson, Ryan C.; Merrell, D. Scott

    The human pathogen Helicobacter pylori requires nickel for colonization of the acidic environment of the stomach. HypA, a Ni metallochaperone that is typically associated with hydrogenase maturation, is also required for urease maturation and acid survival of H. pylori. There are two proposed Ni site structures for HypA; one is a paramagnetic six-coordinate site characterized by X-ray absorption spectroscopy (XAS) in unmodified HypA, while another is a diamagnetic four-coordinate planar site characterized by solution nuclear magnetic resonance in an N-terminally modified HypA construct. To determine the role of the N-terminal amine in Ni binding of HypA, an N-terminal extension variant,more » L2*-HypA, in which a leucine residue was inserted into the second position of the amino acid sequence in the proposed Ni-binding motif, was characterized in vitro and in vivo. Structural characterization of the Ni site using XAS showed a coordination change from six-coordinate in wild-type HypA (WT-HypA) to five-coordinate pyramidal in L2*-HypA, which was accompanied by the loss of two N/O donor protein ligands and the addition of an exogenous bromide ligand from the buffer. The magnetic properties of the Ni sites in WT-HypA compared to those of the Ni sites in L2*-HypA confirmed that a spin-state change from high to low spin accompanied this change in structure. The L2*-HypA H. pylori strain was shown to be acid sensitive and deficient in urease activity in vivo. In vitro characterization showed that L2*-HypA did not disrupt the HypA–UreE interaction that is essential for urease maturation but was at least 20-fold weaker in Ni binding than WT-HypA. Characterization of the L2*-HypA variant clearly demonstrates that the N-terminal amine of HypA is involved in proper Ni coordination and is necessary for urease activity and acid survival.« less

  15. Pharmacoinformatics study of Piperolactam A from Piper betle root as new lead for non steroidal anti fertility drug development.

    PubMed

    Amin, Sk Abdul; Bhattacharya, Plaban; Basak, Souvik; Gayen, Shovanlal; Nandy, Ashis; Saha, Achintya

    2017-04-01

    Fertility control is a burning problem all over the world to regulate population overflow and maintain ecological balance. This study is an in-silico approach to explore a non-steroidal lead as contraceptive agent in order to avoid several contraindications generated by steroidal analogues. Piperolactam A, an aristolactam isolated from Piper betle Linn. showed binding affinity towards estrogen and progesterone receptor as -8.9 and -9.0Kcal/mol (inhibition constant K i =0.294μM and 0.249μM) respectively which is even larger than that of reported antagonists such as Rohitukine and OrgC (binding affinity -8.7 and -8.4Kcal/mol; K i 0.443μM and 0.685μM respectively). The binding site exploration displayed more hydrogen bonding of Piperolactam A (His 524, Leu 346, Thr 347) than Rohitukine and OrgC (Leu 718) with associated receptors which was further confirmed by molecular dynamics simulations. The drug-likeliness of the compound has been proved from its tally with Lipinsky's Rule of Five and lowered toxicity such as cardiac toxicity, liver toxicity, mutagenicity and ecological toxicity. Endocrine disruptome and later docking guided molecular simulations revealed that Piperolactam A has weaker binding affinity and/or lower probability of binding with nuclear receptors especially hERG and cytochrome P450. The high Caco-2 permeability suggested more bioavailability hence more therapeutic efficacy of the drug. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Effect of Polysorbate 20 and Polysorbate 80 on the Higher-Order Structure of a Monoclonal Antibody and Its Fab and Fc Fragments Probed Using 2D Nuclear Magnetic Resonance Spectroscopy.

    PubMed

    Singh, Surinder M; Bandi, Swati; Jones, David N M; Mallela, Krishna M G

    2017-12-01

    We examined how polysorbate 20 (PS20; Tween 20) and polysorbate 80 (PS80; Tween 80) affect the higher-order structure of a monoclonal antibody (mAb) and its antigen-binding (Fab) and crystallizable (Fc) fragments, using near-UV circular dichroism and 2D nuclear magnetic resonance (NMR). Both polysorbates bind to the mAb with submillimolar affinity. Binding causes significant changes in the tertiary structure of mAb with no changes in its secondary structure. 2D 13 C- 1 H methyl NMR indicates that with increasing concentration of polysorbates, the Fab region showed a decrease in crosspeak volumes. In addition to volume changes, PS20 caused significant changes in the chemical shifts compared to no changes in the case of PS80. No such changes in crosspeak volumes or chemical shifts were observed in the case of Fc region, indicating that polysorbates predominantly affect the Fab region compared to the Fc region. This differential effect of polysorbates on the Fab and Fc regions was because of the lesser thermodynamic stability of the Fab compared to the Fc. These results further indicate that PS80 is the preferred polysorbate for this mAb formulation, because it offers higher protection against aggregation, causes lesser structural perturbation, and has weaker binding affinity with fewer binding sites compared to PS20. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  17. CO Binding and Ligand Discrimination in Human Myeloperoxidase†

    PubMed Central

    Murphy, Emma J.; Maréchal, Amandine; Segal, Anthony W.; Rich, Peter R.

    2015-01-01

    Despite the fact that ferrous myeloperoxidase (MPO) can bind both O2 and NO, its ability to bind CO has been questioned. UV/visible spectroscopy was used to confirm that CO induces small spectral shifts in ferrous MPO, and Fourier transform infrared difference spectroscopy showed definitively that these arose from formation of a heme ferrous–CO compound. Recombination rates after CO photolysis were monitored at 618 and 645 nm as a function of CO concentration and pH. At pH 6.3, kon and koff were 0.14 mM−1·s−1 and 0.23 s−1, respectively, yielding an unusually high KD of 1.6 mM. This affinity of MPO for CO is 10 times weaker than its affinity for O2. The observed rate constant for CO binding increased with increasing pH and was governed by a single protonatable group with a pKa of 7.8. Fourier transform infrared spectroscopy revealed two different conformations of bound CO with frequencies at 1927 and 1942 cm−1. Their recombination rate constants were identical, indicative of two forms of bound CO that are in rapid thermal equilibrium rather than two distinct protein populations with different binding sites. The ratio of bound states was pH-dependent (pKa ≈ 7.4) with the 1927 cm−1 form favored at high pH. Structural factors that account for the ligand-binding properties of MPO are identified by comparisons with published data on a range of other ligand-binding heme proteins, and support is given to the recent suggestion that the proximal His336 in MPO is in a true imidazolate state. PMID:20146436

  18. Weaker Ligands Can Dominate an Odor Blend due to Syntopic Interactions

    PubMed Central

    2013-01-01

    Most odors in natural environments are mixtures of several compounds. Perceptually, these can blend into a new “perfume,” or some components may dominate as elements of the mixture. In order to understand such mixture interactions, it is necessary to study the events at the olfactory periphery, down to the level of single-odorant receptor cells. Does a strong ligand present at a low concentration outweigh the effect of weak ligands present at high concentrations? We used the fruit fly receptor dOr22a and a banana-like odor mixture as a model system. We show that an intermediate ligand at an intermediate concentration alone elicits the neuron’s blend response, despite the presence of both weaker ligands at higher concentration, and of better ligands at lower concentration in the mixture. Because all of these components, when given alone, elicited significant responses, this reveals specific mixture processing already at the periphery. By measuring complete dose–response curves we show that these mixture effects can be fully explained by a model of syntopic interaction at a single-receptor binding site. Our data have important implications for how odor mixtures are processed in general, and what preprocessing occurs before the information reaches the brain. PMID:23315042

  19. Binding of human and rat CD59 to the terminal complement complexes.

    PubMed Central

    Lehto, T; Morgan, B P; Meri, S

    1997-01-01

    CD59-antigen (protectin) is a widely distributed glycolipid-anchored inhibitor of complement lysis. CD59 interacts with complement components C8 and C9 during assembly of the membrane attack complex (MAC). To evaluate species specificity of these interactions we have in the present study examined cross-species binding of isolated human and rat CD59 to the terminal complement components C8 and C9. By using primarily soluble CD59 isolated from urine (CD59U) potentially non-specific binding interactions of the phospholipid portion of the membrane forms of CD59 could be avoided. Sucrose density gradient ultracentrifugation analysis showed that human CD59U bound to both human and rat C8 in the SC5b-8 complexes. Similar binding occurred when rat CD59U was used. The degree of binding did not significantly differ between the heterologous and homologous CD59-C8 combinations. C9 from both species inhibited the binding of CD59 to soluble SC5b-8. In ligand blotting analysis human and rat CD59U bound to human and rat C8 alpha gamma-subunit and C9. Binding of human and rat CD59U was stronger to human than rat C9. In plate binding assays the erythrocyte form of CD59 (CD59E) bound to both human and rat C8. Binding of CD59E to heterologous C9 was considerably weaker than to homologous C9. Our results imply that the reciprocal binding sites between C8 and CD59 and to a lesser degree between CD59 and C9 are conserved between human and rat. Interactions of CD59 with the terminal C components are thus species selective but not 'homologously restricted'. Images Figure 4 Figure 5 PMID:9038722

  20. Is the Sudlow site I of human serum albumin more generous to adopt prospective anti-cancer bioorganic compound than that of bovine: A combined spectroscopic and docking simulation approach.

    PubMed

    Joshi, Ritika; Jadhao, Manojkumar; Kumar, Himank; Ghosh, Sujit Kumar

    2017-12-01

    A comparative biophysical study on the individual conformational adaptation embraced by two homologous serum albumins (SA) (bovine and human) towards a potential anticancer bioorganic compound 2-(6-chlorobenzo[d] thiazol-2-yl)-1H-benzo[de] isoquinoline-1,3(2H)- dione (CBIQD) is apparent from the discrimination in binding behavior and the ensuing consequences accomplished by combined in vitro optical spectroscopy, in silico molecular docking and molecular dynamics (MD) simulation. The Sudlow site I of HSA although anion receptive, harbors neutral CBIQD in Sudlow site I (subdomain IIA, close to Trp) of HSA, while in BSA its prefers to snugly fit into Sudlow site II (subdomain IIIA, close to Tyr). Based on discernable diminution of HSA mean fluorescence lifetime as a function of biluminophore concentration, facile occurrence of fluorescence resonance energy transfer (FRET) is substantiated as the probable quenching mechanism accompanied by structural deformations in the protein ensemble. CBIQD establishes itself within HSA close to Trp214, and consequently reduces the micropolarity of the cybotactic environment that is predominantly constituted by hydrophobic amino acid residues. The stronger association of CBIQD with HSA encourages an allosteric modulation leading to slight deformation in its secondary structure whereas for BSA the association is comparatively weaker. Sudlow site I of HSA is capable to embrace a favorable conformation like malleable gold to provide room for incoming CBIQD, whereas for BSA it behaves more like rigid cast-iron which does not admit any change thus forcing CBIQD to occupy an altogether different binding location i.e. the Sudlow site II. The anticancer CBIQD is found to be stable within the HSA scaffold as vindicated by root mean square deviation (RMSD) and root mean square fluctuation (RMSF) obtained by MD simulation. A competitively inhibited esterase-like activity of HSA upon CBIQD binding to Lys199 and Arg257 residues, plausibly envisions that similar naphthalimide based prodrugs, bearing ester functionality, can be particularly activated by Sudlow site I of HSA. The consolidated spectroscopic research described herein may encourage design of naphthalimide based pro-drugs for effective in vivo biodistribution using HSA-based drug delivery systems. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Discovering Small Molecule Inhibitors Targeted to Ligand-Stimulated RAGE-DIAPH1 Signaling Transduction

    NASA Astrophysics Data System (ADS)

    Pan, Jinhong

    The receptor of advanced glycation end product (RAGE) is a multiligand receptor of the immunoglobulin superfamily of cell surface molecules, which plays an important role in immune responses. Full-length RAGE includes three extracellular immunoglobulin domains, a transmembrane domain and an intracellular domain. It is a pattern recognition receptor that can bind diverse ligands. NMR spectroscopy and x-ray crystallization studies of the extracellular domains of RAGE indicate that RAGE ligands bind by distinct charge- and hydrophobicity-dependent mechanisms. It is found that calgranulin binding to the C1C2 domain or AGEs binding to the V domain activates extracellular signaling, which triggers interactions of the RAGE cytoplasmic tail (ctRAGE) with intracellular effector, such as diaphanous 1 (DIAPH1), to initiate signal transduction cascades. ctRAGE is essential for RAGE-ligand-mediated signal transduction and consequent modulation of gene expression and cellular properties. RAGE is over-expressed in diseased tissues of most RAGE-associated pathogenic conditions, such as complications of Alzheimer's diseases, diabetes, vascular diseases, inflammation, cancers and neurodegeneration. They are the major diseases affecting a large population worldwide. RAGE can function as a biomarker or drug target for these diseases. The cytoplasmic tail of RAGE can be used as a drug target to inhibit RAGE-induced intracellular signaling by small molecule inhibitors to treat RAGE-associated diseases. We developed a high throughput screening assay with which we probed a small molecule library of 58,000 compounds to find that 777 small molecules displayed 50% inhibition and 97 compounds demonstrated dose-dependent inhibition of the binding of ctRAGE-DIAPH1. Eventually, there were 13 compounds which displayed dose-dependent inhibition of ctRAGE binding to DIAPH1 and direct binding to ctRAGE analyzed by 15N HSQC-NMR and native tryptophan fluorescence titration experiments; thus, they were identified as competitive inhibitors of ctRAGE interaction with DIAPH1. These compounds, which exhibit in vitro and in vivo inhibition of RAGE-dependent molecular processes, present attractive molecular scaffolds for the development of therapeutics against RAGE-induced diseases, and provide support for the feasibility of inhibition of protein-protein interaction (PPI). Among those 13 compounds, compounds 3, 4 and 11 with novel druggable structural features, strongly bound to ctRAGE with Kd values reaching to 18, 2 and 2 nM, respectively. There were 28 quinoline acetamide analogues of compound 11, and 20 carbazole/benzimidazole/indole 1,3-diamino-2-propanol analogues of compounds 3 and 4 were selected for SAR study by 15N-HSQC NMR. Native tryptophan fluorescence titration studies quantified the binding affinity and confirmed that tryptophan is involved in this interaction. The binding affinity tests found 19 compounds binding to ctRAGE with nanomolar binding affinities. They would be developed into lead compounds for in vitro and in vivo studies. The site directed mutagenesis was adopted to verify the interaction mode, in which the amino acid residues at the binding sites (Q3 and Q6) were knocked out individually and replaced with one alanine, resulting in weaker binding to the selective small molecule inhibitors across these knock-out sites. Therefore, it is confirmed that the amino acid residues of ctRAGE, Q3, and Q6, were involved in binding with R24, R102, R108, R 166, R167 and R208. Mutation modeling verified the established binding models for ctRAGE-R25 and ctRAGE-compound 3. Mapping the binding sites by NMR and CYANA calculation which established three-dimensional structure models of the ctRAGE-compound 3 complex and the ctRAGE-R25 complex, found the interactions between ctRAGE and compound 3 take place at W2, Q3 and Q6, while the interactions between ctRAGE and R25 take place W2, Q3, Q6 and E11. Their binding sites overlap the binding sites of ctRAGE-DIAPH1, which results that these two inhibitors bind to ctRAGE by replacing DIAPH1, and thus inhibit RAGE signaling.

  2. Analysis of nucleoside-binding proteins by ligand-specific elution from dye resin: application to Mycobacterium tuberculosis aldehyde dehydrogenases.

    PubMed

    Kim, Chang-Yub; Webster, Cecelia; Roberts, Justin K M; Moon, Jin Ho; Alipio Lyon, Emily Z; Kim, Heungbok; Yu, Minmin; Hung, Li-Wei; Terwilliger, Thomas C

    2009-12-01

    We show that Cibacron Blue F3GA dye resin chromatography can be used to identify ligands that specifically interact with proteins from Mycobacterium tuberculosis, and that the identification of these ligands can facilitate structure determination by enhancing the quality of crystals. Four native Mtb proteins of the aldehyde dehydrogenase (ALDH) family were previously shown to be specifically eluted from a Cibacron Blue F3GA dye resin with nucleosides. In this study we characterized the nucleoside-binding specificity of one of these ALDH isozymes (recombinant Mtb Rv0223c) and compared these biochemical results with co-crystallization experiments with different Rv0223c-nucleoside pairings. We found that the strongly interacting ligands (NAD and NADH) aided formation of high-quality crystals, permitting solution of the first Mtb ALDH (Rv0223c) structure. Other nucleoside ligands (AMP, FAD, adenosine, GTP and NADP) exhibited weaker binding to Rv0223c, and produced co-crystals diffracting to lower resolution. Difference electron density maps based on crystals of Rv0223c with various nucleoside ligands show most share the binding site where the natural ligand NAD binds. From the high degree of similarity of sequence and structure compared to human mitochondrial ALDH-2 (BLAST Z-score = 53.5 and RMSD = 1.5 A), Rv0223c appears to belong to the ALDH-2 class. An altered oligomerization domain in the Rv0223c structure seems to keep this protein as monomer whereas native human ALDH-2 is a multimer.

  3. The effect of CNTs on structures and catalytic properties of AuPd clusters for H2O2 synthesis.

    PubMed

    Yang, Hua-feng; Xie, Peng-yang; Yu, Hui-you; Li, Xiao-nian; Wang, Jian-guo

    2012-12-28

    The structures and catalytic properties of AuPd clusters supported on carbon nanotubes (CNTs) for H(2)O(2) synthesis have been investigated by means of density functional theory calculations. Firstly, the structures of AuPd clusters are strongly influenced by CNTs, in which the bottom layers are mainly composed of Pd and the top layers are a mix of Au and Pd due to the stronger binding of Pd than Au on CNTs. Especially, it is found that O(2) adsorption on the Pd/CNTs interfacial sites is much weaker than that on the only Pd sites, which is in contrast to transition metal oxide (for example TiO(2), Al(2)O(3), CeO(2)) supported metal clusters. Furthermore, Pd ensembles on the interfacial sites have far superior catalytic properties for H(2)O(2) formation than those away from CNT supports due to the changes in electronic structures caused by the CNTs. Therefore, our study provides a physical insight into the enhanced role of carbon supports in H(2)O(2) synthesis over supported AuPd catalysts.

  4. Insight into the molecular mechanism of yeast acetyl-coenzyme A carboxylase mutants F510I, N485G, I69E, E477R, and K73R resistant to soraphen A

    NASA Astrophysics Data System (ADS)

    Gao, Jian; Liang, Li; Chen, Qingqing; Zhang, Ling; Huang, Tonghui

    2018-02-01

    Acetyl-coenzyme A carboxylases (ACCs) is the first committed enzyme of fatty acid synthesis pathway. The inhibition of ACC is thought to be beneficial not only for diseases related to metabolism, such as type-2 diabetes, but also for infectious disease like bacterial infection disease. Soraphen A, a potent allosteric inhibitor of BC domain of yeast ACC, exhibit lower binding affinities to several yeast ACC mutants and the corresponding drug resistance mechanisms are still unknown. We report here a theoretical study of binding of soraphen A to wild type and yeast ACC mutants (including F510I, N485G, I69E, E477R, and K73R) via molecular dynamic simulation and molecular mechanics/generalized Born surface area free energy calculations methods. The calculated binding free energies of soraphen A to yeast ACC mutants are weaker than to wild type, which is highly consistent with the experimental results. The mutant F510I weakens the binding affinity of soraphen A to yeast ACC mainly by decreasing the van der Waals contributions, while the weaker binding affinities of Soraphen A to other yeast ACC mutants including N485G, I69E, E477R, and K73R are largely attributed to the decreased net electrostatic (ΔE ele + ΔG GB) interactions. Our simulation results could provide important insights for the development of more potent ACC inhibitors.

  5. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    C Harrison; G Meinke; H Kwun

    2011-12-31

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistentmore » with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.« less

  6. Impact of Dendrimer Terminal Group Chemistry on Blockage of the Anthrax Toxin Channel: A Single Molecule Study.

    PubMed

    Yamini, Goli; Kalu, Nnanya; Nestorovich, Ekaterina M

    2016-11-15

    Nearly all the cationic molecules tested so far have been shown to reversibly block K⁺ current through the cation-selective PA 63 channels of anthrax toxin in a wide nM-mM range of effective concentrations. A significant increase in channel-blocking activity of the cationic compounds was achieved when multiple copies of positively charged ligands were covalently linked to multivalent scaffolds, such as cyclodextrins and dendrimers. Even though multivalent binding can be strong when the individual bonds are relatively weak, for drug discovery purposes we often strive to design multivalent compounds with high individual functional group affinity toward the respective binding site on a multivalent target. Keeping this requirement in mind, here we perform a single-channel/single-molecule study to investigate kinetic parameters of anthrax toxin PA 63 channel blockage by second-generation (G2) poly(amido amine) (PAMAM) dendrimers functionalized with different surface ligands, including G2-NH₂, G2-OH, G2-succinamate, and G2-COONa. We found that the previously reported difference in IC 50 values of the G2-OH/PA 63 and G2-NH₂/PA 63 binding was determined by both on- and off-rates of the reversible dendrimer/channel binding reaction. In 1 M KCl, we observed a decrease of about three folds in k o n and a decrease of only about ten times in t r e s with G2-OH compared to G2-NH₂. At the same time for both blockers, k o n and t r e s increased dramatically with transmembrane voltage increase. PAMAM dendrimers functionalized with negatively charged succinamate, but not carboxyl surface groups, still had some residual activity in inhibiting the anthrax toxin channels. At 100 mV, the on-rate of the G2-succinamate binding was comparable with that of G2-OH but showed weaker voltage dependence when compared to G2-OH and G2-NH₂. The residence time of G2-succinamate in the channel exhibited opposite voltage dependence compared to G2-OH and G2-NH₂, increasing with the cis -negative voltage increase. We also describe kinetics of the PA 63 ion current modulation by two different types of the "imperfect" PAMAM dendrimers, the mixed-surface G2 75% OH 25% NH₂ dendrimer and G3-NH₂ dendron. At low voltages, both "imperfect" dendrimers show similar rate constants but significantly weaker voltage sensitivity when compared with the intact G2-NH₂ PAMAM dendrimer.

  7. Impact of Dendrimer Terminal Group Chemistry on Blockage of the Anthrax Toxin Channel: A Single Molecule Study

    PubMed Central

    Yamini, Goli; Kalu, Nnanya; Nestorovich, Ekaterina M.

    2016-01-01

    Nearly all the cationic molecules tested so far have been shown to reversibly block K+ current through the cation-selective PA63 channels of anthrax toxin in a wide nM–mM range of effective concentrations. A significant increase in channel-blocking activity of the cationic compounds was achieved when multiple copies of positively charged ligands were covalently linked to multivalent scaffolds, such as cyclodextrins and dendrimers. Even though multivalent binding can be strong when the individual bonds are relatively weak, for drug discovery purposes we often strive to design multivalent compounds with high individual functional group affinity toward the respective binding site on a multivalent target. Keeping this requirement in mind, here we perform a single-channel/single-molecule study to investigate kinetic parameters of anthrax toxin PA63 channel blockage by second-generation (G2) poly(amido amine) (PAMAM) dendrimers functionalized with different surface ligands, including G2-NH2, G2-OH, G2-succinamate, and G2-COONa. We found that the previously reported difference in IC50 values of the G2-OH/PA63 and G2-NH2/PA63 binding was determined by both on- and off-rates of the reversible dendrimer/channel binding reaction. In 1 M KCl, we observed a decrease of about three folds in kon and a decrease of only about ten times in tres with G2-OH compared to G2-NH2. At the same time for both blockers, kon and tres increased dramatically with transmembrane voltage increase. PAMAM dendrimers functionalized with negatively charged succinamate, but not carboxyl surface groups, still had some residual activity in inhibiting the anthrax toxin channels. At 100 mV, the on-rate of the G2-succinamate binding was comparable with that of G2-OH but showed weaker voltage dependence when compared to G2-OH and G2-NH2. The residence time of G2-succinamate in the channel exhibited opposite voltage dependence compared to G2-OH and G2-NH2, increasing with the cis-negative voltage increase. We also describe kinetics of the PA63 ion current modulation by two different types of the “imperfect” PAMAM dendrimers, the mixed-surface G2 75% OH 25% NH2 dendrimer and G3-NH2 dendron. At low voltages, both “imperfect” dendrimers show similar rate constants but significantly weaker voltage sensitivity when compared with the intact G2-NH2 PAMAM dendrimer. PMID:27854272

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, M.; Shi, W; Rinaldo-Mathis, A

    Inhibition of human purine nucleoside phosphorylase (PNP) stops growth of activated T-cells and the formation of 6-oxypurine bases, making it a target for leukemia, autoimmune disorders, and gout. Four generations of ribocation transition-state mimics bound to PNP are structurally characterized. Immucillin-H (K*{sub i} = 58 pM, first-generation) contains an iminoribitol cation with four asymmetric carbons. DADMe-Immucillin-H (K*{sub i} = 9 pM, second-generation), uses a methylene-bridged dihydroxypyrrolidine cation with two asymmetric centers. DATMe-Immucillin-H (K*{sub i} = 9 pM, third-generation) contains an open-chain amino alcohol cation with two asymmetric carbons. SerMe-ImmH (K*{sub i} = 5 pM, fourth-generation) uses achiral dihydroxyaminoalcohol seramide asmore » the ribocation mimic. Crystal structures of PNPs establish features of tight binding to be; (1) ion-pair formation between bound phosphate (or its mimic) and inhibitor cation, (2) leaving-group interactions to N1, O6, and N7 of 9-deazahypoxanthine, (3) interaction between phosphate and inhibitor hydroxyl groups, and (4) His257 interacting with the 5{prime}-hydroxyl group. The first generation analogue is an imperfect fit to the catalytic site with a long ion pair distance between the iminoribitol and bound phosphate and weaker interactions to the leaving group. Increasing the ribocation to leaving-group distance in the second- to fourth-generation analogues provides powerful binding interactions and a facile synthetic route to powerful inhibitors. Despite chemical diversity in the four generations of transition-state analogues, the catalytic site geometry is almost the same for all analogues. Multiple solutions in transition-state analogue design are available to convert the energy of catalytic rate enhancement to binding energy in human PNP.« less

  9. Experimental identification of specificity determinants in the domain linker of a LacI/GalR protein: bioinformatics-based predictions generate true positives and false negatives.

    PubMed

    Meinhardt, Sarah; Swint-Kruse, Liskin

    2008-12-01

    In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.

  10. Differences in the binding of the primary quinone receptor in Photosystem I and reaction centres of Rhodobacter sphaeroides-R26 studied with transient EPR spectroscopy

    NASA Astrophysics Data System (ADS)

    van der Est, A.; Sieckmann, I.; Lubitz, W.; Stehlik, D.

    1995-05-01

    The binding of the primary quinone acceptor, Q, in Photosystem I (PS I) and reaction centres (RC's) of Rhodobacter Sphaeroide-R26 in which, the non-heme iron has been replaced by zinc (Zn-bRC's) is studied using transient EPR spectroscopy. In PS I, Q is phylloquinone (vitamin K 1, VK 1) and is referred to as A 1. In Zn-bRC's, it is ubiquinone-10 (UQ 10) and called Q A. Native samples of the two RC's as well as those in which A 1 and Q A have been replaced by perdeuterated napthoquinone (NQ- d6) and duroquinone (DQ- d12) are compared. The spin polarized K-band (24 GHz) spectra of the charge separated state P +.Q -. (P = primary chlorophyll donor) in Zn-bRC's show that substitution of Q A, with NQ- d6 and DQ- d12 does not have a measurable effect on the quinone orientation in the Q A site. In contrast, large differences in the orientation of VK 1, NQ- d6 and DQ- d12 in the A 1 site in PS I are found. In addition, all three quinones in PS I are oriented differently than Q A in Zn-bRC's. Further, the x and y principal values of the g-tensors of VK 1-., NQ -. and DQ -. in PS I are shown to be significantly larger than in frozen alcohol and Zn-bRC's. It is suggested that the differences in the orientation and a g-values of the quinones in the two RC's arise from a weaker binding to the protein in PS I.

  11. Regulation of mRNA Abundance by Polypyrimidine Tract-Binding Protein-Controlled Alternate 5′ Splice Site Choice

    PubMed Central

    Hamid, Fursham M.; Makeyev, Eugene V.

    2014-01-01

    Alternative splicing (AS) provides a potent mechanism for increasing protein diversity and modulating gene expression levels. How alternate splice sites are selected by the splicing machinery and how AS is integrated into gene regulation networks remain important questions of eukaryotic biology. Here we report that polypyrimidine tract-binding protein 1 (Ptbp1/PTB/hnRNP-I) controls alternate 5′ and 3′ splice site (5′ss and 3′ss) usage in a large set of mammalian transcripts. A top scoring event identified by our analysis was the choice between competing upstream and downstream 5′ss (u5′ss and d5′ss) in the exon 18 of the Hps1 gene. Hps1 is essential for proper biogenesis of lysosome-related organelles and loss of its function leads to a disease called type 1 Hermansky-Pudlak Syndrome (HPS). We show that Ptbp1 promotes preferential utilization of the u5′ss giving rise to stable mRNAs encoding a full-length Hps1 protein, whereas bias towards d5′ss triggered by Ptbp1 down-regulation generates transcripts susceptible to nonsense-mediated decay (NMD). We further demonstrate that Ptbp1 binds to pyrimidine-rich sequences between the u5′ss and d5′ss and activates the former site rather than repressing the latter. Consistent with this mechanism, u5′ss is intrinsically weaker than d5′ss, with a similar tendency observed for other genes with Ptbp1-induced u5′ss bias. Interestingly, the brain-enriched Ptbp1 paralog Ptbp2/nPTB/brPTB stimulated the u5′ss utilization but with a considerably lower efficiency than Ptbp1. This may account for the tight correlation between Hps1 with Ptbp1 expression levels observed across mammalian tissues. More generally, these data expand our understanding of AS regulation and uncover a post-transcriptional strategy ensuring co-expression of a subordinate gene with its master regulator through an AS-NMD tracking mechanism. PMID:25375251

  12. Sequence and structure insights of kazal type thrombin inhibitor protein: Studied with phylogeny, homology modeling and dynamic MM/GBSA studies.

    PubMed

    Jadhav, Aparna; Dash, RadhaCharan; Hirwani, Raj; Abdin, Malik

    2018-03-01

    Despite the wide medical importance of serine protease inhibitors, many of kazal type proteins are still to be explored. These thrombin inhibiting proteins are found in the digestive system of hematophagous organisms mainly Arthropods. We studied one of such protein i.e. Kazal type-1 protein from sand-fly Phlebotomus papatasi as its structure and interaction with thrombin is unclear. Initially, Dipetalin a kazal-follistasin domain protein was run through PSI-BLAST to retrieve related sequences. Using this set of sequence a phylogenetic tree was constructed, which identified a distantly related kazal type-1 protein. A three-dimensional structure was predicted for this protein and was aligned with Rhodniin for further evaluation. To have a comparative understanding of it's binding at the thrombin active site, the aligned kazal model-thrombin and rhodniin-thrombin complexes were subjected to molecular dynamics simulations. Dynamics analysis with reference to main chain RMSD, H-chain residue RMSF and total energy showed rhodniin-thrombin complex as a more stable system. Further, the MM/GBSA method was applied that calculated the binding free energy (ΔG binding ) for rhodniin and kazal model as -220.32kcal/Mol and -90.70kcal/Mol, respectively. Thus, it shows that kazal model has weaker bonding with thrombin, unlike rhodniin. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Concentration-dependent Cu(II) binding to prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry

    2008-03-01

    The prion protein plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The normal function of the prion protein is unknown, but it has been linked to its ability to bind copper ions. Experimental evidence suggests that copper can be bound in three distinct modes depending on its concentration, but only one of those binding modes has been fully characterized experimentally. Using a newly developed hybrid DFT/DFT method [1], which combines Kohn-Sham DFT with orbital-free DFT, we have examined all the binding modes and obtained their detailed binding geometries and copper ion binding energies. Our results also provide explanation for experiments, which have found that when the copper concentration increases the copper binding mode changes, surprisingly, from a stronger to a weaker one. Overall, our results indicate that prion protein can function as a copper buffer. 1. Hodak, Lu, Bernholc, JCP, in press.

  14. Regeneration of bovine and octopus opsins in situ with natural and artificial retinals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koutalos, Y.; Ebrey, T.G.; Tsuda, M.

    1989-03-21

    The authors consider the problem of color regulation in visual pigments for both bovine rhodopsin and octopus rhodopsin. Both pigments have 11-cis-retinal as their chromophore. These rhodopsins were bleached in their native membranes, and the opsins were regenerated with natural and artificial chromophores. Both bovine and octopus opsins were regenerated with the 9-cis- and 11-cis-retinal isomers, but the octopus opsin was additionally regenerated with the 13-cis and all-trans isomers. Titration of the octopus opsin with 11-cis-retinal gave an extinction coefficient for octopus rhodopsin of 27,000 {plus minus} 3,000 M{sup {minus}1} cm{sup {minus}1} at 475 nm. The absorption maxima of bovinemore » artificial pigments formed by regenerating opsin with the 11-cis dihydro series of chromophores support a color regulation model for bovine rhodopsin in which the chromophore-binding site of the protein has two negative charges: one directly hydrogen bonded to the Schiff base nitrogen and another near carbon-13. Formation of octopus artificial pigments with both all-trans and 11-cis dihydro chromophores leads to a similar model for octopus rhodopsin and metarhodopsin: there are two negative charges in the chromophore-binding site, one directly hydrogen bonded to the Schiff base nitrogen and a second near carbon-13. The interaction of this second charge with the chromophore in octopus rhodopsin is weaker than in bovine, while in metarhodopsin it is as strong as in bovine.« less

  15. Different inhibitory potency of febuxostat towards mammalian and bacterial xanthine oxidoreductases: insight from molecular dynamics

    PubMed Central

    Kikuchi, Hiroto; Fujisaki, Hiroshi; Furuta, Tadaomi; Okamoto, Ken; Leimkühler, Silke; Nishino, Takeshi

    2012-01-01

    Febuxostat, a drug recently approved in the US, European Union and Japan for treatment of gout, inhibits xanthine oxidoreductase (XOR)-mediated generation of uric acid during purine catabolism. It inhibits bovine milk XOR with a Ki in the picomolar-order, but we found that it is a much weaker inhibitor of Rhodobacter capsulatus XOR, even though the substrate-binding pockets of mammalian and bacterial XOR are well-conserved as regards to catalytically important residues and three-dimensional structure, and both permit the inhibitor to be accommodated in the active site, as indicated by computational docking studies. To clarify the reason for the difference of inhibitory potency towards the two XORs, we performed molecular dynamics simulations. The results indicate that differences in mobility of hydrophobic residues that do not directly interact with the substrate account for the difference in inhibitory potency. PMID:22448318

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Mi; Gustchina, Alla; Matúz, Krisztina

    Interactions between the protease (PR) encoded by the xenotropic murine leukemia virus-related virus and a number of potential inhibitors have been investigated by biochemical and structural techniques. It was observed that several inhibitors used clinically against HIV PR exhibit nanomolar or even subnanomolar values of K{sub i}, depending on the exact experimental conditions. Both TL-3, a universal inhibitor of retroviral PRs, and some inhibitors originally shown to inhibit plasmepsins were also quite potent, whereas inhibition by pepstatin A was considerably weaker. Crystal structures of the complexes of xenotropic murine leukemia virus-related virus PR with TL-3, amprenavir and pepstatin A weremore » solved at high resolution and compared with the structures of complexes of these inhibitors with other retropepsins. Whereas TL-3 and amprenavir bound in a predictable manner, spanning the substrate-binding site of the enzyme, two molecules of pepstatin A bound simultaneously in an unprecedented manner, leaving the catalytic water molecule in place.« less

  17. Flavin binding to the deca-heme cytochrome MtrC: Insights from computational molecular simulation

    DOE PAGES

    Breuer, Marian; Rosso, Kevin  M.; Blumberger, Jochen

    2015-12-15

    Here, certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrCmore » from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (K d) = 490 μM, in good agreement with recent experimental estimates, K d = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.« less

  18. Multimer Formation Explains Allelic Suppression of PRDM9 Recombination Hotspots.

    PubMed

    Baker, Christopher L; Petkova, Pavlina; Walker, Michael; Flachs, Petr; Mihola, Ondrej; Trachtulec, Zdenek; Petkov, Petko M; Paigen, Kenneth

    2015-09-01

    Genetic recombination during meiosis functions to increase genetic diversity, promotes elimination of deleterious alleles, and helps assure proper segregation of chromatids. Mammalian recombination events are concentrated at specialized sites, termed hotspots, whose locations are determined by PRDM9, a zinc finger DNA-binding histone methyltransferase. Prdm9 is highly polymorphic with most alleles activating their own set of hotspots. In populations exhibiting high frequencies of heterozygosity, questions remain about the influences different alleles have in heterozygous individuals where the two variant forms of PRDM9 typically do not activate equivalent populations of hotspots. We now find that, in addition to activating its own hotspots, the presence of one Prdm9 allele can modify the activity of hotspots activated by the other allele. PRDM9 function is also dosage sensitive; Prdm9+/- heterozygous null mice have reduced numbers and less active hotspots and increased numbers of aberrant germ cells. In mice carrying two Prdm9 alleles, there is allelic competition; the stronger Prdm9 allele can partially or entirely suppress chromatin modification and recombination at hotspots of the weaker allele. In cell cultures, PRDM9 protein variants form functional heteromeric complexes which can bind hotspots sequences. When a heteromeric complex binds at a hotspot of one PRDM9 variant, the other PRDM9 variant, which would otherwise not bind, can still methylate hotspot nucleosomes. We propose that in heterozygous individuals the underlying molecular mechanism of allelic suppression results from formation of PRDM9 heteromers, where the DNA binding activity of one protein variant dominantly directs recombination initiation towards its own hotspots, effectively titrating down recombination by the other protein variant. In natural populations with many heterozygous individuals, allelic competition will influence the recombination landscape.

  19. Multimer Formation Explains Allelic Suppression of PRDM9 Recombination Hotspots

    PubMed Central

    Baker, Christopher L.; Petkova, Pavlina; Walker, Michael; Flachs, Petr; Mihola, Ondrej; Trachtulec, Zdenek; Petkov, Petko M.; Paigen, Kenneth

    2015-01-01

    Genetic recombination during meiosis functions to increase genetic diversity, promotes elimination of deleterious alleles, and helps assure proper segregation of chromatids. Mammalian recombination events are concentrated at specialized sites, termed hotspots, whose locations are determined by PRDM9, a zinc finger DNA-binding histone methyltransferase. Prdm9 is highly polymorphic with most alleles activating their own set of hotspots. In populations exhibiting high frequencies of heterozygosity, questions remain about the influences different alleles have in heterozygous individuals where the two variant forms of PRDM9 typically do not activate equivalent populations of hotspots. We now find that, in addition to activating its own hotspots, the presence of one Prdm9 allele can modify the activity of hotspots activated by the other allele. PRDM9 function is also dosage sensitive; Prdm9 +/- heterozygous null mice have reduced numbers and less active hotspots and increased numbers of aberrant germ cells. In mice carrying two Prdm9 alleles, there is allelic competition; the stronger Prdm9 allele can partially or entirely suppress chromatin modification and recombination at hotspots of the weaker allele. In cell cultures, PRDM9 protein variants form functional heteromeric complexes which can bind hotspots sequences. When a heteromeric complex binds at a hotspot of one PRDM9 variant, the other PRDM9 variant, which would otherwise not bind, can still methylate hotspot nucleosomes. We propose that in heterozygous individuals the underlying molecular mechanism of allelic suppression results from formation of PRDM9 heteromers, where the DNA binding activity of one protein variant dominantly directs recombination initiation towards its own hotspots, effectively titrating down recombination by the other protein variant. In natural populations with many heterozygous individuals, allelic competition will influence the recombination landscape. PMID:26368021

  20. Computational design of nanoparticle drug delivery systems for selective targeting

    NASA Astrophysics Data System (ADS)

    Duncan, Gregg A.; Bevan, Michael A.

    2015-09-01

    Ligand-functionalized nanoparticles capable of selectively binding to diseased versus healthy cell populations are attractive for improved efficacy of nanoparticle-based drug and gene therapies. However, nanoparticles functionalized with high affinity targeting ligands may lead to undesired off-target binding to healthy cells. In this work, Monte Carlo simulations were used to quantitatively determine net surface interactions, binding valency, and selectivity between targeted nanoparticles and cell surfaces. Dissociation constant, KD, and target membrane protein density, ρR, are explored over a range representative of healthy and cancerous cell surfaces. Our findings show highly selective binding to diseased cell surfaces can be achieved with multiple, weaker affinity targeting ligands that can be further optimized by varying the targeting ligand density, ρL. Using the approach developed in this work, nanomedicines can be optimally designed for exclusively targeting diseased cells and tissues.Ligand-functionalized nanoparticles capable of selectively binding to diseased versus healthy cell populations are attractive for improved efficacy of nanoparticle-based drug and gene therapies. However, nanoparticles functionalized with high affinity targeting ligands may lead to undesired off-target binding to healthy cells. In this work, Monte Carlo simulations were used to quantitatively determine net surface interactions, binding valency, and selectivity between targeted nanoparticles and cell surfaces. Dissociation constant, KD, and target membrane protein density, ρR, are explored over a range representative of healthy and cancerous cell surfaces. Our findings show highly selective binding to diseased cell surfaces can be achieved with multiple, weaker affinity targeting ligands that can be further optimized by varying the targeting ligand density, ρL. Using the approach developed in this work, nanomedicines can be optimally designed for exclusively targeting diseased cells and tissues. Electronic supplementary information (ESI) available: Movie showing simulation renderings of targeted (ρL = 1820/μm2, KD = 120 μM) nanoparticle selective binding to cancer (ρR = 256/μm2) vs. healthy (ρR = 64/μm2) cell surfaces. Target membrane proteins have linear color scale depending on binding energy ranging from white when unbound (URL = 0) to red when tightly bound (URL = UM). See DOI: 10.1039/c5nr03691g

  1. Mechanistic insights into the recognition of 5-methylcytosine oxidation derivatives by the SUVH5 SRA domain.

    PubMed

    Rajakumara, Eerappa; Nakarakanti, Naveen Kumar; Nivya, M Angel; Satish, Mutyala

    2016-02-04

    5-Methylcytosine (5 mC) is associated with epigenetic gene silencing in mammals and plants. 5 mC is consecutively oxidized to 5-hydroxymethylcytosine (5 hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) by ten-eleven translocation enzymes. We performed binding and structural studies to investigate the molecular basis of the recognition of the 5 mC oxidation derivatives in the context of a CG sequence by the SET- and RING-associated domain (SRA) of the SUVH5 protein (SUVH5 SRA). Using calorimetric measurements, we demonstrate that the SRA domain binds to the hydroxymethylated CG (5hmCG) DNA duplex in a similar manner to methylated CG (5mCG). Interestingly, the SUVH5 SRA domain exhibits weaker affinity towards carboxylated CG (5caCG) and formylated CG (5fCG). We report the 2.6 Å resolution crystal structure of the SUVH5 SRA domain in a complex with fully hydroxymethyl-CG and demonstrate a dual flip-out mechanism, whereby the symmetrical 5hmCs are simultaneously extruded from the partner strands of the DNA duplex and are positioned within the binding pockets of individual SRA domains. The hydroxyl group of 5hmC establishes both intra- and intermolecular interactions in the binding pocket. Collectively, we show that SUVH5 SRA recognizes 5hmC in a similar manner to 5 mC, but exhibits weaker affinity towards 5 hmC oxidation derivatives.

  2. Sorption of trivalent lanthanides and actinides onto montmorillonite: Macroscopic, thermodynamic and structural evidence for ternary hydroxo and carbonato surface complexes on multiple sorption sites.

    PubMed

    Fernandes, M Marques; Scheinost, A C; Baeyens, B

    2016-08-01

    The credibility of long-term safety assessments of radioactive waste repositories may be greatly enhanced by a molecular level understanding of the sorption processes onto individual minerals present in the near- and far-fields. In this study we couple macroscopic sorption experiments to surface complexation modelling and spectroscopic investigations, including extended X-ray absorption fine structure (EXAFS) and time-resolved laser fluorescence spectroscopies (TRLFS), to elucidate the uptake mechanism of trivalent lanthanides and actinides (Ln/An(III)) by montmorillonite in the absence and presence of dissolved carbonate. Based on the experimental sorption isotherms for the carbonate-free system, the previously developed 2 site protolysis non electrostatic surface complexation and cation exchange (2SPNE SC/CE) model needed to be complemented with an additional surface complexation reaction onto weak sites. The fitting of sorption isotherms in the presence of carbonate required refinement of the previously published model by reducing the strong site capacity and by adding the formation of Ln/An(III)-carbonato complexes both on strong and weak sites. EXAFS spectra of selected Am samples and TRLFS spectra of selected Cm samples corroborate the model assumptions by showing the existence of different surface complexation sites and evidencing the formation of Ln/An(III) carbonate surface complexes. In the absence of carbonate and at low loadings, Ln/An(III) form strong inner-sphere complexes through binding to three Al(O,OH)6 octahedra, most likely by occupying vacant sites in the octahedral layers of montmorillonite, which are exposed on {010} and {110} edge faces. At higher loadings, Ln/An(III) binds to only one Al octahedron, forming a weaker, edge-sharing surface complex. In the presence of carbonate, we identified a ternary mono- or dicarbonato Ln/An(III) complex binding directly to one Al(O,OH)6 octahedron, revealing that type-A ternary complexes form with the one or two carbonate groups pointing away from the surface into the solution phase. Within the spectroscopically observable concentration range these complexes could only be identified on the weak sites, in line with the small strong site capacity suggested by the refined sorption model. When the solubility of carbonates was exceeded, formation of an Am carbonate hydroxide could be identified. The excellent agreement between the thermodynamic model parameters obtained by fitting the macroscopic data, and the spectroscopically identified mechanisms, demonstrates the mature state of the 2SPNE SC/CE model for predicting and quantifying the retention of Ln/An(III) elements by montmorillonite-rich clay rocks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Virtual imprinting as a tool to design efficient MIPs for photosynthesis-inhibiting herbicides.

    PubMed

    Breton, Florent; Rouillon, Regis; Piletska, Elena V; Karim, Kal; Guerreiro, Antonio; Chianella, Iva; Piletsky, Sergey A

    2007-04-15

    Molecular modelling and computational screening were used to identify functional monomers capable of interacting with several different photosynthesis-inhibiting herbicides. The process involved the design of a virtual library of molecular models of functional monomers containing polymerizable residues and residues able to interact with the template through electrostatic, hydrophobic, Van der Waals forces and dipole-dipole interactions. Each of the entries in the virtual library was probed for its possible interactions with molecular models of the template molecules. It was anticipated that the monomers giving the highest binding score would represent good candidates for the preparation of affinity polymers. Strong interactions were computationally determined between acidic functional monomers like methacrylic acid (MAA) or itaconic acid (IA) with triazines, and between vinylimidazole with bentazone and bromoxynil. Nevertheless, weaker interactions were seen with phenylureas. The corresponding blank polymers were prepared using the selected monomers and tested in the solid phase extraction (SPE) of herbicides from chloroform solutions. A good correlation was found between the binding score of the monomers and the affinities of the corresponding polymers. The use of computationally designed blanks can potentially eliminate the need for molecular imprinting, (adding a template to the monomer mixture to create specific binding sites). Data also showed that some monomers have a natural selectivity for some herbicides, which can be further enhanced by imprinting. Thus, in regard to retention on the blank polymer, we can estimate if the resulting imprinted polymer will be effective or not.

  4. Direct Competitive Enzyme-Linked Immunosorbent Assay (ELISA).

    PubMed

    Kohl, Thomas O; Ascoli, Carl A

    2017-07-05

    The competitive enzyme-linked immunosorbent assay (ELISA) (cELISA; also called an inhibition ELISA) is designed so that purified antigen competes with antigen in the test sample for binding to an antibody that has been immobilized in microtiter plate wells. The same concept works if the immobilized molecule is antigen and the competing molecules are purified labeled antibody versus antibody in a test sample. Direct cELISAs incorporate labeled antigen or antibody, whereas indirect assay configurations use reporter-labeled secondary antibodies. The cELISA is very useful for determining the concentration of small-molecule antigens in complex sample mixtures. In the direct cELISA, antigen-specific capture antibody is adsorbed onto the microtiter plate before incubation with either known standards or unknown test samples. Enzyme-linked antigen (i.e., labeled antigen) is also added, which can bind to the capture antibody only when the antibody's binding site is not occupied by either the antigen standard or antigen in the test samples. Unbound labeled and unlabeled antigens are washed away and substrate is added. The amount of antigen in the standard or the test sample determines the amount of reporter-labeled antigen bound to antibody, yielding a signal that is inversely proportional to antigen concentration within the sample. Thus, the higher the antigen concentration in the test sample, the less labeled antigen is bound to the capture antibody, and hence the weaker is the resultant signal. © 2017 Cold Spring Harbor Laboratory Press.

  5. Substituted 2-Aminopyrimidines Selective for α7-Nicotinic Acetylcholine Receptor Activation and Association with Acetylcholine Binding Proteins.

    PubMed

    Kaczanowska, Katarzyna; Camacho Hernandez, Gisela Andrea; Bendiks, Larissa; Kohs, Larissa; Cornejo-Bravo, Jose Manuel; Harel, Michal; Finn, M G; Taylor, Palmer

    2017-03-15

    Through studies with ligand binding to the acetylcholine binding protein (AChBP), we previously identified a series of 4,6-substituted 2-aminopyrimidines that associate with this soluble surrogate of the nicotinic acetylcholine receptor (nAChR) in a cooperative fashion, not seen for classical nicotinic agonists and antagonists. To examine receptor interactions of this structural family on ligand-gated ion channels, we employed HEK cells transfected with cDNAs encoding three requisite receptor subtypes: α7-nAChR, α4β2-nAChR, and a serotonin receptor (5-HT 3A R), along with a fluorescent reporter. Initial screening of a series of over 50 newly characterized 2-aminopyrimidines with affinity for AChBP showed only two to be agonists on the α7-nAChR below 10 μM concentration. Their unique structural features were incorporated into design of a second subset of 2-aminopyrimidines yielding several congeners that elicited α7 activation with EC 50 values of 70 nM and K d values for AChBP in a similar range. Several compounds within this series exhibit specificity for the α7-nAChR, showing no activation or antagonism of α4β2-nAChR or 5-HT3AR at concentrations up to 10 μM, while others were weaker antagonists (or partial agonists) on these receptors. Analysis following cocrystallization of four ligand complexes with AChBP show binding at the subunit interface, but with an orientation or binding pose that differs from classical nicotinic agonists and antagonists and from the previously analyzed set of 2-aminopyrimidines that displayed distinct cooperative interactions with AChBP. Orientations of aromatic side chains of these complexes are distinctive, suggesting new modes of binding at the agonist-antagonist site and perhaps an allosteric action for heteromeric nAChRs.

  6. Conformational changes induced in the eukaryotic translation initiation factor eIF4E by a clinically relevant inhibitor, ribavirin triphosphate

    PubMed Central

    Volpon, Laurent; Osborne, Michael J.; Zahreddine, Hiba; Romeo, Andrea A.; Borden, Katherine L.B.

    2013-01-01

    The eukaryotic translation initiation factor eIF4E is highly elevated in human cancers including acute myeloid leukemia (AML). A potential anticancer agent, ribavirin, targets eIF4E activity in AML patients corresponding to clinical responses. To date, ribavirin is the only direct inhibitor of eIF4E to reach clinical trials. We showed that ribavirin acts as a competitive inhibitor of the methyl 7-guanosine (m7G) cap, the natural ligand of eIF4E. Here we examine the conformational changes occurring in human eIF4E upon binding the active metabolite of ribavirin, ribavirin triphosphate (RTP). Our NMR data revealed an unexpected concentration dependence on RTP affinity for eIF4E. We observed NMR spectra characteristic of tight binding at low micromolar concentrations (2-5μM eIF4E) but much weaker affinity at more typical NMR concentrations (50-200μM). Comparison of chemical shift perturbation and line broadening suggest that the two eIF4E-RTP complexes differ in the precise positioning of RTP within the cap binding pocket, with the high affinity complex showing more extensive changes to the central β-sheet and dorsal surface of eIF4E, similar to m7G cap. The differences between high and low affinity complexes arise due to concentration dependent aggregation of eIF4E and RTP. Given the intracellular concentrations of eIF4E and RTP and the differential binding toward the W56A eIF4E mutant the high affinity complex is the most physiologically relevant. In summary, these findings demonstrate that RTP binds in the cap-binding site but also suggests new features of this pocket that should be considered in both drug design efforts and reveal new insights into ligand eIF4E recognition. PMID:23583375

  7. Specific binding of tubeimoside-2 with proteins in hepatocarcinoma HepG2 cells: investigation by molecular spectroscopy

    NASA Astrophysics Data System (ADS)

    Yang, Sun; Shi-Sheng, Sun; Ying-Yong, Zhao; Jun, Fan

    2012-07-01

    In this study, we compared different binding interactions of TBMS2 with proteins both in hepatocarcinoma HepG2 cells and in normal embryo hepatic L02 cells by using fluorescence, absorption, and CD spectroscopy. The fluorescence data revealed that the fluorescence intensity of proteins in the HepG2 and L02 cells decreased in the presence of TBMS2 by 30.79% and 12.01%, respectively. Binding constants and thermodynamic parameters were obtained for systems of TBMS2 with the two kinds of cell proteins. The results indicated that HepG2 cell proteins had a higher TBMS2 binding activity than those in the L02 cells. Analysis of the TBMS2 cytotoxic activities showed that TBMS2 could selectively induce apoptosis of HepG2 cells by binding to them, while its apoptotic effect on L02 cells was relatively weaker.

  8. Tertiary amine derivatives of chlorochalcone as acetylcholinesterase (AChE) and buthylcholinesterase (BuChE) inhibitors: the influence of chlorine, alkyl amine side chain and α,β-unsaturated ketone group.

    PubMed

    Gao, Xiao-Hui; Zhou, Chao; Liu, Hao-Ran; Liu, Lin-Bo; Tang, Jing-Jing; Xia, Xin-Hua

    2017-12-01

    A new series of tertiary amine derivatives of chlorochalcone (4a∼4l) were designed, synthesized and evaluated for the effect on acetylcholinesterase (AChE) and buthylcholinesterase (BuChE). The results indicated that all compounds revealed moderate or potent inhibitory activity against AChE, and some possessed high selectivity for AChE over BuChE. The structure-activity investigation showed that the substituted position of chlorine significantly influenced the activity and selectivity. The alteration of tertiary amine group also leads to obvious change in bioactivity. Among them, IC 50 of compound 4l against AChE was 0.17 ± 0.06 µmol/L, and the selectivity was 667.2 fold for AChE over BuChE. Molecular docking and enzyme kinetic study on compound 4l suggested that it simultaneously binds to the catalytic active site (CAS) and peripheral anionic site (PAS) of AChE. Further study showed that the pyrazoline derivatives synthesized from chlorochalcones had weaker activity and lower selectivity in inhibiting AChE compared to that of chlorochalcone derivatives.

  9. The role of cysteine 206 in allosteric inhibition of Escherichia coli citrate synthase. Studies by chemical modification, site-directed mutagenesis, and 19F NMR.

    PubMed

    Donald, L J; Crane, B R; Anderson, D H; Duckworth, H W

    1991-11-05

    Escherichia coli citrate synthase is strongly and specifically inhibited by NADH, but this inhibition can be prevented by reacting the enzyme with Ellman's reagent. We have now labeled the single reactive cysteine covalently with monobromobimane and isolated and sequenced the bimane-containing cyanogen bromide peptide and identified the cysteine as Cys-206. Modeling studies suggest that this residue is on the subunit surface, 25-30 A from the active site. Mutation of Cys-206 to serine (C206S), or of Gly-207 to alanine (E207A), weakened NADH binding and inhibition; when these mutations were present together, NADH binding was weaker by 18-fold and inhibition by 250-fold. The mutations also had small effects on substrate binding at the active site. Cys-206 of wild type enzyme and of the mutant E207A was alkylated with 1,1,1-trifluorobromoacetone and the environment of the fluorine nuclei studied by 19F NMR. With wild type enzyme, the NMR spectrum consisted of two peaks of about equal intensity but different line widths, at -8.65 ppm (line width 11.2 +/- 0.5 Hz) and -7.6 ppm (line width 57 +/- 4 Hz). As the labeled wild type citrate synthase was titrated with KCl, the narrow peak converted to the broad one. The same range of KCl concentrations was needed for this conversion as for the allosteric activation of E. coli citrate synthase. The E207A mutant gave the broader NMR peak almost exclusively. We propose that the fluorine label in wild type citrate synthase exists in two conformational states with different mobilities, exchanging slowly on the NMR time scale, and that treatment with KCl, or truncation of the Glu-207 side chain by mutagenesis, stabilizes one of these states. Consistent with this explanation is the finding that Cys-206 reacts more quickly with Ellman's reagent in the presence of KCl, and that this rate is faster yet in the E207A mutant.

  10. Influence of metal loading and humic acid functional groups on the complexation behavior of trivalent lanthanides analyzed by CE-ICP-MS.

    PubMed

    Kautenburger, Ralf; Hein, Christina; Sander, Jonas M; Beck, Horst P

    2014-03-13

    The complexation behavior of Aldrich humic acid (AHA) and a modified humic acid (AHA-PB) with blocked phenolic hydroxyl groups for trivalent lanthanides (Ln) is compared, and their influence on the mobility of Ln(III) in an aquifer is analyzed. As speciation technique, capillary electrophoresis (CE) was hyphenated with inductively coupled plasma mass spectrometry (ICP-MS). For metal loading experiments 25 mg L(-1) of AHA and different concentrations (cLn(Eu+Gd)=100-6000 μg L(-1)) of Eu(III) and Gd(III) in 10mM NaClO4 at pH 5 were applied. By CE-ICP-MS, three Ln-fractions, assumed to be uncomplexed, weakly and strongly AHA-complexed metal can be detected. For the used Ln/AHA-ratios conservative complex stability constants log βLnAHA decrease from 6.33 (100 μg L(-1) Ln(3+)) to 4.31 (6000 μg L(-1) Ln(3+)) with growing Ln-content. In order to verify the postulated weaker and stronger humic acid binding sites for trivalent Eu and Gd, a modified AHA with blocked functional groups was used. For these experiments 500 μg L(-1) Eu and 25 mg L(-1) AHA and AHA-PB in 10mM NaClO4 at pH-values ranging from 3 to 10 have been applied. With AHA-PB, where 84% of the phenolic OH-groups and 40% of the COOH-groups were blocked, Eu complexation was significantly lower, especially at the strong binding sites. The log β-values decrease from 6.11 (pH 10) to 5.61 at pH 3 (AHA) and for AHA-PB from 6.01 (pH 7) to 3.94 at pH 3. As a potential consequence, particularly humic acids with a high amount of strong binding sites (e.g. phenolic OH- and COOH-groups) can be responsible for a higher metal mobility in the aquifer due to the formation of dissolved negatively charged metal-humate species. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Central Ghrelin Resistance Permits the Overconsolidation of Fear Memory.

    PubMed

    Harmatz, Elia S; Stone, Lauren; Lim, Seh Hong; Lee, Graham; McGrath, Anna; Gisabella, Barbara; Peng, Xiaoyu; Kosoy, Eliza; Yao, Junmei; Liu, Elizabeth; Machado, Nuno J; Weiner, Veronica S; Slocum, Warren; Cunha, Rodrigo A; Goosens, Ki A

    2017-06-15

    There are many contradictory findings about the role of the hormone ghrelin in aversive processing, with studies suggesting that ghrelin signaling can both inhibit and enhance aversion. Here, we characterize and reconcile the paradoxical role of ghrelin in the acquisition of fearful memories. We used enzyme-linked immunosorbent assay to measure endogenous acyl-ghrelin and corticosterone at time points surrounding auditory fear learning. We used pharmacological (systemic and intra-amygdala) manipulations of ghrelin signaling and examined several aversive and appetitive behaviors. We also used biotin-labeled ghrelin to visualize ghrelin binding sites in coronal brain sections of amygdala. All work was performed in rats. In unstressed rodents, endogenous peripheral acyl-ghrelin robustly inhibits fear memory consolidation through actions in the amygdala and accounts for virtually all interindividual variability in long-term fear memory strength. Higher levels of endogenous ghrelin after fear learning were associated with weaker long-term fear memories, and pharmacological agonism of the ghrelin receptor during the memory consolidation period reduced fear memory strength. These fear-inhibitory effects cannot be explained by changes in appetitive behavior. In contrast, we show that chronic stress, which increases both circulating endogenous acyl-ghrelin and fear memory formation, promotes profound loss of ghrelin binding sites in the amygdala and behavioral insensitivity to ghrelin receptor agonism. These studies provide a new link between stress, a novel type of metabolic resistance, and vulnerability to excessive fear memory formation and reveal that ghrelin can regulate negative emotionality in unstressed animals without altering appetite. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  12. Mechanistic insights into the recognition of 5-methylcytosine oxidation derivatives by the SUVH5 SRA domain

    PubMed Central

    Rajakumara, Eerappa; Nakarakanti, Naveen Kumar; Nivya, M. Angel; Satish, Mutyala

    2016-01-01

    5-Methylcytosine (5 mC) is associated with epigenetic gene silencing in mammals and plants. 5 mC is consecutively oxidized to 5-hydroxymethylcytosine (5 hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) by ten-eleven translocation enzymes. We performed binding and structural studies to investigate the molecular basis of the recognition of the 5 mC oxidation derivatives in the context of a CG sequence by the SET- and RING-associated domain (SRA) of the SUVH5 protein (SUVH5 SRA). Using calorimetric measurements, we demonstrate that the SRA domain binds to the hydroxymethylated CG (5hmCG) DNA duplex in a similar manner to methylated CG (5mCG). Interestingly, the SUVH5 SRA domain exhibits weaker affinity towards carboxylated CG (5caCG) and formylated CG (5fCG). We report the 2.6 Å resolution crystal structure of the SUVH5 SRA domain in a complex with fully hydroxymethyl-CG and demonstrate a dual flip-out mechanism, whereby the symmetrical 5hmCs are simultaneously extruded from the partner strands of the DNA duplex and are positioned within the binding pockets of individual SRA domains. The hydroxyl group of 5hmC establishes both intra- and intermolecular interactions in the binding pocket. Collectively, we show that SUVH5 SRA recognizes 5hmC in a similar manner to 5 mC, but exhibits weaker affinity towards 5 hmC oxidation derivatives. PMID:26841909

  13. Structure-function analyses unravel distinct effects of allosteric inhibitors of HIV-1 integrase on viral maturation and integration.

    PubMed

    Bonnard, Damien; Le Rouzic, Erwann; Eiler, Sylvia; Amadori, Céline; Orlov, Igor; Bruneau, Jean-Michel; Brias, Julie; Barbion, Julien; Chevreuil, Francis; Spehner, Danièle; Chasset, Sophie; Ledoussal, Benoit; Moreau, François; Saïb, Ali; Klaholz, Bruno P; Emiliani, Stéphane; Ruff, Marc; Zamborlini, Alessia; Benarous, Richard

    2018-04-20

    Recently, a new class of HIV-1 integrase (IN) inhibitors with a dual mode of action, called IN-LEDGF/p75 allosteric inhibitors (INLAIs), was described. Designed to interfere with the IN-LEDGF/p75 interaction during viral integration, unexpectedly, their major impact was on virus maturation. This activity has been linked to induction of aberrant IN multimerization, whereas inhibition of the IN-LEDGF/p75 interaction accounts for weaker antiretroviral effect at integration. Because these dual activities result from INLAI binding to IN at a single binding site, we expected that these activities co-evolved together, driven by the affinity for IN. Using an original INLAI, MUT-A, and its activity on an Ala-125 (A125) IN variant, we found that these two activities on A125-IN can be fully dissociated: MUT-A-induced IN multimerization and the formation of eccentric condensates in viral particles, which are responsible for inhibition of virus maturation, were lost, whereas inhibition of the IN-LEDGF/p75 interaction and consequently integration was fully retained. Hence, the mere binding of INLAI to A125 IN is insufficient to promote the conformational changes of IN required for aberrant multimerization. By analyzing the X-ray structures of MUT-A bound to the IN catalytic core domain (CCD) with or without the Ala-125 polymorphism, we discovered that the loss of IN multimerization is due to stabilization of the A125-IN variant CCD dimer, highlighting the importance of the CCD dimerization energy for IN multimerization. Our study reveals that affinity for the LEDGF/p75-binding pocket is not sufficient to induce INLAI-dependent IN multimerization and the associated inhibition of viral maturation. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. MEMBRANE-TYPE 1 MATRIX METALLOPROTEINASE DOWNREGULATES FIBROBLAST GROWTH FACTOR-2 BINDING TO THE CELL SURFACE AND INTRACELLULAR SIGNALING

    PubMed Central

    Tassone, Evelyne; Valacca, Cristina; Mignatti, Paolo

    2014-01-01

    Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular and transmembrane proteins. Here we show that in tumor cells MT1-MMP downregulates fibroblast growth factor-2 (FGF-2) signaling by reducing the amount of FGF-2 bound to the cell surface with high and low affinity. FGF-2 induces weaker activation of ERK1/2 MAP kinase in MT1-MMP expressing cells than in cells devoid of MT1-MMP. This effect is abolished in cells that express proteolytically inactive MT1-MMP but persists in cells expressing MT1-MMP mutants devoid of hemopexin-like or cytoplasmic domain, showing that FGF-2 signaling is downregulated by MT1-MMP proteolytic activity. MT1-MMP expression results in downregulation of FGFR-1 and -4, and in decreased amount of cell surface-associated FGF-2. In addition, MT1-MMP strongly reduces the amount of FGF-2 bound to the cell surface with low affinity. Because FGF-2 association with low-affinity binding sites is a prerequisite for binding to its high-affinity receptors, downregulation of low-affinity binding to the cell surface results in decreased FGF-2 signaling. Consistent with this conclusion, FGF-2 induction of tumor cell migration and invasion in vitro is stronger in cells devoid of MT1-MMP than in MT1-MMP expressing cells. Thus, MT1-MMP controls FGF-2 signaling by a proteolytic mechanism that decreases the cell’s biological response to FGF-2. PMID:24986796

  15. Functional Divergence of FimX in PilZ Binding and Type IV Pilus Regulation

    PubMed Central

    Qi, Yaning; Xu, Linghui; Dong, Xueming; Yau, Yin Hoe; Ho, Chun Loong; Koh, Siew Lee; Shochat, Susana Geifman; Chou, Shan-Ho; Tang, Kai

    2012-01-01

    Type IV pili (T4P) are polar surface structures that play important roles in bacterial motility, biofilm formation, and pathogenicity. The protein FimX and its orthologs are known to mediate T4P formation in the human pathogen Pseudomonas aeruginosa and some other bacterial species. It was reported recently that FimXXAC2398 from Xanthomonas axonopodis pv. citri interacts with PilZXAC1133 directly through the nonenzymatic EAL domain of FimXXAC2398. Here we present experimental data to reveal that the strong interaction between FimXXAC2398 and PilZXAC1133 is not conserved in P. aeruginosa and likely other Pseudomonas species. In vitro and in vivo binding experiments showed that the interaction between FimX and PilZ in P. aeruginosa is below the measurable limit. Surface plasmon resonance assays further confirmed that the interaction between the P. aeruginosa proteins is at least more than 3 orders of magnitude weaker than that between the X. axonopodis pv. citri pair. The N-terminal lobe region of FimXXAC2398 was identified as the binding surface for PilZXAC1133 by amide hydrogen-deuterium exchange and site-directed mutagenesis studies. Lack of several key residues in the N-terminal lobe region of the EAL domain of FimX is likely to account for the greatly reduced binding affinity between FimX and PilZ in P. aeruginosa. All together, the results suggest that the interaction between PilZ and FimX in Xanthomonas species is not conserved in P. aeruginosa due to the evolutionary divergence among the FimX orthologs. The precise roles of FimX and PilZ in bacterial motility and T4P biogenesis are likely to vary among bacterial species. PMID:22942245

  16. Matrix metalloproteinase-10/TIMP-2 structure and analyses define conserved core interactions and diverse exosite interactions in MMP/TIMP complexes.

    PubMed

    Batra, Jyotica; Soares, Alexei S; Mehner, Christine; Radisky, Evette S

    2013-01-01

    Matrix metalloproteinases (MMPs) play central roles in vertebrate tissue development, remodeling, and repair. The endogenous tissue inhibitors of metalloproteinases (TIMPs) regulate proteolytic activity by binding tightly to the MMP active site. While each of the four TIMPs can inhibit most MMPs, binding data reveal tremendous heterogeneity in affinities of different TIMP/MMP pairs, and the structural features that differentiate stronger from weaker complexes are poorly understood. Here we report the crystal structure of the comparatively weakly bound human MMP-10/TIMP-2 complex at 2.1 Å resolution. Comparison with previously reported structures of MMP-3/TIMP-1, MT1-MMP/TIMP-2, MMP-13/TIMP-2, and MMP-10/TIMP-1 complexes offers insights into the structural basis of binding selectivity. Our analyses identify a group of highly conserved contacts at the heart of MMP/TIMP complexes that define the conserved mechanism of inhibition, as well as a second category of diverse adventitious contacts at the periphery of the interfaces. The AB loop of the TIMP N-terminal domain and the contact loops of the TIMP C-terminal domain form highly variable peripheral contacts that can be considered as separate exosite interactions. In some complexes these exosite contacts are extensive, while in other complexes the AB loop or C-terminal domain contacts are greatly reduced and appear to contribute little to complex stability. Our data suggest that exosite interactions can enhance MMP/TIMP binding, although in the relatively weakly bound MMP-10/TIMP-2 complex they are not well optimized to do so. Formation of highly variable exosite interactions may provide a general mechanism by which TIMPs are fine-tuned for distinct regulatory roles in biology.

  17. Structural and functional characterization of two unusual endonuclease III enzymes from Deinococcus radiodurans.

    PubMed

    Sarre, Aili; Ökvist, Mats; Klar, Tobias; Hall, David R; Smalås, Arne O; McSweeney, Sean; Timmins, Joanna; Moe, Elin

    2015-08-01

    While most bacteria possess a single gene encoding the bifunctional DNA glycosylase Endonuclease III (EndoIII) in their genomes, Deinococcus radiodurans possesses three: DR2438 (DrEndoIII1), DR0289 (DrEndoIII2) and DR0982 (DrEndoIII3). Here we have determined the crystal structures of DrEndoIII1 and an N-terminally truncated form of DrEndoIII3 (DrEndoIII3Δ76). We have also generated a homology model of DrEndoIII2 and measured activity of the three enzymes. All three structures consist of two all α-helical domains, one of which exhibits a [4Fe-4S] cluster and the other a HhH-motif, separated by a DNA binding cleft, similar to previously determined structures of endonuclease III from Escherichia coli and Geobacillus stearothermophilus. However, both DrEndoIII1 and DrEndoIII3 possess an extended HhH motif with extra helical features and an altered electrostatic surface potential. In addition, the DNA binding cleft of DrEndoIII3 seems to be less accessible for DNA interactions, while in DrEndoIII1 it seems to be more open. Analysis of the enzyme activities shows that DrEndoIII2 is most similar to the previously studied enzymes, while DrEndoIII1 seems to be more distant with a weaker activity towards substrate DNA containing either thymine glycol or an abasic site. DrEndoIII3 is the most distantly related enzyme and displays no detectable activity towards these substrates even though the suggested catalytic residues are conserved. Based on a comparative structural analysis, we suggest that the altered surface potential, shape of the substrate-binding pockets and specific amino acid substitutions close to the active site and in the DNA interacting loops may underlie the unexpected differences in activity. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Interaction and interdependent packaging of tegument protein UL11 and glycoprotein e of herpes simplex virus.

    PubMed

    Han, Jun; Chadha, Pooja; Meckes, David G; Baird, Nicholas L; Wills, John W

    2011-09-01

    The UL11 tegument protein of herpes simplex virus plays a critical role in the secondary envelopment; however, the mechanistic details remain elusive. Here, we report a new function of UL11 in the budding process in which it directs efficient acquisition of glycoprotein E (gE) via a direct interaction. In vitro binding assays showed that the interaction required only the first 28, membrane-proximal residues of the cytoplasmic tail of gE, and the C-terminal 26 residues of UL11. A second, weaker binding site was also found in the N-terminal half of UL11. The significance of the gE-UL11 interaction was subsequently investigated with viral deletion mutants. In the absence of the gE tail, virion packaging of UL11, but not other tegument proteins such as VP22 and VP16, was reduced by at least 80%. Reciprocally, wild-type gE packaging was also drastically reduced by about 87% in the absence of UL11, and this defect could be rescued in trans by expressing U(L)11 at the U(L)35 locus. Surprisingly, a mutant that lacks the C-terminal gE-binding site of UL11 packaged nearly normal amounts of gE despite its strong interaction with the gE tail in vitro, indicating that the interaction with the UL11 N terminus may be important. Mutagenesis studies of the UL11 N terminus revealed that the association of UL11 with membrane was not required for this function. In contrast, the UL11 acidic cluster motif was found to be critical for gE packaging and was not replaceable with foreign acidic clusters. Together, these results highlight an important role of UL11 in the acquisition of glycoprotein-enriched lipid bilayers, and the findings may also have important implications for the role of UL11 in gE-mediated cell-to-cell spread.

  19. Comparative solution equilibrium studies on pentamethylcyclopentadienyl rhodium complexes of 2,2'-bipyridine and ethylenediamine and their interaction with human serum albumin.

    PubMed

    Enyedy, Éva A; Mészáros, János P; Dömötör, Orsolya; Hackl, Carmen M; Roller, Alexander; Keppler, Bernhard K; Kandioller, Wolfgang

    2015-11-01

    Complex formation equilibrium processes of the (N,N) donor containing 2,2'-bipyridine (bpy) and ethylenediamine (en) with (η(5)-pentamethylcyclopentadienyl)rhodium(III) were investigated in aqueous solution via pH-potentiometry, (1)H NMR spectroscopy, and UV-vis spectrophotometry in the absence and presence of chloride ions. The structure of [RhCp*(en)Cl]ClO4 (Cp*, pentamethylcyclopentadienyl) was also studied by single-crystal X-ray diffraction. pKa values of 8.56 and 9.58 were determined for [RhCp*(bpy)(H2O)](2+) and [RhCp*(en)(H2O)](2+), respectively resulting in the formation of negligible amount of mixed hydroxido complexes at pH 7.4. Stability and the H2O/Cl(-) co-ligand exchange constants of bpy and en complexes considerably exceed those of the bidentate O-donor deferiprone. The strong affinity of the bpy and en complexes to chloride ions most probably contributes to their low antiproliferative effect. Interactions between human serum albumin (HSA) and [RhCp*(H2O)3](2+), its complexes formed with deferiprone, bpy and en were also monitored by (1)H NMR spectroscopy, ultrafiltration/UV-vis and spectrofluorometry. Numerous binding sites (≥ 8) are available for [RhCp*(H2O)3](2+); and the interaction takes place most probably via covalent bonds through the imidazole nitrogen of His. According to the various fluorescence studies [RhCp*(H2O)3](2+) binds on sites I and II, and coordination of surface side chain donor atoms of the protein is also feasible. The binding of the bpy and en complex is weaker and slower compared to that of [RhCp*(H2O)3](2+), and formation of ternary HSA-RhCp*-ligand adducts was proved. In the case of the deferiprone complex, the RhCp* fragment is cleaved off when HSA is loaded with low equivalents of the compound.

  20. Morality and its relation to political ideology: the role of promotion and prevention concerns.

    PubMed

    Cornwell, James F M; Higgins, E Tory

    2013-09-01

    Our research investigated whether promotion concerns with advancement and prevention concerns with security related to moral beliefs and political ideology. Study 1 found that chronic prevention and promotion focus had opposite relations to binding foundation endorsement (as measured by the Moral Foundations Questionnaire), that is, positive for prevention and negative for promotion, and opposite relations to political ideology, that is, more conservative for prevention and more liberal for promotion, and the relation between focus and political ideology was partially mediated by binding foundation endorsement. Study 2 showed that promotion and prevention, even as situationally induced states, can contribute to differences in binding foundation endorsement, with prevention producing stronger endorsement (compared with a control) and promotion producing weaker endorsement.

  1. Accurate Wavelength Measurement of High-Energy Gamma Rays from the 35Cl(n,{gamma}) Reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belgya, T.; Molnar, G.L.; Mutti, P.

    2005-05-24

    The energies of eight gamma rays in the 36Cl level scheme have been measured with high precision using the 35Cl(n,{gamma}) reaction and the GAMS4 spectrometer. From these energies, a skeleton decay scheme for 36Cl was constructed, and the binding energy of 36Cl was determined to higher precision than previously. It is shown that using this new information, binding energy determination from Ge detector experiments for other nuclei can also be made with higher precision than now available. The measurement of additional weaker 36Cl gamma rays is continuing.

  2. Molecular Insights into Human Monoamine Oxidase B Inhibition by the Glitazone Antidiabetes Drugs

    PubMed Central

    2011-01-01

    The widely employed antidiabetic drug pioglitazone (Actos) is shown to be a specific and reversible inhibitor of human monoamine oxidase B (MAO B). The crystal structure of the enzyme–inhibitor complex shows that the R-enantiomer is bound with the thiazolidinedione ring near the flavin. The molecule occupies both substrate and entrance cavities of the active site, establishing noncovalent interactions with the surrounding amino acids. These binding properties differentiate pioglitazone from the clinically used MAO inhibitors, which act through covalent inhibition mechanisms and do not exhibit a high degree of MAO A versus B selectivity. Rosiglitazone (Avandia) and troglitazone, other members of the glitazone class, are less selective in that they are weaker inhibitors of both MAO A and MAO B. These results suggest that pioglitazone may have utility as a “repurposed” neuroprotectant drug in retarding the progression of disease in Parkinson's patients. They also provide new insights for the development of reversible isoenzyme-specific MAO inhibitors. PMID:22282722

  3. Widespread rearrangement of 3D chromatin organization underlies Polycomb-mediated stress-induced silencing

    PubMed Central

    Li, Li; Lyu, Xiaowen; Hou, Chunhui; Takenaka, Naomi; Nguyen, Huy Q.; Ong, Chin-Tong; Cubeñas-Potts, Caelin; Hu, Ming; Lei, Elissa P.; Bosco, Giovanni; Qin, Zhaohui S.; Corces, Victor G.

    2015-01-01

    SUMMARY Chromosomes of metazoan organisms are partitioned in the interphase nucleus into discrete topologically associating domains (TADs). Borders between TADs are formed in regions containing active genes and clusters of architectural protein binding sites. Transcription of most genes is repressed after temperature stress in Drosophila. Here we show that temperature stress induces relocalization of architectural proteins from TAD borders to inside TADs, and this is accompanied by a dramatic rearrangement in the 3D organization of the nucleus. TAD border strength declines, allowing for an increase in long-distance inter-TAD interactions. Similar but quantitatively weaker effects are observed upon inhibition of transcription or depletion of individual architectural proteins. Heat shock-induced inter-TAD interactions result in increased contacts among enhancers and promoters of silenced genes, which recruit Pc and form Pc bodies in the nucleolus. These results suggest that the TAD organization of metazoan genomes is plastic and can be quickly reconfigured. PMID:25818644

  4. Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

    PubMed

    Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

    2017-05-10

    G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

  5. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  6. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  7. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  8. Quantifying Intrinsic Specificity: A Potential Complement to Affinity in Drug Screening

    NASA Astrophysics Data System (ADS)

    Wang, Jin; Zheng, Xiliang; Yang, Yongliang; Drueckhammer, Dale; Yang, Wei; Verkhivker, Gennardy; Wang, Erkang

    2007-11-01

    We report here the investigation of a novel description of specificity in protein-ligand binding based on energy landscape theory. We define a new term, intrinsic specificity ratio (ISR), which describes the level of discrimination in binding free energies of the native basin for a protein-ligand complex from the weaker binding states of the same ligand. We discuss the relationship between the intrinsic specificity we defined here and the conventional definition of specificity. In a docking study of molecules with the enzyme COX-2, we demonstrate a statistical correspondence between ISR value and geometrical shapes of the small molecules binding to COX-2. We further observe that the known selective (nonselective) inhibitors of COX-2 have higher (lower) ISR values. We suggest that intrinsic specificity ratio may be a useful new criterion and a complement to affinity in drug screening and in searching for potential drug lead compounds.

  9. Non-steroidal anti-inflammatory drug naproxen destabilizes Aβ amyloid fibrils: A molecular dynamics investigation

    PubMed Central

    Takeda, Takako; Kumar, Rashmi; Raman, E. Prabhu; Klimov, Dmitri K.

    2010-01-01

    Using implicit solvent model and replica exchange molecular dynamics we examine the propensity of non-steroidal anti-inflammatory drug, naproxen, to interfere with Aβ fibril growth. We also compare the anti-aggregation propensity of naproxen with that of ibuprofen. Naproxen anti-aggregation effect is influenced by two factors. Similar to ibuprofen, naproxen destabilizes binding of incoming Aβ peptides to the fibril due to direct competition between the ligands and the peptides for the same binding location on the fibril surface (the edge). However, in contrast to ibuprofen naproxen binding also alters the conformational ensemble of Aβ monomers by promoting β-structure. The second factor weakens naproxen anti-aggregation effect. These findings appear to explain the experimental observations, according to which naproxen binds to Aβ fibril with higher affinity than ibuprofen, yet produces weaker anti-aggregation action. PMID:20979356

  10. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  11. Functional Interaction Map of Lyssavirus Phosphoprotein: Identification of the Minimal Transcription Domains

    PubMed Central

    Jacob, Yves; Real, Eléonore; Tordo, Noël

    2001-01-01

    Lyssaviruses, the causative agents of rabies encephalitis, are distributed in seven genotypes. The phylogenetically distant rabies virus (PV strain, genotype 1) and Mokola virus (genotype 3) were used to develop a strategy to identify functional homologous interactive domains from two proteins (P and N) which participate in the viral ribonucleoprotein (RNP) transcription-replication complex. This strategy combined two-hybrid and green fluorescent protein–reverse two-hybrid assays in Saccharomyces cerevisiae to analyze protein-protein interactions and a reverse genetic assay in mammalian cells to study the transcriptional activity of the reconstituted RNP complex. Lyssavirus P proteins contain two N-binding domains (N-BDs), a strong one encompassing amino acid (aa) 176 to the C terminus and a weak one in the 189 N-terminal aa. The N-terminal portion of P (aa 52 to 189) also contains a homomultimerization site. Here we demonstrate that N-P interactions, although weaker, are maintained between proteins of the different genotypes. A minimal transcriptional module of the P protein was obtained by fusing the first 60 N-terminal aa containing the L protein binding site to the C-terminal strong N-BD. Random mutation of the strong N-BD on P protein identified three highly conserved K residues crucial for N-P interaction. Their mutagenesis in full-length P induced a transcriptionally defective RNP. The analysis of homologous interactive domains presented here and previously reported dissections of the P protein allowed us to propose a model of the functional interaction network of the lyssavirus P protein. This model underscores the central role of P at the interface between L protein and N-RNA template. PMID:11559793

  12. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  13. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  14. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  15. Fac and mer isomers of Ru(II) tris(pyrazolyl-pyridine) complexes as models for the vertices of coordination cages: structural characterisation and hydrogen-bonding characteristics.

    PubMed

    Metherell, Alexander J; Cullen, William; Stephenson, Andrew; Hunter, Christopher A; Ward, Michael D

    2014-01-07

    We have prepared a series of mononuclear fac and mer isomers of Ru(II) complexes containing chelating pyrazolyl-pyridine ligands, to examine their differing ability to act as hydrogen-bond donors in MeCN. This was prompted by our earlier observation that octanuclear cube-like coordination cages that contain these types of metal vertex can bind guests such as isoquinoline-N-oxide (K = 2100 M(-1) in MeCN), with a significant contribution to binding being a hydrogen-bonding interaction between the electron-rich atom of the guest and a hydrogen-bond donor site on the internal surface of the cage formed by a convergent set of CH2 protons close to a 2+ metal centre. Starting with [Ru(L(H))3](2+) [L(H) = 3-(2-pyridyl)-1H-pyrazole] the geometric isomers were separated by virtue of the fact that the fac isomer forms a Cu(I) adduct which the mer isomer does not. Alkylation of the pyrazolyl NH group with methyl iodide or benzyl bromide afforded [Ru(L(Me))3](2+) and [Ru(L(bz))3](2+) respectively, each as their fac and mer isomers; all were structurally characterised. In the fac isomers the convergent group of pendant -CH2R or -CH3 protons defines a hydrogen-bond donor pocket; in the mer isomer these protons do not converge and any hydrogen-bonding involving these protons is expected to be weaker. For both [Ru(L(Me))3](2+) and [Ru(L(bz))3](2+), NMR titrations with isoquinoline-N-oxide in MeCN revealed weak 1 : 1 binding (K ≈ 1 M(-1)) between the guest and the fac isomer of the complex that was absent with the mer isomer, confirming a difference in the hydrogen-bond donor capabilities of these complexes associated with their differing geometries. The weak binding compared to the cage however occurs because of competition from the anions, which are free to form ion-pairs with the mononuclear complex cations in a way that does not happen in the cage complexes. We conclude that (i) the presence of fac tris-chelate sites in the cage to act as hydrogen-bond donors, and (ii) exclusion of counter-ions from the central cavity leaving these hydrogen-bonding sites free to interact with guests, are both important design criteria for future coordination cage hosts.

  16. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  17. Load-dependent ADP binding to myosins V and VI: Implications for subunit coordination and function

    PubMed Central

    Oguchi, Yusuke; Mikhailenko, Sergey V.; Ohki, Takashi; Olivares, Adrian O.; De La Cruz, Enrique M.; Ishiwata, Shin'ichi

    2008-01-01

    Dimeric myosins V and VI travel long distances in opposite directions along actin filaments in cells, taking multiple steps in a “hand-over-hand” fashion. The catalytic cycles of both myosins are limited by ADP dissociation, which is considered a key step in the walking mechanism of these motors. Here, we demonstrate that external loads applied to individual actomyosin V or VI bonds asymmetrically affect ADP affinity, such that ADP binds weaker under loads assisting motility. Model-based analysis reveals that forward and backward loads modulate the kinetics of ADP binding to both myosins, although the effect is less pronounced for myosin VI. ADP dissociation is modestly accelerated by forward loads and inhibited by backward loads. Loads applied in either direction slow ADP binding to myosin V but accelerate binding to myosin VI. We calculate that the intramolecular load generated during processive stepping is ≈2 pN for both myosin V and myosin VI. The distinct load dependence of ADP binding allows these motors to perform different cellular functions. PMID:18509050

  18. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  19. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  20. Laser-Induced Population Inversion in Rhodamine 6G for Lysozyme Oligomer Detection.

    PubMed

    Hanczyc, Piotr; Sznitko, Lech

    2017-06-06

    Fluorescence spectroscopy is a common method for detecting amyloid fibrils in which organic fluorophores are used as markers that exhibit an increase in quantum yield upon binding. However, most of the dyes exhibit enhanced emission only when bound to mature fibrils, and significantly weaker signals are obtained in the presence of amyloid oligomers. In the concept of population inversion, a laser is used as an excitation source to keep the major fraction of molecules in the excited state to create the pathways for the occurrence of stimulated emission. In the case of the proteins, the conformational changes lead to the self-ordering and thus different light scattering conditions that can influence the optical signatures of the generated light. Using this methodology, we show it is possible to optically detect amyloid oligomers using commonly available staining dyes in which population inversion can be induced. The results indicate that rhodamine 6G molecules are complexed with oligomers, and using a laser-assisted methodology, weakly emissive states can be detected. Significant spectral red-shifting of rhodamine 6G dispersed with amyloid oligomers and a notable difference determined by comparison of spectra of the fibrils suggest the existence of specific dye aggregates around the oligomer binding sites. This approach can provide new insights into intermediate oligomer states that are believed to be responsible for toxic seeding in neurodegeneration diseases.

  1. A molecular view of cisplatin's mode of action: interplay with DNA bases and acquired resistance.

    PubMed

    Marques, M Paula M; Gianolio, Diego; Cibin, Giannantonio; Tomkinson, John; Parker, Stewart F; Valero, Rosendo; Pedro Lopes, R; Batista de Carvalho, Luis A E

    2015-02-21

    The interaction of the widely used anticancer drug cisplatin with DNA bases was studied by EXAFS and vibrational spectroscopy (FTIR, Raman and INS), coupled with DFT/plane-wave calculations. Detailed information was obtained on the local atomic structure around the Pt(ii) centre, both in the cisplatin-purine (adenine and guanine) and cisplatin-glutathione adducts. Simultaneous neutron and Raman scattering experiments allowed us to obtain a reliable and definite picture of this cisplatin interplay with its main pharmacological target (DNA), at the molecular level. The vibrational experimental spectra were fully assigned in the light of the calculated pattern for the most favoured geometry of each drug-purine adduct, and cisplatin's preference for guanine (G) relative to adenine (A) within the DNA double helix was experimentally verified: a complete N by S substitution in the metal coordination sphere was only observed for [cDDP-A2], reflecting a somewhat weaker Pt-A binding relative to Pt-G. The role of glutathione on the drug's pharmacokinetics, as well as on the stability of platinated DNA adducts, was evaluated as this is the basis for glutathione-mediated intracellular drug scavenging and in vivo resistance to Pt-based anticancer drugs. Spectroscopic evidence of the metal's preference for glutathione's sulfur over purine's nitrogen binding sites was gathered, at least two sulfur atoms being detected in platinum's first coordination sphere.

  2. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  3. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  4. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  6. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  7. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  8. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  9. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  10. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  11. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  12. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  13. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  14. Re-engineering of CYP2C9 to probe acid-base substrate selectivity.

    PubMed

    Tai, Guoying; Dickmann, Leslie J; Matovic, Nicholas; DeVoss, James J; Gillam, Elizabeth M J; Rettie, Allan E

    2008-10-01

    A common feature of many CYP2C9 ligands is their weak acidity. As revealed by crystallography, the structural basis for this behavior involves a charge-pairing interaction between an anionic moiety on the substrate and an active site R108 residue. In the present study we attempted to re-engineer CYP2C9 to better accept basic ligands by charge reversal at this key residue. We expressed and purified the R108E and R108E/D293N mutants and compared their ability with that of native CYP2C9 to interact with (S)-warfarin, diclofenac, pyrene, propranolol, and ibuprofen amine. As expected, the R108E mutant maintained all the native enzyme's pyrene 1-hydroxylation activity, but catalytic activity toward diclofenac and (S)-warfarin was abrogated. In contrast, the double mutant displayed much less selectivity in its behavior toward these control ligands. Neither of the mutants displayed significant enhancement of propranolol metabolism, and all three preparations exhibited a type II (inhibitor) rather than type I (substrate) spectrum with ibuprofen amine, although binding became progressively weaker with the single and double mutants. Collectively, these data underscore the importance of the amino acid at position 108 in the acid substrate selectivity of CYP2C9, highlight the accommodating nature of the CYP2C9 active site, and provide a cautionary note regarding facile re-engineering of these complex cytochrome P450 active sites.

  15. Re-engineering of CYP2C9 to Probe Acid-Base Substrate Selectivity

    PubMed Central

    Tai, Guoying; Dickmann, Leslie J.; Matovic, Nicholas; DeVoss, James J.; Gillam, Elizabeth M. J.; Rettie, Allan E.

    2009-01-01

    A common feature of many CYP2C9 ligands is their weak acidity. As revealed by crystallography, the structural basis for this behavior involves a charge-pairing interaction between an anionic moiety on the substrate and an active site R108 residue. In the present study we attempted to re-engineer CYP2C9 to better accept basic ligands by charge reversal at this key residue. We expressed and purified the R108E and R108E/D293N mutants and compared their ability with that of native CYP2C9 to interact with (S)-warfarin, diclofenac, pyrene, propranolol, and ibuprofen amine. As expected, the R108E mutant maintained all the native enzyme's pyrene 1-hydroxylation activity, but catalytic activity toward diclofenac and (S)-warfarin was abrogated. In contrast, the double mutant displayed much less selectivity in its behavior toward these control ligands. Neither of the mutants displayed significant enhancement of propranolol metabolism, and all three preparations exhibited a type II (inhibitor) rather than type I (substrate) spectrum with ibuprofen amine, although binding became progressively weaker with the single and double mutants. Collectively, these data underscore the importance of the amino acid at position 108 in the acid substrate selectivity of CYP2C9, highlight the accommodating nature of the CYP2C9 active site, and provide a cautionary note regarding facile re-engineering of these complex cytochrome P450 active sites. PMID:18606741

  16. A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer

    PubMed Central

    Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav

    2017-01-01

    Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272

  17. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  19. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  20. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  1. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  2. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  3. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  4. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  5. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  6. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  7. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  8. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  9. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  10. Dissociative adsorption of water on Au/MgO/Ag(001) from first principles calculations

    NASA Astrophysics Data System (ADS)

    Nevalaita, J.; Häkkinen, H.; Honkala, K.

    2015-10-01

    The molecular and dissociative adsorption of water on a Ag-supported 1 ML, 2 ML and 3 ML-a six atomic layer-thick MgO films with a single Au adatom is investigated using density functional theory calculations. The obtained results are compared to a bulk MgO(001) surface with an Au atom. On thin films the negatively charged Au strengthens the binding of the polar water molecule due to the attractive Au-H interaction. The adsorption energy trends of OH and H with respect to the film thickness depend on an adsorption site. In the case OH or H binds atop Au on MgO/Ag(001), the adsorption becomes more exothermic with the increasing film thickness, while the reverse trend is seen when the adsorption takes place on bare MgO/Ag(001). This behavior can be explained by different bonding mechanisms identified with the Bader analysis. Interestingly, we find that the rumpling of the MgO film and the MgO-Ag interface distance correlate with the charge transfer over the thin film and the interface charge, respectively. Moreover, we employ a modified Born-Haber-cycle to analyze the effect of film thickness to the adsorption energy of isolated Au and OH species on MgO/Ag(001). The analysis shows that the attractive Coulomb interaction between the negatively charged adsorbate and the positive MgO-Ag-interface does not completely account for the weaker binding with increasing film thickness. The redox energy associated with the charge transfer from the interface to the adsorbate is more exothermic with the increasing film thickness and partly compensates the decrease in the attractive Coulomb interaction.

  11. Protecting Gram-negative bacterial cell envelopes from human lysozyme: Interactions with Ivy inhibitor proteins from Escherichia coli and Pseudomonas aeruginosa.

    PubMed

    Liu, Zhihong; García-Díaz, Beatriz; Catacchio, Bruno; Chiancone, Emilia; Vogel, Hans J

    2015-11-01

    Lysozymes play an important role in host defense by degrading peptidoglycan in the cell envelopes of pathogenic bacteria. Several Gram-negative bacteria can evade this mechanism by producing periplasmic proteins that inhibit the enzymatic activity of lysozyme. The Escherichia coli inhibitor of vertebrate lysozyme, Ivyc and its Pseudomonas aeruginosa homolog, Ivyp1 have been shown to be potent inhibitors of hen egg white lysozyme (HEWL). Since human lysozyme (HL) plays an important role in the innate immune response, we have examined the binding of HL to Ivyc and Ivyp1. Our results show that Ivyp1 is a weaker inhibitor of HL than Ivyc even though they inhibit HEWL with similar potency. Calorimetry experiments confirm that Ivyp1 interacts more weakly with HL than HEWL. Analytical ultracentrifugation studies revealed that Ivyp1 in solution is a monomer and forms a 30kDa heterodimer with both HL and HEWL, while Ivyc is a homodimer that forms a tetramer with both enzymes. The interaction of Ivyp1 with HL was further characterized by NMR chemical shift perturbation experiments. In addition to the characteristic His-containing Ivy inhibitory loop that binds into the active site of lysozyme, an extended loop (P2) between the final two beta-strands also participates in forming protein-protein interactions. The P2 loop is not conserved in Ivyc and it constitutes a flexible region in Ivyp1 that becomes more rigid in the complex with HL. We conclude that differences in the electrostatic interactions at the binding interface between Ivy inhibitors and distinct lysozymes determine the strength of this interaction. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2.

    PubMed

    Woodfolk, Judith A; Glesner, Jill; Wright, Paul W; Kepley, Christopher L; Li, Mi; Himly, Martin; Muehling, Lyndsey M; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D; Pomés, Anna

    2016-01-29

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4(+) T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. From lin-benzoguanines to lin-benzohypoxanthines as ligands for Zymomonas mobilis tRNA-guanine transglycosylase: replacement of protein-ligand hydrogen bonding by importing water clusters.

    PubMed

    Barandun, Luzi Jakob; Immekus, Florian; Kohler, Philipp C; Tonazzi, Sandro; Wagner, Björn; Wendelspiess, Severin; Ritschel, Tina; Heine, Andreas; Kansy, Manfred; Klebe, Gerhard; Diederich, François

    2012-07-23

    The foodborne illness shigellosis is caused by Shigella bacteria that secrete the highly cytotoxic Shiga toxin, which is also formed by the closely related enterohemorrhagic Escherichia coli (EHEC). It has been shown that tRNA-guanine transglycosylase (TGT) is essential for the pathogenicity of Shigella flexneri. Herein, the molecular recognition properties of a guanine binding pocket in Zymomonas mobilis TGT are investigated with a series of lin-benzohypoxanthine- and lin-benzoguanine-based inhibitors that bear substituents to occupy either the ribose-33 or the ribose-34 pocket. The three inhibitor scaffolds differ by the substituent at C(6) being H, NH(2), or NH-alkyl. These differences lead to major changes in the inhibition constants, pK(a) values, and binding modes. Compared to the lin-benzoguanines, with an exocyclic NH(2) at C(6), the lin-benzohypoxanthines without an exocyclic NH(2) group have a weaker affinity as several ionic protein-ligand hydrogen bonds are lost. X-ray cocrystal structure analysis reveals that a new water cluster is imported into the space vacated by the lacking NH(2) group and by a conformational shift of the side chain of catalytic Asp102. In the presence of an N-alkyl group at C(6) in lin-benzoguanine ligands, this water cluster is largely maintained but replacement of one of the water molecules in the cluster leads to a substantial loss in binding affinity. This study provides new insight into the role of water clusters at enzyme active sites and their challenging substitution by ligand parts, a topic of general interest in contemporary structure-based drug design. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2*

    PubMed Central

    Woodfolk, Judith A.; Glesner, Jill; Wright, Paul W.; Kepley, Christopher L.; Li, Mi; Himly, Martin; Muehling, Lyndsey M.; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D.; Pomés, Anna

    2016-01-01

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4+ T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. PMID:26644466

  15. Characterizing HSF1 Binding and Post-Translational Modifications of hsp70 Promoter in Cultured Cortical Neurons: Implications in the Heat-Shock Response

    PubMed Central

    Gómez, Andrea V.; Córdova, Gonzalo; Munita, Roberto; Parada, Guillermo E.; Barrios, Álvaro P.; Cancino, Gonzalo I.; Álvarez, Alejandra R.; Andrés, María E.

    2015-01-01

    Causes of lower induction of Hsp70 in neurons during heat shock are still a matter of debate. To further inquire into the mechanisms regulating Hsp70 expression in neurons, we studied the activity of Heat Shock Factor 1 (HSF1) and histone posttranslational modifications (PTMs) at the hsp70 promoter in rat cortical neurons. Heat shock induced a transient and efficient translocation of HSF1 to neuronal nuclei. However, no binding of HSF1 at the hsp70 promoter was detected while it bound to the hsp25 promoter in cortical neurons during heat shock. Histone PTMs analysis showed that the hsp70 promoter harbors lower levels of histone H3 and H4 acetylation in cortical neurons compared to PC12 cells under basal conditions. Transcriptomic profiling data analysis showed a predominant usage of cryptic transcriptional start sites at hsp70 gene in the rat cerebral cortex, compared with the whole brain. These data support a weaker activation of hsp70 canonical promoter. Heat shock increased H3Ac at the hsp70 promoter in PC12 cells, which correlated with increased Hsp70 expression while no modifications occurred at the hsp70 promoter in cortical neurons. Increased histone H3 acetylation by Trichostatin A led to hsp70 mRNA and protein induction in cortical neurons. In conclusion, we found that two independent mechanisms maintain a lower induction of Hsp70 in cortical neurons. First, HSF1 fails to bind specifically to the hsp70 promoter in cortical neurons during heat shock and, second, the hsp70 promoter is less accessible in neurons compared to non-neuronal cells due to histone deacetylases repression. PMID:26053851

  16. Sugar-Binding Profiles of Chitin-Binding Lectins from the Hevein Family: A Comprehensive Study

    PubMed Central

    Itakura, Yoko; Nakamura-Tsuruta, Sachiko; Kominami, Junko; Tateno, Hiroaki; Hirabayashi, Jun

    2017-01-01

    Chitin-binding lectins form the hevein family in plants, which are defined by the presence of single or multiple structurally conserved GlcNAc (N-acetylglucosamine)-binding domains. Although they have been used as probes for chito-oligosaccharides, their detailed specificities remain to be investigated. In this study, we analyzed six chitin-binding lectins, DSA, LEL, PWM, STL, UDA, and WGA, by quantitative frontal affinity chromatography. Some novel features were evident: WGA showed almost comparable affinity for pyridylaminated chitotriose and chitotetraose, while LEL and UDA showed much weaker affinity, and DSA, PWM, and STL had no substantial affinity for the former. WGA showed selective affinity for hybrid-type N-glycans harboring a bisecting GlcNAc residue. UDA showed extensive binding to high-mannose type N-glycans, with affinity increasing with the number of Man residues. DSA showed the highest affinity for highly branched N-glycans consisting of type II LacNAc (N-acetyllactosamine). Further, multivalent features of these lectins were investigated by using glycoconjugate and lectin microarrays. The lectins showed substantial binding to immobilized LacNAc as well as chito-oligosaccharides, although the extents to which they bound varied among them. WGA showed strong binding to heavily sialylated glycoproteins. The above observations will help interpret lectin-glycoprotein interactions in histochemical studies and glyco-biomarker investigations. PMID:28556796

  17. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  18. Scaffold Repurposing of Nucleosides (Adenosine Receptor Agonists): Enhanced Activity at the Human Dopamine and Norepinephrine Sodium Symporters.

    PubMed

    Tosh, Dilip K; Janowsky, Aaron; Eshleman, Amy J; Warnick, Eugene; Gao, Zhan-Guo; Chen, Zhoumou; Gizewski, Elizabeth; Auchampach, John A; Salvemini, Daniela; Jacobson, Kenneth A

    2017-04-13

    We have repurposed (N)-methanocarba adenosine derivatives (A 3 adenosine receptor (AR) agonists) to enhance radioligand binding allosterically at the human dopamine (DA) transporter (DAT) and inhibit DA uptake. We extended the structure-activity relationship of this series with small N 6 -alkyl substitution, 5'-esters, deaza modifications of adenine, and ribose restored in place of methanocarba. C2-(5-Halothien-2-yl)-ethynyl 5'-methyl 9 (MRS7292) and 5'-ethyl 10 (MRS7232) esters enhanced binding at DAT (EC 50 ∼ 35 nM) and at the norepinephrine transporter (NET). 9 and 10 were selective for DAT compared to A 3 AR in the mouse but not in humans. At DAT, the binding of two structurally dissimilar radioligands was enhanced; NET binding of only one radioligand was enhanced; SERT radioligand binding was minimally affected. 10 was more potent than cocaine at inhibiting DA uptake (IC 50 = 107 nM). Ribose analogues were weaker in DAT interaction than the corresponding bicyclics. Thus, we enhanced the neurotransmitter transporter activity of rigid nucleosides while reducing A 3 AR affinity.

  19. Synthesis and binding affinity analysis of α1-2- and α1-6-O/S-linked dimannosides for the elucidation of sulfur in glycosidic bonds using quartz crystal microbalance sensors.

    PubMed

    Norberg, Oscar; Wu, Bin; Thota, Niranjan; Ge, Jian-Tao; Fauquet, Germain; Saur, Ann-Kathrin; Aastrup, Teodor; Dong, Hai; Yan, Mingdi; Ramström, Olof

    2017-11-27

    The role of sulfur in glycosidic bonds has been evaluated using quartz crystal microbalance methodology. Synthetic routes towards α1-2- and α1-6-linked dimannosides with S- or O-glycosidic bonds have been developed, and the recognition properties assessed in competition binding assays with the cognate lectin concanavalin A. Mannose-presenting QCM sensors were produced using photoinitiated, nitrene-mediated immobilization methods, and the subsequent binding study was performed in an automated flow-through instrumentation, and correlated with data from isothermal titration calorimetry. The recorded K d -values corresponded well with reported binding affinities for the O-linked dimannosides with affinities for the α1-2-linked dimannosides in the lower micromolar range. The S-linked analogs showed slightly disparate effects, where the α1-6-linked analog showed weaker affinity than the O-linked dimannoside, as well as positive apparent cooperativity, whereas the α1-2-analog displayed very similar binding compared to the O-linked structure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Force fields for describing the solution-phase synthesis of shape-selective metal nanoparticles

    NASA Astrophysics Data System (ADS)

    Zhou, Ya; Al-Saidi, Wissam; Fichthorn, Kristen

    2013-03-01

    Polyvinylpyrrolidone (PVP) and polyethylene oxide (PEO) are structure-directing agents that exhibit different performance in the polyol synthesis of Ag nanostructures. The success of these structure-directing agents in selective nanostructure synthesis is often attributed to their selective binding to Ag(100) facets. We use first-principles, density-functional theory (DFT) calculations in a vacuum environment to show that PVP has a stronger preference to bind to Ag(100) than to Ag(111), whereas PEO exhibits much weaker selectivity. To understand the role of solvent in the surface-sensitive binding, we develop classical force fields to describe the interactions of the structure-directing (PVP and PEO) and solvent (ethylene glycol) molecules with various Ag substrates. We parameterize the force fields through force-and-energy matching to DFT results using simulated annealing. We validate the force fields by comparisons to DFT and experimental binding energies. Our force fields reproduce the surface-sensitive binding predicted by DFT calculations. Molecular dynamics simulations based on these force fields can be used to reveal the role of solvent, polymer chain length, and polymer concentration in the selective synthesis of Ag nanostructures.

  1. Structural basis for selective inhibition of human PKG Iα by the balanol-like compound N46.

    PubMed

    Qin, Liying; Sankaran, Banumathi; Aminzai, Sahar; Casteel, Darren; Kim, Choel

    2018-05-16

    Activation of PKG Iα in nociceptive neurons induces a long-term hyperexcitability that causes chronic pain. Recently, a derivative of the fungal metabolite balanol, N46, has been reported to inhibit PKG Iα with high potency and selectivity and attenuates thermal hyperalgesia and osteoarthritic pain. Here, we determined co-crystal structures of the PKG Iα C-domain and cAMP-dependent protein kinase (PKA) Cα, each bound with N46, at 1.98 Å and 2.65 Å, respectively. N46 binds the active site with its external phenyl ring specifically interacting with the glycine-rich loop and the αC helix. Phe371 at the PKG Iα glycine-rich loop is oriented parallel to the phenyl ring of N46, forming a strong π-stacking interaction, while the analogous Phe54 in PKA Cα rotates 30º and forms a weaker interaction. Structural comparison revealed that steric hindrance between the preceding Ser53 and the propoxy group of the phenyl ring may explain the weaker interaction with PKA Cα. The analogous Gly370 in PKG Iα, however, causes little steric hindrance with Phe371. Moreover, Ile406 on the αC helix forms a hydrophobic interaction with N46 while its counterpart in PKA, Thr88, does not. Substituting these residues in PKG Iα with those in PKA Cα increases its IC50 values for N46 whereas replacing these residues in PKA Cα with those in PKG Iα reduces the IC50, consistent with our structural findings. In conclusion, our results explain the structural basis for N46-mediated selective inhibition of human PKG Iα and provide a starting point for structure-guided design of selective PKG Iα inhibitors. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  3. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  4. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  5. WRKY13 acts in stem development in Arabidopsis thaliana.

    PubMed

    Li, Wei; Tian, Zhaoxia; Yu, Diqiu

    2015-07-01

    Stems are important for plants to grow erectly. In stems, sclerenchyma cells must develop secondary cell walls to provide plants with physical support. The secondary cell walls are mainly composed of lignin, xylan and cellulose. Deficiency of overall stem development could cause weakened stems. Here we prove that WRKY13 acts in stem development. The wrky13 mutants take on a weaker stem phenotype. The number of sclerenchyma cells, stem diameter and the number of vascular bundles were reduced in wrky13 mutants. Lignin-synthesis-related genes were repressed in wrky13 mutants. Chromatin immunoprecipitation assays proved that WRKY13 could directly bind to the promoter of NST2. Taken together, we proposed that WRKY13 affected the overall development of stem. Identification of the role of WRKY13 may help to resolve agricultural problems caused by weaker stems. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  7. Unconventional hydrogen bonding to organic ions in the gas phase: Stepwise association of hydrogen cyanide with the pyridine and pyrimidine radical cations and protonated pyridine

    NASA Astrophysics Data System (ADS)

    Hamid, Ahmed M.; El-Shall, M. Samy; Hilal, Rifaat; Elroby, Shaaban; Aziz, Saadullah G.

    2014-08-01

    Equilibrium thermochemical measurements using the ion mobility drift cell technique have been utilized to investigate the binding energies and entropy changes for the stepwise association of HCN molecules with the pyridine and pyrimidine radical cations forming the C5H5N+.(HCN)n and C4H4N2+.(HCN)n clusters, respectively, with n = 1-4. For comparison, the binding of 1-4 HCN molecules to the protonated pyridine C5H5NH+(HCN)n has also been investigated. The binding energies of HCN to the pyridine and pyrimidine radical cations are nearly equal (11.4 and 12.0 kcal/mol, respectively) but weaker than the HCN binding to the protonated pyridine (14.0 kcal/mol). The pyridine and pyrimidine radical cations form unconventional carbon-based ionic hydrogen bonds with HCN (CHδ+⋯NCH). Protonated pyridine forms a stronger ionic hydrogen bond with HCN (NH+⋯NCH) which can be extended to a linear chain with the clustering of additional HCN molecules (NH+⋯NCH..NCH⋯NCH) leading to a rapid decrease in the bond strength as the length of the chain increases. The lowest energy structures of the pyridine and pyrimidine radical cation clusters containing 3-4 HCN molecules show a strong tendency for the internal solvation of the radical cation by the HCN molecules where bifurcated structures involving multiple hydrogen bonding sites with the ring hydrogen atoms are formed. The unconventional H-bonds (CHδ+⋯NCH) formed between the pyridine or the pyrimidine radical cations and HCN molecules (11-12 kcal/mol) are stronger than the similar (CHδ+⋯NCH) bonds formed between the benzene radical cation and HCN molecules (9 kcal/mol) indicating that the CHδ+ centers in the pyridine and pyrimidine radical cations have more effective charges than in the benzene radical cation.

  8. Unconventional hydrogen bonding to organic ions in the gas phase: stepwise association of hydrogen cyanide with the pyridine and pyrimidine radical cations and protonated pyridine.

    PubMed

    Hamid, Ahmed M; El-Shall, M Samy; Hilal, Rifaat; Elroby, Shaaban; Aziz, Saadullah G

    2014-08-07

    Equilibrium thermochemical measurements using the ion mobility drift cell technique have been utilized to investigate the binding energies and entropy changes for the stepwise association of HCN molecules with the pyridine and pyrimidine radical cations forming the C5H5N(+·)(HCN)n and C4H4N2 (+·)(HCN)n clusters, respectively, with n = 1-4. For comparison, the binding of 1-4 HCN molecules to the protonated pyridine C5H5NH(+)(HCN)n has also been investigated. The binding energies of HCN to the pyridine and pyrimidine radical cations are nearly equal (11.4 and 12.0 kcal/mol, respectively) but weaker than the HCN binding to the protonated pyridine (14.0 kcal/mol). The pyridine and pyrimidine radical cations form unconventional carbon-based ionic hydrogen bonds with HCN (CH(δ+)⋯NCH). Protonated pyridine forms a stronger ionic hydrogen bond with HCN (NH(+)⋯NCH) which can be extended to a linear chain with the clustering of additional HCN molecules (NH(+)⋯NCH··NCH⋯NCH) leading to a rapid decrease in the bond strength as the length of the chain increases. The lowest energy structures of the pyridine and pyrimidine radical cation clusters containing 3-4 HCN molecules show a strong tendency for the internal solvation of the radical cation by the HCN molecules where bifurcated structures involving multiple hydrogen bonding sites with the ring hydrogen atoms are formed. The unconventional H-bonds (CH(δ+)⋯NCH) formed between the pyridine or the pyrimidine radical cations and HCN molecules (11-12 kcal/mol) are stronger than the similar (CH(δ+)⋯NCH) bonds formed between the benzene radical cation and HCN molecules (9 kcal/mol) indicating that the CH(δ+) centers in the pyridine and pyrimidine radical cations have more effective charges than in the benzene radical cation.

  9. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  10. Structural and biochemical characterization of the inhibitor complexes of xenotropic murine leukemia virus-related virus protease.

    PubMed

    Li, Mi; Gustchina, Alla; Matúz, Krisztina; Tözsér, Jozsef; Namwong, Sirilak; Goldfarb, Nathan E; Dunn, Ben M; Wlodawer, Alexander

    2011-11-01

    Interactions between the protease (PR) encoded by the xenotropic murine leukemia virus-related virus and a number of potential inhibitors have been investigated by biochemical and structural techniques. It was observed that several inhibitors used clinically against HIV PR exhibit nanomolar or even subnanomolar values of K(i) , depending on the exact experimental conditions. Both TL-3, a universal inhibitor of retroviral PRs, and some inhibitors originally shown to inhibit plasmepsins were also quite potent, whereas inhibition by pepstatin A was considerably weaker. Crystal structures of the complexes of xenotropic murine leukemia virus-related virus PR with TL-3, amprenavir and pepstatin A were solved at high resolution and compared with the structures of complexes of these inhibitors with other retropepsins. Whereas TL-3 and amprenavir bound in a predictable manner, spanning the substrate-binding site of the enzyme, two molecules of pepstatin A bound simultaneously in an unprecedented manner, leaving the catalytic water molecule in place. Journal compilation © 2011 FEBS. No claim to original US government works.

  11. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  12. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  13. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  14. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  15. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  16. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  17. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  18. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  19. GBR-12909 and fluspirilene potently inhibited binding of ( sup 3 H) (+) 3-PPP to sigma receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Contreras, P.C.; Bremer, M.E.; Rao, T.S.

    1990-01-01

    Fluspirilene and GBR-12909, two compounds structurally similar to BMY-14802 and haloperidol, were assessed for their ability to interact with sigma receptors. Fluspirilene, an antipsychotic agent that interacts potently with dopamine receptors, inhibited the binding of ({sup 3}H)-(+)3-PPP (IC{sub 50} = 380 nM) more potently than rimcazole, a putative sigma antagonist that was tested clinically for antipsychotic activity. GBR-12909, a potent dopamine uptake blocker, also inhibited the binding of ({sup 3}H)-(+)3-PPP with an IC{sub 50} of 48 nM. However, other compounds that block the re-uptake of catecholamines, such as nomifensine, desipramine, imipramine, xylamine, benztropine and cocaine, were much weaker than GBR-12909asmore » sigma ligands. Thus, GBR-12909 and fluspirilene, compounds structurally similar to BMY-14802, are potent sigma ligands.« less

  20. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  1. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  2. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  3. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  5. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  6. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  7. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  8. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  10. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  12. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  13. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  14. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  15. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  16. Structure-based Design of Cyclically Permuted HIV-1 gp120 Trimers That Elicit Neutralizing Antibodies*

    PubMed Central

    Kesavardhana, Sannula; Das, Raksha; Citron, Michael; Datta, Rohini; Ecto, Linda; Srilatha, Nonavinakere Seetharam; DiStefano, Daniel; Swoyer, Ryan; Joyce, Joseph G.; Dutta, Somnath; LaBranche, Celia C.; Montefiori, David C.; Flynn, Jessica A.; Varadarajan, Raghavan

    2017-01-01

    A major goal for HIV-1 vaccine development is an ability to elicit strong and durable broadly neutralizing antibody (bNAb) responses. The trimeric envelope glycoprotein (Env) spikes on HIV-1 are known to contain multiple epitopes that are susceptible to bNAbs isolated from infected individuals. Nonetheless, all trimeric and monomeric Env immunogens designed to date have failed to elicit such antibodies. We report the structure-guided design of HIV-1 cyclically permuted gp120 that forms homogeneous, stable trimers, and displays enhanced binding to multiple bNAbs, including VRC01, VRC03, VRC-PG04, PGT128, and the quaternary epitope-specific bNAbs PGT145 and PGDM1400. Constructs that were cyclically permuted in the V1 loop region and contained an N-terminal trimerization domain to stabilize V1V2-mediated quaternary interactions, showed the highest homogeneity and the best antigenic characteristics. In guinea pigs, a DNA prime-protein boost regimen with these new gp120 trimer immunogens elicited potent neutralizing antibody responses against highly sensitive Tier 1A isolates and weaker neutralizing antibody responses with an average titer of about 115 against a panel of heterologous Tier 2 isolates. A modest fraction of the Tier 2 virus neutralizing activity appeared to target the CD4 binding site on gp120. These results suggest that cyclically permuted HIV-1 gp120 trimers represent a viable platform in which further modifications may be made to eventually achieve protective bNAb responses. PMID:27879316

  17. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  18. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  19. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  20. Functional Coupling between HIV-1 Integrase and the SWI/SNF Chromatin Remodeling Complex for Efficient in vitro Integration into Stable Nucleosomes

    PubMed Central

    Lesbats, Paul; Botbol, Yair; Chevereau, Guillaume; Vaillant, Cédric; Calmels, Christina; Arneodo, Alain; Andreola, Marie-Line; Lavigne, Marc; Parissi, Vincent

    2011-01-01

    Establishment of stable HIV-1 infection requires the efficient integration of the retroviral genome into the host DNA. The molecular mechanism underlying the control of this process by the chromatin structure has not yet been elucidated. We show here that stably associated nucleosomes strongly inhibit in vitro two viral-end integration by decreasing the accessibility of DNA to integrase. Remodeling of the chromatinized template by the SWI/SNF complex, whose INI1 major component interacts with IN, restores and redirects the full-site integration into the stable nucleosome region. These effects are not observed after remodeling by other human remodeling factors such as SNF2H or BRG1 lacking the integrase binding protein INI1. This suggests that the restoration process depends on the direct interaction between IN and the whole SWI/SNF complex, supporting a functional coupling between the remodeling and integration complexes. Furthermore, in silico comparison between more than 40,000 non-redundant cellular integration sites selected from literature and nucleosome occupancy predictions also supports that HIV-1 integration is promoted in the genomic region of weaker intrinsic nucleosome density in the infected cell. Our data indicate that some chromatin structures can be refractory for integration and that coupling between nucleosome remodeling and HIV-1 integration is required to overcome this natural barrier. PMID:21347347

  1. Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage

    PubMed Central

    Narula, Gagandeep; Tse-Dinh, Yuk-Ching

    2012-01-01

    Bacterial and archaeal topoisomerase I display selectivity for a cytosine base 4 nt upstream from the DNA cleavage site. Recently, the solved crystal structure of Escherichia coli topoisomerase I covalently linked to a single-stranded oligonucleotide revealed that R169 and R173 interact with the cytosine base at the −4 position via hydrogen bonds while the phenol ring of Y177 wedges between the bases at the −4 and the −5 position. Substituting R169 to alanine changed the selectivity of the enzyme for the base at the −4 position from a cytosine to an adenine. The R173A mutant displayed similar sequence selectivity as the wild-type enzyme, but weaker cleavage and relaxation activity. Mutation of Y177 to serine or alanine rendered the enzyme inactive. Although mutation of each of these residues led to different outcomes, R169, R173 and Y177 work together to interact with a cytosine base at the −4 position to facilitate DNA cleavage. These strictly conserved residues might act after initial substrate binding as a Molecular Ruler to form a protein–DNA complex with the scissile phosphate positioned at the active site for optimal DNA cleavage by the tyrosine hydroxyl nucleophile to facilitate DNA cleavage in the reaction pathway. PMID:22833607

  2. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  3. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  4. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  5. Matrix metalloproteinase-10 (MMP-10) interaction with tissue inhibitors of metalloproteinases TIMP-1 and TIMP-2: binding studies and crystal structure.

    PubMed

    Batra, Jyotica; Robinson, Jessica; Soares, Alexei S; Fields, Alan P; Radisky, Derek C; Radisky, Evette S

    2012-05-04

    Matrix metalloproteinase 10 (MMP-10, stromelysin-2) is a secreted metalloproteinase with functions in skeletal development, wound healing, and vascular remodeling; its overexpression is also implicated in lung tumorigenesis and tumor progression. To understand the regulation of MMP-10 by tissue inhibitors of metalloproteinases (TIMPs), we have assessed equilibrium inhibition constants (K(i)) of putative physiological inhibitors TIMP-1 and TIMP-2 for the active catalytic domain of human MMP-10 (MMP-10cd) using multiple kinetic approaches. We find that TIMP-1 inhibits the MMP-10cd with a K(i) of 1.1 × 10(-9) M; this interaction is 10-fold weaker than the inhibition of the similar MMP-3 (stromelysin-1) catalytic domain (MMP-3cd) by TIMP-1. TIMP-2 inhibits the MMP-10cd with a K(i) of 5.8 × 10(-9) M, which is again 10-fold weaker than the inhibition of MMP-3cd by this inhibitor (K(i) = 5.5 × 10(-10) M). We solved the x-ray crystal structure of TIMP-1 bound to the MMP-10cd at 1.9 Å resolution; the structure was solved by molecular replacement and refined with an R-factor of 0.215 (R(free) = 0.266). Comparing our structure of MMP-10cd·TIMP-1 with the previously solved structure of MMP-3cd·TIMP-1 (Protein Data Bank entry 1UEA), we see substantial differences at the binding interface that provide insight into the differential binding of stromelysin family members to TIMP-1. This structural information may ultimately assist in the design of more selective TIMP-based inhibitors tailored for specificity toward individual members of the stromelysin family, with potential therapeutic applications.

  6. Investigating Ebola virus pathogenicity using molecular dynamics.

    PubMed

    Pappalardo, Morena; Collu, Francesca; Macpherson, James; Michaelis, Martin; Fraternali, Franca; Wass, Mark N

    2017-08-11

    Ebolaviruses have been known to cause deadly disease in humans for 40 years and have recently been demonstrated in West Africa to be able to cause large outbreaks. Four Ebolavirus species cause severe disease associated with high mortality in humans. Reston viruses are the only Ebolaviruses that do not cause disease in humans. Conserved amino acid changes in the Reston virus protein VP24 compared to VP24 of other Ebolaviruses have been suggested to alter VP24 binding to host cell karyopherins resulting in impaired inhibition of interferon signalling, which may explain the difference in human pathogenicity. Here we used protein structural analysis and molecular dynamics to further elucidate the interaction between VP24 and KPNA5. As a control experiment, we compared the interaction of wild-type and R137A-mutant (known to affect KPNA5 binding) Ebola virus VP24 with KPNA5. Results confirmed that the R137A mutation weakens direct VP24-KPNA5 binding and enables water molecules to penetrate at the interface. Similarly, Reston virus VP24 displayed a weaker interaction with KPNA5 than Ebola virus VP24, which is likely to reduce the ability of Reston virus VP24 to prevent host cell interferon signalling. Our results provide novel molecular detail on the interaction of Reston virus VP24 and Ebola virus VP24 with human KPNA5. The results indicate a weaker interaction of Reston virus VP24 with KPNA5 than Ebola virus VP24, which is probably associated with a decreased ability to interfere with the host cell interferon response. Hence, our study provides further evidence that VP24 is a key player in determining Ebolavirus pathogenicity.

  7. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  8. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  9. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  10. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  11. Indole Localization in an Explicit Bilayer Revealed via Molecular Dynamics

    NASA Astrophysics Data System (ADS)

    Norman, Kristen

    2005-11-01

    It is well known that the amino-acid tryptophan is particularly stable in the interfacial region of biological membranes, and this preference is a property of the tryptophan side-chain. Analogues of this side-chain, such as indole, strongly localize in the interfacial region, especially near the glycerol moiety of the lipids in the bilayer. Using molecular dynamics calculations, we determine the potential of mean force (PMF) for indoles in the bilayer. We compare the calculated PMF for indole with that of benzene to show that exclusion from the center of the lipid bilayer does not occur in all aromatics, but is strong in indoles. We find three minima in the PMF. Indole is most stabilized near the glycerol moiety. A weaker binding location is found near the choline groups of the lipid molecules. An even weaker binding side is found near the center of the lipid hydrocarbon core. Comparisions between uncharged, weakly charged, and highly charged indoles demonstrate that the exclusion is caused by the charge distribution on the indole rather than the ``lipo-phobic'' effect. High temperature simulations are used to determine the relative contribution of enthalpy and entropy to indole localization. The orientation of indole is found to be largely charge independent and is a strong function of depth within the bilayer. We find good agreement between simulated SCD order parameters for indole and experimentally determined order parameters.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowley, S.; Okumura, N; Lord, S

    'A:a' knob-hole interactions and D:D interfacial interactions are important for fibrin polymerization. Previous studies with recombinant ?N308K fibrinogen, a substitution at the D:D interface, showed impaired polymerization. We examined the molecular basis for this loss of function by solving the crystal structure of ?N308K fragment D. In contrast to previous fragment D crystals, the ?N308K crystals belonged to a tetragonal space group with an unusually long unit cell (a = b = 95 Angstroms, c = 448.3 Angstroms). Alignment of the normal and ?N308K structures showed the global structure of the variant was not changed and the knob 'A' peptidemore » GPRP was bound as usual to hole 'a'. The substitution introduced an elongated positively charged patch in the D:D region. The structure showed novel, symmetric D:D crystal contacts between ?N308K molecules, indicating the normal asymmetric D:D interface in fibrin would be unstable in this variant. We examined GPRP binding to ?N308K in solution by plasmin protection assay. The results showed weaker peptide binding, suggesting that 'A:a' interactions were altered. We examined fibrin network structures by scanning electron microscopy and found the variant fibers were thicker and more heterogeneous than normal fibers. Considered together, our structural and biochemical studies indicate both 'A:a' and D:D interactions are weaker. We conclude that stable protofibrils cannot assemble from ?N308K monomers, leading to impaired polymerization.« less

  13. Evolution and Protein Packaging of Small Molecule RNA Aptamers

    PubMed Central

    Lau, Jolene L.; Baksh, Michael M.; Fiedler, Jason D.; Brown, Steven D.; Kussrow, Amanda; Bornhop, Darryl J.; Ordoukhanian, Phillip

    2011-01-01

    A high-affinity RNA aptamer (Kd = 50 nM) was efficiently identified by SELEX against a heteroaryl dihydropyrimidine structure, chosen as a representative drug-like molecule with no cross reactivity with mammalian or bacterial cells. This aptamer, its weaker-binding variants, and a known aptamer against theophylline were each embedded in a longer RNA sequence that was encapsidated inside a virus-like particle by a convenient expression technique. These nucleoprotein particles were shown by backscattering interferometry to bind to the small-molecule ligands with affinities similar to those of the free (non-encapsidated) aptamers. The system therefore comprises a general approach to the production and sequestration of functional RNA molecules, characterized by a convenient label-free analytical technique. PMID:21899290

  14. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  15. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  16. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  17. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  18. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  19. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  20. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  1. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  2. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  3. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  4. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  5. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  6. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  7. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  8. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  9. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  10. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  11. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  12. The cis conformation of proline leads to weaker binding of a p53 peptide to MDM2 compared to trans.

    PubMed

    Zhan, Yingqian Ada; Ytreberg, F Marty

    2015-06-01

    The cis and trans conformations of the Xaa-Pro (Xaa: any amino acid) peptide bond are thermodynamically stable while other peptide bonds strongly prefer trans. The effect of proline cis-trans isomerization on protein binding has not been thoroughly investigated. In this study, computer simulations were used to calculate the absolute binding affinity for a p53 peptide (residues 17-29) to MDM2 for both cis and trans isomers of the p53 proline in position 27. Results show that the cis isomer of p53(17-29) binds more weakly to MDM2 than the trans isomer, and that this is primarily due to the difference in the free energy cost associated with the loss of conformational entropy of p53(17-29) when it binds to MDM2. The population of cis p53(17-29) was estimated to be 0.8% of the total population in the bound state. The stronger binding of trans p53(17-29) to MDM2 compared to cis may leave a minimal level of p53 available to respond to cellular stress. This study demonstrates that it is feasible to estimate the absolute binding affinity for an intrinsically disordered protein fragment binding to an ordered protein that are in good agreement with experimental results. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  14. TPD IR studies of CO desorption from zeolites CuY and CuX

    NASA Astrophysics Data System (ADS)

    Datka, Jerzy; Kozyra, Paweł

    2005-06-01

    The desorption of CO from zeolites CuY and CuX was followed by TPD-IR method. This is a combination of temperature programmed desorption and IR spectroscopy. In this method, the status of activated zeolite (before adsorption), the process of adsorption, and the status of adsorbed molecules can be followed by IR spectroscopy, and the process of desorption (with linear temperature increase) can be followed both by IR spectroscopy and by mass spectrometry. IR spectra have shown two kinds of Cu + sites in both CuY and CuX. Low frequency (l.f.) band (2140 cm -1 in CuY and 2130 cm -1 in CuX) of adsorbed CO represents Cu + sites for which π back donation is stronger and σ donation is weaker whereas high frequency h.f. band (2160 cm -1 in CuY and 2155 cm -1 in CuX) represent Cu + sites for which π back donation is weaker and σ donation is stronger. The TPD-IR experiments evidenced that the Cu + sites represented by l.f. band bond CO more weakly than those represented by h.f. one, indicating that σ donation has more important impact to the strength of Cu +-CO bonding. On the contrary, π back donation has bigger contribution to the activation of adsorbed molecules.

  15. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  16. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  17. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  18. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  19. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  20. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  1. Balanol analogues probe specificity determinants and the conformational malleability of the cyclic 3',5'-adenosine monophosphate-dependent protein kinase catalytic subunit.

    PubMed

    Akamine, Pearl; Madhusudan; Brunton, Laurence L; Ou, Horng D; Canaves, Jaume M; Xuong, Nguyen-huu; Taylor, Susan S

    2004-01-13

    The protein kinase family is a prime target for therapeutic agents, since unregulated protein kinase activities are linked to myriad diseases. Balanol, a fungal metabolite consisting of four rings, potently inhibits Ser/Thr protein kinases and can be modified to yield potent inhibitors that are selective-characteristics of a desirable pharmaceutical compound. Here, we characterize three balanol analogues that inhibit cyclic 3',5'-adenosine monophosphate-dependent protein kinase (PKA) more specifically and potently than calcium- and phospholipid-dependent protein kinase (PKC). Correlation of thermostability and inhibition potency suggests that better inhibitors confer enhanced protection against thermal denaturation. Crystal structures of the PKA catalytic (C) subunit complexed to each analogue show the Gly-rich loop stabilized in an "intermediate" conformation, disengaged from important phosphoryl transfer residues. An analogue that perturbs the PKA C-terminal tail has slightly weaker inhibition potency. The malleability of the PKA C subunit is illustrated by active site residues that adopt alternate rotamers depending on the ligand bound. On the basis of sequence homology to PKA, a preliminary model of the PKC active site is described. The balanol analogues serve to test the model and to highlight differences in the active site local environment of PKA and PKC. The PKA C subunit appears to tolerate balanol analogues with D-ring modifications; PKC does not. We attribute this difference in preference to the variable B helix and C-terminal tail. By understanding the details of ligand binding, more specific and potent inhibitors may be designed that differentiate among closely related AGC protein kinase family members.

  2. Carbonic anhydrase inhibitors. Comparison of chlorthalidone, indapamide, trichloromethiazide, and furosemide X-ray crystal structures in adducts with isozyme II, when several water molecules make the difference.

    PubMed

    Temperini, Claudia; Cecchi, Alessandro; Scozzafava, Andrea; Supuran, Claudiu T

    2009-02-01

    Thiazide and high ceiling diuretics were recently shown to inhibit all mammalian isoforms of carbonic anhydrase (CA, EC 4.2.1.1) with a very different profile as compared to classical inhibitors, such as acetazolamide, methazolamide, and ethoxzolamide. Some of these structurally related compounds have a very different behavior against the widespread isozyme CA II, with chlorthalidone, trichloromethiazide, and furosemide being efficient inhibitors against CA II (K(I)s of 65-138 nM), whereas indapamide is a much weaker one (K(I) of 2520 nM). Furthermore, some of these diuretics are quite efficient (low nanomolar) inhibitors of other isoforms, for example, chlorthalidone against hCA VB, VII, IX, and XIII; indapamide against CA VII, IX, XII, and XIII, trichloromethiazide against CA VII and IX, and furosemide against CA I and XIV. Examining the four X-ray crystal structures of their CA II adducts, we observed several (2-3) active site water molecules interacting with the chlorthalidone, trichloromethiazide, and furosemide scaffolds which may be responsible for this important difference of activity. Indeed, indapamide bound to CA II has no interactions with active site water molecules. Chlorthalidone bound within the CA II active site is in an enolic (lactimic) tautomeric form, with the enolic OH also participating in two strong hydrogen bonds with Asn67 and a water molecule. The newly evidenced binding modes of these diuretics may be exploited for designing better CA II inhibitors as well as compounds with selectivity/affinity for various isoforms with medicinal chemistry applications.

  3. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  4. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  5. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  6. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  7. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  8. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  9. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  10. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  12. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  13. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  14. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  15. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  16. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  17. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  18. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  19. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  20. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  1. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  2. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  3. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  4. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  5. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  6. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  7. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  8. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  9. Structural and functional evidences for the interactions between nuclear hormone receptors and endocrine disruptors at low doses.

    PubMed

    Balaguer, Patrick; Delfosse, Vanessa; Grimaldi, Marina; Bourguet, William

    Endocrine-disrupting chemicals (EDCs) represent a broad class of exogenous substances that cause adverse effects in the endocrine system mainly by interacting with nuclear hormone receptors (NRs). Humans are generally exposed to low doses of pollutants, and current researches aim at deciphering the mechanisms accounting for the health impact of EDCs at environmental concentrations. Our correlative analysis of structural, interaction and cell-based data has revealed a variety of, sometimes unexpected, binding modes, reflecting a wide range of EDC affinities and specificities. Here, we present a few representative examples to illustrate various means by which EDCs achieve high-affinity binding to NRs. These examples include the binding of the mycoestrogen α-zearalanol to estrogen receptors, the covalent interaction of organotins with the retinoid X- and peroxisome proliferator-activated receptors, and the cooperative binding of two chemicals to the pregnane X receptor. We also discuss some hypotheses that could further explain low-concentration effects of EDCs with weaker affinity towards NRs. Copyright © 2017. Published by Elsevier Masson SAS.

  10. Adhesion of a bimetallic interface. Ph.D. Thesis - Case Western Reserve Univ.; [for Al, Mg, and Zn

    NASA Technical Reports Server (NTRS)

    Ferrante, J.

    1978-01-01

    The Hohenberg-Kohn and Kohn-Sham formalisms are used to examine binding (binding energy as a function of separation) for combinations of the simple metals Al(111), Zn(0001), Mg(0001), and Na(110) in contact. Similar metal contacts between Al, Zn, Mg, and Na are examined self-consistently in an ab initio calculation using the Kohn-Sham formalism. Crystallinity is included using the Aschroft pseudopotential via first order perturbation theory for the electron-ion interaction; and the ion-ion interaction is included exactly via a lattice sum. Binding energy was determined both in the local-density approximation and including gradient corrections to the exchange and correlation energy. Binding was found in all cases. In dissimilar metal contacts, interfacial bonding was greater than that in the weaker material predicting the possibility of metallic transfer. The nonzero position of the energy minimum in like metal contacts is explained in terms of consistency between the Ashcroft pseudopotential and the bulk charge density. Good agreement with experimental surface energies is obtained in the self-consistent calculation when nonlocal terms are included.

  11. The moral foundations hypothesis does not replicate well in Black samples.

    PubMed

    Davis, Don E; Rice, Kenneth; Van Tongeren, Daryl R; Hook, Joshua N; DeBlaere, Cirleen; Worthington, Everett L; Choe, Elise

    2016-04-01

    The current study examined the generalizability of the moral foundations hypothesis (Graham, Haidt, & Nosek, 2009), which predicts that conservatism will be positively related to the binding foundations (i.e., virtues of ingroup/loyalty, authority/respect, and purity/sanctity). Religiosity has been consistently linked with the binding foundations in predominately White samples, but Black people in the United States are both more religious and more liberal than White people. In a sample of college students (N = 693; 58.3% Black, 41.7% White), examination of measurement invariance suggested metric, but not scalar invariance. The relationship between conservatism and the binding foundations-specifically, respect/authority and purity/sanctity-was weaker in Black people than in White people. These results were replicated in a second sample (N = 490; 63.5% Black, 36.5% White) using a 4-item measure of conservatism rather than a single item. Once again examination of measurement invariance suggested metric but not scalar invariance, and conservatism was more weakly related to the binding foundations in Black people than it was in White people. Implications for future theory and research are discussed. (c) 2016 APA, all rights reserved).

  12. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  13. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  14. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  15. Thermometric sensing of nitrofurantoin by noncovalently imprinted polymers containing two complementary functional monomers.

    PubMed

    Athikomrattanakul, Umporn; Gajovic-Eichelmann, Nenad; Scheller, Frieder W

    2011-10-15

    Molecularly imprinted polymers (MIPs) for nitrofurantoin (NFT) recognition addressing in parallel of two complementary functional groups were created using a noncovalent imprinting approach. Specific tailor-made functional monomers were synthesized: a diaminopyridine derivative as the receptor for the imide residue and three (thio)urea derivatives for the interaction with the nitro group of NFT. A significantly improved binding of NFT to the new MIPs was revealed from the imprinting factor, efficiency of binding, affinity constants and maximum binding number as compared to previously reported MIPs, which addressed either the imide or the nitro residue. Substances possessing only one functionality (either the imide group or nitro group) showed significantly weaker binding to the new imprinted polymers than NFT. However, the compounds lacking both functionalities binds extremely weak to all imprinted polymers. The new imprinted polymers were applied in a flow-through thermistor in organic solvent for the first time. The MIP-thermistor allows the detection of NFT down to a concentration of 5 μM in acetonitrile + 0.2% dimethyl sulfoxide (DMSO). The imprinting factor of 3.91 at 0.1 mM of NFT as obtained by thermistor measurements is well comparable to the value obtained by batch binding experiments. © 2011 American Chemical Society

  16. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  17. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  18. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  19. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  20. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  1. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  2. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Interactions of p-Nitrobenzene Diazonium Fluoroborate and Analogs with the Active Sites of Acetylcholine-Receptor and -Esterase*

    PubMed Central

    Mautner, Henry G.; Bartels, Eva

    1970-01-01

    p-Nitrobenzene diazonium fluoroborate (NDF) is a potent inhibitor of the carbamylcholine-induced depolarization of the electroplax and of acetylcholinesterase. It probably forms covalent bonds with the acetylcholine-receptor and -esterase at the active site of the proteins. Its inhibitory strength is at least the same as that of trimethylammonium diazonium fluoroborate (TDF). The p-acetoxy analog, with its weaker electron-withdrawing group, is about ten times weaker as an inhibitor than the trimethylammonium or p-nitro analogs, both of which have strong electron-withdrawing groups. After treatment of the electroplax preparation with dithiothreitol, NDF remains an irreversible receptor-inhibitor, while TDF becomes a potent reversible receptor-activator. TDF is self-inhibitory: applied before reduction, it no longer depolarizes. Although the first observations on TDF suggested that the compound labels both proteins by virtue of the steric complementary of its trimethylammonium group to a negative subsite in the proteins, the present study indicates that it is the positively charged diazonium group that reacts with the active sites of the proteins to form a covalent bond with an appropriate amino-acid residue. PMID:5272331

  5. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  6. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  7. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  8. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  10. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  11. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  12. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  13. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  14. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  15. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  16. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  17. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  18. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  19. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  20. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  1. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  2. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  3. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  4. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  5. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  6. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  7. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  8. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  9. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Kinetic Limitations of Cooperativity-Based Drug Delivery Systems

    NASA Astrophysics Data System (ADS)

    Licata, Nicholas A.; Tkachenko, Alexei V.

    2008-04-01

    We study theoretically a novel drug delivery system that utilizes the overexpression of certain proteins in cancerous cells for cell-specific chemotherapy. The system consists of dendrimers conjugated with “keys” (ex: folic acid) which “key-lock” bind to particular cell-membrane proteins (ex: folate receptor). The increased concentration of “locks” on the surface leads to a longer residence time for the dendrimer and greater incorporation into the cell. Cooperative binding of the nanocomplexes leads to an enhancement of cell specificity. However, both our theory and detailed analysis of in vitro experiments indicate that the degree of cooperativity is kinetically limited. We demonstrate that cooperativity and hence the specificity to particular cell type can be increased by making the strength of individual bonds weaker, and suggest a particular implementation of this idea.

  11. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  12. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  13. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  14. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  16. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  17. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  18. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  19. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  20. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  1. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  2. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  3. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  4. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  5. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  6. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  7. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  8. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  9. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  10. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  11. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  12. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  13. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  14. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  15. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  16. Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

    PubMed

    Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

    2006-04-28

    Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Su, Minfei; Li, Yue; Wyborny, Shane

    ATG14 binding to BECN/Beclin homologs is essential for autophagy, a critical catabolic homeostasis pathway. Here, we show that the α-helical, coiled-coil domain (CCD) of BECN2, a recently identified mammalian BECN1 paralog, forms an antiparallel, curved homodimer with seven pairs of nonideal packing interactions, while the BECN2 CCD and ATG14 CCD form a parallel, curved heterodimer stabilized by multiple, conserved polar interactions. Compared to BECN1, the BECN2 CCD forms a weaker homodimer, but binds more tightly to the ATG14 CCD. Mutation of nonideal BECN2 interface residues to more ideal pairs improves homodimer self-association and thermal stability. Unlike BECN1, all BECN2 CCDmore » mutants bind ATG14, although more weakly than wild type. Thus, polar BECN2 CCD interface residues result in a metastable homodimer, facilitating dissociation, but enable better interactions with polar ATG14 residues stabilizing the BECN2:ATG14 heterodimer. These structure-based mechanistic differences in BECN1 and BECN2 homodimerization and heterodimerization likely dictate competitive ATG14 recruitment.« less

  18. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  19. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  20. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  1. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  2. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  3. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  4. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  5. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  6. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  7. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  8. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  10. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  11. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  12. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  13. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  14. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  15. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  16. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  17. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  18. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  19. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  20. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  1. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  2. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  3. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  4. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  5. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  6. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  7. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  8. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  9. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  10. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  11. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  12. An Integrated Phosphoproteomics Work Flow Reveals Extensive Network Regulation in Early Lysophosphatidic Acid Signaling*

    PubMed Central

    Schreiber, Thiemo B.; Mäusbacher, Nina; Kéri, György; Cox, Jürgen; Daub, Henrik

    2010-01-01

    Lysophosphatidic acid (LPA) induces a variety of cellular signaling pathways through the activation of its cognate G protein-coupled receptors. To investigate early LPA responses and assess the contribution of epidermal growth factor (EGF) receptor transactivation in LPA signaling, we performed phosphoproteomics analyses of both total cell lysate and protein kinase-enriched fractions as complementary strategies to monitor phosphorylation changes in A498 kidney carcinoma cells. Our integrated work flow enabled the identification and quantification of more than 5,300 phosphorylation sites of which 224 were consistently regulated by LPA. In addition to induced phosphorylation events, we also obtained evidence for early dephosphorylation reactions due to rapid phosphatase regulation upon LPA treatment. Phosphorylation changes induced by direct heparin-binding EGF-like growth factor-mediated EGF receptor activation were typically weaker and only detected on a subset of LPA-regulated sites, indicating signal integration among EGF receptor transactivation and other LPA-triggered pathways. Our results reveal rapid phosphoregulation of many proteins not yet implicated in G protein-coupled receptor signaling and point to various additional mechanisms by which LPA might regulate cell survival and migration as well as gene transcription on the molecular level. Moreover, our phosphoproteomics analysis of both total lysate and kinase-enriched fractions provided highly complementary parts of the LPA-regulated signaling network and thus represents a useful and generic strategy toward comprehensive signaling studies on a system-wide level. PMID:20071362

  13. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  14. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  15. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  16. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  17. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  18. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  19. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  20. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  1. RNA binding specificity of Ebola virus transcription factor VP30.

    PubMed

    Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K

    2016-09-01

    The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

  2. Unconventional hydrogen bonding to organic ions in the gas phase: Stepwise association of hydrogen cyanide with the pyridine and pyrimidine radical cations and protonated pyridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamid, Ahmed M.; El-Shall, M. Samy, E-mail: mselshal@vcu.edu; Hilal, Rifaat

    2014-08-07

    Equilibrium thermochemical measurements using the ion mobility drift cell technique have been utilized to investigate the binding energies and entropy changes for the stepwise association of HCN molecules with the pyridine and pyrimidine radical cations forming the C{sub 5}H{sub 5}N{sup +·}(HCN){sub n} and C{sub 4}H{sub 4}N{sub 2}{sup +·}(HCN){sub n} clusters, respectively, with n = 1–4. For comparison, the binding of 1–4 HCN molecules to the protonated pyridine C{sub 5}H{sub 5}NH{sup +}(HCN){sub n} has also been investigated. The binding energies of HCN to the pyridine and pyrimidine radical cations are nearly equal (11.4 and 12.0 kcal/mol, respectively) but weaker than themore » HCN binding to the protonated pyridine (14.0 kcal/mol). The pyridine and pyrimidine radical cations form unconventional carbon-based ionic hydrogen bonds with HCN (CH{sup δ+}⋯NCH). Protonated pyridine forms a stronger ionic hydrogen bond with HCN (NH{sup +}⋯NCH) which can be extended to a linear chain with the clustering of additional HCN molecules (NH{sup +}⋯NCH··NCH⋯NCH) leading to a rapid decrease in the bond strength as the length of the chain increases. The lowest energy structures of the pyridine and pyrimidine radical cation clusters containing 3-4 HCN molecules show a strong tendency for the internal solvation of the radical cation by the HCN molecules where bifurcated structures involving multiple hydrogen bonding sites with the ring hydrogen atoms are formed. The unconventional H-bonds (CH{sup δ+}⋯NCH) formed between the pyridine or the pyrimidine radical cations and HCN molecules (11–12 kcal/mol) are stronger than the similar (CH{sup δ+}⋯NCH) bonds formed between the benzene radical cation and HCN molecules (9 kcal/mol) indicating that the CH{sup δ+} centers in the pyridine and pyrimidine radical cations have more effective charges than in the benzene radical cation.« less

  3. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  4. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  5. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  6. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  7. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  8. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  9. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  10. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  11. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  12. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  13. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  15. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  16. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  18. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  19. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  20. X-ray Diffraction and Density Functional Theory Provide Insight into Vanadate Binding to Homohexameric Bromoperoxidase II and the Mechanism of Bromide Oxidation.

    PubMed

    Radlow, Madlen; Czjzek, Mirjam; Jeudy, Alexandra; Dabin, Jerome; Delage, Ludovic; Leblanc, Catherine; Hartung, Jens

    2018-05-18

    X-ray diffraction of native bromoperoxidase II (EC 1.11.1.18) from the brown alga Ascophyllum nodosum reveals at a resolution of 2.26 Å details of orthovanadate binding and homohexameric protein organization. Three dimers interwoven in contact regions and tightened by hydrogen-bond-clamped guanidinium stacks along with regularly aligned water molecules form the basic structure of the enyzme. Intra- and intermolecular disulfide bridges further stabilize the enzyme preventing altogether the protein from denaturing up to a temperature of 90 °C, as evident from dynamic light scattering and the on-gel ortho-dianisidine assay. Every monomer binds one equivalent of orthovanadate in a cavity formed from side chains of three histidines, two arginines, one lysine, serine, and tryptophan. Protein binding occurs primarily through hydrogen bridges and superimposed by Coulomb attraction according to thermochemical model on density functional level of theory (B3LYP/6-311++G**). The strongest attractor is the arginine side chain mimic N-methylguanidinium, enhancing in positive cooperative manner hydrogen bridges toward weaker acceptors, such as residues from lysine and serine. Activating hydrogen peroxide occurs in the thermochemical model by side-on binding in orthovanadium peroxoic acid, oxidizing bromide with virtually no activation energy to hydrogen bonded hypobromous acid.

  1. HIGH-AFFINITY T CELL RECEPTOR DIFFERENTIATES COGNATE PEPTIDE-MHC AND ALTERED PEPTIDE LIGANDS WITH DISTINCT KINETICS AND THERMODYNAMICS

    PubMed Central

    Persaud, Stephen P.; Donermeyer, David L.; Weber, K. Scott; Kranz, David M.; Allen, Paul M.

    2010-01-01

    Interactions between the T cell receptor and cognate peptide-MHC are crucial initiating events in the adaptive immune response. These binding events are highly specific yet occur with micromolar affinity. Even weaker interactions between TCR and self-pMHC complexes play critical regulatory roles in T cell development, maintenance and coagonist activity. Due to their low affinity, the kinetics and thermodynamics of such weak interactions are difficult to study. In this work, we used M15, a high-affinity TCR engineered from the 3.L2 TCR system, to study the binding properties, thermodynamics, and specificity of two altered peptide ligands (APLs). Our affinity measurements of the high-affinity TCR support the view that the wild type TCR binds these APLs in the millimolar affinity range, and hence very low affinities can still elicit biological functions. Finally, single methylene differences among the APLs gave rise to strikingly different binding thermodynamics. These minor changes in the pMHC antigen were associated with significant and unpredictable changes in both the entropy and enthalpy of the reaction. As the identical TCR was analyzed with several structurally similar ligands, the distinct thermodynamic binding profiles provide a mechanistic perspective on how exquisite antigen specificity is achieved by the T cell receptor. PMID:20334923

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  3. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  4. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  5. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  6. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  7. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  8. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  9. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  10. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  12. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  13. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  14. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  15. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  16. Investigating the effects of tropomyosin mutations on its flexibility and interactions with filamentous actin using molecular dynamics simulation.

    PubMed

    Zheng, Wenjun; Hitchcock-DeGregori, Sarah E; Barua, Bipasha

    2016-10-01

    Tropomyosin (Tpm) is a two-chained α-helical coiled-coil protein that binds to filamentous actin (F-actin), and regulates its interactions with myosin by occupying three average positions on F-actin (blocked, closed, and open). Mutations in the Tpm are linked to heart diseases including hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM). To elucidate the molecular mechanisms of Tpm mutations (including DCM mutation E54K, HCM mutations E62Q, A63V, K70T, V95A, D175N, E180G, L185R, E192K, and a designed synthetic mutation D137L) in terms of their effects on Tpm flexibility and its interactions with F-actin, we conducted extensive molecular dynamics simulations for the wild-type and mutant Tpm in complex with F-actin (total simulation time 160 ns per mutant). The mutants exhibited distinct changes (i.e., increase or decrease) in the overall and local flexibility of the Tpm coiled-coil, with each mutation causing both local and long-range modifications of the Tpm flexibility. In addition, our binding calculations revealed weakened Tpm-F-actin interactions (except for L185R, D137L and A63V) involving five periods of Tpm, which correlate with elevated fluctuation of Tpm relative to the blocked position on F-actin that may lead to easier activation and increased Ca 2+ -sensitivity. We also simulated the αβ/βα-Tpm heterodimer in comparison with the αα-Tpm homodimer, which revealed greater flexibility and weaker actin binding in the heterodimer. Our findings are consistent with a complex mechanism underlying how different Tpm mutations perturb the Tpm function in distinct ways (e.g., by affecting specific sites of Tpm), which bear no simple links to the disease phenotypes (e.g., HCM vs. DCM).

  17. CO adsorption on small Au{sub n} (n = 1–4) structures supported on hematite. II. Adsorption on the O-rich termination of α-Fe{sub 2}O{sub 3}(0001) surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pabisiak, Tomasz; Kiejna, Adam, E-mail: kiejna@ifd.uni.wroc.pl; Winiarski, Maciej J.

    2016-01-28

    The adsorption of small Au{sub n} (n = 1–4) nanostructures on oxygen terminated α-Fe{sub 2}O{sub 3}(0001) surface was investigated using density functional theory in the generalized gradient approximation of Perdew-Burke-Ernzerhof (PBE) form with Hubbard correction U, accounting for strong electron correlations (PBE+U). The structural, energetic, and electronic properties were examined for two classes of the adsorbed Au{sub n} nanostructures with vertical and flattened configurations. Similarly to the Fe-terminated α-Fe{sub 2}O{sub 3}(0001) surface considered in Part I, the flattened configurations were found energetically more favored than vertical ones. The binding of Au{sub n} to the O-terminated surface is much stronger thanmore » to the Fe-termination. The adsorption bonding energy of Au{sub n} and the work function of the Au{sub n}/α-Fe{sub 2}O{sub 3}(0001) systems decrease with the increased number of Au atoms in a structure. All of the adsorbed Au{sub n} structures are positively charged. The bonding of CO molecules to the Au{sub n} structures is distinctly stronger than on the Fe-terminated surface; however, it is weaker than the binding to the bare O-terminated surface. The CO molecule binds to the Au{sub n}/α-Fe{sub 2}O{sub 3}(0001) system through a peripheral Au atom partly detached from the Au{sub n} structure. The results of this work indicate that the most energetically favored sites for adsorption of a CO molecule on the Au{sub n}/α-Fe{sub 2}O{sub 3}(0001) systems are atoms in the Au{sup 0.5+} oxidation state.« less

  18. Analysis of glutathione S-transferase allergen cross-reactivity in a North American population: Relevance for molecular diagnosis.

    PubMed

    Mueller, Geoffrey A; Pedersen, Lars C; Glesner, Jill; Edwards, Lori L; Zakzuk, Josefina; London, Robert E; Arruda, Luisa Karla; Chapman, Martin D; Caraballo, Luis; Pomés, Anna

    2015-11-01

    It is not clear whether cross-reactivity or cosensitization to glutathione S-transferases (GSTs) occurs in tropical and subtropical environments. In the United States, Bla g 5 is the most important GST allergen and lack of coexposure to GSTs from certain species allows a better assessment of cross-reactivity. To examine the molecular structure of GST allergens from cockroach (Bla g 5), dust mites (Der p 8 and Blo t 8), and helminth (Asc s 13) for potential cross-reactive sites, and to assess the IgE cross-reactivity of sensitized patients from a temperate climate for these allergens for molecular diagnostic purposes. Four crystal structures were determined. Sera from patients allergic to cockroach and mite were tested for IgE reactivity to these GSTs. A panel of 6 murine anti-Bla g 5 mAb was assessed for cross-reactivity with the other 3 GSTs using antibody binding assays. Comparisons of the allergen structures, formed by 2-domain monomers that dimerize, revealed few contiguous regions of similar exposed residues, rendering cross-reactivity unlikely. Accordingly, anti-Bla g 5 or anti-Der p 8 IgE from North American patients did not recognize Der p 8 or Bla g 5, respectively, and neither showed binding to Blo t 8 or Asc s 13. A weaker binding of anti-Bla g 5 IgE to Der p 8 versus Bla g 5 (∼ 100-fold) was observed by inhibition assays, similar to a weak recognition of Der p 8 by anti-Bla g 5 mAb. Patients from tropical Colombia had IgE to all 4 GSTs. The lack of significant IgE cross-reactivity among the 4 GSTs is in agreement with the low shared amino acid identity at the molecular surface. Each GST is needed for accurate molecular diagnosis in different geographic areas. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  19. Mechanism of inhibition of mammalian tumor and other thymidylate synthases by N sup 4 -hydroxy-dCMP, N sup 4 -hydroxy-5-fluoro-dCMP, and related analogues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rode, W.; Zielinski, Z.; Dzik, J.M.

    1990-12-01

    N{sup 4}-Hydroxy-dCMP (N{sup 4}-OH-dCMP), N{sup 4}-methoxy-dCMP (N{sup 4}-OMe-dCMP), and their 5-fluoro congeners were all slow-binding inhibitors of Ehrlich carcinoma thymidylate synthase (TS), competitive with respect to dUMP, and had differing kinetic constants describing interactions with the two TS binding sites. N{sup 4}-OH-dCMP was not a substrate and its inactivation of TS was methylenetetrahydrofolate-dependent, hence mechanism-based. K{sub i} values for N{sup 4}-OH-dCMP and its 5-fluoro analogue were in the range 10{sup {minus}7}-10{sup {minus}8} M, 2-3 orders of magnitude higher for the corresponding N{sup 4}-OMe analogues. The 5-methyl analogue of N{sup 4}-OHdCMP was 10{sup 4}-fold less potent, pointing to the anti rotamermore » of the imino form of exocyclic N{sup 4}-OH, relative to the ring N(3), as the active species. This is consistent with weaker slow-binding inhibition of the altered enzyme from 5-FdUrd-resistant, relative to parent, L1210 cells by both FdUMP and N{sup 4}-OH-dCMP, suggesting interaction of both N{sup 4}-OH and C(5)-F groups with the same region of the active center. Kinetic studies with purified enzyme from five sources, viz., Ehrlich carcinoma, L1210 parental, and 5-FdUrd-resistant cells, regenerating rat liver, and the tapeworm Hymenolepis diminuta, demonstrated that addition of a 5-fluoro substituent to N{sup 4}-OH-dCMP increased its affinity from 2- to 20-fold for the enzyme from different sources. With the Ehrlich and tapeworm enzymes, N{sup 4}-OH-FdCMP and FdUMP were almost equally effective inhibitors.« less

  20. Sodium channel selectivity and conduction: Prokaryotes have devised their own molecular strategy

    PubMed Central

    Finol-Urdaneta, Rocio K.; Wang, Yibo; Al-Sabi, Ahmed; Zhao, Chunfeng

    2014-01-01

    Striking structural differences between voltage-gated sodium (Nav) channels from prokaryotes (homotetramers) and eukaryotes (asymmetric, four-domain proteins) suggest the likelihood of different molecular mechanisms for common functions. For these two channel families, our data show similar selectivity sequences among alkali cations (relative permeability, Pion/PNa) and asymmetric, bi-ionic reversal potentials when the Na/K gradient is reversed. We performed coordinated experimental and computational studies, respectively, on the prokaryotic Nav channels NaChBac and NavAb. NaChBac shows an “anomalous,” nonmonotonic mole-fraction dependence in the presence of certain sodium–potassium mixtures; to our knowledge, no comparable observation has been reported for eukaryotic Nav channels. NaChBac’s preferential selectivity for sodium is reduced either by partial titration of its highly charged selectivity filter, when extracellular pH is lowered from 7.4 to 5.8, or by perturbation—likely steric—associated with a nominally electro-neutral substitution in the selectivity filter (E191D). Although no single molecular feature or energetic parameter appears to dominate, our atomistic simulations, based on the published NavAb crystal structure, revealed factors that may contribute to the normally observed selectivity for Na over K. These include: (a) a thermodynamic penalty to exchange one K+ for one Na+ in the wild-type (WT) channel, increasing the relative likelihood of Na+ occupying the binding site; (b) a small tendency toward weaker ion binding to the selectivity filter in Na–K mixtures, consistent with the higher conductance observed with both sodium and potassium present; and (c) integrated 1-D potentials of mean force for sodium or potassium movement that show less separation for the less selective E/D mutant than for WT. Overall, tight binding of a single favored ion to the selectivity filter, together with crucial inter-ion interactions within the pore, suggests that prokaryotic Nav channels use a selective strategy more akin to those of eukaryotic calcium and potassium channels than that of eukaryotic Nav channels. PMID:24420772

  1. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  2. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  4. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  5. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  6. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  7. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  9. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  10. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  11. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  12. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  13. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  14. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  15. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  16. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  17. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  18. Modulating the DNA affinity of Elk-1 with computationally selected mutations.

    PubMed

    Park, Sheldon; Boder, Eric T; Saven, Jeffery G

    2005-04-22

    In order to regulate gene expression, transcription factors must first bind their target DNA sequences. The affinity of this binding is determined by both the network of interactions at the interface and the entropy change associated with the complex formation. To study the role of structural fluctuation in fine-tuning DNA affinity, we performed molecular dynamics simulations of two highly homologous proteins, Elk-1 and SAP-1, that exhibit different sequence specificity. Simulation studies show that several residues in Elk have significantly higher main-chain root-mean-square deviations than their counterparts in SAP. In particular, a single residue, D69, may contribute to Elk's lower DNA affinity for P(c-fos) by structurally destabilizing the carboxy terminus of the recognition helix. While D69 does not contact DNA directly, the increased mobility in the region may contribute to its weaker binding. We measured the ability of single point mutants of Elk to bind P(c-fos) in a reporter assay, in which D69 of wild-type Elk has been mutated to other residues with higher helix propensity in order to stabilize the local conformation. The gains in transcriptional activity and the free energy of binding suggested from these measurements correlate well with stability gains computed from helix propensity and charge-macrodipole interactions. The study suggests that residues that are distal to the binding interface may indirectly modulate the binding affinity by stabilizing the protein scaffold required for efficient DNA interaction.

  19. Specificity and Affinity Quantification of Flexible Recognition from Underlying Energy Landscape Topography

    PubMed Central

    Chu, Xiakun; Wang, Jin

    2014-01-01

    Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less) flexibility leads to weaker (stronger) coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition. PMID:25144525

  20. Specificity and affinity quantification of flexible recognition from underlying energy landscape topography.

    PubMed

    Chu, Xiakun; Wang, Jin

    2014-08-01

    Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less) flexibility leads to weaker (stronger) coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition.

  1. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  2. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  3. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  4. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  5. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  7. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  8. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  9. Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

    NASA Astrophysics Data System (ADS)

    Dyer, Brian

    2014-03-01

    Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

  10. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  11. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  12. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  13. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  14. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  15. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Reid, A.; Mahboubi, A.

    1991-02-01

    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

  16. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  17. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  18. Cooperative interplay of let-7 mimic and HuR with MYC RNA

    PubMed Central

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

  19. Two classes of binding sites for [3H]substance P in rat cerebral cortex.

    PubMed

    Geraghty, D P; Burcher, E

    1993-01-22

    The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

Top