GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
GSP: a web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David
2006-01-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David
2006-07-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
ERIC Educational Resources Information Center
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades
2007-01-01
Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.
Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn
2015-03-20
USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
TipMT: Identification of PCR-based taxon-specific markers.
Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C
2017-02-11
Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502
Survey Says? A Primer on Web-based Survey Design and Distribution
Oppenheimer, Adam J.; Pannucci, Christopher J.; Kasten, Steven J.; Haase, Steven C.
2011-01-01
The internet has changed the way in which we gather and interpret information. While books were once the exclusive bearers of data, knowledge is now only a keystroke away. The internet has also facilitated the synthesis of new knowledge. Specifically, it has become a tool through which medical research is conducted. A review of the literature reveals that in the past year, over one-hundred medical publications have been based on web-based survey data alone. Due to emerging internet technologies, web-based surveys can now be launched with little computer knowledge. They may also be self-administered, eliminating personnel requirements. Ultimately, an investigator may build, implement, and analyze survey results with speed and efficiency, obviating the need for mass mailings and data processing. All of these qualities have rendered telephone and mail-based surveys virtually obsolete. Despite these capabilities, web-based survey techniques are not without their limitations, namely recall and response biases. When used properly, however, web-based surveys can greatly simplify the research process. This article discusses the implications of web-based surveys and provides guidelines for their effective design and distribution. PMID:21701347
Informatics in radiology (infoRAD): HTML and Web site design for the radiologist: a primer.
Ryan, Anthony G; Louis, Luck J; Yee, William C
2005-01-01
A Web site has enormous potential as a medium for the radiologist to store, present, and share information in the form of text, images, and video clips. With a modest amount of tutoring and effort, designing a site can be as painless as preparing a Microsoft PowerPoint presentation. The site can then be used as a hub for the development of further offshoots (eg, Web-based tutorials, storage for a teaching library, publication of information about one's practice, and information gathering from a wide variety of sources). By learning the basics of hypertext markup language (HTML), the reader will be able to produce a simple and effective Web page that permits display of text, images, and multimedia files. The process of constructing a Web page can be divided into five steps: (a) creating a basic template with formatted text, (b) adding color, (c) importing images and multimedia files, (d) creating hyperlinks, and (e) uploading one's page to the Internet. This Web page may be used as the basis for a Web-based tutorial comprising text documents and image files already in one's possession. Finally, there are many commercially available packages for Web page design that require no knowledge of HTML.
Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.
Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas
2016-06-17
Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.
STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.
O'Halloran, Damien M
2015-06-01
Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.
DyNAVacS: an integrative tool for optimized DNA vaccine design.
Harish, Nagarajan; Gupta, Rekha; Agarwal, Parul; Scaria, Vinod; Pillai, Beena
2006-07-01
DNA vaccines have slowly emerged as keystones in preventive immunology due to their versatility in inducing both cell-mediated as well as humoral immune responses. The design of an efficient DNA vaccine, involves choice of a suitable expression vector, ensuring optimal expression by codon optimization, engineering CpG motifs for enhancing immune responses and providing additional sequence signals for efficient translation. DyNAVacS is a web-based tool created for rapid and easy design of DNA vaccines. It follows a step-wise design flow, which guides the user through the various sequential steps in the design of the vaccine. Further, it allows restriction enzyme mapping, design of primers spanning user specified sequences and provides information regarding the vectors currently used for generation of DNA vaccines. The web version uses Apache HTTP server. The interface was written in HTML and utilizes the Common Gateway Interface scripts written in PERL for functionality. DyNAVacS is an integrated tool consisting of user-friendly programs, which require minimal information from the user. The software is available free of cost, as a web based application at URL: http://miracle.igib.res.in/dynavac/.
2011-09-01
unique data requirements. For an excellent primer on the CBDN process see Keller and Plaga [2010]. This report shows an example of a database, in...data [Buhrman, Plaga , Cheng, Mosher, 2001]. 2.1.2.2 Web application development All technologies are based upon and run on top of the .NET...builds). Better manikin design leads to better assessment of personnel equipment under acceleration [such as helmet systems, see Plaga and Boehmer
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
2012-01-01
Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469
Yoon, Hyejin; Leitner, Thomas
2014-12-17
Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less
Cowan, Ashley F; Elkins, Kelly M
2017-12-01
Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
Marsh, Terence L.; Saxman, Paul; Cole, James; Tiedje, James
2000-01-01
Rapid analysis of microbial communities has proven to be a difficult task. This is due, in part, to both the tremendous diversity of the microbial world and the high complexity of many microbial communities. Several techniques for community analysis have emerged over the past decade, and most take advantage of the molecular phylogeny derived from 16S rRNA comparative sequence analysis. We describe a web-based research tool located at the Ribosomal Database Project web site (http://www.cme.msu.edu/RDP/html/analyses.html) that facilitates microbial community analysis using terminal restriction fragment length polymorphism of 16S ribosomal DNA. The analysis function (designated TAP T-RFLP) permits the user to perform in silico restriction digestions of the entire 16S sequence database and derive terminal restriction fragment sizes, measured in base pairs, from the 5′ terminus of the user-specified primer to the 3′ terminus of the restriction endonuclease target site. The output can be sorted and viewed either phylogenetically or by size. It is anticipated that the site will guide experimental design as well as provide insight into interpreting results of community analysis with terminal restriction fragment length polymorphisms. PMID:10919828
Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya
2012-03-04
Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.
2012-01-01
Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976
WebSat--a web software for microsatellite marker development.
Martins, Wellington Santos; Lucas, Divino César Soares; Neves, Kelligton Fabricio de Souza; Bertioli, David John
2009-01-01
Simple sequence repeats (SSR), also known as microsatellites, have been extensively used as molecular markers due to their abundance and high degree of polymorphism. We have developed a simple to use web software, called WebSat, for microsatellite molecular marker prediction and development. WebSat is accessible through the Internet, requiring no program installation. Although a web solution, it makes use of Ajax techniques, providing a rich, responsive user interface. WebSat allows the submission of sequences, visualization of microsatellites and the design of primers suitable for their amplification. The program allows full control of parameters and the easy export of the resulting data, thus facilitating the development of microsatellite markers. The web tool may be accessed at http://purl.oclc.org/NET/websat/
Koester, Meike; Gergs, René
2017-10-05
Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.
NASA Astrophysics Data System (ADS)
Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing
2014-05-01
Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.
WebSat ‐ A web software for microsatellite marker development
Martins, Wellington Santos; Soares Lucas, Divino César; de Souza Neves, Kelligton Fabricio; Bertioli, David John
2009-01-01
Simple sequence repeats (SSR), also known as microsatellites, have been extensively used as molecular markers due to their abundance and high degree of polymorphism. We have developed a simple to use web software, called WebSat, for microsatellite molecular marker prediction and development. WebSat is accessible through the Internet, requiring no program installation. Although a web solution, it makes use of Ajax techniques, providing a rich, responsive user interface. WebSat allows the submission of sequences, visualization of microsatellites and the design of primers suitable for their amplification. The program allows full control of parameters and the easy export of the resulting data, thus facilitating the development of microsatellite markers. Availability The web tool may be accessed at http://purl.oclc.org/NET/websat/ PMID:19255650
ESAP plus: a web-based server for EST-SSR marker development.
Ponyared, Piyarat; Ponsawat, Jiradej; Tongsima, Sissades; Seresangtakul, Pusadee; Akkasaeng, Chutipong; Tantisuwichwong, Nathpapat
2016-12-22
Simple sequence repeats (SSRs) have become widely used as molecular markers in plant genetic studies due to their abundance, high allelic variation at each locus and simplicity to analyze using conventional PCR amplification. To study plants with unknown genome sequence, SSR markers from Expressed Sequence Tags (ESTs), which can be obtained from the plant mRNA (converted to cDNA), must be utilized. With the advent of high-throughput sequencing technology, huge EST sequence data have been generated and are now accessible from many public databases. However, SSR marker identification from a large in-house or public EST collection requires a computational pipeline that makes use of several standard bioinformatic tools to design high quality EST-SSR primers. Some of these computational tools are not users friendly and must be tightly integrated with reference genomic databases. A web-based bioinformatic pipeline, called EST Analysis Pipeline Plus (ESAP Plus), was constructed for assisting researchers to develop SSR markers from a large EST collection. ESAP Plus incorporates several bioinformatic scripts and some useful standard software tools necessary for the four main procedures of EST-SSR marker development, namely 1) pre-processing, 2) clustering and assembly, 3) SSR mining and 4) SSR primer design. The proposed pipeline also provides two alternative steps for reducing EST redundancy and identifying SSR loci. Using public sugarcane ESTs, ESAP Plus automatically executed the aforementioned computational pipeline via a simple web user interface, which was implemented using standard PHP, HTML, CSS and Java scripts. With ESAP Plus, users can upload raw EST data and choose various filtering options and parameters to analyze each of the four main procedures through this web interface. All input EST data and their predicted SSR results will be stored in the ESAP Plus MySQL database. Users will be notified via e-mail when the automatic process is completed and they can download all the results through the web interface. ESAP Plus is a comprehensive and convenient web-based bioinformatic tool for SSR marker development. ESAP Plus offers all necessary EST-SSR development processes with various adjustable options that users can easily use to identify SSR markers from a large EST collection. With familiar web interface, users can upload the raw EST using the data submission page and visualize/download the corresponding EST-SSR information from within ESAP Plus. ESAP Plus can handle considerably large EST datasets. This EST-SSR discovery tool can be accessed directly from: http://gbp.kku.ac.th/esap_plus/ .
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
2010-01-01
Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
An innovative SNP genotyping method adapting to multiple platforms and throughputs.
Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L
2017-03-01
An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.
Matthew Parks; Aaron Liston; Rich Cronn
2011-01-01
Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Landers, Richard N; Brusso, Robert C; Cavanaugh, Katelyn J; Collmus, Andrew B
2016-12-01
The term big data encompasses a wide range of approaches of collecting and analyzing data in ways that were not possible before the era of modern personal computing. One approach to big data of great potential to psychologists is web scraping, which involves the automated collection of information from webpages. Although web scraping can create massive big datasets with tens of thousands of variables, it can also be used to create modestly sized, more manageable datasets with tens of variables but hundreds of thousands of cases, well within the skillset of most psychologists to analyze, in a matter of hours. In this article, we demystify web scraping methods as currently used to examine research questions of interest to psychologists. First, we introduce an approach called theory-driven web scraping in which the choice to use web-based big data must follow substantive theory. Second, we introduce data source theories , a term used to describe the assumptions a researcher must make about a prospective big data source in order to meaningfully scrape data from it. Critically, researchers must derive specific hypotheses to be tested based upon their data source theory, and if these hypotheses are not empirically supported, plans to use that data source should be changed or eliminated. Third, we provide a case study and sample code in Python demonstrating how web scraping can be conducted to collect big data along with links to a web tutorial designed for psychologists. Fourth, we describe a 4-step process to be followed in web scraping projects. Fifth and finally, we discuss legal, practical and ethical concerns faced when conducting web scraping projects. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi
2017-01-01
ABSTRACT The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer (http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively. PMID:28453368
Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Nakade, Shota; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi
2017-05-04
The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer ( http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html ), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively.
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.
Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing
2013-03-01
KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( http://www.sicau.edu.cn/web/yms/PCOSWeb/PCOS.html ).
40 CFR 63.825 - Standards: Product and packaging rotogravure and wide-web flexographic printing.
Code of Federal Regulations, 2014 CFR
2014-07-01
... inks, coatings, varnishes, adhesives, primers, solvents, reducers, thinners, and other materials... calculated equivalent allowable mass based on the organic HAP and solids contents of the inks, coatings... (b)(1) through (b)(10) of this section: (1) Demonstrate that each ink, coating, varnish, adhesive...
40 CFR 63.825 - Standards: Product and packaging rotogravure and wide-web flexographic printing.
Code of Federal Regulations, 2013 CFR
2013-07-01
... inks, coatings, varnishes, adhesives, primers, solvents, reducers, thinners, and other materials... calculated equivalent allowable mass based on the organic HAP and solids contents of the inks, coatings... (b)(1) through (b)(10) of this section: (1) Demonstrate that each ink, coating, varnish, adhesive...
40 CFR 63.825 - Standards: Product and packaging rotogravure and wide-web flexographic printing.
Code of Federal Regulations, 2012 CFR
2012-07-01
... inks, coatings, varnishes, adhesives, primers, solvents, reducers, thinners, and other materials... calculated equivalent allowable mass based on the organic HAP and solids contents of the inks, coatings... (b)(1) through (b)(10) of this section: (1) Demonstrate that each ink, coating, varnish, adhesive...
RefPrimeCouch—a reference gene primer CouchApp
Silbermann, Jascha; Wernicke, Catrin; Pospisil, Heike; Frohme, Marcus
2013-01-01
To support a quantitative real-time polymerase chain reaction standardization project, a new reference gene database application was required. The new database application was built with the explicit goal of simplifying not only the development process but also making the user interface more responsive and intuitive. To this end, CouchDB was used as the backend with a lightweight dynamic user interface implemented client-side as a one-page web application. Data entry and curation processes were streamlined using an OpenRefine-based workflow. The new RefPrimeCouch database application provides its data online under an Open Database License. Database URL: http://hpclife.th-wildau.de:5984/rpc/_design/rpc/view.html PMID:24368831
RefPrimeCouch--a reference gene primer CouchApp.
Silbermann, Jascha; Wernicke, Catrin; Pospisil, Heike; Frohme, Marcus
2013-01-01
To support a quantitative real-time polymerase chain reaction standardization project, a new reference gene database application was required. The new database application was built with the explicit goal of simplifying not only the development process but also making the user interface more responsive and intuitive. To this end, CouchDB was used as the backend with a lightweight dynamic user interface implemented client-side as a one-page web application. Data entry and curation processes were streamlined using an OpenRefine-based workflow. The new RefPrimeCouch database application provides its data online under an Open Database License. Database URL: http://hpclife.th-wildau.de:5984/rpc/_design/rpc/view.html.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.
David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart
2017-01-04
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
MAJIQ-SPEL: Web-tool to interrogate classical and complex splicing variations from RNA-Seq data.
Green, Christopher J; Gazzara, Matthew R; Barash, Yoseph
2017-09-11
Analysis of RNA sequencing (RNA-Seq) data have highlighted the fact that most genes undergo alternative splicing (AS) and that these patterns are tightly regulated. Many of these events are complex, resulting in numerous possible isoforms that quickly become difficult to visualize, interpret, and experimentally validate. To address these challenges we developed MAJIQ-SPEL, a web-tool that takes as input local splicing variations (LSVs) quantified from RNA-Seq data and provides users with visualization and quantification of gene isoforms associated with those. Importantly, MAJIQ-SPEL is able to handle both classical (binary) and complex, non-binary, splicing variations. Using a matching primer design algorithm it also suggests users possible primers for experimental validation by RT-PCR and displays those, along with the matching protein domains affected by the LSV, on UCSC Genome Browser for further downstream analysis. Program and code will be available at http://majiq.biociphers.org/majiq-spel. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki
2014-01-01
For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201
A Primer on the Effective Use of Threaded Discussion Forums.
ERIC Educational Resources Information Center
Kirk, James J.; Orr, Robert L.
Threaded discussion forums are asynchronous, World Wide Web-based discussions occurring under a number of different topics called threads. By allowing students to post, read, and respond to messages independently of time or place, threaded discussion forums give students an opportunity for deeper reflection and more thoughtful replies than chat…
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Reading Assessment: A Primer for Teachers and Tutors.
ERIC Educational Resources Information Center
Caldwell, JoAnne Schudt
This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…
Murrinh Nganki (Our Language), 1.
ERIC Educational Resources Information Center
Street, Chester; And Others
This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
2014-01-01
Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
A Guide to Using STITCHER for Overlapping Assembly PCR Applications.
O'Halloran, Damien M
2017-01-01
Overlapping PCR is commonly used in many molecular applications that include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping assembly PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online.
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
ERIC Educational Resources Information Center
Levine, Elliott
2001-01-01
Sound technology policies can spell the difference between an effective website and an online nightmare. An effective web development policy addresses six key areas: roles and responsibilities, content/educational value, privacy and safety, adherence to copyright laws, technical standards, and use of commercial sites and services. (MLH)
CMD: a Cotton Microsatellite Database resource for Gossypium genomics
Blenda, Anna; Scheffler, Jodi; Scheffler, Brian; Palmer, Michael; Lacape, Jean-Marc; Yu, John Z; Jesudurai, Christopher; Jung, Sook; Muthukumar, Sriram; Yellambalase, Preetham; Ficklin, Stephen; Staton, Margaret; Eshelman, Robert; Ulloa, Mauricio; Saha, Sukumar; Burr, Ben; Liu, Shaolin; Zhang, Tianzhen; Fang, Deqiu; Pepper, Alan; Kumpatla, Siva; Jacobs, John; Tomkins, Jeff; Cantrell, Roy; Main, Dorrie
2006-01-01
Background The Cotton Microsatellite Database (CMD) is a curated and integrated web-based relational database providing centralized access to publicly available cotton microsatellites, an invaluable resource for basic and applied research in cotton breeding. Description At present CMD contains publication, sequence, primer, mapping and homology data for nine major cotton microsatellite projects, collectively representing 5,484 microsatellites. In addition, CMD displays data for three of the microsatellite projects that have been screened against a panel of core germplasm. The standardized panel consists of 12 diverse genotypes including genetic standards, mapping parents, BAC donors, subgenome representatives, unique breeding lines, exotic introgression sources, and contemporary Upland cottons with significant acreage. A suite of online microsatellite data mining tools are accessible at CMD. These include an SSR server which identifies microsatellites, primers, open reading frames, and GC-content of uploaded sequences; BLAST and FASTA servers providing sequence similarity searches against the existing cotton SSR sequences and primers, a CAP3 server to assemble EST sequences into longer transcripts prior to mining for SSRs, and CMap, a viewer for comparing cotton SSR maps. Conclusion The collection of publicly available cotton SSR markers in a centralized, readily accessible and curated web-enabled database provides a more efficient utilization of microsatellite resources and will help accelerate basic and applied research in molecular breeding and genetic mapping in Gossypium spp. PMID:16737546
Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde
2014-11-01
To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
1979-10-01
BRIEFIN-G OF CINCUSAREUR ON STATUS OF SUBJ. 2 NCV 77. 1. r£F A EXPLAINED BASIC CONCEPT PLAN FOR SUBJ INITIATIVE...TM 43-0001-2 8) Diameter Color Propellant: Composition — Grain Type --- Weight Web — - Primer M82 - TB 9-2300-303-10 PaUet: 165 -mm (6...perforated cylinder Weight 12. 9 kg (28. 51bs.) Web - — .109-mm (0.043 in.) Primer M82 Used with Cannon (Weapon) M2A2 (M2A1E1
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Lee, Chang Soo; Lee, Jiyoung
2010-09-01
A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.
Net Lessons: Education World's Internet Primer.
ERIC Educational Resources Information Center
1997
This booklet presents educators with practical ways to put the Internet to work in the classroom. An introduction provides resources for getting connected to and exploring the Internet. The next section on using the Web in the classroom discusses a student-created Web survey; cooperative challenge; social action; community connection; simulation;…
Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A
2008-05-01
Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this group. Phylogenetic analysis of amplicons from virus assemblages from Norwegian coastal waters as well as from isolated algal viruses revealed a cluster of viruses infecting members of the prymnesiophyte and prasinophyte alga divisions. Other distinct clusters were also identified, containing amplicons from this study as well as sequences retrieved from the Sargasso Sea metagenome. This shows that closely related sequences of this family are present at geographically distant locations within the marine environment.
Gene Polymorphism Studies in a Teaching Laboratory
NASA Astrophysics Data System (ADS)
Shultz, Jeffry
2009-02-01
I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.
Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis
2003-01-01
A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
An electronic laboratory notebook based on HTML forms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marstaller, J.E.; Zorn, M.D.
The electronic notebook records information that has traditionally been kept in handwritten laboratory notebooks. It keeps detailed information about the progress of the research , such as the optimization of primers, the screening of the primers and, finally, the mapping of the probes. The notebook provides two areas of services: Data entry, and reviewing of data in all stages. The World wide Web browsers, with HTML based forms provide a fast and easy mechanism to create forms-based user interfaces. The computer scientist can sit down with the biologist and rapidly make changes in response to the user`s comments. Furthermore themore » HTML forms work equally well on a number of different hardware platforms; thus the biologists may continue using their Macintosh computers and find a familiar interface if they have to work on a Unix workstation. The web browser can be run from any machine connected to the Internet: thus the users are free to enter or view information even away from their labs at home or while on travel. Access can be restricted by password and other means to secure the confidentiality of the data. A bonus that is hard to implement otherwise is the facile connection to outside resources. Linking local information to data in public databases is only a hypertext link away with little or no additional programming efforts.« less
Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel
2014-06-03
Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.
Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR
Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo
2005-01-01
A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
GeneFisher-P: variations of GeneFisher as processes in Bio-jETI
Lamprecht, Anna-Lena; Margaria, Tiziana; Steffen, Bernhard; Sczyrba, Alexander; Hartmeier, Sven; Giegerich, Robert
2008-01-01
Background PCR primer design is an everyday, but not trivial task requiring state-of-the-art software. We describe the popular tool GeneFisher and explain its recent restructuring using workflow techniques. We apply a service-oriented approach to model and implement GeneFisher-P, a process-based version of the GeneFisher web application, as a part of the Bio-jETI platform for service modeling and execution. We show how to introduce a flexible process layer to meet the growing demand for improved user-friendliness and flexibility. Results Within Bio-jETI, we model the process using the jABC framework, a mature model-driven, service-oriented process definition platform. We encapsulate remote legacy tools and integrate web services using jETI, an extension of the jABC for seamless integration of remote resources as basic services, ready to be used in the process. Some of the basic services used by GeneFisher are in fact already provided as individual web services at BiBiServ and can be directly accessed. Others are legacy programs, and are made available to Bio-jETI via the jETI technology. The full power of service-based process orientation is required when more bioinformatics tools, available as web services or via jETI, lead to easy extensions or variations of the basic process. This concerns for instance variations of data retrieval or alignment tools as provided by the European Bioinformatics Institute (EBI). Conclusions The resulting service- and process-oriented GeneFisher-P demonstrates how basic services from heterogeneous sources can be easily orchestrated in the Bio-jETI platform and lead to a flexible family of specialized processes tailored to specific tasks. PMID:18460174
Search Engines: A Primer on Finding Information on the World Wide Web.
ERIC Educational Resources Information Center
Maddux, Cleborne
1996-01-01
Presents an annotated list of several World Wide Web search engines, including Yahoo, Infoseek, Alta Vista, Magellan, Lycos, Webcrawler, Excite, Deja News, and the LISZT Directory of discussion groups. Uniform Resource Locators (URLs) are included. Discussion assesses performance and describes rules and syntax for refining or limiting a search.…
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Bhawna; Chaduvula, Pavan K; Bonthala, Venkata S; Manjusha, Verma; Siddiq, Ebrahimali A; Polumetla, Ananda K; Prasad, Gajula M N V
2015-01-01
Cucumis melo L. that belongs to Cucurbitaceae family ranks among one of the highest valued horticulture crops being cultivated across the globe. Besides its economical and medicinal importance, Cucumis melo L. is a valuable resource and model system for the evolutionary studies of cucurbit family. However, very limited numbers of molecular markers were reported for Cucumis melo L. so far that limits the pace of functional genomic research in melon and other similar horticulture crops. We developed the first whole genome based microsatellite DNA marker database of Cucumis melo L. and comprehensive web resource that aids in variety identification and physical mapping of Cucurbitaceae family. The Cucumis melo L. microsatellite database (CmMDb: http://65.181.125.102/cmmdb2/index.html) encompasses 39,072 SSR markers along with its motif repeat, motif length, motif sequence, marker ID, motif type and chromosomal locations. The database is featured with novel automated primer designing facility to meet the needs of wet lab researchers. CmMDb is a freely available web resource that facilitates the researchers to select the most appropriate markers for marker-assisted selection in melons and to improve breeding strategies.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
ERIC Educational Resources Information Center
Moallem, Mahnaz
2001-01-01
Provides an overview of the process of designing and developing a Web-based course using instructional design principles and models, including constructivist and objectivist theories. Explains the process of implementing an instructional design model in designing a Web-based undergraduate course and evaluates the model based on course evaluations.…
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander
2012-01-01
The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-09-29
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
AMPLISAS: a web server for multilocus genotyping using next-generation amplicon sequencing data.
Sebastian, Alvaro; Herdegen, Magdalena; Migalska, Magdalena; Radwan, Jacek
2016-03-01
Next-generation sequencing (NGS) technologies are revolutionizing the fields of biology and medicine as powerful tools for amplicon sequencing (AS). Using combinations of primers and barcodes, it is possible to sequence targeted genomic regions with deep coverage for hundreds, even thousands, of individuals in a single experiment. This is extremely valuable for the genotyping of gene families in which locus-specific primers are often difficult to design, such as the major histocompatibility complex (MHC). The utility of AS is, however, limited by the high intrinsic sequencing error rates of NGS technologies and other sources of error such as polymerase amplification or chimera formation. Correcting these errors requires extensive bioinformatic post-processing of NGS data. Amplicon Sequence Assignment (AMPLISAS) is a tool that performs analysis of AS results in a simple and efficient way, while offering customization options for advanced users. AMPLISAS is designed as a three-step pipeline consisting of (i) read demultiplexing, (ii) unique sequence clustering and (iii) erroneous sequence filtering. Allele sequences and frequencies are retrieved in excel spreadsheet format, making them easy to interpret. AMPLISAS performance has been successfully benchmarked against previously published genotyped MHC data sets obtained with various NGS technologies. © 2015 John Wiley & Sons Ltd.
2013-01-01
Background Though India has sequenced water buffalo genome but its draft assembly is based on cattle genome BTau 4.0, thus de novo chromosome wise assembly is a major pending issue for global community. The existing radiation hybrid of buffalo and these reported STR can be used further in final gap plugging and “finishing” expected in de novo genome assembly. QTL and gene mapping needs mining of putative STR from buffalo genome at equal interval on each and every chromosome. Such markers have potential role in improvement of desirable characteristics, such as high milk yields, resistance to diseases, high growth rate. The STR mining from whole genome and development of user friendly database is yet to be done to reap the benefit of whole genome sequence. Description By in silico microsatellite mining of whole genome, we have developed first STR database of water buffalo, BuffSatDb (Buffalo MicroSatellite Database (http://cabindb.iasri.res.in/buffsatdb/) which is a web based relational database of 910529 microsatellite markers, developed using PHP and MySQL database. Microsatellite markers have been generated using MIcroSAtellite tool. It is simple and systematic web based search for customised retrieval of chromosome wise and genome-wide microsatellites. Search has been enabled based on chromosomes, motif type (mono-hexa), repeat motif and repeat kind (simple and composite). The search may be customised by limiting location of STR on chromosome as well as number of markers in that range. This is a novel approach and not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of the selected markers enabling researcher to select markers of choice at desired interval over the chromosome. The unique add-on of degenerate bases further helps in resolving presence of degenerate bases in current buffalo assembly. Conclusion Being first buffalo STR database in the world , this would not only pave the way in resolving current assembly problem but shall be of immense use for global community in QTL/gene mapping critically required to increase knowledge in the endeavour to increase buffalo productivity, especially for third world country where rural economy is significantly dependent on buffalo productivity. PMID:23336431
Sarika; Arora, Vasu; Iquebal, Mir Asif; Rai, Anil; Kumar, Dinesh
2013-01-19
Though India has sequenced water buffalo genome but its draft assembly is based on cattle genome BTau 4.0, thus de novo chromosome wise assembly is a major pending issue for global community. The existing radiation hybrid of buffalo and these reported STR can be used further in final gap plugging and "finishing" expected in de novo genome assembly. QTL and gene mapping needs mining of putative STR from buffalo genome at equal interval on each and every chromosome. Such markers have potential role in improvement of desirable characteristics, such as high milk yields, resistance to diseases, high growth rate. The STR mining from whole genome and development of user friendly database is yet to be done to reap the benefit of whole genome sequence. By in silico microsatellite mining of whole genome, we have developed first STR database of water buffalo, BuffSatDb (Buffalo MicroSatellite Database (http://cabindb.iasri.res.in/buffsatdb/) which is a web based relational database of 910529 microsatellite markers, developed using PHP and MySQL database. Microsatellite markers have been generated using MIcroSAtellite tool. It is simple and systematic web based search for customised retrieval of chromosome wise and genome-wide microsatellites. Search has been enabled based on chromosomes, motif type (mono-hexa), repeat motif and repeat kind (simple and composite). The search may be customised by limiting location of STR on chromosome as well as number of markers in that range. This is a novel approach and not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of the selected markers enabling researcher to select markers of choice at desired interval over the chromosome. The unique add-on of degenerate bases further helps in resolving presence of degenerate bases in current buffalo assembly. Being first buffalo STR database in the world , this would not only pave the way in resolving current assembly problem but shall be of immense use for global community in QTL/gene mapping critically required to increase knowledge in the endeavour to increase buffalo productivity, especially for third world country where rural economy is significantly dependent on buffalo productivity.
The Value of Web Log Data in Use-based Design and Testing.
ERIC Educational Resources Information Center
Burton, Mary C.; Walther, Joseph B.
2001-01-01
Suggests Web-based logs contain useful empirical data with which World Wide Web designers and design theorists can assess usability and effectiveness of design choices. Enumerates identification of types of Web server logs, client logs, types and uses of log data, and issues associated with the validity of these data. Presents an approach to…
Designing Effective Online Instruction: A Handbook for Web-Based Courses
ERIC Educational Resources Information Center
Koontz, Franklin R.; Li, Hongqin; Compora, Daniel P.
2006-01-01
The designing of online courses requires a radical change in the way the instruction is designed and presented to the student. To date, however, there are no research-based models, using a systems approach, that are available to design Web-based instruction. This book introduces the ASSIST-ME Model, an instructional design model for Web-based…
Molecular diagnosis of group B coltiviruses infections.
Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X
1999-08-01
The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.
Gell, I; Cubero, J; Melgarejo, P
2007-12-01
To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.
An Automated Data Fusion Process for an Air Defense Scenario
2011-06-01
and Applications, Proceedings of the IEEE, 77(4)541-580, April of 1989. [4] – Antoniou, G. e Harmelen, F.V. A Semantic Web Primer-Second Edition. The...Instituto Tecnológico de Aeronáutica, São Jose dos Campos, SP, Brazil, 2004. [10] – “What is a Web Service?”, at January, 20, 2011, from http://www.w3...org/TR/ws- arch/#introduction [11] – Yasmine Charif, “An Overview of Semantic Web Services Composition Approaches”, Eletronic Notes in Theorical
Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie
2014-01-01
Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.
S-genotype identification based on allele-specific PCR in Japanese pear
Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya
2015-01-01
Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R
2013-01-01
Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.
Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo
2015-01-01
The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023
Designing Web-Based Educative Curriculum Materials for the Social Studies
ERIC Educational Resources Information Center
Callahan, Cory; Saye, John; Brush, Thomas
2013-01-01
This paper reports on a design experiment of web-based curriculum materials explicitly created to help social studies teachers develop their professional teaching knowledge. Web-based social studies curriculum reform efforts, human-centered interface design, and investigations into educative curriculum materials are reviewed, as well as…
Metacognitive Skills Development: A Web-Based Approach in Higher Education
ERIC Educational Resources Information Center
Shen, Chun-Yi; Liu, Hsiu-Chuan
2011-01-01
Although there were studies that presented the applications of metacognitive skill training, the research on web-based metacognitive skills training are few. The purpose of this study is to design a web-based learning environment and further examine the effect of the web-based training. A pretest-posttest quasi-experimental design was used in this…
NASA Astrophysics Data System (ADS)
Tanumihardja, J.; Bela, B.
2017-08-01
Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.
Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio
2008-10-15
Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.
Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.
Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin
2015-05-15
The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. Copyright © 2014 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
van der Kolk, Koos; Beldman, Gerrit; Hartog, Rob; Gruppen, Harry
2012-01-01
The design, usage, and evaluation of a Web-based laboratory manual (WebLM) are described. The main aim of the WebLM is to support students while working in the laboratory by providing them with just-in-time information. Design guidelines for this electronic manual were derived from literature on cognitive load and user interface design. The WebLM…
A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.
van der Linde, Sietse; Alexander, Ian; Anderson, Ian C
2008-09-01
To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.
Issues to Consider in Designing WebQuests: A Literature Review
ERIC Educational Resources Information Center
Kurt, Serhat
2012-01-01
A WebQuest is an inquiry-based online learning technique. This technique has been widely adopted in K-16 education. Therefore, it is important that conditions of effective WebQuest design are defined. Through this article the author presents techniques for improving WebQuest design based on current research. More specifically, the author analyzes…
The Interface Design and the Usability Testing of a Fossilization Web-Based Learning Environment
ERIC Educational Resources Information Center
Wang, Shiang-Kwei; Yang, Chiachi
2005-01-01
This article describes practical issues related to the design and the development of a Web-Based Learning Environment (Web-LE) for high school students. The purpose of the Fossilization Web-LE was to help students understand the process of fossilization, which is a complex phenomenon and is affected by many factors. The instructional design team…
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome
Sarika; Arora, Vasu; Iquebal, M. A.; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on ‘three-tier architecture’ that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers’ search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
ERIC Educational Resources Information Center
Pomales-García, Cristina; Rivera-Nivar, Mericia
2015-01-01
Research in design of Web-based modules should incorporate aging as an important factor given the diversity of the current workforce. This work aims to understand how Web-Based Learning modules can be designed to accommodate young (25-35 years) as well as older (55-65 years) users by: (1) identifying how information sources (instructor video,…
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Utilization of two web-based continuing education courses evaluated by Markov chain model
Lin, Jin-Mann S; Reeves, William C
2011-01-01
Objectives To evaluate the web structure of two web-based continuing education courses, identify problems and assess the effects of web site modifications. Design Markov chain models were built from 2008 web usage data to evaluate the courses' web structure and navigation patterns. The web site was then modified to resolve identified design issues and the improvement in user activity over the subsequent 12 months was quantitatively evaluated. Measurements Web navigation paths were collected between 2008 and 2010. The probability of navigating from one web page to another was analyzed. Results The continuing education courses' sequential structure design was clearly reflected in the resulting actual web usage models, and none of the skip transitions provided was heavily used. The web navigation patterns of the two different continuing education courses were similar. Two possible design flaws were identified and fixed in only one of the two courses. Over the following 12 months, the drop-out rate in the modified course significantly decreased from 41% to 35%, but remained unchanged in the unmodified course. The web improvement effects were further verified via a second-order Markov chain model. Conclusions The results imply that differences in web content have less impact than web structure design on how learners navigate through continuing education courses. Evaluation of user navigation can help identify web design flaws and guide modifications. This study showed that Markov chain models provide a valuable tool to evaluate web-based education courses. Both the results and techniques in this study would be very useful for public health education and research specialists. PMID:21976027
Inquiry-Based Learning and Technology: Designing and Exploring WebQuests
ERIC Educational Resources Information Center
Lacina, Jan
2007-01-01
A WebQuest is an inquiry-based technology activity designed by Bernie Dodge and Tom March at San Diego State University in 1995. Dodge and March describe WebQuests as activities in which most, or all, of the information used by learners is drawn from the Web. WebQuests are a powerful instructional activity for teachers and students. Students will…
Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad
2017-09-15
At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.
Zhou, Jindan; Rudd, Kenneth E.
2013-01-01
EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection. PMID:23197660
Zhou, Jindan; Rudd, Kenneth E
2013-01-01
EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection.
RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.
Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin
2008-06-15
A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.
A Web Based Collaborative Design Environment for Spacecraft
NASA Technical Reports Server (NTRS)
Dunphy, Julia
1998-01-01
In this era of shrinking federal budgets in the USA we need to dramatically improve our efficiency in the spacecraft engineering design process. We have come up with a method which captures much of the experts' expertise in a dataflow design graph: Seamlessly connectable set of local and remote design tools; Seamlessly connectable web based design tools; and Web browser interface to the developing spacecraft design. We have recently completed our first web browser interface and demonstrated its utility in the design of an aeroshell using design tools located at web sites at three NASA facilities. Multiple design engineers and managers are now able to interrogate the design engine simultaneously and find out what the design looks like at any point in the design cycle, what its parameters are, and how it reacts to adverse space environments.
Choi, Hong-Kyu; Kim, Dongjin; Uhm, Taesik; Limpens, Eric; Lim, Hyunju; Mun, Jeong-Hwan; Kalo, Peter; Penmetsa, R Varma; Seres, Andrea; Kulikova, Olga; Roe, Bruce A; Bisseling, Ton; Kiss, Gyorgy B; Cook, Douglas R
2004-01-01
A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an F(2) population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene analogs, covering 513 cM. In the case of EST-based markers we used an intron-targeted marker strategy with primers designed to anneal in conserved exon regions and to amplify across intron regions. Polymorphisms were significantly more frequent in intron vs. exon regions, thus providing an efficient mechanism to map transcribed genes. Genetic and cytogenetic analysis produced eight well-resolved linkage groups, which have been previously correlated with eight chromosomes by means of FISH with mapped BAC clones. We anticipated that mapping of conserved coding regions would have utility for comparative mapping among legumes; thus 60 of the EST-based primer pairs were designed to amplify orthologous sequences across a range of legume species. As an initial test of this strategy, we used primers designed against M. truncatula exon sequences to rapidly map genes in M. sativa. The resulting comparative map, which includes 68 bridging markers, indicates that the two Medicago genomes are highly similar and establishes the basis for a Medicago composite map. PMID:15082563
Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.
Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong
2018-02-01
The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.
Redesigning Instruction through Web-based Course Authoring Tools.
ERIC Educational Resources Information Center
Dabbagh, Nada H.; Schmitt, Jeff
1998-01-01
Examines the pedagogical implications of redesigning instruction for Web-based delivery through a case study of an undergraduate computer science course. Initially designed for a traditional learning environment, this course transformed to a Web-based course using WebCT, a Web-based course authoring tool. Discusses the specific features of WebCT.…
Doh, Eui Jeong; Paek, Seung-Ho; Lee, Guemsan; Lee, Mi-Young; Oh, Seung-Eun
2016-01-01
Several Artemisia species are used as herbal medicines including the dried aerial parts of Artemisia capillaris, which are used as Artemisiae Capillaris Herba (known as “Injinho” in Korean medicinal terminology and “Yin Chen Hao” in Chinese). In this study, we developed tools for distinguishing between A. capillaris and 11 other Artemisia species that grow and/or are cultured in China, Japan, and Korea. Based on partial nucleotide sequences in the internal transcribed spacer (ITS) that differ between the species, we designed primers to amplify a DNA marker for A. capillaris. In addition, to detect other Artemisia species that are contaminants of A. capillaris, we designed primers to amplify DNA markers of A. japonica, A. annua, A. apiacea, and A. anomala. Moreover, based on random amplified polymorphic DNA analysis, we confirmed that primers developed in a previous study could be used to identify Artemisia species that are sources of Artemisiae Argyi Folium and Artemisiae Iwayomogii Herba. By using these primers, we found that multiplex polymerase chain reaction (PCR) was a reliable tool to distinguish between A. capillaris and other Artemisia species and to identify other Artemisia species as contaminants of A. capillaris in a single PCR. PMID:27313651
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Designing for transportation management and operations : a primer.
DOT National Transportation Integrated Search
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
The Design and Development of an Online, Case-Based Course in a Teacher Preparation Program
ERIC Educational Resources Information Center
Peña, Carmen M.
2004-01-01
The goals of this study were to: 1) design a web-based course using WebCT for future secondary school teachers at the University of Texas Pan American, 2) evaluate the effectiveness of the course, and 3) provide a set of guidelines for designing web-based courses for other teacher educators. The participants in this study consisted of junior- and…
Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo
2007-10-01
Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.
Web Based Personal Nutrition Management Tool
NASA Astrophysics Data System (ADS)
Bozkurt, Selen; Zayim, Neşe; Gülkesen, Kemal Hakan; Samur, Mehmet Kemal
Internet is being used increasingly as a resource for accessing health-related information because of its several advantages. Therefore, Internet tailoring becomes quite preferable in health education and personal health management recently. Today, there are many web based health programs de-signed for individuals. Among these studies nutrition and weight management is popular because, obesity has become a heavy burden for populations worldwide. In this study, we designed a web based personal nutrition education and management tool, The Nutrition Web Portal, in order to enhance patients’ nutrition knowledge, and provide behavioral change against obesity. The present paper reports analysis, design and development processes of The Nutrition Web Portal.
Stockburger, D W
1999-05-01
Active server pages permit a software developer to customize the Web experience for users by inserting server-side script and database access into Web pages. This paper describes applications of these techniques and provides a primer on the use of these methods. Applications include a system that generates and grades individualized homework assignments and tests for statistics students. The student accesses the system as a Web page, prints out the assignment, does the assignment, and enters the answers on the Web page. The server, running on NT Server 4.0, grades the assignment, updates the grade book (on a database), and returns the answer key to the student.
Utilization of two web-based continuing education courses evaluated by Markov chain model.
Tian, Hao; Lin, Jin-Mann S; Reeves, William C
2012-01-01
To evaluate the web structure of two web-based continuing education courses, identify problems and assess the effects of web site modifications. Markov chain models were built from 2008 web usage data to evaluate the courses' web structure and navigation patterns. The web site was then modified to resolve identified design issues and the improvement in user activity over the subsequent 12 months was quantitatively evaluated. Web navigation paths were collected between 2008 and 2010. The probability of navigating from one web page to another was analyzed. The continuing education courses' sequential structure design was clearly reflected in the resulting actual web usage models, and none of the skip transitions provided was heavily used. The web navigation patterns of the two different continuing education courses were similar. Two possible design flaws were identified and fixed in only one of the two courses. Over the following 12 months, the drop-out rate in the modified course significantly decreased from 41% to 35%, but remained unchanged in the unmodified course. The web improvement effects were further verified via a second-order Markov chain model. The results imply that differences in web content have less impact than web structure design on how learners navigate through continuing education courses. Evaluation of user navigation can help identify web design flaws and guide modifications. This study showed that Markov chain models provide a valuable tool to evaluate web-based education courses. Both the results and techniques in this study would be very useful for public health education and research specialists.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.
2012-01-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-01-01
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711
Designing, Implementing, and Evaluating Secure Web Browsers
ERIC Educational Resources Information Center
Grier, Christopher L.
2009-01-01
Web browsers are plagued with vulnerabilities, providing hackers with easy access to computer systems using browser-based attacks. Efforts that retrofit existing browsers have had limited success since modern browsers are not designed to withstand attack. To enable more secure web browsing, we design and implement new web browsers from the ground…
Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun
2017-12-15
This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.
Evaluation of a computer-based approach to teaching acid/base physiology.
Rawson, Richard E; Quinlan, Kathleen M
2002-12-01
Because acid/base physiology is a difficult subject for most medical and veterinary students, the first author designed a software program, Acid/Base Primer, that would help students with this topic. The Acid/Base Primer was designed and evaluated within a conceptual framework of basic educational principles. Seventy-five first-year veterinary students (of 81; 93% response rate) participated in this study. Students took both a pre- and posttest of content understanding. After completing the Acid/Base Primer in pairs, each student filled out a survey evaluating the features of the program and describing his/her use and experience of it. Four pairs of students participated in interviews that elaborated on the surveys. Scores improved from 53 +/- 2% on the pretest to 74 +/- 1% on an immediate posttest. On surveys and in interviews, students reported that the program helped them construct their own understanding of acid/base physiology and prompted discussions in pairs of students when individual understandings differed. The case-based format provided anchors and a high degree of relevance. Repetition of concepts helped students develop a more complex network of understanding. Questions in the program served to scaffold the learning process by providing direction, accentuating the relevant features of the cases, and provoking discussion. Guidelines for software development were generated on the basis of the findings and relevant educational literature.
Development of a molecular approach to describe the composition of Trichoderma communities.
Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele
2010-01-01
Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-01-01
Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
A Randomized Crossover Study of Web-Based Media Literacy to Prevent Smoking
ERIC Educational Resources Information Center
Shensa, Ariel; Phelps-Tschang, Jane; Miller, Elizabeth; Primack, Brian A.
2016-01-01
Feasibly implemented Web-based smoking media literacy (SML) programs have been associated with improving SML skills among adolescents. However, prior evaluations have generally had weak experimental designs. We aimed to examine program efficacy using a more rigorous crossover design. Seventy-two ninth grade students completed a Web-based SML…
ERIC Educational Resources Information Center
Lee, Hye-Jung; Rha, Ilju
2009-01-01
This study examines the influence of instructional design and management style on student achievement and satisfaction in a web-based distance learning environment. From the literature review, two major instructional design and management styles in web-based distance education were conceptualized as structure and interpersonal interaction. To…
Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA
Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus
2018-01-01
One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017
Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo
2009-04-01
For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements
Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.
2010-01-01
Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
2013-01-01
Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286
NASA Technical Reports Server (NTRS)
Bill, R. C.; Sovey, J.; Allen, G. P.
1981-01-01
The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.
ERIC Educational Resources Information Center
Dabbagh, Nada; Denisar, Katrina
2005-01-01
For this study, we examined the cogency, comprehensiveness, and viability of team-based problem solutions of a Web-based hypermedia case designed to promote student understanding of the practice of instructional design. Participants were 14 students enrolled in a graduate course on advanced instructional design. The case was presented to students…
ERIC Educational Resources Information Center
McDaniel, Rudy; Fanfarelli, Joseph R.
2015-01-01
This dataset contains participant data related to the use of badging (achievement) feedback in pedagogical design. Two sections each of web-based graphic design and web design undergraduate courses were offered at the University of Central Florida. A badging system for achievements was included in one section of each. Performance, engagement and…
An Object-Oriented Architecture for a Web-Based CAI System.
ERIC Educational Resources Information Center
Nakabayashi, Kiyoshi; Hoshide, Takahide; Seshimo, Hitoshi; Fukuhara, Yoshimi
This paper describes the design and implementation of an object-oriented World Wide Web-based CAI (Computer-Assisted Instruction) system. The goal of the design is to provide a flexible CAI/ITS (Intelligent Tutoring System) framework with full extendibility and reusability, as well as to exploit Web-based software technologies such as JAVA, ASP (a…
Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko
2002-12-01
The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.
Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw
2011-05-01
A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642
ICCE/ICCAI 2000 Full & Short Papers (Web-Based Learning).
ERIC Educational Resources Information Center
2000
This document contains full and short papers on World Wide Web-based learning from ICCE/ICCAI 2000 (International Conference on Computers in Education/International Conference on Computer-Assisted Instruction). Topics covered include: design and development of CAL (Computer Assisted Learning) systems; design and development of WBI (Web-Based…
Vervoort, Mariëtte T. W.; Vonk, J. Arie; Mooijman, Paul J. W.; Van den Elsen, Sven J. J.; Van Megen, Hanny H. B.; Veenhuizen, Peter; Landeweert, Renske; Bakker, Jaap; Mulder, Christian; Helder, Johannes
2012-01-01
Soils are among the most complex, diverse and competitive habitats on Earth and soil biota are responsible for ecosystem services such as nutrient cycling, carbon sequestration and remediation of freshwater. The extreme biodiversity prohibits the making of a full inventory of soil life. Hence, an appropriate indicator group should be selected to determine the biological condition of soil systems. Due to their ubiquity and the diverse responses to abiotic and biotic changes, nematodes are suitable indicators for environmental monitoring. However, the time-consuming microscopic analysis of nematode communities has limited the scale at which this indicator group is used. In an attempt to circumvent this problem, a quantitative PCR-based tool for the detection of a consistent part of the soil nematofauna was developed based on a phylum-wide molecular framework consisting of 2,400 full-length SSU rDNA sequences. Taxon-specific primers were designed and tested for specificity. Furthermore, relationships were determined between the quantitative PCR output and numbers of target nematodes. As a first field test for this DNA sequence signature-based approach, seasonal fluctuations of nematode assemblages under open canopy (one field) and closed canopy (one forest) were monitored. Fifteen taxa from four feeding guilds (covering ∼ 65% of the free-living nematode biodiversity at higher taxonomical level) were detected at two trophic levels. These four feeding guilds are composed of taxa that developed independently by parallel evolution and we detected ecologically interpretable patterns for free-living nematodes belonging to the lower trophic level of soil food webs. Our results show temporal fluctuations, which can be even opposite within taxa belonging to the same guild. This research on nematode assemblages revealed ecological information about the soil food web that had been partly overlooked. PMID:23112818
Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi
2005-01-01
Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428
Web Design Curriculum and Syllabus Based on Web Design Practice and Students' Prior Knowledge
ERIC Educational Resources Information Center
Krunic, Tanja; Ruzic-Dimitrijevic, Ljiljana; Petrovic, Branka; Farkas, Robert
2006-01-01
The Advanced Technical School from Novi Sad set up a completely new study group for web design in 2004. The main goals of the paper are to explain the steps that were taken in starting this group, and to present the educational program based on our own research through the organization of the group and course descriptions. Since there is a…
Methodological Issues in Research on Web-Based Behavioral Interventions
Danaher, Brian G; Seeley, John R
2013-01-01
Background Web-based behavioral intervention research is rapidly growing. Purpose We review methodological issues shared across Web-based intervention research to help inform future research in this area. Methods We examine measures and their interpretation using exemplar studies and our research. Results We report on research designs used to evaluate Web-based interventions and recommend newer, blended designs. We review and critique methodological issues associated with recruitment, engagement, and social validity. Conclusions We suggest that there is value to viewing this burgeoning realm of research from the broader context of behavior change research. We conclude that many studies use blended research designs, that innovative mantling designs such as the Multiphase Optimization Strategy and Sequential Multiple Assignment Randomized Trial methods hold considerable promise and should be used more widely, and that Web-based controls should be used instead of usual care or no-treatment controls in public health research. We recommend topics for future research that address participant recruitment, engagement, and social validity. PMID:19806416
NASA Astrophysics Data System (ADS)
Brambilla, Marco; Ceri, Stefano; Valle, Emanuele Della; Facca, Federico M.; Tziviskou, Christina
Although Semantic Web Services are expected to produce a revolution in the development of Web-based systems, very few enterprise-wide design experiences are available; one of the main reasons is the lack of sound Software Engineering methods and tools for the deployment of Semantic Web applications. In this chapter, we present an approach to software development for the Semantic Web based on classical Software Engineering methods (i.e., formal business process development, computer-aided and component-based software design, and automatic code generation) and on semantic methods and tools (i.e., ontology engineering, semantic service annotation and discovery).
ERIC Educational Resources Information Center
Hung, Yen-Chu
2012-01-01
The instructional value of web-based education systems has been an important area of research in information systems education. This study investigates the effect of various teaching methods on program design learning for students with specific learning styles in web-based education systems. The study takes first-year Computer Science and…
Web-Based Online Public Access Catalogues of IIT Libraries in India: An Evaluative Study
ERIC Educational Resources Information Center
Madhusudhan, Margam; Aggarwal, Shalini
2011-01-01
Purpose: The purpose of the paper is to examine the various features and components of web-based online public access catalogues (OPACs) of IIT libraries in India with the help of a specially designed evaluation checklist. Design/methodology/approach: The various features of the web-based OPACs in six IIT libraries (IIT Delhi, IIT Bombay, IIT…
Enable Web-Based Tracking and Guiding by Integrating Location-Awareness with the World Wide Web
ERIC Educational Resources Information Center
Zhou, Rui
2008-01-01
Purpose: The aim of this research is to enable web-based tracking and guiding by integrating location-awareness with the Worldwide Web so that the users can use various location-based applications without installing extra software. Design/methodology/approach: The concept of web-based tracking and guiding is introduced and the relevant issues are…
Concept Mapping Your Web Searches: A Design Rationale and Web-Enabled Application
ERIC Educational Resources Information Center
Lee, Y.-J.
2004-01-01
Although it has become very common to use World Wide Web-based information in many educational settings, there has been little research on how to better search and organize Web-based information. This paper discusses the shortcomings of Web search engines and Web browsers as learning environments and describes an alternative Web search environment…
Ramirez-Gonzalez, Ricardo; Caccamo, Mario; MacLean, Daniel
2011-10-01
Scientists now use high-throughput sequencing technologies and short-read assembly methods to create draft genome assemblies in just days. Tools and pipelines like the assembler, and the workflow management environments make it easy for a non-specialist to implement complicated pipelines to produce genome assemblies and annotations very quickly. Such accessibility results in a proliferation of assemblies and associated files, often for many organisms. These assemblies get used as a working reference by lots of different workers, from a bioinformatician doing gene prediction or a bench scientist designing primers for PCR. Here we describe Gee Fu, a database tool for genomic assembly and feature data, including next-generation sequence alignments. Gee Fu is an instance of a Ruby-On-Rails web application on a feature database that provides web and console interfaces for input, visualization of feature data via AnnoJ, access to data through a web-service interface, an API for direct data access by Ruby scripts and access to feature data stored in BAM files. Gee Fu provides a platform for storing and sharing different versions of an assembly and associated features that can be accessed and updated by bench biologists and bioinformaticians in ways that are easy and useful for each. http://tinyurl.com/geefu dan.maclean@tsl.ac.uk.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
ERIC Educational Resources Information Center
Papastergiou, Marina
2005-01-01
This paper reports on a project-based learning (PBL) environment targeted towards introducing student teachers to the design and development of educational web sites. The participants were 46 student teachers who constructed 16 web sites for primary school. A survey of their views, before and after the projects, and an evaluation of the web sites…
ERIC Educational Resources Information Center
Papastergiou, Marina
2005-01-01
This paper reports on a project-based learning (PBL) environment targeted towards introducing student teachers to the design and development of educational web sites. The participants were 46 student teachers who constructed 16 web sites for primary school. A survey of their views, before and after the projects, and an evaluation of the web sites…
Dual phase multiplex polymerase chain reaction
Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL
2008-10-07
Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.
Long, Ju
2016-05-01
In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.
Microsatellite analysis in the genome of Acanthaceae: An in silico approach.
Kaliswamy, Priyadharsini; Vellingiri, Srividhya; Nathan, Bharathi; Selvaraj, Saravanakumar
2015-01-01
Acanthaceae is one of the advanced and specialized families with conventionally used medicinal plants. Simple sequence repeats (SSRs) play a major role as molecular markers for genome analysis and plant breeding. The microsatellites existing in the complete genome sequences would help to attain a direct role in the genome organization, recombination, gene regulation, quantitative genetic variation, and evolution of genes. The current study reports the frequency of microsatellites and appropriate markers for the Acanthaceae family genome sequences. The whole nucleotide sequences of Acanthaceae species were obtained from National Center for Biotechnology Information database and screened for the presence of SSRs. SSR Locator tool was used to predict the microsatellites and inbuilt Primer3 module was used for primer designing. Totally 110 repeats from 108 sequences of Acanthaceae family plant genomes were identified, and the occurrence of dinucleotide repeats was found to be abundant in the genome sequences. The essential amino acid isoleucine was found rich in all the sequences. We also designed the SSR-based primers/markers for 59 sequences of this family that contains microsatellite repeats in their genome. The identified microsatellites and primers might be useful for breeding and genetic studies of plants that belong to Acanthaceae family in the future.
Cook, Anthony L; Snow, Elizabeth T; Binns, Henrica; Cook, Peta S
2015-01-01
Inquiry-based learning (IBL) activities are complementary to the processes of laboratory discovery, as both are focused on producing new findings through research and inquiry. Here, we describe the results of student surveys taken pre- and postpractical to an IBL undergraduate practical on PCR. Our analysis focuses primarily student perceptions of knowledge acquisition and their ability to troubleshoot problems. The survey results demonstrate significant self-reported gains in knowledge related to DNA structure and PCR, and an increase in confidence with "troubleshooting problems during scientific experiments." We conclude that the IBL-based approach that combines PCR primer design with wet laboratory experimentation using student-designed primers, provides students a sense of confidence by imparting workplace and research skills that are integral to diverse forms and applications of laboratory practices. © 2015 The International Union of Biochemistry and Molecular Biology.
Williams, Lauren Therese; Grealish, Laurie; Jamieson, Maggie
2015-01-01
Background Clinicians need to be supported by universities to use credible and defensible assessment practices during student placements. Web-based delivery of clinical education in student assessment offers professional development regardless of the geographical location of placement sites. Objective This paper explores the potential for a video-based constructivist Web-based program to support site supervisors in their assessments of student dietitians during clinical placements. Methods This project was undertaken as design-based research in two stages. Stage 1 describes the research consultation, development of the prototype, and formative feedback. In Stage 2, the program was pilot-tested and evaluated by a purposeful sample of nine clinical supervisors. Data generated as a result of user participation during the pilot test is reported. Users’ experiences with the program were also explored via interviews (six in a focus group and three individually). The interviews were transcribed verbatim and thematic analysis conducted from a pedagogical perspective using van Manen’s highlighting approach. Results This research succeeded in developing a Web-based program, “Feed our Future”, that increased supervisors’ confidence with their competency-based assessments of students on clinical placements. Three pedagogical themes emerged: constructivist design supports transformative Web-based learning; videos make abstract concepts tangible; and accessibility, usability, and pedagogy are interdependent. Conclusions Web-based programs, such as Feed our Future, offer a viable means for universities to support clinical supervisors in their assessment practices during clinical placements. A design-based research approach offers a practical process for such Web-based tool development, highlighting pedagogical barriers for planning purposes. PMID:25803172
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
Preliminary investigation of steel girder end panel shear resistance.
DOT National Transportation Integrated Search
2010-01-01
Prior to 1973, steel bridges in California were designed based on Allowable Stress : Design and the shear design of web and transverse stiffeners was based on the : average shear stress in the web. The tension field action equation similar to the : c...
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bowman, Stephen M
2008-09-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less
Internet Issues and Applications, 1997-1998.
ERIC Educational Resources Information Center
Dempsey, Bert J., Ed.; Jones, Paul, Ed.
This book gives an overview of the leading-edge Internet application areas (streaming multimedia, collaborative tools, Web databases) and key information policy issues (privacy, censorship, information quality, and more). The text serves as a primer on understanding the forces--economic, legal, social, as well as technological--that are shaping…
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Improving the Aircraft Design Process Using Web-Based Modeling and Simulation
NASA Technical Reports Server (NTRS)
Reed, John A.; Follen, Gregory J.; Afjeh, Abdollah A.; Follen, Gregory J. (Technical Monitor)
2000-01-01
Designing and developing new aircraft systems is time-consuming and expensive. Computational simulation is a promising means for reducing design cycle times, but requires a flexible software environment capable of integrating advanced multidisciplinary and multifidelity analysis methods, dynamically managing data across heterogeneous computing platforms, and distributing computationally complex tasks. Web-based simulation, with its emphasis on collaborative composition of simulation models, distributed heterogeneous execution, and dynamic multimedia documentation, has the potential to meet these requirements. This paper outlines the current aircraft design process, highlighting its problems and complexities, and presents our vision of an aircraft design process using Web-based modeling and simulation.
Improving the Aircraft Design Process Using Web-based Modeling and Simulation
NASA Technical Reports Server (NTRS)
Reed, John A.; Follen, Gregory J.; Afjeh, Abdollah A.
2003-01-01
Designing and developing new aircraft systems is time-consuming and expensive. Computational simulation is a promising means for reducing design cycle times, but requires a flexible software environment capable of integrating advanced multidisciplinary and muitifidelity analysis methods, dynamically managing data across heterogeneous computing platforms, and distributing computationally complex tasks. Web-based simulation, with its emphasis on collaborative composition of simulation models, distributed heterogeneous execution, and dynamic multimedia documentation, has the potential to meet these requirements. This paper outlines the current aircraft design process, highlighting its problems and complexities, and presents our vision of an aircraft design process using Web-based modeling and simulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna
ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less
Interstellar Initiative Web Page Design
NASA Technical Reports Server (NTRS)
Mehta, Alkesh
1999-01-01
This summer at NASA/MSFC, I have contributed to two projects: Interstellar Initiative Web Page Design and Lenz's Law Relative Motion Demonstration. In the Web Design Project, I worked on an Outline. The Web Design Outline was developed to provide a foundation for a Hierarchy Tree Structure. The Outline would help design a Website information base for future and near-term missions. The Website would give in-depth information on Propulsion Systems and Interstellar Travel. The Lenz's Law Relative Motion Demonstrator is discussed in this volume by Russell Lee.
Web-based learning resources - new opportunities for competency development.
Moen, Anne; Nygård, Kathrine A; Gauperaa, Torunn
2009-01-01
Creating web-based learning environments holds great promise for on the job training and competence development in nursing. The web-based learning environment was designed and customized by four professional development nurses. We interviewed five RNs that pilot tested the web-based resource. Our findings give some insight into how the web-based design tool are perceived and utilized, and how content is represented in the learning environment. From a competency development perspective, practicing authentic tasks in a web-based learning environment can be useful to train skills and keep up important routines. The approach found in this study also needs careful consideration. Emphasizing routines and skills can be important to reduce variation and ensure more streamlined practice from an institution-wide quality improvement efforts. How the emphasis on routines and skills plays out towards the individual's overall professional development needs further careful studies.
Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K
2015-09-08
The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.
Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.
2015-01-01
The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000
Randomized, Controlled Trial of CBT Training for PTSD Providers
2016-10-29
trial and comparative effectiveness study is to design, implement and evaluate a cost effective, web based self paced training program to provide skills...without web -centered supervision, may provide an effective means to train increasing numbers of mental health providers in relevant, evidence-based...in equal numbers to three parallel intervention condition: a) Web -based training plus web -centered supervision; b) Web - based training alone; and c
Development of a web-based intervention for the indicated prevention of depression.
Kelders, Saskia M; Pots, Wendy T M; Oskam, Maarten Jan; Bohlmeijer, Ernst T; van Gemert-Pijnen, Julia E W C
2013-02-20
To reduce the large public health burden of the high prevalence of depression, preventive interventions targeted at people at risk are essential and can be cost-effective. Web-based interventions are able to provide this care, but there is no agreement on how to best develop these applications and often the technology is seen as a given. This seems to be one of the main reasons that web-based interventions do not reach their full potential. The current study describes the development of a web-based intervention for the indicated prevention of depression, employing the CeHRes (Center for eHealth Research and Disease Management) roadmap. The goals are to create a user-friendly application which fits the values of the stakeholders and to evaluate the process of development. The employed methods are a literature scan and discussion in the contextual inquiry; interviews, rapid prototyping and a requirement session in the value specification stage; and user-based usability evaluation, expert-based usability inspection and a requirement session in the design stage. The contextual inquiry indicated that there is a need for easily accessible interventions for the indicated prevention of depression and web-based interventions are seen as potentially meeting this need. The value specification stage yielded expected needs of potential participants, comments on the usefulness of the proposed features and comments on two proposed designs of the web-based intervention. The design stage yielded valuable comments on the system, content and service of the web-based intervention. Overall, we found that by developing the technology, we successfully (re)designed the system, content and service of the web-based intervention to match the values of stakeholders. This study has shown the importance of a structured development process of a web-based intervention for the indicated prevention of depression because: (1) it allows the development team to clarify the needs that have to be met for the intervention to be of use to the target audience; and (2) it yields feedback on the design of the application that is broader than color and buttons, but encompasses comments on the quality of the service that the application offers.
Development of a web-based intervention for the indicated prevention of depression
2013-01-01
Background To reduce the large public health burden of the high prevalence of depression, preventive interventions targeted at people at risk are essential and can be cost-effective. Web-based interventions are able to provide this care, but there is no agreement on how to best develop these applications and often the technology is seen as a given. This seems to be one of the main reasons that web-based interventions do not reach their full potential. The current study describes the development of a web-based intervention for the indicated prevention of depression, employing the CeHRes (Center for eHealth Research and Disease Management) roadmap. The goals are to create a user-friendly application which fits the values of the stakeholders and to evaluate the process of development. Methods The employed methods are a literature scan and discussion in the contextual inquiry; interviews, rapid prototyping and a requirement session in the value specification stage; and user-based usability evaluation, expert-based usability inspection and a requirement session in the design stage. Results The contextual inquiry indicated that there is a need for easily accessible interventions for the indicated prevention of depression and web-based interventions are seen as potentially meeting this need. The value specification stage yielded expected needs of potential participants, comments on the usefulness of the proposed features and comments on two proposed designs of the web-based intervention. The design stage yielded valuable comments on the system, content and service of the web-based intervention. Conclusions Overall, we found that by developing the technology, we successfully (re)designed the system, content and service of the web-based intervention to match the values of stakeholders. This study has shown the importance of a structured development process of a web-based intervention for the indicated prevention of depression because: (1) it allows the development team to clarify the needs that have to be met for the intervention to be of use to the target audience; and (2) it yields feedback on the design of the application that is broader than color and buttons, but encompasses comments on the quality of the service that the application offers. PMID:23425322
Designing Online Problem Representation Engine for Conceptual Change
ERIC Educational Resources Information Center
Lee, Chwee Beng; Ling, Keck Voon
2012-01-01
Purpose: This paper aims to describe the web-based scaffold dynamic simulation system (PRES-on) designed for pre-service teachers. Design/methodology/approach: The paper describes the initial design of a web-based scaffold dynamic simulation system (PRES-on) as a cognitive tool for learners to represent problems. For the widespread use of the…
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee
2007-01-01
Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.
Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.
2012-01-01
Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843
ERIC Educational Resources Information Center
Fujimoto, Toru
2010-01-01
The purpose of this research was to design and evaluate a web-based self-learning environment for historical inquiry embedded with different types of instructional support featuring story-based pedagogical agents. This research focused on designing a learning environment by integrating story-based instruction and pedagogical agents as a means to…
Methylation-Sensitive High Resolution Melting (MS-HRM).
Hussmann, Dianna; Hansen, Lise Lotte
2018-01-01
Methylation-Sensitive High Resolution Melting (MS-HRM) is an in-tube, PCR-based method to detect methylation levels at specific loci of interest. A unique primer design facilitates a high sensitivity of the assays enabling detection of down to 0.1-1% methylated alleles in an unmethylated background.Primers for MS-HRM assays are designed to be complementary to the methylated allele, and a specific annealing temperature enables these primers to anneal both to the methylated and the unmethylated alleles thereby increasing the sensitivity of the assays. Bisulfite treatment of the DNA prior to performing MS-HRM ensures a different base composition between methylated and unmethylated DNA, which is used to separate the resulting amplicons by high resolution melting.The high sensitivity of MS-HRM has proven useful for detecting cancer biomarkers in a noninvasive manner in urine from bladder cancer patients, in stool from colorectal cancer patients, and in buccal mucosa from breast cancer patients. MS-HRM is a fast method to diagnose imprinted diseases and to clinically validate results from whole-epigenome studies. The ability to detect few copies of methylated DNA makes MS-HRM a key player in the quest for establishing links between environmental exposure, epigenetic changes, and disease.
VisBOL: Web-Based Tools for Synthetic Biology Design Visualization.
McLaughlin, James Alastair; Pocock, Matthew; Mısırlı, Göksel; Madsen, Curtis; Wipat, Anil
2016-08-19
VisBOL is a Web-based application that allows the rendering of genetic circuit designs, enabling synthetic biologists to visually convey designs in SBOL visual format. VisBOL designs can be exported to formats including PNG and SVG images to be embedded in Web pages, presentations and publications. The VisBOL tool enables the automated generation of visualizations from designs specified using the Synthetic Biology Open Language (SBOL) version 2.0, as well as a range of well-known bioinformatics formats including GenBank and Pigeoncad notation. VisBOL is provided both as a user accessible Web site and as an open-source (BSD) JavaScript library that can be used to embed diagrams within other content and software.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesismore » at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.« less
Designing a Web-Based Science Learning Environment for Model-Based Collaborative Inquiry
ERIC Educational Resources Information Center
Sun, Daner; Looi, Chee-Kit
2013-01-01
The paper traces a research process in the design and development of a science learning environment called WiMVT (web-based inquirer with modeling and visualization technology). The WiMVT system is designed to help secondary school students build a sophisticated understanding of scientific conceptions, and the science inquiry process, as well as…
Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D
2009-12-01
The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.
Architecture, Design, and Development of an HTML/JavaScript Web-Based Group Support System.
ERIC Educational Resources Information Center
Romano, Nicholas C., Jr.; Nunamaker, Jay F., Jr.; Briggs, Robert O.; Vogel, Douglas R.
1998-01-01
Examines the need for virtual workspaces and describes the architecture, design, and development of GroupSystems for the World Wide Web (GSWeb), an HTML/JavaScript Web-based Group Support System (GSS). GSWeb, an application interface similar to a Graphical User Interface (GUI), is currently used by teams around the world and relies on user…
swga: a primer design toolkit for selective whole genome amplification.
Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin
2017-07-15
Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Web-Based Training in Corporations: Design Issues.
ERIC Educational Resources Information Center
Lee, Doris; Chamers, Terri; Ely, Tim
2005-01-01
Web-based training, WBT, is a relatively new application of instructional design in any organization. Advances in technology may tempt WBT designers to use the fastest or the latest technological features possible, but if content and intent are obscured and instructional effectiveness sacrificed, the WBT becomes another neglected eye-catching, yet…
Web-Based Learning Design Tool
ERIC Educational Resources Information Center
Bruno, F. B.; Silva, T. L. K.; Silva, R. P.; Teixeira, F. G.
2012-01-01
Purpose: The purpose of this paper is to propose a web-based tool that enables the development and provision of learning designs and its reuse and re-contextualization as generative learning objects, aimed at developing educational materials. Design/methodology/approach: The use of learning objects can facilitate the process of production and…
Nimesh, Manoj; Joon, Deepali; Pathak, Anil Kumar; Saluja, Daman
2013-11-01
Indian contribution to global burden of tuberculosis is about 26%. In the present study we have developed an in-house PCR assay using primers for sdaA gene of Mycobacterium tuberculosis and evaluated against already established primers devR, IS6110, MPB64, rpoB primers for diagnosis of pulmonary tuberculosis. Using universal sample preparation (USP) method, DNA was extracted from sputum specimens of 412 symptomatic patients from Delhi, India. The DNA so extracted was used as template for PCR amplification using primers targeting sdaA, devR, IS6110, MPB64 and rpoB genes. Out of 412, 149 specimens were considered positive based on composite reference standard (CRS) criteria. The in-house designed sdaA PCR showed high specificity (96.5%), the high positive likelihood ratio (28), the high sensitivity (95.9%), and the very low negative likelihood ratio (0.04) in comparison to CRS. Based on our results, the sdaA PCR assay can be considered as one of the most reliable diagnostic tests in comparison to other PCR based detection methods. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
A Web-Based Visualization and Animation Platform for Digital Logic Design
ERIC Educational Resources Information Center
Shoufan, Abdulhadi; Lu, Zheng; Huss, Sorin A.
2015-01-01
This paper presents a web-based education platform for the visualization and animation of the digital logic design process. This includes the design of combinatorial circuits using logic gates, multiplexers, decoders, and look-up-tables as well as the design of finite state machines. Various configurations of finite state machines can be selected…
Berg, Marie; Linden, Karolina; Adolfsson, Annsofie; Sparud Lundin, Carina; Ranerup, Agneta
2018-05-02
Numerous Web-based interventions have been implemented to promote health and health-related behaviors in persons with chronic conditions. Using randomized controlled trials to evaluate such interventions creates a range of challenges, which in turn can influence the study outcome. Applying a critical perspective when evaluating Web-based health interventions is important. The objective of this study was to critically analyze and discuss the challenges of conducting a Web-based health intervention as a randomized controlled trial. The MODIAB-Web study was critically examined using an exploratory case study methodology and the framework for analysis offered through the Persuasive Systems Design model. Focus was on technology, study design, and Web-based support usage, with special focus on the forum for peer support. Descriptive statistics and qualitative content analysis were used. The persuasive content and technological elements in the design of the randomized controlled trial included all four categories of the Persuasive Systems Design model, but not all design principles were implemented. The study duration was extended to a period of four and a half years. Of 81 active participants in the intervention group, a maximum of 36 women were simultaneously active. User adherence varied greatly with a median of 91 individual log-ins. The forum for peer support was used by 63 participants. Although only about one-third of the participants interacted in the forum, there was a fairly rich exchange of experiences and advice between them. Thus, adherence in terms of social interactions was negatively affected by limited active participation due to prolonged recruitment process and randomization effects. Lessons learned from this critical analysis are that technology and study design matter and might mutually influence each other. In Web-based interventions, the use of design theories enables utilization of the full potential of technology and promotes adherence. The randomization element in a randomized controlled trial design can become a barrier to achieving a critical mass of user interactions in Web-based interventions, especially when social support is included. For extended study periods, the technology used may need to be adapted in line with newly available technical options to avoid the risk of becoming outdated in the user realm, which in turn might jeopardize study validity in terms of randomized controlled trial designs. On the basis of lessons learned in this randomized controlled trial, we give recommendations to consider when designing and evaluating Web-based health interventions. ©Marie Berg, Karolina Linden, Annsofie Adolfsson, Carina Sparud Lundin, Agneta Ranerup. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 02.05.2018.
Kopp, Sandra L; Smith, Hugh M
2011-01-01
Little is known about the use of Web-based education in regional anesthesia training. Benefits of Web-based education include the ability to standardize learning material quality and content, build appropriate learning progressions, use interactive multimedia technologies, and individualize delivery of course materials. The goals of this investigation were (1) to determine whether module design influences regional anesthesia knowledge acquisition, (2) to characterize learner preference patterns among anesthesia residents, and (3) to determine whether learner preferences play a role in knowledge acquisition. Direct comparison of knowledge assessments, learning styles, and learner preferences will be made between an interactive case-based and a traditional textbook-style module design. Forty-three Mayo Clinic anesthesiology residents completed 2 online modules, a knowledge pretest, posttest, an Index of Learning Styles assessment, and a participant satisfaction survey. Interscalene and lumbar plexus regional techniques were selected as the learning content for 4 Web modules constructed using the Blackboard Vista coursework application. One traditional textbook-style module and 1 interactive case-based module were designed for each of the interscalene and lumbar plexus techniques. Participants scored higher on the postmodule knowledge assessment for both of the interscalene and lumbar plexus modules. Postmodule knowledge performance scores were independent of both module design (interactive case-based versus traditional textbook style) and learning style preferences. However, nearly all participants reported a preference for Web-based learning and believe that it should be used in anesthesia resident education. Participants did not feel that Web-base learning should replace the current lecture-based curriculum. All residents scored higher on the postmodule knowledge assessment, but this improvement was independent of the module design and individual learning styles. Although residents believe that online learning should be used in anesthesia training, the results of this study do not demonstrate improved learning or justify the time and expense of developing complex case-based training modules. While there may be practical benefits of Web-based education, educators in regional anesthesia should be cautious about developing curricula based on learner preference data.
JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms
Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim
2015-01-01
The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/ PMID:26424080
JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.
Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim
2015-01-01
The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. © The Author(s) 2015. Published by Oxford University Press.
The Web Resource Collaboration Center
ERIC Educational Resources Information Center
Dunlap, Joanna C.
2004-01-01
The Web Resource Collaboration Center (WRCC) is a web-based tool developed to help software engineers build their own web-based learning and performance support systems. Designed using various online communication and collaboration technologies, the WRCC enables people to: (1) build a learning and professional development resource that provides…
Student Perceptions of Learning in a Web-Based Tutorial.
ERIC Educational Resources Information Center
Brescia, William; McAuley, Sean
This case study used both quantitative and qualitative methods to investigate students' perceptions of learning using a Web-based tutorial. Students participated in a Web-based tutorial to learn basic HTML as part of a graduate-level Web design course. Four of five students agreed to participate in the survey and interviews. After completing the…
pelB gene in isolates of Colletotrichum gloeosporioides from several hosts.
Medeiros, L V; Maciel, D B; Medeiros, V V; Houllou Kido, L M; Oliveira, N T
2010-04-13
Colletotrichum gloeosporioides is an important pathogen for a great number of economically important crops. During the necrotrophic phase of infection by Colletotrichum spp, the degradative enzymes of plant cell walls, such as pectate lyase, clearly increase. A gene pelB that expresses a pectate lyase was identified in isolates of C. gloeosporioides in avocado pathogens. Various molecular studies have identified a kind of specialization of C. gloeosporioides isolates with specific hosts; however, there have been no studies of this gene in isolates from hosts other than avocado. The same is true for other species of Colletotrichum. We examined genetic variability in order to design primers that would amplify pelB gene fragments and compared the products of this amplification in C. gloeosporioides isolates from different hosts. Genetic variability was assessed using ISSR primers; the resultant data were grouped based on the UPGMA clustering method. Primers for the pelB gene were designed from selected GenBank sequences using the Primer 3 program at an annealing temperature of 60 degrees C and product amplification of nearly 600 bp. The ISSR primers were efficient in demonstrating the genetic variability of the Colletotrichum isolates and in distinguishing C. gloeosporioides, C. acutatum and C. sublineolum species. The gene pelB was found in C. gloeosporioides, C. acutatum and C. sublineolum. Amplified restriction fragments using MspI did not reveal differences in pelB gene structure in isolates from the three different host species that we investigated.
ERIC Educational Resources Information Center
Singh, Oma B.
2009-01-01
This study used a design based-research (DBR) methodology to examine how an Instructional Systematic Design (ISD) process such as ADDIE (Analysis, Design, Development, Implementation, Evaluation) can be employed to develop a web-based module to teach metacognitive learning strategies to students in higher education. The goal of the study was…
Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR
Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru
2005-01-01
Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K
2012-01-01
An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.
Research and Development of Web-Based Virtual Online Classroom
ERIC Educational Resources Information Center
Yang, Zongkai; Liu, Qingtang
2007-01-01
To build a web-based virtual learning environment depends on information technologies, concerns technology supporting learning methods and theories. A web-based virtual online classroom is designed and developed based on learning theories and streaming media technologies. And it is composed of two parts: instructional communicating environment…
Trigger Videos on the Web: Impact of Audiovisual Design
ERIC Educational Resources Information Center
Verleur, Ria; Heuvelman, Ard; Verhagen, Plon W.
2011-01-01
Audiovisual design might impact emotional responses, as studies from the 1970s and 1980s on movie and television content show. Given today's abundant presence of web-based videos, this study investigates whether audiovisual design will impact web-video content in a similar way. The study is motivated by the potential influence of video-evoked…
Microsatellite analysis in the genome of Acanthaceae: An in silico approach
Kaliswamy, Priyadharsini; Vellingiri, Srividhya; Nathan, Bharathi; Selvaraj, Saravanakumar
2015-01-01
Background: Acanthaceae is one of the advanced and specialized families with conventionally used medicinal plants. Simple sequence repeats (SSRs) play a major role as molecular markers for genome analysis and plant breeding. The microsatellites existing in the complete genome sequences would help to attain a direct role in the genome organization, recombination, gene regulation, quantitative genetic variation, and evolution of genes. Objective: The current study reports the frequency of microsatellites and appropriate markers for the Acanthaceae family genome sequences. Materials and Methods: The whole nucleotide sequences of Acanthaceae species were obtained from National Center for Biotechnology Information database and screened for the presence of SSRs. SSR Locator tool was used to predict the microsatellites and inbuilt Primer3 module was used for primer designing. Results: Totally 110 repeats from 108 sequences of Acanthaceae family plant genomes were identified, and the occurrence of dinucleotide repeats was found to be abundant in the genome sequences. The essential amino acid isoleucine was found rich in all the sequences. We also designed the SSR-based primers/markers for 59 sequences of this family that contains microsatellite repeats in their genome. Conclusion: The identified microsatellites and primers might be useful for breeding and genetic studies of plants that belong to Acanthaceae family in the future. PMID:25709226
New primers for the detection Leishmania species by multiplex polymerase chain reaction.
Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi
2018-02-01
Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.
Role of Theories in the Design of Web-Based Person-Centered Support: A Critical Analysis
Ranerup, Agneta; Sparud-Lundin, Carina; Koinberg, Ingalill; Skärsäter, Ingela; Jenholt-Nolbris, Margaretha; Berg, Marie
2014-01-01
Objective. The aim of this study was to provide a critical understanding of the role of theories and their compatibility with a person-centered approach in the design and evaluation of web-based support for the management of chronic illness. Methods. Exploration of web-based support research projects focusing on four cases: (1) preschool children aged 4–6 with bladder dysfunction and urogenital malformation; (2) young adults aged 16–25 living with mental illness; (3) women with type 1 diabetes who are pregnant or in early motherhood; and (4) women who have undergone surgery for breast cancer. Data comprised interviews with research leaders and documented plans. Analysis was performed by means of a cross-case methodology. Results. The used theories concerned design, learning, health and well-being, or transition. All web support products had been developed using a participatory design (PD). Fundamental to the technology design and evaluation of outcomes were theories focusing on learning and on health and well-being. All theories were compatible with a person-centered approach. However, a notable exception was the relatively collective character of PD and Communities of Practice. Conclusion. Our results illustrate multifaceted ways for theories to be used in the design and evaluation of web-based support. PMID:26464860
How to Increase Reach and Adherence of Web-Based Interventions: A Design Research Viewpoint.
Ludden, Geke D S; van Rompay, Thomas J L; Kelders, Saskia M; van Gemert-Pijnen, Julia E W C
2015-07-10
Nowadays, technology is increasingly used to increase people's well-being. For example, many mobile and Web-based apps have been developed that can support people to become mentally fit or to manage their daily diet. However, analyses of current Web-based interventions show that many systems are only used by a specific group of users (eg, women, highly educated), and that even they often do not persist and drop out as the intervention unfolds. In this paper, we assess the impact of design features of Web-based interventions on reach and adherence and conclude that the power that design can have has not been used to its full potential. We propose looking at design research as a source of inspiration for new (to the field) design approaches. The paper goes on to specify and discuss three of these approaches: personalization, ambient information, and use of metaphors. Central to our viewpoint is the role of positive affect triggered by well-designed persuasive features to boost adherence and well-being. Finally, we discuss the future of persuasive eHealth interventions and suggest avenues for follow-up research.
A web-based approach to managing stress and mood disorders in the workforce.
Billings, Douglas W; Cook, Royer F; Hendrickson, April; Dove, David C
2008-08-01
To evaluate the effectiveness of a web-based multimedia health promotion program for the workplace, designed to help reduce stress and to prevent depression, anxiety, and substance abuse. Using a randomized controlled trial design, 309 working adults were randomly assigned to the web-based condition or to a wait-list control condition. All participants were assessed on multiple self-reported outcomes at pretest and posttest. Relative to controls, the web-based group reduced their stress, increased their knowledge of depression and anxiety, developed more positive attitudes toward treatment, and adopted a more healthy approach to alcohol consumption. We found that a brief and easily adaptable web-based stress management program can simultaneously reduce worker stress and address stigmatized behavioral health problems by embedding this prevention material into a more positive stress management framework.
Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan
2014-07-01
In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A
2016-01-01
The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
ERIC Educational Resources Information Center
Turkish Online Journal of Distance Education, 2013
2013-01-01
It might be said that attitudes impact success directly in web-based teaching and timely and appropriate fulfillment of learners' expectations bear utmost significance for their success. From this perspective a properly designed web supported teaching application can provide positive contribution as well to learners' attitudes towards web…
The Knowledge of Web 2.0 by Library and Information Science Academics
ERIC Educational Resources Information Center
Al-Daihani, Sultan
2009-01-01
This research paper reports the results of a Web-based survey designed to explore the attitude of Library and Information Science (LIS) academics to Web 2.0. It investigates their familiarity with Web 2.0 concepts, tools and services and applications as these relate to LIS education, and the barriers to their use. A Web-based questionnaire was…
Adapting an in-person patient-caregiver communication intervention to a tailored web-based format.
Zulman, Donna M; Schafenacker, Ann; Barr, Kathryn L C; Moore, Ian T; Fisher, Jake; McCurdy, Kathryn; Derry, Holly A; Saunders, Edward W; An, Lawrence C; Northouse, Laurel
2012-03-01
Interventions that target cancer patients and their caregivers have been shown to improve patient-caregiver communication, support, and emotional well-being. To adapt an in-person communication intervention for cancer patients and caregivers to a web-based format, and to examine the usability and acceptability of the web-based program among representative users. A tailored, interactive web-based communication program for cancer patients and their family caregivers was developed based on an existing in-person, nurse-delivered intervention. The development process involved: (1) building a multidisciplinary team of content and web design experts, (2) combining key components of the in-person intervention with the unique tailoring and interactive features of a web-based platform, and (3) conducting focus groups and usability testing to obtain feedback from representative program users at multiple time points. Four focus groups with 2-3 patient-caregiver pairs per group (n = 22 total participants) and two iterations of usability testing with four patient-caregiver pairs per session (n = 16 total participants) were conducted. Response to the program's structure, design, and content was favorable, even among users who were older or had limited computer and Internet experience. The program received high ratings for ease of use and overall usability (mean System Usability Score of 89.5 out of 100). Many elements of a nurse-delivered patient-caregiver intervention can be successfully adapted to a web-based format. A multidisciplinary design team and an iterative evaluation process with representative users were instrumental in the development of a usable and well-received web-based program. Copyright © 2011 John Wiley & Sons, Ltd.
Zulman, Donna M.; Schafenacker, Ann; Barr, Kathryn L.C.; Moore, Ian T.; Fisher, Jake; McCurdy, Kathryn; Derry, Holly A.; Saunders, Edward W.; An, Lawrence C.; Northouse, Laurel
2011-01-01
Background Interventions that target cancer patients and their caregivers have been shown to improve communication, support, and emotional well-being. Objective To adapt an in-person communication intervention for cancer patients and caregivers to a web-based format, and to examine the usability and acceptability of the web-based program among representative users. Methods A tailored, interactive web-based communication program for cancer patients and their family caregivers was developed based on an existing in-person, nurse-delivered intervention. The development process involved: 1) building a multidisciplinary team of content and web design experts, 2) combining key components of the in-person intervention with the unique tailoring and interactive features of a web-based platform, and 3) conducting focus groups and usability testing to obtain feedback from representative program users at multiple time points. Results Four focus groups with 2 to 3 patient-caregiver pairs per group (n = 22 total participants) and two iterations of usability testing with 4 patient-caregiver pairs per session (n = 16 total participants) were conducted. Response to the program's structure, design, and content was favorable, even among users who were older or had limited computer and internet experience. The program received high ratings for ease of use and overall usability (mean System Usability Score of 89.5 out of 100). Conclusions Many elements of a nurse-delivered patient-caregiver intervention can be successfully adapted to a web-based format. A multidisciplinary design team and an iterative evaluation process with representative users were instrumental in the development of a usable and well-received web-based program. PMID:21830255
Web-Based Instruction: Business Courses.
ERIC Educational Resources Information Center
Park-Kim, Kwi
This paper describes the design, implementation, and application of interactive World Wide Web-based learning, based on several business courses taught at Bronx Community College/The City University of New York. The first section summarizes ways the Web was used, including managing the dissemination of course materials, instructor/student…
Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture
2015-08-01
preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally
Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt
2017-03-22
Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.
NASA Astrophysics Data System (ADS)
Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei
2017-08-01
One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.
WIWS: a protein structure bioinformatics Web service collection.
Hekkelman, M L; Te Beek, T A H; Pettifer, S R; Thorne, D; Attwood, T K; Vriend, G
2010-07-01
The WHAT IF molecular-modelling and drug design program is widely distributed in the world of protein structure bioinformatics. Although originally designed as an interactive application, its highly modular design and inbuilt control language have recently enabled its deployment as a collection of programmatically accessible web services. We report here a collection of WHAT IF-based protein structure bioinformatics web services: these relate to structure quality, the use of symmetry in crystal structures, structure correction and optimization, adding hydrogens and optimizing hydrogen bonds and a series of geometric calculations. The freely accessible web services are based on the industry standard WS-I profile and the EMBRACE technical guidelines, and are available via both REST and SOAP paradigms. The web services run on a dedicated computational cluster; their function and availability is monitored daily.
Web-Based Learning Environment: A Theory-Based Design Process for Development and Evaluation
ERIC Educational Resources Information Center
Nam, Chang S.; Smith-Jackson, Tonya L.
2007-01-01
Web-based courses and programs have increasingly been developed by many academic institutions, organizations, and companies worldwide due to their benefits for both learners and educators. However, many of the developmental approaches lack two important considerations needed for implementing Web-based learning applications: (1) integration of the…
Development of a PCR protocol to detect aflatoxigenic molds in food products.
Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J
2012-01-01
Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
Problem-Based Learning in Web-Based Science Classroom.
ERIC Educational Resources Information Center
Kim, Heeyoung; Chung, Ji-Sook; Kim, Younghoon
The purpose of this paper is to discuss how general problem-based learning (PBL) models and social-constructivist perspectives are applied to the design and development of a Web-based science program, which emphasizes inquiry-based learning for fifth grade students. The paper also deals with the general features and learning process of a Web-based…
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
ERIC Educational Resources Information Center
Chang, Kuo-En; Sung, Yao-Ting; Hou, Huei-Tse
2006-01-01
Educational software for teachers is an important, yet usually ignored, link for integrating information technology into classroom instruction. This study builds a web-based teaching material design and development system. The process in the system is divided into four stages, analysis, design, development, and practice. Eight junior high school…
Toward a Web Based Environment for Evaluation and Design of Pedagogical Hypermedia
ERIC Educational Resources Information Center
Trigano, Philippe C.; Pacurar-Giacomini, Ecaterina
2004-01-01
We are working on a method, called CEPIAH. We propose a web based system used to help teachers to design multimedia documents and to evaluate their prototypes. Our current research objectives are to create a methodology to sustain the educational hypermedia design and evaluation. A module is used to evaluate multimedia software applied in…
Developing a Web 2.0-Based System with User-Authored Content for Community Use and Teacher Education
ERIC Educational Resources Information Center
Cifuentes, Lauren; Sharp, Amy; Bulu, Sanser; Benz, Mike; Stough, Laura M.
2010-01-01
We report on an investigation into the design, development, implementation, and evaluation of an informational and instructional Website in order to generate guidelines for instructional designers of read/write Web environments. We describe the process of design and development research, the problem addressed, the theory-based solution, and the…
Li, Ying; Yu, Chuanfeng; Han, Huixia; Zhao, Caisheng; Zhang, Xiaoru
2016-07-15
A novel and sensitive surface-enhanced Raman scattering (SERS) method is proposed for the assay of DNA methyltransferase (MTase) activity and evaluation of inhibitors by developing a target triggering primer generation-based multiple signal amplification strategy. By using of a duplex substrate for Dam MTase, two hairpin templates and a Raman probe, multiple signal amplification mode is achieved. Once recognized by Dam MTase, the duplex substrate can be cleaved by Dpn I endonuclease and two primers are released for triggering the multiple signal amplification reaction. Consequently, a wide dynamic range and remarkably high sensitivity are obtained under isothermal conditions. The detection limit is 2.57×10(-4)UmL(-1). This assay exhibits an excellent selectivity and is successfully applied in the screening of inhibitors for Dam MTase. In addition, this novel sensing system is potentially universal as the recognition element can be conveniently designed for other target analytes by changing the substrate of DNA MTase. Copyright © 2016 Elsevier B.V. All rights reserved.
Engineering Laboratory Instruction in Virtual Environment--"eLIVE"
ERIC Educational Resources Information Center
Chaturvedi, Sushil; Prabhakaran, Ramamurthy; Yoon, Jaewan; Abdel-Salam, Tarek
2011-01-01
A novel application of web-based virtual laboratories to prepare students for physical experiments is explored in some detail. The pedagogy of supplementing physical laboratory with web-based virtual laboratories is implemented by developing a web-based tool, designated in this work as "eLIVE", an acronym for Engineering Laboratory…
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
2018-01-01
Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254
Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A
Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole
2013-01-01
Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505
Simplify Web Development for Faculty and Promote Instructional Design.
ERIC Educational Resources Information Center
Pedersen, David C.
Faculty members are often overwhelmed with the prospect of implementing Web-based instruction. In an effort to simplify the process and incorporate some basic instructional design elements, the Educational Technology Team at Embry Riddle Aeronautical University created a course template for WebCT. Utilizing rapid prototyping, the template…
Design Considerations for Enhancing Confidence and Participation in Web Based Courses.
ERIC Educational Resources Information Center
Winfield, William; Mealy, Martha; Scheibel, Pamela
The University of Wisconsin Learning Innovations Center's instructional design model for World Wide Web delivered courses incorporates a range of collaborative discussions and interactive experiences for the learner. In addition, these courses capitalize on the multimedia learning environment that the web offers to accommodate many kinds of…
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971
Person-centred web-based support - development through a Swedish multi-case study
2013-01-01
Background Departing from the widespread use of the internet in modern society and the emerging use of web applications in healthcare this project captures persons’ needs and expectations in order to develop highly usable web recourses. The purpose of this paper is to outline a multi-case research project focused on the development and evaluation of person-centred web-based support for people with long-term illness. To support the underlying idea to move beyond the illness, we approach the development of web support from the perspective of the emergent area of person-centred care. The project aims to contribute to the ongoing development of web-based supports in health care and to the emerging field of person-centred care. Methods/Design The research design uses a meta-analytical approach through its focus on synthesizing experiences from four Swedish regional and national cases of design and use of web-based support in long-term illness. The cases include children (bladder dysfunction and urogenital malformation), young adults (living close to persons with mental illness), and two different cases of adults (women with breast cancer and childbearing women with type 1 diabetes). All of the cases are ongoing, though in different stages of design, implementation, and analysis. This, we argue, will lead to a synthesis of results on a meta-level not yet described. Discussion To allow valid comparisons between the four cases we explore and problematize them in relation to four main aspects: 1) The use of people’s experiences and needs; 2) The role of use of theories in the design of person-centred web-based supports; 3) The evaluation of the effects of health outcomes for the informants involved and 4) The development of a generic person-centred model for learning and social support for people with long-term illness and their significant others. Person-centred web-based support is a new area and few studies focus on how web-based interventions can contribute to the development of person-centred care. In summary, the main intention of the project outlined here is to contribute with both a synthesis of results on meta-level from four cases and a substantial contribution to the field person-centred care. PMID:24139057
Person-centred web-based support--development through a Swedish multi-case study.
Josefsson, Ulrika; Berg, Marie; Koinberg, Ingalill; Hellström, Anna-Lena; Nolbris, Margaretha Jenholt; Ranerup, Agneta; Lundin, Carina Sparud; Skärsäter, Ingela
2013-10-19
Departing from the widespread use of the internet in modern society and the emerging use of web applications in healthcare this project captures persons' needs and expectations in order to develop highly usable web recourses. The purpose of this paper is to outline a multi-case research project focused on the development and evaluation of person-centred web-based support for people with long-term illness. To support the underlying idea to move beyond the illness, we approach the development of web support from the perspective of the emergent area of person-centred care. The project aims to contribute to the ongoing development of web-based supports in health care and to the emerging field of person-centred care. The research design uses a meta-analytical approach through its focus on synthesizing experiences from four Swedish regional and national cases of design and use of web-based support in long-term illness. The cases include children (bladder dysfunction and urogenital malformation), young adults (living close to persons with mental illness), and two different cases of adults (women with breast cancer and childbearing women with type 1 diabetes). All of the cases are ongoing, though in different stages of design, implementation, and analysis. This, we argue, will lead to a synthesis of results on a meta-level not yet described. To allow valid comparisons between the four cases we explore and problematize them in relation to four main aspects: 1) The use of people's experiences and needs; 2) The role of use of theories in the design of person-centred web-based supports; 3) The evaluation of the effects of health outcomes for the informants involved and 4) The development of a generic person-centred model for learning and social support for people with long-term illness and their significant others. Person-centred web-based support is a new area and few studies focus on how web-based interventions can contribute to the development of person-centred care. In summary, the main intention of the project outlined here is to contribute with both a synthesis of results on meta-level from four cases and a substantial contribution to the field person-centred care.
Design and evaluation of web-based image transmission and display with different protocols
NASA Astrophysics Data System (ADS)
Tan, Bin; Chen, Kuangyi; Zheng, Xichuan; Zhang, Jianguo
2011-03-01
There are many Web-based image accessing technologies used in medical imaging area, such as component-based (ActiveX Control) thick client Web display, Zerofootprint thin client Web viewer (or called server side processing Web viewer), Flash Rich Internet Application(RIA) ,or HTML5 based Web display. Different Web display methods have different peformance in different network environment. In this presenation, we give an evaluation on two developed Web based image display systems. The first one is used for thin client Web display. It works between a PACS Web server with WADO interface and thin client. The PACS Web server provides JPEG format images to HTML pages. The second one is for thick client Web display. It works between a PACS Web server with WADO interface and thick client running in browsers containing ActiveX control, Flash RIA program or HTML5 scripts. The PACS Web server provides native DICOM format images or JPIP stream for theses clients.
Web-Based Learning in the Computer-Aided Design Curriculum.
ERIC Educational Resources Information Center
Sung, Wen-Tsai; Ou, S. C.
2002-01-01
Applies principles of constructivism and virtual reality (VR) to computer-aided design (CAD) curriculum, particularly engineering, by integrating network, VR and CAD technologies into a Web-based learning environment that expands traditional two-dimensional computer graphics into a three-dimensional real-time simulation that enhances user…
Web-Enhanced Learning: Engaging Students in Constructivist Learning
ERIC Educational Resources Information Center
Neo, Mai
2005-01-01
Purpose: The purpose of this paper is to study the impact of a web-based constructivist learning environment, which was developed based on a course given to students in the Faculty of Creative Multimedia (FCM) on student learning. Design/methodology/approach: In this paper, a web-based multimedia-mediated project was developed based on an Internet…
Towards Greater Learner Control: Web Supported Project-Based Learning
ERIC Educational Resources Information Center
Guthrie, Cameron
2010-01-01
Project-based learning has been suggested as an appropriate pedagogy to prepare students in information systems for the realities of the business world. Web-based resources have been used to support such pedagogy with mixed results. The paper argues that the design of web-based learning support to cater to different learning styles may give…
The Development of Interactive World Wide Web Based Teaching Material in Forensic Science.
ERIC Educational Resources Information Center
Daeid, Niamh Nic
2001-01-01
Describes the development of a Web-based tutorial in the forensic science teaching program at the University of Strathclyde (Scotland). Highlights include the theoretical basis for course development; objectives; Web site design; student feedback; and staff feedback. (LRW)
An online planning tool for designing terrace layouts
USDA-ARS?s Scientific Manuscript database
A web-based conservation planning tool, WebTERLOC (web-based Terrace Location Program), was developed to provide multiple terrace layout options using digital elevation model (DEM) and geographic information systems (GIS). Development of a terrace system is complicated by the time-intensive manual ...
Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers
Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie
2013-01-01
The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915
Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.
Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D
2000-11-01
(a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.
The charged particle accelerators subsystems modeling
NASA Astrophysics Data System (ADS)
Averyanov, G. P.; Kobylyatskiy, A. V.
2017-01-01
Presented web-based resource for information support the engineering, science and education in Electrophysics, containing web-based tools for simulation subsystems charged particle accelerators. Formulated the development motivation of Web-Environment for Virtual Electrophysical Laboratories. Analyzes the trends of designs the dynamic web-environments for supporting of scientific research and E-learning, within the framework of Open Education concept.
Use of Web Technology to Access and Update College Plans
ERIC Educational Resources Information Center
Valeau, Edward J.; Luan, Jing
2007-01-01
In this study, the process and outcome of a web-based planning application, called Ports of Call, are discussed. The application allows college management to create, edit, and report out activities relating to college plans, all through a web browser. Its design was based on best practices in modern web technology and the application can be easily…
WebQuest on Conic Sections as a Learning Tool for Prospective Teachers
ERIC Educational Resources Information Center
Kurtulus, Aytac; Ada, Tuba
2012-01-01
WebQuests incorporate technology with educational concepts through integrating online resources with student-centred and activity-based learning. In this study, we describe and evaluate a WebQuest based on conic sections, which we have used with a group of prospective mathematics teachers. The WebQuest entitled: "Creating a Carpet Design Using…
ERIC Educational Resources Information Center
Gilstrap, Donald L.
1998-01-01
Explains how to build World Wide Web home pages using frames-based HTML so that librarians can manage Web-based information and improve their home pages. Provides descriptions and 15 examples for writing frames-HTML code, including advanced concepts and additional techniques for home-page design. (Author/LRW)
Designing Industrial Networks Using Ecological Food Web Metrics.
Layton, Astrid; Bras, Bert; Weissburg, Marc
2016-10-18
Biologically Inspired Design (biomimicry) and Industrial Ecology both look to natural systems to enhance the sustainability and performance of engineered products, systems and industries. Bioinspired design (BID) traditionally has focused on a unit operation and single product level. In contrast, this paper describes how principles of network organization derived from analysis of ecosystem properties can be applied to industrial system networks. Specifically, this paper examines the applicability of particular food web matrix properties as design rules for economically and biologically sustainable industrial networks, using an optimization model developed for a carpet recycling network. Carpet recycling network designs based on traditional cost and emissions based optimization are compared to designs obtained using optimizations based solely on ecological food web metrics. The analysis suggests that networks optimized using food web metrics also were superior from a traditional cost and emissions perspective; correlations between optimization using ecological metrics and traditional optimization ranged generally from 0.70 to 0.96, with flow-based metrics being superior to structural parameters. Four structural food parameters provided correlations nearly the same as that obtained using all structural parameters, but individual structural parameters provided much less satisfactory correlations. The analysis indicates that bioinspired design principles from ecosystems can lead to both environmentally and economically sustainable industrial resource networks, and represent guidelines for designing sustainable industry networks.
Web-Based Museum Trails on PDAs for University-Level Design Students: Design and Evaluation
ERIC Educational Resources Information Center
Reynolds, R.; Walker, K.; Speight, C.
2010-01-01
This paper describes the development and evaluation of web-based museum trails for university-level design students to access on handheld devices in the Victoria and Albert Museum (V&A) in London. The trails offered students a range of ways of exploring the museum environment and collections, some encouraging students to interpret objects and…
Introduction to Chemical Engineering Reactor Analysis: A Web-Based Reactor Design Game
ERIC Educational Resources Information Center
Orbey, Nese; Clay, Molly; Russell, T.W. Fraser
2014-01-01
An approach to explain chemical engineering through a Web-based interactive game design was developed and used with college freshman and junior/senior high school students. The goal of this approach was to demonstrate how to model a lab-scale experiment, and use the results to design and operate a chemical reactor. The game incorporates both…
How to Increase Reach and Adherence of Web-Based Interventions: A Design Research Viewpoint
2015-01-01
Nowadays, technology is increasingly used to increase people’s well-being. For example, many mobile and Web-based apps have been developed that can support people to become mentally fit or to manage their daily diet. However, analyses of current Web-based interventions show that many systems are only used by a specific group of users (eg, women, highly educated), and that even they often do not persist and drop out as the intervention unfolds. In this paper, we assess the impact of design features of Web-based interventions on reach and adherence and conclude that the power that design can have has not been used to its full potential. We propose looking at design research as a source of inspiration for new (to the field) design approaches. The paper goes on to specify and discuss three of these approaches: personalization, ambient information, and use of metaphors. Central to our viewpoint is the role of positive affect triggered by well-designed persuasive features to boost adherence and well-being. Finally, we discuss the future of persuasive eHealth interventions and suggest avenues for follow-up research. PMID:26163456
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico
Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.
Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
The Acquisition of Integrated Science Process Skills in a Web-Based Learning Environment
ERIC Educational Resources Information Center
Saat, Rohaida Mohd
2004-01-01
Web-based learning is becoming prevalent in science learning. Some use specially designed programs, while others use materials available on the Internet. This qualitative case study examined the process of acquisition of integrated science process skills, particularly the skill of controlling variables, in a web-based learning environment among…
ERIC Educational Resources Information Center
Murphy, Elizabeth; Ciszewska-Carr, Justyna
2007-01-01
This paper reports on an exploratory case study designed to gain insight into instructors' experiences with web based synchronous communication using two way audio and direct messaging. We conducted semi-structured interviews with eight instructors who used "Elluminate Live" in their web based, asynchronous courses in Education, Nursing,…
Web-Based Quiz-Game-Like Formative Assessment: Development and Evaluation
ERIC Educational Resources Information Center
Wang, Tzu-Hua
2008-01-01
This research aims to develop a multiple-choice Web-based quiz-game-like formative assessment system, named GAM-WATA. The unique design of "Ask-Hint Strategy" turns the Web-based formative assessment into an online quiz game. "Ask-Hint Strategy" is composed of "Prune Strategy" and "Call-in Strategy".…
Language Practice with Multimedia Supported Web-Based Grammar Revision Material
ERIC Educational Resources Information Center
Baturay, Meltem Huri; Daloglu, Aysegul; Yildirim, Soner
2010-01-01
The aim of this study was to investigate the perceptions of elementary-level English language learners towards web-based, multimedia-annotated grammar learning. WEBGRAM, a system designed to provide supplementary web-based grammar revision material, uses audio-visual aids to enrich the contextual presentation of grammar and allows learners to…
Leys, Natalie M. E. J.; Ryngaert, Annemie; Bastiaens, Leen; Verstraete, Willy; Top, Eva M.; Springael, Dirk
2004-01-01
Bacterial strains of the genus Sphingomonas are often isolated from contaminated soils for their ability to use polycyclic aromatic hydrocarbons (PAH) as the sole source of carbon and energy. The direct detection of Sphingomonas strains in contaminated soils, either indigenous or inoculated, is, as such, of interest for bioremediation purposes. In this study, a culture-independent PCR-based detection method using specific primers targeting the Sphingomonas 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) was developed to assess Sphingomonas diversity in PAH-contaminated soils. PCR using the new primer pair on a set of template DNAs of different bacterial genera showed that the method was selective for bacteria belonging to the family Sphingomonadaceae. Single-band DGGE profiles were obtained for most Sphingomonas strains tested. Strains belonging to the same species had identical DGGE fingerprints, and in most cases, these fingerprints were typical for one species. Inoculated strains could be detected at a cell concentration of 104 CFU g of soil−1. The analysis of Sphingomonas population structures of several PAH-contaminated soils by the new PCR-DGGE method revealed that soils containing the highest phenanthrene concentrations showed the lowest Sphingomonas diversity. Sequence analysis of cloned PCR products amplified from soil DNA revealed new 16S rRNA gene Sphingomonas sequences significantly different from sequences from known cultivated isolates (i.e., sequences from environmental clones grouped phylogenetically with other environmental clone sequences available on the web and that possibly originated from several potential new species). In conclusion, the newly designed Sphingomonas-specific PCR-DGGE detection technique successfully analyzed the Sphingomonas communities from polluted soils at the species level and revealed different Sphingomonas members not previously detected by culture-dependent detection techniques. PMID:15066784
Smart caching based on mobile agent of power WebGIS platform.
Wang, Xiaohui; Wu, Kehe; Chen, Fei
2013-01-01
Power information construction is developing towards intensive, platform, distributed direction with the expansion of power grid and improvement of information technology. In order to meet the trend, power WebGIS was designed and developed. In this paper, we first discuss the architecture and functionality of power WebGIS, and then we study caching technology in detail, which contains dynamic display cache model, caching structure based on mobile agent, and cache data model. We have designed experiments of different data capacity to contrast performance between WebGIS with the proposed caching model and traditional WebGIS. The experimental results showed that, with the same hardware environment, the response time of WebGIS with and without caching model increased as data capacity growing, while the larger the data was, the higher the performance of WebGIS with proposed caching model improved.
Dolor, Rowena J; Greene, Sarah M; Thompson, Ella; Baldwin, Laura-Mae; Neale, Anne Victoria
2011-08-01
This project aimed to develop an open-access website providing adaptable resources to facilitate best practices for multisite research from initiation to closeout. methods: A web-based assessment was sent to the leadership of the Clinical and Translational Science Award (CTSA) Community Engagement Key Functions Committee (n= 38) and the CTSA-affiliated Primary Care Practice-based Research Networks (PBRN, n= 55). Respondents rated the benefits and barriers of multisite research, the utility of available resources, and indicated their level of interest in unavailable resources. Then, existing research resources were evaluated for relevance to multisite research, adaptability to other projects, and source credibility. Fifty-five (59%) of invited participants completed the survey. Top perceived benefits of multisite research were the ability to conduct community-relevant research through academic-community partnerships (34%) and accelerating translation of research into practice (31%). Top perceived barriers were lack of research infrastructure to support PBRNs and community partners (31%) and inadequate funding to support multisite collaborations (26%). Over 200 resources were evaluated, of which 120 unique resources were included in the website. The PRIMER Research Toolkit (http://www.researchtoolkit.org) provides an array of peer-reviewed resources to facilitate translational research for the conduct of multisite studies within PBRNs and community-based organizations. © 2011 Wiley Periodicals, Inc.
Free Chlorine and Cyanuric Acid Simulator Application ...
A web-based application designed to simulate the free chlorine in systems adding free chlorine and cyanuric acid, including the application of Dichlor and Trichlor. A web-based application designed to simulate the free chlorine in systems adding free chlorine and cyanuric acid, including the application of Dichlor and Trichlor.
Design Considerations in Developing a Web-Based Mentor Network.
ERIC Educational Resources Information Center
Sumner, Todd
This paper describes a Web-based mentor network designed to pair students in rural independent schools with undergraduates at selected liberal arts colleges. It is one of nine central program elements that constitute the Proteus(TM) system, a multimedia technologies architecture that supports distributed collaborations and work undertaken in the…
Search Interface Design Using Faceted Indexing for Web Resources.
ERIC Educational Resources Information Center
Devadason, Francis; Intaraksa, Neelawat; Patamawongjariya, Pornprapa; Desai, Kavita
2001-01-01
Describes an experimental system designed to organize and provide access to Web documents using a faceted pre-coordinate indexing system based on the Deep Structure Indexing System (DSIS) derived from POPSI (Postulate based Permuted Subject Indexing) of Bhattacharyya, and the facet analysis and chain indexing system of Ranganathan. (AEF)
Motivation Mining: Prospecting the Web.
ERIC Educational Resources Information Center
Small, Ruth V.; Arnone, Marilyn P.
1999-01-01
Describes WebMAC instruments, which differ from other Web-evaluation instruments because they have a theoretical base, are user-centered, are designed for students in grades 7 through 12, and assess the motivational quality of Web sites. Examples are given of uses of WebMAC Middle and WebMAC Senior in activities to promote evaluation and…
Provenance-Based Approaches to Semantic Web Service Discovery and Usage
ERIC Educational Resources Information Center
Narock, Thomas William
2012-01-01
The World Wide Web Consortium defines a Web Service as "a software system designed to support interoperable machine-to-machine interaction over a network." Web Services have become increasingly important both within and across organizational boundaries. With the recent advent of the Semantic Web, web services have evolved into semantic…
Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R
2016-09-01
Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].
Self-Determination Theory and Web-Enhanced Course Template Development
ERIC Educational Resources Information Center
Bachman, Christine M.; Stewart, Cindy
2011-01-01
A theoretical approach to the design and implementation of a web-enhanced course template for Introduction to Psychology is reviewed. Links between psychological constructs and pedagogical principles of learning that are pertinent to a web-based course and the self-determination theory literature are discussed in relation to the design and…
Visual Design Principles Applied To World Wide Web Construction.
ERIC Educational Resources Information Center
Luck, Donald D.; Hunter, J. Mark
This paper describes basic types of World Wide Web pages and presents design criteria for page layout based on principles of visual literacy. Discussion focuses on pages that present information in the following styles: billboard; directory/index; textual; and graphics. Problems and solutions in Web page construction are explored according to…
2012-01-01
Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984
Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed
2012-08-10
Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Bielaszewska, Martina; Karch, Helge; Toth, Ian K.
2012-01-01
Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820
Beam shaping for laser initiated optical primers
NASA Astrophysics Data System (ADS)
Lizotte, Todd E.
2008-08-01
Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.
Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.
Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia
2018-06-01
Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.
Genome-Wide Identification and Transferability of Microsatellite Markers between Palmae Species
Xiao, Yong; Xia, Wei; Ma, Jianwei; Mason, Annaliese S.; Fan, Haikuo; Shi, Peng; Lei, Xintao; Ma, Zilong; Peng, Ming
2016-01-01
The Palmae family contains 202 genera and approximately 2800 species. Except for Elaeis guineensis and Phoenix dactylifera, almost no genetic and genomic information is available for Palmae species. Therefore, this is an obstacle to the conservation and genetic assessment of Palmae species, especially those that are currently endangered. The study was performed to develop a large number of microsatellite markers which can be used for genetic analysis in different Palmae species. Based on the assembled genome of E. guineensis and P. dactylifera, a total of 814 383 and 371 629 microsatellites were identified. Among these microsatellites identified in E. guineensis, 734 509 primer pairs could be designed from the flanking sequences of these microsatellites. The majority (618 762) of these designed primer pairs had in silico products in the genome of E. guineensis. These 618 762 primer pairs were subsequently used to in silico amplify the genome of P. dactylifera. A total of 7 265 conserved microsatellites were identified between E. guineensis and P. dactylifera. One hundred and thirty-five primer pairs flanking the conserved SSRs were stochastically selected and validated to have high cross-genera transferability, varying from 16.7 to 93.3% with an average of 73.7%. These genome-wide conserved microsatellite markers will provide a useful tool for genetic assessment and conservation of different Palmae species in the future. PMID:27826307
Molecular Diagnostic for Prospecting Polyhydroxyalkanoate-Producing Bacteria.
Montenegro, Eduarda Morgana da Silva; Delabary, Gabriela Scholante; Silva, Marcus Adonai Castro da; Andreote, Fernando Dini; Lima, André Oliveira de Souza
2017-05-25
The use of molecular diagnostic techniques for bioprospecting and microbial diversity study purposes has gained more attention thanks to their functionality, low cost and quick results. In this context, ten degenerate primers were designed for the amplification of polyhydroxyalkanoate synthase ( phaC ) gene, which is involved in the production of polyhydroxyalkanoate (PHA)-a biodegradable, renewable biopolymer. Primers were designed based on multiple alignments of phaC gene sequences from 218 species that have their genomes already analyzed and deposited at Biocyc databank. The combination of oligos phaCF3/phaCR1 allowed the amplification of the expected product (PHA synthases families types I and IV) from reference organisms used as positive control (PHA producer). The method was also tested in a multiplex system with two combinations of initiators, using 16 colonies of marine bacteria (pre-characterized for PHA production) as a DNA template. All amplicon positive organisms ( n = 9) were also PHA producers, thus no false positives were observed. Amplified DNA was sequenced ( n = 4), allowing for the confirmation of the pha C gene identity as well its diversity among marine bacteria. Primers were also tested for screening purposes using 37 colonies from six different environments. Almost 30% of the organisms presented the target amplicon. Thus, the proposed primers are an efficient tool for screening bacteria with potential for the production of PHA as well to study PHA genetic diversity.
Molecular Diagnostic for Prospecting Polyhydroxyalkanoate-Producing Bacteria
Montenegro, Eduarda Morgana da Silva; Delabary, Gabriela Scholante; da Silva, Marcus Adonai Castro; Andreote, Fernando Dini; Lima, André Oliveira de Souza
2017-01-01
The use of molecular diagnostic techniques for bioprospecting and microbial diversity study purposes has gained more attention thanks to their functionality, low cost and quick results. In this context, ten degenerate primers were designed for the amplification of polyhydroxyalkanoate synthase (phaC) gene, which is involved in the production of polyhydroxyalkanoate (PHA)—a biodegradable, renewable biopolymer. Primers were designed based on multiple alignments of phaC gene sequences from 218 species that have their genomes already analyzed and deposited at Biocyc databank. The combination of oligos phaCF3/phaCR1 allowed the amplification of the expected product (PHA synthases families types I and IV) from reference organisms used as positive control (PHA producer). The method was also tested in a multiplex system with two combinations of initiators, using 16 colonies of marine bacteria (pre-characterized for PHA production) as a DNA template. All amplicon positive organisms (n = 9) were also PHA producers, thus no false positives were observed. Amplified DNA was sequenced (n = 4), allowing for the confirmation of the phaC gene identity as well its diversity among marine bacteria. Primers were also tested for screening purposes using 37 colonies from six different environments. Almost 30% of the organisms presented the target amplicon. Thus, the proposed primers are an efficient tool for screening bacteria with potential for the production of PHA as well to study PHA genetic diversity. PMID:28952531
Wang, Zhihui; Kiryu, Tohru
2006-04-01
Since machine-based exercise still uses local facilities, it is affected by time and place. We designed a web-based system architecture based on the Java 2 Enterprise Edition that can accomplish continuously supported machine-based exercise. In this system, exercise programs and machines are loosely coupled and dynamically integrated on the site of exercise via the Internet. We then extended the conventional health promotion model, which contains three types of players (users, exercise trainers, and manufacturers), by adding a new player: exercise program creators. Moreover, we developed a self-describing strategy to accommodate a variety of exercise programs and provide ease of use to users on the web. We illustrate our novel design with examples taken from our feasibility study on a web-based cycle ergometer exercise system. A biosignal-based workload control approach was introduced to ensure that users performed appropriate exercise alone.
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
ERIC Educational Resources Information Center
Mackey, Thomas P.; Ho, Jinwon
2008-01-01
The purpose of this case study is to better understand the relationships between Web usability and students' perceived learning in the design and implementation of Web-based multimedia (WBMM) tutorials in blended courses. Much of the current research in this area focuses on the use of multimedia as a replacement for classroom instruction rather…
A multiplex primer design algorithm for target amplification of continuous genomic regions.
Ozturk, Ahmet Rasit; Can, Tolga
2017-06-19
Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.
Development of Continuing Nursing Education Offerings for the World Wide Web.
ERIC Educational Resources Information Center
Billings, Diane M.; Rowles, Connie J.
2001-01-01
Describes steps for web-based continuing education courses in terms of planning (strategic plan, website development, resource team, marketing plan), implementing (course design, web-based tools, copyright and intellectual property), and evaluating (pilot test, formative/summative evaluation, continuous quality improvement). (Contains 16…
WebCN: A web-based computation tool for in situ-produced cosmogenic nuclides
NASA Astrophysics Data System (ADS)
Ma, Xiuzeng; Li, Yingkui; Bourgeois, Mike; Caffee, Marc; Elmore, David; Granger, Darryl; Muzikar, Paul; Smith, Preston
2007-06-01
Cosmogenic nuclide techniques are increasingly being utilized in geoscience research. For this it is critical to establish an effective, easily accessible and well defined tool for cosmogenic nuclide computations. We have been developing a web-based tool (WebCN) to calculate surface exposure ages and erosion rates based on the nuclide concentrations measured by the accelerator mass spectrometry. WebCN for 10Be and 26Al has been finished and published at http://www.physics.purdue.edu/primelab/for_users/rockage.html. WebCN for 36Cl is under construction. WebCN is designed as a three-tier client/server model and uses the open source PostgreSQL for the database management and PHP for the interface design and calculations. On the client side, an internet browser and Microsoft Access are used as application interfaces to access the system. Open Database Connectivity is used to link PostgreSQL and Microsoft Access. WebCN accounts for both spatial and temporal distributions of the cosmic ray flux to calculate the production rates of in situ-produced cosmogenic nuclides at the Earth's surface.
Hoffman, Aubri S; Llewellyn-Thomas, Hilary A; Tosteson, Anna N A; O'Connor, Annette M; Volk, Robert J; Tomek, Ivan M; Andrews, Steven B; Bartels, Stephen J
2014-12-12
Over 100 trials show that patient decision aids effectively improve patients' information comprehension and values-based decision making. However, gaps remain in our understanding of several fundamental and applied questions, particularly related to the design of interactive, personalized decision aids. This paper describes an interdisciplinary development process for, and early field testing of, a web-based patient decision support research platform, or virtual decision lab, to address these questions. An interdisciplinary stakeholder panel designed the web-based research platform with three components: a) an introduction to shared decision making, b) a web-based patient decision aid, and c) interactive data collection items. Iterative focus groups provided feedback on paper drafts and online prototypes. A field test assessed a) feasibility for using the research platform, in terms of recruitment, usage, and acceptability; and b) feasibility of using the web-based decision aid component, compared to performance of a videobooklet decision aid in clinical care. This interdisciplinary, theory-based, patient-centered design approach produced a prototype for field-testing in six months. Participants (n = 126) reported that: the decision aid component was easy to use (98%), information was clear (90%), the length was appropriate (100%), it was appropriately detailed (90%), and it held their interest (97%). They spent a mean of 36 minutes using the decision aid and 100% preferred using their home/library computer. Participants scored a mean of 75% correct on the Decision Quality, Knowledge Subscale, and 74 out of 100 on the Preparation for Decision Making Scale. Completing the web-based decision aid reduced mean Decisional Conflict scores from 31.1 to 19.5 (p < 0.01). Combining decision science and health informatics approaches facilitated rapid development of a web-based patient decision support research platform that was feasible for use in research studies in terms of recruitment, acceptability, and usage. Within this platform, the web-based decision aid component performed comparably with the videobooklet decision aid used in clinical practice. Future studies may use this interactive research platform to study patients' decision making processes in real-time, explore interdisciplinary approaches to designing web-based decision aids, and test strategies for tailoring decision support to meet patients' needs and preferences.
Ludovici, Alessandro; Calveras, Anna
2015-01-01
In this paper, we present the design of a Constrained Application Protocol (CoAP) proxy able to interconnect Web applications based on Hypertext Transfer Protocol (HTTP) and WebSocket with CoAP based Wireless Sensor Networks. Sensor networks are commonly used to monitor and control physical objects or environments. Smart Cities represent applications of such a nature. Wireless Sensor Networks gather data from their surroundings and send them to a remote application. This data flow may be short or long lived. The traditional HTTP long-polling used by Web applications may not be adequate in long-term communications. To overcome this problem, we include the WebSocket protocol in the design of the CoAP proxy. We evaluate the performance of the CoAP proxy in terms of latency and memory consumption. The tests consider long and short-lived communications. In both cases, we evaluate the performance obtained by the CoAP proxy according to the use of WebSocket and HTTP long-polling. PMID:25585107
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Atreja, Ashish; Mehta, Neil B; Jain, Anil K; Harris, CM; Ishwaran, Hemant; Avital, Michel; Fishleder, Andrew J
2008-01-01
Background Healthcare institutions spend enormous time and effort to train their workforce. Web-based training can potentially streamline this process. However the deployment of web-based training in a large-scale setting with a diverse healthcare workforce has not been evaluated. The aim of this study was to evaluate the satisfaction of healthcare professionals with web-based training and to determine the predictors of such satisfaction including age, education status and computer proficiency. Methods Observational, cross-sectional survey of healthcare professionals from six hospital systems in an integrated delivery network. We measured overall satisfaction to web-based training and response to survey items measuring Website Usability, Course Usefulness, Instructional Design Effectiveness, Computer Proficiency and Self-learning Attitude. Results A total of 17,891 healthcare professionals completed the web-based training on HIPAA Privacy Rule; and of these, 13,537 completed the survey (response rate 75.6%). Overall course satisfaction was good (median, 4; scale, 1 to 5) with more than 75% of the respondents satisfied with the training (rating 4 or 5) and 65% preferring web-based training over traditional instructor-led training (rating 4 or 5). Multivariable ordinal regression revealed 3 key predictors of satisfaction with web-based training: Instructional Design Effectiveness, Website Usability and Course Usefulness. Demographic predictors such as gender, age and education did not have an effect on satisfaction. Conclusion The study shows that web-based training when tailored to learners' background, is perceived as a satisfactory mode of learning by an interdisciplinary group of healthcare professionals, irrespective of age, education level or prior computer experience. Future studies should aim to measure the long-term outcomes of web-based training. PMID:18922178
Gamification and Adherence to Web-Based Mental Health Interventions: A Systematic Review.
Brown, Menna; O'Neill, Noelle; van Woerden, Hugo; Eslambolchilar, Parisa; Jones, Matt; John, Ann
2016-08-24
Adherence to effective Web-based interventions for common mental disorders (CMDs) and well-being remains a critical issue, with clear potential to increase effectiveness. Continued identification and examination of "active" technological components within Web-based interventions has been called for. Gamification is the use of game design elements and features in nongame contexts. Health and lifestyle interventions have implemented a variety of game features in their design in an effort to encourage engagement and increase program adherence. The potential influence of gamification on program adherence has not been examined in the context of Web-based interventions designed to manage CMDs and well-being. This study seeks to review the literature to examine whether gaming features predict or influence reported rates of program adherence in Web-based interventions designed to manage CMDs and well-being. A systematic review was conducted of peer-reviewed randomized controlled trials (RCTs) designed to manage CMDs or well-being and incorporated gamification features. Seven electronic databases were searched. A total of 61 RCTs met the inclusion criteria and 47 different intervention programs were identified. The majority were designed to manage depression using cognitive behavioral therapy. Eight of 10 popular gamification features reviewed were in use. The majority of studies utilized only one gamification feature (n=58) with a maximum of three features. The most commonly used feature was story/theme. Levels and game leaders were not used in this context. No studies explicitly examined the role of gamification features on program adherence. Usage data were not commonly reported. Interventions intended to be 10 weeks in duration had higher mean adherence than those intended to be 6 or 8 weeks in duration. Gamification features have been incorporated into the design of interventions designed to treat CMD and well-being. Further research is needed to improve understanding of gamification features on adherence and engagement in order to inform the design of future Web-based health interventions in which adherence to treatment is of concern. Conclusions were limited by varied reporting of adherence and usage data.
Gamification and Adherence to Web-Based Mental Health Interventions: A Systematic Review
O'Neill, Noelle; van Woerden, Hugo; Eslambolchilar, Parisa; Jones, Matt; John, Ann
2016-01-01
Background Adherence to effective Web-based interventions for common mental disorders (CMDs) and well-being remains a critical issue, with clear potential to increase effectiveness. Continued identification and examination of “active” technological components within Web-based interventions has been called for. Gamification is the use of game design elements and features in nongame contexts. Health and lifestyle interventions have implemented a variety of game features in their design in an effort to encourage engagement and increase program adherence. The potential influence of gamification on program adherence has not been examined in the context of Web-based interventions designed to manage CMDs and well-being. Objective This study seeks to review the literature to examine whether gaming features predict or influence reported rates of program adherence in Web-based interventions designed to manage CMDs and well-being. Methods A systematic review was conducted of peer-reviewed randomized controlled trials (RCTs) designed to manage CMDs or well-being and incorporated gamification features. Seven electronic databases were searched. Results A total of 61 RCTs met the inclusion criteria and 47 different intervention programs were identified. The majority were designed to manage depression using cognitive behavioral therapy. Eight of 10 popular gamification features reviewed were in use. The majority of studies utilized only one gamification feature (n=58) with a maximum of three features. The most commonly used feature was story/theme. Levels and game leaders were not used in this context. No studies explicitly examined the role of gamification features on program adherence. Usage data were not commonly reported. Interventions intended to be 10 weeks in duration had higher mean adherence than those intended to be 6 or 8 weeks in duration. Conclusions Gamification features have been incorporated into the design of interventions designed to treat CMD and well-being. Further research is needed to improve understanding of gamification features on adherence and engagement in order to inform the design of future Web-based health interventions in which adherence to treatment is of concern. Conclusions were limited by varied reporting of adherence and usage data. PMID:27558893
Staudacher, Karin; Jonsson, Mattias; Traugott, Michael
Successful biological control of agricultural pests is dependent on a thorough understanding of the underlying trophic interactions between predators and prey. Studying trophic interactions can be challenging, particularly when generalist predators that frequently use multiple prey and interact with both pest and alternative prey are considered. In this context, diagnostic PCR proved to be a suitable approach, however at present, prey-specific PCR primers necessary for assessing such interactions across trophic levels are missing. Here we present a new set of 45 primers designed to target a wide range of invertebrate taxa common to temperate cereal crops: cereal aphids, their natural enemies such as carabid beetles, ladybeetles, lacewings, and spiders, and potential alternative prey groups (earthworms, springtails, and dipterans). These primers were combined in three 'ready to use' multiplex PCR assays for quick and cost-effective analyses of large numbers of predator samples. The assays were tested on 560 carabids collected in barley fields in Sweden. Results from this screening suggest that aphids constitute a major food source for carabids in cereal crops (overall DNA detection rate: 51 %), whereas alternative extraguild and intraguild prey appear to be less frequently preyed upon when aphids are present (11 % for springtails and 12 % for earthworms; 1 % for spiders and 4 % for carabids). In summary, the newly developed molecular assays proved reliable and effective in assessing previously cryptic predator-prey trophic interactions, specifically with focus on biological control of aphids. The diagnostic PCR assays will be applicable manifold as the targeted invertebrates are common to many agricultural systems of the temperate region.
The Impact of Web-Based Assessment and Practice on Students' Mathematics Learning Attitudes
ERIC Educational Resources Information Center
Nguyen, Diem M.; Hsieh, Yi-Chuan; Allen, G. Donald
2006-01-01
This study investigates the effects of web-based assessment and practice on improving middle school students' mathematics learning attitudes. With the use of an experimental design and a combination of quantitative and qualitative methods, the study compared and contrasted the attitude achievement of students, who used the web-based assessment and…
ERIC Educational Resources Information Center
Shin, Suhkyung; Brush, Thomas A.; Glazewski, Krista D.
2017-01-01
This study explores how web-based scaffolding tools provide instructional support while implementing a socio-scientific inquiry (SSI) unit in a science classroom. This case study focused on how students used web-based scaffolding tools during SSI activities, and how students perceived the SSI unit and the scaffolding tools embedded in the SSI…
ERIC Educational Resources Information Center
Hall, Richard, Ed.
This proceedings of the Fifth International Conference on Web-Based Learning, NAWeb 99, includes the following papers: "Coordinating Different Masters and Customers: Dalhousie's Diploma in Disability Management Program"; "The Design, Development, Implementation, and Evaluation of a Graduate Level Course for Teaching Web-Based Instruction";…
The Effect of Web-Based Portfolio Use on Academic Achievement and Retention
ERIC Educational Resources Information Center
Guzeller, Cem Oktay
2012-01-01
The web-based portfolio emerged as a result of the influence of technological developments on educational practices. In this study, the effect of the web-based portfolio building process on academic achievement and retention is explored. For this purpose, a study platform known as a computer-assisted personal development portfolio was designed for…
Web-Based OPACs in Indian Academic Libraries: A Functional Comparison
ERIC Educational Resources Information Center
Kapoor, Kanta; Goyal, O. P.
2007-01-01
Purpose: The paper seeks to provide a comparative analysis of the functionality of five web-based OPACs available in Indian academic libraries. Design/methodology/approach: Same-topic searches were carried out by three researchers on the web-based OPACs of Libsys, VTLS's iPortal, NewGenLib, Troodon, and Alice for Windows, implemented in five…
NASA Technical Reports Server (NTRS)
Laakso, J. H.; Zimmerman, D. K.
1972-01-01
An advanced composite shear web design concept was developed for the Space Shuttle orbiter main engine thrust beam structure. Various web concepts were synthesized by a computer-aided adaptive random search procedure. A practical concept is identified having a titanium-clad + or - 45 deg boron/epoxy web plate with vertical boron/epoxy reinforced aluminum stiffeners. The boron-epoxy laminate contributes to the strength and stiffness efficiency of the basic web section. The titanium-cladding functions to protect the polymeric laminate parts from damaging environments and is chem-milled to provide reinforcement in selected areas. Detailed design drawings are presented for both boron/epoxy reinforced and all-metal shear webs. The weight saving offered is 24% relative to all-metal construction at an attractive cost per pound of weight saved, based on the detailed designs. Small scale element tests substantiate the boron/epoxy reinforced design details in critical areas. The results show that the titanium-cladding reliably reinforces the web laminate in critical edge load transfer and stiffener fastener hole areas.
Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti
Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig
2016-01-01
Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115
Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J
2017-08-01
Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.
NASA Astrophysics Data System (ADS)
Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo
2014-05-01
The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.
Smart Caching Based on Mobile Agent of Power WebGIS Platform
Wang, Xiaohui; Wu, Kehe; Chen, Fei
2013-01-01
Power information construction is developing towards intensive, platform, distributed direction with the expansion of power grid and improvement of information technology. In order to meet the trend, power WebGIS was designed and developed. In this paper, we first discuss the architecture and functionality of power WebGIS, and then we study caching technology in detail, which contains dynamic display cache model, caching structure based on mobile agent, and cache data model. We have designed experiments of different data capacity to contrast performance between WebGIS with the proposed caching model and traditional WebGIS. The experimental results showed that, with the same hardware environment, the response time of WebGIS with and without caching model increased as data capacity growing, while the larger the data was, the higher the performance of WebGIS with proposed caching model improved. PMID:24288504
Towards Web Service-Based Educational Systems
ERIC Educational Resources Information Center
Sampson, Demetrios G.
2005-01-01
The need for designing the next generation of web service-based educational systems with the ability of integrating components from different tools and platforms is now recognised as the major challenge in advanced learning technologies. In this paper, we discuss this issue and we present the conceptual design of such environment, referred to as…
Course Management Systems: Time for Users to Get What They Need
ERIC Educational Resources Information Center
Ioannou, Andri; Hannafin, Robert D.
2008-01-01
Course management systems (CMSs) are software systems designed to manage course content and course activities. These tools integrate technological and pedagogical features into a web-based system that allows instructors, even those who are unfamiliar with web-based technologies, to design, deliver, and manage an online course. However, CMSs have…
Using Web-Based Practice to Enhance Mathematics Learning and Achievement
ERIC Educational Resources Information Center
Nguyen, Diem M.; Kulm, Gerald
2005-01-01
This article describes 1) the special features and accessibility of an innovative web-based practice instrument (WebMA) designed with randomized short-answer, matching and multiple choice items incorporated with automatically adapted feedback for middle school students; and 2) an exploratory study that compares the effects and contributions of…
Web-Based Instruction (WBI): An Introduction.
ERIC Educational Resources Information Center
Khan, Badrul H.
1998-01-01
Advances in information technology, coupled with changes in society, are creating new paradigms for education. The Web, as a medium of learning and instruction, has the potential to support the creation of well-designed resources. A table of features and components associated with Web-based instruction learning environments is provided.…
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
The Design of Modular Web-Based Collaboration
NASA Astrophysics Data System (ADS)
Intapong, Ploypailin; Settapat, Sittapong; Kaewkamnerdpong, Boonserm; Achalakul, Tiranee
Online collaborative systems are popular communication channels as the systems allow people from various disciplines to interact and collaborate with ease. The systems provide communication tools and services that can be integrated on the web; consequently, the systems are more convenient to use and easier to install. Nevertheless, most of the currently available systems are designed according to some specific requirements and cannot be straightforwardly integrated into various applications. This paper provides the design of a new collaborative platform, which is component-based and re-configurable. The platform is called the Modular Web-based Collaboration (MWC). MWC shares the same concept as computer supported collaborative work (CSCW) and computer-supported collaborative learning (CSCL), but it provides configurable tools for online collaboration. Each tool module can be integrated into users' web applications freely and easily. This makes collaborative system flexible, adaptable and suitable for online collaboration.
Bae, Jeongyee
2013-04-01
The purpose of this project was to develop an international web-based expert system using principals of artificial intelligence and user-centered design for management of mental health by Korean emigrants. Using this system, anyone can access the system via computer access to the web. Our design process utilized principles of user-centered design with 4 phases: needs assessment, analysis, design/development/testing, and application release. A survey was done with 3,235 Korean emigrants. Focus group interviews were also conducted. Survey and analysis results guided the design of the web-based expert system. With this system, anyone can check their mental health status by themselves using a personal computer. The system analyzes facts based on answers to automated questions, and suggests solutions accordingly. A history tracking mechanism enables monitoring and future analysis. In addition, this system will include intervention programs to promote mental health status. This system is interactive and accessible to anyone in the world. It is expected that this management system will contribute to Korean emigrants' mental health promotion and allow researchers and professionals to share information on mental health.
Walsh, Jane C; Groarke, AnnMarie; Moss-Morris, Rona; Morrissey, Eimear; McGuire, Brian E
2017-01-01
Background Cancer-related fatigue (CrF) is the most common and disruptive symptom experienced by cancer survivors. We aimed to develop a theory-based, interactive Web-based intervention designed to facilitate self-management and enhance coping with CrF following cancer treatment. Objective The aim of our study was to outline the rationale, decision-making processes, methods, and findings which led to the development of a Web-based intervention to be tested in a feasibility trial. This paper outlines the process and method of development of the intervention. Methods An extensive review of the literature and qualitative research was conducted to establish a therapeutic approach for this intervention, based on theory. The psychological principles used in the development process are outlined, and we also clarify hypothesized causal mechanisms. We describe decision-making processes involved in the development of the content of the intervention, input from the target patient group and stakeholders, the design of the website features, and the initial user testing of the website. Results The cocreation of the intervention with the experts and service users allowed the design team to ensure that an acceptable intervention was developed. This evidence-based Web-based program is the first intervention of its kind based on self-regulation model theory, with the primary aim of targeting the representations of fatigue and enhancing self-management of CrF, specifically. Conclusions This research sought to integrate psychological theory, existing evidence of effective interventions, empirically derived principles of Web design, and the views of potential users into the systematic planning and design of the intervention of an easy-to-use website for cancer survivors. PMID:28676465
Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C
2018-06-04
DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.
Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel
2013-01-01
A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333
Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel
2013-01-01
A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.
[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].
Chen, Suiqing; Lu, Xiaolei; Wang, Lili
2011-05-01
To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.
Quality evaluation on an e-learning system in continuing professional education of nurses.
Lin, I-Chun; Chien, Yu-Mei; Chang, I-Chiu
2006-01-01
Maintaining high quality in Web-based learning is a powerful means of increasing the overall efficiency and effectiveness of distance learning. Many studies have evaluated Web-based learning but seldom evaluate from the information systems (IS) perspective. This study applied the famous IS Success model in measuring the quality of a Web-based learning system using a Web-based questionnaire for data collection. One hundred and fifty four nurses participated in the survey. Based on confirmatory factor analysis, the variables of the research model fit for measuring the quality of a Web-based learning system. As Web-based education continues to grow worldwide, the results of this study may assist the system adopter (hospital executives), the learner (nurses), and the system designers in making reasonable and informed judgments with regard to the quality of Web-based learning system in continuing professional education.
NASA Astrophysics Data System (ADS)
Bos, Nathan Daniel
This dissertation investigates the emerging affordance of the World Wide Web as a place for high school students to become authors and publishers of information. Two empirical studies lay groundwork for student publishing by examining learning issues related to audience adaptation in writing, motivation and engagement with hypermedia, design, problem-solving, and critical evaluation. Two models of student publishing on the World Wide Web were investigated over the course of two 11spth grade project-based science curriculums. In the first curricular model, students worked in pairs to design informative hypermedia projects about infectious diseases that were published on the Web. Four case studies were written, drawing on both product- and process-related data sources. Four theoretically important findings are illustrated through these cases: (1) multimedia, especially graphics, seemed to catalyze some students' design processes by affecting the sequence of their design process and by providing a connection between the science content and their personal interest areas, (2) hypermedia design can demand high levels of analysis and synthesis of science content, (3) students can learn to think about science content representation through engagement with challenging design tasks, and (4) students' consideration of an outside audience can be facilitated by teacher-given design principles. The second Web-publishing model examines how students critically evaluate scientific resources on the Web, and how students can contribute to the Web's organization and usability by publishing critical reviews. Students critically evaluated Web resources using a four-part scheme: summarization of content, content, evaluation of credibility, evaluation of organizational structure, and evaluation of appearance. Content analyses comparing students' reviews and reviewed Web documents showed that students were proficient at summarizing content of Web documents, identifying their publishing source, and evaluating their organizational features; however, students struggled to identify scientific evidence, bias, or sophisticated use of media in Web pages. Shortcomings were shown to be partly due to deficiencies in the Web pages themselves and partly due to students' inexperience with the medium or lack of critical evaluation skills. Future directions of this idea are discussed, including discussion of how students' reviews have been integrated into a current digital library development project.
Molecular Tools for the Detection of Nitrogen Cycling Archaea
Rusch, Antje
2013-01-01
Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509
Open-Source web-based geographical information system for health exposure assessment
2012-01-01
This paper presents the design and development of an open source web-based Geographical Information System allowing users to visualise, customise and interact with spatial data within their web browser. The developed application shows that by using solely Open Source software it was possible to develop a customisable web based GIS application that provides functions necessary to convey health and environmental data to experts and non-experts alike without the requirement of proprietary software. PMID:22233606
Perceptions of Business Students' Feature Requirements in Educational Web Sites
ERIC Educational Resources Information Center
Hazari, Sunil; Johnson, Barbara
2007-01-01
There is paucity of original research that explains phenomena related to content organization and site design of educational Web sites. Educational Web sites are often used to provide Web-based instruction, which itself is a relatively recent phenomenon for business schools, and additional research is needed in this area. Educational Web sites are…
ERIC Educational Resources Information Center
Schubert, Sandra; Zelinsky, Benjamin
Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…
Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN
Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger
2016-01-01
Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
1998-01-01
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
2005-04-19
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Hoffmann, Robert; Houben, Robin; Krause, Laura; Kamtsiuris, Panagiotis; Gößwald, Antje
2018-01-01
Background The implementation of an Internet option in an existing public health interview survey using a mixed-mode design is attractive because of lower costs and faster data availability. Additionally, mixed-mode surveys can increase response rates and improve sample composition. However, mixed-mode designs can increase the risk of measurement error (mode effects). Objective This study aimed to determine whether the prevalence rates or mean values of self- and parent-reported health indicators for children and adolescents aged 0-17 years differ between self-administered paper-based questionnaires (SAQ-paper) and self-administered Web-based questionnaires (SAQ-Web), as well as between a single-mode control group and different mixed-mode groups. Methods Data were collected for a methodological pilot of the third wave of the "German Health Interview and Examination Survey for Children and Adolescents". Questionnaires were completed by parents or adolescents. A population-based sample of 11,140 children and adolescents aged 0-17 years was randomly allocated to 4 survey designs—a single-mode control group with paper-and-pencil questionnaires only (n=970 parents, n=343 adolescents)—and 3 mixed-mode designs, all of which offered Web-based questionnaire options. In the concurrent mixed-mode design, both questionnaires were offered at the same time (n=946 parents, n=290 adolescents); in the sequential mixed-mode design, the SAQ-Web was sent first, followed by the paper questionnaire along with a reminder (n=854 parents, n=269 adolescents); and in the preselect mixed-mode design, both options were offered and the respondents were asked to request the desired type of questionnaire (n=698 parents, n=292 adolescents). In total, 3468 questionnaires of parents of children aged 0-17 years (SAQ-Web: n=708; SAQ-paper: n=2760) and 1194 questionnaires of adolescents aged 11-17 years (SAQ-Web: n=299; SAQ-paper: n=895) were analyzed. Sociodemographic characteristics and a broad range of health indicators for children and adolescents were compared by survey design and data collection mode by calculating predictive margins from regression models. Results There were no statistically significant differences in sociodemographic characteristics or health indicators between the single-mode control group and any of the mixed-mode survey designs. Differences in sociodemographic characteristics between SAQ-Web and SAQ-paper were found. Web respondents were more likely to be male, have higher levels of education, and higher household income compared with paper respondents. After adjusting for sociodemographic characteristics, only one of the 38 analyzed health indicators showed different prevalence rates between the data collection modes, with a higher prevalence rate for lifetime alcohol consumption among the online-responding adolescents (P<.001). Conclusions These results suggest that mode bias is limited in health interview surveys for children and adolescents using a mixed-mode design with Web-based and paper questionnaires. PMID:29506967
ERIC Educational Resources Information Center
Kurtulus, Aytac
2013-01-01
The aim of this study was to investigate the effects of web-based interactive virtual tours on the development of prospective mathematics teachers' spatial skills. The study was designed based on experimental method. The "one-group pre-test post-test design" of this method was taken as the research model. The study was conducted with 3rd year…
ERIC Educational Resources Information Center
Roehl, Amy
2013-01-01
This study utilizes web-based video as a strategy to transfer knowledge about the interior design industry in a format that interests the current generation of students. The model of instruction developed is based upon online video as an engaging, economical, and time-saving alternative to a field trip, guest speaker, or video teleconference.…
ERIC Educational Resources Information Center
Rappolt-Schlichtmann, Gabrielle; Daley, Samantha G.; Lim, Seoin; Lapinski, Scott; Robinson, Kristin H.; Johnson, Mindy
2013-01-01
Science notebooks can play a critical role in activity-based science learning, but the tasks of recording, organizing, analyzing, and interpreting data create barriers that impede science learning for many students. This study (a) assessed in a randomized controlled trial the potential for a web-based science notebook designed using the Universal…
USDA-ARS?s Scientific Manuscript database
Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...
ERIC Educational Resources Information Center
Bodily, Robert; Wood, Steven
2017-01-01
This paper presents the technical infrastructure required to track student use of web-based resources in an introductory chemistry course, the design of a student dashboard, and the results from analyzing student web-based resource use. Students were tracked as they interacted with online homework problems and high quality course content videos.…
Creating Effective Web-Based Learning Environments: Relevant Research and Practice
ERIC Educational Resources Information Center
Wijekumar, Kay
2005-01-01
Web-based learning environments are a great asset only if they are designed well and used as intended. The urgency to create courses in response to the growing demand for online learning has resulted in a hurried push to drop PowerPoint notes into Web-based course management systems (WBCMSs), devise an electronic quiz, put together a few…
ERIC Educational Resources Information Center
Tasocak, Gülsün; Kaya, Hülya; Senyuva, Emine; Isik, Burçin; Bodur, Gönül
2014-01-01
The study was designed as descriptive and cross-sectional to determine the relation between students' views about web-based Patient Education course and anxiety. The study group consisted of all students registered the web-based Patient Education course (N: 148) at 2010-2011 semester at a nursing school. Data were collected using "Information…
ERIC Educational Resources Information Center
Wang, K. H.; Wang, T. H.; Wang, W. L.; Huang, S. C.
2006-01-01
The purpose of this research was to investigate the effects of formative assessment and learning style on student achievement in a Web-based learning environment. A quasi-experimental research design was used. Participants were 455 seventh grade students from 12 classes of six junior high schools. A Web-based course, named BioCAL, combining three…
Gauging the Success of Your Web Site
ERIC Educational Resources Information Center
Goldsborough, Reid
2005-01-01
Web analytics is a way to measure and optimize Web site performance, says Jason Burby, director of Web analytics for ZAAZ Inc., a Web design and development firm in Seattle with a countrywide client base. He compares it to using Evite, which is a useful, free web service that makes it easy to send out party and other invitations and,…
Development and Evaluation of an Interactive WebQuest Environment: "Web Macerasi"
ERIC Educational Resources Information Center
Gulbahar, Yasemin; Madran, R. Orcun; Kalelioglu, Filiz
2010-01-01
This study was conducted to develop a web-based interactive system, Web Macerasi, for teaching-learning and evaluation purposes, and to find out the possible effects of this system. The study has two stages. In the first stage, a WebQuest site was designed as an interactive system in which various Internet and web technologies were used for…
XML-Based Visual Specification of Multidisciplinary Applications
NASA Technical Reports Server (NTRS)
Al-Theneyan, Ahmed; Jakatdar, Amol; Mehrotra, Piyush; Zubair, Mohammad
2001-01-01
The advancements in the Internet and Web technologies have fueled a growing interest in developing a web-based distributed computing environment. We have designed and developed Arcade, a web-based environment for designing, executing, monitoring, and controlling distributed heterogeneous applications, which is easy to use and access, portable, and provides support through all phases of the application development and execution. A major focus of the environment is the specification of heterogeneous, multidisciplinary applications. In this paper we focus on the visual and script-based specification interface of Arcade. The web/browser-based visual interface is designed to be intuitive to use and can also be used for visual monitoring during execution. The script specification is based on XML to: (1) make it portable across different frameworks, and (2) make the development of our tools easier by using the existing freely available XML parsers and editors. There is a one-to-one correspondence between the visual and script-based interfaces allowing users to go back and forth between the two. To support this we have developed translators that translate a script-based specification to a visual-based specification, and vice-versa. These translators are integrated with our tools and are transparent to users.
Workflows for microarray data processing in the Kepler environment.
Stropp, Thomas; McPhillips, Timothy; Ludäscher, Bertram; Bieda, Mark
2012-05-17
Microarray data analysis has been the subject of extensive and ongoing pipeline development due to its complexity, the availability of several options at each analysis step, and the development of new analysis demands, including integration with new data sources. Bioinformatics pipelines are usually custom built for different applications, making them typically difficult to modify, extend and repurpose. Scientific workflow systems are intended to address these issues by providing general-purpose frameworks in which to develop and execute such pipelines. The Kepler workflow environment is a well-established system under continual development that is employed in several areas of scientific research. Kepler provides a flexible graphical interface, featuring clear display of parameter values, for design and modification of workflows. It has capabilities for developing novel computational components in the R, Python, and Java programming languages, all of which are widely used for bioinformatics algorithm development, along with capabilities for invoking external applications and using web services. We developed a series of fully functional bioinformatics pipelines addressing common tasks in microarray processing in the Kepler workflow environment. These pipelines consist of a set of tools for GFF file processing of NimbleGen chromatin immunoprecipitation on microarray (ChIP-chip) datasets and more comprehensive workflows for Affymetrix gene expression microarray bioinformatics and basic primer design for PCR experiments, which are often used to validate microarray results. Although functional in themselves, these workflows can be easily customized, extended, or repurposed to match the needs of specific projects and are designed to be a toolkit and starting point for specific applications. These workflows illustrate a workflow programming paradigm focusing on local resources (programs and data) and therefore are close to traditional shell scripting or R/BioConductor scripting approaches to pipeline design. Finally, we suggest that microarray data processing task workflows may provide a basis for future example-based comparison of different workflow systems. We provide a set of tools and complete workflows for microarray data analysis in the Kepler environment, which has the advantages of offering graphical, clear display of conceptual steps and parameters and the ability to easily integrate other resources such as remote data and web services.
2005-01-01
The need to support bioinformatics training has been widely recognized by scientists, industry, and government institutions. However, the discussion of instructional methods for teaching bioinformatics is only beginning. Here we report on a systematic attempt to design two bioinformatics workshops for graduate biology students on the basis of Gagne's Conditions of Learning instructional design theory. This theory, although first published in the early 1970s, is still fundamental in instructional design and instructional technology. First, top-level as well as prerequisite learning objectives for a microarray analysis workshop and a primer design workshop were defined. Then a hierarchy of objectives for each workshop was created. Hands-on tutorials were designed to meet these objectives. Finally, events of learning proposed by Gagne's theory were incorporated into the hands-on tutorials. The resultant manuals were tested on a small number of trainees, revised, and applied in 1-day bioinformatics workshops. Based on this experience and on observations made during the workshops, we conclude that Gagne's Conditions of Learning instructional design theory provides a useful framework for developing bioinformatics training, but may not be optimal as a method for teaching it. PMID:16220141
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Web Survey Design in ASP.Net 2.0: A Simple Task with One Line of Code
ERIC Educational Resources Information Center
Liu, Chang
2007-01-01
Over the past few years, more and more companies have been investing in electronic commerce (EC) by designing and implementing Web-based applications. In the world of practice, the importance of using Web technology to reach individual customers has been presented by many researchers. This paper presents an easy way of conducting marketing…
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina
2013-02-01
Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.
Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao
2015-08-01
The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.
Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming
2012-01-01
Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780
ERIC Educational Resources Information Center
Ünal, Erhan; Çakir, Hasan
2017-01-01
The purpose of this study was to design a problem based collaborative learning environment supported by dynamic web technologies and to examine students' views about this learning environment. The study was designed as a qualitative research. Some 36 students who took an Object Oriented Programming I-II course at the department of computer…
Web-Based Designed Activities for Young People in Health Education: A Constructivist Approach
ERIC Educational Resources Information Center
Goldman, Juliette D. G.
2006-01-01
Modern Health Education in primary schools is increasingly using computer technologies in a variety of ways to enhance teaching and learning. Here, a Constructivist approach for a web-based educational activity for Grade 7 is discussed using an example of designing a healthy Food Handling Manual in the food industry. The Constructivist principles…
Learning How to Design a Technology Supported Inquiry-Based Learning Environment
ERIC Educational Resources Information Center
Hakverdi-Can, Meral; Sonmez, Duygu
2012-01-01
This paper describes a study focusing on pre-service teachers' experience of learning how to design a technology supported inquiry-based learning environment using the Internet. As part of their elective course, pre-service science teachers were asked to develop a WebQuest environment targeting middle school students. A WebQuest is an…
Evaluating CSL/CFL Website Usability: A User-Centered Design Approach
ERIC Educational Resources Information Center
Huang, Chung-Kai; Hsin, Ching-O; Chiu, Chiung-Hui
2010-01-01
With the widespread availability of Internet and computer technology, on-line web-based learning has become prevalent in the field of teaching Chinese as a second/foreign language (CSL/CFL). This study examined the concepts of usability and types of design elements that help construct an effective web-based learning environment, as well as their…
Towards an Intelligent Possibilistic Web Information Retrieval Using Multiagent System
ERIC Educational Resources Information Center
Elayeb, Bilel; Evrard, Fabrice; Zaghdoud, Montaceur; Ahmed, Mohamed Ben
2009-01-01
Purpose: The purpose of this paper is to make a scientific contribution to web information retrieval (IR). Design/methodology/approach: A multiagent system for web IR is proposed based on new technologies: Hierarchical Small-Worlds (HSW) and Possibilistic Networks (PN). This system is based on a possibilistic qualitative approach which extends the…
sTeam--Providing Primary Media Functions for Web-Based Computer-Supported Cooperative Learning.
ERIC Educational Resources Information Center
Hampel, Thorsten
The World Wide Web has developed as the de facto standard for computer based learning. However, as a server-centered approach, it confines readers and learners to passive nonsequential reading. Authoring and Web-publishing systems aim at supporting the authors' design process. Consequently, learners' activities are confined to selecting and…
Knowledge Base for Automatic Generation of Online IMS LD Compliant Course Structures
ERIC Educational Resources Information Center
Pacurar, Ecaterina Giacomini; Trigano, Philippe; Alupoaie, Sorin
2006-01-01
Our article presents a pedagogical scenarios-based web application that allows the automatic generation and development of pedagogical websites. These pedagogical scenarios are represented in the IMS Learning Design standard. Our application is a web portal helping teachers to dynamically generate web course structures, to edit pedagogical content…
Assessment of Web Content Accessibility Levels in Spanish Official Online Education Environments
ERIC Educational Resources Information Center
Roig-Vila, Rosabel; Ferrández, Sergio; Ferri-Miralles, Imma
2014-01-01
Diversity-based designing, or the goal of ensuring that web-based information is accessible to as many diverse users as possible, has received growing international acceptance in recent years, with many countries introducing legislation to enforce it. This paper analyses web content accessibility levels in Spanish education portals according to…
Trends in Culturally Relevant Interface Design Features for Latino Web Site Users
ERIC Educational Resources Information Center
Sachau, Lori L.; Hutchinson, Susan R.
2012-01-01
There is a lack of published research on designing Web-based instruction for the adult U.S. Latino population. Instructional designers need guidance on how to design culturally relevant learning environments for this audience, particularly for Latino people from Mexican heritage. The authors used content analysis to investigate the extent to which…
USDA-ARS?s Scientific Manuscript database
Botrytis cinerea, B. fabae and B. fabiopsis are known to cause chocolate spot on broad bean. This study was conducted to develop PCR-based assays to detect and differentiate this three species. Two sets of primers, Bc-f/Bc-r for B. cinerea and Bfab-f/Bfab-r for B. fabiopsis, were designed based on t...
Creating Patient and Family Education Web Sites
YADRICH, DONNA MACAN; FITZGERALD, SHARON A.; WERKOWITCH, MARILYN; SMITH, CAROL E.
2013-01-01
This article gives details about the methods and processes used to ensure that usability and accessibility were achieved during development of the Home Parenteral Nutrition Family Caregivers Web site, an evidence-based health education Web site for the family members and caregivers of chronically ill patients. This article addresses comprehensive definitions of usability and accessibility and illustrates Web site development according to Section 508 standards and the national Health and Human Services’ Research-Based Web Design and Usability Guidelines requirements. PMID:22024970
Engineering Analysis Using a Web-based Protocol
NASA Technical Reports Server (NTRS)
Schoeffler, James D.; Claus, Russell W.
2002-01-01
This paper reviews the development of a web-based framework for engineering analysis. A one-dimensional, high-speed analysis code called LAPIN was used in this study, but the approach can be generalized to any engineering analysis tool. The web-based framework enables users to store, retrieve, and execute an engineering analysis from a standard web-browser. We review the encapsulation of the engineering data into the eXtensible Markup Language (XML) and various design considerations in the storage and retrieval of application data.
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.
Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543
Toward a More Flexible Web-Based Framework for Multidisciplinary Design
NASA Technical Reports Server (NTRS)
Rogers, J. L.; Salas, A. O.
1999-01-01
In today's competitive environment, both industry and government agencies are under pressure to reduce the time and cost of multidisciplinary design projects. New tools have been introduced to assist in this process by facilitating the integration of and communication among diverse disciplinary codes. One such tool, a framework for multidisciplinary design, is defined as a hardware-software architecture that enables integration, execution, and communication among diverse disciplinary processes. An examination of current frameworks reveals weaknesses in various areas, such as sequencing, monitoring, controlling, and displaying the design process. The objective of this research is to explore how Web technology can improve these areas of weakness and lead toward a more flexible framework. This article describes a Web-based system that optimizes and controls the execution sequence of design processes in addition to monitoring the project status and displaying the design results.
Morrow, Jay B; Sepdham, Dan; Snell, Laura; Lindeman, Carolyn; Dobbie, Alison
2010-01-01
Web-based cases are well accepted by medical students and enable faculty to deliver equivalent educational experiences to all students. A 2009 literature search revealed no study investigating student use patterns of Web-based case libraries for self-directed learning. We investigated third-year students' use of a Web-based case program for self-directed learning in a family medicine clerkship. We analyzed Design A Case usage patterns of 210 medical students during academic year 2008--2009. We compared board score differences between these students and those from the previous 5 years who did not use Design A Case. We analyzed data from a 13-item survey, administered to a subgroup of 85 students, about the strengths, weaknesses, and acceptability of the program. Students completed, on average, four cases, which was beyond the requirement of three. They reported that the content was highly relevant to cases they saw in clinic. Almost 75% preferred the self-directed Web-based learning over didactics, and most (64%) felt they learned more electronically. Use of the cases was associated with equivalent Board scores versus didactic lectures. In our setting, self-directed learning using a Web-based case program was highly acceptable to students. Web-based cases may provide an option for family medicine educators who wish to deliver equivalent educational experiences across sites.
Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig
2008-03-01
Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids. © 2007 The Authors.
Sample Return Primer and Handbook
NASA Technical Reports Server (NTRS)
Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth;
2007-01-01
This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.
Design and Evaluation of an Open Web Platform Cartography Lab Curriculum
ERIC Educational Resources Information Center
Sack, Carl M.; Roth, Robert E.
2017-01-01
Recent shifts in web map technology away from proprietary software and toward development on the Open Web Platform have increased the number and complexity of technical skills needed to do cartography on the Web. Web-based cartography curricula likewise must be adapted to prepare geography, cartography, and GIS students with the skills needed to…
USDA-ARS?s Scientific Manuscript database
Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...
Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu
2017-08-01
Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.
Nomoto, R; Kagawa, H; Yoshida, T
2008-01-01
To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.
Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.
Doh, Eui Jeong; Oh, Seung-Eun
2012-01-01
Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.
Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid
2012-11-01
Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.
T-Cap Pull-Off and Bending Behavior for Stitched Structure
NASA Technical Reports Server (NTRS)
Lovejoy, Andrew E.; Leone, Frank A., Jr.
2016-01-01
The Pultruded Rod Stitched Efficient Unitized Structure (PRSEUS) is a structural concept that was developed by The Boeing Company to address the complex structural design aspects associated with a pressurized hybrid wing body aircraft configuration. An important design feature required for assembly is the integrally stitched T-cap, which provides connectivity of the corner (orthogonal) joint between adjacent panels. A series of tests were conducted on T-cap test articles, with and without a rod stiffener penetrating the T-cap web, under tension (pull-off) and bending loads. Three designs were tested, including the baseline design used in largescale test articles. The baseline had only the manufacturing stitch row adjacent to the fillet at the base of the T-cap web. Two new designs added stitching rows to the T-cap web at either 0.5- or 1.0-inch spacing along the height of the web. Testing was conducted at NASA Langley Research Center to determine the behavior of the T-cap region resulting from the applied loading. Results show that stitching arrests the initial delamination failures so that the maximum strength capability exceeds the load at which the initial delaminations develop. However, it was seen that the added web stitching had very little effect on the initial delamination failure load, but actually decreased the initial delamination failure load for tension loading of test articles without a stiffener passing through the web. Additionally, the added web stitching only increased the maximum load capability by between 1% and 12.5%. The presence of the stiffener, however, did increase the initial and maximum loads for both tension and bending loading as compared to the stringerless baseline design. Based on the results of the few samples tested, the additional stitching in the T-cap web showed little advantage over the baseline design in terms of structural failure at the T-cap web/skin junction for the current test articles.
Tension and Bending Testing of an Integral T-Cap for Stitched Composite Airframe Joints
NASA Technical Reports Server (NTRS)
Lovejoy, Andrew E.; Leone, Frank A., Jr.
2016-01-01
The Pultruded Rod Stitched Efficient Unitized Structure (PRSEUS) is a structural concept that was developed by The Boeing Company to address the complex structural design aspects associated with a pressurized hybrid wing body aircraft configuration. An important design feature required for assembly is the integrally stitched T-cap, which provides connectivity of the corner (orthogonal) joint between adjacent panels. A series of tests were conducted on T-cap test articles, with and without a rod stiffener penetrating the T-cap web, under tension (pull-off) and bending loads. Three designs were tested, including the baseline design used in large-scale test articles. The baseline had only the manufacturing stitch row adjacent to the fillet at the base of the T-cap web. Two new designs added stitching rows to the T-cap web at either 0.5- or 1.0-inch spacing along the height of the web. Testing was conducted at NASA Langley Research Center to determine the behavior of the T-cap region resulting from the applied loading. Results show that stitching arrests the initial delamination failures so that the maximum strength capability exceeds the load at which the initial delaminations develop. However, it was seen that the added web stitching had very little effect on the initial delamination failure load, but actually decreased the initial delamination failure load for tension loading of test articles without a stiffener passing through the web. Additionally, the added web stitching only increased the maximum load capability by between 1% and 12.5%. The presence of the stiffener, however, did increase the initial and maximum loads for both tension and bending loading as compared to the stringerless baseline design. Based on the results of the few samples tested, the additional stitching in the T-cap web showed little advantage over the baseline design in terms of structural failure at the T-cap web/skin junction for the current test articles.
Aradaib, Imadeldin E; Majid, Ali A
2006-01-01
A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737
ERIC Educational Resources Information Center
Kimemia, Judy
2017-01-01
Purpose: The purpose of this project was to compare web-based to high-fidelity simulation training in the management of high risk/low occurrence anesthesia related events, to enhance knowledge acquisition for Certified Registered Nurse Anesthetists (CRNAs). This project was designed to answer the question: Is web-based training as effective as…
ERIC Educational Resources Information Center
Hung, Yen-Chu
2011-01-01
This study investigates the different effects of web-based and face-to-face discussion on computer engineering majors' performance using the Karnaugh map in digital logic design. Pretest and posttest scores for two treatment groups (web-based discussion and face-to-face discussion) and a control group were compared and subjected to covariance…
ERIC Educational Resources Information Center
Ke, Chih-Horng; Sun, Huey-Min; Yang, Yuan-Chi; Sun, Huey-Min
2012-01-01
This study explores the effect of user and system characteristics on our proposed web-based classroom response system (CRS) by a longitudinal design. The results of research are expected to understand the important factors of user and system characteristics in the web-based CRS. The proposed system can supply interactive teaching contents,…
Limited-life cartridge primers
Makowiecki, D.M.; Rosen, R.S.
1998-06-30
A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
Designing a Pedagogical Model for Web Engineering Education: An Evolutionary Perspective
ERIC Educational Resources Information Center
Hadjerrouit, Said
2005-01-01
In contrast to software engineering, which relies on relatively well established development approaches, there is a lack of a proven methodology that guides Web engineers in building reliable and effective Web-based systems. Currently, Web engineering lacks process models, architectures, suitable techniques and methods, quality assurance, and a…
A GIS-Interface Web Site: Exploratory Learning for Geography Curriculum
ERIC Educational Resources Information Center
Huang, Kuo Hung
2011-01-01
Although Web-based instruction provides learners with sufficient resources for self-paced learning, previous studies have confirmed that browsing navigation-oriented Web sites possibly hampers users' comprehension of information. Web sites designed as "categories of materials" for navigation demand more cognitive effort from users to orient their…
A Quantitative Cost Effectiveness Model for Web-Supported Academic Instruction
ERIC Educational Resources Information Center
Cohen, Anat; Nachmias, Rafi
2006-01-01
This paper describes a quantitative cost effectiveness model for Web-supported academic instruction. The model was designed for Web-supported instruction (rather than distance learning only) characterizing most of the traditional higher education institutions. It is based on empirical data (Web logs) of students' and instructors' usage…
Information Architecture for Bilingual Web Sites.
ERIC Educational Resources Information Center
Cunliffe, Daniel; Jones, Helen; Jarvis, Melanie; Egan, Kevin; Huws, Rhian; Munro, Sian
2002-01-01
Discusses creating an information architecture for a bilingual Web site and reports work in progress on the development of a content-based bilingual Web site to facilitate shared resources between speech and language therapists. Considers a structural analysis of existing bilingual Web designs and explains a card-sorting activity conducted with…
Development and process evaluation of a Web-based responsible beverage service training program.
Danaher, Brian G; Dresser, Jack; Shaw, Tracy; Severson, Herbert H; Tyler, Milagra S; Maxwell, Elisabeth D; Christiansen, Steve M
2012-09-22
Responsible beverage service (RBS) training designed to improve the appropriate service of alcohol in commercial establishments is typically delivered in workshops. Recently, Web-based RBS training programs have emerged. This report describes the formative development and subsequent design of an innovative Web-delivered RBS program, and evaluation of the impact of the program on servers' knowledge, attitudes, and self-efficacy. Formative procedures using focus groups and usability testing were used to develop a Web-based RBS training program. Professional alcohol servers (N = 112) who worked as servers and/or mangers in alcohol service settings were recruited to participate. A pre-post assessment design was used to assess changes associated with using the program. Participants who used the program showed significant improvements in their RBS knowledge, attitudes, and self-efficacy. Although the current study did not directly observe and determine impact of the intervention on server behaviors, it demonstrated that the development process incorporating input from a multidisciplinary team in conjunction with feedback from end-users resulted in creation of a Web-based RBS program that was well-received by servers and that changed relevant knowledge, attitudes, and self-efficacy. The results also help to establish a needed evidence base in support of the use of online RBS training, which has been afforded little research attention.
Mauz, Elvira; Hoffmann, Robert; Houben, Robin; Krause, Laura; Kamtsiuris, Panagiotis; Gößwald, Antje
2018-03-05
The implementation of an Internet option in an existing public health interview survey using a mixed-mode design is attractive because of lower costs and faster data availability. Additionally, mixed-mode surveys can increase response rates and improve sample composition. However, mixed-mode designs can increase the risk of measurement error (mode effects). This study aimed to determine whether the prevalence rates or mean values of self- and parent-reported health indicators for children and adolescents aged 0-17 years differ between self-administered paper-based questionnaires (SAQ-paper) and self-administered Web-based questionnaires (SAQ-Web), as well as between a single-mode control group and different mixed-mode groups. Data were collected for a methodological pilot of the third wave of the "German Health Interview and Examination Survey for Children and Adolescents". Questionnaires were completed by parents or adolescents. A population-based sample of 11,140 children and adolescents aged 0-17 years was randomly allocated to 4 survey designs-a single-mode control group with paper-and-pencil questionnaires only (n=970 parents, n=343 adolescents)-and 3 mixed-mode designs, all of which offered Web-based questionnaire options. In the concurrent mixed-mode design, both questionnaires were offered at the same time (n=946 parents, n=290 adolescents); in the sequential mixed-mode design, the SAQ-Web was sent first, followed by the paper questionnaire along with a reminder (n=854 parents, n=269 adolescents); and in the preselect mixed-mode design, both options were offered and the respondents were asked to request the desired type of questionnaire (n=698 parents, n=292 adolescents). In total, 3468 questionnaires of parents of children aged 0-17 years (SAQ-Web: n=708; SAQ-paper: n=2760) and 1194 questionnaires of adolescents aged 11-17 years (SAQ-Web: n=299; SAQ-paper: n=895) were analyzed. Sociodemographic characteristics and a broad range of health indicators for children and adolescents were compared by survey design and data collection mode by calculating predictive margins from regression models. There were no statistically significant differences in sociodemographic characteristics or health indicators between the single-mode control group and any of the mixed-mode survey designs. Differences in sociodemographic characteristics between SAQ-Web and SAQ-paper were found. Web respondents were more likely to be male, have higher levels of education, and higher household income compared with paper respondents. After adjusting for sociodemographic characteristics, only one of the 38 analyzed health indicators showed different prevalence rates between the data collection modes, with a higher prevalence rate for lifetime alcohol consumption among the online-responding adolescents (P<.001). These results suggest that mode bias is limited in health interview surveys for children and adolescents using a mixed-mode design with Web-based and paper questionnaires. ©Elvira Mauz, Robert Hoffmann, Robin Houben, Laura Krause, Panagiotis Kamtsiuris, Antje Gößwald. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 05.03.2018.
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian
2018-01-01
"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Kuder, Margaret; Goheen, Mary Jett; Dize, Laura; Barnes, Mathilda; Gaydos, Charlotte A
2015-05-01
The www.iwantthekit.org provides Internet-based, at-home sexually transmitted infection screening. The Web site implemented an automated test result access system. To evaluate potential deleterious effects of the new system, we analyzed demographics, Web site usage, and treatment. The post-Web site design captured more participant information and no decrease in requests, kit return, or treatment adherence.
Ruggiero, Kenneth J; Davidson, Tatiana M; McCauley, Jenna; Gros, Kirstin Stauffacher; Welsh, Kyleen; Price, Matthew; Resnick, Heidi S; Danielson, Carla Kmett; Soltis, Kathryn; Galea, Sandro; Kilpatrick, Dean G; Saunders, Benjamin E; Nissenboim, Josh; Muzzy, Wendy; Fleeman, Anna; Amstadter, Ananda B
2015-01-01
Disasters have far-reaching and potentially long-lasting effects on youth and families. Research has consistently shown a clear increase in the prevalence of several mental health disorders after disasters, including depression and posttraumatic stress disorder. Widely accessible evidence-based interventions are needed to address this unmet need for youth and families, who are underrepresented in disaster research. Rapid growth in Internet and Smartphone access, as well as several Web based evaluation studies with various adult populations has shown that Web-based interventions are likely to be feasible in this context and can improve clinical outcomes. Such interventions also are generally cost-effective, can be targeted or personalized, and can easily be integrated in a stepped care approach to screening and intervention delivery. This is a protocol paper that describes an innovative study design in which we evaluate a self-help Web-based resource, Bounce Back Now, with a population-based sample of disaster affected adolescents and families. The paper includes description and justification for sampling selection and procedures, selection of assessment measures and methods, design of the intervention, and statistical evaluation of critical outcomes. Unique features of this study design include the use of address-based sampling to recruit a population-based sample of disaster-affected adolescents and parents, telephone and Web-based assessments, and development and evaluation of a highly individualized Web intervention for adolescents. Challenges related to large-scale evaluation of technology-delivered interventions with high-risk samples in time-sensitive research are discussed, as well as implications for future research and practice. Published by Elsevier Inc.
Ruggiero, Kenneth J.; Davidson, Tatiana M.; McCauley, Jenna; Gros, Kirstin Stauffacher; Welsh, Kyleen; Price, Matthew; Resnick, Heidi S.; Danielson, Carla Kmett; Soltis, Kathryn; Galea, Sandro; Kilpatrick, Dean G.; Saunders, Benjamin E.; Nissenboim, Josh; Muzzy, Wendy; Fleeman, Anna; Amstadter, Ananda B.
2014-01-01
Disasters have far-reaching and potentially long-lasting effects on youth and families. Research has consistently shown a clear increase in the prevalence of several mental health disorders after disasters, including depression and posttraumatic stress disorder. Widely accessible evidence-based interventions are needed to address this unmet need for youth and families, who are underrepresented in disaster research. Rapid growth in Internet and Smartphone access, as well as several web based evaluation studies with various adult populations has shown that web-based interventions are likely to be feasible in this context and can improve clinical outcomes. Such interventions also are generally cost-effective, can be targeted or personalized, and can easily be integrated in a stepped care approach to screening and intervention delivery. This is a protocol paper that describes an innovative study design in which we evaluate a self-help web-based resource, Bounce Back Now, with a population-based sample of disaster affected adolescents and families. The paper includes description and justification for sampling selection and procedures, selection of assessment measures and methods, design of the intervention, and statistical evaluation of critical outcomes. Unique features of this study design include the use of address-based sampling to recruit a population-based sample of disaster-affected adolescents and parents, telephone and web-based assessments, and development and evaluation of a highly individualized web intervention for adolescents. Challenges related to large-scale evaluation of technology-delivered interventions with high-risk samples in time-sensitive research are discussed, as well as implications for future research and practice. PMID:25478956
Distributed Group Design Process: Lessons Learned.
ERIC Educational Resources Information Center
Eseryel, Deniz; Ganesan, Radha
A typical Web-based training development team consists of a project manager, an instructional designer, a subject-matter expert, a graphic artist, and a Web programmer. The typical scenario involves team members working together in the same setting during the entire design and development process. What happens when the team is distributed, that is…
Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H
2015-09-28
Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.
Web-based learning for continuing nursing education of emergency unit staff.
Paavilainen, Eija; Salminen-Tuomaala, Mari
2010-01-01
The authors describe a Web-based continuing education course focusing on patient counseling in an emergency department. Course materials were developed based on data collected from the department's patients and their family members and on earlier findings on counseling. Web-based education is an appropriate method for continuing education in a specific hospital department. This puts special demands for nurse managers in arranging, designing, and implementing the education together with educators.
Design and implementation of web service-based mobile reply testing management system
NASA Astrophysics Data System (ADS)
Gao, Liang; Han, Yu-min
2013-03-01
This paper introduces the design and implementation of a reply testing management system that based-on C#, Web Service and ASP .Net. With the system, teachers can manage reply site through Windows Mobile, judges can grade onscene by visiting WAP site through GPRS. Then this paper discusses details of the implementation and key technologies of the system.
The Impact of Content Area Focus on the Effectiveness of a Web-Based Simulation
ERIC Educational Resources Information Center
Adcock, Amy B.; Duggan, Molly H.; Watson, Ginger S.; Belfore, Lee A.
2010-01-01
This paper describes an assessment of a web-based interview simulation designed to teach empathetic helping skills. The system includes an animated character acting as a client and responses designed to recreate a simulated role-play, a common assessment method used for teaching these skills. The purpose of this study was to determine whether…
ERIC Educational Resources Information Center
Boulet, Marie-Michele
2004-01-01
Design prescriptions to create web-based courses and sites that are dynamic, easy-to-use, interactive and data-driven, emerge from a "how to do it" approach. Unfortunately, the theory behind these methods, prescriptions, procedures or tools, is rarely provided and the important terms, such as "easy-to-use", to which these…
ERIC Educational Resources Information Center
Türker, Fatih Mehmet
2016-01-01
In today's world, where online learning environments have increased their efficiency in education and training, the design of the websites prepared for education and training purposes has become an important process. This study is about the teaching process of the online learning environments created to teach Turkish in web based environments, and…
Learning in Virtual Forest: A Forest Ecosystem in the Web-Based Learning Environment
ERIC Educational Resources Information Center
Jussila, Terttu; Virtanen, Viivi
2014-01-01
Virtual Forest is a web-based, open-access learning environment about forests designed for primary-school pupils between the ages of 10 and 13 years. It is pedagogically designed to develop an understanding of ecology, to enhance conceptual development and to give a holistic view of forest ecosystems. Various learning tools, such as concept maps,…
ERIC Educational Resources Information Center
Wilkerson, Joyce A.; Elkins, Susan A.
This qualitative case study assessed web-based instruction in a computer-aided design/computer-assisted manufacturing (CAD/CAM) course designed for workforce development. The study examined students' and instructors' experience in a CAD/CAM course delivered exclusively on the Internet, evaluating course content and delivery, clarity of…
ERIC Educational Resources Information Center
Carney, Robert D.
2010-01-01
This dissertation rationalizes the best use of Web-based instruction (WBI) for teaching music theory to private piano students in the later primary grades. It uses an integrative research methodology for defining, designing, and implementing a curriculum that includes WBI. Research from the fields of music education, educational technology,…
Short Tandem Repeat DNA Internet Database
National Institute of Standards and Technology Data Gateway
SRD 130 Short Tandem Repeat DNA Internet Database (Web, free access) Short Tandem Repeat DNA Internet Database is intended to benefit research and application of short tandem repeat DNA markers for human identity testing. Facts and sequence information on each STR system, population data, commonly used multiplex STR systems, PCR primers and conditions, and a review of various technologies for analysis of STR alleles have been included.
Design Principles of an Open Agent Architecture for Web-Based Learning Community.
ERIC Educational Resources Information Center
Jin, Qun; Ma, Jianhua; Huang, Runhe; Shih, Timothy K.
A Web-based learning community involves much more than putting learning materials into a Web site. It can be seen as a complex virtual organization involved with people, facilities, and cyber-environment. Tremendous work and manpower for maintaining, upgrading, and managing facilities and the cyber-environment are required. There is presented an…
ERIC Educational Resources Information Center
Young, Shelley Shwu-Ching; Huang, Yi-Long; Jang, Jyh-Shing Roger
2000-01-01
Describes the development and implementation process of a Web-based science museum in Taiwan. Topics include use of the Internet; lifelong distance learning; museums and the Internet; objectives of the science museum; funding; categories of exhibitions; analysis of Web users; homepage characteristics; graphics and the effect on speed; and future…
6-D, A Process Framework for the Design and Development of Web-based Systems.
ERIC Educational Resources Information Center
Christian, Phillip
2001-01-01
Explores how the 6-D framework can form the core of a comprehensive systemic strategy and help provide a supporting structure for more robust design and development while allowing organizations to support whatever methods and models best suit their purpose. 6-D stands for the phases of Web design and development: Discovery, Definition, Design,…
Jung, Tae-Sung; Yeo, Hock Chuan; Reddy, Satty G; Cho, Wan-Sup; Lee, Dong-Yup
2009-11-01
WEbcoli is a WEb application for in silico designing, analyzing and engineering Escherichia coli metabolism. It is devised and implemented using advanced web technologies, thereby leading to enhanced usability and dynamic web accessibility. As a main feature, the WEbcoli system provides a user-friendly rich web interface, allowing users to virtually design and synthesize mutant strains derived from the genome-scale wild-type E.coli model and to customize pathways of interest through a graph editor. In addition, constraints-based flux analysis can be conducted for quantifying metabolic fluxes and charactering the physiological and metabolic states under various genetic and/or environmental conditions. WEbcoli is freely accessible at http://webcoli.org. cheld@nus.edu.sg.
2012-01-01
Background Although modern sequencing technologies permit the ready detection of numerous DNA sequence variants in any organisms, converting such information to PCR-based genetic markers is hampered by a lack of simple, scalable tools. Onion is an example of an under-researched crop with a complex, heterozygous genome where genome-based research has previously been hindered by limited sequence resources and genetic markers. Results We report the development of generic tools for large-scale web-based PCR-based marker design in the Galaxy bioinformatics framework, and their application for development of next-generation genetics resources in a wide cross of bulb onion (Allium cepa L.). Transcriptome sequence resources were developed for the homozygous doubled-haploid bulb onion line ‘CUDH2150’ and the genetically distant Indian landrace ‘Nasik Red’, using 454™ sequencing of normalised cDNA libraries of leaf and shoot. Read mapping of ‘Nasik Red’ reads onto ‘CUDH2150’ assemblies revealed 16836 indel and SNP polymorphisms that were mined for portable PCR-based marker development. Tools for detection of restriction polymorphisms and primer set design were developed in BioPython and adapted for use in the Galaxy workflow environment, enabling large-scale and targeted assay design. Using PCR-based markers designed with these tools, a framework genetic linkage map of over 800cM spanning all chromosomes was developed in a subset of 93 F2 progeny from a very large F2 family developed from the ‘Nasik Red’ x ‘CUDH2150’ inter-cross. The utility of tools and genetic resources developed was tested by designing markers to transcription factor-like polymorphic sequences. Bin mapping these markers using a subset of 10 progeny confirmed the ability to place markers within 10 cM bins, enabling increased efficiency in marker assignment and targeted map refinement. The major genetic loci conditioning red bulb colour (R) and fructan content (Frc) were located on this map by QTL analysis. Conclusions The generic tools developed for the Galaxy environment enable rapid development of sets of PCR assays targeting sequence variants identified from Illumina and 454 sequence data. They enable non-specialist users to validate and exploit large volumes of next-generation sequence data using basic equipment. PMID:23157543
Baldwin, Samantha; Revanna, Roopashree; Thomson, Susan; Pither-Joyce, Meeghan; Wright, Kathryn; Crowhurst, Ross; Fiers, Mark; Chen, Leshi; Macknight, Richard; McCallum, John A
2012-11-19
Although modern sequencing technologies permit the ready detection of numerous DNA sequence variants in any organisms, converting such information to PCR-based genetic markers is hampered by a lack of simple, scalable tools. Onion is an example of an under-researched crop with a complex, heterozygous genome where genome-based research has previously been hindered by limited sequence resources and genetic markers. We report the development of generic tools for large-scale web-based PCR-based marker design in the Galaxy bioinformatics framework, and their application for development of next-generation genetics resources in a wide cross of bulb onion (Allium cepa L.). Transcriptome sequence resources were developed for the homozygous doubled-haploid bulb onion line 'CUDH2150' and the genetically distant Indian landrace 'Nasik Red', using 454™ sequencing of normalised cDNA libraries of leaf and shoot. Read mapping of 'Nasik Red' reads onto 'CUDH2150' assemblies revealed 16836 indel and SNP polymorphisms that were mined for portable PCR-based marker development. Tools for detection of restriction polymorphisms and primer set design were developed in BioPython and adapted for use in the Galaxy workflow environment, enabling large-scale and targeted assay design. Using PCR-based markers designed with these tools, a framework genetic linkage map of over 800cM spanning all chromosomes was developed in a subset of 93 F(2) progeny from a very large F(2) family developed from the 'Nasik Red' x 'CUDH2150' inter-cross. The utility of tools and genetic resources developed was tested by designing markers to transcription factor-like polymorphic sequences. Bin mapping these markers using a subset of 10 progeny confirmed the ability to place markers within 10 cM bins, enabling increased efficiency in marker assignment and targeted map refinement. The major genetic loci conditioning red bulb colour (R) and fructan content (Frc) were located on this map by QTL analysis. The generic tools developed for the Galaxy environment enable rapid development of sets of PCR assays targeting sequence variants identified from Illumina and 454 sequence data. They enable non-specialist users to validate and exploit large volumes of next-generation sequence data using basic equipment.
Wong, Lai Fun; Chan, Sally Wai-Chi; Ho, Jasmine Tze Yin; Mordiffi, Siti Zubaidah; Ang, Sophia Bee Leng; Goh, Poh Sun; Ang, Emily Neo Kim
2015-01-01
Background Web-based learning is becoming an increasingly important instructional tool in nursing education. Multimedia advancements offer the potential for creating authentic nursing activities for developing nursing competency in clinical practice. Objective This study aims to describe the design, development, and evaluation of an interactive multimedia Web-based simulation for developing nurses’ competencies in acute nursing care. Methods Authentic nursing activities were developed in a Web-based simulation using a variety of instructional strategies including animation video, multimedia instructional material, virtual patients, and online quizzes. A randomized controlled study was conducted on 67 registered nurses who were recruited from the general ward units of an acute care tertiary hospital. Following a baseline evaluation of all participants’ clinical performance in a simulated clinical setting, the experimental group received 3 hours of Web-based simulation and completed a survey to evaluate their perceptions of the program. All participants were re-tested for their clinical performances using a validated tool. Results The clinical performance posttest scores of the experimental group improved significantly (P<.001) from the pretest scores after the Web-based simulation. In addition, compared to the control group, the experimental group had significantly higher clinical performance posttest scores (P<.001) after controlling the pretest scores. The participants from the experimental group were satisfied with their learning experience and gave positive ratings for the quality of the Web-based simulation. Themes emerging from the comments about the most valuable aspects of the Web-based simulation include relevance to practice, instructional strategies, and fostering problem solving. Conclusions Engaging in authentic nursing activities using interactive multimedia Web-based simulation can enhance nurses’ competencies in acute care. Web-based simulations provide a promising educational tool in institutions where large groups of nurses need to be trained in acute nursing care and accessibility to repetitive training is essential for achieving long-term retention of clinical competency. PMID:25583029
Subotic-Kerry, Mirjana; King, Catherine; O'Moore, Kathleen; Achilles, Melinda; O'Dea, Bridianne
2018-03-23
Anxiety disorders and depression are prevalent among youth. General practitioners (GPs) are often the first point of professional contact for treating health problems in young people. A Web-based mental health service delivered in partnership with schools may facilitate increased access to psychological care among adolescents. However, for such a model to be implemented successfully, GPs' views need to be measured. This study aimed to examine the needs and attitudes of GPs toward a Web-based mental health service for adolescents, and to identify the factors that may affect the provision of this type of service and likelihood of integration. Findings will inform the content and overall service design. GPs were interviewed individually about the proposed Web-based service. Qualitative analysis of transcripts was performed using thematic coding. A short follow-up questionnaire was delivered to assess background characteristics, level of acceptability, and likelihood of integration of the Web-based mental health service. A total of 13 GPs participated in the interview and 11 completed a follow-up online questionnaire. Findings suggest strong support for the proposed Web-based mental health service. A wide range of factors were found to influence the likelihood of GPs integrating a Web-based service into their clinical practice. Coordinated collaboration with parents, students, school counselors, and other mental health care professionals were considered important by nearly all GPs. Confidence in Web-based care, noncompliance of adolescents and GPs, accessibility, privacy, and confidentiality were identified as potential barriers to adopting the proposed Web-based service. GPs were open to a proposed Web-based service for the monitoring and management of anxiety and depression in adolescents, provided that a collaborative approach to care is used, the feedback regarding the client is clear, and privacy and security provisions are assured. ©Mirjana Subotic-Kerry, Catherine King, Kathleen O'Moore, Melinda Achilles, Bridianne O'Dea. Originally published in JMIR Human Factors (http://humanfactors.jmir.org), 23.03.2018.
Liaw, Sok Ying; Wong, Lai Fun; Chan, Sally Wai-Chi; Ho, Jasmine Tze Yin; Mordiffi, Siti Zubaidah; Ang, Sophia Bee Leng; Goh, Poh Sun; Ang, Emily Neo Kim
2015-01-12
Web-based learning is becoming an increasingly important instructional tool in nursing education. Multimedia advancements offer the potential for creating authentic nursing activities for developing nursing competency in clinical practice. This study aims to describe the design, development, and evaluation of an interactive multimedia Web-based simulation for developing nurses' competencies in acute nursing care. Authentic nursing activities were developed in a Web-based simulation using a variety of instructional strategies including animation video, multimedia instructional material, virtual patients, and online quizzes. A randomized controlled study was conducted on 67 registered nurses who were recruited from the general ward units of an acute care tertiary hospital. Following a baseline evaluation of all participants' clinical performance in a simulated clinical setting, the experimental group received 3 hours of Web-based simulation and completed a survey to evaluate their perceptions of the program. All participants were re-tested for their clinical performances using a validated tool. The clinical performance posttest scores of the experimental group improved significantly (P<.001) from the pretest scores after the Web-based simulation. In addition, compared to the control group, the experimental group had significantly higher clinical performance posttest scores (P<.001) after controlling the pretest scores. The participants from the experimental group were satisfied with their learning experience and gave positive ratings for the quality of the Web-based simulation. Themes emerging from the comments about the most valuable aspects of the Web-based simulation include relevance to practice, instructional strategies, and fostering problem solving. Engaging in authentic nursing activities using interactive multimedia Web-based simulation can enhance nurses' competencies in acute care. Web-based simulations provide a promising educational tool in institutions where large groups of nurses need to be trained in acute nursing care and accessibility to repetitive training is essential for achieving long-term retention of clinical competency.
Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A
2016-10-01
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.
The Web as a Delivery Medium To Enhance Instruction.
ERIC Educational Resources Information Center
Gillani, Bijan
1998-01-01
Discusses how to design and develop an effective Web site to enhance instruction based on a graduate course at California State University at Hayward. Topics include the analysis phase, content organization, site architecture, interface design, testing, and the evaluation process. (LRW)
Werner, Nicole E; Stanislawski, Barbara; Marx, Katherine A; Watkins, Daphne C; Kobayashi, Marissa; Kales, Helen; Gitlin, Laura N
2017-02-22
Consumer health informatics (CHI) such as web-based applications may provide the platform for enabling the over 15 million family caregivers of patients with Alzheimer's Disease or related dementias the information they need when they need it to support behavioral symptom management. However, for CHI to be successful, it is necessary that it be designed to meet the specific information needs of family caregivers in the context in which caregiving occurs. A sociotechnical systems approach to CHI design can help to understand the contextual complexities of family caregiving and account for those complexities in the design of CHI for family caregivers. This study used a sociotechnical systems approach to identify barriers to meeting caregivers' information needs related to the management of dementia-related behavioral symptoms, and to derive design implications that overcome barriers for caregiver-focused web-based platforms. We have subsequently used these design implications to inform the development of a web-based platform, WeCareAdvisor,TM which provides caregivers with information and an algorithm by which to identify and manage behavioral symptoms for which they seek management strategies. We conducted 4 focus groups with family caregivers (N=26) in a Midwestern state. Qualitative content analysis of the data was guided by a sociotechnical systems framework. We identified nine categories of barriers that family caregivers confront in obtaining needed information about behavioral symptom management from which we extrapolated design implications for a web-based platform. Based on interactions within the sociotechnical system, three critical information needs were identified: 1) timely access to information, 2) access to information that is tailored or specific to caregiver's needs and contexts, and 3) usable information that can directly inform how caregivers' manage behaviors. The sociotechnical system framework is a useful approach for identifying information needs of family caregivers to inform design of web-based platforms that are user-centered.
Ballew, Paula; Castro, Sarah; Claus, Julie; Kittur, Nupur; Brennan, Laura; Brownson, Ross C.
2013-01-01
During a time when governmental funding, resources and staff are decreasing and travel restrictions are increasing, attention to efficient methods of public health workforce training is essential. A literature review was conducted to inform the development and delivery of web-based trainings for public health practitioners. Literature was gathered and summarized from five disciplines: Information Technology, Health, Education, Business and Communications, following five research themes: benefits, barriers, retention, promotion and evaluation. As a result, a total of 138 articles relevant to web-based training design and implementation were identified. Key recommendations emerged, including the need to conduct formative research and evaluation, provide clear design and layout, concise content, interactivity, technical support, marketing and promotion and incentives. We conclude that there is limited application of web-based training in public health. This review offers an opportunity to learn from other disciplines. Web-based training methods may prove to be a key training strategy for reaching our public health workforce in the environment of limited resources. PMID:22987862
Web-based e-learning and virtual lab of human-artificial immune system.
Gong, Tao; Ding, Yongsheng; Xiong, Qin
2014-05-01
Human immune system is as important in keeping the body healthy as the brain in supporting the intelligence. However, the traditional models of the human immune system are built on the mathematics equations, which are not easy for students to understand. To help the students to understand the immune systems, a web-based e-learning approach with virtual lab is designed for the intelligent system control course by using new intelligent educational technology. Comparing the traditional graduate educational model within the classroom, the web-based e-learning with the virtual lab shows the higher inspiration in guiding the graduate students to think independently and innovatively, as the students said. It has been found that this web-based immune e-learning system with the online virtual lab is useful for teaching the graduate students to understand the immune systems in an easier way and design their simulations more creatively and cooperatively. The teaching practice shows that the optimum web-based e-learning system can be used to increase the learning effectiveness of the students.
2012-08-01
Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a
Ou, Hong-Yu; He, Xinyi; Harrison, Ewan M.; Kulasekara, Bridget R.; Thani, Ali Bin; Kadioglu, Aras; Lory, Stephen; Hinton, Jay C. D.; Barer, Michael R.; Rajakumar, Kumar
2007-01-01
MobilomeFINDER (http://mml.sjtu.edu.cn/MobilomeFINDER) is an interactive online tool that facilitates bacterial genomic island or ‘mobile genome’ (mobilome) discovery; it integrates the ArrayOme and tRNAcc software packages. ArrayOme utilizes a microarray-derived comparative genomic hybridization input data set to generate ‘inferred contigs’ produced by merging adjacent genes classified as ‘present’. Collectively these ‘fragments’ represent a hypothetical ‘microarray-visualized genome (MVG)’. ArrayOme permits recognition of discordances between physical genome and MVG sizes, thereby enabling identification of strains rich in microarray-elusive novel genes. Individual tRNAcc tools facilitate automated identification of genomic islands by comparative analysis of the contents and contexts of tRNA sites and other integration hotspots in closely related sequenced genomes. Accessory tools facilitate design of hotspot-flanking primers for in silico and/or wet-science-based interrogation of cognate loci in unsequenced strains and analysis of islands for features suggestive of foreign origins; island-specific and genome-contextual features are tabulated and represented in schematic and graphical forms. To date we have used MobilomeFINDER to analyse several Enterobacteriaceae, Pseudomonas aeruginosa and Streptococcus suis genomes. MobilomeFINDER enables high-throughput island identification and characterization through increased exploitation of emerging sequence data and PCR-based profiling of unsequenced test strains; subsequent targeted yeast recombination-based capture permits full-length sequencing and detailed functional studies of novel genomic islands. PMID:17537813
USDA-ARS?s Scientific Manuscript database
One hundred and forty-seven primer pairs originally designed to amplify microsatellites, also known as simple sequence repeats (SSR), in black walnut (Juglans nigra L.) were screened for utility in persian walnut (J. regia L.). Based on scorability and number of informative polymorphisms, the best 1...
Design and Evaluation of a Web-Based Symptom Monitoring Tool for Heart Failure.
Wakefield, Bonnie J; Alexander, Gregory; Dohrmann, Mary; Richardson, James
2017-05-01
Heart failure is a chronic condition where symptom recognition and between-visit communication with providers are critical. Patients are encouraged to track disease-specific data, such as weight and shortness of breath. Use of a Web-based tool that facilitates data display in graph form may help patients recognize exacerbations and more easily communicate out-of-range data to clinicians. The purposes of this study were to (1) design a Web-based tool to facilitate symptom monitoring and symptom recognition in patients with chronic heart failure and (2) conduct a usability evaluation of the Web site. Patient participants generally had a positive view of the Web site and indicated it would support recording their health status and communicating with their doctors. Clinician participants generally had a positive view of the Web site and indicated it would be a potentially useful adjunct to electronic health delivery systems. Participants expressed a need to incorporate decision support within the site and wanted to add other data, for example, blood pressure, and have the ability to adjust font size. A few expressed concerns about data privacy and security. Technologies require careful design and testing to ensure they are useful, usable, and safe for patients and do not add to the burden of busy providers.
Effects of a Web-based course on nursing skills and knowledge learning.
Lu, Der-Fa; Lin, Zu-Chun; Li, Yun-Ju
2009-02-01
The purpose of the study was to assess the effectiveness of supplementing traditional classroom teaching with Web-based learning design when teaching intramuscular injection nursing skills. Four clusters of nursing students at a junior college in eastern Taiwan were randomly assigned to experimental and control groups. A total of 147 students (80 in the experimental group, 67 in the control group) completed the study. All participants received the same classroom lectures and skill demonstration. The experimental group interacted using a Web-based course and were able to view the content on demand. The students and instructor interacted via a chatroom, the bulletin board, and e-mail. Participants in the experimental group had significantly higher scores on both intramuscular injection knowledge and skill learning. A Web-based design can be an effective supplementing learning tool for teaching nursing knowledge and skills.
Improving Conceptual Design for Launch Vehicles
NASA Technical Reports Server (NTRS)
Olds, John R.
1998-01-01
This report summarizes activities performed during the second year of a three year cooperative agreement between NASA - Langley Research Center and Georgia Tech. Year 1 of the project resulted in the creation of a new Cost and Business Assessment Model (CABAM) for estimating the economic performance of advanced reusable launch vehicles including non-recurring costs, recurring costs, and revenue. The current year (second year) activities were focused on the evaluation of automated, collaborative design frameworks (computation architectures or computational frameworks) for automating the design process in advanced space vehicle design. Consistent with NASA's new thrust area in developing and understanding Intelligent Synthesis Environments (ISE), the goals of this year's research efforts were to develop and apply computer integration techniques and near-term computational frameworks for conducting advanced space vehicle design. NASA - Langley (VAB) has taken a lead role in developing a web-based computing architectures within which the designer can interact with disciplinary analysis tools through a flexible web interface. The advantages of this approach are, 1) flexible access to the designer interface through a simple web browser (e.g. Netscape Navigator), 2) ability to include existing 'legacy' codes, and 3) ability to include distributed analysis tools running on remote computers. To date, VAB's internal emphasis has been on developing this test system for the planetary entry mission under the joint Integrated Design System (IDS) program with NASA - Ames and JPL. Georgia Tech's complementary goals this year were to: 1) Examine an alternate 'custom' computational architecture for the three-discipline IDS planetary entry problem to assess the advantages and disadvantages relative to the web-based approach.and 2) Develop and examine a web-based interface and framework for a typical launch vehicle design problem.
ABACAS: algorithm-based automatic contiguation of assembled sequences
Assefa, Samuel; Keane, Thomas M.; Otto, Thomas D.; Newbold, Chris; Berriman, Matthew
2009-01-01
Summary: Due to the availability of new sequencing technologies, we are now increasingly interested in sequencing closely related strains of existing finished genomes. Recently a number of de novo and mapping-based assemblers have been developed to produce high quality draft genomes from new sequencing technology reads. New tools are necessary to take contigs from a draft assembly through to a fully contiguated genome sequence. ABACAS is intended as a tool to rapidly contiguate (align, order, orientate), visualize and design primers to close gaps on shotgun assembled contigs based on a reference sequence. The input to ABACAS is a set of contigs which will be aligned to the reference genome, ordered and orientated, visualized in the ACT comparative browser, and optimal primer sequences are automatically generated. Availability and Implementation: ABACAS is implemented in Perl and is freely available for download from http://abacas.sourceforge.net Contact: sa4@sanger.ac.uk PMID:19497936
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.
Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y
2015-12-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.
Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.
Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo
2016-08-30
Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.
Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M
2014-05-30
Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.
A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts
Ealba, Erin L.; Schneider, Richard A.
2013-01-01
Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056
Students' Reaction to WebCT: Implications for Designing On-Line Learning Environments
ERIC Educational Resources Information Center
Osman, Mohamed Eltahir
2005-01-01
There is a growing number of web-based and web-assisted course development tools and products that can be used to create on-line learning environment. The utility of these products, however, varies greatly depending on their feasibility, prerequisite infrastructure, technical features, interface, and course development and management tools. WebCT…
ERIC Educational Resources Information Center
Salsovic, Annette R.
2009-01-01
A WebQuest is an inquiry-based lesson plan that uses the Internet. This article explains what a WebQuest is, shows how to create one, and provides an example. When engaged in a WebQuest, students use technology to experience cooperative learning and discovery learning while honing their research, writing, and presentation skills. It has been found…
Supplementing Introductory Biology with On-Line Curriculum
ERIC Educational Resources Information Center
McGroarty, Estelle; Parker, Joyce; Heidemann, Merle; Lim, Heejun; Olson, Mark; Long, Tammy; Merrill, John; Riffell, Samuel; Smith, James; Batzli, Janet; Kirschtel, David
2004-01-01
We developed web-based modules addressing fundamental concepts of introductory biology delivered through the LON-CAPA course management system. These modules were designed and used to supplement large, lecture-based introductory biology classes. Incorporating educational principles and the strength of web-based instructional technology, choices…
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
AirLab: a cloud-based platform to manage and share antibody-based single-cell research.
Catena, Raúl; Özcan, Alaz; Jacobs, Andrea; Chevrier, Stephane; Bodenmiller, Bernd
2016-06-29
Single-cell analysis technologies are essential tools in research and clinical diagnostics. These methods include flow cytometry, mass cytometry, and other microfluidics-based technologies. Most laboratories that employ these methods maintain large repositories of antibodies. These ever-growing collections of antibodies, their multiple conjugates, and the large amounts of data generated in assays using specific antibodies and conditions makes a dedicated software solution necessary. We have developed AirLab, a cloud-based tool with web and mobile interfaces, for the organization of these data. AirLab streamlines the processes of antibody purchase, organization, and storage, antibody panel creation, results logging, and antibody validation data sharing and distribution. Furthermore, AirLab enables inventory of other laboratory stocks, such as primers or clinical samples, through user-controlled customization. Thus, AirLab is a mobile-powered and flexible tool that harnesses the capabilities of mobile tools and cloud-based technology to facilitate inventory and sharing of antibody and sample collections and associated validation data.
The Information Architecture of E-Commerce: An Experimental Study on User Performance and Preference
NASA Astrophysics Data System (ADS)
Wan Mohd, Wan Abdul Rahim; Md Noor, Nor Laila; Mehad, Shafie
Too often, designers of e-commerce web sites use models, concepts, guidelines, and designs that focus on the artifacts while ignoring the context in which the artifacts will be used. Furthermore, the link between culture and usability in web site IA phenomenon is still considered as uncharted area, as it lacks much theoretical consideration. In an effort toward addressing the aforementioned issues, our study provides a theoretical and empirical link between cultural and usability through the application of ‘Venustas' (Delight) drawn from the architectural field and Hofstede's cultural dimensions. We use Islamic culture as the case study and report on the experiment to investigate the effect of the IA designs based on the cultural dimensions on e-commerce web sites. The result provides partial empirical support to the theorized link between culture and usability based on the usability measurement on user performance and preference. In addition, practical web site IA cultural design prescriptions are also provided.
Evaluation of a Web-based Error Reporting Surveillance System in a Large Iranian Hospital.
Askarian, Mehrdad; Ghoreishi, Mahboobeh; Akbari Haghighinejad, Hourvash; Palenik, Charles John; Ghodsi, Maryam
2017-08-01
Proper reporting of medical errors helps healthcare providers learn from adverse incidents and improve patient safety. A well-designed and functioning confidential reporting system is an essential component to this process. There are many error reporting methods; however, web-based systems are often preferred because they can provide; comprehensive and more easily analyzed information. This study addresses the use of a web-based error reporting system. This interventional study involved the application of an in-house designed "voluntary web-based medical error reporting system." The system has been used since July 2014 in Nemazee Hospital, Shiraz University of Medical Sciences. The rate and severity of errors reported during the year prior and a year after system launch were compared. The slope of the error report trend line was steep during the first 12 months (B = 105.727, P = 0.00). However, it slowed following launch of the web-based reporting system and was no longer statistically significant (B = 15.27, P = 0.81) by the end of the second year. Most recorded errors were no-harm laboratory types and were due to inattention. Usually, they were reported by nurses and other permanent employees. Most reported errors occurred during morning shifts. Using a standardized web-based error reporting system can be beneficial. This study reports on the performance of an in-house designed reporting system, which appeared to properly detect and analyze medical errors. The system also generated follow-up reports in a timely and accurate manner. Detection of near-miss errors could play a significant role in identifying areas of system defects.
Supporting in- and off-Hospital Patient Management Using a Web-based Integrated Software Platform.
Spyropoulos, Basile; Botsivali, Maria; Tzavaras, Aris; Pierros, Vasileios
2015-01-01
In this paper, a Web-based software platform appropriately designed to support the continuity of health care information and management for both in and out of hospital care is presented. The system has some additional features as it is the formation of continuity of care records and the transmission of referral letters with a semantically annotated web service. The platform's Web-orientation provides significant advantages, allowing for easily accomplished remote access.
SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).
Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T
2016-09-01
To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.
Adolfsson, Annsofie; Linden, Karolina; Sparud-Lundin, Carina; Larsson, Per-Göran; Berg, Marie
2014-12-29
Women with type 1 diabetes face particular demands in their lives in relation to childbearing. During pregnancy, in order to optimize the probability of giving birth to a healthy child, their blood glucose levels need to be as normal as possible. After childbirth, they experience a 'double stress': in addition to the ordinary challenges they face as new mothers, they also need to focus on getting their blood glucose levels normal. To improve self-management of diabetes and overall well-being in women with type 1 diabetes, a person-centered web-based support was designed to be tested in a randomized controlled trial (RCT) to be used during pregnancy and early motherhood. This protocol outlines the design of this RCT, which will evaluate the effectiveness of the specially designed web-based support for mothers with type 1 diabetes in Sweden. The study is designed as an RCT. The web support consists of three parts: 1) evidence-based information, 2) a self-care diary, and 3) communication with peers. The primary outcome is general well-being evaluated with the Well-Being Questionnaire short version (W-BQ12) and diabetes management evaluated with the Diabetes Empowerment Scale, short version (SWE-DES). Women attending six hospital-based antenatal care centers in Sweden are invited to participate. The inclusion period is November 2011 to late 2014. The allocation of participants to web support (intervention group) and to usual care (control group) is equal (1:1). In total, 68 participants in each group will be needed to reach a statistical power of 80% with significance level 0.05. The web support is expected to strengthen the women's personal capacity and autonomy during pregnancy, breastfeeding, and early motherhood, leading to optimal well-being and diabetes management. ClinicalTrials.gov: NCT01565824 (registration date March 27th 2012).
ERIC Educational Resources Information Center
Hunt, Leslie; Karl, Rita
This paper provides an account of the instructional design and development process used by a team of students enrolled in a graduate level course in distance education as the team members conceptualized and created two prototype World Wide Web-based instructional modules, aimed at grades 5 through 12, for the Lunar and Planetary Institute's Mars…
ERIC Educational Resources Information Center
Liang, Chaoyun; Chang, Chi-Cheng; Shu, Kuen-Ming; Tseng, Ju-Shih; Lin, Chun-Yu
2016-01-01
The purpose of the present study was to design reflective writing mechanisms in a web-based portfolio assessment system and evaluate its effects on self-regulated learning. Participants were two classes of juniors majoring in data processing and taking a course called "Website design" at a vocational high school in Taiwan. One class was…