[Monkey-pox, a model of emergent then reemergent disease].

PubMed

Georges, A J; Matton, T; Courbot-Georges, M C

2004-01-01

The recent emergence of monkey pox in the United States of America highlights the problem (known for other infectious agents) of dissemination of pathogens outside their endemic area, and of subsequent global threats of variable gravity according to agents. It is a real emergency since monkey pox had been confined to Africa for several decades, where small epidemics occurred from time to time, monkey pox is a "miniature smallpox" which, in Africa, evolves on an endemic (zoonotic) mode with, as reservoirs, several species of wild rodents (mainly squirrels) and some monkey species. It can be accidentally transmitted to man then develops as epidemics, sometimes leading to death. The virus was imported in 2003 in the United States of America, via Gambia rats and wild squirrels (all African species), and infected prairie dogs (which are now in fashion as pets), then crossed the species barrier to man. In the United States of America, screening campaigns, epidemiological investigations, and subsequent treatments led to a rapid control of the epidemic, which is a model of emergent disease for this country. Therapeutic and preventive measures directly applicable to monkey pox are discussed. They can also be applied against other pox virus infections (including smallpox). The risk of criminal introduction of pox viruses is discussed since it is, more than ever, a real worldwide threat.

Prevalence of pox-like lesions and malaria in forest bird communitites on leeward Mauna Loa volcano, Hawaii

USGS Publications Warehouse

Atkinson, C.T.; Lease, J.K.; Dusek, Robert J.; Samuel, M.D.

2005-01-01

Introduced avian pox virus and malaria have had devastating impacts on native Hawaiian forest birds, yet little has been published about their prevalence and distribution in forest bird communities outside of windward Hawaii Island. We surveyed native and non-native forest birds for these two diseases at three different elevations on leeward Mauna Loa Volcano at the Kona Forest Unit of Hakalau Forest National Wildlife Refuge. Prevalence of malaria by both serology and microscopy varied by elevation and ranged from 28% at 710 m to 13% at 1830 m. Prevalence of pox-like lesions also varied by altitude, ranging in native species from 10% at 710 m to 2% at 1830 m. Native species at all elevations had the highest prevalence of malarial antibody and pox-like lesions. By contrast, pox-like lesions were not detected in individuals of four non-native species and only 5% of Japanese White-eye (Zosterops japonicus) was positive for malaria. A significantly high proportion of birds with pox-like lesions also had serological evidence of concurrent, chronic malarial infections, suggesting an interaction between these diseases, dual transmission of both diseases by the primary mosquito vector (Culex quinquefasciatus) or complete recovery of some pox-infected birds without loss of toes. Results from this study document high prevalence of malaria and pox at this refuge. Development of effective disease control strategies will be important for restoration of remnant populations of the endangered 'Akiapola'au (Hemignathus munroi), Hawaii Creeper (Oreomystis mana), and Hawaii 'Akepa (Loxops coccineus coccineus) that still occur on the refuge.

Assessment and comparison of the pathogenicity of Sheeppox Virus strains isolated in Morocco

PubMed Central

Hajjou, Saida; Khataby, Khadija; Amghar, Souad; El Fahime, Mustapha; El Harrak, Mehdi; Fakiri, Malika; Loutfi, Chafiqa

2017-01-01

Background and Objectives: Sheeppox virus causes systemic disease in sheep that is often associated with high morbidity and mortality. Protection against sheep pox is mainly based on medical prophylaxis, vaccination being the only way. In Morocco, and up to now, there is no available information about local challenge strain to use for controlling the efficiency of vaccines produced against sheep pox. Hence, the objective of the present study was to evaluate and compare the pathogenicity of seven Sheeppox virus (SPVs) isolates from 1993–1995 in Morocco. Materials and Methods: These seven SPV isolates have undergone various tests to evaluate their pathogenicity: Passages and titration on cell culture, Experimental inoculation on sheep, Virus-neutralization, In vivo titration and viral re-isolation by real-time PCR assay. Results: All infected lambs showed severe clinical signs, while most of them have been reproduced on 5 dpi and persisted until 21 dpi. The lambs infected by Oj1P4, Oj2P4 and BerP5 appeared lethargic, reluctant to move compared to those infected by other isolates. The results also revealed that all isolates were able to induce serological response. Virus isolation from infected organs and blood and amplification of the viral DNA by real-time PCR proved the presence of the virus in tissues and blood of infected lambs. These Moroccan SPVs demonstrated that the three isolates Oj1P4, Oj2P4 and BerP5 have a high pathogenicity; especially the BerP5 isolate which has an important infectious titer. Conclusion: These results demonstrate that the Berkane isolate is the most pathogenic of the tested isolates and it can be an excellent challenge strain for the control of the efficiency of vaccines against sheep pox produced in Morocco. PMID:29487736

[Retrobulbar optic nevritis and chicken pox: a case report in a child].

PubMed

Roelandt, V; Fayol, L; Hugonenq, C; Mancini, J; Chabrol, B

2005-03-01

We report here the case of a three-year-old boy presenting with an optic neuritis during the invasive phase of a chicken pox. This clinical, infrequent picture, can be directly due to the virus or be secondary to an auto-immune mechanism. The examination of the ocular fundus, the profile of the spinal fluid, the MRI and the measure of visual evoked potential allow to reach diagnosis and to identify the type of lesion. There is no consensus on the treatment of this optic neuritis and the current attitude is therapeutic abstention because of a rapid spontaneous improvement. Cerebellitis, meningitis can also be seen during chicken pox. Their evolution is quickly favorable, not requiring additional exam. Encephalitis can result from an auto-immune lesion of the white matter and require then the use of corticoids with antiviral drugs.

Avian Pox Discovered in the Critically Endangered Waved Albatross (Phoebastria irrorata) from the Galápagos Islands, Ecuador.

PubMed

Tompkins, Emily M; Anderson, David J; Pabilonia, Kristy L; Huyvaert, Kathryn P

2017-10-01

The Waved Albatross (Phoebastria irrorata) is a critically endangered seabird in a rapidly shrinking population in the Galápagos Islands, Ecuador. The introduction of novel pathogens and parasites poses a threat to population persistence. Monitoring disease prevalence and guarding against the spread of such agents in endemic taxa are conservation priorities for the Galápagos, where recent increases in the prevalence of avian pox may have contributed to population declines and range contractions in other bird species. During November 2013-January 2014, we identified 14 Waved Albatross nestlings at our study site on Española Island with avian pox-like lesions and clinical signs. Other seabirds, landbirds, and adult Waved Albatrosses were apparently unaffected. Histopathology of tissue samples from five infected nestlings revealed inclusion bodies in all samples, consistent with avipoxvirus infection. We documented higher mortality (6 of 14 nestlings) in affected nestlings than in unaffected young in this small outbreak of avian pox, the first report of its kind in the world's only tropical albatross.

Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

PubMed

Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

2014-01-17

Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

Plum pox virus capsid protein suppresses plant pathogen-associated molecular pattern (PAMP)-triggered immunity.

PubMed

Nicaise, Valerie; Candresse, Thierry

2017-08-01

The perception of pathogen-associated molecular patterns (PAMPs) by immune receptors launches defence mechanisms referred to as PAMP-triggered immunity (PTI). Successful pathogens must suppress PTI pathways via the action of effectors to efficiently colonize their hosts. So far, plant PTI has been reported to be active against most classes of pathogens, except viruses, although this defence layer has been hypothesized recently as an active part of antiviral immunity which needs to be suppressed by viruses for infection success. Here, we report that Arabidopsis PTI genes are regulated upon infection by viruses and contribute to plant resistance to Plum pox virus (PPV). Our experiments further show that PPV suppresses two early PTI responses, the oxidative burst and marker gene expression, during Arabidopsis infection. In planta expression of PPV capsid protein (CP) was found to strongly impair these responses in Nicotiana benthamiana and Arabidopsis, revealing its PTI suppressor activity. In summary, we provide the first clear evidence that plant viruses acquired the ability to suppress PTI mechanisms via the action of effectors, highlighting a novel strategy employed by viruses to escape plant defences. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Concurrent Fowlpox and Candidiasis Diseases in Backyard Chickens with Unusual Pox Lesions in the Bursa of Fabricius.

PubMed

Ogasawara, Fusae; Yamamoto, Yu; Sato, Yasuo; Fukunari, Kazuhiro; Murata, Ken-Ichi; Yaegashi, Gakuji; Goto, Makiko; Murakami, Ryukoh

2016-09-01

Concurrent fowlpox and candidiasis diseases occurred in a backyard chicken flock. Four deceased chickens (one Nagoya breed and three white silkie chickens) were examined for diagnosis. At necropsy, white curd-like plaques were observed in the crop. Fungal elements that stained positive for Candida albicans with immunohistochemistry were distributed throughout the tongue, choanal mucosa, esophagus, and crop. Typical fowlpox lesions, composed of proliferating epithelial cells with ballooning degeneration and viral intracytoplasmic inclusions, were observed in the conjunctiva, nasal mucosa, and skin around the cloaca. Interestingly, hyperplastic interfollicular epithelium with rare virus inclusions was observed in the bursa of Fabricius (BF). Some bursal follicles were replaced by proliferating epithelial cells. These proliferating cells immunohistochemically stained positive for cytokeratin. PCR and subsequent genetic sequencing detected the C. albicans gene in the crop, and fowlpox virus genes in the BF. These results indicate that this outbreak was a rare presentation of fowlpox in spontaneously infected chickens, with unusual pox lesions in the BF.

Agricultural Bioterrorism: Why It Is A Concern And What We Must Do

DTIC Science & Technology

2003-04-07

that causes smallpox. • Fungus are any of a major group (Fungi) of saprophytic and parasitic lower plants that lack chlorophyll and include molds, rusts ...fever* • Sheep and goat pox* • Swine vesicular disease* • Vesicular stomatitis* Plant Pathogens • Rice blast (Magnaporthe griesea) • Wheat stem rust ...Puccinia graminis) • Wheat smut (Fusarium graminearum) Wheat Pathogens • Wheat dwarf geminivirus • Barley yellow dwarf virus • Pseudomonas fascovaginaei

Detection, identification, and differentiation of sheep pox virus and goat pox virus from clinical cases in Giza Governorate, Egypt

PubMed Central

Mahmoud, M. A.; Khafagi, M. H.

2016-01-01

Aim: To isolate, identify, and differentiate Capripoxviruses (CaPV) (sheep pox virus and goat pox virus) infections by egg inoculation, transmission electron microscopy (TEM), and 30 kDa RNA polymerase subunit gene-based polymerase chain reaction (PCR) (RPO30) in clinically affected animals in Hawamdia township of Giza Governorate, Egypt. Materials and Methods: A total of 37 scab samples were collected from clinically suspected field cases of sheep pox and goat pox. These samples were collected during (2014-2015) during different outbreaks of sheep pox and goat pox from Hawamdia township of Giza Governorate, Egypt. The samples were subjected to egg inoculation, TEM, and (RPO30) gene-based PCR. By using the egg inoculation: Previously prepared 37 scab samples (n=23 sheep and n=14 goats) were inoculated on the chorioallantoic membrane of specific pathogen free (SPF) embryonated chicken eggs (12 days old age). In the presence of the suitable percentage of humidity and candling, the inoculated eggs were incubated at 37°C. By using the TEM: Samples showed positive pock lesions on the chorioallantoic membranes, were fixed in glutaraldehyde, then processed and sectioned for TEM. Using the (RPO30) gene-based PCR assay, 30 of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened. Results: Using the egg inoculation, a characteristic pock lesions for poxviruses were seen in 30/37 (n=19 sheep and n=11 goats) (81.08%). Using the TEM, examination of the positive samples after egg inoculation revealed positive result in 23/30 (n=15 sheep and n=8 goats) (76.66%). The positive results represented by the presence of negatively stained oval-shape virus particles. Using the (RPO30) gene-based PCR assay, out of 30 total of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened, 27 (90%) samples (n=17 sheep and n=10 goats) were positive. The given band sizes of sheep and goats were 172 and 152 bp, respectively. Conclusion: PCR assay depended on RPO30 gene can be used lonely for the detection, identification, and differentiation of CaPVs. RPO30 gene-based PCR assay in combination with gene sequencing helps in molecular epidemiological studies of CaPV infection. PMID:28096619

Detection, identification, and differentiation of sheep pox virus and goat pox virus from clinical cases in Giza Governorate, Egypt.

PubMed

Mahmoud, M A; Khafagi, M H

2016-12-01

To isolate, identify, and differentiate Capripoxviruses (CaPV) (sheep pox virus and goat pox virus) infections by egg inoculation, transmission electron microscopy (TEM), and 30 kDa RNA polymerase subunit gene-based polymerase chain reaction (PCR) (RPO30) in clinically affected animals in Hawamdia township of Giza Governorate, Egypt. A total of 37 scab samples were collected from clinically suspected field cases of sheep pox and goat pox. These samples were collected during (2014-2015) during different outbreaks of sheep pox and goat pox from Hawamdia township of Giza Governorate, Egypt. The samples were subjected to egg inoculation, TEM, and (RPO30) gene-based PCR. By using the egg inoculation: Previously prepared 37 scab samples (n=23 sheep and n=14 goats) were inoculated on the chorioallantoic membrane of specific pathogen free (SPF) embryonated chicken eggs (12 days old age). In the presence of the suitable percentage of humidity and candling, the inoculated eggs were incubated at 37°C. By using the TEM: Samples showed positive pock lesions on the chorioallantoic membranes, were fixed in glutaraldehyde, then processed and sectioned for TEM. Using the (RPO30) gene-based PCR assay, 30 of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened. Using the egg inoculation, a characteristic pock lesions for poxviruses were seen in 30/37 (n=19 sheep and n=11 goats) (81.08%). Using the TEM, examination of the positive samples after egg inoculation revealed positive result in 23/30 (n=15 sheep and n=8 goats) (76.66%). The positive results represented by the presence of negatively stained oval-shape virus particles. Using the (RPO30) gene-based PCR assay, out of 30 total of positive samples after egg inoculation (n=19 sheep and n=11 goats) were screened, 27 (90%) samples (n=17 sheep and n=10 goats) were positive. The given band sizes of sheep and goats were 172 and 152 bp, respectively. PCR assay depended on RPO30 gene can be used lonely for the detection, identification, and differentiation of CaPVs. RPO30 gene-based PCR assay in combination with gene sequencing helps in molecular epidemiological studies of CaPV infection.

Sharka epidemiology and worldwide management strategies: learning lessons to optimize disease control in perennial plants

USDA-ARS?s Scientific Manuscript database

Many plant epidemics that cause major economic losses cannot be controlled with pesticides. Among them, sharka epidemics severely affect prunus trees worldwide. Its causal agent, Plum pox virus (PPV;, genus Potyvirus), has been classified as a quarantine pathogen in numerous countries. As a result, ...

Synthesis and Biological Evaluation of Brain-Specific Anti-RNA Viral Agents

DTIC Science & Technology

1989-06-30

disease or ultimately death. DNA viruses are subdivided into five families and include the pathogens responsible for labial and genital herpes, chicken ... pox , shingles and mononucleosis. RNA viruses are present in more numerous forms and are subdivided into ten families. These viruses are unusual in

Participation of chitin-binding peroxidase isoforms in the wilt pathogenesis of cotton

USDA-ARS?s Scientific Manuscript database

Specific chitin-binding isozymes of peroxidase (POX) play an important role in pathogenesis of plant diseases caused with fungi. We studied the dynamics of peroxidase activity in two varieties of cotton (Gossypium hirsutum L.); one was a susceptible and the other resistant to the plant pathogen Vert...

Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

PubMed

Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

2015-07-07

Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

Studies on the serological relationships between avian pox, sheep pox, goat pox and vaccinia viruses

PubMed Central

Uppal, P. K.; Nilakantan, P. R.

1970-01-01

By using neutralization, complement fixation and immunogel-diffusion tests, it has been demonstrated that cross-reactions occur between various avian pox viruses and between sheep pox and goat pox viruses. No such reactions were demonstrated between avian pox viruses and vaccinia virus or between avian pox and sheep pox and goat pox viruses. Furthermore, no serological relationship was demonstrable between vaccinia virus and sheep pox and goat pox viruses. PMID:4989854

Diversity, origins and virulence of Avipoxviruses in Hawaiian Forest Birds

USGS Publications Warehouse

Jarvi, S.I.; Triglia, D.; Giannoulis, A.; Farias, M.; Bianchi, K.; Atkinson, C.T.

2008-01-01

We cultured avian pox (Avipoxvirus spp.) from lesions collected on Hawai'i, Maui, Moloka'i, and 'Oahu in the Hawaiian Islands from 15 native or non-native birds representing three avian orders. Phylogenetic analysis of a 538 bp fragment of the gene encoding the virus 4b core polypeptide revealed two distinct variant clusters, with sequences from chickens (fowlpox) forming a third distinct basal cluster. Pox isolates from one of these two clusters appear closely related to canarypox and other passerine pox viruses, while the second appears more specific to Hawai'i. There was no evidence that birds were infected simultaneously with multiple pox virus variants based on evaluation of multiples clones from four individuals. No obvious temporal or geographic associations were observed and strict host specificity was not apparent among the 4b-defined field isolates. We amplified a 116 bp 4b core protein gene fragment from an 'Elepaio (Chasiempis sandwichensis) collected in 1900 on Hawai'i Island that clustered closely with the second of the two variants, suggesting that this variant has been in Hawai'i for at least 100 years. The high variation detected between the three 4b clusters provides evidence for multiple, likely independent introductions, and does not support the hypothesis of infection of native species through introduction of infected fowl. Preliminary experimental infections in native Hawai'i 'Amakihi (Hemignathus virens) suggest that the 4b-defined variants may be biologically distinct, with one variant appearing more virulent. These pox viruses may interact with avian malaria (Plasmodium relictum), another introduced pathogen in Hawaiian forest bird populations, through modulation of host immune responses. ?? 2007 Springer Science+Business Media B.V.

Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

PubMed

Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

2014-10-01

Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.

Clinical and pathological findings of concurrent poxvirus lesions and aspergillosis infection in canaries.

PubMed

Reza, Kheirandish; Nasrin, Askari; Mahmoud, Salehi

2013-03-01

To investigate clinical, pathological and mycological findings in canaries, in which pox lesions and Aspergillus fumigatus (A. fumigatus) infection were observed simultaneously. This study was performed on a breeding colony (about 100 canaries) affected by fatal wasting disease. Necropsy was undertaken on 10 severely affected canaries, and gross lesions were recorded. Samples from internal organs displaying lesions were obtained for histopathological evaluation. Tracheal swap samples of internal organs of the all infected animals with lesions at necropsy were cultured in Sabouraud Dextrose Agar for mycological examination. At necropsy, caseous foci were determined in the lungs, on the air sacs, liver, spleen, heart. Swelling of the eyelids, diffuse hemorrhages in the subcutaneous tissue with small papular lesions of the skin were other typical necropsy findings. Histopathologically, pathognomonic eosinophilic intracytoplasmic inclusion bodies, which called Bollinger bodies, in both skin cells and vacuolated air way epithelial cells confirmed canary pox infection. Moreover, histopathological examination of the white-yellowish caseous foci revealed necrotic granulomatous reaction consisting of macrophages, heterophil leukocytes and giant cells encapsulated with a fibrous tissue. After the culture of the tissue samples, the formation of bluish green colonies confirmed A. fumigatus infection. Canary pox has been known as the disease that can result in high losses in a short time, as a re-emerging disease that has not been present during recent years in canary flocks in Iran. So, the current paper provides useful information to prevent misdiagnosed of canary pox disease which can cause secondary mycotic infection.

A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats.

PubMed

Boshra, Hani; Truong, Thang; Nfon, Charles; Bowden, Timothy R; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A; Kara, Pravesh; Mather, Arshad; Wallace, David B; Babiuk, Shawn

2015-11-01

Sheep and goat pox continue to be important livestock diseases that pose a major threat to the livestock industry in many regions in Africa and Asia. Currently, several live attenuated vaccines are available and used in endemic countries to control these diseases. One of these is a partially attenuated strain of lumpy skin disease virus (LSDV), KS-1, which provides cross-protection against both sheep pox and goat pox. However, when used in highly stressed dairy cattle to protect against lumpy skin disease (LSD) the vaccine can cause clinical disease. In order to develop safer vaccines effective against all three diseases, a pathogenic strain of LSDV (Warmbaths [WB], South Africa) was attenuated by removing a putative virulence factor gene (IL-10-like) using gene knockout (KO) technology. This construct (LSDV WB005KO) was then evaluated as a vaccine for sheep and goats against virulent capripoxvirus challenge. Sheep and goats were vaccinated with the construct and the animals were observed for 21days. The vaccine appeared to be safe, and did not cause disease, although it induced minor inflammation at the injection site similar to that caused by other attenuated sheep and goat pox vaccines. In addition, no virus replication was detected in blood, oral or nasal swabs using real-time PCR following vaccination and low levels of neutralising antibodies were detected in both sheep and goats. Leukocytes isolated from vaccinated animals following vaccination elicited capripoxvirus-specific IFN-γ secretion, suggesting that immunity was also T-cell mediated. Following challenge with virulent capripoxvirus, vaccinated sheep and goats were found to be completely protected and exhibited no clinical disease. Furthermore, real-time PCR of blood samples at various time points suggested that viremia was absent in both groups of vaccinated animals, as opposed to capripoxvirus-related clinical disease and viremia observed in the unvaccinated animals. These findings suggest that this novel knockout strain of LSDV has potential as a vaccine to protect livestock against sheep pox and goat pox. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

Use of Quantitative Real-Time PCR for Direct Detection of Serratia marcescens in Marine and Other Aquatic Environments

PubMed Central

Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D.

2014-01-01

Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml−1 and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml−1. This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health. PMID:24375136

Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

PubMed

Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

2014-03-01

Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

Disposal of Hospital Wastes Containing Pathogenic Organisms

DTIC Science & Technology

1979-09-01

virus African swine fever virus Besnoitia besnoiti Borna disease virus Bovine infectious petechial fever virus Camel pox virus Ephemeral fever virus...Sindbis virus Tensaw virus Turlock virus Vaccinia virus Varicella virus Vole rickettsia Yellow fever virus, 17D vaccinL strain 163 Class 3 AlastruLn...Rickettsia - all species except Vole rickettsia when used for transmission or animal inoculation experiments Vesicular stomatitis virus Yellow fever virus

Evaluation of Animal and Plant Pathogens as Terrorism and Warfare Agents, Vectors and Pests

DTIC Science & Technology

2001-09-01

fever virus Bluetongue virus African horse sickness virus Nipah swine encephalitis virus Lumpy skin disease virus Camel pox virus Bacteria Bacillus...anthracis Bulkholderia (Pseudomonas) mallei Brucella spp. Mycoplasmas Contagious bovine (pleuropneum.) (M. mycoides var. mycoides type SC) (CBPP...virus Newcastle disease virus Rinderpest virus Pest des petits ruminants virus Bluetongue virus Teschen disease virus (Porcine enterovirus type 1) Rift

Poly(2-oxazoline)s as Polymer Therapeutics

PubMed Central

Luxenhofer, Robert; Han, Yingchao; Schulz, Anita; Tong, Jing; He, Zhijian; Kabanov, Alexander V.; Jordan, Rainer

2013-01-01

Poly(2-oxazoline)s (POx) are currently discussed as an upcoming platform for biomaterials design and especially for polymer therapeutics. POx meets several requirements needed for the development of next-generation polymer therapeutics such as biocompatibility, high modulation of solubility, variation of size, architecture as well as chemical functionality. Although in the early 1990s first and promising POx-based systems were presented but the field lay dormant for almost two decades. Only very recently, POx based polymer therapeutics came back into the focus of very intensive research. In this review, we give an overview on the chemistry and physicochemical properties of POx and summarize the research of POx-protein conjugates, POx-drug conjugates, POx-based polyplexes and POx micelles for drug delivery. PMID:22865555

Real-time PCR to identify variola virus or other human pathogenic orthopox viruses.

PubMed

Scaramozzino, Natale; Ferrier-Rembert, Audrey; Favier, Anne-Laure; Rothlisberger, Corinne; Richard, Stéphane; Crance, Jean-Marc; Meyer, Hermann; Garin, Daniel

2007-04-01

Variola virus (family Poxviridae, genus Orthopoxvirus) and the closely related cowpox, vaccinia, and monkeypox viruses can infect humans. Efforts are mounting to replenish the smallpox vaccine stocks, optimize diagnostic methods for poxviruses, and develop new antivirals against smallpox, because it is feared that variola virus might be used as a weapon of bioterrorism. We developed an assay for the detection of variola virus DNA. The assay is based on TaqMan chemistry targeting the 14-kD protein gene. For the 1st stage of the assay we used genus consensus primers and a mixture of 2 probes (14-kD POX and 14-kD VAR) spanning the 14-kD protein-encoding gene for detection of all human pathogenic orthopoxviruses. We then tested positive samples with the specific orthopoxvirus-specific probe 14-kD POX to identify monkeypox, cowpox, and vaccinia viruses and with the 14-kD VAR probe to identify variola viruses. The assay was established on 4 different PCR cycler platforms. It was assessed in a study with 85 different orthopoxvirus species and strains that included variola, camelpox, cowpox, monkeypox, and vaccinia viruses at concentrations ranging from 100 ng/L to 1 microg/L. The assay detected as little as 0.05 fg of DNA, corresponding to 25 copies of DNA, and enabled differentiation of variola virus from the other orthopoxviruses. This real-time PCR assay provides a rapid method for the early detection and differentiation of smallpox and other human pathogenic orthopoxvirus infections.

Early signs of recovery of Acropora palmata in St. John, US Virgin Islands

USGS Publications Warehouse

Muller, E.M.; Rogers, Caroline S.; van Woesik, R.

2014-01-01

Since the 1980s, diseases have caused significant declines in the population of the threatened Caribbean coral Acropora palmata. Yet it is largely unknown whether the population densities have recovered from these declines and whether there have been any recent shifts in size-frequency distributions toward large colonies. It is also unknown whether colony size influences the risk of disease infection, the most common stressor affecting this species. To address these unknowns, we examined A. palmata colonies at ten sites around St. John, US Virgin Islands, in 2004 and 2010. The prevalence of white-pox disease was highly variable among sites, ranging from 0 to 53 %, and this disease preferentially targeted large colonies. We found that colony density did not significantly change over the 6-year period, although six out of ten sites showed higher densities through time. The size-frequency distributions of coral colonies at all sites were positively skewed in both 2004 and 2010, however, most sites showed a temporal shift toward more large-sized colonies. This increase in large-sized colonies occurred despite the presence of white-pox disease, a severe bleaching event, and several storms. This study provides evidence of slow recovery of the A. palmata population around St. John despite the persistence of several stressors.

Interacting Populations: Hosts and Pathogens, Prey and Predators

DTIC Science & Technology

2007-06-01

model. The importance of seasonality has been well documented for other diseases. For childhood diseases like measles and chicken pox , seasonality comes...Spaniards and in soime cases reduced indigenous population to one tenth of its preepidemic size the Indian p)op)ulation of Mexico is thought to have been... Mexico (1993-94), striped dolphins (Stenella coeuleoalba) in the Mediterranean Sea (1990- 92) and commoin dolphins (Delphinus delphis) in the Black Sea

Results From the New Jersey Statewide Critical Congenital Heart Defects Screening Program

PubMed Central

Garg, Lorraine F.; Van Naarden Braun, Kim; Knapp, Mary M.; Anderson, Terry M.; Koppel, Robert I.; Hirsch, Daniel; Beres, Leslie M.; Hyg, MS; Sweatlock, Joseph; Olney, Richard S.; Glidewell, Jill; Hinton, Cynthia F.; Kemper, Alex R.

2015-01-01

BACKGROUND AND OBJECTIVE New Jersey was the first state to implement legislatively mandated newborn pulse oximetry screening (POxS) in all licensed birthing facilities to detect critical congenital heart defects (CCHDs). The objective of this report was to evaluate implementation of New Jersey’s statewide POxS mandate. METHODS A 2-pronged approach was used to collect data on infants screened in all New Jersey birthing facilities from August 31, 2011, through May 31, 2012. Aggregate screening results were submitted by each birthing facility. Data on failed screens and clinical characteristics of those newborns were reported to the New Jersey Birth Defects Registry (NJBDR). Three indicators were used to distinguish the added value of mandated POxS from standard clinical care: prenatal congenital heart defect diagnosis, cardiology consultation or echocardiogram indicated or performed before PoxS, or clinical findings at the time of POxS warranting a pulse oximetry measurement. RESULTS Of 75 324 live births in licensed New Jersey birthing facilities, 73 320 were eligible for screening, of which 99% were screened. Forty-nine infants with failed POxS were reported to the NJBDR, 30 of whom had diagnostic evaluations solely attributable to the mandated screening. Three of the 30 infants had previously unsuspected CCHDs and 17 had other diagnoses or non-CCHD echocardiogram findings. CONCLUSIONS In the first 9 months after implementation, New Jersey achieved a high statewide screening rate and established surveillance mechanisms to evaluate the unique contribution of POxS. The screening mandate identified 3 infants with previously unsuspected CCHDs that otherwise might have resulted in significant morbidity and mortality and also identified other significant secondary targets such as sepsis and pneumonia. PMID:23858425

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

9 CFR 113.326 - Avian Pox Vaccine.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Avian Pox Vaccine. 113.326 Section 113... Vaccines § 113.326 Avian Pox Vaccine. Fowl Pox Vaccine and Pigeon Pox Vaccine shall be prepared from virus... this section shall be used for preparing the production seed virus for vaccine production. All serials...

Proline Oxidase (POX) as A Target for Cancer Therapy.

PubMed

Kononczuk, Joanna; Czyzewska, Urszula; Moczydlowska, Joanna; Surażyński, Arkadiusz; Palka, Jerzy; Miltyk, Wojciech

2015-01-01

Proline dehydrogenase/proline oxidase (PRODH/POX) is an enzyme catalyzing the first step of proline degradation, during which ROS and/or ATP is generated. POX is widely distributed in living organisms and is responsible for a number of regulatory processes such as redox homeostasis, osmotic adaptation, cell signaling and oxidative stress. Recent data provided evidence that POX plays an important role in carcinogenesis and tumor growth. POX may induce apoptosis in both intrinsic and extrinsic way. Due to ROS generation, POX may induce caspase-9 activity, which mediates mitochondrial apoptosis (intrinsic apoptosis pathway). POX can also stimulate TRAIL (tumor necrosis factorrelated apoptosis inducing ligand) and DR5 (death receptor 5) expression, resulting in cleavage of procaspase-8 and thus extrinsic apoptotic pathway. However, this tumor suppressor in certain environmental conditions may act as a prosurvival factor. Genotoxic, inflammatory and metabolic stress may switch POX from tumor growth inhibiting to tumor growth supporting factor. The potential mechanisms which may regulate switching of POX mode are discussed in this review.

Pox in mourning doves in the United States

USGS Publications Warehouse

Locke, L.N.

1961-01-01

Pox infection has occurrcd in mourning doves in at least 8 states on 12 separate occasions. Unsuccessful attempts were made to transmit both fowl pox (chicken isolate) and passerine pox (cowbird isolate) to mourning doves.

The Ustilago maydis Effector Pep1 Suppresses Plant Immunity by Inhibition of Host Peroxidase Activity

PubMed Central

Zechmann, Bernd; Hillmer, Morten; Doehlemann, Gunther

2012-01-01

The corn smut Ustilago maydis establishes a biotrophic interaction with its host plant maize. This interaction requires efficient suppression of plant immune responses, which is attributed to secreted effector proteins. Previously we identified Pep1 (Protein essential during penetration-1) as a secreted effector with an essential role for U. maydis virulence. pep1 deletion mutants induce strong defense responses leading to an early block in pathogenic development of the fungus. Using cytological and functional assays we show that Pep1 functions as an inhibitor of plant peroxidases. At sites of Δpep1 mutant penetrations, H2O2 strongly accumulated in the cell walls, coinciding with a transcriptional induction of the secreted maize peroxidase POX12. Pep1 protein effectively inhibited the peroxidase driven oxidative burst and thereby suppresses the early immune responses of maize. Moreover, Pep1 directly inhibits peroxidases in vitro in a concentration-dependent manner. Using fluorescence complementation assays, we observed a direct interaction of Pep1 and the maize peroxidase POX12 in vivo. Functional relevance of this interaction was demonstrated by partial complementation of the Δpep1 mutant defect by virus induced gene silencing of maize POX12. We conclude that Pep1 acts as a potent suppressor of early plant defenses by inhibition of peroxidase activity. Thus, it represents a novel strategy for establishing a biotrophic interaction. PMID:22589719

Characterization of poxviruses from forest birds in Hawaii

USGS Publications Warehouse

Tripathy, Deoki N.; Schnitzlein, William M.; Morris, Patrick J.; Janssen, Don L.; Zuba, Jeffery K.; Massey, Greg; Atkinson, Carter T.

2000-01-01

Two strains of avian pox viruses were isolated from cutaneous lesions in Hawaiian crows (Corvus hawaiiensis) examined in 1994 and a third from a biopsy obtained in 1992 from an infected bird of the Apapane species (Himatione sanguinea) by inoculation of the chorioallantoic membranes (CAM) of developing chicken embryos. The resulting proliferative CAM lesions contained eosinophilic cytoplasmic inclusion bodies characteristic of pox virus infection. The pathogenicity of these three viruses in domestic chickens was mild as evidenced by the development of relatively minor lesions of short duration at the sites of inoculation. Their virulence in this host was similar to that of a fowlpox virus (FPV) vaccine strain and contrasted greatly with the ability of two field strains of FPV to produce extensive proliferative lesions. One of the Hawaiian crow pox virus isolates as well as the one originating from the Apapane species could be propagated in two secondary avian cell lines, QT-35 and LMH. A comparison of the restriction fragment length polymorphisms (RFLP) of the genomes of the two cell line-adapted viruses, generated by EcoRI digestion, revealed a limited degree of similarity. Moreover, neither profile was comparable to those of the two field isolates of FPV, which were almost indistinguishable from each other. Thus, based on the genetic distinctness of the two Hawaiian bird viruses, they appear to represent different strains of avipoxvirus.

Calcium signals and caspase-12 participated in paraoxon-induced apoptosis in EL4 cells.

PubMed

Li, Lan; Cao, Zhiheng; Jia, Pengfei; Wang, Ziren

2010-04-01

In order to investigate whether calcium signals participate in paraoxon (POX)-induced apoptosis in EL4 cells, real-time laser scanning confocal microscopy (LSCM) was used to detect Ca(2+) changes during the POX application. Apoptotic rates of EL4 cells and caspase-12 expression were also evaluated. POX (1-10nM) increased intracellular calcium concentration ([Ca(2+)]i) in EL4 cells in a dose-dependent manner at early stage (0-2h) of POX application, and apoptotic rates of EL4 cells after treatment with POX for 16h were also increased in a dose-dependent manner. Pre-treatment with EGTA, heparin or procaine attenuated POX-induced [Ca(2+)]i elevation and apoptosis. Additionally, POX up-regulated caspase-12 expression in a dose-dependent manner, and pre-treatment with EGTA, heparin or procaine significantly inhibited POX-induced increase of caspase-12 expression. Our results suggested that POX induced [Ca(2+)]i elevation in EL4 cells at the early stage of POX-induced apoptosis, which might involve Ca(2+) efflux from the endoplasmic reticulum (ER) and Ca(2+) influx from extracellular medium. Calcium signals and caspase-12 were important upstream messengers in POX-induced apoptosis in EL4 cells. The ER-associated pathway possibly operated in this apoptosis. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

A POX on Renal Cancer Cells | Center for Cancer Research

Cancer.gov

Proline oxidase, or POX, is an enzyme responsible for metabolizing the amino acid proline. POX contributes to the regulation of cell death that occurs when cellular systems malfunction, a process called apoptosis. Previous studies have determined that levels of POX are reduced in several types of human cancer. Likewise, many cancer cells become resistant to apoptosis, suggesting a link between POX and cancer cell survival.

Efficacy of a commercial canarypox vaccine for protecting Hawai'i 'Amakihi from field isolates of avipoxvirus

USGS Publications Warehouse

Atkinson, Carter T.; Wiegand, Kimberly C.; Triglia, Dennis; Jarvi, Susan I.

2010-01-01

At least three variants of avian pox virus are present in Hawai’i - Fowlpox from domestic poultry and a group of genetically distinct viruses that cluster within two clades (Pox Variant 1 and Pox Variant 2) that are most similar to Canarypox based on DNA sequence of the virus 4b core protein gene. We tested whether Hawai’i ‘Amakihi can be protected from wild virus isolates with an attenuated live Canarypox vaccine that is closely related to isolates that cluster within clade 1 (Pox Variant 1) based on sequence of the attenuated Canarypox virus 4b core protein. Thirty-one (31) Hawai`i ‘Amakihi (Hemignathus virens) with no prior physical evidence of pox infection were collected on Mauna Kea from xeric, high elevation habitats with low pox prevalence and randomly divided into two groups. One group of 16 was vaccinated with Poximmune C® while the other group received a sham vaccination with virus diluent. Four of 15 (27%) vaccinated birds developed potentially life-threatening disseminated lesions or lesions of unusually long duration, while one bird never developed a vaccine-associated lesion or “take”. After vaccine-associated lesions healed, vaccinated birds were randomly divided into three groups of five and challenged with either a wild isolate of Fowlpox, a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 1 (Pox Variant 1) or a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 2 (Pox Variant 2). Similarly, three random groups of five unvaccinated ‘Amakihi were challenged with the same virus isolates. Vaccinated and unvaccinated ‘Amakihi challenged with Fowlpox had transient infections with no clinical signs of infection. Mortality in vaccinated ‘Amakihi that were challenged with Pox Variant 1 and Pox Variant 2 ranged from 0% (0/5) for Pox Variant 1 to 60% (3/5) for Pox Variant 2. Mortality in unvaccinated ‘Amakihi ranged from 40% (2/5) for Pox Variant 1 to 100% (5/5) for Pox Variant 2. While the vaccine provided some protection against Pox Variant 1, serious side effects and low efficacy against Pox Variant 2 make it risky to use in captive or wild honeycreepers.

Efficacy of commercial canarypox vaccine for protecting Hawai'i 'Amakihi from field isolates of Avipoxvirus

USGS Publications Warehouse

Atkinson, Carter T.; Wiegand, Kimberly C.; Triglia, Dennis; Jarvi, Susan I.

2010-01-01

At least three variants of avian pox virus are present in Hawai‘i - Fowlpox from domestic poultry and a group of genetically distinct viruses that cluster within two clades (Pox Variant 1 and Pox Variant 2) that are most similar to Canarypox based on DNA sequence of the virus 4b core protein gene. We tested whether Hawai‘i ‘Amakihi can be protected from wild virus isolates with an attenuated live Canarypox vaccine that is closely related to isolates that cluster within clade 1 (Pox Variant 1) based on sequence of the attenuated Canarypox virus 4b core protein. Thirty-one (31) Hawai`i ‘Amakihi (Hemignathus virens) with no prior physical evidence of pox infection were collected on Mauna Kea from xeric, high elevation habitats with low pox prevalence and randomly divided into two groups. One group of 16 was vaccinated with Poximmune C® while the other group received a sham vaccination with virus diluent. Four of 15 (27%) vaccinated birds developed potentially life-threatening disseminated lesions or lesions of unusually long duration, while one bird never developed a vaccine-associated lesion or "take". After vaccine-associated lesions healed, vaccinated birds were randomly divided into three groups of five and challenged with either a wild isolate of Fowlpox, a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 1 (Pox Variant 1) or a Hawai`i `Amakihi isolate of a Canarypox-like virus from clade 2 (Pox Variant 2). Similarly, three random groups of five unvaccinated ‘Amakihi were challenged with the same virus isolates. Vaccinated and unvaccinated ‘Amakihi challenged with Fowlpox had transient infections with no clinical signs of infection. Mortality in vaccinated ‘Amakihi that were challenged with Pox Variant 1 and Pox Variant 2 ranged from 0% (0/5) for Pox Variant 1 to 60% (3/5) for Pox Variant 2. Mortality in unvaccinated ‘Amakihi ranged from 40% (2/5) for Pox Variant 1 to 100% (5/5) for Pox Variant 2. While the vaccine provided some protection against Pox Variant 1, serious side effects and low efficacy against Pox Variant 2 make it risky to use in captive or wild honeycreepers.

Culture-dependent and culture-independent analyses reveal no prokaryotic community shifts or recovery of Serratia marcescens in Acropora palmata with white pox disease.

PubMed

Lesser, Michael P; Jarett, Jessica K

2014-06-01

Recently, the etiological agent of white pox (WP) disease, also known as acroporid serratiosis, in the endangered coral Acropora palmata is the enteric bacterium Serratia marcescens with the source being localized sewage release onto coastal coral reef communities. Here, we show that both culture-dependent and culture-independent approaches could not recover this bacterium from samples of tissue and mucus from A. palmata colonies affected by WP disease in the Bahamas, or seawater collected adjacent to A. palmata colonies. Additionally, a metagenetic 16S rRNA pyrosequencing study shows no significant difference in the bacterial communities of coral tissues with and without WP lesions. As recent studies have shown for other coral diseases, S. marcescens cannot be identified in all cases of WP disease in several geographically separated populations of A. palmata with the same set of signs. As a result, its identification as the etiological agent of WP disease, and cause of a reverse zoonosis, cannot be broadly supported. However, the prevalence of WP disease associated with S. marcescens does appear to be associated with proximity to population centers, and research efforts should be broadened to examine this association, and to identify other causes of this syndrome. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Calcium plays a key role in paraoxon-induced apoptosis in EL4 cells by regulating both endoplasmic reticulum- and mitochondria-associated pathways.

PubMed

Li, Lan; Du, Yi; Ju, Furong; Ma, Shunxiang; Zhang, Shengxiang

2016-01-01

Paraoxon (POX) is one of the most toxic organophosphorus pesticides, but its toxic mechanisms associated with apoptosis remain unclear. The aim of this study was to investigate calcium-associated mechanisms in POX-induced apoptosis in EL4 cells. EL4 cells were exposed to POX for 0-16 h. EGTA was used to chelate Ca(2+ ) in extracellular medium, and heparin and procaine were used to inhibit Ca(2+ )efflux from the endoplasmic reticulum (ER). Z-ATAD-FMK was used to inhibit caspase-12 activity. The apoptotic rate assay, western blotting and immunocytochemistry (ICC) were used to reveal the mechanisms of POX-induced apoptosis. POX significantly increased the expression and activation of caspase-12 and caspase-3, enhanced expression of calpain 1 and calpain 2, and induced the release of cyt c, but did not change the expression of Grp 78. Inhibiting caspase-12 activity alleviated POX-induced upregulation of calpain 1 and caspase-3, promoted POX-induced upregulation of calpain 2, and reduced POX-induced cyt c release, suggesting that there was a cross-talk between the ER-associated pathway and mitochondria-associated apoptotic signals. Attenuating intracellular calcium concentration with EGTA, heparin or procaine decreased POX-induced upregulation of calpain 1, calpain 2, caspase-12 and caspase-3, and reduced POX-induced cyt c release. After pretreatment with EGTA or procaine, POX significantly promoted expression of Grp 78. Calcium played a key role in POX-induced apoptosis in EL4 cells by regulating both ER- and mitochondria-associated pathways. The cross-talk of ER- and mitochondria-associated pathways was accomplished through calcium signal.

Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model.

PubMed

Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy

2017-01-01

The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

Hairy root transgene expression analysis of a secretory peroxidase (PvPOX1) from common bean infected by Fusarium wilt.

PubMed

Xue, Renfeng; Wu, Xingbo; Wang, Yingjie; Zhuang, Yan; Chen, Jian; Wu, Jing; Ge, Weide; Wang, Lanfen; Wang, Shumin; Blair, Matthew W

2017-07-01

Plant peroxidases (POXs) are one of the most important redox enzymes in the defense responses. However, the large number of different plant POX genes makes it necessary to carefully confirm the function of each paralogous POX gene in specific tissues and disease interactions. Fusarium wilt is a devastating disease of common bean caused by Fusarium oxysporum f. sp. phaseoli. In this study, we evaluated a peroxidase gene, PvPOX1, from a resistant common bean genotype, CAAS260205 and provided direct evidence for PvPOX1's role in resistance by transforming the resistant allele into a susceptible common bean genotype, BRB130, via hairy root transformation using Agrobacterium rhizogenes. Analysis of PvPOX1 gene over-expressing hairy roots showed it increased resistance to Fusarium wilt both in the roots and the rest of transgenic plants. Meanwhile, the PvPOX1 expressive level, the peroxidase activity and hydrogen peroxide (H 2 O 2 ) accumulation were also enhanced in the interaction. The result showed that the PvPOX1 gene played an essential role in Fusarium wilt resistance through the occurrence of reactive oxygen species (ROS) induced hypersensitive response. Therefore, PvPOX1 expression was proven to be a valuable gene for further analysis which can strengthen host defense response against Fusarium wilt through a ROS activated resistance mechanism. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of status epilepticus, sustained calcium elevations and neuronal injury in a rat survival model of lethal paraoxon intoxication

PubMed Central

Deshpande, Laxmikant S.; Carter, Dawn S.; Phillips, Kristin F.; Blair, Robert E.; DeLorenzo, Robert J.

2014-01-01

Paraoxon (POX) is an active metabolite of organophosphate (OP) pesticide parathion that has been weaponized and used against civilian populations. Exposure to POX produces high mortality. OP poisoning is often associated with chronic neurological disorders. In this study, we optimize a rat survival model of lethal POX exposures in order to mimic both acute and long-term effects of POX intoxication. Male Sprague-Dawley rats injected with POX (4 mg/kg, ice-cold PBS, s.c.) produced a rapid cholinergic crisis that evolved into status epilepticus (SE) and death within 6–8 min. The EEG profile for POX induced SE was characterized and showed clinical and electrographic seizures with 7–10 Hz spike activity. Treatment of 100% lethal POX intoxication with an optimized three drug regimen (atropine, 2 mg/kg, i.p., 2-PAM, 25 mg/kg, i.m. and diazepam, 5 mg/kg, i.p.) promptly stopped SE and reduced acute mortality to 12% and chronic mortality to 18%. This model is ideally suited to test effective countermeasures against lethal POX exposure. Animals that survived the POX SE manifested prolonged elevations in hippocampal [Ca2+]i (Ca2+ plateau) and significant multifocal neuronal injury. POX SE induced Ca2+ plateau had its origin in Ca2+ release from intracellular Ca2+ stores since inhibition of ryanodine/ IP3 receptor lowered elevated Ca2+ levels post SE. POX SE induced neuronal injury and alterations in Ca2+ dynamics may underlie some of the long term morbidity associated with OP toxicity. PMID:24785379

75 FR 81087 - Plum Pox Virus; Update of Quarantined Areas

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-27

.... APHIS-2010-0089] Plum Pox Virus; Update of Quarantined Areas AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Interim rule and request for comments. SUMMARY: We are amending the plum pox virus.... SUPPLEMENTARY INFORMATION: Background The plum pox virus (PPV) is an extremely serious viral disease of plants...

Chicken pox in pregnancy : an obstetric concern.

PubMed

Wiwanitkit, Viroj

2010-10-01

Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken pox on pregnancy as well as the vertical transmission are also documented.

CHICKEN POX IN PREGNANCY : AN OBSTETRIC CONCERN

PubMed Central

Wiwanitkit, Viroj

2010-01-01

Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken pox on pregnancy as well as the vertical transmission are also documented. PMID:21430880

Virus variants with differences in the P1 protein coexist in a Plum pox virus population and display particular host-dependent pathogenicity features.

PubMed

Maliogka, Varvara I; Salvador, Beatriz; Carbonell, Alberto; Sáenz, Pilar; León, David San; Oliveros, Juan Carlos; Delgadillo, Ma Otilia; García, Juan Antonio; Simón-Mateo, Carmen

2012-10-01

Subisolates segregated from an M-type Plum pox virus (PPV) isolate, PPV-PS, differ widely in pathogenicity despite their high degree of sequence similarity. A single amino acid substitution, K109E, in the helper component proteinase (HCPro) protein of PPV caused a significant enhancement of symptom severity in herbaceous hosts, and notably modified virus infectivity in peach seedlings. The presence of this substitution in certain subisolates that induced mild symptoms in herbaceous hosts and did not infect peach seedlings suggested the existence of uncharacterized attenuating factors in these subisolates. In this study, we show that two amino acid changes in the P1 protein are specifically associated with the mild pathogenicity exhibited by some PS subisolates. Site-directed mutagenesis studies demonstrated that both substitutions, W29R and V139E, but especially W29R, resulted in lower levels of virus accumulation and symptom severity in a woody host, Prunus persica. Furthermore, when W29R and V139E mutations were expressed concomitantly, PPV infectivity was completely abolished in this host. In contrast, the V139E substitution, but not W29R, was found to be responsible for symptom attenuation in herbaceous hosts. Deep sequencing analysis demonstrated that the W29R and V139E heterogeneities already existed in the original PPV-PS isolate before its segregation in different subisolates by local lesion cloning. These results highlight the potential complexity of potyviral populations and the relevance of the P1 protein of potyviruses in pathogenesis and viral adaptation to the host. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

Proline oxidase promotes tumor cell survival in hypoxic tumor microenvironments

PubMed Central

Liu, Wei; Glunde, Kristine; Bhujwalla, Zaver M.; Raman, Venu; Sharma, Anit; Phang, James M.

2012-01-01

Proline is a readily released stress substrate that can be metabolized by proline oxidase (POX) to generate either reactive oxygen species to induce apoptosis or autophagy or ATP during times of nutrient stress. However, the contribution of proline metabolism to tumorigenesis in hypoxic microenvironments has not been explored. In this study, we investigated the different functions of POX under hypoxia and glucose depletion. We found that hypoxia induced POX expression in cancer cells in vitro and that POX upregulation co-localized with hypoxic tissues in vivo. In addition, the combination of hypoxia and low-glucose showed additive effects on POX expression. Similar to conditions of low glucose, hypoxia-mediated POX induction was dependent on AMP-activated protein kinase (AMPK) activation, but was independent of HIF-1α and HIF-2α. Under low-glucose and combined low-glucose and hypoxic conditions, proline catabolized by POX was used preferentially for ATP production, whereas under hypoxia, POX mediated autophagic signaling for survival by generating ROS. Although the specific mechanism was different for hypoxia and glucose deprivation, POX consistently contributed to tumor cell survival under these conditions. Together, our findings offer new insights into the metabolic reprogramming of tumor cells present within a hostile microenvironment and suggest that proline metabolism is a potential target for cancer therapeutics. PMID:22609800

Seroprevalence of fowl pox antibody in indigenous chickens in jos north and South council areas of plateau state, Nigeria: implication for vector vaccine.

PubMed

Adebajo, Meseko Clement; Ademola, Shittu Ismail; Oluwaseun, Akinyede

2012-01-01

Fowl pox is a viral disease of domestic and wild birds. The large size of the genome makes it a useful vector for recombinant DNA technology. Although the disease has been described in both commercial and indigenous chickens in Nigeria, data are limited on seroprevalence in free range chickens. Such data are, however, important in the design and implementation of fowl pox virus vector vaccine. We surveyed current antibody status to fowl pox virus in free range chickens by testing 229 sera collected from 10 villages in Jos North and Jos South LGA of Plateau State Nigeria. Sera were analyzed by AGID against standard fowl pox antigen. Fifty-two of the 229 (23%) tested sera were positive for fowl pox virus antibody, and the log titre in all positive specimen was >2. Thirty (21%) and twenty-two (27%) of the samples from Jos South and Jos North, respectively, tested positive. This was, however, not statistically significant (P = 0.30). Generally the study showed a significant level of antibody to fowl pox virus in the study area. This observation may hinder effective use of fowl pox vectored viral vaccine. Fowl pox control is recommended to reduce natural burden of the disease.

Seroprevalence of Fowl Pox Antibody in Indigenous Chickens in Jos North and South Council Areas of Plateau State, Nigeria: Implication for Vector Vaccine

PubMed Central

Adebajo, Meseko Clement; Ademola, Shittu Ismail; Oluwaseun, Akinyede

2012-01-01

Fowl pox is a viral disease of domestic and wild birds. The large size of the genome makes it a useful vector for recombinant DNA technology. Although the disease has been described in both commercial and indigenous chickens in Nigeria, data are limited on seroprevalence in free range chickens. Such data are, however, important in the design and implementation of fowl pox virus vector vaccine. We surveyed current antibody status to fowl pox virus in free range chickens by testing 229 sera collected from 10 villages in Jos North and Jos South LGA of Plateau State Nigeria. Sera were analyzed by AGID against standard fowl pox antigen. Fifty-two of the 229 (23%) tested sera were positive for fowl pox virus antibody, and the log titre in all positive specimen was >2. Thirty (21%) and twenty-two (27%) of the samples from Jos South and Jos North, respectively, tested positive. This was, however, not statistically significant (P = 0.30). Generally the study showed a significant level of antibody to fowl pox virus in the study area. This observation may hinder effective use of fowl pox vectored viral vaccine. Fowl pox control is recommended to reduce natural burden of the disease. PMID:23762578

[Impact of universal vaccination against chicken pox in Navarre, 2006-2010].

PubMed

Cenoz, M García; Catalán, J Castilla; Zamarbide, F Irisarri; Berastegui, M Arriazu; Gurrea, A Barricarte

2011-01-01

In 2007 universal vaccination against chicken pox was introduced in the vaccine calendar of Navarre. The aim of this study is to evaluate the impact of this measure on the incidence of chicken pox in both the vaccinated cohorts (direct effect) and in the unvaccinated cohorts (indirect effect). Chicken pox is a disease of individualized compulsory notification. We analyzed the annual incidence by age groups between 2006 and 2010. Hospital admittances with chicken pox or complicated chicken pox as the principal diagnosis were taken from the minimum basic data set on hospital discharges for the years 2006 to 2009. The incidence of chicken pox has fallen by 93.0%, from 8.04 cases per 1,000 inhabitants in 2006 to 0.56 per 1,000 inhabitants in 2010 (p<0,0001). In children from 1 to 6 years (vaccinated cohorts), the incidence of chicken pox has fallen by 96.3%. In the cohorts vaccinated at 10 and 14 years, a fall of 93.6% can also be observed in children from 10 to 14 years, and of 85.0% in those of 15 to 19 years. In the unvaccinated age groups we can observe falls of 88.2% in children under one year, of 73.3% in those of 7 to 9 years, and of 84.6% in people over 20 years. In 2006 there were 25 hospital admissions due to chicken pox in Navarre and in 2009 this figure fell to 7. The rate of admissions fell by 71%. The introduction of universal chicken pox vaccination in Navarre has resulted in a rapid and very steep reduction of the incidence of chicken pox in both vaccinated and unvaccinated people.

A POX on Renal Cancer Cells | Center for Cancer Research

Cancer.gov

Proline oxidase, or POX, is an enzyme responsible for metabolizing the amino acid proline. POX contributes to the regulation of cell death that occurs when cellular systems malfunction, a process called apoptosis. Previous studies have determined that levels of POX are reduced in several types of human cancer. Likewise, many cancer cells become resistant to apoptosis,

Loop-mediated isothermal amplification assay for rapid and sensitive detection of sheep pox and goat pox viruses in clinical samples.

PubMed

Venkatesan, G; Balamurugan, V; Bhanuprakash, V; Singh, R K; Pandey, A B

2016-06-01

A Loop-mediated isothermal amplification (LAMP) assay targeting the highly conserved DNA polymerase gene of capripox virus genome was developed and evaluated for rapid detection of sheep pox and goat pox viruses. The optimized LAMP assay is found specific and sensitive for amplification of target DNA with a diagnostic sensitivity and specificity of 96.6% and 100% respectively compared to quantitative PCR. The detection rate of LAMP, PCR and Q-PCR assays is found to be 81.5%, 67% and 83% respectively. This LAMP assay has the potential for rapid clinical diagnosis and surveillance of sheep pox and goat pox in field diagnostic laboratories. Copyright © 2016 Elsevier Ltd. All rights reserved.

[EFFECTIVENESS OF PREVENTIVE VACCINE PROPHYLAXIS OF CHICKEN POX IN MILITARY COLLECTIVES].

PubMed

Dubodelov, D V; Rybin, V V; Rikhter, V V; Yaroslavtsev, V V; Gritsik, A A; Kazanova, A S; Lavrov, V F; Semenenko, T A; Kuzin, S N

2015-01-01

Study the effectiveness of preventive vaccine prophylaxis of chicken pox in military collectives. In the focus of chicken pox, 200 servicemen of the new addition by conscription were immunized once against chicken pox; 97 servicemen by conscription of the new addition (comparison group) were not vaccinated. Epidemiologic and immunologic effectiveness of conduction of preventive vaccine prophylaxis in chicken pox focus were studied. In the group of 200 soldiers, that were present in the focus of infection and were immunized once against chicken pox, only 2 cases of this disease were registered (10 per thousand). In the comparison group, that consisted of 97 unvaccinated servicemen, chicken pox disease was registered in 7 individuals (72 per thousand). Epidemiologic effectiveness of preventive vaccine prophylaxis of chicken pox amounted to 86%. Immunologic effectiveness of vaccination 2-3 weeks after the immunization was 42%, and 2 months after--44%. Local reactions in the form of hyperemia (up to 1.5 cm) and edema were noted in 10% of the vaccinated at the location of preparation administration; in 1.7%--general reaction in the form of temperature increase to 37.8°C was observed. Post-vaccinal complications in the immunized group were not detected. Preventive vaccination of servicemen allows to minimize the spread of chicken pox, however can not serve as means of complete elimination of the infection from military collectives.

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

Interpersonal Tension: A Two-Factor Approach to the POX Situation.

ERIC Educational Resources Information Center

Gupta, Mahesh

1985-01-01

A theoretical explanation, in terms of a two-factor approach to a Person-Other-Issue (POX) Situation is offered, in an attempt to fill the void that exists in the face of the Heider-Newcomb controversy about POX balance. Validity and parsimony is demonstrated by applying it to some of the POX data reported in earlier studies. (Author/BL)

A serological survey for pathogens in old fancy chicken breeds in central and eastern part of The Netherlands.

PubMed

de Wit, J J; van Eck, J H; Crooijmans, R P; Pijpers, A

2004-05-15

To get an impression of the presence of pathogens in multi-aged flocks of old fancy chicken breeds in the Netherlands, plasma samples originating from 24 flocks were examined for antibodies against 17 chicken pathogens. These flocks were housed mainly in the centre and east of the Netherlands, regions with a high poultry density. The owners of the tested flocks showed their chicken at national and international poultry exhibitions. Antibodies against Avian Influenza, Egg Drop Syndrome '76 virus, Pox virus, Salmonella pullorum/gallinarum, Salmonella Enteritidis or Salmonella Typhimurium were not detected. However, antibodies against other Salmonella species, Mycoplasma gallisepticum, infectious bursal disease virus, infectious bronchitis virus, avian encephalomyelitis virus, chicken anaemia virus, infectious laryngotracheitis virus, and avian leukosis virus, subgroups A and B, and subgroup J were detected in a varying proportion of the flocks. This study shows that antibodies against many chicken pathogens are present among the flocks of old fancy chicken breeds that are exhibited at international poultry exhibitions.

Plant defense induced in in vitro propagated banana (Musa paradisiaca) plantlets by Fusarium derived elicitors.

PubMed

Patel, Miral; Kothari, I L; Mohan, J S S

2004-07-01

Perception of microbial signal molecules is part of the strategy evolved by plants to survive attacks by potential pathogens. To gain a more complete understanding of the early signaling events involved in these responses, we used fungal components of Fusarium under in vitro condition and checked the rise in signal molecule, salicylic acid (SA), and marker enzymes in defense reactions against the pathogen. SA level increased by 21 folds in elicitor treated plantlets as compared to that of control plantlets and there was marked increase in phenylalanine ammonia-lyase(PAL), peroxidase(POX), polyphenol oxidase(PPO) along with higher total phenolic content. Present results indicated that use of fungal components had successfully induced systemic resistance in in vitro cultured banana plantlets.

Emergence of a Novel Avian Pox Disease in British Tit Species

PubMed Central

Lawson, Becki; Lachish, Shelly; Colvile, Katie M.; Durrant, Chris; Peck, Kirsi M.; Toms, Mike P.; Sheldon, Ben C.; Cunningham, Andrew A.

2012-01-01

Avian pox is a viral disease with a wide host range. In Great Britain, avian pox in birds of the Paridae family was first diagnosed in a great tit (Parus major) from south-east England in 2006. An increasing number of avian pox incidents in Paridae have been reported each year since, indicative of an emergent infection. Here, we utilise a database of opportunistic reports of garden bird mortality and morbidity to analyse spatial and temporal patterns of suspected avian pox throughout Great Britain, 2006–2010. Reports of affected Paridae (211 incidents) outnumbered reports in non-Paridae (91 incidents). The majority (90%) of Paridae incidents involved great tits. Paridae pox incidents were more likely to involve multiple individuals (77.3%) than were incidents in non-Paridae hosts (31.9%). Unlike the small wart-like lesions usually seen in non-Paridae with avian pox in Great Britain, lesions in Paridae were frequently large, often with an ulcerated surface and caseous core. Spatial analyses revealed strong clustering of suspected avian pox incidents involving Paridae hosts, but only weak, inconsistent clustering of incidents involving non-Paridae hosts. There was no spatial association between Paridae and non-Paridae incidents. We documented significant spatial spread of Paridae pox from an origin in south-east England; no spatial spread was evident for non-Paridae pox. For both host clades, there was an annual peak of reports in August/September. Sequencing of the avian poxvirus 4b core protein produced an identical viral sequence from each of 20 great tits tested from Great Britain. This sequence was identical to that from great tits from central Europe and Scandinavia. In contrast, sequence variation was evident amongst virus tested from 17 non-Paridae hosts of 5 species. Our findings show Paridae pox to be an emerging infectious disease in wild birds in Great Britain, apparently originating from viral incursion from central Europe or Scandinavia. PMID:23185231

Emergence of a novel avian pox disease in British tit species.

PubMed

Lawson, Becki; Lachish, Shelly; Colvile, Katie M; Durrant, Chris; Peck, Kirsi M; Toms, Mike P; Sheldon, Ben C; Cunningham, Andrew A

2012-01-01

Avian pox is a viral disease with a wide host range. In Great Britain, avian pox in birds of the Paridae family was first diagnosed in a great tit (Parus major) from south-east England in 2006. An increasing number of avian pox incidents in Paridae have been reported each year since, indicative of an emergent infection. Here, we utilise a database of opportunistic reports of garden bird mortality and morbidity to analyse spatial and temporal patterns of suspected avian pox throughout Great Britain, 2006-2010. Reports of affected Paridae (211 incidents) outnumbered reports in non-Paridae (91 incidents). The majority (90%) of Paridae incidents involved great tits. Paridae pox incidents were more likely to involve multiple individuals (77.3%) than were incidents in non-Paridae hosts (31.9%). Unlike the small wart-like lesions usually seen in non-Paridae with avian pox in Great Britain, lesions in Paridae were frequently large, often with an ulcerated surface and caseous core. Spatial analyses revealed strong clustering of suspected avian pox incidents involving Paridae hosts, but only weak, inconsistent clustering of incidents involving non-Paridae hosts. There was no spatial association between Paridae and non-Paridae incidents. We documented significant spatial spread of Paridae pox from an origin in south-east England; no spatial spread was evident for non-Paridae pox. For both host clades, there was an annual peak of reports in August/September. Sequencing of the avian poxvirus 4b core protein produced an identical viral sequence from each of 20 great tits tested from Great Britain. This sequence was identical to that from great tits from central Europe and Scandinavia. In contrast, sequence variation was evident amongst virus tested from 17 non-Paridae hosts of 5 species. Our findings show Paridae pox to be an emerging infectious disease in wild birds in Great Britain, apparently originating from viral incursion from central Europe or Scandinavia.

The role of nitric oxide in basal and induced resistance in relation with hydrogen peroxide and antioxidant enzymes.

PubMed

Keshavarz-Tohid, Vahid; Taheri, Parissa; Taghavi, Seyed Mohsen; Tarighi, Saeed

2016-07-20

Nitric oxide (NO) is one of the main signal molecules, which is involved in plant growth and development and can change regular physiological activity in biotic and abiotic stresses. In this study, the role of NO in induced resistance with Pseudomonas fluorescent (CHA0) and basal resistance against Rhizoctonia solani in bean plant was investigated. Our results revealed that P. fluorescent and R. solani can increase NO production at 6h post inoculation (hpi). Also, using the NO donor S-nitroso-N-acetyl D-penicillamine (SNAP) led to increase NO and bean plant resistance against R. solani. Utilizing the NO scavenger, 2-(4-carboxyphenyl)-4,4,5,5-tetramethy-limidazoline-1-oxyl-3-oxide (cPTIO), not only decreased basal resistance but also reduced induced resistance. In continue, the activity of antioxidant enzymes was studied in the former treatments. SNAP, CHA0 and R. solani increased the activity of peroxidase (POX), catalase (CAT) and ascorbate peroxidase (APX) at 6, 12 and 24h post inoculation (hpi). In contrast, using cPTIO and R. solani simultaneously (cPTIO+R) showed reduction in activity of POX and APX at 6 hpi. The cPTIO+R treatment increased POX, APX and CAT activity at 12 and 24 hpi. Hydrogen peroxide (H 2 O 2 ) monitoring in the leaf discs clarified that SNAP can increase H 2 O 2 production like CHA0 and R. solani. On the other hand, SNAP increased the resistance level of leaf discs against R. solani. Treating the leaf discs with cPTIO led to decrease resistance against the pathogen. These leaf discs showed reduction in H 2 O 2 production at 6 hpi and suddenly enhanced H 2 O 2 generation was observed at 24hpi. This study showed that CHA0 can increase NO level in bean plants. NO induced H 2 O 2 generation and regulated redox state of the host plant. This interaction resulted in significant defense against the pathogen. Copyright © 2016 Elsevier GmbH. All rights reserved.

From backwater to mainstream

USGS Publications Warehouse

Allen, J.A.

1993-01-01

Pox infection has occurrcd in mourning doves in at least 8 states on 12 separate occasions. Unsuccessful attempts were made to transmit both fowl pox (chicken isolate) and passerine pox (cowbird isolate) to mourning doves.

Evaluation of Cytology for Diagnosing Avian Pox in Wild Turkeys ( Meleagris gallopavo).

PubMed

Hydock, Kira; Brown, Holly; Nemeth, Nicole; Poulson, Rebecca; Casalena, Mary Jo; Johnson, Joshua B; Brown, Justin

2018-03-01

Avian pox virus is a common cause of proliferative skin disease in wild turkeys ( Meleagris gallopavo); however, other etiologies may produce grossly indistinguishable lesions. Common methods for diagnosing avian pox include histopathology, virus isolation, and PCR. While these methods are sufficient in most cases, each has their limitations. Cytology is a cost-effective and rapid approach that may be useful when traditional diagnostics are not feasible. The objective of this study was to evaluate the performance of cytology relative to histopathology and PCR for avian pox diagnosis in wild turkeys. Fifty wild turkeys were submitted for necropsy due to nodular skin lesions on unfeathered skin of the head. Of these, five had similar skin lesions on the unfeathered legs and 26 had plaques on the mucosa of the oropharynx or esophagus. Representative skin, oropharyngeal, and esophageal lesions from all birds were examined with cytology and histopathology. Skin lesions on the head of each bird were also tested for avian pox virus via PCR. Histopathology and PCR were equally sensitive in diagnosing avian pox from skin lesions on the head. There were no significant differences between cytologic and histopathologic diagnosis of avian pox from skin lesions on the head (sensitivity = 97.4%, specificity = 100.0%), legs (sensitivity = 75.0%, specificity = 100.0%), or from lesions in the oropharynx and esophagus (sensitivity of 62.5%). Similarly, there were no significant differences between PCR and cytology for diagnosis of pox viral skin lesions of the head. Relative to PCR detection of avian pox virus, cytology had a sensitivity of 90.0% and a specificity of 90.0%. These results suggest that cytology is a useful tool for diagnosis of avian pox in wild turkeys.

Squamous cell carcinoma-like and pox lesions occurring simultaneously in chorioallantoic membranes of chicken embryos inoculated with materials from squamous cell carcinoma and pox lesions in broiler chickens.

PubMed

Fallavena, L C; Rodrigues, N C; Moraes, H L; Salle, C T; da Silva, A B; Nascimento, V P; Rodrigues, O

1997-01-01

The finding of closely associated squamous cell carcinoma (SCC)-like lesions and pox lesions in chorioallantoic membranes (CAMs) inoculated with skin and palate samples taken from broilers is described. The samples were obtained from two broilers coming from different flocks that were not vaccinated against fowl pox. Both birds presented skin lesions, which were diagnosed in one bird as fowl pox, and in the other as SCC. After inoculation of CAMs with fresh tissues from both birds, histologic examination revealed, in all CAMs, lesions that were characteristic of fowl pox together with lesions consistent with those seen in the skin of broilers affected with SCC. This finding was unexpected and may shed some light on the etiology of SCC.

Sub-chronic exposure to paraoxon neither induces nor exacerbates diabetes mellitus in Wistar rat.

PubMed

Nurulain, Syed M; Petroianu, Georg; Shafiullah, Mohamed; Kalász, Huba; Oz, Murat; Saeed, Tariq; Adem, Abdu; Adeghate, Ernest

2013-10-01

There is an increasing belief that organophosphorus compounds (OPCs) impair glucose homeostasis and cause hyperglycemia and diabetes mellitus. The present study was undertaken to investigate the putative diabetogenic effect of sub-lethal and sub-chronic exposure to paraoxon (POX), an extremely hazardous OPC used in pesticides. The effect of paraoxon on streptozotocin-induced diabetic rats was also examined. Each rat was injected with 100 nmol of POX 5 days per week for 6 weeks. Blood glucose levels and red blood cell acetylcholinesterase activity were measured weekly. Biochemical analysis and morphological studies were performed at the end of the experiment. The results revealed that POX neither induces nor exacerbates diabetes mellitus in experimental rats. Liver and kidney/body weight ratios revealed statistically insignificant differences when compared with controls. Biochemical analysis of urine samples showed a small but not significant increase in protein level in all groups. Urine bilirubin was significantly higher in the diabetes + POX group when compared with the control group. The number of blood cells in urine was significantly higher in the POX-treated group compared with the control group. Hyperglycemia was noted in the diabetes and diabetes + POX groups, but neither in the saline control nor in POX-treated normal rats. Electron microscopy of POX-treated pancreas did not show any morphological changes in beta cells. These results suggest that POX does not cause diabetes mellitus at sub-lethal sub-chronic exposure. Copyright © 2012 John Wiley & Sons, Ltd.

Prey: Thamnophis hammondii (Two-striped Garter Snake)

USGS Publications Warehouse

Ervin, E.L.; Fisher, R.N.

2001-01-01

Pox infection has occurrcd in mourning doves in at least 8 states on 12 separate occasions. Unsuccessful attempts were made to transmit both fowl pox (chicken isolate) and passerine pox (cowbird isolate) to mourning doves.

Molecular detection of avian pox virus from nodular skin and mucosal fibrinonecrotic lesions of Iranian backyard poultry.

PubMed

Gholami-Ahangaran, Majid; Zia-Jahromi, Noosha; Namjoo, Abdolrasul

2014-02-01

In recent years, some outbreaks of skin lesions suspected to be avian pox were observed in the backyard poultry in different parts of western areas in Iran. Consequently, 328 backyard poultries with suspected signs of avian pox virus infection were sampled. All birds showed nodular lesions on unfeathered head skin and/or fibronecrotic lesions on mucus membrane of the oral cavity and upper respiratory tract. For histopathological analysis, the sections of tissue samples from cutaneous lesions of examined birds were stained with H&E method. For PCR, after DNA extraction a 578-bp fragment of avian pox virus from 4b core protein gene was amplified. Results showed 217 and 265 out of 328 (66.1 and 80.7%, respectively) samples were positive for avian pox virus on histopathological and PCR examination, respectively. In this study, the samples that had intracytoplasmic inclusion bodies on pathologic examination were PCR positive. This study revealed that PCR is a valuable tool for identification of an avian pox virus and that the frequency of pox infection in backyard poultry in western areas of Iran is high.

Biological Warfare Improved Response Program (BW-IRP) CDC/DoD Smallpox Workshop

DTIC Science & Technology

2005-01-01

national surveillance effort. Awareness of unique symptoms will need to be raised by training clinicians. For example, adults presenting with chicken pox ...no case definitions but rather visual recognition cards. Presently, the chicken pox definition has been modified to create a smallpox definition. The...the last 2 weeks • Pharmaceuticals prescribed or issued for chicken pox • A number of suspected cases of chicken pox • Reports of rashes, especially a

Avian pox in Magellanic Penguins (Spheniscus magellanicus).

PubMed

Kane, Olivia J; Uhart, Marcela M; Rago, Virginia; Pereda, Ariel J; Smith, Jeffrey R; Van Buren, Amy; Clark, J Alan; Boersma, P Dee

2012-07-01

Avian pox is an enveloped double-stranded DNA virus that is mechanically transmitted via arthropod vectors or mucosal membrane contact with infectious particles or birds. Magellanic Penguins (Spheniscus magellanicus) from two colonies (Punta Tombo and Cabo Dos Bahías) in Argentina showed sporadic, nonepidemic signs of avian pox during five and two of 29 breeding seasons (1982-2010), respectively. In Magellanic Penguins, avian pox expresses externally as wart-like lesions around the beak, flippers, cloaca, feet, and eyes. Fleas (Parapsyllus longicornis) are the most likely arthropod vectors at these colonies. Three chicks with cutaneous pox-like lesions were positive for Avipoxvirus and revealed phylogenetic proximity with an Avipoxvirus found in Black-browed Albatross (Thalassarche melanophrys) from the Falkland Islands in 1987. This proximity suggests a long-term circulation of seabird Avipoxviruses in the southwest Atlantic. Avian pox outbreaks in these colonies primarily affected chicks, often resulted in death, and were not associated with handling, rainfall, or temperature.

Chromatographic analysis of toxic phosphylated oximes (POX): a brief overview.

PubMed

Becker, Christian; Worek, Franz; John, Harald

2010-10-01

Poisoning with organophosphorus compounds (OP), e.g. pesticides and nerve agents, causes inhibition of acetylcholinesterase (AChE) by phosphylation of the active site serine residue. Consequently, accumulation of stimulating acetylcholine in the synaptic cleft induces cholinergic crisis which ultimately may lead to death. For standard causal therapy, enzyme reactivators are administered representing oxime derivatives of quarternary pyridinium compounds, e.g. pralidoxime (2-PAM), obidoxime and HI 6. The mechanism of action includes removal of the phosphyl moiety by a nucleophilic attack of the oximate molecule substituting the enzyme and forming a phosphylated oxime (POX). POX is produced in stoichiometric amounts of reactivated enzyme and exhibits a significantly enhanced toxicity (inhibition rate constant) when compared to the parent OP. However, stability of POX under physiological conditions appears to be highly limited. Nevertheless, the presence of POX reveals a potential critical issue for both therapeutic efficacy in vivo and pharmacokinetic and pharmacodynamic (PK-PD) modelling based on cholinesterase activity data. Detailed characterization represents an important need for elaboration of the entire oxime pharmacology.Nevertheless, reports on POX toxicity and analysis are quite rare and may therefore be indicative of the challenge of POX analysis. This review provides a concise overview of chromatographic approaches applied to POX separation. Chromatography represents the key technology for POX purification and quantification in kinetic in vitro studies using buffers and biological fluids. Applications based on reversed-phase chromatography (RPC), ion pair chromatography (IPC) and an affinity approach as well as thin layer chromatography (TLC) are discussed and novel applications and data are presented. Copyright © 2010 John Wiley & Sons, Ltd.

Identification and phylogenetic analysis of a sheep pox virus isolated from the Ningxia Hui Autonomous Region of China.

PubMed

Zhu, X L; Yang, F; Li, H X; Dou, Y X; Meng, X L; Li, H; Luo, X N; Cai, X P

2013-05-14

An outbreak of sheep pox was investigated in the Ningxia Hui Autonomous Region in China. Through immunofluorescence testing, isolated viruses, polymerase chain reaction identification, and electron microscopic examination, the isolated strain was identified as a sheep pox virus. The virus was identified through sequence and phylogenetic analysis of the P32 gene, open reading frame (ORF) 095, and ORF 103 genes. This study is the first to use the ORF 095 and ORF 103 genes as candidate genes for the analysis of sheep pox. The results showed that the ORF 095 and ORF 103 genes could be used for the genotyping of the sheep pox virus.

Herpes rugbiorum: a review on scrum pox and rugby player guidelines.

PubMed

Alamri, Yassar A S

2011-07-08

Sports, especially contact ones, have long been associated with an increased risk of contracting a communicable disease. Viral infections, in particular, have had an increased attention, due to their adverse effects on athletes' performance. As world sport events have now become more organised and diverse, athletes are now exposed to a wider range of pathogens. With the upcoming Rugby World Cup in 2011 taking place in New Zealand, team-doctors should keep a 'careful' eye on potential infectious outbreaks and make sure to adhere to guidelines accessed through fact sheets.

Troglitazone induced apoptosis via PPARγ activated POX-induced ROS formation in HT29 cells.

PubMed

Wang, Jing; Lv, XiaoWen; Shi, JiePing; Hu, XiaoSong; DU, YuGuo

2011-08-01

In order to investigate the potential mechanisms in troglitazone-induced apoptosis in HT29 cells, the effects of PPARγ and POX-induced ROS were explored. [3- (4, 5)-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay, Annexin V and PI staining using FACS, plasmid transfection, ROS formation detected by DCFH staining, RNA interference, RT-PCR & RT-QPCR, and Western blotting analyses were employed to investigate the apoptotic effect of troglitazone and the potential role of PPARγ pathway and POX-induced ROS formation in HT29 cells. Troglitazone was found to inhibit the growth of HT29 cells by induction of apoptosis. During this process, mitochondria related pathways including ROS formation, POX expression and cytochrome c release increased, which were inhibited by pretreatment with GW9662, a specific antagonist of PPARγ. These results illustrated that POX upregulation and ROS formation in apoptosis induced by troglitazone was modulated in PPARγ-dependent pattern. Furthermore, the inhibition of ROS and apoptosis after POX siRNA used in troglitazone-treated HT29 cells indicated that POX be essential in the ROS formation and PPARγ-dependent apoptosis induced by troglitazone. The findings from this study showed that troglitazone-induced apoptosis was mediated by POX-induced ROS formation, at least partly, via PPARγ activation. Copyright © 2011 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

Paraoxon induces apoptosis in EL4 cells via activation of mitochondrial pathways.

PubMed

Saleh, A M; Vijayasarathy, C; Masoud, L; Kumar, L; Shahin, A; Kambal, A

2003-07-01

The toxicity of organophosphorus compounds, such as paraoxon (POX), is due to their anticholinesterase action. Recently, we have shown that, at noncholinergic doses (1 to 10 nM), POX (the bioactive metabolite of parathion) causes apoptotic cell death in murine EL4 T-lymphocytic leukemia cell line through activation of caspase-3. In this study, by employing caspase-specific inhibitors, we extend our observations to elucidate the sequence of events involved in POX-stimulated apoptosis. Pretreatment of EL4 cells with the caspase-9-specific inhibitor zLEHD-fmk attenuated POX-induced apoptosis in a dose-dependent manner, whereas the caspase-8 inhibitor zIETD-fmk had no effect. Furthermore, the activation of caspase-9, -8, and -3 in response to POX treatment was completely inhibited in the presence of zLEHD-fmk, implicating the involvement of caspase 9-dependent mitochondrial pathways in POX-stimulated apoptosis. Indeed, under both in vitro and in vivo conditions, POX triggered a dose- and time-dependent translocation of cytochrome c from mitochondria into the cytosol, as assessed by Western blot analysis. Investigation of the mechanism of cytochrome c release revealed that POX disrupted mitochondrial transmembrane potential. Neither this effect nor cytchrome c release was dependent on caspase activation, since the general inhibitor of the caspase family zVAD-fmk did not influence both processes. Finally, POX treatment also resulted in a time-dependent up-regulation and translocation of the proapoptotic molecule Bax to mitochondria. Inhibition of this event by zVAD-fmk suggests that the activation and translocation of Bax to mitochondria is subsequent to activation of the caspase cascades. The results indicate that POX induces apoptosis in EL4 cells through a direct effect on mitochondria by disrupting its transmembrane potential, causing the release of cytochrome c into the cytosol and subsequent activation of caspase-9. Inhibition of this specific pathway might provide a useful strategy to minimize organophosphate-induced poisoning.

Recombinant sheep pox virus proteins elicit neutralizing antibodies

USDA-ARS?s Scientific Manuscript database

The aim of this study was to evaluate the immunogenicity and neutralizing activity of bacterially-expressed sheep pox virus (SPPV) structural proteins as candidate subunit vaccines to control sheep pox disease. SPPV structural proteins were identified by sequence homology with proteins from vaccinia...

Acute pancreatitis: rare complication of chicken pox in an immunocompetent host.

PubMed

Kumar, Sunil; Jain, A P; Pandit, A K

2007-01-01

Chicken pox is a highly contagious infection, caused by the varicella zoster virus. Although generally a benign, self-limited disease, varicella may be associated with serious complications especially in adults. We present acute pancreatitis- a rare complication, in otherwise healthy patients suffering from chicken pox. The presence of pancreatitis in association with chickenpox in immunocompetent patients can influence the outcome of the latter. This interesting case will hopefully increase awareness about this complication and its fatality in chicken pox.

Biodegradable poly(vinyl alcohol)/polyoxalate electrospun nanofibers for hydrogen peroxide-triggered drug release.

PubMed

Phromviyo, Nutthakritta; Lert-Itthiporn, Aurachat; Swatsitang, Ekaphan; Chompoosor, Apiwat

2015-01-01

Release of drugs in a controlled and sustainable manner is of great interest for treating some inflammatory diseases, drug delivery, and cosmetics. In this work, we demonstrated the control release of a drug from composite nanofibers mediated by hydrogen peroxide. Composite nanofibers of polyvinyl alcohol (PVA)/polyoxalate (PVA/POX NFs) blended at various weight ratios were successfully prepared by electrospinning. Rhodamine B (RB) was used as a model of drug and was initially loaded into the POX portion. The morphology of NFs was characterized using scanning electron microscopy (SEM). The functional groups presented in the NFs were characterized using IR spectroscopy. In vitro release behavior and cell toxicity of nanofibers were also investigated using the MTT assay. The results indicated that POX content had a significant effect on the size and release profiles of nanofibers. Microstructure analysis revealed that sizes of PVA/POX NFs increased with increasing POX content, ranging from 214 to 422 nm. Release profiles of RB at 37 °C were non-linear and showed different release mechanisms. The mechanism of drug release depended on the chemical composition of the NFs. RB release from the NFs with highest POX content was caused by the degradation of the nanofiber matrix, whereas the RB release in lower POX content NFs was caused by diffusion. The NFs with POX showed a loss of structural integrity in the presence of hydrogen peroxide as seen using SEM. The MTT assay showed that composite nanofibers had minimal cytotoxicity. We anticipate that nanofibrous PVA/POX can potentially be used to target numerous inflammatory diseases that overproduce hydrogen peroxide and may become a potential candidate for use as a local drug delivery vehicle.

A Novel Role of Proline Oxidase in HIV-1 Envelope Glycoprotein-induced Neuronal Autophagy*

PubMed Central

Pandhare, Jui; Dash, Sabyasachi; Jones, Bobby; Villalta, Fernando; Dash, Chandravanu

2015-01-01

Proline oxidase (POX) catalytically converts proline to pyrroline-5-carboxylate. This catabolic conversion generates reactive oxygen species (ROS) that triggers cellular signaling cascades including autophagy and apoptosis. This study for the first time demonstrates a role of POX in HIV-1 envelope glycoprotein (gp120)-induced neuronal autophagy. HIV-1 gp120 is a neurotoxic factor and is involved in HIV-1-associated neurological disorders. However, the mechanism of gp120-mediated neurotoxicity remains unclear. Using SH-SY5Y neuroblastoma cells as a model, this study demonstrates that gp120 treatment induced POX expression and catalytic activity. Concurrently, gp120 also increased intracellular ROS levels. However, increased ROS had a minimal effect on neuronal apoptosis. Further investigation indicated that the immediate cellular response to increased ROS paralleled with induction of autophagy markers, beclin-1 and LC3-II. These data lead to the hypothesis that neuronal autophagy is activated as a cellular protective response to the toxic effects of gp120. A direct and functional role of POX in gp120-mediated neuronal autophagy was examined by inhibition and overexpression studies. Inhibition of POX activity by a competitive inhibitor “dehydroproline” decreased ROS levels concomitant with reduced neuronal autophagy. Conversely, overexpression of POX in neuronal cells increased ROS levels and activated ROS-dependent autophagy. Mechanistic studies suggest that gp120 induces POX by targeting p53. Luciferase reporter assays confirm that p53 drives POX transcription. Furthermore, data demonstrate that gp120 induces p53 via binding to the CXCR4 co-receptor. Collectively, these results demonstrate a novel role of POX as a stress response metabolic regulator in HIV-1 gp120-associated neuronal autophagy. PMID:26330555

Class III peroxidases in cellulose deficient cultured maize cells during cell wall remodelling.

PubMed

Martínez-Rubio, Romina; Acebes, José Luis; Encina, Antonio; Kärkönen, Anna

2018-02-21

Maize (Zea mays L.) suspension-cultured cells habituated to a cellulose biosynthesis inhibitor 2,6-dichlorobenzonitrile (DCB) have a modified cell wall, in which the reduction in the cellulose content is compensated by a network of highly cross-linked feruloylated arabinoxylans and the deposition of lignin-like polymers. For both arabinoxylan cross-linking and lignin polymerization, class III peroxidases (POXs) have been demonstrated to have a prominent role. For the first time, a comparative study of POX activity and isoforms in control and cellulose-impaired cells has been addressed, also taking into account their cellular distribution in different compartments. Proteins from the spent medium (SM), soluble cellular (SC), ionically (ICW) and covalently bound cell wall protein fractions were assayed for total and specific peroxidase activity by using coniferyl and sinapyl alcohol and ferulic acid as substrates. The isoPOX profile was obtained by isoelectric focusing. POX activity was higher in DCB-habituated than in non-habituated cells in all protein fractions at all cell culture stages. For all substrates assayed, SC and ICW fractions showed higher activity at the early-log growth phase than at the late-log phase. However, the highest POX activity in the spent medium was found at the late-log phase. According to the isoPOX profiles, the highest diversity of isoPOXs was detected in the ICW and SM protein fractions. The latter fraction contained isoPOXs with higher activity in DCB-habituated cells. Some of the isoPOXs detected could be involved in cross-linking of arabinoxylans and in the lignin-like polymer formation in DCB-habituated cells. This article is protected by copyright. All rights reserved.

Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

PubMed Central

Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

2018-01-01

Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

Bleaching, disease and recovery in the threatened scleractinian coral Acropora palmata in St. John, US Virgin Islands: 2003-2010

NASA Astrophysics Data System (ADS)

Rogers, C. S.; Muller, E. M.

2012-09-01

A long-term study of the scleractinian coral Acropora palmata in the US Virgin Islands (USVI) showed that diseases, particularly white pox, are limiting the recovery of this threatened species. Colonies of A. palmata in Haulover Bay, within Virgin Islands National Park, St. John, were examined monthly in situ for signs of disease and other stressors from January 2003 through December 2009. During the study, 89.9 % of the colonies ( n = 69) exhibited disease, including white pox (87 %), white band (13 %), and unknown (9 %). Monthly disease prevalence ranged from 0 to 57 %, and disease was the most significant cause of complete colony mortality ( n = 17). A positive correlation was found between water temperature and disease prevalence, but not incidence. Annual average disease prevalence and incidence remained constant during the study. Colonies generally showed an increase in the estimated amount of total living tissue from growth, but 25 (36.2 %) of the colonies died. Acropora palmata bleached in the USVI for the first time during the 2005 Caribbean bleaching event. Only one of the 23 colonies that bleached appeared to die directly from bleaching. In 2005, corals that bleached had greater disease prevalence than those that did not bleach. Just over half (52 %) of the colonies incurred some physical damage. Monitoring of fragments (broken branches) that were generated by physical damage through June 2007 showed that 46.1 % died and 28.4 % remained alive; the fragments that attached to the substrate survived longer than those that did not. Recent surveys showed an increase in the total number of colonies within the reef area, formed from both asexual and sexual reproduction. Genotype analysis of 48 of the originally monitored corals indicated that 43 grew from sexual recruits supporting the conclusion that both asexual and sexual reproduction are contributing to an increase in colony density at this site.

Bleaching, disease and recovery in the threatened scleractinian coral Acropora palmata in St. John, US Virgin Islands: 2003-2010

USGS Publications Warehouse

Rogers, C.S.; Muller, E.M.

2012-01-01

A long-term study of the scleractinian coral Acropora palmata in the US Virgin Islands (USVI) showed that diseases, particularly white pox, are limiting the recovery of this threatened species. Colonies of A. palmata in Haulover Bay, within Virgin Islands National Park, St. John, were examined monthly in situ for signs of disease and other stressors from January 2003 through December 2009. During the study, 89.9 % of the colonies (n = 69) exhibited disease, including white pox (87 %), white band (13 %), and unknown (9 %). Monthly disease prevalence ranged from 0 to 57 %, and disease was the most significant cause of complete colony mortality (n = 17). A positive correlation was found between water temperature and disease prevalence, but not incidence. Annual average disease prevalence and incidence remained constant during the study. Colonies generally showed an increase in the estimated amount of total living tissue from growth, but 25 (36.2 %) of the colonies died. Acropora palmata bleached in the USVI for the first time during the 2005 Caribbean bleaching event. Only one of the 23 colonies that bleached appeared to die directly from bleaching. In 2005, corals that bleached had greater disease prevalence than those that did not bleach. Just over half (52 %) of the colonies incurred some physical damage. Monitoring of fragments (broken branches) that were generated by physical damage through June 2007 showed that 46.1 % died and 28.4 % remained alive; the fragments that attached to the substrate survived longer than those that did not. Recent surveys showed an increase in the total number of colonies within the reef area, formed from both asexual and sexual reproduction. Genotype analysis of 48 of the originally monitored corals indicated that 43 grew from sexual recruits supporting the conclusion that both asexual and sexual reproduction are contributing to an increase in colony density at this site.

7 CFR 301.74-3 - Quarantined areas.

Code of Federal Regulations, 2010 CFR

2010-01-01

... SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-3 Quarantined areas. (a... quarantined area in paragraph (c) of this section each State, or each portion of a State, in which plum pox... to believe that plum pox is present, or that the Administrator considers necessary to quarantine...

Avian Pox in Native Captive Psittacines, Brazil, 2015.

PubMed

Esteves, Felipe C B; Marín, Sandra Y; Resende, Maurício; Silva, Aila S G; Coelho, Hannah L G; Barbosa, Mayara B; D'Aparecida, Natália S; de Resende, José S; Torres, Ana C D; Martins, Nelson R S

2017-01-01

To investigate an outbreak of avian pox in psittacines in a conservation facility, we examined 94 birds of 10 psittacine species, including sick and healthy birds. We found psittacine pox virus in 23 of 27 sick birds and 4 of 67 healthy birds. Further characterization is needed for these isolates.

Sequential treatment with intradermal incision (intracision) and 2,940-nm Er:YAG laser for chicken pox scars.

PubMed

Lee, Sang Ju; Kim, Young Koo; Choi, Sun Young; Park, Kui Young; Seo, Seong Jun

2014-01-01

Boxcar scars, such as chicken pox scars, are round to oval depressions with sharply defined vertical edges. Subcision is a simple and safe procedure for treatment of atrophic and depressed scars, but boxcar scars are generally not eliminated by subcision. Intradermal incision technique (intracision) can treat chicken pox scars by untethering fibrotic strands, raising collagen synthesis, and having additional intradermal blood pocket formation. We have found that chicken pox scars further improve when intracision is followed by laser skin resurfacing. © 2013 Wiley Periodicals, Inc.

Electrochemical characterization of the pyranose 2-oxidase variant N593C shows a complete loss of the oxidase function with full preservation of substrate (dehydrogenase) activity† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6cp06009a Click here for additional data file.

PubMed Central

Brugger, Dagmar; Sützl, Leander; Zahma, Kawah; Haltrich, Dietmar; Peterbauer, Clemens K.

2016-01-01

This study presents the first electrochemical characterization of the pyranose oxidase (POx) variant N593C (herein called POx-C), which is considered a promising candidate for future glucose-sensing applications. The resulting cyclic voltammograms obtained in the presence of various concentrations of glucose and mediator (1,4-benzoquinone, BQ), as well as the control experiments by addition of catalase, support the conclusion of a complete suppression of the oxidase function and oxygen reactivity at POx-C. Additionally, these electrochemical experiments demonstrate, contrary to previous biochemical studies, that POx-C has a fully retained enzymatic activity towards glucose. POx-C was immobilized on a special screen-printed electrode (SPE) based on carbon ink and grafted with gold-nanoparticles (GNP). Suppression of the oxygen reactivity at N593C-POx variant is a prerequisite for utilizing POx in electrochemical applications for glucose sensing. To our knowledge, this is the first report presented in the literature showing an absolute conversion of an oxidase into a fully active equivalent dehydrogenase via a single residue exchange. PMID:27808302

Oxygen-Inducible Conversion of Lactate to Acetate in Heterofermentative Lactobacillus brevis ATCC 367.

PubMed

Guo, Tingting; Zhang, Li; Xin, Yongping; Xu, ZhenShang; He, Huiying; Kong, Jian

2017-11-01

Lactobacillus brevis is an obligatory heterofermentative lactic acid bacterium that produces high levels of acetate, which improve the aerobic stability of silages against deterioration caused by yeasts and molds. However, the mechanism involved in acetate accumulation has yet to be elucidated. Here, experimental evidence indicated that aerobiosis resulted in the conversion of lactate to acetate after glucose exhaustion in L. brevis ATCC 367 (GenBank accession number NC_008497). To elucidate the conversion pathway, in silico analysis showed that lactate was first converted to pyruvate by the reverse catalytic reaction of lactate dehydrogenase (LDH); subsequently, pyruvate conversion to acetate might be mediated by pyruvate dehydrogenase (PDH) or pyruvate oxidase (POX). Transcriptional analysis indicated that the pdh and pox genes of L. brevis ATCC 367 were upregulated 37.92- and 18.32-fold, respectively, by oxygen and glucose exhaustion, corresponding to 5.32- and 2.35-fold increases in the respective enzyme activities. Compared with the wild-type strain, the transcription and enzymatic activity of PDH remained stable in the Δ pox mutant, while those of POX increased significantly in the Δ pdh mutant. More lactate but less acetate was produced in the Δ pdh mutant than in the wild-type and Δ pox mutant strains, and more H 2 O 2 (a product of the POX pathway) was produced in the Δ pdh mutant. We speculated that the high levels of aerobic acetate accumulation in L. brevis ATCC 367 originated mainly from the reuse of lactate to produce pyruvate, which was further converted to acetate by the predominant and secondary functions of PDH and POX, respectively. IMPORTANCE PDH and POX are two possible key enzymes involved in aerobic acetate accumulation in lactic acid bacteria (LAB). It is currently thought that POX plays the major role in aerobic growth in homofermentative LAB and some heterofermentative LAB, while the impact of PDH remains unclear. In this study, we reported that both PDH and POX worked in the aerobic conversion of lactate to acetate in L. brevis ATCC 367, in dominant and secondary roles, respectively. Our findings will further develop the theory of aerobic metabolism by LAB. Copyright © 2017 American Society for Microbiology.

Oxygen-Inducible Conversion of Lactate to Acetate in Heterofermentative Lactobacillus brevis ATCC 367

PubMed Central

Guo, Tingting; Zhang, Li; Xin, Yongping; Xu, ZhenShang; He, Huiying

2017-01-01

ABSTRACT Lactobacillus brevis is an obligatory heterofermentative lactic acid bacterium that produces high levels of acetate, which improve the aerobic stability of silages against deterioration caused by yeasts and molds. However, the mechanism involved in acetate accumulation has yet to be elucidated. Here, experimental evidence indicated that aerobiosis resulted in the conversion of lactate to acetate after glucose exhaustion in L. brevis ATCC 367 (GenBank accession number NC_008497). To elucidate the conversion pathway, in silico analysis showed that lactate was first converted to pyruvate by the reverse catalytic reaction of lactate dehydrogenase (LDH); subsequently, pyruvate conversion to acetate might be mediated by pyruvate dehydrogenase (PDH) or pyruvate oxidase (POX). Transcriptional analysis indicated that the pdh and pox genes of L. brevis ATCC 367 were upregulated 37.92- and 18.32-fold, respectively, by oxygen and glucose exhaustion, corresponding to 5.32- and 2.35-fold increases in the respective enzyme activities. Compared with the wild-type strain, the transcription and enzymatic activity of PDH remained stable in the Δpox mutant, while those of POX increased significantly in the Δpdh mutant. More lactate but less acetate was produced in the Δpdh mutant than in the wild-type and Δpox mutant strains, and more H2O2 (a product of the POX pathway) was produced in the Δpdh mutant. We speculated that the high levels of aerobic acetate accumulation in L. brevis ATCC 367 originated mainly from the reuse of lactate to produce pyruvate, which was further converted to acetate by the predominant and secondary functions of PDH and POX, respectively. IMPORTANCE PDH and POX are two possible key enzymes involved in aerobic acetate accumulation in lactic acid bacteria (LAB). It is currently thought that POX plays the major role in aerobic growth in homofermentative LAB and some heterofermentative LAB, while the impact of PDH remains unclear. In this study, we reported that both PDH and POX worked in the aerobic conversion of lactate to acetate in L. brevis ATCC 367, in dominant and secondary roles, respectively. Our findings will further develop the theory of aerobic metabolism by LAB. PMID:28842545

Sterile Protection against Plasmodium knowlesi in Rhesus Monkeys from a Malaria Vaccine: Comparison of Heterologous Prime Boost Strategies

PubMed Central

Jiang, George; Shi, Meng; Conteh, Solomon; Richie, Nancy; Banania, Glenna; Geneshan, Harini; Valencia, Anais; Singh, Priti; Aguiar, Joao; Limbach, Keith; Kamrud, Kurt I.; Rayner, Jonathan; Smith, Jonathan; Bruder, Joseph T.; King, C. Richter; Tsuboi, Takafumi; Takeo, Satoru; Endo, Yaeta; Doolan, Denise L.; Richie, Thomas L.; Weiss, Walter R.

2009-01-01

Using newer vaccine platforms which have been effective against malaria in rodent models, we tested five immunization regimens against Plasmodium knowlesi in rhesus monkeys. All vaccines included the same four P. knowlesi antigens: the pre-erythrocytic antigens CSP, SSP2, and erythrocytic antigens AMA1, MSP1. We used four vaccine platforms for prime or boost vaccinations: plasmids (DNA), alphavirus replicons (VRP), attenuated adenovirus serotype 5 (Ad), or attenuated poxvirus (Pox). These four platforms combined to produce five different prime/boost vaccine regimens: Pox alone, VRP/Pox, VRP/Ad, Ad/Pox, and DNA/Pox. Five rhesus monkeys were immunized with each regimen, and five Control monkeys received a mock vaccination. The time to complete vaccinations was 420 days. All monkeys were challenged twice with 100 P. knowlesi sporozoites given IV. The first challenge was given 12 days after the last vaccination, and the monkeys receiving the DNA/Pox vaccine were the best protected, with 3/5 monkeys sterilely protected and 1/5 monkeys that self-cured its parasitemia. There was no protection in monkeys that received Pox malaria vaccine alone without previous priming. The second sporozoite challenge was given 4 months after the first. All 4 monkeys that were protected in the first challenge developed malaria in the second challenge. DNA, VRP and Ad5 vaccines all primed monkeys for strong immune responses after the Pox boost. We discuss the high level but short duration of protection in this experiment and the possible benefits of the long interval between prime and boost. PMID:19668343

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Edward jenner and the small pox vaccine.

PubMed

Smith, Kendall A

2011-01-01

Edward Jenner, who discovered that it is possible to vaccinate against Small Pox using material from Cow Pox, is rightly the man who started the science of immunology. However, over the passage of time many of the details surrounding his astounding discovery have been lost or forgotten. Also, the environment within which Jenner worked as a physician in the countryside, and the state of the art of medicine and society are difficult to appreciate today. It is important to recall that people were still being bled at the time, to relieve the presence of evil humors. Accordingly, this review details Jenner's discovery and attempts to place it in historical context. Also, the vaccine that Jenner used, which decreased the prevalence of Small Pox worldwide in his own time, and later was used to eradicate Small Pox altogether, is discussed in light of recent data.

Varicella-associated purpura fulminans: chicken pox is not always benign.

PubMed

Abdulmalik, A; Al-Ateeqi, W; Al-Khawari, M; Al-Osaimi, S

2006-01-01

To report a 6-year-old boy with post-chicken pox purpura fulminans (PF). A 6-year-old boy presented with purpura of the legs that rapidly progressed to other parts of the limbs and the buttocks. The patient had had chicken pox 10 days prior to presentation. He was afebrile and the chicken pox lesions were dry. He received anti-coagulants, a large volume of fresh frozen plasma, immunoglobulin and steroids. The skin lesions regressed but both hands and parts of the lower limbs remained necrotic; the patient was transferred to an orthopaedic hospital for amputation and skin grafting. This case report shows that PF can occur as a post-infection syndrome after primary varicella. Early and aggressive treatment of post-chicken pox PF might reduce the mortality and morbidity associated with this condition. Copyright 2006 S. Karger AG, Basel.

Harnessing hyperthermostable lactonase from Sulfolobus solfataricus for biotechnological applications

PubMed Central

Rémy, Benjamin; Plener, Laure; Poirier, Laetitia; Elias, Mikael; Daudé, David; Chabrière, Eric

2016-01-01

Extremozymes have gained considerable interest as they could meet industrial requirements. Among these, SsoPox is a hyperthermostable enzyme isolated from the archaeon Sulfolobus solfataricus. This enzyme is a lactonase catalyzing the hydrolysis of acyl-homoserine lactones; these molecules are involved in Gram-negative bacterial communication referred to as quorum sensing. SsoPox exhibits promiscuous phosphotriesterase activity for the degradation of organophosphorous chemicals including insecticides and chemical warfare agents. Owing to its bi-functional catalytic abilities as well as its intrinsic stability, SsoPox is appealing for many applications, having potential uses in the agriculture, defense, food and health industries. Here we investigate the biotechnological properties of the mutant SsoPox-W263I, a variant with increased lactonase and phosphotriesterase activities. We tested enzyme resistance against diverse process-like and operating conditions such as heat resistance, contact with organic solvents, sterilization, storage and immobilization. Bacterial secreted materials from both Gram-negative and positive bacteria were harmless on SsoPox-W263I activity and could reactivate heat-inactivated enzyme. SsoPox showed resistance to harsh conditions demonstrating that it is an extremely attractive enzyme for many applications. Finally, the potential of SsoPox-W263I to be active at subzero temperature is highlighted and discussed in regards to the common idea that hyperthermophile enzymes are nearly inactive at low temperatures. PMID:27876889

Gulf of Maine Seals - Populations, Problems and Priorities

DTIC Science & Technology

2010-06-01

3) rabies, (4) leptospirosis, (5) herpes, (6) toxoplasmosis, (7) pox, (8) lung worms, (9) Vibrio spp. and (10) harmful algal bloom toxins (HABs...Toxoplasmosis Pox Lungworms Vibrio HABs - We need to identify categories of disease and classify diseases opposed to simply stating that...infections Pox Vibrio Morbilli Pneumonia Dermatitis Alopecia Septicemia Body condition Dehydration Foreign body ingestion Natural

Poxvirus Antigen Staining of Immune Cells as a Biomarker to Predict Disease Outcome in Monkeypox and Cowpox Virus Infection in Non-Human Primates

PubMed Central

Song, Haifeng; Janosko, Krisztina; Johnson, Reed F.; Qin, Jing; Josleyn, Nicole; Jett, Catherine; Byrum, Russell; Claire, Marisa St.; Dyall, Julie; Blaney, Joseph E.; Jennings, Gerald; Jahrling, Peter B.

2013-01-01

Infection of non-human primates (NHPs) such as rhesus and cynomolgus macaques with monkeypox virus (MPXV) or cowpox virus (CPXV) serve as models to study poxvirus pathogenesis and to evaluate vaccines and anti-orthopox therapeutics. Intravenous inoculation of macaques with high dose of MPXV (>1–2×107 PFU) or CPXV (>102 PFU) results in 80% to 100% mortality and 66 to 100% mortality respectively. Here we report that NHPs with positive detection of poxvirus antigens in immune cells by flow cytometric staining, especially in monocytes and granulocytes succumbed to virus infection and that early positive pox staining is a strong predictor for lethality. Samples from four independent studies were analyzed. Eighteen NHPs from three different experiments were inoculated with two different MPXV strains at lethal doses. Ten NHPs displayed positive pox-staining and all 10 NHPs reached moribund endpoint. In contrast, none of the three NHPs that survived anticipated lethal virus dose showed apparent virus staining in the monocytes and granulocytes. In addition, three NHPs that were challenged with a lethal dose of MPXV and received cidofovir treatment were pox-antigen negative and all three NHPs survived. Furthermore, data from a CPXV study also demonstrated that 6/9 NHPs were pox-antigen staining positive and all 6 NHPs reached euthanasia endpoint, while the three survivors were pox-antigen staining negative. Thus, we conclude that monitoring pox-antigen staining in immune cells can be used as a biomarker to predict the prognosis of virus infection. Future studies should focus on the mechanisms and implications of the pox-infection of immune cells and the correlation between pox-antigen detection in immune cells and disease progression in human poxviral infection. PMID:23577120

AN EPIZOOTIC OF EMERGING NOVEL AVIAN POX IN CARRION CROWS (CORVUS CORONE) AND LARGE-BILLED CROWS (CORVUS MACRORHYNCHOS) IN JAPAN.

PubMed

Fukui, Daisuke; Nakamura, Makiko; Yamaguchi, Tsuyoshi; Takenaka, Makiko; Murakami, Mami; Yanai, Tokuma; Fukushi, Hideto; Yanagida, Kazumi; Bando, Gen; Matsuno, Keita; Nagano, Masashi; Tsubota, Toshio

2016-04-28

In 2006-10, an epizootic of emerging avian pox occurred in Carrion Crows ( Corvus corone ) and Large-billed Crows ( Corvus macrorhynchos ), leading to mortality of juvenile crows in Hokkaido, the northernmost island of Japan. We diagnosed 27 crows with proliferative skin lesions (19 carcasses and eight biopsied cases [one in zoo captivity]) as avian pox clinically, histopathologically by detection of Avipoxvirus-specific 4b core protein (P4b) gene, and epidemiologically. The fatal cases demonstrated intensively severe infection and aggressive lesions with secondary bacterial infection. Since the first identification of avian pox in Sapporo, Japan, in 2006, the frequency of mortality events has increased, peaking in 2007-08. Mortalities have subsequently occurred in other areas, suggesting disease expansion. In Sapporo, prevalence of avian pox evaluated by field censuses during 2007-12 was 17.6% (6.6-27.2%), peaked during 2007-08 and 2008-09, and then decreased. All diseased crows were juveniles, except for one adult. The number of crows assembling in the winter roosts had been stable for >10 yr; however, it declined in 2007-08, decreased by about 50% in 2008-09, and recovered to the previous level in 2009-10, correlated with the avian pox outbreak. Thus, avian pox probably contributed to the unusual crow population decline. All P4b sequences detected in six specimens in Sapporo were identical and different from any previously reported sequences. The sequence detected in the zoo-kept crow was distinct from any reported clades, and interspecies transmission was suspected. This report demonstrates an emerging novel avian pox in the Japanese avifauna and in global populations of Carrion Crows and Large-billed Crows. Longitudinal monitoring is needed to evaluate its impact on the crow population.

Edward Jenner and the Small Pox Vaccine

PubMed Central

Smith, Kendall A.

2011-01-01

Edward Jenner, who discovered that it is possible to vaccinate against Small Pox using material from Cow Pox, is rightly the man who started the science of immunology. However, over the passage of time many of the details surrounding his astounding discovery have been lost or forgotten. Also, the environment within which Jenner worked as a physician in the countryside, and the state of the art of medicine and society are difficult to appreciate today. It is important to recall that people were still being bled at the time, to relieve the presence of evil humors. Accordingly, this review details Jenner’s discovery and attempts to place it in historical context. Also, the vaccine that Jenner used, which decreased the prevalence of Small Pox worldwide in his own time, and later was used to eradicate Small Pox altogether, is discussed in light of recent data. PMID:22566811

Atypical distribution of fowl pox lesions in broilers.

PubMed

Sentíes-Cué, C G; Charlton, B R; Woolcock, P; Bickford, A A; Cooper, G; Bland, M

2010-12-01

An unusual cutaneous fowl pox outbreak occurred in 8-wk-old broilers in California. Rounded and longitudinal, proliferative scratch-associated lesions were found only in feathered areas of the body. Both sides of the hip, the lower abdomen, pericloacal area, and lateral lower neck area were involved. The head, legs, feet, and toes did not have lesions. Birds in only one section of one of five houses were affected. Fifteen percent condemnations occurred in birds from the affected house due to the skin lesions. A diagnosis of fowl pox was achieved by histopathology, viral isolation, and direct electron microscopy. The unusual distribution of pox lesions was assumed to be associated with skin scratches. There was no evidence that mosquitoes or other types of insects were involved in this outbreak. To the knowledge of the authors, this is the first report of this kind of unusual fowl pox in the United States.

Database of Autotransplants for Breast Cancer.

DTIC Science & Technology

1996-12-01

Infections (Indicate code for atypical bacteria; 301 Herpes Simplex (HSV1, HSV2) list bacterium for non-atypical bacteria.) 302 Herpes Zoster ( Chicken pox ...for non-atypical bacteria.) 302 Herpes Zoster ( Chicken pox , Varicella) 303 Cytomegalovirus (CMV) 100 Atypical bacteria, not otherwise specified 304... Chicken pox , Varicella) 303 Cytomegalovirus (CMV) 100 Atypical bacteria, not otherwise specified 304 Adenovirus 101 Coxiella 305 Enterovirus (Coxsackie

Bioterrorism Preparedness for Infectious Disease (BTPID) Proposal

DTIC Science & Technology

2007-01-01

approximately $210,000/ year x 5 years. (Pending) Safety, Tolerability and Immunogenicity of ACAM3000 Modified Vaccinia Ankara (MVA) Small Pox ...Hospital. • (Pending) Safety, Tolerability and Immunogenicity of ACAM3000 Modified Vaccinia Ankara (MVA) Small Pox Vaccine in HIV-Seropositive...choosing optimal pox virus derived vectors as vaccines in terms of reducing clinical reactogenicity and inducing dendritic cell (DC) aturation. 2006 Elsevier

Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

PubMed

Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

2015-01-01

RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.)

PubMed Central

Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

2015-01-01

RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, “Rojo Pasión” and “Z506-7”, resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance. PMID:26658051

A Mutation in the PoxA Gene of Salmonella enterica Serovar Typhimurium Results in Altered Protein Production, Elevated Susceptibility to Environmental Challenges, and Decreased Swine Colonization

USDA-ARS?s Scientific Manuscript database

Using signature-tagged mutagenesis of Salmonella enterica serovar Typhimurium (S. Typhimurium), a mutation in the poxA gene (STM4344; yjeA; poxR), encoding a putative lysyl-tRNA synthetase, was previously identified by our research group which caused decreased survival in an ex vivo swine stomach co...

Avian pox

USGS Publications Warehouse

Hansen, W.

1999-01-01

Avian pox is the common name for a mild-to-severe, slowdeveloping disease of birds that is caused by a large virus belonging to the avipoxvirus group, a subgroup of poxviruses. This group contains several similar virus strains; some strains have the ability to infect several groups or species of birds but others appear to be species-specific. Mosquitoes are common mechanical vectors or transmitters of this disease. Avian pox is transmitted when a mosquito feeds on an infected bird that has viremia or pox virus circulating in its blood, or when a mosquito feeds on virus-laden secretions seeping from a pox lesion and then feeds on another bird that is susceptible to that strain of virus. Contact with surfaces or exposure to air-borne particles contaminated with poxvirus can also result in infections when virus enters the body through abraded skin or the conjunctiva or the mucous membrane lining that covers the front part of the eyeball and inner surfaces of the eyelids of the eye.

A Mutation in the Putative Lysl-tRNA Synthetase Gene, PoxR of Salmonella enterica Serovar Typhimurium Results in Altered Protein Production, Elevated Susceptibility to Environmental Challenges and Decreased Swine Colonization

USDA-ARS?s Scientific Manuscript database

Using signature-tagged mutagenesis, a mutation in the poxR gene of Salmonella enterica serovar Typhimurium was identified with decreased survival in an ex vivo swine stomach content assay(Bearson et al. Appl Environ Microbiol. 72:2829-36). Gastrointestinal colonization and fecal shedding of the pox...

Database of Autotransplants for Breast Cancer.

DTIC Science & Technology

1998-11-01

atypical bacteria in Q.79, 81.) 301 Herpes Simplex (HSV1, HSV2) 100 Atypical bacteria, not otherwise specified 302 Herpes Zoster ( Chicken pox , Varicella...100 Atypical bacteria, not otherwise specified 302 Herpes Zoster ( Chicken pox , Varicella) 101 Coxiella 303 Cytomegalovirus (CMV) 102 Legionella 304...atypical bacteria in Q.329, 330.) 301 Herpes Simplex (HSV1, HSV2) 100 Atypical bacteria, not otherwise specified 302 Herpes Zoster ( Chicken pox , Vadcella

Infectious and Hazardous Waste Protocol for Medical Facilities

DTIC Science & Technology

1991-03-01

possible, have a known immune status to that disease (e.g., chicken pox ). Caregivers who have no immunity or unknown immune status should not provide care...employees living in barracks who are diagnosed as having a highly communicable disease which has a respiratory transmission route (such as chicken pox ...high-risk patients (i.e., neonates, young infants, COPD, immune compromised) until acute symptoms resolve. Varicella ( Chicken pox ) Active Yes Until all

Worldwide Report, Epidemiology

DTIC Science & Technology

1985-12-26

them to take their chlldrerv outside the village-for treats rnent of measles, chicken - pox and small- pox . {The result of this superstition was the...within two days of the attack. The village inmates, out of ignorance, treated them with neem leaves as they used to do in case of chicken pox . Having...Migrants v (Penang THE STAR, 30 Oct 85) JU Briefs ~2 Jaundice Cases - b - MEXICO National AIDS Statistics: New Study Facility ( Mexico City

An investigation into western white pine partial resistance against the rust pathogen Cronartium ribicola using in vitro screening method

Treesearch

D. Noshad; J.N. King

2012-01-01

Cronartium ribicola is one of the most destructive forest pathogens of North American white pines. The pathogen infects pine trees through their stomata, colonizes the stem, and produces stem cankers the following growing season. In this research, we collected samples from different white pine populations across Canada and the United States to...

Fatal pox infection in a rough-legged hawk

USGS Publications Warehouse

Pearson, G.L.; Pass, D.A.; Beggs, E.C.

1975-01-01

Natural pox infection occurred in a free-living rough-legged hawk (Buteo lagopus) in northeastern North Dakota. Gross, histological and electron microscopic findings were typical of pox infection, and characteristic lesions developed in red-tailed hawks (Buteo jamaicensis) but not in great horned owls (Bubo virginianus) following inoculation with case material. Death of the rough-legged hawk was attributed to starvation resulting from inability to capture prey and to blood loss from foot lesions.

Modeling sheep pox disease from the 1994-1998 epidemic in Evros Prefecture, Greece.

PubMed

Malesios, C; Demiris, N; Abas, Z; Dadousis, K; Koutroumanidis, T

2014-10-01

Sheep pox is a highly transmissible disease which can cause serious loss of livestock and can therefore have major economic impact. We present data from sheep pox epidemics which occurred between 1994 and 1998. The data include weekly records of infected farms as well as a number of covariates. We implement Bayesian stochastic regression models which, in addition to various explanatory variables like seasonal and environmental/meteorological factors, also contain serial correlation structure based on variants of the Ornstein-Uhlenbeck process. We take a predictive view in model selection by utilizing deviance-based measures. The results indicate that seasonality and the number of infected farms are important predictors for sheep pox incidence. Copyright © 2014 Elsevier Ltd. All rights reserved.

Taqman Real-Time PCR Detects Avipoxvirus DNA in Blood of Hawaìi `Amakihi (Hemignathus virens)

PubMed Central

Farias, Margaret E. M.; LaPointe, Dennis A.; Atkinson, Carter T.; Czerwonka, Christopher; Shrestha, Rajesh; Jarvi, Susan I.

2010-01-01

Background Avipoxvirus sp. is a significant threat to endemic bird populations on several groups of islands worldwide, including Hawaìi, the Galapagos Islands, and the Canary Islands. Accurate identification and genotyping of Avipoxvirus is critical to the study of this disease and how it interacts with other pathogens, but currently available methods rely on invasive sampling of pox-like lesions and may be especially harmful in smaller birds. Methodology/Principal Findings Here, we present a nested TaqMan Real-Time PCR for the detection of the Avipoxvirus 4b core protein gene in archived blood samples from Hawaiian birds. The method was successful in amplifying Avipoxvirus DNA from packed blood cells of one of seven Hawaiian honeycreepers with confirmed Avipoxvirus infections and 13 of 28 Hawaìi `amakihi (Hemignathus virens) with suspected Avipoxvirus infections based on the presence of pox-like lesions. Mixed genotype infections have not previously been documented in Hawaìi but were observed in two individuals in this study. Conclusions/Significance We anticipate that this method will be applicable to other closely related strains of Avipoxvirus and will become an important and useful tool in global studies of the epidemiology of Avipoxvirus. PMID:20523726

Diverse amino acid changes at specific positions in the N-terminal region of the coat protein allow Plum pox virus to adapt to new hosts.

PubMed

Carbonell, Alberto; Maliogka, Varvara I; Pérez, José de Jesús; Salvador, Beatriz; León, David San; García, Juan Antonio; Simón-Mateo, Carmen

2013-10-01

Plum pox virus (PPV)-D and PPV-R are two isolates from strain D of PPV that differ in host specificity. Previous analyses of chimeras originating from PPV-R and PPV-D suggested that the N terminus of the coat protein (CP) includes host-specific pathogenicity determinants. Here, these determinants were mapped precisely by analyzing the infectivity in herbaceous and woody species of chimeras containing a fragment of the 3' region of PPV-D (including the region coding for the CP) in a PPV-R backbone. These chimeras were not infectious in Prunus persica, but systemically infected Nicotiana clevelandii and N. benthamiana when specific amino acids were modified or deleted in a short 30-amino-acid region of the N terminus of the CP. Most of these mutations did not reduce PPV fitness in Prunus spp. although others impaired systemic infection in this host. We propose a model in which the N terminus of the CP, highly relevant for virus systemic movement, is targeted by a host defense mechanism in Nicotiana spp. Mutations in this short region allow PPV to overcome the defense response in this host but can compromise the efficiency of PPV systemic movement in other hosts such as Prunus spp.

Side-by-side comparison of gene-based smallpox vaccine with MVA in nonhuman primates.

PubMed

Golden, Joseph W; Josleyn, Matthew; Mucker, Eric M; Hung, Chien-Fu; Loudon, Peter T; Wu, T C; Hooper, Jay W

2012-01-01

Orthopoxviruses remain a threat as biological weapons and zoonoses. The licensed live-virus vaccine is associated with serious health risks, making its general usage unacceptable. Attenuated vaccines are being developed as alternatives, the most advanced of which is modified-vaccinia virus Ankara (MVA). We previously developed a gene-based vaccine, termed 4pox, which targets four orthopoxvirus antigens, A33, B5, A27 and L1. This vaccine protects mice and non-human primates from lethal orthopoxvirus disease. Here, we investigated the capacity of the molecular adjuvants GM-CSF and Escherichia coli heat-labile enterotoxin (LT) to enhance the efficacy of the 4pox gene-based vaccine. Both adjuvants significantly increased protective antibody responses in mice. We directly compared the 4pox plus LT vaccine against MVA in a monkeypox virus (MPXV) nonhuman primate (NHP) challenge model. NHPs were vaccinated twice with MVA by intramuscular injection or the 4pox/LT vaccine delivered using a disposable gene gun device. As a positive control, one NHP was vaccinated with ACAM2000. NHPs vaccinated with each vaccine developed anti-orthopoxvirus antibody responses, including those against the 4pox antigens. After MPXV intravenous challenge, all control NHPs developed severe disease, while the ACAM2000 vaccinated animal was well protected. All NHPs vaccinated with MVA were protected from lethality, but three of five developed severe disease and all animals shed virus. All five NHPs vaccinated with 4pox/LT survived and only one developed severe disease. None of the 4pox/LT-vaccinated animals shed virus. Our findings show, for the first time, that a subunit orthopoxvirus vaccine delivered by the same schedule can provide a degree of protection at least as high as that of MVA.

Pulse Oximetry and Auscultation for Congenital Heart Disease Detection.

PubMed

Hu, Xiao-Jing; Ma, Xiao-Jing; Zhao, Qu-Ming; Yan, Wei-Li; Ge, Xiao-Ling; Jia, Bing; Liu, Fang; Wu, Lin; Ye, Ming; Liang, Xue-Cun; Zhang, Jing; Gao, Yan; Zhai, Xiao-Wen; Huang, Guo-Ying

2017-10-01

Pulse oximetry (POX) has been confirmed as a specific screening modality for critical congenital heart disease (CCHD), with moderate sensitivity. However, POX is not able to detect most serious and critical cardiac lesions (major congenital heart disease [CHD]) without hypoxemia. In this study, we investigated the accuracy and feasibility of the addition of cardiac auscultation to POX as a screening method for asymptomatic major CHD. A multicenter prospective observational screening study was conducted at 15 hospitals in Shanghai between July 1, 2012, and December 31, 2014. Newborns with either an abnormal POX or cardiac auscultation were defined as screen positive. All screen-positive newborns underwent further echocardiography. False-negative results were identified by clinical follow-up, parents' feedback, and telephone review. We assessed the accuracy of POX plus cardiac auscultation for the detection of major CHD. CHD screening was completed in all 15 hospitals, with a screening rate of 94.0% to 99.8%. In total, 167 190 consecutive asymptomatic newborn infants were screened, of which 203 had major CHD (44 critical and 159 serious). The sensitivity of POX plus cardiac auscultation was 95.5% (95% confidence interval 84.9%-98.7%) for CCHD and 92.1% (95% confidence interval 87.7%-95.1%) for major CHD. The false-positive rate was 1.2% for detecting CCHD and 1.1% for detecting major CHD. In our current study, we show that using POX plus cardiac auscultation significantly improved the detection rate of major CHD in the early neonatal stage, with high sensitivity and a reasonable false-positive rate. It provides strong evidence and a reliable method for neonatal CHD screening. Copyright © 2017 by the American Academy of Pediatrics.

Side-by-Side Comparison of Gene-Based Smallpox Vaccine with MVA in Nonhuman Primates

PubMed Central

Golden, Joseph W.; Josleyn, Matthew; Mucker, Eric M.; Hung, Chien-Fu; Loudon, Peter T.; Wu, T. C.; Hooper, Jay W.

2012-01-01

Orthopoxviruses remain a threat as biological weapons and zoonoses. The licensed live-virus vaccine is associated with serious health risks, making its general usage unacceptable. Attenuated vaccines are being developed as alternatives, the most advanced of which is modified-vaccinia virus Ankara (MVA). We previously developed a gene-based vaccine, termed 4pox, which targets four orthopoxvirus antigens, A33, B5, A27 and L1. This vaccine protects mice and non-human primates from lethal orthopoxvirus disease. Here, we investigated the capacity of the molecular adjuvants GM-CSF and Escherichia coli heat-labile enterotoxin (LT) to enhance the efficacy of the 4pox gene-based vaccine. Both adjuvants significantly increased protective antibody responses in mice. We directly compared the 4pox plus LT vaccine against MVA in a monkeypox virus (MPXV) nonhuman primate (NHP) challenge model. NHPs were vaccinated twice with MVA by intramuscular injection or the 4pox/LT vaccine delivered using a disposable gene gun device. As a positive control, one NHP was vaccinated with ACAM2000. NHPs vaccinated with each vaccine developed anti-orthopoxvirus antibody responses, including those against the 4pox antigens. After MPXV intravenous challenge, all control NHPs developed severe disease, while the ACAM2000 vaccinated animal was well protected. All NHPs vaccinated with MVA were protected from lethality, but three of five developed severe disease and all animals shed virus. All five NHPs vaccinated with 4pox/LT survived and only one developed severe disease. None of the 4pox/LT-vaccinated animals shed virus. Our findings show, for the first time, that a subunit orthopoxvirus vaccine delivered by the same schedule can provide a degree of protection at least as high as that of MVA. PMID:22860117

Comparative evaluation of oxidative enzyme activities during adventitious rooting in the cuttings of grapevine rootstocks.

PubMed

Kose, Cafer; Erdal, Serkan; Kaya, Ozkan; Atici, Okkeş

2011-03-15

This study investigated changes in peroxidase (POX) and polyphenol oxidase (PPO) activities through adventitious rooting in hardwood cuttings of grapevine rootstocks. Three grapevine rootstocks with different propensity to produce adventitious roots were selected: recalcitrant (Ramsey), non-recalcitrant (Rupestris du Lot) and intermediate (99R) cultivars. The averages of root number at 65 days were 96 in Lot, 76 in 99R and 30 in Ramsey. Both enzyme activities characteristically increased before adventitious rooting, regardless of rooting ability of the rootstocks, and then decreased. POX activity increased in Ramsey cuttings at 22 days, in Lot and 99R cuttings at 14 days after planting, and then decreased gradually until 51 days. The highest POX activity was determined in Ramsey rootstock with the highest rooting ability and the lowest activity was determined in the rootstocks with the lowest rooting ability. PPO activity gradually increased in Ramsey rootstock cuttings from 10 days to 22 days, in Lot and 99R cuttings at 14 days, and then decreased until 51 days. A significant correlation was identified between high POX activity and adventitious rooting capability in rootstocks, but the same result was not determined with PPO activity. A recalcitrant rooting variety cannot increase POX activity sufficiently before rooting. Therefore applications that could increase POX activity in stem cuttings during rooting may facilitate increased rooting in such rootstocks. Copyright © 2011 Society of Chemical Industry.

Epizootiology and effect of avian pox on Hawaiian forest birds

USGS Publications Warehouse

van Riper, Charles; van Riper, Sandra G.; Hansen, Wallace R.

2002-01-01

We determined prevalence and altitudinal distribution of forest birds infected with avian pox at 16 locations on Hawaii, from sea level to tree line in mesic and xeric habitats, during 1977–1980. Isolates from lesions were cultured in the laboratory for positive identification of Poxvirus avium. Infected birds from the wild were brought into the laboratory to assess differences in the course of infection in native versus introduced species. We also documented distributions and activity cycles of potential avian pox vectors.Native forest birds were (1) more susceptible to avian pox infection than were introduced species, (2) most likely to be infected during the wet season, and (3) found to have a higher prevalence in mesic when compared to xeric forests. Avian pox occurred in forest birds at all elevations, but highest levels were in the mid-elevational ranges (∼1,200 m) where vectors and native birds had the greatest overlap. Temporal and elevational differences in prevalence were apparent throughout the annual cycle. Avian pox probably did not reach epizootic proportions on Hawaii until after introduction of the mosquito and domestic birds in the early 1800s, and since then has had a negative effect on the population dynamics of native forest birds. Today, this introduced disease is an important factor that should be considered in future conservation efforts that are directed at the recovery of native forest birds in Hawaii.

Comparison of partial oxidation and steam-CO{sub 2} mixed reforming of CH{sub 4} to syngas on MgO-supported metals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, D.; Lapszewicz, J.; Jiang, X.

1996-03-01

Partial oxidation (POX) and steam-CO{sub 2} mixed reforming of CH{sub 4} on MgO-supported noble metals were investigated at high space velocity (5.5 x 10{sup 5} h{sup -1}). Temperature-programmed reaction (TPR) and isotope transient techniques were used to study the mechanism of POX and mixed reforming. TPR profiles of POX and mixed reforming showed similar ignition reaction behaviors, which implied that there are similar characteristics in their mechanisms. Steam reforming and CO{sub 2} reforming were found to start at the same time in mixed reforming. TPR and CH{sub 4}-D{sub 2} exchange experiments indicated that CH{sub 4} was activated at low temperaturemore » on Rh/MgO. POX showed much higher activity than mixed reforming although their C, H, and O atomic concentrations were the same at the beginning of each reaction. Mechanisms for POX and mixed reforming are suggested and the effect of oxygen-metal bond strength on activity is discussed. 31 refs., 11 figs., 3 tabs.« less

Triage for Civil Support. Using Military Medical Assets to Respond to Terrorist Attacks

DTIC Science & Technology

2004-01-01

chicken pox , ma- laria, viral syndromes, and meningitis gave way to the suspicion that one or more of the pa- tients may have contracted smallpox. While...awaiting the results of an infectious disease consultation on a patient that appeared to be too ill to have chicken pox (raising the strong suspicion...Whiteman Air Force Base (home to 150 nuclear-armed ICBMs). • (April 2003) A misdiagnosis of chicken pox as smallpox at a major Nashville hospital

The Role of the U.S. Army Forces Command in Project New Arrivals. Reception and Care of Refugees from Vietnam,

DTIC Science & Technology

1981-09-01

epidemic of chicken pox in the refugee area became a cause for concern because of the arrival of 368 Thai Dams (also known as Black Thais) from Thailand...wounds which, coupled with the refugees’ lowered resistance resulting from the vaccinations and travel fatigue and the presence of chicken pox in the...lengthy and expensive treat- ment required -- and chicken pox which ravaged both children and adults. The latter disease did not consititue a significant

[Chicken pox recurrence revealing a renal adenocarcinoma in an adult].

PubMed

Thieulent, N; Grezard, P; Wolf, F; Barrut, D; Perrot, H

2000-09-01

A new episode of chicken pox in adults who had a well documented infection previously is usually observed in immunocompromised individuals. The principal immunodeficiency factors are hematology diseases, acquired immunodeficiency disease and old age. We report here the case of a young woman who after a contaminating contact presented a recurrence of typical chicken pox. Morphological investigations evidenced a right kidney tumor which pathology revealed to be a renal adenocarcinoma. We discuss this pathological association and review cases reported in the literature.

Resolution of chicken pox neuroretinitis with oral acyclovir: a case report.

PubMed

Biswas, Jyotirmay; Nagpal, Amit; Chopra, Sumeet; Karna, Satya

2003-12-01

It is usual to consider chicken pox as a benign infectious disease with a few anterior segment ocular complications like conjunctivitis, keratitis, episcleritis, scleritis, iridocyclitis, and glaucoma. The retinal manifestations are necrotising retinitis, vitritis, neuroretinitis, and retinal detachments. We report a case of neuroretinitis following chicken pox in a 23-year-old male. The complication was resolved by treatment with oral acyclovir in combination with systemic steroids. This report highlights the necessity for fundus examination in cases of chickenpox exhibiting visual symptoms.

In vitro skin decontamination of the organophosphorus pesticide Paraoxon with nanometric cerium oxide CeO2.

PubMed

Salerno, Alicia; Devers, Thierry; Bolzinger, Marie-Alexandrine; Pelletier, Jocelyne; Josse, Denis; Briançon, Stéphanie

2017-04-01

Organophosphorus compounds (OP), which mainly penetrate via the percutaneous pathway, represent a threat for both military and civilians. Body surface decontamination is vital to prevent victims poisoning. The development of a cost-effective formulation, which could be efficient and easy to handle in case of mass contamination, is therefore crucial. Metal oxides nanoparticles, due their large surface areas and the large amount of highly reactive sites, present high reactivity towards OP. First, this study aimed at evaluating the reaction of CeO 2 nanoparticles, synthetized by microwave path and calcined at 500 or 600 °C, with Paraoxon (POX) in aqueous solution. Results showed that both nanoparticles degraded 60%-70% of POX. CeO 2 calcined at 500 °C, owing to its larger specific area, was the most effective. Moreover, the degradation was significantly increased under Ultra-Violet irradiation (initial degradation rate doubled). Then, skin decontamination was studied in vitro using the Franz cell method with pig-ear skin samples. CeO 2 powder and an aqueous suspension of CeO 2 (CeO 2 -W) were applied 1 h after POX exposure. The efficiency of decontamination, including removal and/or degradation of POX, was compared to Fuller's earth (FE) and RSDL lotion which are, currently, the most efficient systems for skin decontamination. CeO 2 -W and RSDL were the most efficient to remove POX from the skin surface and decrease skin absorption by 6.4 compared to the control not decontaminated. FE reduced significantly (twice) the absorbed fraction of POX, contrarily to CeO 2 powder. Considering only the degradation rate of POX, the products ranged in the order CeO 2  > RSDL > CeO 2 -W > FE (no degradation). This study showed that CeO 2 nanoparticles are a promising material for skin decontamination of OP if formulated as a dispersion able to remove POX like CeO 2 -W and to degrade it as CeO 2 powder. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Evaluation of a commercial vaccine against avian poxvirus in turkeys kept in the backyard system in the state of Yucatan, Mexico.

PubMed

Estrella-Tec, J E; Gutiérrez-Ruiz, E J; Ramírez-González, S; Aranda-Cirerol, F; Santos-Ricalde, R; Puerto-Nájera, J L

2013-12-01

One hundred and sixty 1-month-old turkey poults were delivered to 40 households in four communities of the State of Yucatan, Mexico. The poults were divided into two populations, one vaccinated and the other non-vaccinated against avian pox. During three months, monthly visits were carried out in order to monitor the appearance of lesions suggesting avian pox in the birds delivered. Each turkey was clinically examined, searching for characteristic avian pox lesions that were classified according to the degree of severity observed. The true incidence rate and the cumulative incidence rate of avian pox were determined and the true incidence and cumulative incidence rates of mortality were determined and the relative risks calculated. The true incidence rates for avian pox in vaccinated and non-vaccinated birds were 1.5 and 1.47 respectively. The cumulative incidence rates were 0.94 and 0.90 for vaccinated and non-vaccinated birds, respectively. The comparison for the whole period between vaccinated and non-vaccinated groups did not show a significant statistical difference for mortality. However, when mortality was compared between vaccinated and non-vaccinated turkeys for each month of the study, there was a statistically significant difference for the first month (relative risk = 0.216, confidence interval 0.069 to 0.676). In addition, when the severity of pox lesions between groups was compared, statistically significant differences were found in favour of the vaccinated birds (P < 0.0001).

Seasonal variation and trend of chicken pox in the southern region of Saudi Arabia (2007-2012).

PubMed

Saleh, Noha; Al Moghazy, Bassem

2014-12-01

Chicken pox is a contagious disease caused by varicella zoster virus. Children are most susceptible to infection. In 1998, the WHO recommended that routine childhood varicella vaccination be considered in countries where the disease is a relatively important public health concern. There are few data on the trends of chicken pox. We aimed to evaluate the trend of chicken pox in Saudi Arabia (KSA) during the period 2007-2012. Data were collected by retrospective review of the existing anonymous surveillance records and book registries of chicken pox cases at the preventive medicine department of Armed Forces Hospital of the Southern Region of Saudi Arabia from 2007 to 2012. The collected data included the number, age, and sex of registered cases. A seasonal pattern was clearly demonstrated, with peak in March and April. There was also a decreasing trend from 2007 to 2012. Most cases occurred in the age group 4-15 years. The number of infected male patients was a little higher compared with female patients. These results indicate success in controlling the disease in the southern region of Saudi Arabia, which may be attributed to the implementation of public health interventions targeted at reducing infectious diseases (such as the introduction of varicella zoster vaccine in 2008). We recommend that a future study be conducted on the severity of chicken pox infection in adults (hospitalization, complications, and death) and a national survey among adults for the seroprevalence of markers of infection with varicella zoster.

Parallels in amphibian and bat declines from pathogenic fungi.

PubMed

Eskew, Evan A; Todd, Brian D

2013-03-01

Pathogenic fungi have substantial effects on global biodiversity, and 2 emerging pathogenic species-the chytridiomycete Batrachochytrium dendrobatidis, which causes chytridiomycosis in amphibians, and the ascomycete Geomyces destructans, which causes white-nose syndrome in hibernating bats-are implicated in the widespread decline of their vertebrate hosts. We synthesized current knowledge for chytridiomycosis and white-nose syndrome regarding disease emergence, environmental reservoirs, life history characteristics of the host, and host-pathogen interactions. We found striking similarities between these aspects of chytridiomycosis and white-nose syndrome, and the research that we review and propose should help guide management of future emerging fungal diseases.

An inquiry into the causes and effects of the variolae (or Cow-pox. 1798).

PubMed

Jenson, Alfred B; Ghim, Shin-Je; Sundberg, John P

2016-03-01

Few papers have had a greater impact on the health of the human species than the simple, yet elegant, observations and clinical trials of Edward Jenner with what was at the time called the Cow Pox. In fact, this was a naturally attenuated rodent (probably rat) pox that could infect horses and, through farriers and farm hands, dairy cattle. While commonly called the Cow Pox at the time, Jenner's transmission studies between humans used infectious materials from horses. His methods provided protection from the serious effects of smallpox infections. In 1977, smallpox was considered to be eradicated, although people continue to be infected by pox viruses from other mammalian species. We consider this to be our 'favorite historical paper' because it emphasizes careful clinical observation followed by relatively simple clinical testing can have a profound influence on human health, even when almost nothing is known about the underlying molecular mechanisms. Continued follow-up with strict attention to detail resulted in a crude but effective way to deal with an epidemic, methods still used today for containing infectious diseases. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

PubMed

Rawal, H C; Singh, N K; Sharma, T R

2013-01-01

Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

Vitiligo iridis and glaucoma: a rare sequelae of small pox.

PubMed

Kavitha, S; Patel, S R; Mohini, P; Venkatesh, R; Sengupta, S

2015-10-01

Vitiligo iridis refers to focal areas of iris atrophy as sequelae of small pox infection. We report a series of patients with unilateral vitiligo iridis, some of whom presented with secondary open-angle glaucoma. Three patients with vitiligo iridis underwent a comprehensive ophthalmic examination including intraocular pressure (IOP) measurement, slit lamp biomicroscopy, gonioscopy, and fundus evaluation. Patients' facial features were also documented and photographed. All patients were in their sixth decade. Two out the three had elevated IOP (52 mm Hg and 36 mm Hg) in the same eye as vitiligo iridis, at initial presentation. Gonioscopy showed patchy iris hyperpigmentation and fundus evaluation showed glaucomatous optic disc changes in the involved eye. One patient responded favourably to topical antiglaucoma medications, whereas the other was taken up for combined phacoemulsification-trabeculectomy with good results. The third patient had normal IOP in the involved eye. All three patients gave a history of small pox in childhood and had pitted facial scars typical of previous small pox infection. Vitiligo iridis may be associated with the secondary glaucoma as a long-term sequelae of small pox. It may be prudent to periodically follow-up such patients for development of raised IOP in the future.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

PubMed Central

Rawal, H. C.; Singh, N. K.; Sharma, T. R.

2013-01-01

Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future. PMID:23671845

Alternative technologies to steam-methane reforming

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tindall, B.M.; Crews, M.A.

1995-11-01

Steam-methane reforming (SMR) has been the conventional route for hydrogen and carbon monoxide production from natural gas feedstocks. However, several alternative technologies are currently finding favor for an increasing number of applications. The competing technologies include: steam-methane reforming combined with oxygen secondary reforming (SMR/O2R); autothermal reforming (ATR); thermal partial oxidation (POX). Each of these alternative technologies uses oxygen as a feedstock. Accordingly, if low-cost oxygen is available, they can be an attractive alternate to SMR with natural gas feedstocks. These technologies are composed technically and economically. The following conclusions can be drawn: (1) the SMR/O2R, ATR and POX technologies canmore » be attractive if low-cost oxygen is available; (2) for competing technologies, the H{sub 2}/CO product ratio is typically the most important process parameter; (3) for low methane slip, the SMR/O2R, ATR and POX technologies are favored; (4) for full CO{sub 2} recycle, POX is usually better than ATR; (5) relative to POX, the ATR is a nonlicensed technology that avoids third-party involvement; (6) economics of each technology are dependent on the conditions and requirements for each project and must be evaluated on a case-by-case basis.« less

Extreme sensitivity to ultraviolet light in the fungal pathogen causing white-nose syndrome of bats

Treesearch

Jonathan M. Palmer; Kevin P. Drees; Jeffrey T. Foster; Daniel L. Lindner

2018-01-01

Bat white-nose syndrome (WNS), caused by the fungal pathogen Pseudogymnoascus destructans, has decimated North American hibernating bats since its emergence in 2006. Here, we utilize comparative genomics to examine the evolutionary history of this pathogen in comparison to six closely related nonpathogenic species....

Chicken pox infection in patients undergoing chemotherapy: A retrospective analysis from a tertiary care center in India.

PubMed

Noronha, Vanita; Ostwal, Vikas; Ramaswamy, Anant; Joshi, Amit; Nair, Reena; Banavali, Shripad D; Prabhash, Kumar

There is paucity of data on the incidence, severity and management of chicken pox in patients receiving active chemotherapy for cancer. From October 2010 to October 2011, patients were included in this study if they developed a chicken pox infection during their chemotherapy. The details of patients' cancer diagnosis and treatment along with clinical and epidemiological data of the chicken pox infections were assessed from a prospectively maintained database. Twenty-four patients had a chicken pox infection while receiving chemotherapy and/or radiotherapy. The median age of the patients was 21 years, and two-thirds of the patients had solid tumor malignancies. Overall, eight (33%) patients had complications, six (25%) patients had febrile neutropenia, four (17%) had diarrhea/mucositis, and four (17%) had pneumonia. The median time for recovery of the infection and complications in the patients was 9.5 days (5-29 days), whereas for neutropenic patients, it was 6.5 days (3-14 days). The median time for recovery from chicken pox infections in neutropenic patients was 10 days (5-21 days), compared with 8.5 days (0-29 days) in non-neutropenic patients (P=0.84). The median time for recovery from infections was 8.5 days in patients with comorbidities (N=4), which was the same for patients with no comorbidities. The clinical presentation and complication rates of chicken pox in cancer patients, who were on active chemotherapy, are similar to the normal population. The recovery from a varicella infection and complications may be delayed in patients with neutropenia. The varicella infection causes a therapy delay in 70% of patients. Aggressive antiviral therapy, supportive care and isolation of the index cases remain the backbone of treatment. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Acute pancreatitis : complication of chicken pox in an immunocompetent host.

PubMed

Roy, Pinaki; Maity, Pranab; Basu, Arindam; Dey, Somitra; Das, Biman; Ghosh, U S

2012-12-01

Chicken pox is a benign self limited disease. But it may rarely be complicated with acute pancreatitis in otherwise healthy patient. We present a case of varicella pancreatitis and its marked recovery with acyclovir.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Seroprevalence of Sheep and Goat Pox, Peste Des Petits Ruminants and Rift Valley Fever in Saudi Arabia.

PubMed

Boshra, Hani; Truong, Thang; Babiuk, Shawn; Hemida, Maged Gomaa

2015-01-01

Sheep and goat pox, peste des petits ruminants and Rift Valley fever are important diseases of small ruminant livestock. Sheep and goat pox, along with peste des petits ruminants, are endemic throughout most of Africa, Asia and the Middle East. Whereas Rift Valley fever is endemic in Africa, outbreaks in the Middle East have been reported over the past decade, including the Arabian Peninsula. Saudi Arabia is a major importer of livestock, and understanding the prevalence of these viral infections would be useful for disease control. In this study, sera from sheep and goats were collected from 3 regions in Saudi Arabia. They were evaluated for antibodies specific to sheep and goat pox, peste des petits ruminants and Rift Valley fever by virus neutralization assays. To the best of our knowledge, this is the first study to evaluate the seroprevalence of these viruses in sheep and goats.

Single amino acid changes in the 6K1-CI region can promote the alternative adaptation of Prunus- and Nicotiana-propagated Plum pox virus C isolates to either host.

PubMed

Calvo, María; Malinowski, Tadeusz; García, Juan Antonio

2014-02-01

Plum pox virus (PPV) C is one of the less common PPV strains and specifically infects cherry trees in nature. Making use of two PPV-C isolates that display different pathogenicity features, i.e., SwCMp, which had been adapted to Nicotiana species, and BY101, which had been isolated from cherry rootstock L2 (Prunus lannesiana) and propagated only in cherry species, we have generated two infective full-length cDNA clones in order to determine which viral factors are involved in the adaptation to each host. According to our results, the C-P3(PIPO)/6K1/N-CI (cylindrical inclusion) region contains overlapping but not coincident viral determinants involved in symptoms development, local viral amplification, and systemic movement capacity. Amino acid changes in this region promoting the adaptation to N. benthamiana or P. avium have trade-off effects in the alternative host. In both cases, adaptation can be achieved through single amino acid changes in the NIapro protease recognition motif between 6K1 and CI or in nearby sequences. Thus, we hypothesize that the potyvirus polyprotein processing could depend on specific host factors and the adaptation of PPV-C isolates to particular hosts relies on a fine regulation of the proteolytic cleavage of the 6K1-CI junction.

Characterization of structure and activity of garlic peroxidase (POX(1B)).

PubMed

El Ichi, Sarra; Miodek, Anna; Sauriat-Dorizon, Hélène; Mahy, Jean-Pierre; Henry, Céline; Marzouki, Mohamed Nejib; Korri-Youssoufi, Hafsa

2011-01-01

Structural characterization and study of the activity of new POX(1B) protein from garlic which has a high peroxidase activity and can be used as a biosensor for the detection of hydrogen peroxide and phenolic compounds were performed and compared with the findings for other heme peroxidases. The structure-function relationship was investigated by analysis of the spectroscopic properties and correlated to the structure determined by a new generation of high-performance hybrid mass spectrometers. The reactivity of the enzyme was analyzed by studies of the redox activity toward various ligands and the reactivity with various substrates. We demonstrated that, in the case of garlic peroxidase, the heme group is pentacoordinated, and has an histidine as a proximal ligand. POX(1B) exhibited a high affinity for hydrogen peroxide as well as various reducing cosubstrates. In addition, high enzyme specificity was demonstrated. The k(cat) and K(M) values were 411 and 400 mM(-1) s(-1) for 3,3',5,5'-tetramethylbenzidine and 2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid), respectively. Furthermore, the reduction of nitro compounds in the presence of POX(1B) was demonstrated by iron(II) nitrosoalkane complex assay. In addition, POX(1B) showed a great potential for application for drug metabolism since its ability to react with 1-nitrohexane in the presence of sodium dithionite was demonstrated by the appearance of a characteristic Soret band at 411 nm. The high catalytic efficiency obtained in the case of the new garlic peroxidase (POX(1B)) is suitable for the monitoring of different analytes and biocatalysis.

[Social and economic impact of chicken pox vaccine at 15 months of age. Castile and Leon, Spain, 2004].

PubMed

Pérez-Rubio, A; Castrodeza Sanz, J J; Gil Costa, M; Luquero Alcalde, F J; Eiros Bouza, J; Ortiz de Lejarazu, R

2008-01-01

Chicken pox is a mainly childhood contagious disease caused by the Varicella Zoster Virus which gives rise to major healthcare and social costs. In 2005, Castile and Leon added chicken pox vaccine injections to its childhood vaccination schedule for eleven year-olds subject to coming down with this disease. This strategy does not modify the major mobility generated thereby at younger ages. This study is aimed at evaluating the profitability of systematic vaccination for chicken pox in infants 15 months of age in Castile and Leon. An economic cost-benefit evaluation has been set out by jeans of a decision-making tree. A fictitious cohort of 100,000 children in Castile and Leon having reached 15 months of age in 2004 is studied, to whom the chicken pox vaccine would be administered in conjunction with the mumps, measles, rubella vaccines. This study is approached from the social standpoint. The time horizon selected was that of up until the study cohort was to reach 15 years of age, applying a 3% discount rate. A sensitivity analysis was made for evaluating the uncertainty of some variables... The cost-benefit ratio of adding this vaccine to the childhood vaccination schedule amounts to 1.23. From the social standpoint, administering chicken pox vaccine in conjunction with the mumps, measles, rubella vaccines show itself to be profitable. The profitability is modified both if a second dose of vaccine is added as well as if only the direct healthcare costs are analyzed.

Auto immune hemolytic anemia in a child precipitated by chicken pox.

PubMed

Billoo, Samina Shamim; Jamalvi, Syed Waseem

2008-05-01

Auto Immune Hemolytic Anemia (AIHA) is a rare entity in children. We report a case of an adolescent girl with AIHA, which was precipitated by chicken pox. Clinical course over 3 years, till remission is described.

Applications of Heider's p-o-x Balance Model to Classroom Situations

ERIC Educational Resources Information Center

Richey, Harold; Richey, Marjorie H.

1975-01-01

Some selected principles of Heider's balance theory are presented and the p-o-x model is explained as a theoretical framework for predicting responses to interpersonal situations in which the participants are in attitudinal agreement or disagreement. (Author)

Presetting ECG electrodes for earlier heart rate detection in the delivery room.

PubMed

Gulati, Rashmi; Zayek, Michael; Eyal, Fabien

2018-07-01

To determine whether heart rate (HR) could be detected earlier than by pulse oximeter (POX), using a novel method of application of electrocardiogram (ECG) electrodes during neonatal resuscitation in the delivery room. ECG electrodes were set before delivery to be applied to the back of infants' thorax. Time to detect HR was recorded as soon as a numerical HR along with a recognizable and persistent QRS complex was observed on ECG monitor (HRECG) and a plethysmographic waveform was seen on POX monitor (HRPOX). Out of 334 infants, 49 were <31 weeks of gestational age. Overall, the median (interquartile range, IQR) time to detect HRECG was significantly shorter [29 (5, 60) seconds] than time by POX [60 (45,120) seconds], (p < 0.001). Similarly, in <31-week infants, the median (IQR) time to detect HRECG was 10 (2, 40) seconds compared to 60 (30,120) seconds by POX, (p < 0.001). Failure to have HR detected by 1 minute occurred in 30%, 54% and 20% of infants by ECG, POX and either of the devices, respectively. In the delivery room, electrodes applied by the study method are more effective than pulse oximetry in providing the neonatal team with timely HR information that is necessary for proper resuscitative actions. Published by Elsevier B.V.

POX 52: A Dwarf Seyfert 1 Galaxy with an Intermediate-Mass Black Hole

NASA Astrophysics Data System (ADS)

Barth, Aaron J.; Ho, Luis C.; Rutledge, Robert E.; Sargent, Wallace L. W.

2004-05-01

We describe new optical images and spectra of POX 52, a dwarf galaxy with an active nucleus that was originally detected in the POX objective-prism survey. While POX 52 was originally thought to be a Seyfert 2 galaxy, the new data reveal an emission-line spectrum very similar to that of the dwarf Seyfert 1 galaxy NGC 4395, with broad components to the permitted line profiles, and we classify POX 52 as a Seyfert 1 galaxy. The host galaxy appears to be a dwarf elliptical, and its brightness profile is best fit by a Sérsic model with an index of 3.6+/-0.2 and a total magnitude of MV=-17.6. Applying mass-luminosity-line width scaling relations to estimate the black hole mass from the broad Hβ line width and nonstellar continuum luminosity, we find MBH~1.6×105Msolar. The stellar velocity dispersion in the host galaxy, measured from the Ca II λ8498, 8542 lines, is 36+/-5 km s-1, also suggestive of a black hole mass of order 105Msolar. Further searches for active nuclei in dwarf galaxies can provide unique constraints on the demographics of black holes in the mass range below 106Msolar.

Molecular epidemiology of goat pox viruses.

PubMed

Roy, P; Jaisree, S; Balakrishnan, S; Senthilkumar, K; Mahaprabhu, R; Mishra, A; Maity, B; Ghosh, T K; Karmakar, A P

2018-02-01

Goat pox disease outbreaks were observed in different places affecting Black Bengal Goats in West Bengal (WB) and Tellicherry, Vembur and non-descriptive breeds in Tamil Nadu (TN) causing severe lesions and mortality up to 30%. Clinical specimens from all the outbreaks were screened by polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) and confirmed the diseases as Goat Pox. Virus isolation in Vero cell line was done with randomly selected ten samples, cytopathic effects (CPE) characterized by syncytia and intracytoplasmic inclusion bodies were observed after several blind passages. Nucleotide sequence of complete p32 gene using randomly selected two isolates and three clinical specimens revealed presence of Goat pox virus (GTPV)-specific signature residues in all the sequences. Phylogenetic analysis using the present five sequences along with GenBank data of GTPV complete p32 gene sequences showed all the GTPV sequences cluster together except Pellor strain (NC004003) and FZ Chinese strain (KC951854). The five sequences either from WB or TN cluster more closely with GTPV isolates of Maharashtra state that were responsible for cross species outbreak of pox disease in both sheep (KF468759) and goats (KF468762) in India during the year 2010. All the Indian goat pox viruses, including the Mukteswar strain, isolated in 1946 and sequence reported in 2004 clustered together with the GTPVs causing the recent outbreaks. It was observed that GTPVs caused similar clinical manifestation irrespective of their geographical locations and breed characteristics, no variation observed among the Indian isolates based on p32 gene over the period of seventy years and disease outbreaks could not be observed or reported in vaccinated goats. © 2017 Blackwell Verlag GmbH.

mi-siRNAs and plum pox virus resistance

USDA-ARS?s Scientific Manuscript database

The agricultural sector is expecting to derive tangible benefits from the investments that have been made in plant biotechnology. Although plant biotechnology research has been carried out for decades, only a few examples of biotech horticultural crops have reached the market. Plum pox virus (PPV)...

77 FR 5381 - Plum Pox Compensation

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-03

... to provide for the payment of compensation to eligible owners of non-fruit-bearing ornamental tree... fruit orchards and fruit tree nurseries whose trees are required to be destroyed in order to prevent the... for treating trees or other plant material infected with plum pox, nor are there any known effective...

Development and deregulation of the plum pox virus resistant transgenic plum 'HoneySweet'

USDA-ARS?s Scientific Manuscript database

We have demonstrated that genetic engineering can be an important source of high level and durable resistance against Plum pox virus (PPV). We have shown, through a number of field studies, the environmental safety of this genetically engineered plum. Nevertheless, the utilization of this demonstr...

Needle reactions in resistance to Cronartium ribicola: Hypersensitivity response or not?

Treesearch

Katarina Sweeney; Jeffrey Stone; Kathy Cook; Richard A. Sniezko; Angelia Kegley; Anna W. Schoettle

2012-01-01

White pine blister rust (WPBR) is caused by the fungal pathogen Cronartium ribicola. The pathogen is native to Eurasia and was introduced to North America early in the 20th century and is still spreading destructively throughout the range of native western white pines (Douglas ex D. Don) (McDonald and Hoff 2001). All of the North American five-needle (white) pines are...

Post chicken pox neurological sequelae: Three distinct presentations.

PubMed

Paul, Rudrajit; Singhania, Pankaj; Hashmi, Ma; Bandyopadhyay, Ramtanu; Banerjee, Amit Kumar

2010-07-01

Varicella zoster infection is known to cause neurological involvement. The infection is usually self-limiting and resolves without sequelae. We present a series of three cases with neurological presentations following chicken pox infection. The first case is a case of meningitis, cerebellitis and polyradiculopathy, the second is a florid case of acute infective demyelinating polyradiculoneuropathy (Guillian-Barré syndrome) in a middle-aged female and the third case is a young man in whom we diagnosed acute transverse myelitis. All these cases presented with distinct neurological diagnoses and the etiology was established on the basis of history and serological tests confirmatory for chicken pox. The cases responded differently to treatment and the patients were left with minimum disability.

Rare sugars and sugar-based synthons by chemo-enzymatic synthesis.

PubMed

Giffhorn; Köpper; Huwig; Freimund

2000-12-01

The unique catalytic potential of the fungal enzyme pyranose oxidase was demonstrated by preparative conversions of a variety of carbohydrates, and by extensive chemical characterization of the reaction products with NMR spectroscopy. The studies revealed that POx not only oxidizes most substrates very efficiently but also that POx possesses a glycosyl-transfer potential, producing disaccharides from beta-glycosides of higher alcohols. Although most substrates are oxidized by POx at the C-2 position, several substrates are converted into the 3-keto-derivatives. On the basis of these products, strategies are developed for the convenient production of sugar-derived synthons, rare sugars and fine chemicals by combining biotechnical and chemical methods.

Phosphorus oxide gate dielectric for black phosphorus field effect transistors

NASA Astrophysics Data System (ADS)

Dickerson, W.; Tayari, V.; Fakih, I.; Korinek, A.; Caporali, M.; Serrano-Ruiz, M.; Peruzzini, M.; Heun, S.; Botton, G. A.; Szkopek, T.

2018-04-01

The environmental stability of the layered semiconductor black phosphorus (bP) remains a challenge. Passivation of the bP surface with phosphorus oxide, POx, grown by a reactive ion etch with oxygen plasma is known to improve photoluminescence efficiency of exfoliated bP flakes. We apply phosphorus oxide passivation in the fabrication of bP field effect transistors using a gate stack consisting of a POx layer grown by reactive ion etching followed by atomic layer deposition of Al2O3. We observe room temperature top-gate mobilities of 115 cm2 V-1 s-1 in ambient conditions, which we attribute to the low defect density of the bP/POx interface.

Plum pox virus (PPV) genome expression in genetically engineered RNAi plants

USDA-ARS?s Scientific Manuscript database

An important approach to controlling sharka disease caused by Plum pox virus (PPV) is the development of PPV resistant plants using small interfering RNAs (siRNA) technology. In order to evaluate siRNA induced gene silencing, we studied, based on knowledge of the PPV genome sequence, virus genome t...

Evaluation of thermodynamically favourable operating conditions for production of hydrogen in three different reforming technologies

NASA Astrophysics Data System (ADS)

Seo, Y.-S.; Shirley, A.; Kolaczkowski, S. T.

With the aid of thermodynamic analysis using AspenPlus™, the characteristics of three different types of reforming process are investigated. These include: steam-methane reforming (SMR), partial oxidation (POX) and autothermal reforming (ATR). Thereby, favourable operating conditions are identified for each process. The optimum steam-to-carbon (S:C) ratio of the SMR reactor is found to be 1.9. The optimum air ratio of the POX reactor is 0.3 at a preheat temperature of 312 °C. The optimum air ratio and S:C ratio of the ATR reactor are 0.29 and 0.35, respectively at a preheat temperature of 400 °C. Simulated material and energy balances show that the CH 4 flow rates required to generate 1 mol s -1 of hydrogen are 0.364 mol s -1 for POX, 0.367 mol s -1 for ATR and 0.385 mol s -1 for the SMR. These results demonstrate that the POX reforming system has the lowest energy cost to produce the same amount of hydrogen from CH 4.

Characterization of sheep pox virus vaccine for cattle against lumpy skin disease virus.

PubMed

Tuppurainen, Eeva S M; Pearson, Caroline R; Bachanek-Bankowska, Katarzyna; Knowles, Nick J; Amareen, Shadi; Frost, Lorraine; Henstock, Mark R; Lamien, Charles E; Diallo, Adama; Mertens, Peter P C

2014-09-01

Lumpy skin disease is of significant economic impact for the cattle industry in Africa. The disease is currently spreading aggressively in the Near East, posing a threat of incursion to Europe and Asia. Due to cross-protection within the Capripoxvirus genus, sheep pox virus (SPPV) vaccines have been widely used for cattle against lumpy skin disease virus (LSDV). In the Middle East and the Horn of Africa these vaccines have been associated with incomplete protection and adverse reactions in cattle post-vaccination. The present study confirms that the real identity of the commonly used Kenyan sheep and goat pox vaccine virus (KSGP) O-240 is not SPPV but is actually LSDV. The low level attenuation of this virus is likely to be not sufficient for safe use in cattle, causing clinical disease in vaccinated animals. In addition, Isiolo and Kedong goat pox strains, capable of infecting sheep, goats and cattle are identified for potential use as broad-spectrum vaccine candidates against all capripox diseases. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

Constituents of Propolis: Chrysin, Caffeic Acid, p-Coumaric Acid, and Ferulic Acid Induce PRODH/POX-Dependent Apoptosis in Human Tongue Squamous Cell Carcinoma Cell (CAL-27).

PubMed

Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech

2018-01-01

Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p -coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis.

Constituents of Propolis: Chrysin, Caffeic Acid, p-Coumaric Acid, and Ferulic Acid Induce PRODH/POX-Dependent Apoptosis in Human Tongue Squamous Cell Carcinoma Cell (CAL-27)

PubMed Central

Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech

2018-01-01

Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p-coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis. PMID:29681859

A Multiwavelength Study of POX 52, a Dwarf Seyfert Galaxy with an Intermediate-Mass Black Hole

NASA Astrophysics Data System (ADS)

Barth, Aaron

2004-07-01

We propose a comprehensive optical, UV, and X-ray investigation of the unique galaxy POX 52. POX 52 is a Seyfert 1 galaxy with unprecedented properties: its host galaxy appears to be a dwarf elliptical, and its stellar velocity dispersion is only 36 km/s. The stellar velocity dispersion and the broad emission-line widths both suggest a black hole mass of order 10^5 solar masses, placing POX 52 in a region of AGN parameter space that is almost completely unexplored at present. We request ACS/HRC imaging to perform a definitive measurement of the host galaxy structure; STIS UV and optical spectroscopy to study the nonstellar continuum and the structure of the broad-line region; and Chandra ACS imaging to detect the X-ray emission from the nucleus and investigate its spectral and variability properties. The results of this program will give a detailed understanding of the host galaxy and accretion properties of one of the very few known black holes in the mass range around 10^5 solar masses.

[Direct costs of complicated chicken pox in a Colombian pediatric population].

PubMed

Alvis-Guzmán, Nelson; Paternina-Caicedo, Angel; Alvis-Estrada, Luis; De la Hoz-Restrepo, Fernando

2011-12-01

Estimating the cost of chicken pox in a Colombian pediatric population. This was a retrospective case study which searched for all diagnosed chicken pox cases in the Napoleón Franco Pareja children's hospital (Cartagena, Colombia), during 2005-2008. The hospital's records/perspective was used. Cost related to health personnel, lab, diagnostic images and drugs were searched. The micro-costing was made at Colombian peso prices for 2010. An adjustment was made for inflation. Mean hospital costs were $ 898,766 (Q1: $ 197,348; Q3: $ 1,195,262). Mean hospital cost per day was $ 221,777 (Q1: $ 97,027; Q3: $ 293,740). Mean cost <1 year-old patients was $ 980,742 (Q1: $ 905,708; Q3: $ 1,026,031). Mean cost was $ 105,833 in 5-12 year-old patients (Q1: $ 39,568; Q3: $ 891,824). The results were similar to those of previous studies (in Panama and some developed countries) highlighting relatively high illness costs in Colombia. These results increase the evidence in favor of vaccination and invite Colombian public health officials to consider introducing a chicken pox vaccine into Colombia.

Onboard fuel reformers for fuel cell vehicles: Equilibrium, kinetic and system modeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreutz, T.G.; Steinbugler, M.M.; Ogden, J.M.

1996-12-31

On-board reforming of liquid fuels to hydrogen for use in proton exchange membrane (PEM) fuel cell electric vehicles (FCEVs) has been the subject of numerous investigations. In many respects, liquid fuels represent a more attractive method of carrying hydrogen than compressed hydrogen itself, promising greater vehicle range, shorter refilling times, increased safety, and perhaps most importantly, utilization of the current fuel distribution infrastructure. The drawbacks of on-board reformers include their inherent complexity [for example a POX reactor includes: a fuel vaporizer, a reformer, water-gas shift reactors, a preferential oxidation (PROX) unit for CO cleanup, heat exchangers for thermal integration, sensorsmore » and controls, etc.], weight, and expense relative to compressed H{sub 2}, as well as degraded fuel cell performance due to the presence of inert gases and impurities in the reformate. Partial oxidation (POX) of automotive fuels is another alternative for hydrogen production. This paper provides an analysis of POX reformers and a fuel economy comparison of vehicles powered by on-board POX and SRM fuel processors.« less

Case report: Pox in the mourning dove in Maryland

USGS Publications Warehouse

Locke, L.N.; Herman, C.M.; King, E.S.

1960-01-01

Although trichomoniasis has received attention as a cause of death among mourning doves (Zenaidura macroura),  ittle work has been done on other diseases of this species. Kossack and Hanson2 reported the occurrence of pox lesions in mourning doves in Illinois. Rosen3 reported that "pigeon pox" had caused a severe mortality in a mourning dove flock near Yreka, Siskiyou County, California. A severe outbreak of pox that occurred in a captive flock of mourning doves at the Patuxent Research Refuge further emphasizes the need for more study of this disease as a cause of dove mortality. Twenty-two mourning doves were live trapped on the Agricultural Research Center, Beltsville, Maryland, in September, 1958. The doves were examined for presence of Trichomonas gallinae and, when found to be free of trichomonads, were made the nucleus of a captive dove colony. A mourning dove that had a small, pink nodule on the left eyelid was captured on the Agricultural Research Center on September 17, 1958. The nodule was excised and the cut surface was treated with tincture of merthiolate. The dove then was added to the dove colony.

Sites and Regulation of Polyamine Catabolism in the Tobacco Plant. Correlations with Cell Division/Expansion, Cell Cycle Progression, and Vascular Development1

PubMed Central

Paschalidis, Konstantinos A.; Roubelakis-Angelakis, Kalliopi A.

2005-01-01

We previously gave a picture of the homeostatic characteristics of polyamine (PA) biosynthesis and conjugation in tobacco (Nicotiana tabacum) plant organs during development. In this work, we present the sites and regulation of PA catabolism related to cell division/expansion, cell cycle progression, and vascular development in the tobacco plant. Diamine oxidase (DAO), PA oxidase (PAO), peroxidases (POXs), and putrescine N-methyltransferase expressions follow temporally and spatially discrete patterns in shoot apical cells, leaves (apical, peripheral, and central regions), acropetal and basipetal petiole regions, internodes, and young and old roots in developing plants. DAO and PAO produce hydrogen peroxide, a plant signal molecule and substrate for POXs. Gene expression and immunohistochemistry analyses reveal that amine oxidases in developing tobacco tissues precede and overlap with nascent nuclear DNA and also with POXs and lignification. In mature and old tissues, flow cytometry indicates that amine oxidase and POX activities, as well as pao gene and PAO protein levels, coincide with G2 nuclear phase and endoreduplication. In young versus the older roots, amine oxidases and POX expression decrease with parallel inhibition of G2 advance and endoreduplication, whereas putrescine N-methyltransferase dramatically increases. In both hypergeous and hypogeous tissues, DAO and PAO expression occurs in cells destined to undergo lignification, suggesting a different in situ localization. DNA synthesis early in development and the advance in cell cycle/endocycle are temporally and spatially related to PA catabolism and vascular development. PMID:16040649

Cutaneous form of pox infection among captive peafowl (Pavo cristatus) chicks.

PubMed

Khan, Ahrar; Yousaf, Arfan; Khan, M Zargham; Siddique, Muhammad; Gul, S Tehseen; Mahmood, Fazal

2009-02-01

The present study was carried out to investigate the epidemiology and lesions of avian pox in captive peafowl chicks. Overall values of morbidity, mortality and case fatality were 45.2%, 27.1% and 60.0%, respectively. The chicks of 9 to 12 weeks of age showed a significantly (P<0.001) higher prevalence rate than other age groups. The morbidity and mortality due to avian pox in peafowl chicks was significantly (P<0.001) reduced when kept in mosquito-proof cages and hatched under broody chicken hens. Morbidity due to poxvirus infection on the peafowl farm was 82%, 26% and 12% in successive years. This reduction might have been the result of the introduction of mosquito-proof nets after year 1, although this was not the subject of a controlled experiment. All of the peafowl chicks suffering from dry pox showed pustular and nodular lesions on eye lids, beak, legs and toes. Distribution of lesions in different body parts varied significantly (P<0.023). Lesion diameters were less than 1 cm (59.73%), 1 to 2 cm (23.75%) and more than 2 cm (16.87%). Histopathological studies revealed extensive proliferation of subdermal connective tissue and infiltration of heterophils and macrophages. The keratinocytes showed degenerative changes in the form of cytoplasmic vacuolation, ballooning and hyper-chromatic nuclei. Eosinophilic intracytoplasmic inclusions (Bollinger bodies) in keratinocytes were consistently present. It was concluded that avian pox rendered high morbidity, mortality and case fatality in peafowl chicks.

Reprogramming of proline and glutamine metabolism contributes to the proliferative and metabolic responses regulated by oncogenic transcription factor c-MYC

PubMed Central

Liu, Wei; Le, Anne; Hancock, Chad; Lane, Andrew N.; Dang, Chi V.; Fan, Teresa W.-M.; Phang, James M.

2012-01-01

In addition to glycolysis, the oncogenic transcription factor c-MYC (MYC) stimulates glutamine catabolism to fuel growth and proliferation of cancer cells through up-regulating glutaminase (GLS). Glutamine is converted to glutamate by GLS, entering the tricarboxylic acid cycle as an important energy source. Less well-recognized, glutamate can also be converted to proline through Δ1-pyrroline-5-carboxylate (P5C) and vice versa. This study suggests that some MYC-induced cellular effects are due to MYC regulation of proline metabolism. Proline oxidase, also known as proline dehydrogenase (POX/PRODH), the first enzyme in proline catabolism, is a mitochondrial tumor suppressor that inhibits proliferation and induces apoptosis. MiR-23b* mediates POX/PRODH down-regulation in human kidney tumors. MiR-23b* is processed from the same transcript as miR-23b; the latter inhibits the translation of GLS. Using MYC-inducible human Burkitt lymphoma model P493 and PC3 human prostate cancer cells, we showed that MYC suppressed POX/PRODH expression primarily through up-regulating miR-23b*. The growth inhibition in the absence of MYC was partially reversed by POX/PRODH knockdown, indicating the importance of suppression of POX/PRODH in MYC-mediated cellular effects. Interestingly, MYC not only inhibited POX/PRODH, but also markedly increased the enzymes of proline biosynthesis from glutamine, including P5C synthase and P5C reductase 1. MYC-induced proline biosynthesis from glutamine was directly confirmed using 13C,15N-glutamine as a tracer. The metabolic link between glutamine and proline afforded by MYC emphasizes the complexity of tumor metabolism. Further studies of the relationship between glutamine and proline metabolism should provide a deeper understanding of tumor metabolism while enabling the development of novel therapeutic strategies. PMID:22615405

Sero-prevalence, risk factors and distribution of sheep and goat pox in Amhara Region, Ethiopia.

PubMed

Fentie, Tsegaw; Fenta, Nigusie; Leta, Samson; Molla, Wassie; Ayele, Birhanu; Teshome, Yechale; Nigatu, Seleshe; Assefa, Ashenafi

2017-12-11

Sheep pox and goat pox are contagious viral diseases of sheep and goats, respectively. The diseases result in substantial economic losses due to decreased milk and meat production, damage to hides and wool, and possible trade restriction. A study was undertaken in Amhara region of Ethiopia. A cross-sectional study design was used to estimate the sero-prevalence and identify associated risk factors, while retrospective study design was used to assess the temporal and spatial distribution of the disease. A total of 672 serum samples were collected from 30 Kebeles and tested using virus neutralization test. From a total of 672 sera tested, 104 (15.5%) were positive for sheep and goat pox virus antibody; from which 56 (17%) were sheep and 48 (14%) were goats. The diseases were prevalent in all study zones, the highest sero-prevalence was observed in South Gondar (20.9%) and the lowest in North Gondar and West Gojjam zones (11.9% each). From the potential risk factors considered (species, sex, age, agro-ecology and location); only sex and age were significantly associated (p < 0.05) with the diseases in multivariable logistic regression. Female and young animals were at higher risk than their counterparts. From January 2010 to December 2014, a total of 366 outbreaks, 12,822 cases and 1480 deaths due to SP and 182 outbreaks, 10,066 cases and 997 deaths due to GP were recorded in Amhara National Regional State. Both the serological and the outbreak data revealed that sheep and goat pox is one of the most prevalent and widespread diseases of sheep and goats in the study area. Hence, annual mass vaccination program must be implemented for economic and viable control of sheep and goat pox diseases in the Amhara region in particular and at a national level in general.

Fusarium spp. and Pinus strobus seedlings: root disease pathogens and taxa associated with seed

Treesearch

C. M. Ocamb; J. Juzwik; F. B. Martin

2002-01-01

Eastern white pine (Pinus strobus L .) seeds were sown in soil infested wlth Fusarium proliferatum, root necrosis developed on seedling roots, and F. proliferatum as reisolated from symptomatic roots; thus, demonstrating that F. proliferatum is pathogenic to eastern white pine seedling. Soils...

Phylogenetics of a fungal invasion: origins and widespread dispersal of white-nose syndrome

Treesearch

Kevin P. Drees; Jeffrey M. Lorch; Sebastien J. Puechmaille; Katy L. Parise; Gudrun Wibbelt; Joseph R. Hoyt; Keping Sun; Ariunbold Jargalsaikhan; Munkhnast Dalannast; Jonathan M. Palmer; Daniel L. Lindner; A. Marm Kilpatrick; Talima Pearson; Paul S. Keim; David S. Blehert; Jeffrey T. Foster; Joseph Heitman

2017-01-01

Globalization has facilitated the worldwide movement and introduction of pathogens, but epizoological reconstructions of these invasions are often hindered by limited sampling and insufficient genetic resolution among isolates. Pseudogymnoascus destructans, a fungal pathogen causing the epizootic of white-nose syndrome in North American bats, has...

Potential Military Chemical/Biological Agents and Compounds

DTIC Science & Technology

2005-01-01

synonym: fowl plague) Bluetongue virus Fungi Foot and mouth disease virus Colletorichum coffeanum var Goat pox virus Cochiliobolus...Swine vesicular disease virus) Virus Rinderpest virus (synonym: Cattle plague Barley Yellow Dwarf Virus Sheep pox virus Teschen disease virus...2) Occurrence. Infection has been documented throughout the US, in Canada, western and central Mexico , Panama, Costa Rica, Colombia, Argentina

Silencing in genetically engineered Prunus domestica provides durable and safe resistance to Plum pox virus (sharka disease)

USDA-ARS?s Scientific Manuscript database

Originally identified in Bulgaria in 1915, Plum pox virus (PPV) is the most damaging virus of stone fruit trees including apricot, plum, peach, and cherry. PPV steadily spread throughout Europe over the years since its discovery, and at the turn of the century (1999-2000), it reached North America ...

'HoneySweet' (C5), the first genetically engineered Plum pox virus-resistant plum (Prunus domestica L.) cultivar

USDA-ARS?s Scientific Manuscript database

‘HoneySweet’ plum was released by the U.S. Department of Agriculture, Agricultural Research Service, to provide U.S. growers and P. domestica plum breeders with a high fruit quality plum cultivar resistant to Plum pox virus (PPV). ‘HoneySweet’ was developed through genetic engineering utilizing the...

The Electrochemical Society, Inc. Meeting Program (181st), Held in St. Louis, Missouri on May 17-22, 1992. Including: State-of-the-Art Program on Compound Semiconductors XVI, Fullerenes: Chemistry, Physics, and New Directions, Quantum Confinement, Micromachining and Microstructures, Electronics/Dielectric Science and Technology Joint Recent News Papers

DTIC Science & Technology

1991-04-28

evening. After the boat has crusied for Division Executive Committee a while, you will be served a buffet-style dinner of baked ham. chicken a Is...you would like to discuss. a The Pox Theatre and St. Louis Science Center are spectacular sites member of the Society Headquarters Staff will be...be no larger than 8 In 1929 by William Pox of 20th Century Pon fame, as crown jewel of 1" i 11’. ie empire, It be earned the name "The Fabulous Pox

An Outbreak of Sheep Pox in Zabajkalskij kray of Russia.

PubMed

Maksyutov, R A; Gavrilova, E V; Agafonov, A P; Taranov, O S; Glotov, A G; Miheev, V N; Shchelkunov, S N; Sergeev, A N

2015-08-01

In this study, we investigated recent sheep pox outbreaks that occurred in Ononsky and Borzunsky regions of Zabajkalskij kray of Russia. The outbreaks involved in 2756 animals of which 112 were infected and 3 were slaughtered. Samples of injured skin of infected sheep were analysed by electron microscopy and CaPV-specific P32 gene amplification. Following sequence analysis of entire P32 gene showed that both specimens were identical to the sequence of several sheep poxvirus isolates from China and India. The close location of China to the last decade's Russian outbreaks suggest that possible future outbreaks in Russia could occur along the border regions with countries where sheep and goat pox are not controlled. © 2013 Blackwell Verlag GmbH.

Protecting trees against virus diseases in the 21st century: genetic engineering of Plum pox virus resistance - from concept to product

USDA-ARS?s Scientific Manuscript database

Sharka disease, caused by Plum pox virus (PPV), was first recorded in Bulgaria during the early twentieth century. Since that first report, the disease has progressively spread throughout Europe where it has infected over 100 million stone fruit trees. From Europe, sharka disease spread to Asia, A...

World Epidemiology Review, Number 109.

DTIC Science & Technology

1978-10-11

Various sources, various dates) ..........j 0 Medical Tests Made Secretly Tests Indicate Chicken Pox Socioeconomic Ramifications of...Abating BURMA Briefs Campaign Against Diseases 12 CAMEROON Briefs Vaccination Campaign 13 EAST GERMANY Briefs Medical Care Shortages Ik...AMONG INDIANS IS REALLY CHICKEN POX Medical Tests Made Secretly Sao Paulo 0 ESTADO DE SAO PAULO in Portuguese 19 Aug 78 p 14 [Text] Nearly all the

Childhood Disintegrative Disorder as a Complication of Chicken Pox.

PubMed

Verma, Jitendra Kumar; Mohapatra, Satyakam

2016-01-01

Childhood disintegrative disorder (CDD) is characterized by late onset (>3 years of age) of developmental delays in language, social function and motor skills. Commonly there is no antecedent physical disorder leading to childhood disintegrative disorder. The present case report describes a child who developed childhood disintegrative disorder at the age of 6 years after an episode of chicken pox.

Lipid-modifying enzymes in oat and faba bean.

PubMed

Yang, Zhen; Piironen, Vieno; Lampi, Anna-Maija

2017-10-01

The aim was to study lipase, lipoxygenase (LOX) and peroxygenase (POX) activities in oat and faba bean samples to be able to evaluate their potential in formation of lipid-derived off-flavours. Lipase and LOX activities were measured by spectroscopy, and POX activities via the formation of epoxides. An ultra-high performance liquid chromatography method was developed to study the formation of fatty acid epoxides. The epoxides of esters were measured by gas chromatography. Mass spectroscopy was used to verify the identity of the epoxides. Both oat and faba bean possessed high lipase activities. In faba bean, LOX catalysed the formation of hydroperoxides, whose break-down products are the likely cause of off-flavours. Since oat had low LOX activity, autoxidation is needed to initiate lipid oxidation. Oat had high POX activity, which is able to convert hydroperoxides to epoxy and hydroxy fatty acids that could contribute significantly to off-flavours. POX activity in the faba bean was low. Thus, in faba bean volatile lipid oxidation products could rapidly be formed by LOX, whereas in oat reactions are slower due to the need of autoxidation prior to further reactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Great Pox and the Surgeon's Role in the Sixteenth Century.

PubMed

Allen Shotwell, R

2017-01-01

The sixteenth century saw a shift in perceptions of the scope of surgery. The medieval focus on elevating the status of surgery had been accompanied by a certain distancing of surgery from manual operations, but the medical humanism of the sixteenth century embraced manual skills as an important part of medicine, most noticeably in the case of anatomy. In the first part of this paper I use accounts of the treatment of ulcers as a way of exploring these changes in perceptions. Ulcers were a well-known surgical ailment in medieval medicine, but in the sixteenth century they were also associated with the Great Pox. This made their treatment an important test case for establishing the scope of surgery and ultimately led Gabriele Falloppio to claim that ulcers from the Pox were not a part of surgery at all. In the second half of the paper, I look at sixteenth-century descriptions of surgery found in works on surgery and anatomy and note how important the idea of the efficacy of surgical treatment was in them. I conclude by suggesting that the concern with efficacy was itself another aspect of the arrival of the Pox.

Avian pox in a red-tailed hawk (Buteo jamaicensis)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fitzner, R.E.; Miller, R.A. Pierce, C.A.; Rowe, S.E.

1985-07-01

Avian pox has been reported in at least 60 species of birds belonging to 20 different families. However, poxvirus infection in birds of prey is apparently uncommon. On 18 May 1981, an adult male red-tailed hawk was found on the US Department of Energy's Arid Land Ecology Reserve in Benton County, Washington. The bird was incapable of flight and was extremely thin. Nodular proliferations were noted on both feet and cutaneous scab-like lesions around the beak and eyes. The bird was killed in the field and submitted promptly to the diagnostic laboratory for necropsy. This report of pox infection inmore » a free-living adult red-tailed hawk represents one of the few such cases reported in the US. The potential for spread of the virus to other hawks may occur particularly during the nesting season when an infected adult could conceivably pass the virus to a mate and nestlings by direct contact or fomites. Little is known of the natural of avian pox infection in birds of prey. In other birds it is generally considered mild and self-limiting; however, eye lesions resulting in impaired vision may lead to starvation.« less

Prevalence and spatial distribution of antibodies to bovine viral diarrhea virus and Coxiella burnetii in white-tailed deer (Odocoileus virginianus) in New York and Pennsylvania.

PubMed

Kirchgessner, Megan S; Dubovi, Edward J; Porter, William F; Zylich, Nancy C; Whipps, Christopher M

2012-09-01

Significant pathogens of domestic livestock and public-health related pathogens, such as bovine viral diarrhea virus (BVDV) and Coxiella burnetii, are commonly diagnosed in some wildlife species. BVDV is an economically important pathogen of domestic bovids and Coxiella burnetii is a highly infectious zoonotic bacterium. As a result of recent shifting patterns of disease, it is critical that baseline information regarding the status of both significant pathogens of domestic livestock and public-health related pathogens are established for commonly encountered wildlife such as white-tailed deer (Odocoileus virginianus). White-tailed deer are susceptible to both BVDV and C. burnetii infection, and the purpose of this study was to investigate for the presence of antibodies to these two pathogens in New York and Pennsylvania white-tailed deer. Exposure to BVDV and C. burnetii was determined using sera collected from 333 (219 males and 114 females) wild white-tailed deer in New York and 291 (130 males and 161 females) wild white-tailed deer from Pennsylvania. Samples were collected from hunter-harvested deer in central New York State in 2009 and live-captured deer in Pennsylvania in 2010. Sera were screened for anti-BVDV antibodies via a commercial blocking BVDV enzyme-linked immunosorbent assay. Coxiella burnetii phase II whole-cell antigen-coated slides were used to screen sera via an indirect microimmunofluorescence assay. Antibody prevalence was compared by sex class and location of collection. Deer in New York had higher antibody prevalence to BVDV (6.01%) than did deer in Pennsylvania (0.34%). Conversely, C. burnetii phase II antibodies were more common in Pennsylvania (20.96%) than in New York (14.41%). No statistically significant difference between locations was observed in either BVDV or C. burnetii antibody prevalence when data were analyzed by sex-class. Overall, C. burnetii seroprevalence was not significantly higher in Pennsylvania than in New York.

Reactivation of model cholinesterases by oximes and intermediate phosphyloximes: A computational study

PubMed Central

Vyas, Shubham; Hadad, Christopher M.

2008-01-01

Phosphyloximes (POX) are generated upon the reactivation of organophosphorus (OP) inhibited cholinesterases (ChEs) by pyridinium oximes. These POXs are known to be potent inhibitors of the ChEs following reactivation. However, they can also decompose to give an OP derivative and a cyano derivative of the oxime when a base abstracts the benzylic proton. Using density functional theory, thermodynamic properties were calculated for the reactivation and decomposition pathways of three different oximes (2-PAM, 3-PAM and 4-PAM) with six different OPs (cyclosarin, paraoxon, sarin, tabun, VR and VX). For reactivation purposes, 2-PAM is predicted to be more efficient than 3- and 4-PAM. Based on atomic charges and relative energies, 2-POXs were found to be more inclined towards the decomposition process. PMID:18582852

The Meaning of Signs:

PubMed Central

Stein, Claudia

2006-01-01

This article reconstructs the diagnostic act of the French pox in the French-disease hospital of sixteenth-century Augsburg. It focuses on how the participants in the clinical encounter imagined the configuration of the pox and its localization in the human body. Of central importance for answering this question is the early modern conception of physical signs. It has been argued that it was due to a specific understanding of bodily signs and their relationship to a disease and its causes, that disease definition and classification in the early modern period showed a high degree of flexibility and fluidity. This paper looks at how the sixteenth-century theoretical conception of physical signs not only shaped the diagnosis and treatment of the pox but also reflected the overall organization of institutions. PMID:17242549

Resistance to Plum pox virus strain C in Arabidopsis thaliana and Chenopodium foetidum involves genome-linked viral protein and other viral determinants and might depend on compatibility with host translation initiation factors.

PubMed

Calvo, María; Martínez-Turiño, Sandra; García, Juan Antonio

2014-11-01

Research performed on model herbaceous hosts has been useful to unravel the molecular mechanisms that control viral infections. The most common Plum pox virus (PPV) strains are able to infect Nicotiana species as well as Chenopodium and Arabidopsis species. However, isolates belonging to strain C (PPV-C) that have been adapted to Nicotiana spp. are not infectious either in Chenopodium foetidum or in Arabidopsis thaliana. In order to determine the mechanism underlying this interesting host-specific behavior, we have constructed chimerical clones derived from Nicotiana-adapted PPV isolates from the D and C strains, which differ in their capacity to infect A. thaliana and C. foetidum. With this approach, we have identified the nuclear inclusion a protein (VPg+Pro) as the major pathogenicity determinant that conditions resistance in the presence of additional secondary determinants, different for each host. Genome-linked viral protein (VPg) mutations similar to those involved in the breakdown of eIF4E-mediated resistance to other potyviruses allow some PPV chimeras to infect A. thaliana. These results point to defective interactions between a translation initiation factor and the viral VPg as the most probable cause of host-specific incompatibility, in which other viral factors also participate, and suggest that complex interactions between multiple viral proteins and translation initiation factors not only define resistance to potyviruses in particular varieties of susceptible hosts but also contribute to establish nonhost resistance.

Molecular characterization of chicken infectious anemia virus from contaminated live-virus vaccines.

PubMed

Li, Yang; Hu, Yan; Cui, Shuai; Fu, Jiayuan; Wang, Yixin; Cui, Zhizhong; Fang, Lichun; Chang, Shuang; Zhao, Peng

2017-05-01

The aim of this study was to investigate possible causes of the pervasiveness of chicken infectious anemia virus (CIAV) infection in chickens in recent years in China. A total of 14 batches of live-virus vaccines were examined using PCR to detect CIAV contamination, of which only 2 samples (a Newcastle disease vaccine and a fowl pox vaccine) tested positive for CIAV. These Newcastle and fowl pox vaccines were then inoculated into 1-day-old specific-pathogen-free chickens. Serum samples were collected from chickens infected with the PCR-positive vaccines, and these tested positive for CIAV-specific antibodies as tested using ELISA. In addition, DNA samples isolated from the serum samples also tested positive by PCR. The results indicated that the samples were contaminated with CIAV and identified 2 exogenous CIAV strains, designated CIAV-N22 and CIAV-F10, in the respective samples. The full genome sequences of these novel CIAV strains were sequenced and analyzed. Phylogenetic tree analysis indicated that the CIAV-F10 strain might represent a recombinant viral strain arising from the parental CIAV strains JQ690762 and KJ728816. Overall, the results suggested that vaccination with CIAV-contaminated vaccines contributed to the prevalence and spread of CIAV infection in chickens. Furthermore, the CIAV contaminant was likely subsequently transmitted to commercial chickens through congenital transmission. Our findings therefore highlight the need for more extensive screening of live-virus vaccines for poultry in China to reduce the threat of contamination with exogenous viruses. © 2016 Poultry Science Association Inc.

Superficial fungal infections.

PubMed

Schwartz, Robert A

Superficial fungal infections arise from a pathogen that is restricted to the stratum corneum, with little or no tissue reaction. In this Seminar, three types of infection will be covered: tinea versicolor, piedra, and tinea nigra. Tinea versicolor is common worldwide and is caused by Malassezia spp, which are human saprophytes that sometimes switch from yeast to pathogenic mycelial form. Malassezia furfur, Malassezia globosa, and Malassezia sympodialis are most closely linked to tinea versicolor. White and black piedra are both common in tropical regions of the world; white piedra is also endemic in temperate climates. Black piedra is caused by Piedraia hortae; white piedra is due to pathogenic species of the Trichosporon genus. Tinea nigra is also common in tropical areas and has been confused with melanoma.

World Epidemiology Review, Number 91

DTIC Science & Technology

1978-02-09

50 LIBYA 53 MALAYSIA 54 MEXICO 54 MOZAMBIQUE 55 NEW ZEALAND 57 NIGERIA. 58 a - [III - INT - 134] CONTENTS (Continued) Page...Editorial: "Mass Immunization"] [Text] Afghanistan was declared a small- pox free country at the begin- ning of this year after the assessment and...Afghanistan and inter- national organisations. For eradication of small- pox mass immunisation was a major weapon and the program was implemented in most

Problem Oriented Differential Diagnosis of Tropical Diseases

DTIC Science & Technology

1989-09-01

glomerulonephritis. 13. Varicella ( chicken pox ): rare complication. II. Nephrotic syndrome A distinctive lesion associated with nephrotic syndrome in West...hypersensitivity reactions, Stevens-Johnson syndrome, toxic nephrosis, and hypoglycemia. Studies in Mexico have shown that bismuth subsalicylate tablets are...typhus fever 7 14 Murine typhus 14 26 Q fever 10 21 Rickettsial pox 3 14 Rocky mountain spotted fever 6 21 Scrub typhus 2 10 Tick-borne rickettsioses

Multi-state analysis of the impacts of avian pox on a population of Serins (Serinus serinus): The importance of estimating recapture rates

USGS Publications Warehouse

Senar, J.C.; Conroy, M.J.

2004-01-01

Disease is one of the evolutionary forces shaping populations. Recent studies have shown that epidemics like avian pox, malaria, or mycoplasmosis have affected passerine population dynamics, being responsible for the decline of some populations or disproportionately killing males and larger individuals and thus selecting for specific morphotypes. However, few studies have estimated the effects of an epidemic by following individual birds using the capture-recapture approach. Because avian pox can be diagnosed by direct examination of the birds, we are here able to analyze, using multistate models, the development and consequences of an avian pox epidemic affecting in 1996, a population of Serins (Serinus serinus) in northeastern Spain. The epidemics lasted from June to the end of November of 1996, with a maximum apparent prevalence rate > 30% in October. However, recapture rate of sick birds was very high (0.81, range 0.37-0.93) compared to that of healthy birds (0.21, range 0.020-32), which highly inflated apparent prevalence rate. This was additionally supported by the low predicted transition from the state of being uninfected to the state of being infected (0.03, SE 0.03). Once infected, Serin avian pox was very virulent with (15-day) survival rate of infected birds being of only 0.46 (SE 0.17) compared to that of healthy ones (0.87, SE 0.03). Probability of recovery from disease, provided that the bird survived the first two weeks, however, was very high (0.65, SE 0.25). The use of these estimates together with a simple model, allowed us to predict an asymptotic increase to prevalence of about 4% by the end of the outbreak period, followed by a sharp decline, with the only remaining infestations being infected birds that had not yet recovered. This is in contrast to the apparent prevalence of pox and stresses the need to estimate recapture rates when estimating population dynamics parameters. ?? 2004 Museu de Cie??ncies Naturals.

An update on mechanism of entry of white spot syndrome virus into shrimps.

PubMed

Verma, Arunima Kumar; Gupta, Shipra; Singh, Shivesh Pratap; Nagpure, Naresh Sahebrao

2017-08-01

Host-parasite relationships can be best understood at the level of protein-protein interaction between host and pathogen. Such interactions are instrumental in understanding the important stages of life cycle of pathogen such as adsorption of the pathogen on host surface followed by effective entry of pathogen into the host body, movement of the pathogen across the host cytoplasm to reach the host nucleus and replication of the pathogen within the host. White Spot Disease (WSD) is a havoc for shrimps and till date no effective treatment is available against the disease. Moreover information regarding the mechanism of entry of White Spot Syndrome Virus (WSSV) into shrimps, as well as knowledge about the protein interactions occurring between WSSV and shrimp during viral entry are still at very meagre stage. A cumulative and critically assessed information on various viral-shrimp interactions occurring during viral entry can help to understand the exact pathway of entry of WSSV into the shrimp which in turn can be used to device drugs that can stop the entry of virus into the host. In this context, we highlight various WSSV and shrimp proteins that play role in the entry mechanism along with the description of the interaction between host and pathogen proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chicken pox associated thrombocytopenia in adults.

PubMed

Ali, Nadir; Anwar, Masood; Majeed, Irfan; Tariq, Waheed Uz Zaman

2006-04-01

To determine the frequency and magnitude of thrombocytopenia associated with chicken pox in adults. Observational descriptive study. Combined Military Hospital, Attock, from July 2003 to June 2004. All patients of age 15 years and above with history of fever, followed by appearance of the typical vesicular chicken pox rash, were inducted after informed consent. Two milliliters of whole blood was collected on day 1 of admission, and blood counts were performed. Patients were admitted and given 800 mg oral acyclovir, 5 times/day, for 7 days, in addition to symptomatic treatment. Patients were followed till 8 weeks. A total of 410 patients of chicken pox were received, out of which 270 were included. Age of patients ranged between 15 and 40 years with median age of 21 years. Platelet count on the day of admission ranged between 29 x 10(9)/L to 513 x 10(9)/L, mean platelet count 178 x 10(9)/L. Platelet count < 150 x 10(9)/L was detected in 80/270 (30%) patients. Platelet count in thrombocytopenia patients was from 29 x 10(9)/L to 149 x 10(9)/L with mean 121 x 10(9)/L. Thrombocytopenia recovered within 02 weeks in 78/80 (97%) patients. In 2 patients, thrombocytopenia recovered in 3 weeks. None of the patients developed purpuric spots, ecchymosis or bleeding manifestations. Thrombocytopenia in chicken pox is a common entity. Platelet count remains above 25 x 10(9) /L, which is usually not associated with bleeding manifestations. None of the patients in this series developed purpura. No specific pattern of total leukocyte counts was predictive of the progression or regression in platelet count.

POx/Al2O3 stacks: Highly effective surface passivation of crystalline silicon with a large positive fixed charge

NASA Astrophysics Data System (ADS)

Black, Lachlan E.; Kessels, W. M. M. Erwin

2018-05-01

Thin-film stacks of phosphorus oxide (POx) and aluminium oxide (Al2O3) are shown to provide highly effective passivation of crystalline silicon (c-Si) surfaces. Surface recombination velocities as low as 1.7 cm s-1 and saturation current densities J0s as low as 3.3 fA cm-2 are obtained on n-type (100) c-Si surfaces passivated by 6 nm/14 nm thick POx/Al2O3 stacks deposited in an atomic layer deposition system and annealed at 450 °C. This excellent passivation can be attributed in part to an unusually large positive fixed charge density of up to 4.7 × 1012 cm-2, which makes such stacks especially suitable for passivation of n-type Si surfaces.

Inhibiting effects of some oxadiazole derivatives on the corrosion of mild steel in perchloric acid solution

NASA Astrophysics Data System (ADS)

Lebrini, Mounim; Bentiss, Fouad; Vezin, Hervé; Lagrenée, Michel

2005-11-01

The efficiency of 3,5-bis( n-pyridyl)-1,3,4-oxadiazole ( n-POX, n = 1, 2, 3), as corrosion inhibitors for mild steel in 1 M perchloric acid (HClO 4) have been determined by weight loss measurements and electrochemical studies. The results show that these inhibitors revealed a good corrosion inhibition even at very low concentrations. Comparison of results among those obtained by the studied oxadiazoles shows that 3-POX was the best inhibitor. Polarisation curves indicate that n-pyridyl substituted-1,3,4-oxadiazoles are mixed type inhibitors in 1 M HClO 4. The adsorption of these inhibitors follows a Langmuir isotherm model. The electronic properties of n-POX, obtained using the AM1 semi-empirical quantum chemical approach, were correlated with their experimental efficiencies using the linear resistance model (LR).

Fast start-up reactor for partial oxidation of methane with electrically-heated metallic monolith catalyst

NASA Astrophysics Data System (ADS)

Jung, Heon; Yoon, Wang Lai; Lee, Hotae; Park, Jong Soo; Shin, Jang Sik; La, Howon; Lee, Jong Dae

A palladium-washcoated metallic monolith catalyst is applied to the partial oxidation of methane to syngas. This catalyst is highly active at a gas hourly space velocity (GHSV) of 100,000 h -1. The compact partial oxidation (POX) reactor equipped with both 96 cc of the metallic monolith catalyst and an electrically-heated catalyst (EHC) has a start-up time of less than 1.5 min and a syngas generation capacity of 9.5 Nm 3 h -1. The POX reaction is sustained without the need for an external heater. With the stand-alone POX reactor, the methane conversion can be increased either by preheating the reactant mixture heat-exchanged with the product gas, or by supplying a larger amount of oxygen than is necessary for the reaction stoichiometry.

White Adipose Tissue Is a Reservoir for Memory T Cells and Promotes Protective Memory Responses to Infection.

PubMed

Han, Seong-Ji; Glatman Zaretsky, Arielle; Andrade-Oliveira, Vinicius; Collins, Nicholas; Dzutsev, Amiran; Shaik, Jahangheer; Morais da Fonseca, Denise; Harrison, Oliver J; Tamoutounour, Samira; Byrd, Allyson L; Smelkinson, Margery; Bouladoux, Nicolas; Bliska, James B; Brenchley, Jason M; Brodsky, Igor E; Belkaid, Yasmine

2017-12-19

White adipose tissue bridges body organs and plays a fundamental role in host metabolism. To what extent adipose tissue also contributes to immune surveillance and long-term protective defense remains largely unknown. Here, we have shown that at steady state, white adipose tissue contained abundant memory lymphocyte populations. After infection, white adipose tissue accumulated large numbers of pathogen-specific memory T cells, including tissue-resident cells. Memory T cells in white adipose tissue expressed a distinct metabolic profile, and white adipose tissue from previously infected mice was sufficient to protect uninfected mice from lethal pathogen challenge. Induction of recall responses within white adipose tissue was associated with the collapse of lipid metabolism in favor of antimicrobial responses. Our results suggest that white adipose tissue represents a memory T cell reservoir that provides potent and rapid effector memory responses, positioning this compartment as a potential major contributor to immunological memory. Published by Elsevier Inc.

Threats, status & management options for bristlecone pines and limber pines in Southern Rockies

Treesearch

A. W. Schoettle; K. S. Burns; F. Freeman; R. A. Sniezko

2006-01-01

High-elevation white pines define the most remote alpine-forest ecotones in western North America yet they are not beyond the reach of a lethal non-native pathogen. The pathogen (Cronartium ribicola), a native to Asia, causes the disease white pine blister rust (WPBR) and was introduced into western Canada in 1910. Whitebark (Pinus albicaulis) and...

Compound Warfare: That Fatal Knot

DTIC Science & Technology

2002-08-01

this contact—the contact, incidentally, was a two-way street, with small pox , chicken pox , typhoid, measles, mumps, and other viral diseases killing...and Indian societies in Mexico and the Southwest quickly adopted the hardy and versatile animals into their local culture. By the end of the... Mexico and being admitted as the twenty-eighth state of the Union in 1845. Some of the great Indian heroes—Geronimo (born 1829) and Cochise (born ca

Field Manual of Wildlife Diseases. General Field Procedures and Diseases of Birds

DTIC Science & Technology

1999-01-01

The internal form of disease is referred to as wet pox and it is primarily a problem of young chickens and turkeys. This diphtheritic form...of Cranes 153 Chapter 18 Miscellaneous Herpesviruses of Birds 157 Chapter 19 Avian Pox 163 Chapter 20 Eastern Equine Encephalomyelitis 171...Raccoon Rats, mice, voles Muskrats, nutria Chipmunks Sea lions, fur seals Cottontail rabbits Chickens , turkeys Ducks, geese Pigeons Figure 7.4

JPRS Report, Epidemiology.

DTIC Science & Technology

1989-07-19

diagnoses as "endemic complacentitis." Chicken pox has persisted well past its seasonal limits. Since it is a non-notifiable disease, exact...Diseases comparative figures for the first four months of 1988 and 1989 show a worri- some graph. The hospital admitted 1,935 chicken pox patients last...PAULO, 20 Jun 89] 13 Leprosy Incidence Fourth Highest in World [Rio de Janiero O GLOBO, 3 May 89] 14 MEXICO African Bees Kill Farm Animals in

Seroprevalence of Capripoxvirus infection in sheep and goats among different agro-climatic zones of Odisha, India

PubMed Central

Hota, Abhishek; Biswal, Sangram; Sahoo, Niranjana; Venkatesan, Gnanavel; Arya, Sargam; Kumar, Amit; Ramakrishnan, Muthannan Andavar; Pandey, Awadh Bihari; Rout, Manoranjan

2018-01-01

Aim: The study was undertaken to assess the prevalence of antibodies to Capripoxviruses among small ruminants of Odisha, India. Materials and Methods: A total of 500 random serum samples collected from 214 sheep and 286 goats across 10 agro-climatic zones of Odisha, were screened using whole virus antigen-based indirect ELISA for antibodies against Capripoxviruses. Results were analyzed by suitable statistical methods. Results: Screening of 500 serum samples showed seropositivity of 8.88% and 31.47% in sheep and goats, respectively, for Capripoxviruses. The prevalence rate according to agro-climatic zone ranged from 0% (North Eastern coastal plain zone) to 48.57% (North central plateau zone) for goat pox, and 0% (Western undulating zone and North central plateau) to 22.22% (South Eastern ghat zone) for sheep pox. The difference in prevalence rates among the various agro-climatic zones was statistically significant (p<0.05) for goats, but not for sheep. Antibody prevalence rates among various districts were recorded to be the highest in Jagatsinghpur (30%) for sheep pox and Dhenkanal (80%) for goat pox. Conclusions: The study revealed serological evidence of Capripoxvirus infection in sheep and goat populations in the study area, in the absence of vaccination. Systematic investigation, monitoring, and reporting of outbreaks are necessary to devise control strategies. PMID:29479159

POX 4 and Tol 35: Two Peculiar Wolf-Rayet Dwarf Galaxies

NASA Astrophysics Data System (ADS)

Méndez, David I.; Esteban, César

1999-12-01

We present results of narrowband (Hα and adjacent continuum) and broadband (U, B, and V) optical CCD imaging together with high-resolution Hα spectroscopy of the blue compact Wolf-Rayet dwarf galaxies POX 4 and Tol 35. POX 4 has a fainter, irregular, and diffuse companion located 20.5" (4.7 kpc) along the minor axis of the galaxy, which is visible also in the Hα emission. The difference in recession velocity between the galaxy and the companion is about 130 km s-1. The observational results lead us to propose that POX 4 could be interpreted as a low-mass ring galaxy, produced by a head-on intrusion of the fainter companion. Regarding the other object, a spectrum taken along the major axis of Tol 35 shows the coexistence of systems of motion with a velocity difference of about 50 km s-1. Moreover, the deep continuum-subtracted Hα image of the galaxy shows very faint features that resemble the beginning of crossed tidal tails or gaseous filaments powered by the mechanical action of the young stellar population. In this sense, Tol 35 could be interpreted either as an object in an intermediate-stage merging process between two gas-rich dwarf galaxies or as an object suffering the effect of a galactic wind.

Epidemiology of the Emergent Disease Paridae pox in an Intensively Studied Wild Bird Population

PubMed Central

Lachish, Shelly; Lawson, Becki; Cunningham, Andrew A.; Sheldon, Ben C.

2012-01-01

Paridae pox, a novel avipoxvirus infection, has recently been identified as an emerging infectious disease affecting wild tit species in Great Britain. The incursion of Paridae pox to a long-term study site where populations of wild tits have been monitored in detail for several decades provided a unique opportunity to obtain information on the local-scale epidemiological characteristics of this novel infection during a disease outbreak. Using captures of >8000 individual birds, we show that, within two years of initial emergence, Paridae pox had become established within the population of great tits (Parus major) reaching relatively high peak prevalence (10%), but was far less prevalent (<1%) in sympatric populations of several other closely related, abundant Paridae species. Nonlinear smoothing models revealed that the temporal pattern of prevalence among great tits was characterised by within-year fluctuations indicative of seasonal forcing of infection rates, which was likely driven by multiple environmental and demographic factors. There was individual heterogeneity in the course of infection and, although recovery was possible, diseased individuals were far less likely to be recaptured than healthy individuals, suggesting a survival cost of infection. This study demonstrates the value of long-term monitoring for obtaining key epidemiological data necessary to understand disease dynamics, spread and persistence in natural populations. PMID:23185230

Black South African children's understanding of health and illness: colds, chicken pox, broken arms and AIDS.

PubMed

Peltzer, K; Promtussananon, S

2003-09-01

To examine the understanding of both health and illness (colds, broken arms, chicken pox, AIDS) in the same black South African children The sample included 60 children (30 were 5-year-olds and 30 were 9-year-olds) selected by simple random sampling from a rural primary school. They were interviewed, using a semi-structured interview schedule, about their understanding of health issues and their exposure to learning about health or sickness. Differences across age in children's expressed understanding of health and illnesses were found. The 9-year-olds were more likely to give objective signs of chicken pox and AIDS than the 5-year-olds. They also knew more about objective symptoms of colds, chicken pox and AIDS, and were more likely to mention non-observable signs of colds and broken arms. Although there were no differences between the two age groups regarding 'knowing' strategies for avoiding illnesses, the older children had a more accurate knowledge about preventive measures than the younger children. The understanding of AIDS followed the same developmental sequence reported for children's understanding of general physical illness. The results have implications for the creation of developmentally appropriate and effective health and AIDS education curricula for primary and elementary grades.

[Association of phytoplasma with Bermuda grass white-leaf disease].

PubMed

Tan, Weijun; Chen, Yong; Zhang, Wu; Han, Chengchou; Tan, Zhiyuan; Zhang, Juming

2008-10-01

Bermuda grass white leaf is an important disease on Bermuda grass all over the world. The aim of this research is to identify the pathogen which leads to Bermuda grass white leaf occurring on the Chinese mainland. PCR amplification technique, sequence analysis and Southern hybridization were used. A 1.3 kb fragment was amplified by PCR phytoplasma universal primers and total DNA sample extracted from ill Bermuda grass as the amplified template. Sequence analysis of the amplified fragment indicated it clustered into Candidatus Phytoplasm Cynodontis. Southern hybridization analysis showed differential cingulums. The pathogen of Bermuda grass white leaf on the Chinese mainland contains phytoplasma, which provides a scientific basis for further identification, prevention and control of the disease.

White Band Disease (type I) of endangered caribbean acroporid corals is caused by pathogenic bacteria.

PubMed

Kline, David I; Vollmer, Steven V

2011-01-01

Diseases affecting coral reefs have increased exponentially over the last three decades and contributed to their decline, particularly in the Caribbean. In most cases, the responsible pathogens have not been isolated, often due to the difficulty in isolating and culturing marine bacteria. White Band Disease (WBD) has caused unprecedented declines in the Caribbean acroporid corals, resulting in their listings as threatened on the US Threatened and Endangered Species List and critically endangered on the IUCN Red List. Yet, despite the importance of WBD, the probable pathogen(s) have not yet been determined. Here we present in situ transmission data from a series of filtrate and antibiotic treatments of disease tissue that indicate that WBD is contagious and caused by bacterial pathogen(s). Additionally our data suggest that Ampicillin could be considered as a treatment for WBD (type I).

A Study of Waste Management within the COL Florence A. Blanchfield Army Community Hospital, Fort Campbell, Kentucky.

DTIC Science & Technology

1981-08-01

besnoiti Borna disease virus Bovine infectious petechial fever virus Camel pox virus Ephemeral fever virus Fowl plague virus Goat pox virus Hog...Varicella virus Vole rickettsia Yellow fever virus, 17D vaccine strain 69 Class 3 Alastrun, smallpox, monkeypox, and whitepox, when used in vitro Arbovirus...animal inoculation experiments Vesicular stomatitis virus Yellow fever virus - wild when used in vitro Class 4 Alastrun, smallpox, monkeypox, and

Hairpin plum pox virus coat protein (hpPPV-CP) structure in 'HoneySweet' C5 plum provides PPV resistance when genetically engineered into plum (Prunus domestica) seedlings

USDA-ARS?s Scientific Manuscript database

The genetically engineered plum 'HoneySweet' (aka C5) has proven to be highly resistant to Plum pox virus (PPV) for over 10 years in field trials. The original vector used for transformation to develop 'HoneySweet' carried a single sense sequence of the full length PPV coat protein (ppv-cp) gene, y...

[Destructive mastoiditis with thrombosis of the sigmoid sinus in a 8 year-old child presenting with concomitant chicken pox].

PubMed

Bogomil'skiĭ, M R; Polunin, M M; Ivanenko, A M; Poliakov, A A

2014-01-01

The specific clinical feature of mastoidities that developed in a patient presenting with chicken pox was the rapid progress in temporal bone destruction with partial thrombosis of the sigmoid sinusis in the absence of typical manifestations of mastoiditis. The pronounced destructive changes found in a series of CT images were regarded as the indications for urgent antromastoidotomy with the puncture of the sigmoid sinusis.

Extraction of Molybdenum from Molybdenite Concentrates with Hydrometallurgical Processing

NASA Astrophysics Data System (ADS)

Jiang, Kaixi; Wang, Yufang; Zou, Xiaoping; Zhang, Lei; Liu, Sanping

2012-11-01

Molybdenite concentrates are usually treated by roasting, but low-concentration SO2 pollution is an associated problem. A hydrometallurgical process with pressure oxidation leaching (POX) and solvent extraction (SX) was developed in recent years. During POX, the oxidation of molybdenum (Mo) is above 98%. More than 95% of the rhenium (Re) and 15% to 20% of the Mo are leached into solution. The sulfur in the concentrate is converted to H2SO4, which results in high acidity of the solution. SX was used to recover the Re and Mo from the solution. The extraction of Re and Mo were above 98%. The loaded organic reagent is stripped with ammonia. More than 98% of the Mo can be stripped from the organic phase. Compared with the roasting process, the total recovery of Mo increased from 93% to 97% and that of Re from 60% to 90% when POX and SX are utilized.

[Psoas abscess as a chicken pox complication].

PubMed

Larcamon, Jorge E; Juanco, Gabriela; Alvarez, Lionel A; Pebe, Florián V

2010-06-01

Chicken pox is the most frequent exantematic illness; usually its course is self-limited and benign. Several bacterial complications are described due to the disruption of the skin as a defensive barrier because of the characteristics of the injuries and the associated inmunodepression. Psoas abscess is a rare illness and it's difficult to diagnose, with a general unspecified clinical presentation. We present the case of a 5-year-old girl, on her fifth day of chicken pox, who consults about a febrile convulsion, from which she recovers without any neurological symptoms, referring to functional impotence of her inferior left limb and pain in the lumbar and gluteal zone, which irradiates to the homolateral hip, making deambulation impossible. The definitive diagnosis was made with a CAT at hospital admission. The germ isolated was community-acquired methricillin-resistant Staphilococcus aureus. Treatment consisted in surgical drainage and endovenous antibiotics.

Comparative sequence analysis of B5R gene of zoonotic buffalo pox virus isolates with other orthopoxviruses.

PubMed

Chandranaik, B M; Singh, Raj Kumar; Hosamani, Mahusudan; Krishnappa, Giriappa; Harish, Balur R; Chethana, C S; Renukaprasad, C

2011-02-01

The present paper describes the isolation of buffalo pox virus from scab lesions and its molecular characterization through B5R gene sequencing. During our study, pustular pox lesions were observed on the teats and mammary parenchyma of cattle and buffaloes, and the disease was of significant zoonotic importance since similar lesions were produced on the hands, legs, and face of people in close contact with the affected animals. The collected scab materials were subjected for virus isolation in 9-11-day-old chicken embryos by the chorioallontoic membrane route and in the Vero cell line. The virus was confirmed by a sensitive and rapid diagnostic polymerase chain reaction using the primers that amplify "A type inclusion" gene, and further, B5R gene of the virus was sequenced and compared with the corresponding sequences of other orthopoxviruses. The results showed high sequence homology of our isolates with other orthopoxviruses.

A virulent babesia bovis strain failed to infect white-tailed deer (Odocoileus virginianus)

USDA-ARS?s Scientific Manuscript database

Wildlife are an important component in the vector-host-pathogen triangle of livestock diseases, as they maintain biological vectors that transmit pathogens and can serve as reservoirs for such infectious pathogens. Babesia bovis is a tick-borne pathogen, vectored by cattle fever ticks, Rhipicephalus...

White pine blister rust resistance of 12 western white pine families at three field sites in the Pacific Northwest

Treesearch

Richard A. Sniezko; Robert Danchok; Jim Hamlin; Angelia Kegley; Sally Long; James Mayo

2012-01-01

Western white pine (Pinus monticola Douglas ex D. Don) is highly susceptible to the non-native, invasive pathogen Cronartium ribicola, the causative agent of white pine blister rust. The susceptibility of western white pine to blister rust has limited its use in restoration and reforestation throughout much of western North...

UH-USA Agreement - A Telemedicine Research Proposal

DTIC Science & Technology

2004-11-01

hold and they were going to quarantine the entire airport. From his description, I explained that it probably was not smallpox but rather chicken pox ...but I still had to come over to examine the patient. I left my busy office, drove post haste to the airport, and confirmed that it was indeed chicken ... pox . No need for quarantine, and the planes resumed their schedules, although a bit late. I thought it would be so nice if the airport medical

Environmental Assessment for Kirtland Air Force Base Prairie Dog Management Program

DTIC Science & Technology

2003-11-01

such as chicken and small pox and is characterized by rashes, temperature at or above 99.3 degrees, chills and/or sweats, headache, backache...FINDING OF NO SIGNIFICANT IMPACT PRAIRIE DOG MANAGEMENT PROGRAM AT KIRTLAND AIR FORCE BASE, NEW MEXICO The 377th Air Base Wing of Air Force Materiel...of African rodents, prairie dogs, and certain other animals. We are taking this action to prevent the spread of monkey pox , a communicable disease, in

[Gigantic keloïds after chicken-pox. A case report].

PubMed

Gathse, A; Ibara, J R; Obengui; Moyen, G

2003-01-01

Keloïds are tumors which appear after a lesion or spontaneously. They are frequent on black skin. We report a gigantic keloïd case appeared after chicken-pox on a 29 year-old black girl who had viral infection when she was 6 years old. The tumors increased after chirurgical treatment and became very unaesthetic. This observation specific by its clinical presentation relates the treatment difficulties of these tumors in our area.

Epidemic pox and malaria in native forest birds

USGS Publications Warehouse

Atkinson, C. T.; Dusek, R. J.; Iko, W. M.

1993-01-01

Studies by Warner in the 1950’s and van Riper in the 1970’s identified disease as a potential limiting factor in the distribution and abundance of Hawaii’s native forest birds. Mosquito-transmitted protozoan and viral infections caused by malarial parasites and pox virus were especially significant. Both organisms were introduced to the islands after the arrival of Europeans and are thought to have affected avian communities the same way that measles devastated native Hawaiian peoples.

Digital epidemiology reveals global childhood disease seasonality and the effects of immunization

PubMed Central

2016-01-01

Public health surveillance systems are important for tracking disease dynamics. In recent years, social and real-time digital data sources have provided new means of studying disease transmission. Such affordable and accessible data have the potential to offer new insights into disease epidemiology at national and international scales. We used the extensive information repository Google Trends to examine the digital epidemiology of a common childhood disease, chicken pox, caused by varicella zoster virus (VZV), over an 11-y period. We (i) report robust seasonal information-seeking behavior for chicken pox using Google data from 36 countries, (ii) validate Google data using clinical chicken pox cases, (iii) demonstrate that Google data can be used to identify recurrent seasonal outbreaks and forecast their magnitude and seasonal timing, and (iv) reveal that VZV immunization significantly dampened seasonal cycles in information-seeking behavior. Our findings provide strong evidence that VZV transmission is seasonal and that seasonal peaks show remarkable latitudinal variation. We attribute the dampened seasonal cycles in chicken pox information-seeking behavior to VZV vaccine-induced reduction of seasonal transmission. These data and the methodological approaches provide a way to track the global burden of childhood disease and illustrate population-level effects of immunization. The global latitudinal patterns in outbreak seasonality could direct future studies of environmental and physiological drivers of disease transmission. PMID:27247405

POX 186: A Dwarf Galaxy Under Construction?

NASA Astrophysics Data System (ADS)

Corbin, M. R.; Vacca, W. D.

2000-12-01

We have obtained deep images of the ultracompact ( ~ 3'') blue compact dwarf galaxy POX 186 in the F336W, F555W, and F814W filters of the Planetary Camera of the Hubble Space Telescope. We have additionally obtained a low-resolution near ultraviolet spectrum of the object with STIS and combine this with a ground-based spectrum covering the visible continuum and emission lines. Our images confirm this object to be highly compact, with a maximum projected size of only ~ 240 pc, making it one of the smallest galaxies known. We also confirm that the outer regions of the galaxy consist of an evolved stellar population, ruling out earlier speculations that POX 186 is a protogalaxy. However, the PC images reveal the galaxy to have a highly irregular morphology, with a pronounced tidal arm on its western side. This morphology is strongly suggestive of a recent collision between two smaller components which has in turn triggered the central starburst. The F336W image also shows that the material in this tidal stream is actively star forming. Given the very small ( ~ 100 pc) sizes of the colliding components, POX 186 may be a dwarf galaxy in the early stages of formation, which would be consistent with current ``downsizing'' models of galaxy formation in which the least massive objects are the last to form. This work is supported by NASA and the Space Telescope Science Institute.

Partial oxidation for improved cold starts in alcohol-fueled engines: Phase 2 topical report

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1998-04-01

Alcohol fuels exhibit poor cold-start performance because of their low volatility. Neat alcohol engines become difficult, if not impossible, to start at temperatures close to or below freezing. Improvements in the cold-start performance (both time to start and emissions) are essential to capture the full benefits of alcohols as an alternative transportation fuel. The objective of this project was to develop a neat alcohol partial oxidation (POX) reforming technology to improve an alcohol engine`s ability to start at low temperatures (as low as {minus}30 C) and to reduce its cold-start emissions. The project emphasis was on fuel-grade ethanol (E95) butmore » the technology can be easily extended to other alcohol fuels. Ultimately a compact, on-vehicle, ethanol POX reactor was developed as a fuel system component to produce a hydrogen-rich, fuel-gas mixture for cold starts. The POX reactor is an easily controllable combustion device that allows flexibility during engine startup even in the most extreme conditions. It is a small device that is mounted directly onto the engine intake manifold. The gaseous fuel products (or reformate) from the POX reactor exit the chamber and enter the intake manifold, either replacing or supplementing the standard ethanol fuel consumed during an engine start. The combustion of the reformate during startup can reduce engine start time and tail-pipe emissions.« less

Digital epidemiology reveals global childhood disease seasonality and the effects of immunization.

PubMed

Bakker, Kevin M; Martinez-Bakker, Micaela Elvira; Helm, Barbara; Stevenson, Tyler J

2016-06-14

Public health surveillance systems are important for tracking disease dynamics. In recent years, social and real-time digital data sources have provided new means of studying disease transmission. Such affordable and accessible data have the potential to offer new insights into disease epidemiology at national and international scales. We used the extensive information repository Google Trends to examine the digital epidemiology of a common childhood disease, chicken pox, caused by varicella zoster virus (VZV), over an 11-y period. We (i) report robust seasonal information-seeking behavior for chicken pox using Google data from 36 countries, (ii) validate Google data using clinical chicken pox cases, (iii) demonstrate that Google data can be used to identify recurrent seasonal outbreaks and forecast their magnitude and seasonal timing, and (iv) reveal that VZV immunization significantly dampened seasonal cycles in information-seeking behavior. Our findings provide strong evidence that VZV transmission is seasonal and that seasonal peaks show remarkable latitudinal variation. We attribute the dampened seasonal cycles in chicken pox information-seeking behavior to VZV vaccine-induced reduction of seasonal transmission. These data and the methodological approaches provide a way to track the global burden of childhood disease and illustrate population-level effects of immunization. The global latitudinal patterns in outbreak seasonality could direct future studies of environmental and physiological drivers of disease transmission.

Development of mixed-type autoimmune hemolytic anemia and Evans' syndrome following chicken pox infection in a case of low-titer cold agglutinin disease.

PubMed

Tanaka, Yumi; Masuya, Masahiro; Katayama, Naoyuki; Miyata, Eri; Sugimoto, Yuka; Shibasaki, Tetsunori; Yamamura, Kentaro; Ohishi, Kohshi; Minami, Nobuyuki; Shiku, Hiroshi; Nobori, Tsutomu

2006-10-01

We describe a patient with low-titer cold agglutinin disease (CAD) who developed mixed-type autoimmune hemolytic anemia (AIHA) and idiopathic thrombocytopenia following chicken pox infection. At least 1 year before admission to hospital, the patient had mild hemolytic anemia associated with low-titer cold agglutinins. A severe hemolytic crisis and thrombocytopenia (Evans' syndrome) occurred several days after infection with chicken pox, and the patient was referred to our hospital. Serological findings revealed the presence of both cold agglutinins and warm-reactive autoantibodies against erythrocytes, and the diagnosis was mixed-type AIHA. Following steroid therapy, the hemoglobin (Hb) level and platelet count improved. The patient was closely followed over a 10-year period with recurrent documented hemolysis after viral or bacterial infections. Warm-reactive autoantibodies have not been detected in the last 2 years, and only the immunoglobulin M anti-I cold agglutinins with a low titer and wide thermal amplitude have remained unchanged. Therefore, the patient has received at least 10 mg prednisolone daily to maintain a Hb level of 10 g/dL. To the best of our knowledge, no adult case of low-titer CAD that has evolved into mixed-type AIHA and Evans' syndrome after chicken pox infection has been previously reported in the literature.

Experimental infection of Hawai'i 'Amakihi (hemignathus virens) with West Nile virus and competence of a co-occurring vector, culex quinquefasciatus: potential impacts on endemic Hawaiian avifauna.

PubMed

Lapointe, Dennis A; Hofmeister, Erik K; Atkinson, Carter T; Porter, Robert E; Dusek, Robert J

2009-04-01

Introduced mosquito-borne avian disease is a major limiting factor in the recovery and restoration of native Hawaiian forest birds. Annual epizootics of avian pox (Avipoxvirus) and avian malaria (Plasmodium relictum) likely led to the extinction of some species and continue to impact populations of susceptible Hawaiian honeycreepers (Drepanidinae). The introduction of a novel pathogen, such as West Nile virus (WNV), could result in further population declines and extinctions. During September and October 2004, we infected Hawai'i' Amakihi (Hemignathus virens) with a North American isolate of WNV by needle inoculation and mosquito bite to observe susceptibility, mortality, and illness in this endemic passerine, and to determine the vector competence of the co-occurring, introduced mosquito Culex quinquefasciatus. All experimentally infected Hawai'i ;Amakihi became viremic, with a mean titer >10(5) plaque-forming units (PFU)/ml, and they experienced clinical signs ranging from anorexia and lethargy to ataxia. The fatality rate among needle-inoculated Hawai'i' Amakihi (n=16) was 31.3%, but mortality in free-ranging birds is likely to increase due to predation, starvation, thermal stress, and concomitant infections of avian malaria and pox. Surviving Hawai'i' Amakihi seem to clear WNV from the peripheral blood by 7-10 days postinfection (DPI), and neutralizing antibodies were detected from 9 to 46 DPI. In transmission trials, Hawaiian Cx. quinquefasciatus proved to be a competent vector and Hawai'i Amakihi an adequate amplification host of WNV, suggesting that epizootic WNV could readily become an additional limiting factor of some native Hawaiian bird populations.

Experimental infection of Hawai'i 'Amakihi (hemignathus virens) with West Nile virus and competence of a co-occurring vector, culex quinquefasciatus: potential impacts on endemic Hawaiian avifauna.

USGS Publications Warehouse

Lapointe, Dennis; Hofmeister, Erik K.; Atkinson, C.T.; Porter, R.E.; Dusek, Robert J.

2009-01-01

Introduced mosquito-borne avian disease is a major limiting factor in the recovery and restoration of native Hawaiian forest birds. Annual epizootics of avian pox (Avipoxvirus) and avian malaria (Plasmodium relictum) likely led to the extinction of some species and continue to impact populations of susceptible Hawaiian honeycreepers (Drepanidinae). The introduction of a novel pathogen, such as West Nile virus (WNV), could result in further population declines and extinctions. During September and October 2004, we infected Hawai'i' Amakihi (Hemignathus virens) with a North American isolate of WNV by needle inoculation and mosquito bite to observe susceptibility, mortality, and illness in this endemic passerine, and to determine the vector competence of the co-occurring, introduced mosquito Culex quinquefasciatus. All experimentally infected Hawai'i ;Amakihi became viremic, with a mean titer >10(5) plaque-forming units (PFU)/ml, and they experienced clinical signs ranging from anorexia and lethargy to ataxia. The fatality rate among needle-inoculated Hawai'i' Amakihi (n=16) was 31.3%, but mortality in free-ranging birds is likely to increase due to predation, starvation, thermal stress, and concomitant infections of avian malaria and pox. Surviving Hawai'i' Amakihi seem to clear WNV from the peripheral blood by 7-10 days postinfection (DPI), and neutralizing antibodies were detected from 9 to 46 DPI. In transmission trials, Hawaiian Cx. quinquefasciatus proved to be a competent vector and Hawai'i Amakihi an adequate amplification host of WNV, suggesting that epizootic WNV could readily become an additional limiting factor of some native Hawaiian bird populations.

Recombinase polymerase amplification applied to plant virus detection and potential implications.

PubMed

Babu, Binoy; Ochoa-Corona, Francisco M; Paret, Mathews L

2018-04-01

Several isothermal techniques for the detection of plant pathogens have been developed with the advent of molecular techniques. Among them, Recombinase Polymerase Amplification (RPA) is becoming an important technique for the rapid, sensitive and cost-effective detection of plant viruses. The RPA technology has the advantage to be implemented in field-based scenarios because the method requires a minimal sample preparation, and is performed at constant low temperature (37-42 °C). The RPA technique is rapidly becoming a promising tool for use in rapid detection and further diagnostics in plant clinics and monitoring quarantine services. This paper presents a review of studies conducted using RPA for detection/diagnosis of plant viruses with either DNA genomes (Banana bunchy top virus, Bean golden yellow mosaic virus, Tomato mottle virus, Tomato yellow leaf curl virus) or RNA genomes (Little Cherry virus 2, Plum pox virus and Rose rosette virus). Copyright © 2018 Elsevier Inc. All rights reserved.

Altered virulence potential of Salmonella Enteritidis cultured in different foods: A cumulative effect of differential gene expression and immunomodulation.

PubMed

Jaiswal, Sangeeta; Sahoo, Prakash Kumar; Ryan, Daniel; Das, Jugal Kishore; Chakraborty, Eesha; Mohakud, Nirmal Kumar; Suar, Mrutyunjay

2016-08-02

Salmonella enterica serovars Enteritidis (S. Enteritidis) is one of the most common causes of food borne illness. Bacterial growth environment plays an important role in regulating gene expression thereby affecting the virulence profile of the bacteria. Different foods present diverse growth conditions which may affect the pathogenic potential of the bacteria. In the present study, the effect of food environments on the pathogenic potential of S. Enteritidis has been evaluated. S. Enteritidis was grown in different foods e.g. egg white, peanut butter and milk, and virulent phenotypes were compared to those grown in Luria Bertani broth. In-vivo experiments in C57BL/6 mice revealed S. Enteritidis grown in egg white did not induce significant (p<0.001) production of proinflammatory cytokines in mice and were unable to cause colitis despite efficient colonization in cecum, mesenteric lymph node, spleen and liver. Further studies revealed that bacteria grown in LB activated MAP Kinase and NFκB pathways efficiently, while those grown in egg white poorly activated the above pathways which can account for the decreased production of proinflammatory cytokines. qRT PCR analysis revealed SPI-1 effectors were downregulated in bacteria grown in egg white. Interestingly, bacteria grown in egg white showed reversal of phenotype upon change in growth media to LB. Additionally, bacteria grown in milk and peanut butter showed different degrees of virulence in mice as compared to those grown in LB media. Thus, the present study demonstrates that, S. Enteritidis grown in egg white colonizes systemic sites without causing colitis in a mouse model, while bacteria grown in milk and peanut butter show different pathogenicity profiles suggesting that food environments significantly affect the pathogenicity of S. Enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

Transcriptome of an Armillaria root disease pathogen reveals candidate genes involved in host substrate utilization at the host­-pathogen interface

Treesearch

A. L. Ross-Davis; J. E. Stewart; J. W. Hanna; M.-S. Kim; B. J. Knaus; R. Cronn; H. Rai; B. A. Richardson; G. I. McDonald; N. B. Klopfenstein

2013-01-01

Armillaria species display diverse ecological roles ranging from beneficial saprobe to virulent pathogen. Armillaria solidipes (formerly A. ostoyae), a causal agent of Armillaria root disease, is a virulent primary pathogen with a broad host range of woody plants across the Northern Hemisphere. This white-rot pathogen grows between trees as rhizomorphs and attacks...

International Symposium on Positive Strand RNA Viruses (2nd) Held in Vienna, Austria on June 26-30, 1989. Abstracts

DTIC Science & Technology

1989-07-01

DEAE dextran-treated chicken embryo Iosdr specific probe hybridised in -olont bluis to a fiibroblasts (CEF). VEE antigens were demonstrated in 1,1...P 13 P 14 MOLECULAR CLONING ANDOEXPRESSION OF ARNA-DEPENDENT MOLECULAR CLONING OF DEFECTIVE-LIKE RNA OF TWO RNA POLYMERASE OF PLUM POX VIRUS IN...Mokhosi PpO)TEINS. RNA STIMULATED ATyase ACffVITY OF PLUM Dept of Microbiologo, RihodvoJs sv POX POTYVIROS C1 PROTEIN. GRAHiAMSTOWN, South Af~ir . Sonia

Quality of Care Provided by Physician’s Extenders in Air Force Primary Medicine Clinics.

DTIC Science & Technology

1980-01-01

WITHOUT 214 ARRHYTHMIAS OR HEART BLOCK GASTROENTERITIS :634 HEART MURMUR [ 11 13. 15 MEASLES. MUMPS, CHICKEN POX 213. 215. 217 OTHER HEART DISEASES 01...mumps, chicken pox 8 11 7 16 Hepatitis or exposure to hepatitis 11 8 4 17 Infectious mononucleosis 1 15 2 *4 Gonorrhea (or exposure to gonorrhea) 17 28...Operation of the New Mexico Experimental Medical Care Review Organization," Medical Care 14 (Supplement 9), December 1976. Daniels, M., and S. A

Foot abnormalities of wild birds

USGS Publications Warehouse

Herman, C.M.; Locke, L.N.; Clark, G.M.

1962-01-01

The various foot abnormalities that occur in birds, including pox, scaly-leg, bumble-foot, ergotism and freezing are reviewed. In addition, our findings at the Patuxent Wildlife Research Center include pox from dove, mockingbird, cowbird, grackle and several species of sparrows. Scaly-leg has been particularly prevalent on icterids. Bumble foot has been observed in a whistling swan and in a group of captive woodcock. Ergotism is reported from a series of captive Canada geese from North Dakota. Several drug treatments recommended by others are presented.

Acute retinal necrosis complicating chicken pox in a healthy adult: a case report and review of literature.

PubMed

Tajunisah, Iqbal; Reddy, Sagili Chandrasekhara

2007-01-01

We report a case of unilateral acute retinal necrosis (ARN) with marked vitritis and retinal necrosis leading to retinal breaks following chicken pox successfully treated with intravenous acyclovir followed by oral acyclovir, orbital floor triamcinolone injections to contain the inflammation, and barrier laser therapy to secure the retinal breaks with good visual outcome. This case is unusual in its severity and the novel use orbital floor triamcinolone therapy to contain ARN inflammation.

Pea disease diagnostic series - White mold

USDA-ARS?s Scientific Manuscript database

White mold is a serious disease of pea worldwide, and it is caused by the fungus Sclerotinia sclerotiorum. Water soaked lesions and white mycelial growth may occur on leaves, stems and pods, and are characteristics of the disease. The pathogen may form black fruiting bodies called sclerotia on infec...

Sharka: The Past, The Present and The Future

PubMed Central

Sochor, Jiri; Babula, Petr; Adam, Vojtech; Krska, Boris; Kizek, Rene

2012-01-01

Members the Potyviridae family belong to a group of plant viruses that are causing devastating plant diseases with a significant impact on agronomy and economics. Plum pox virus (PPV), as a causative agent of sharka disease, is widely discussed. The understanding of the molecular biology of potyviruses including PPV and the function of individual proteins as products of genome expression are quite necessary for the proposal the new antiviral strategies. This review brings to view the members of Potyviridae family with respect to plum pox virus. The genome of potyviruses is discussed with respect to protein products of its expression and their function. Plum pox virus distribution, genome organization, transmission and biochemical changes in infected plants are introduced. In addition, techniques used in PPV detection are accentuated and discussed, especially with respect to new modern techniques of nucleic acids isolation, based on the nanotechnological approach. Finally, perspectives on the future of possibilities for nanotechnology application in PPV determination/identification are outlined. PMID:23202508

Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.

PubMed

Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon

2016-04-05

Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sharka: the past, the present and the future.

PubMed

Sochor, Jiri; Babula, Petr; Adam, Vojtech; Krska, Boris; Kizek, Rene

2012-11-07

Members the Potyviridae family belong to a group of plant viruses that are causing devastating plant diseases with a significant impact on agronomy and economics. Plum pox virus (PPV), as a causative agent of sharka disease, is widely discussed. The understanding of the molecular biology of potyviruses including PPV and the function of individual proteins as products of genome expression are quite necessary for the proposal the new antiviral strategies. This review brings to view the members of Potyviridae family with respect to plum pox virus. The genome of potyviruses is discussed with respect to protein products of its expression and their function. Plum pox virus distribution, genome organization, transmission and biochemical changes in infected plants are introduced. In addition, techniques used in PPV detection are accentuated and discussed, especially with respect to new modern techniques of nucleic acids isolation, based on the nanotechnological approach. Finally, perspectives on the future of possibilities for nanotechnology application in PPV determination/identification are outlined.

Cysteine-independent Catalase-like Activity of Vertebrate Peroxiredoxin 1 (Prx1)*

PubMed Central

Sun, Cen-Cen; Dong, Wei-Ren; Zhao, Jing; Nie, Li; Xiang, Li-Xin; Zhu, Guan; Shao, Jian-Zhong

2015-01-01

Peroxiredoxins (Prxs) are a ubiquitous family of antioxidant proteins that are known as thioredoxin peroxidases. Here we report that Prx1 proteins from Tetraodon nigroviridis and humans also possess a previously unknown catalase-like activity that is independent of Cys residues and reductants but dependent on iron. We identified that the GVL motif was essential to the catalase (CAT)-like activity of Prx1 but not to the Cys-dependent thioredoxin peroxidase (POX) activity, and we generated mutants lacking POX and/or CAT activities for individually delineating their functional features. We discovered that the TnPrx1 POX and CAT activities possessed different kinetic features in reducing H2O2. The overexpression of wild-type TnPrx1 and mutants differentially regulated the intracellular levels of reactive oxygen species and p38 phosphorylation in HEK-293T cells treated with H2O2. These observations suggest that the dual antioxidant activities of Prx1 may be crucial for organisms to mediate intracellular redox homeostasis. PMID:26088136

Theoretical study on the molecular structure and vibrational properties, NBO and HOMO-LUMO analysis of the POX3 (X = F, Cl, Br, I) series of molecules

NASA Astrophysics Data System (ADS)

Galván, Jorge E.; Gil, Diego M.; Lanús, Hernán E.; Altabef, Aida Ben

2015-02-01

The fourth member of the series of compounds of the type POX3 with X = I was synthesized and characterized by infrared spectroscopy. The geometrical parameters and vibrational properties of POX3 (X = F, Cl, Br, I) molecules were investigated theoretically by means DFT and ab initio methods. Available geometrical and vibrational data were used together with theoretical calculations in order to obtain a set of scaled force constants. The observed trends in geometrical parameters are analyzed and compared with those obtained in a previous work for the VOX3 (X = F, Cl, Br, I) series of compounds. NBO analysis was performed in order to know the hyper-conjugative interactions that favor one structure over another. The molecular properties such as ionization potential, electron affinity, electronegativity, chemical potential, chemical hardness, softness and global electrophilicity index have been deduced from HOMO-LUMO analysis.

An Intermediate-Mass Black Hole in the Dwarf Seyfert 1 Galaxy POX 52

NASA Astrophysics Data System (ADS)

Barth, A.; Ho, L.; Sargent, W.

2004-06-01

We describe new observations of POX 52, a previously known but nearly forgotten example of a dwarf galaxy with an active nucleus. While POX 52 was originally thought to be a Seyfert 2 galaxy, the new data reveal an emission-line spectrum very similar to that of the dwarf Seyfert 1 galaxy NGC 4395, with clear broad components to the permitted line profiles. The host galaxy appears to be a dwarf elliptical; this is the only known case of a Seyfert nucleus in a galaxy of this type. Applying scaling relations to estimate the black hole mass from the broad Hβ linewidth and continuum luminosity, we find MBH ≈ 1.6×105 M⊙. The stellar velocity dispersion in the host galaxy is 36 km s-1, also suggestive of a black hole mass of order 105 M⊙. Further searches for AGNs in dwarf galaxies can provide crucial constraints on the demographics of black holes in the mass range below 106 M⊙.

Recombinant Sheep Pox Virus Proteins Elicit Neutralizing Antibodies

PubMed Central

Chervyakova, Olga V.; Zaitsev, Valentin L.; Iskakov, Bulat K.; Tailakova, Elmira T.; Strochkov, Vitaliy M.; Sultankulova, Kulyaisan T.; Sandybayev, Nurlan T.; Stanbekova, Gulshan E.; Beisenov, Daniyar K.; Abduraimov, Yergali O.; Mambetaliyev, Muratbay; Sansyzbay, Abylay R.; Kovalskaya, Natalia Y.; Nemchinov, Lev. G.; Hammond, Rosemarie W.

2016-01-01

The aim of this work was to evaluate the immunogenicity and neutralizing activity of sheep pox virus (SPPV; genus Capripoxvirus, family Poxviridae) structural proteins as candidate subunit vaccines to control sheep pox disease. SPPV structural proteins were identified by sequence homology with proteins of vaccinia virus (VACV) strain Copenhagen. Four SPPV proteins (SPPV-ORF 060, SPPV-ORF 095, SPPV-ORF 117, and SPPV-ORF 122), orthologs of immunodominant L1, A4, A27, and A33 VACV proteins, respectively, were produced in Escherichia coli. Western blot analysis revealed the antigenic and immunogenic properties of SPPV-060, SPPV-095, SPPV-117 and SPPV-122 proteins when injected with adjuvant into experimental rabbits. Virus-neutralizing activity against SPPV in lamb kidney cell culture was detected for polyclonal antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins. To our knowledge, this is the first report demonstrating the virus-neutralizing activities of antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins. PMID:27338444

Recombinant Sheep Pox Virus Proteins Elicit Neutralizing Antibodies.

PubMed

Chervyakova, Olga V; Zaitsev, Valentin L; Iskakov, Bulat K; Tailakova, Elmira T; Strochkov, Vitaliy M; Sultankulova, Kulyaisan T; Sandybayev, Nurlan T; Stanbekova, Gulshan E; Beisenov, Daniyar K; Abduraimov, Yergali O; Mambetaliyev, Muratbay; Sansyzbay, Abylay R; Kovalskaya, Natalia Y; Nemchinov, Lev G; Hammond, Rosemarie W

2016-06-07

The aim of this work was to evaluate the immunogenicity and neutralizing activity of sheep pox virus (SPPV; genus Capripoxvirus, family Poxviridae) structural proteins as candidate subunit vaccines to control sheep pox disease. SPPV structural proteins were identified by sequence homology with proteins of vaccinia virus (VACV) strain Copenhagen. Four SPPV proteins (SPPV-ORF 060, SPPV-ORF 095, SPPV-ORF 117, and SPPV-ORF 122), orthologs of immunodominant L1, A4, A27, and A33 VACV proteins, respectively, were produced in Escherichia coli. Western blot analysis revealed the antigenic and immunogenic properties of SPPV-060, SPPV-095, SPPV-117 and SPPV-122 proteins when injected with adjuvant into experimental rabbits. Virus-neutralizing activity against SPPV in lamb kidney cell culture was detected for polyclonal antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins. To our knowledge, this is the first report demonstrating the virus-neutralizing activities of antisera raised to SPPV-060, SPPV-117, and SPPV-122 proteins.

Sheep pox in Tunisia: Current status and perspectives.

PubMed

Ben Chehida, F; Ayari-Fakhfakh, E; Caufour, P; Amdouni, J; Nasr, J; Messaoudi, L; Haj Ammar, H; Sghaier, S; Bernard, C; Ghram, A; Cêtre-Sossah, C

2018-02-01

Sheep pox, a well-known endemic capripox infection, has significant impacts on small ruminant populations in Tunisia. It is responsible for high economic losses throughout North Africa due to its enzootic nature and to the active animal transhumance existing in some governorates in Tunisia. The aim of this review was to analyse data gathered on annual vaccination campaigns designed to control its spread by reducing the level of endemicity and to describe diagnostic and management tools adapted to the Tunisian situation. Seasonal, temporal and spatial distributions of sheep pox outbreaks, as well as related clinical features, were found. It was concluded from this review that establishing strong herd immunization through individual animal immunization, creating adequate infrastructure, increasing awareness among breeders, setting up a field-based surveillance network and improving routine diagnostic methods need to be the major components of a programme to eradicate the disease. It was also felt that cost-benefit analyses of the surveillance and control strategies used would help in controlling its persistence. © 2017 Blackwell Verlag GmbH.

A search for HI in some peculiar faint dwarf galaxies

NASA Astrophysics Data System (ADS)

Begum, Ayesha; Chengalur, Jayaram N.

2005-09-01

We present a deep Giant Metrewave Radio Telescope (GMRT) search for HI 21-cm emission from three dwarf galaxies, viz. POX 186, SC 24 and KKR 25. Based, in part, on previous single-dish HI observations, these galaxies have been classified as a blue compact dwarf (BCD), a dwarf irregular and a transition galaxy, respectively. However, in conflict with previous single-dish detections, we do not detect HI in SC 24 or KKR 25. We suggest that the previous single-dish measurements were probably confused with the local Galactic emission. In the case of POX 186, we confirm the previous non-detection of HI but with substantially improved limits on its HI mass. Our derived upper limits on the HI mass of SC 24 and KKR 25 are similar to the typical HI mass limit for dwarf spheroidal (dSph) galaxies, whereas in the case of POX 186, we find that its gas content is somewhat smaller than is typical of BCD galaxies.

[Management of chicken pox purpura fulminans: a pediatric case report].

PubMed

Domergue, S; Rodiere, M; Bigorre, M; Guye, E; Captier, G

2006-06-01

The authors report a case of a 4 years old girl who had presented a chicken-pox purpura fulminans. Lesions appeared 5 days after chicken-pox start and were quickly evoluted in cutaneous and sub-cutaneous necrosis on external side of thighs and behind side of right calf. A medical management was done with fresh plasma, blood, antithrombine 3, and fibrin. Specifics treatments were done: heparin and activated C protein. Surgical treatment was realised 5 weeks later. It consisted of clean necrosis areas and put a thin skin graft witch was took on the scalp. The evolution was fast good. The follow-up is 3 years without big esthetic and functional consequences. Some cases of this pathology were described in literature with serious lesions. The management should be multidisciplinary. Surgical treatment should be realised when lesions are stabilized. Scalp is a donor site for skin graft very interesting because of big quantity of skin and not esthetic consequence.

First report of the white pine blister rust pathogen, Cronartium ribicola, in Arizona

Treesearch

M. L. Fairweather; Brian Geils

2011-01-01

White pine blister rust, caused by Cronartium ribicola J.C. Fisch., was found on southwestern white pine (Pinus flexilis James var. reflexa Engelm., synonym P. strobiformis Engelm.) near Hawley Lake, Arizona (Apache County, White Mountains, 34.024°N, 109.776°W, elevation 2,357 m) in April 2009. Although white pines in the Southwest (Arizona and New Mexico) have been...

II. Pathogens

Treesearch

Ned B. Klopfenstein; Brian W. Geils

2011-01-01

Invasive fungal pathogens have caused immeasurably large ecological and economic damage to forests. It is well known that invasive fungal pathogens can cause devastating forest diseases (e.g., white pine blister rust, chestnut blight, Dutch elm disease, dogwood anthracnose, butternut canker, Scleroderris canker of pines, sudden oak death, pine pitch canker) (Maloy 1997...

Pathogenicity of Genetically Similar, H5N1 Highly Pathogenic Avian Influenza Virus Strains in Chicken and the Differences in Sensitivity among Different Chicken Breeds

PubMed Central

Matsuu, Aya; Kobayashi, Tomoko; Patchimasiri, Tuangthong; Shiina, Takashi; Suzuki, Shingo; Chaichoune, Kridsada; Ratanakorn, Parntep; Hiromoto, Yasuaki; Abe, Haruka; Parchariyanon, Sujira; Saito, Takehiko

2016-01-01

Differences in the pathogenicity of genetically closely related H5N1 highly pathogenic avian influenza viruses (HPAIVs) were evaluated in White Leghorn chickens. These viruses varied in the clinical symptoms they induced, including lethality, virus shedding, and replication in host tissues. A comparison of the host responses in the lung, brain, and spleen suggested that the differences in viral replication efficiency were related to the host cytokine response at the early phase of infection, especially variations in the proinflammatory cytokine IL-6. Based on these findings, we inoculated the virus that showed the mildest pathogenicity among the five tested, A/pigeon/Thailand/VSMU-7-NPT/2004, into four breeds of Thai indigenous chicken, Phadu-Hung-Dang (PHD), Chee, Dang, and Luang-Hung-Khao (LHK), to explore effects of genetic background on host response. Among these breeds, Chee, Dang, and LHK showed significantly longer survival times than White Leghorns. Virus shedding from dead Thai indigenous chickens was significantly lower than that from White Leghorns. Although polymorphisms were observed in the Mx and MHC class I genes, there was no significant association between the polymorphisms in these loci and resistance to HPAIV. PMID:27078641

Prevalence, distribution, and risk factor for sheep pox and goat pox (SPGP) in Algeria.

PubMed

Kardjadj, Moustafa

2017-03-01

A cross-sectional study using a tested questionnaire was carried out across Algeria between January and June 2014. Our investigation demonstrated that of the 150 flocks visited, 21 were positive for sheep pox and goat pox (SPGP) with an overall flock prevalence of 14% (95% CI 11.08-16.92%) suggesting that SPGP is endemic in Algeria. Our results showed also that the disease appears only in sheep and no case affecting goats has been reported. For the risk factor analysis, univariate analysis of variables followed by a multiple logistic regression identified steppe region (OR = 1.81, 95% CI 0.87-2.57; P = 0.037), large flocks (OR = 2. 19, 95% CI 1.02-3.36; P = 0.027), and transhumance (OR = 3.98, 95% CI 2.59-5.34; P = 0.021) as risk factors in the spread of the disease. Furthermore, our study revealed that the use of vaccination as preventive measures in the selected flocks decreased the odds for SPGP positivity by 5.78 (95% CI 2.22-9.34; P < 0.001) times compared to non vaccinated flocks. In conclusion, our findings documented an evidence of a widespread distribution and endemic establishment of the SPGP in Algerian sheep population despite the annual vaccination program. Consequently, the vaccination must cover all the Algerian sheep population to improve animal welfare and reduce economic losses associated with outbreak episodes.

Comparison of Fiber Optic and Conduit Attenuated Total Reflection (ATR) Fourier Transform Infrared (FT-IR) Setup for In-Line Fermentation Monitoring.

PubMed

Koch, Cosima; Posch, Andreas E; Herwig, Christoph; Lendl, Bernhard

2016-12-01

The performance of a fiber optic and an optical conduit in-line attenuated total reflection mid-infrared (IR) probe during in situ monitoring of Penicillium chrysogenum fermentation were compared. The fiber optic probe was connected to a sealed, portable, Fourier transform infrared (FT-IR) process spectrometer via a plug-and-play interface. The optical conduit, on the other hand, was connected to a FT-IR process spectrometer via a knuckled probe with mirrors that had to be adjusted prior to each fermentation, which were purged with dry air. Penicillin V (PenV) and its precursor phenoxyacetic acid (POX) concentrations were determined by online high-performance liquid chromatography and the obtained concentrations were used as reference to build partial least squares regression models. Cross-validated root-mean-square errors of prediction were found to be 0.2 g L -1 (POX) and 0.19 g L -1 (PenV) for the fiber optic setup and 0.17 g L -1 (both POX and PenV) for the conduit setup. Higher noise-levels and spectrum-to-spectrum variations of the fiber optic setup lead to higher noise of estimated (i.e., unknown) POX and PenV concentrations than was found for the conduit setup. It seems that trade-off has to be made between ease of handling (fiber optic setup) and measurement accuracy (optical conduit setup) when choosing one of these systems for bioprocess monitoring. © The Author(s) 2016.

Peroxiredoxin 1 (Prx1) is a dual-function enzyme by possessing Cys-independent catalase-like activity

PubMed Central

Sun, Cen-Cen; Dong, Wei-Ren; Shao, Tong; Li, Jiang-Yuan; Zhao, Jing; Nie, Li

2017-01-01

Peroxiredoxin (Prx) was previously known as a Cys-dependent thioredoxin. However, we unexpectedly observed that Prx1 from the green spotted puffer fish Tetraodon nigroviridis (TnPrx1) was able to reduce H2O2 in a manner independent of Cys peroxidation and reductants. This study aimed to validate a novel function for Prx1, delineate the biochemical features and explore its antioxidant role in cells. We have confirmed that Prx1 from the puffer fish and humans truly possesses a catalase (CAT)-like activity that is independent of Cys residues and reductants, but dependent on iron. We have identified that the GVL motif was essential to the CAT-like activity of Prx1, but not to the Cys-dependent thioredoxin peroxidase (POX) activity, and generated mutants lacking POX and/or CAT-like activities for individual functional validation. We discovered that the TnPrx1 POX and CAT-like activities possessed different kinetic features in the reduction of H2O2. The overexpression of wild-type TnPrx1 and mutants differentially regulated the intracellular levels of reactive oxygen species (ROS) and the phosphorylation of p38 in HEK-293T cells treated with H2O2. Prx1 is a dual-function enzyme by acting as POX and CAT with varied affinities towards ROS. This study extends our knowledge on Prx1 and provides new opportunities to further study the biological roles of this family of antioxidants. PMID:28219939

Deciphering how LIP2 and POX2 promoters can optimally regulate recombinant protein production in the yeast Yarrowia lipolytica.

PubMed

Sassi, Hosni; Delvigne, Frank; Kar, Tambi; Nicaud, Jean-Marc; Coq, Anne-Marie Crutz-Le; Steels, Sebastien; Fickers, Patrick

2016-09-20

In recent years, the non-conventional model yeast species Yarrowia lipolytica has received much attention because it is a useful cell factory for producing recombinant proteins. In this species, expression vectors involving LIP2 and POX2 promoters have been developed and used successfully for protein production at yields similar to or even higher than those of other cell factories, such as Pichia pastoris. However, production processes involving these promoters can be difficult to manage, especially if carried out at large scales in fed-batch bioreactors, because they require hydrophobic inducers, such as oleic acid or methyl oleate. Thus, the challenge has become to reduce loads of hydrophobic substrates while simultaneously promoting recombinant protein production. One possible solution is to replace a portion of the inducer with a co-substrate that can serve as an alternative energy source. However, implementing such an approach would require detailed knowledge of how carbon sources impact promoter regulation, which is surprisingly still lacking for the LIP2 and POX2 promoters. This study's aim was thus to better characterize promoter regulation and cell metabolism in Y. lipolytica cultures grown in media supplemented with different carbon sources. pPOX2 induction could be detected when glucose or glycerol was used as sole carbon source, which meant these carbon source could not prevent promoter induction. In addition, when a mixture of glucose and oleic acid was used in complex medium, pPOX2 induction level was lower that that of pLIP2. In contrast, pLIP2 induction was absent when glucose was present in the culture medium, which meant that cell growth could occur without any recombinant gene expression. When a 40/60 mixture of glucose and oleic acid (w/w) was used, a tenfold increase in promoter induction, as compared to when an oleic-acid-only medium was observed. It was also clear that individual cells were adapting metabolically to use both glucose and oleic acid. Indeed, no distinct subpopulations that specialized on glucose versus oleic acid were observed; such an outcome would have led to producer and non-producer phenotypes. In medium containing both glucose and oleic acid, cells tended to directly metabolize oleic acid instead of storing it in lipid bodies. This study found that pLIP2 is a promoter of choice as compared to pPOX2 to drive gene expression for recombinant protein production by Y. lipolytica used as cell factory.

A pox on thee! Manipulation of the host immune system by myxoma virus and implications for viral-host co-adaptation.

PubMed

Zúñiga, Martha C

2002-09-01

The poxviruses have evolved a diverse array of proteins which serve to subvert innate and adaptive host responses that abort or at least limit viral infections. Myxoma virus and its rabbit host are considered to represent an ideal poxvirus-host system in which to study the effects of these immunomodulatory proteins. Studies of laboratory rabbits (Oryctolagus cuniculus) infected with gene knockout variants of myxoma virus have provided compelling evidence that several myxoma virus gene products contribute to the pathogenic condition known as myxomatosis. However, myxomatosis, which is characterized by skin lesions, systemic immunosuppression, and a high mortality rate, does not occur in the virus' natural South American host, Sylvilogus brasiliensis. Moreover, in Australia where myxoma virus was willfully introduced to control populations of O. cuniculus, myxomatosis-resistant rabbits emerged within a year of myxoma virus introduction into the field. In this review I discuss the characterized immunomodulatory proteins of myxoma virus, their biochemical properties, their pathogenic effects in laboratory rabbits, the role of the host immune system in the susceptibility or resistance to myxomatosis, and the evidence that immunomodulatory genes may have been attenuated during the co-adaptation of myxoma virus and O. cuniculus in Australia.

Role of L-alanine for redox self-sufficient amination of alcohols.

PubMed

Klatte, Stephanie; Wendisch, Volker F

2015-01-23

In white biotechnology biocatalysis represents a key technology for chemical functionalization of non-natural compounds. The plasmid-born overproduction of an alcohol dehydrogenase, an L-alanine-dependent transaminase and an alanine dehydrogenase allows for redox self-sufficient amination of alcohols in whole cell biotransformation. Here, conditions to optimize the whole cell biocatalyst presented in (Bioorg Med Chem 22:5578-5585, 2014), and the role of L-alanine for efficient amine functionalization of 1,10-decanediol to 1,10-diaminodecane were analyzed. The enzymes of the cascade for amine functionalization of alcohols were characterized in vitro to find optimal conditions for an efficient process. Transaminase from Chromobacterium violaceum, TaCv, showed three-fold higher catalytic efficiency than transaminase from Vibrio fluvialis, TaVf, and improved production at 37°C. At 42°C, TaCv was more active, which matched thermostable alcohol dehydrogenase and alanine dehydrogenase and improved the 1,10-diaminodecane production rate four-fold. To study the role of L-alanine in the whole cell biotransformation, the L-alanine concentration was varied and 1,10.diaminodecane formation tested with constant 10 mM 1,10- decanediol and 100 mM NH4Cl. Only 5.6% diamine product were observed without added L-alanine. L-alanine concentrations equimolar to that of the alcohol enabled for 94% product formation but higher L-alanine concentrations allowed for 100% product formation. L-alanine was consumed by the E. coli biocatalyst, presumably due to pyruvate catabolism since up to 16 mM acetate accumulated. Biotransformation employing E. coli strain YYC202/pTrc99a-ald-adh-ta Cv, which is unable to catabolize pyruvate, resulted in conversion with a selectivity of 42 mol-%. Biotransformation with E. coli strains only lacking pyruvate oxidase PoxB showed similar reduced amination of 1,10-decanediol indicating that oxidative decarboxylation of pyruvate to acetate by PoxB is primarily responsible for pyruvate catabolism during redox self-sufficient amination of alcohols using this whole cell biocatalyst. The replacement of the transaminase TaVf by TaCv, which showed higher activity at 42°C, in the artificial operon ald-adh-ta improved amination of alcohols in whole cell biotransformation. The addition of L-alanine, which was consumed by E. coli via pyruvate catabolism, was required for 100% product formation possibly by providing maintenance energy. Metabolic engineering revealed that pyruvate catabolism occurred primarily via oxidative decarboxylation to acetate by PoxB under the chosen biotranformation conditions.

Enplanement and All Cargo Activity

DTIC Science & Technology

1991-01-01

ORLEANS NEW ORLEANS INTL/M MSY 3,255,817 $3.481.281 41 IL CHICAGO CHICAGO MIDWAY MDW 3,241,851 $3,472.203 42 OR PORTLAND PORTLAND INTL POX # 3,178,617...FNN 66.042 $473.418 NEW MEXICO TOTAL 2.560.292 $4.236.347 3601 COUNTY OF BROOME EDWIN A LINK FIELD-BRD 5GM 151.518 $783.947 3602 COUNTY OF CHAUTAUQUA...PENDLETON MUNI PDT 11,056 $400.000 4109 CITY OF REDMOND ROBERTS FtELD ROM 64.773 $486.820 4113 PORT OF PORTLAND PORTLAND INTL POX # 3.178,617 $1.715.551

Paroxysmal cold haemoglobinuria in an adult with chicken pox.

PubMed

Papalia, M A; Schwarer, A P

2000-05-01

Paroxysmal cold haemoglobinuria (PCH) is an autoimmune disorder characterized by intravascular haemolysis causing haemoglobinuria. It is due to a biphasic haemolysin known as the Donath-Landsteiner antibody, which binds specifically to the P antigen of red blood cells at low temperatures, leading to complement activation and red cell lysis at 37 degrees C. PCH is a rare disease which predominantly affects the paediatric population, occurring mostly during viral infections. We report on what is possibly the first case of PCH in an adult to be precipitated by chicken pox infection.

New respiratory virus (chicken pox, influenza and respiratory syncytial virus) vaccines: efficacy, necessity and policy for the tropical world at present.

PubMed

Wiwanitkit, Viroj

2009-09-01

Several respiratory viruses are documented in medicine. Several infectious diseases due to these viruses are current global public health problems. Prevention of respiratory viral infections becomes the focus of the public health ministries of many tropical countries. Presently, there are many new vaccines for respiratory viruses. These vaccines include chicken pox vaccine, influenza vaccine and respiratory syncytial virus vaccine. In this article, the author will briefly discuss on these quoted vaccines focusing on efficacy, necessity and policy for tropical world at present.

[Atypical course of chicken-pox complicated by hepatitis and endocarditis].

PubMed

Hryckiewicz, Katarzyna; Flieger, Jan; Juszczyk, Jacek

2004-01-01

A case of chicken-pox complicated by hepatitis and endocarditis in 21 years old man was described. Three weeks before admission to the Department of Infectious Diseases the patient stayed at the Neurological Department and was diagnosed as encephalitis. The spots on the skin and a very high level of aminotransferases were noticed in 19th day of hospitalization. The blood cultures were positive for Staphylococcus aureus MSSA. Bacterial endocarditis was diagnosed on the base of echocardiography. The patient was treated with antibiotics six weeks. He recovered completely.

Myocardial infarction in a 35-day-old infant with incomplete Kawasaki disease and chicken pox.

PubMed

Kossiva, Lydia; Papadopoulos, Marios; Lagona, Evangelia; Papadopoulos, George; Athanassaki, Corina

2010-10-01

Kawasaki disease is an acute febrile vasculitis of infancy and early childhood. It is uncommon in early infancy, because a significant proportion of these children do not meet the classical diagnostic criteria at this age. Infants younger than 6 months with persistent fever and some of the criteria of Kawasaki disease should always raise suspicion for Kawasaki disease early to avoid delayed diagnosis with severe cardiac complications. We present a 35-day-old infant with incomplete Kawasaki disease complicated with myocardial infarction during chicken pox.

Status of white pine blister rust and seed collections in california's high-elevation white pine species

Treesearch

J. Dunlap

2011-01-01

White pine blister rust (caused by the non-native pathogen Cronartium ribicola) reached northern California about 80 years ago. Over the years its spread southward had been primarily recorded on sugar pine. However, observations on its occurrence had also been reported in several of the higher elevation five-needled white pine species in California. Since the late...

Exploring the potential of the permanganate oxidation method as a tool to monitor soil quality in agricultural upland systems of Southeast Asia

NASA Astrophysics Data System (ADS)

Hepp, Catherine M.; Bruun, Thilde Bech; de Neergaard, Andreas

2014-05-01

The transition to more intensified upland systems is having an impact on the soil quality, defined as the ability of a soil to both provide and maintain essential services to an ecosystem. As many tropical upland soils are inherently low in quality, it is essential that impacts be monitored. Soil quality is assessed by using a combination of parameters that serve as indicators and cover the soil chemical, biological and physical properties. An ideal indicator should be sensitive to changes in the environment and management practices and should be widely accessible, meaning low resource requirement (i.e. time and equipment). Total organic carbon (TOC) content is a commonly used indicator of soil quality as it is linked to many soil functions and processes; however analysis is costly and requires access to advanced instrumental facilities, rendering it unsuited for many developing countries. An alternative indicator is the soil fraction dominated by easily decomposable carbon; this may be measured by treating soil samples with 0.2M potassium permanganate (KMnO4), an oxidizing agent which is thought to mimic the enzymes released by the soil microbial community. The advantage of this method is that it is accessible: it is fast, requires little resource input and is field appropriate. There is no consensus however as to which soil carbon fraction the method targets. Furthermore Skjemstad et al. (2006) has indicated that KMnO4 may oxidise charcoal, a component of the non-labile carbon pool; this has implications for the suitability of the method when used for soils of shifting cultivation systems. The purpose of this study was to investigate the potential of permanganate oxidizable carbon (Pox C) as a reliable indicator of soil quality in agricultural upland systems in Northern Lao PDR. Focus was placed on the relations between Pox C and other soil quality parameters (bulk density, pH, CEC, TOC, total N, exchangeable K, plant available P) and upland rice yields. The ability of KMnO4 to oxidize charcoal was also a focus however, as the study is still in its initial stage, no results can be discussed. Volumetric soil samples (at the surface and at 10 cm) and upland rice yield measurements were taken from three fields with three plots that were previously left fallow for five years (n=9; soil n=81). Pearson's Correlation test and Stepwise Regression analysis was done using SPSS v 16.0 for Windows. Results show that Pox C is significantly correlated to the measured soil parameters in a manner similar to TOC. Both are positively correlated to the soil nutrients: Total N %, P Avail and K Exch; Pox C however had a stronger correlation to K Exch than TOC. This affirms the important role of Pox C in soil processes in the biological, chemical and physical spheres. Furthermore, the regression analysis identified Pox C as an influencing factor for the variations seen in upland rice yields. It is concluded that Pox C is a suitable indicator for soil quality and may be useful in monitoring changes in the soil quality of agricultural upland systems.

The Ontogeny and Brain Distribution Dynamics of the Appetite Regulators NPY, CART and pOX in Larval Atlantic Cod (Gadus morhua L.)

PubMed Central

Le, Hoang T. M. D.; Angotzi, Anna Rita; Ebbesson, Lars O. E.; Karlsen, Ørjan

2016-01-01

Similar to many marine teleost species, Atlantic cod undergo remarkable physiological changes during the early life stages with concurrent and profound changes in feeding biology and ecology. In contrast to the digestive system, very little is known about the ontogeny and the localization of the centers that control appetite and feed ingestion in the developing brain of fish. We examined the expression patterns of three appetite regulating factors (orexigenic: neuropeptide Y, NPY; prepro-orexin, pOX and anorexigenic: cocaine- and amphetamine-regulated transcript, CART) in discrete brain regions of developing Atlantic cod using chromogenic and double fluorescent in situ hybridization. Differential temporal and spatial expression patterns for each appetite regulator were found from first feeding (4 days post hatch; dph) to juvenile stage (76 dph). Neurons expressing NPY mRNA were detected in the telencephalon (highest expression), diencephalon, and optic tectum from 4 dph onward. CART mRNA expression had a wider distribution along the anterior-posterior brain axis, including both telencephalon and diencephalon from 4 dph. From 46 dph, CART transcripts were also detected in the olfactory bulb, region of the nucleus of medial longitudinal fascicle, optic tectum and midbrain tegmentum. At 4 and 20 dph, pOX mRNA expression was exclusively found in the preoptic region, but extended to the hypothalamus at 46 and 76 dph. Co-expression of both CART and pOX genes were also observed in several hypothalamic neurons throughout larval development. Our results show that both orexigenic and anorexigenic factors are present in the telencephalon, diencephalon and mesencephalon in cod larvae. The telencephalon mostly contains key factors of hunger control (NPY), while the diencephalon, and particularly the hypothalamus may have a more complex role in modulating the multifunctional control of appetite in this species. As the larvae develop, the overall progression in temporal and spatial complexity of NPY, CART and pOX mRNAs expression might be correlated to the maturation of appetite control regulation. These observations suggest that teleost larvae continue to develop the regulatory networks underlying appetite control after onset of exogenous feeding. PMID:27100086

The Ontogeny and Brain Distribution Dynamics of the Appetite Regulators NPY, CART and pOX in Larval Atlantic Cod (Gadus morhua L.).

PubMed

Le, Hoang T M D; Angotzi, Anna Rita; Ebbesson, Lars O E; Karlsen, Ørjan; Rønnestad, Ivar

2016-01-01

Similar to many marine teleost species, Atlantic cod undergo remarkable physiological changes during the early life stages with concurrent and profound changes in feeding biology and ecology. In contrast to the digestive system, very little is known about the ontogeny and the localization of the centers that control appetite and feed ingestion in the developing brain of fish. We examined the expression patterns of three appetite regulating factors (orexigenic: neuropeptide Y, NPY; prepro-orexin, pOX and anorexigenic: cocaine- and amphetamine-regulated transcript, CART) in discrete brain regions of developing Atlantic cod using chromogenic and double fluorescent in situ hybridization. Differential temporal and spatial expression patterns for each appetite regulator were found from first feeding (4 days post hatch; dph) to juvenile stage (76 dph). Neurons expressing NPY mRNA were detected in the telencephalon (highest expression), diencephalon, and optic tectum from 4 dph onward. CART mRNA expression had a wider distribution along the anterior-posterior brain axis, including both telencephalon and diencephalon from 4 dph. From 46 dph, CART transcripts were also detected in the olfactory bulb, region of the nucleus of medial longitudinal fascicle, optic tectum and midbrain tegmentum. At 4 and 20 dph, pOX mRNA expression was exclusively found in the preoptic region, but extended to the hypothalamus at 46 and 76 dph. Co-expression of both CART and pOX genes were also observed in several hypothalamic neurons throughout larval development. Our results show that both orexigenic and anorexigenic factors are present in the telencephalon, diencephalon and mesencephalon in cod larvae. The telencephalon mostly contains key factors of hunger control (NPY), while the diencephalon, and particularly the hypothalamus may have a more complex role in modulating the multifunctional control of appetite in this species. As the larvae develop, the overall progression in temporal and spatial complexity of NPY, CART and pOX mRNAs expression might be correlated to the maturation of appetite control regulation. These observations suggest that teleost larvae continue to develop the regulatory networks underlying appetite control after onset of exogenous feeding.

The other white-nose syndrome transcriptome: Tolerant and susceptible hosts respond differently to the pathogen Pseudogymnoascus destructans.

PubMed

Davy, Christina M; Donaldson, Michael E; Willis, Craig K R; Saville, Barry J; McGuire, Liam P; Mayberry, Heather; Wilcox, Alana; Wibbelt, Gudrun; Misra, Vikram; Bollinger, Trent; Kyle, Christopher J

2017-09-01

Mitigation of emerging infectious diseases that threaten global biodiversity requires an understanding of critical host and pathogen responses to infection. For multihost pathogens where pathogen virulence or host susceptibility is variable, host-pathogen interactions in tolerant species may identify potential avenues for adaptive evolution in recently exposed, susceptible hosts. For example, the fungus Pseudogymnoascus destructans causes white-nose syndrome (WNS) in hibernating bats and is responsible for catastrophic declines in some species in North America, where it was recently introduced. Bats in Europe and Asia, where the pathogen is endemic, are only mildly affected. Different environmental conditions among Nearctic and Palearctic hibernacula have been proposed as an explanation for variable disease outcomes, but this hypothesis has not been experimentally tested. We report the first controlled, experimental investigation of response to P. destructans in a tolerant, European species of bat (the greater mouse-eared bat, Myotis myotis ). We compared body condition, disease outcomes and gene expression in control (sham-exposed) and exposed M. myotis that hibernated under controlled environmental conditions following treatment. Tolerant M. myotis experienced extremely limited fungal growth and did not exhibit symptoms of WNS. However, we detected no differential expression of genes associated with immune response in exposed bats, indicating that immune response does not drive tolerance of P. destructans in late hibernation. Variable responses to P. destructans among bat species cannot be attributed solely to environmental or ecological factors. Instead, our results implicate coevolution with the pathogen, and highlight the dynamic nature of the "white-nose syndrome transcriptome." Interspecific variation in response to exposure by the host (and possibly pathogen) emphasizes the importance of context in studies of the bat-WNS system, and robust characterization of genetic responses to exposure in various hosts and the pathogen should precede any attempts to use particular bat species as generalizable "model hosts."

Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering.

PubMed

Karimova, Madina; Splith, Victoria; Karpinski, Janet; Pisabarro, M Teresa; Buchholz, Frank

2016-07-22

Precise genome engineering is instrumental for biomedical research and holds great promise for future therapeutic applications. Site-specific recombinases (SSRs) are valuable tools for genome engineering due to their exceptional ability to mediate precise excision, integration and inversion of genomic DNA in living systems. The ever-increasing complexity of genome manipulations and the desire to understand the DNA-binding specificity of these enzymes are driving efforts to identify novel SSR systems with unique properties. Here, we describe two novel tyrosine site-specific recombination systems designated Nigri/nox and Panto/pox. Nigri originates from Vibrio nigripulchritudo (plasmid VIBNI_pA) and recombines its target site nox with high efficiency and high target-site selectivity, without recombining target sites of the well established SSRs Cre, Dre, Vika and VCre. Panto, derived from Pantoea sp. aB, is less specific and in addition to its native target site, pox also recombines the target site for Dre recombinase, called rox. This relaxed specificity allowed the identification of residues that are involved in target site selectivity, thereby advancing our understanding of how SSRs recognize their respective DNA targets.

Critical oxide cluster size on Si(111)

NASA Astrophysics Data System (ADS)

Shklyaev, A. A.; Aono, M.; Suzuki, T.

1999-03-01

The initial stage of oxide growth and subsequent oxide decomposition on Si(111)-7×7 at temperatures between 350 and 720°C are studied with the optical second harmonic generation for O 2 pressures ( Pox) between 5×10 -9 and 4×10 -6 Torr. The obtained pressure dependencies of the initial oxide growth rate ( Rgr) and the subsequent oxide decomposition rate are associated with the cluster-forming nature of the oxidation process. For the model of oxide cluster nucleation and growth, a scaling relationship is derived among the critical oxide cluster size, i, and the experimentally measurable values of Rgr and Pox. The critical oxide cluster size, i, thus obtained from the kinetic data increases with temperature. This correlates with an increase of desorption channels and their rates in that the competition between growth and decomposition requires more stable oxide clusters, i.e. clusters with a larger critical size, for oxide to grow at higher temperatures. The increase of i with decreasing Pox is related with a decrease of Rgr: a decreased Rgr requires critical clusters with a longer lifetime, i.e. clusters with a larger size.

Environmental Factors Influencing White-Tailed Deer (Odocoileus virginianus) Exposure to Livestock Pathogens in Wisconsin

PubMed Central

Kern, Bryant; Mahoney, Kathleen; Norton, Andrew; Patnayak, Devi; Van Deelen, Timothy

2015-01-01

White-tailed deer (Odocoileus virginianus) are commonly exposed to disease agents that affect livestock but environmental factors that predispose deer to exposure are unknown for many pathogens. We trapped deer during winter months on two study areas (Northern Forest and Eastern Farmland) in Wisconsin from 2010 to 2013. Deer were tested for exposure to six serovars of Leptospira interrogans (grippotyphosa, icterohaemorrhagiae, canicola, bratislava, pomona, and hardjo), bovine viral diarrhea virus (BVDV-1 and BVDV-2), infectious bovine rhinotracheitis virus (IBR), and parainfluenza 3 virus (PI3). We used logistic regression to model potential intrinsic (e.g., age, sex) and extrinsic (e.g., land type, study site, year, exposure to multiple pathogens) variables we considered biologically meaningful to exposure of deer to livestock pathogens. Deer sampled in 2010–2011 did not demonstrate exposure to BVDV, so we did not test for BVDV in subsequent years. Deer had evidence of exposure to PI3 (24.7%), IBR (7.9%), Leptospira interrogans serovar pomona (11.7%), L. i. bratislava (1.0%), L. i. grippotyphosa (2.5%) and L. i. hardjo (0.3%). Deer did not demonstrate exposure to L. interrogans serovars canicola and icterohaemorrhagiae. For PI3, we found that capture site and year influenced exposure. Fawns (n = 119) were not exposed to L. i. pomona, but land type was an important predictor of exposure to L. i. pomona for older deer. Our results serve as baseline exposure levels of Wisconsin white-tailed deer to livestock pathogens, and helped to identify important factors that explain deer exposure to livestock pathogens. PMID:26030150

Environmental Factors Influencing White-Tailed Deer (Odocoileus virginianus) Exposure to Livestock Pathogens in Wisconsin.

PubMed

Dubay, Shelli; Jacques, Christopher; Golden, Nigel; Kern, Bryant; Mahoney, Kathleen; Norton, Andrew; Patnayak, Devi; Van Deelen, Timothy

2015-01-01

White-tailed deer (Odocoileus virginianus) are commonly exposed to disease agents that affect livestock but environmental factors that predispose deer to exposure are unknown for many pathogens. We trapped deer during winter months on two study areas (Northern Forest and Eastern Farmland) in Wisconsin from 2010 to 2013. Deer were tested for exposure to six serovars of Leptospira interrogans (grippotyphosa, icterohaemorrhagiae, canicola, bratislava, pomona, and hardjo), bovine viral diarrhea virus (BVDV-1 and BVDV-2), infectious bovine rhinotracheitis virus (IBR), and parainfluenza 3 virus (PI3). We used logistic regression to model potential intrinsic (e.g., age, sex) and extrinsic (e.g., land type, study site, year, exposure to multiple pathogens) variables we considered biologically meaningful to exposure of deer to livestock pathogens. Deer sampled in 2010-2011 did not demonstrate exposure to BVDV, so we did not test for BVDV in subsequent years. Deer had evidence of exposure to PI3 (24.7%), IBR (7.9%), Leptospira interrogans serovar pomona (11.7%), L. i. bratislava (1.0%), L. i. grippotyphosa (2.5%) and L. i. hardjo (0.3%). Deer did not demonstrate exposure to L. interrogans serovars canicola and icterohaemorrhagiae. For PI3, we found that capture site and year influenced exposure. Fawns (n = 119) were not exposed to L. i. pomona, but land type was an important predictor of exposure to L. i. pomona for older deer. Our results serve as baseline exposure levels of Wisconsin white-tailed deer to livestock pathogens, and helped to identify important factors that explain deer exposure to livestock pathogens.

Review of Specifications for Zinc-Rich Paints,

DTIC Science & Technology

1979-09-01

inspected in 1976, the repair inorganic zinc was in very poor condition due to extensive " chicken pox " rusting. The original red lead alkyd and basic...Nebraska H-186 New Hampshire H-188 New Jersey H-189 /y’/9 7’ 𔃼 New Mexico H(-216.0 North Carolina H-217 North Dakota l1- 246 Ohio H-247 Oklahoma H-254...8217l.% 2. Olharfing I r A1 1 1e a £I )II d To be separately packaged in multiples of 0 54 pound of pox der per M . Cnpost vehicle. One 2.70 pound

Trichosporon beigelii infection presenting as white piedra and onychomycosis in the same patient.

PubMed

Elmer, Kathleen B; Elston, Dirk M; Libow, Lester F

2002-10-01

Trichosporon beigelii is a fungal organism that causes white piedra and has occasionally been implicated as a nail pathogen. We describe a patient with both hair and nail changes associated with T. beigelii.

Very Virulent Infectious Bursal Disease Virus Produces More-Severe Disease and Lesions in Specific-Pathogen-Free (SPF) Leghorns Than in SPF Broiler Chickens.

PubMed

Sá e Silva, Mariana; Rissi, Daniel R; Swayne, David E

2016-03-01

Infectious bursal disease virus (IBDV) is an important pathogen of chickens causing negative economic impacts in poultry industries worldwide. IBDV has a variable range of virulence, with very virulent (vvIBDV) strains being responsible for the greatest losses from mortality and decreased performance. Previous vvIBDV studies using conventional broilers reported resistance to lethal effects and decreased performance as compared to specific-pathogen-free (SPF) layers, but the potential contribution of the conventional vs. SPF status to resistance has not been examined. In this study we compared differences in the acute pathologic effects of infection by the California rA strain of vvIBDV for SPF white leghorn egg-laying chickens and SPF white Plymouth Rock broiler chickens over a 7-day experimental period. Based on the clinical signs and mortality observed, as well as on the more-severe pathologic changes in lymphoid tissues and kidneys, white leghorns were shown to be more susceptible to the deleterious effects of vvIBDV infection than were white Plymouth Rocks. This study provides important information on the impact of chicken breed on susceptibility to vvIBDV and the absence of impact from conventional vs. SPF status on the outcome.

Landscape biology of western white pine: implications for conservation of a widely-distributed five-needle pine at its southern range limit

Treesearch

Patricia Maloney; Andrew Eckert; Detlev Vogler; Camille Jensen; Annette Delfino Mix; David Neale

2016-01-01

Throughout much of the range of western white pine, Pinus monticola Dougl., timber harvesting, fire exclusion and the presence of Cronartium ribicola J. C. Fisch., the white pine blister rust (WPBR) pathogen, have led to negative population and genetic consequences. To address these interactions, we examined population dynamics...

Current and future molecular approaches to investigate the white pine blister rust pathosystem

Treesearch

B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein

2010-01-01

Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

Differential induction of peroxisomal beta-oxidation enzymes by clofibric acid and aspirin in piglet tissues.

PubMed

Yu, X X; Odle, J; Drackley, J K

2001-11-01

Peroxisomal beta-oxidation (POX) of fatty acids is important in lipid catabolism and thermogenesis. To investigate the effects of peroxisome proliferators on peroxisomal and mitochondrial beta-oxidation in piglet tissues, newborn pigs (1-2 days old) were allowed ad libitum access to milk replacer supplemented with 0.5% clofibric acid (CA) or 1% aspirin for 14 days. CA increased ratios of liver weight to body weight (P < 0.07), kidney weight to body weight (P < 0.05), and heart weight to body weight (P < 0.001). Aspirin decreased daily food intake and final body weight but increased the ratio of heart weight to body weight (P < 0.01). In liver, activities of POX, fatty acyl-CoA oxidase (FAO), total carnitine palmitoyltransferase (CPT), and catalase were 2.7-, 2.2-, 1.5-fold, and 33% greater, respectively, for pigs given CA than for control pigs. In heart, these variables were 2.2-, 4.1-, 1.9-, and 1.8-fold greater, respectively, for pigs given CA than for control pigs. CA did not change these variables in either kidney or muscle, except that CPT activity was increased approximately 110% (P < 0.01) in kidney. Aspirin increased only hepatic FAO and CPT activities. Northern blot analysis revealed that CA increased the abundance of catalase mRNA in heart by approximately 2.2-fold. We conclude that 1) POX and CPT in newborn pigs can be induced by peroxisomal proliferators with tissue specificity and 2) the relatively smaller induction of POX in piglets (compared with that in young or adult rodents) may be related to either age or species differences.

Pox 186: An ultracompact galaxy with dominant ionized gas emission

NASA Astrophysics Data System (ADS)

Guseva, N. G.; Papaderos, P.; Izotov, Y. I.; Noeske, K. G.; Fricke, K. J.

2004-07-01

We present a ground-based optical spectroscopic and HST U, V, I photometric study of the blue compact dwarf (BCD) galaxy Pox 186. It is found that the emission of the low-surface brightness (LSB) component in Pox 186 at radii ⪉3 arcsec (⪉270 pc in linear scale) is mainly gaseous in origin. We detect Hα emission out to radii as large as 6 arcsec. At radii ⪆3 arcsec the light of the LSB component is contaminated by the emission of background galaxies complicating the study of the outermost regions. The surface brightness distribution in the LSB component can be approximated by an exponential law with a scale length α ⪉ 120 pc. This places Pox 186 among the most compact dwarf galaxies known. The derived α is likely to be an upper limit to the scale length of the LSB component because of the strong contribution of the gaseous emission. The oxygen abundance in the bright H II region derived from the 4.5 m Multiple Mirror Telescope (MMT) and 3.6 m ESO telescope spectra are 12 + log (O/H) = 7.76 ± 0.02 and 7.74 ± 0.01 (˜Z⊙/15), respectively, in accordance with previous determinations. The helium mass fractions found in this region are Y = 0.248 ± 0.009 (MMT) and Y = 0.248 ± 0.004 (3.6 m) suggesting a high primordial helium abundance. The MMT Observatory is a joint facility of the Smithsonian Institution and the University of Arizona. Based on observations collected at the European Southern Observatory, Chile, ESO program 71.B-0032(A). 12+\\log(O/H)⊙ = 8.92 (Anders & Grevesse \\cite{Anders89}).

Prevalence and distribution of pox-like lesions, avian malaria, and mosquito vectors in Kipahulu valley, Haleakala National Park, Hawai'i, USA

USGS Publications Warehouse

Aruch, Samuel; Atkinson, Carter T.; Savage, Amy F.; LaPointe, Dennis

2007-01-01

We determined prevalence and altitudinal distribution of introduced avian malarial infections (Plasmodium relictum) and pox-like lesions (Avipoxvirus) in forest birds from Kīpahulu Valley, Haleakalā National Park, on the island of Maui, and we identified primary larval habitat for the mosquito vector of this disease. This intensively managed wilderness area and scientific reserve is one of the most pristine areas of native forest remaining in the state of Hawai‘i, and it will become increasingly important as a site for restoration and recovery of endangered forest birds. Overall prevalence of malarial infections in the valley was 8% (11/133) in native species and 4% (4/101) in nonnative passerines; prevalence was lower than reported for comparable elevations and habitats elsewhere in the state. Infections occurred primarily in ‘Apapane (Himatione sanguinea) and Hawai‘i ‘Amakihi (Hemignathus virens) at elevations below 1,400 m. Pox-like lesions were detected in only two Hawai‘i ‘Amakihi (2%; 2/94) at elevations below 950 m. We did not detect malaria or pox in birds caught at 1,400 m in upper reaches of the valley. Adult mosquitoes (Culex quinquefasciatus) were captured at four sites at elevations of 640, 760, 915, and 975 m, respectively. Culex quinquefasciatus larvae were found only in rock holes along intermittent tributaries of the two largest streams in the valley, but not in standing surface water, pig wallows, ground pools, tree cavities, and tree fern cavities. Mosquito populations in the valley are low, and they are probably influenced by periods of high rainfall that flush stream systems.

Oxidative stress induction by Prunus necrotic ringspot virus infection in apricot seeds.

PubMed

Amari, Khalid; Díaz-Vivancos, Pedro; Pallás, Vincente; Sánchez-Pina, María Amelia; Hernández, José Antonio

2007-10-01

Prunus necrotic ringspot rvirus (PNRSV) was able to invade the immature apricot seed including the embryo. The amount of virus was very high inside the embryo compared with that present in the cotyledons. PNRSV infection produced an oxidative stress in apricot seeds as indicated by the increase in lipid peroxidation, measured as thiobarbituric acid-reactive substances. This lipid peroxidation increase was parallelled with an imbalance in the seed antioxidant enzymes. A significant decrease in the ascorbate-GSH cycle enzymes as well as in peroxidase (POX) activity took place in infected seeds, suggesting a low capability to eliminate H2O2. No changes in superoxide dismutase (SOD) or catalase activity were observed. A significant decrease in polyphenoloxidase (PPO) activity was also observed. Native PAGE revealed the presence of three different SOD activity bands in apricot seeds: a Mn-containing SOD and two CuZn-containing SODs. Only an isozyme with catalase, glutathione reductase (GR) or PPO activity was detected in both healthy and infected apricot seeds. Regarding POX staining, three bands with POX activity were detected in native gels in both healthy and infected seeds. The gel results emphasise that the drop detected in POX, GR and PPO activities in PNRSV-infected apricot seeds by kinetic analyses was also evident from the results obtained by native PAGE. The oxidative stress and the imbalance in the antioxidant systems from PNRSV-infected apricot seeds resemble the hypersensitive response observed in some virus-host interactions. This defence mechanism would inactivate PNRSV during seed formation and/or the storage period or even during seed germination. Those results can explain the decrease in seed germination and the low transmission of PNRSV by seeds in apricot trees.

Pralidoxime inhibits paraoxon-induced depression of rocuronium-neuromuscular block in a time-dependent fashion.

PubMed

Narimatsu, Eichi; Niiya, Tomohisa; Takahashi, Kazunobu; Yamauchi, Masanori; Yamakage, Michiaki

2012-07-01

The composite effects of organophosphorus (OP)-cholinesterase (ChE) inhibitors and oximes on the actions of nondepolarizing neuromuscular blockers in acute OP-ChE inhibitor intoxication have not been evaluated in detail. We investigated the effects of paraoxon (Pox) (an OP-ChE inhibitor) and pralidoxime (PAM) (an oxime) on the nondepolarizing neuromuscular blocking action of rocuronium. Isometric twitch tensions of rat left phrenic nerve-hemidiaphragm preparations elicited by indirect (phrenic nerve) supramaximal stimulation at 0.1 Hz were evaluated. Analysis of variance with post hoc testing was used for statistical comparison, and P < .05 was accepted as significant. Rocuronium reduced the indirectly elicited twitch tensions in normal (50% inhibitory concentration [IC(50)], 9.84 [9.64-10.04] μM, mean [95% confidence interval]) and all pretreated diaphragms (P < .01, n = 6) in a concentration-dependent fashion. Paraoxon caused a rightward shift in the rocuronium concentration-twitch tension curve (IC(50), 15.48 [15.24-15.72] μM). The rightward shift was completely inhibited by previous copretreatment (IC(50), 9.98 [9.77-10.20] μM) and partially inhibited by simultaneous copretreatment (IC(50), 11.68 [11.45-11.91] μM) with PAM but was not inhibited by subsequent copretreatment (IC(50), 13.69 [13.39-13.99] μM) with PAM (P < .01, n = 6). Atropine did not influence the rightward shift (P < .01, n = 6). Paraoxon depressed rocuronium-induced neuromuscular block by inhibiting ChEs, and the action of Pox was inhibited by PAM. Pralidoxime acts more intensely when applied earlier. The time-dependent effect of PAM indicates that the preceding presence of PAM in proximity to ChEs before Pox is necessary for definite suppression of the Pox-induced ChE inhibition. Copyright © 2012 Elsevier Inc. All rights reserved.

Pathogen dynamics during invasion and establishment of white-nose syndrome explain mechanisms of host persistence.

PubMed

Frick, Winifred F; Cheng, Tina L; Langwig, Kate E; Hoyt, Joseph R; Janicki, Amanda F; Parise, Katy L; Foster, Jeffrey T; Kilpatrick, A Marm

2017-03-01

Disease dynamics during pathogen invasion and establishment determine the impacts of disease on host populations and determine the mechanisms of host persistence. Temporal progression of prevalence and infection intensity illustrate whether tolerance, resistance, reduced transmission, or demographic compensation allow initially declining populations to persist. We measured infection dynamics of the fungal pathogen Pseudogymnoascus destructans that causes white-nose syndrome in bats by estimating pathogen prevalence and load in seven bat species at 167 hibernacula over a decade as the pathogen invaded, became established, and some host populations stabilized. Fungal loads increased rapidly and prevalence rose to nearly 100% at most sites within 2 yr of invasion in six of seven species. Prevalence and loads did not decline over time despite huge reductions in colony sizes, likely due to an extensive environmental reservoir. However, there was substantial variation in fungal load among sites with persisting colonies, suggesting that both tolerance and resistance developed at different sites in the same species. In contrast, one species disappeared from hibernacula within 3 yr of pathogen invasion. Variable host responses to pathogen invasion require different management strategies to prevent disease-induced extinction and to facilitate evolution of tolerance or resistance in persisting populations. © 2016 by the Ecological Society of America.

Host persistence or extinction from emerging infectious disease: insights from white-nose syndrome in endemic and invading regions

PubMed Central

Hoyt, Joseph R.; Langwig, Kate E.; Sun, Keping; Lu, Guanjun; Parise, Katy L.; Jiang, Tinglei; Foster, Jeffrey T.; Feng, Jiang; Kilpatrick, A. Marm

2016-01-01

Predicting species' fates following the introduction of a novel pathogen is a significant and growing problem in conservation. Comparing disease dynamics between introduced and endemic regions can offer insight into which naive hosts will persist or go extinct, with disease acting as a filter on host communities. We examined four hypothesized mechanisms for host–pathogen persistence by comparing host infection patterns and environmental reservoirs for Pseudogymnoascus destructans (the causative agent of white-nose syndrome) in Asia, an endemic region, and North America, where the pathogen has recently invaded. Although colony sizes of bats and hibernacula temperatures were very similar, both infection prevalence and fungal loads were much lower on bats and in the environment in Asia than North America. These results indicate that transmission intensity and pathogen growth are lower in Asia, likely due to higher host resistance to pathogen growth in this endemic region, and not due to host tolerance, lower transmission due to smaller populations, or lower environmentally driven pathogen growth rate. Disease filtering also appears to be favouring initially resistant species in North America. More broadly, determining the mechanisms allowing species persistence in endemic regions can help identify species at greater risk of extinction in introduced regions, and determine the consequences for disease dynamics and host–pathogen coevolution. PMID:26962138

Resistance in persisting bat populations after white-nose syndrome invasion.

PubMed

Langwig, Kate E; Hoyt, Joseph R; Parise, Katy L; Frick, Winifred F; Foster, Jeffrey T; Kilpatrick, A Marm

2017-01-19

Increases in anthropogenic movement have led to a rise in pathogen introductions and the emergence of infectious diseases in naive host communities worldwide. We combined empirical data and mathematical models to examine changes in disease dynamics in little brown bat (Myotis lucifugus) populations following the introduction of the emerging fungal pathogen Pseudogymnoascus destructans, which causes the disease white-nose syndrome. We found that infection intensity was much lower in persisting populations than in declining populations where the fungus has recently invaded. Fitted models indicate that this is most consistent with a reduction in the growth rate of the pathogen when fungal loads become high. The data are inconsistent with the evolution of tolerance or an overall reduced pathogen growth rate that might be caused by environmental factors. The existence of resistance in some persisting populations of little brown bats offers a glimmer of hope that a precipitously declining species will persist in the face of this deadly pathogen.This article is part of the themed issue 'Human influences on evolution, and the ecological and societal consequences'. © 2016 The Author(s).

Genetic characterization of poxviruses in Camelus dromedarius in Ethiopia, 2011-2014.

PubMed

Gelaye, Esayas; Achenbach, Jenna Elizabeth; Ayelet, Gelagay; Jenberie, Shiferaw; Yami, Martha; Grabherr, Reingard; Loitsch, Angelika; Diallo, Adama; Lamien, Charles Euloge

2016-10-01

Camelpox and camel contagious ecthyma are infectious viral diseases of camelids caused by camelpox virus (CMLV) and camel contagious ecthyma virus (CCEV), respectively. Even though, in Ethiopia, pox disease has been creating significant economic losses in camel production, little is known on the responsible pathogens and their genetic diversity. Thus, the present study aimed at isolation, identification and genetic characterization of the causative viruses. Accordingly, clinical case observations, infectious virus isolation, and molecular and phylogenetic analysis of poxviruses infecting camels in three regions and six districts in the country, Afar (Chifra), Oromia (Arero, Miyu and Yabello) and Somali (Gursum and Jijiga) between 2011 and 2014 were undertaken. The full hemagglutinin (HA) and partial A-type inclusion protein (ATIP) genes of CMLV and full major envelope protein (B2L) gene of CCEV of Ethiopian isolates were sequenced, analyzed and compared among each other and to foreign isolates. The viral isolation confirmed the presence of infectious poxviruses. The preliminary screening by PCR showed 27 CMLVs and 20 CCEVs. The sequence analyses showed that the HA and ATIP gene sequences are highly conserved within the local isolates of CMLVs, and formed a single cluster together with isolates from Somalia and Syria. Unlike CMLVs, the B2L gene analysis of Ethiopian CCEV showed few genetic variations. The phylogenetic analysis revealed three clusters of CCEV in Ethiopia with the isolates clustering according to their geographical origins. To our knowledge, this is the first report indicating the existence of CCEV in Ethiopia where camel contagious ecthyma was misdiagnosed as camelpox. Additionally, this study has also disclosed the existence of co-infections with CMLV and CCEV. A comprehensive characterization of poxviruses affecting camels in Ethiopia and the full genome sequencing of representative isolates are recommended to better understand the dynamics of pox diseases of camels and to assist in the implementation of more efficient control measures. Copyright © 2016 Elsevier B.V. All rights reserved.

Up-regulation of antioxidants in tobacco by low concentrations of H₂O₂ suppresses necrotic disease symptoms.

PubMed

Hafez, Yaser Mohamed; Bacsó, Renáta; Király, Zoltán; Künstler, András; Király, Lóránt

2012-09-01

Pretreatment of tobacco leaves with low concentrations (5 to 10 mM) of H₂O₂ suppressed hypersensitive-type necrosis associated with resistance to Tobacco mosaic virus (TMV) or Pseudomonas syringae pv. phaseolicola. The same pretreatment resulted in suppression of normosensitive necrosis associated with susceptibility to Botrytis cinerea. This type of H₂O₂-mediated, induced disease symptom resistance correlated with enhanced host antioxidant capacity, i.e., elevated enzymatic activities of catalase (CAT), ascorbate peroxidase (APX), and guaiacol peroxidase (POX) after viral and bacterial infections. Induction of genes that encode the antioxidants superoxide dismutase (SOD), CAT, and APX was also enhanced early after TMV infection. Artificial application of SOD and CAT suppressed necroses caused by viral, bacterial, or fungal pathogens similarly as H₂O₂ pretreatment, implying that H₂O₂-mediated symptom resistance operates through enhancement of plant antioxidant capacity. Pathogen multiplication was not significantly affected in H₂O₂-pretreated plants. Salicylic acid (SA), a central component of plant defense, does not seem to function in this type of H₂O₂-mediated symptom resistance, indicated by unchanged levels of free and bound SA and a lack of early up-regulation of an SA glucosyltransferase gene in TMV-infected H₂O₂-pretreated tobacco. Taken together, H₂O₂-mediated, induced resistance to necrotic symptoms in tobacco seems to depend on enhanced antioxidant capacity.

'GETTING' THE POX: Reflections by an Historian on How to Write the History of Early Modern Disease.

PubMed

Stein, Claudia

This article reflects upon the recent return to linear history writing in medical history. It takes as its starting point a critique of the current return to constructivist ideas, suggesting the use of other methodological choices and interpretations to the surviving archival and textural sources of the sixteenth century pox. My investigation analyses the diagnostic act as an effort to bring together a study of medical semiotics. Medical semiotics considers how signs speak through the physical body, coached within a particular epistemology. There are no hidden meanings behind the visible sign or symptom - it is tranparent to the calculative and authoritative gaze and language of the doctor. It concerns how diseases came into being, the relationships they have constituted, the power they have secured and the actual knowledge/power they have eclipsed or are eclipsing. From such a perspective, "getting the pox" is not a bad thing. A methodological turn to medical semiotics reminds us that the history of disease should be an inquiry both into the grounds of our current knowledge and beliefs about disease and how they inspire our writing, as well as the analytical categories that establish their inevitability.

Next Generation Hemostatic Materials Based on NHS-Ester Functionalized Poly(2-oxazoline)s.

PubMed

Boerman, Marcel A; Roozen, Edwin; Sánchez-Fernández, María José; Keereweer, Abraham R; Félix Lanao, Rosa P; Bender, Johan C M E; Hoogenboom, Richard; Leeuwenburgh, Sander C; Jansen, John A; Van Goor, Harry; Van Hest, Jan C M

2017-08-14

In order to prevent hemorrhage during surgical procedures, a wide range of hemostatic agents have been developed. However, their efficacy is variable; hemostatic devices that use bioactive components to accelerate coagulation are dependent on natural sources, which limits reproducibility. Hybrid devices in which chain-end reactive poly(ethylene glycol) is employed as active component sometimes suffer from irregular cross-linking and dissolution of the polar PEG when blood flow is substantial. Herein, we describe a synthetic, nonbioactive hemostatic product by coating N-hydroxysuccinimide ester (NHS)-functional poly(2-oxazoline)s (POx-NHS) onto gelatin patches, which acts by formation of covalent cross-links between polymer, host blood proteins, gelatin and tissue to seal the wound site and prevent hemorrhage during surgery. We studied different process parameters (including polymer, carrier, and coating technique) in direct comparison with clinical products (Hemopatch and Tachosil) to obtain deeper understanding of this class of hemostatic products. In this work, we successfully prove the hemostatic efficacy of POx-NHS as polymer powders and coated patches both in vitro and in vivo against Hemopatch and Tachosil, demonstrating that POx-NHS are excellent candidate polymers for the development of next generation hemostatic patches.

Nanoarmored Enzymes for Organic Enzymology: Synthesis and Characterization of Poly(2-Alkyloxazoline)-Enzyme Conjugates.

PubMed

Leurs, Melanie; Tiller, Joerg C

2017-01-01

The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.

Investigation of a Possible Link Between Vaccination and the 2010 Sheep Pox Epizootic in Morocco.

PubMed

Haegeman, A; Zro, K; Sammin, D; Vandenbussche, F; Ennaji, M M; De Clercq, K

2016-12-01

Sheep pox is endemic in most parts of Northern Africa and has the potential to cause severe economic problems. Live attenuated vaccines are used in Morocco, and in many other countries, to control the disease. Sheep pox virus (SPPV) re-appeared in 2010 causing a nodular clinical form previously not observed in Morocco. The severe clinical signs observed during the course of this outbreak and initial reports citing similarity in nucleotide sequence between the Moroccan vaccine strain and field isolates warranted a more in depth analysis of this epizootic. In this study, sequence analysis showed that isolates obtained from four provinces of eastern Morocco were identical, demonstrating that a single SPPV strain was responsible for the 2010 epizootic. In addition, the genome fragments sequenced and phylogenetic analyses undertaken as part of this study showed significant differences between field isolates and the Moroccan vaccine strain. New PCR methods were developed to differentiate between wild-type isolates and vaccine strains of SPPV. Using these methods, no trace of wild-type SPPV was found in the vaccine and no evidence was found to suggest that the vaccine strain was causing clinical disease. © 2015 Blackwell Verlag GmbH.

[Followup of chicken pox keratitis. Anatomic-clinical case report].

PubMed

D'hermies, F; Ellies, P; Meyer, A; Halhal, M; Morel, X; Behar-Cohen, F; Renard, G; Dighiero, P

2002-09-01

Chicken pox is a very common infectious disease in children. Its corneal involvement is less serious than with measles, which may lead to blindness in numerous developing countries. However, with occasional cases occur. A case of a 59-year-old male patient whose left cornea was involved during a chicken pox infection at the age of 7 is reported. More recently, the vision of the right eye was normal at 20/20 and reduced to visual perception in the affected left eye. Corneal sensitivity was maintained in the left eye, which, however exhibited a central epithelial defect. A central round opacity of the left corneal stroma was believed to be the scar resulting from a previous disciform keratitis. The left central cornea was thinned and there was neither an anterior chamber flare nor new corneal vessels. This corneal condition required a corneal allograft, performed quickly because of the potential risk of perforation. Histopathological study of the corneal button showed a central corneal thinning with an increase in epithelial thickness. The corneal stroma was disorganized, with irregular collagen bundles. No inflammatory cells could be observed, however. All the histopathological changes observed were those of a corneal scar.

Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering

PubMed Central

Karimova, Madina; Splith, Victoria; Karpinski, Janet; Pisabarro, M. Teresa; Buchholz, Frank

2016-01-01

Precise genome engineering is instrumental for biomedical research and holds great promise for future therapeutic applications. Site-specific recombinases (SSRs) are valuable tools for genome engineering due to their exceptional ability to mediate precise excision, integration and inversion of genomic DNA in living systems. The ever-increasing complexity of genome manipulations and the desire to understand the DNA-binding specificity of these enzymes are driving efforts to identify novel SSR systems with unique properties. Here, we describe two novel tyrosine site-specific recombination systems designated Nigri/nox and Panto/pox. Nigri originates from Vibrio nigripulchritudo (plasmid VIBNI_pA) and recombines its target site nox with high efficiency and high target-site selectivity, without recombining target sites of the well established SSRs Cre, Dre, Vika and VCre. Panto, derived from Pantoea sp. aB, is less specific and in addition to its native target site, pox also recombines the target site for Dre recombinase, called rox. This relaxed specificity allowed the identification of residues that are involved in target site selectivity, thereby advancing our understanding of how SSRs recognize their respective DNA targets. PMID:27444945

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

Treesearch

Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

2014-01-01

Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

Preparing the landscape for invasion - Early intervention approaches for threatened high elevation white pine ecosystems

Treesearch

Anna W. Schoettle; Richard A. Sniezko; Kelly S. Burns; Freeman Floyd

2007-01-01

White pine blister rust is now a permanent resident of North America. The disease continued to cause tree mortality and impact ecosystems in many areas. However, not all high elevation white pine ecosystems have been invaded; the pathogen is still spreading within the distributions of the whitebark, limber, foxtail, Rocky Mountain bristlecone pine and has yet to infect...

New insights into Escherichia coli metabolism: carbon scavenging, acetate metabolism and carbon recycling responses during growth on glycerol

PubMed Central

2012-01-01

Background Glycerol has enhanced its biotechnological importance since it is a byproduct of biodiesel synthesis. A study of Escherichia coli physiology during growth on glycerol was performed combining transcriptional-proteomic analysis as well as kinetic and stoichiometric evaluations in the strain JM101 and certain derivatives with important inactivated genes. Results Transcriptional and proteomic analysis of metabolic central genes of strain JM101 growing on glycerol, revealed important changes not only in the synthesis of MglB, LamB and MalE proteins, but also in the overexpression of carbon scavenging genes: lamB, malE, mglB, mglC, galP and glk and some members of the RpoS regulon (pfkA, pfkB, fbaA, fbaB, pgi, poxB, acs, actP and acnA). Inactivation of rpoS had an important effect on stoichiometric parameters and growth adaptation on glycerol. The observed overexpression of poxB, pta, acs genes, glyoxylate shunt genes (aceA, aceB, glcB and glcC) and actP, suggested a possible carbon flux deviation into the PoxB, Acs and glyoxylate shunt. In this scenario acetate synthesized from pyruvate with PoxB was apparently reutilized via Acs and the glyoxylate shunt enzymes. In agreement, no acetate was detected when growing on glycerol, this strain was also capable of glycerol and acetate coutilization when growing in mineral media and derivatives carrying inactivated poxB or pckA genes, accumulated acetate. Tryptophanase A (TnaA) was synthesized at high levels and indole was produced by this enzyme, in strain JM101 growing on glycerol. Additionally, in the isogenic derivative with the inactivated tnaA gene, no indole was detected and acetate and lactate were accumulated. A high efficiency aromatic compounds production capability was detected in JM101 carrying pJLBaroGfbrtktA, when growing on glycerol, as compared to glucose. Conclusions The overexpression of several carbon scavenging, acetate metabolism genes and the absence of acetate accumulation occurred in JM101 cultures growing on glycerol. To explain these results it is proposed that in addition to the glycolytic metabolism, a gluconeogenic carbon recycling process that involves acetate is occurring simultaneously in this strain when growing on glycerol. Carbon flux from glycerol can be efficiently redirected in JM101 strain into the aromatic pathway using appropriate tools. PMID:22513097

Draft Genome Sequences of Human Pathogenic Fungus Geomyces pannorum Sensu Lato and Bat White Nose Syndrome Pathogen Geomyces (Pseudogymnoascus) destructans.

PubMed

Chibucos, Marcus C; Crabtree, Jonathan; Nagaraj, Sushma; Chaturvedi, Sudha; Chaturvedi, Vishnu

2013-12-19

We report the draft genome sequences of Geomyces pannorum sensu lato and Geomyces (Pseudogymnoascus) destructans. G. pannorum has a larger proteome than G. destructans, containing more proteins with ascribed enzymatic functions. This dichotomy in the genomes of related psychrophilic fungi is a valuable target for defining their distinct saprobic and pathogenic attributes.

Extreme sensitivity to ultraviolet light in the fungal pathogen causing white-nose syndrome of bats.

PubMed

Palmer, Jonathan M; Drees, Kevin P; Foster, Jeffrey T; Lindner, Daniel L

2018-01-02

Bat white-nose syndrome (WNS), caused by the fungal pathogen Pseudogymnoascus destructans, has decimated North American hibernating bats since its emergence in 2006. Here, we utilize comparative genomics to examine the evolutionary history of this pathogen in comparison to six closely related nonpathogenic species. P. destructans displays a large reduction in carbohydrate-utilizing enzymes (CAZymes) and in the predicted secretome (~50%), and an increase in lineage-specific genes. The pathogen has lost a key enzyme, UVE1, in the alternate excision repair (AER) pathway, which is known to contribute to repair of DNA lesions induced by ultraviolet (UV) light. Consistent with a nonfunctional AER pathway, P. destructans is extremely sensitive to UV light, as well as the DNA alkylating agent methyl methanesulfonate (MMS). The differential susceptibility of P. destructans to UV light in comparison to other hibernacula-inhabiting fungi represents a potential "Achilles' heel" of P. destructans that might be exploited for treatment of bats with WNS.

Light quality influences the virulence and physiological responses of Colletotrichum acutatum causing anthracnose in pepper plants.

PubMed

Yu, S-M; Ramkumar, G; Lee, Y H

2013-08-01

To explore the effects of light quality on the physiology and pathogenicity of Colletotrichum acutatum, we analysed the morphological traits, melanin production and virulence of the pathogen under different light wavelengths. The influence of light wavelength on the mycelial growth and conidial germination of C. acutatum was investigated using red, green, blue and white light sources. Red and green light reduced the mycelial growth in comparison with blue and white light, and dark conditions. The least percentage of conidial germination was observed under blue light, while the germination rate among white, red and green light, as well as in the dark, was insignificant. In comparison with its influence on mycelial growth and conidial germination, light wavelength significantly affected the pathogen's virulence towards hot pepper fruits. The highest disease severity was observed under blue light, which was at least a twofold increase compared with the disease severity under other light conditions. To elucidate the effect of light on the disparity in virulence, scytalone was assayed by HPLC, and scd1 gene expression was examined with real-time PCR. The highest and lowest scytalone production was observed in the cultures incubated under blue (10.9 mAU) and green light (1.5 mAU), respectively. Higher scd1 gene expression (~ 40-fold increase) was observed in cultures incubated under blue and white light in comparison with those incubated in the dark. This study revealed that light affects the growth, colonial morphology and virulence of C. acutatum. The pathogen needs light for its active melanin production and also to attain higher virulence. This is the first report on the effect of light quality on the virulence of C. acutatum. The findings of this study will broaden our knowledge of the influence of light on physiological responses of fungal pathogens. © 2013 The Society for Applied Microbiology.

The pathogen-occupied vacuoles of anaplasma phagocytophilum and anaplasma marginale interact with the endoplasmic reticulum

USDA-ARS?s Scientific Manuscript database

The genus Anaplasma consists of tick-transmitted obligate intracellular bacteria that invade white or red blood cells to cause debilitating and potentially fatal infections. A. phagocytophilum, a human and veterinary pathogen, infects neutrophils to cause granulocytic anaplasmosis. A. marginale inva...

Mycological examinations on the fungal flora of the chicken comb.

PubMed

Gründer, S; Mayser, P; Redmann, T; Kaleta, E F

2005-03-01

A total of 500 combs of adult chickens from two different locations in Germany (Hessen and Schleswig-Holstein) were clinically and mycologically examined. The chickens came from three battery cages (n = 79), one voliere system (n=32), six flocks maintained on deep litter (n = 69) and 12 flocks kept on free outdoor range (n=320). Twenty-two of the 500 chicken combs (4.4%) were found to have clinical signs: only non-specific lesions neither typical of mycosis nor of avian pox such as desquamation with crust formation, yellow to brown or black dyschromic changes, alopecia in the surrounding area and moist inflammation. Only seven of the 22 clinically altered combs showed a positive mycological result; the non-pathogenic and geophilic Trichophyton terrestre in one case and non-pathogenic yeast in six cases. The following fungi were seen in the different housing systems: 13 dermatophytes (2.6% of 500 samples): 12 x T. terrestre, 1 x Trichophyton mentagrophytes, 11 isolates of Chrysosporium georgiae (2.2% of 500 samples) and 149 isolates of yeasts (29.8%): Malassezia sympodialis: n = 52, Kloeckera apiculata: n = 33, Trichosporon capitatum (syn. Geotrichum capitatum): n = 23, Trichosporon cutaneum/Trichosporon mucoides: n = 12, Trichosporon inkin (syn. Sarcinosporon inkin): n = 8 and Candida spp.: n = 21, including pathogenic or possibly pathogenic species: Candida albicans: n = 3, Candida famata: n = 4, Candida guilliermondii: n = 3, Candida lipolytica: n = 3, Candida dattila: n = 2 and one isolate each of Candida glabrata, Candida parapsilosis, Candida aaseri, Candida catenulata sive brumpti, Candida fructus and Candida kefyr sive pseudotropicalis. There is no stringent correlation between the clinical symptoms diagnosed on the chicken combs and the species of yeasts isolated. The causative agent of favus in chickens, Trichophyton gallinae, and the saprophytic yeast in pigeons, Cr. neoformans were not isolated. The most frequently isolated yeasts M. sympodialis and Kloeckera apiculata are suggested to be classified as members of the resident flora of the chicken comb.

Gene gain and loss during evolution of obligate parasitism in the white rust pathogen of Arabidopsis thaliana.

PubMed

Kemen, Eric; Gardiner, Anastasia; Schultz-Larsen, Torsten; Kemen, Ariane C; Balmuth, Alexi L; Robert-Seilaniantz, Alexandre; Bailey, Kate; Holub, Eric; Studholme, David J; Maclean, Dan; Jones, Jonathan D G

2011-07-01

Biotrophic eukaryotic plant pathogens require a living host for their growth and form an intimate haustorial interface with parasitized cells. Evolution to biotrophy occurred independently in fungal rusts and powdery mildews, and in oomycete white rusts and downy mildews. Biotroph evolution and molecular mechanisms of biotrophy are poorly understood. It has been proposed, but not shown, that obligate biotrophy results from (i) reduced selection for maintenance of biosynthetic pathways and (ii) gain of mechanisms to evade host recognition or suppress host defence. Here we use Illumina sequencing to define the genome, transcriptome, and gene models for the obligate biotroph oomycete and Arabidopsis parasite, Albugo laibachii. A. laibachii is a member of the Chromalveolata, which incorporates Heterokonts (containing the oomycetes), Apicomplexa (which includes human parasites like Plasmodium falciparum and Toxoplasma gondii), and four other taxa. From comparisons with other oomycete plant pathogens and other chromalveolates, we reveal independent loss of molybdenum-cofactor-requiring enzymes in downy mildews, white rusts, and the malaria parasite P. falciparum. Biotrophy also requires "effectors" to suppress host defence; we reveal RXLR and Crinkler effectors shared with other oomycetes, and also discover and verify a novel class of effectors, the "CHXCs", by showing effector delivery and effector functionality. Our findings suggest that evolution to progressively more intimate association between host and parasite results in reduced selection for retention of certain biosynthetic pathways, and particularly reduced selection for retention of molybdopterin-requiring biosynthetic pathways. These mechanisms are not only relevant to plant pathogenic oomycetes but also to human pathogens within the Chromalveolata.

Gene Gain and Loss during Evolution of Obligate Parasitism in the White Rust Pathogen of Arabidopsis thaliana

PubMed Central

Kemen, Eric; Gardiner, Anastasia; Schultz-Larsen, Torsten; Kemen, Ariane C.; Balmuth, Alexi L.; Robert-Seilaniantz, Alexandre; Bailey, Kate; Holub, Eric; Studholme, David J.; MacLean, Dan; Jones, Jonathan D. G.

2011-01-01

Biotrophic eukaryotic plant pathogens require a living host for their growth and form an intimate haustorial interface with parasitized cells. Evolution to biotrophy occurred independently in fungal rusts and powdery mildews, and in oomycete white rusts and downy mildews. Biotroph evolution and molecular mechanisms of biotrophy are poorly understood. It has been proposed, but not shown, that obligate biotrophy results from (i) reduced selection for maintenance of biosynthetic pathways and (ii) gain of mechanisms to evade host recognition or suppress host defence. Here we use Illumina sequencing to define the genome, transcriptome, and gene models for the obligate biotroph oomycete and Arabidopsis parasite, Albugo laibachii. A. laibachii is a member of the Chromalveolata, which incorporates Heterokonts (containing the oomycetes), Apicomplexa (which includes human parasites like Plasmodium falciparum and Toxoplasma gondii), and four other taxa. From comparisons with other oomycete plant pathogens and other chromalveolates, we reveal independent loss of molybdenum-cofactor-requiring enzymes in downy mildews, white rusts, and the malaria parasite P. falciparum. Biotrophy also requires “effectors” to suppress host defence; we reveal RXLR and Crinkler effectors shared with other oomycetes, and also discover and verify a novel class of effectors, the “CHXCs”, by showing effector delivery and effector functionality. Our findings suggest that evolution to progressively more intimate association between host and parasite results in reduced selection for retention of certain biosynthetic pathways, and particularly reduced selection for retention of molybdopterin-requiring biosynthetic pathways. These mechanisms are not only relevant to plant pathogenic oomycetes but also to human pathogens within the Chromalveolata. PMID:21750662

Ecology of whitebark pine populations in relation to white pine blister rust infection in subalpine forests of the Lake Tahoe Basin: Implications for restoration

Treesearch

Patricia E. Maloney; Detlev R. Vogler; Camille E. Jensen; Annette Delfino Mix

2012-01-01

For over a century, white pine blister rust (WPBR), caused by the introduced fungal pathogen, Cronartium ribicola J.C. Fisch., has affected white pine (Subgenus Strobus) individuals, populations, and associated forest communities in North America. We surveyed eight populations of whitebark pine (Pinus albicaulis Engelm.) across a range of environmental conditions in...

Host persistence or extinction from emerging infectious disease: insights from white-nose syndrome in endemic and invading regions.

PubMed

Hoyt, Joseph R; Langwig, Kate E; Sun, Keping; Lu, Guanjun; Parise, Katy L; Jiang, Tinglei; Frick, Winifred F; Foster, Jeffrey T; Feng, Jiang; Kilpatrick, A Marm

2016-03-16

Predicting species' fates following the introduction of a novel pathogen is a significant and growing problem in conservation. Comparing disease dynamics between introduced and endemic regions can offer insight into which naive hosts will persist or go extinct, with disease acting as a filter on host communities. We examined four hypothesized mechanisms for host-pathogen persistence by comparing host infection patterns and environmental reservoirs for Pseudogymnoascus destructans (the causative agent of white-nose syndrome) in Asia, an endemic region, and North America, where the pathogen has recently invaded. Although colony sizes of bats and hibernacula temperatures were very similar, both infection prevalence and fungal loads were much lower on bats and in the environment in Asia than North America. These results indicate that transmission intensity and pathogen growth are lower in Asia, likely due to higher host resistance to pathogen growth in this endemic region, and not due to host tolerance, lower transmission due to smaller populations, or lower environmentally driven pathogen growth rate. Disease filtering also appears to be favouring initially resistant species in North America. More broadly, determining the mechanisms allowing species persistence in endemic regions can help identify species at greater risk of extinction in introduced regions, and determine the consequences for disease dynamics and host-pathogen coevolution. © 2016 The Author(s).

Draft Genome Sequences of Human Pathogenic Fungus Geomyces pannorum Sensu Lato and Bat White Nose Syndrome Pathogen Geomyces (Pseudogymnoascus) destructans

PubMed Central

Crabtree, Jonathan; Nagaraj, Sushma; Chaturvedi, Sudha

2013-01-01

We report the draft genome sequences of Geomyces pannorum sensu lato and Geomyces (Pseudogymnoascus) destructans. G. pannorum has a larger proteome than G. destructans, containing more proteins with ascribed enzymatic functions. This dichotomy in the genomes of related psychrophilic fungi is a valuable target for defining their distinct saprobic and pathogenic attributes. PMID:24356829

Enterocytozoon bieneusi, Giardia and Cryptosporidium infecting white-tailed deer

USDA-ARS?s Scientific Manuscript database

Despite a white-tailed deer (WTD) population in the United States of approximately 32 million animals extremely little is known of the prevalence and species of the protists that infect these animals. The present study was undertaken to determine the presence of potential human protist pathogens in ...

Sporulation capacity and longevity of Puccinia horiana teliospores in infected chrysanthemum leaves

USDA-ARS?s Scientific Manuscript database

PUCCINIA HORIANA is a quarantine-significant fungal pathogen and causal agent of Chrysanthemum white rust, first discovered in the U.S. in 1977. The disease was eradicated and for many years successfully controlled by fungicides and strict regulatory measures. However, recently Chrysanthemum white r...

Response of white peach scale to metabolic stress disinfection and disinfestation (MSDD) treatment

USDA-ARS?s Scientific Manuscript database

Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment that combines short periods of low pressure (vacuum) and high CO2 with ethanol vapor to control pathogens and arthropod pests on commodities. The system was tested against white peach scale, Pseudaulacaspis pentagona ...

Dietary supplementation with white button mushroom augments the protective immune response to Salmonella vaccine in mice

USDA-ARS?s Scientific Manuscript database

We previously showed that dietary white button mushrooms (WBM) enhanced natural killer cell activity and that in vitro WBM supplementation promotes maturation and function of dendritic cells (DC). The current study investigated whether WBM consumption would enhance pathogen-specific immune response ...

A holistic approach to genetic conservation of Pinus strobiformis

Treesearch

K.M. Waring; R. Sniezko; B.A. Goodrich; C. Wehenkel; J.J. Jacobs

2017-01-01

Pinus strobiformis (southwestern white pine) is threatened by both a rapidly changing climate and the tree disease white pine blister rust, caused by an introduced fungal pathogen, Cronartium ribicola. We began a proactive program in ~2009 to sustain P. strobiformis that includes genetic conservation, research, and management strategies. Research...

Dynamic analysis of growth of Salmonella Enteritidis in liquid egg whites

USDA-ARS?s Scientific Manuscript database

Salmonella Enteritidis (SE) is a common foodborne pathogen associated with eggs and egg products. This research was conducted to study the kinetics of growth and survival of SE in liquid egg whites (LEW). A dynamic temperature profile that exposed SE to suboptimal temperatures and below the minimu...

Evaluation of pathogen-specific biomarkers for the diagnosis of tuberculosis in white-tailed deer (Odocoileus virginianus)

USDA-ARS?s Scientific Manuscript database

Objective - To develop a noninvasive biomarker based Mycobacterium bovis specific detection system to track infection in domestic and wild animals. Design – Experimental longitudinal study for discovery and cross sectional design for validation Animals - Yearling white-tailed deer fawns (n=8) were ...

Impaired Chloroplast Biogenesis in Immutans, an Arabidopsis Variegation Mutant, Modifies Developmental Programming, Cell Wall Composition and Resistance to Pseudomonas syringae.

PubMed

Pogorelko, Gennady V; Kambakam, Sekhar; Nolan, Trevor; Foudree, Andrew; Zabotina, Olga A; Rodermel, Steven R

2016-01-01

The immutans (im) variegation mutation of Arabidopsis has green- and white- sectored leaves due to action of a nuclear recessive gene. IM codes for PTOX, a plastoquinol oxidase in plastid membranes. Previous studies have revealed that the green and white sectors develop into sources (green tissues) and sinks (white tissues) early in leaf development. In this report we focus on white sectors, and show that their transformation into effective sinks involves a sharp reduction in plastid number and size. Despite these reductions, cells in the white sectors have near-normal amounts of plastid RNA and protein, and surprisingly, a marked amplification of chloroplast DNA. The maintenance of protein synthesis capacity in the white sectors might poise plastids for their development into other plastid types. The green and white im sectors have different cell wall compositions: whereas cell walls in the green sectors resemble those in wild type, cell walls in the white sectors have reduced lignin and cellulose microfibrils, as well as alterations in galactomannans and the decoration of xyloglucan. These changes promote susceptibility to the pathogen Pseudomonas syringae. Enhanced susceptibility can also be explained by repressed expression of some, but not all, defense genes. We suggest that differences in morphology, physiology and biochemistry between the green and white sectors is caused by a reprogramming of leaf development that is coordinated, in part, by mechanisms of retrograde (plastid-to-nucleus) signaling, perhaps mediated by ROS. We conclude that variegation mutants offer a novel system to study leaf developmental programming, cell wall metabolism and host-pathogen interactions.

Occurrence and characterization of plum pox virus strain D isolates from European Russia and Crimea.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna; Kudryavtseva, Anna; Prikhodko, Yuri; Mitrofanova, Irina

2016-02-01

Numerous plum pox virus (PPV) strain D isolates have been found in geographically distant regions of European Russia and the Crimean peninsula on different stone fruit hosts. Phylogenetic analysis of their partial and complete genomes suggests multiple introductions of PPV-D into Russia. Distinct natural isolates from Prunus tomentosa were found to bear unique amino acid substitutions in the N-terminus of the coat protein (CP) that may contribute to the adaptation of PPV-D to this host. Serological analysis using the PPV-D-specific monoclonal antibody 4DG5 provided further evidence that mutations at positions 58 and 59 of the CP are crucial for antibody binding.

Large Cellular Inclusions Accumulate in Arabidopsis Roots Exposed to Low-Sulfur Conditions1[OPEN

PubMed Central

Popov, Vladimir A.; Mathur, Jaideep; Benfey, Philip N.

2015-01-01

Sulfur is vital for primary and secondary metabolism in plant roots. To understand the molecular and morphogenetic changes associated with loss of this key macronutrient, we grew Arabidopsis (Arabidopsis thaliana) seedlings in low-sulfur conditions. These conditions induced a cascade of cellular events that converged to produce a profound intracellular phenotype defined by large cytoplasmic inclusions. The inclusions, termed low-sulfur Pox, show cell type- and developmental zone-specific localization. Transcriptome analysis suggested that low sulfur causes dysfunction of the glutathione/ascorbate cycle, which reduces flavonoids. Genetic and biochemical evidence indicated that low-sulfur Pox are the result of peroxidase-catalyzed oxidation of quercetin in roots grown under sulfur-depleted conditions. PMID:26099270

H9N2 influenza A virus isolated from a Greater White-fronted wild goose (Anser albifrons) in Alaska has a mutation in the PB2 gene, which is associated with pathogenicity in human pandemic 2009 H1N1

USGS Publications Warehouse

Reeves, Andrew; Ip, Hon S.

2016-01-01

We report here the genomic sequence of an H9N2 influenza A virus [A/greater white-fronted goose/Alaska/81081/2008 (H9N2)]. This virus shares ≥99.8% identity with a previously reported virus. Both strains contain a G590S mutation in the polymerase basic 2 (PB2) gene, which is a pathogenicity marker in the pandemic 2009 H1N1 virus when combined with R591.

First report of the white pine blister rust fungus, Cronartium ribicola, infecting Pinus flexilis on Pine Mountain, Humboldt National Forest, Elko County, northeastern Nevada, U.S.A.

Treesearch

Detlev R. Vogler; Patricia E. Maloney; Tom Burt; Jacob W. Snelling

2017-01-01

In 2013, while surveying for five-needle white pine cone crops in northeastern Nevada, we observed white pine blister rust, caused by the rust pathogen Cronartium ribicola Fisch., infecting branches and stems of limber pines (Pinus flexilis James) on Pine Mountain (41.76975°N, 115.61622°W), Humboldt National Forest,...

Pox 186: A Nearby Protogalaxy?

NASA Astrophysics Data System (ADS)

Corbin, Michael

1999-07-01

Blue Compact Dwarf Galaxies {BCDGs} typically consist of clusters of early-type stars embedded in older, evolved stellar populations similar in size and shape to normal dwarf ellipticals. However, deep ground-based CCD images of one faint BCDG, Pox 186, reveal a very compact { 5" diameter} structure with no evidence of an underlying older population. Optical spectroscopy of this object also indicates that a large number of Wolf-Rayet stars are present, which implies that a burst of star formation must have occurred very recently {<=sssim 10^7 years ago}. It has thus been suggested that Pox 186 is a protogalaxy, forming its very first generation of stars. Further investigation of this possibility requires the high angular resolution and ultraviolet spectral coverage that only HST can provide. Using WFPC2, we propose to image the galaxy in the U, V, and I bands, in order to better test for the presence of an underlying evolved population and to reveal any substructure in its star-forming regions. Using STIS, we will obtain low-resolution ultraviolet spectra of the galaxy for combination with ground-based spectra covering the optical through near infrared. This will allow us to determine its spectral energy distribution, metallicity, and dust content, which will in turn constrain its age and star formation history.

Efficiency gain of solid oxide fuel cell systems by using anode offgas recycle - Results for a small scale propane driven unit

NASA Astrophysics Data System (ADS)

Dietrich, Ralph-Uwe; Oelze, Jana; Lindermeir, Andreas; Spitta, Christian; Steffen, Michael; Küster, Torben; Chen, Shaofei; Schlitzberger, Christian; Leithner, Reinhard

The transfer of high electrical efficiencies of solid oxide fuel cells (SOFC) into praxis requires appropriate system concepts. One option is the anode-offgas recycling (AOGR) approach, which is based on the integration of waste heat using the principle of a chemical heat pump. The AOGR concept allows a combined steam- and dry-reforming of hydrocarbon fuel using the fuel cell products steam and carbon dioxide. SOFC fuel gas of higher quantity and quality results. In combination with internal reuse of waste heat the system efficiency increases compared to the usual path of partial oxidation (POX). The demonstration of the AOGR concept with a 300 Wel-SOFC stack running on propane required: a combined reformer/burner-reactor operating in POX (start-up) and AOGR modus; a hotgas-injector for anode-offgas recycling to the reformer; a dynamic process model; a multi-variable process controller; full system operation for experimental proof of the efficiency gain. Experimental results proof an efficiency gain of 18 percentage points (η·POX = 23%, η·AOGR = 41%) under idealized lab conditions. Nevertheless, further improvements of injector performance, stack fuel utilization and additional reduction of reformer reformer O/C ratio and system pressure drop are required to bring this approach into self-sustaining operation.

Long Term Persistence of IgE Anti-Varicella Zoster Virus in Pediatric and Adult Serum Post Chicken Pox Infection and after Vaccination with Varicella Virus Vaccine.

PubMed

Smith-Norowitz, Tamar A; Josekutty, Joby; Silverberg, Jonathan I; Lev-Tov, Hadar; Norowitz, Yitzchok M; Kohlhoff, Stephan; Nowakowski, Maja; Durkin, Helen G; Bluth, Martin H

2009-12-01

The production of IgE specific to different viruses (HIV-1, Parvovirus B19, RSV), and the ability for IgE anti-HIV-1 to suppress HIV-1 production in vitro, strongly suggest an important role for IgE and/or anti viral specific IgE in viral pathogenesis. Previous studies in our laboratory were the first to report the presence of IgE anti-varicella zoster virus (VZV) in an adolescent patient with shingles. However, the presence and long term persistence of IgE anti VZV antibodies has not been studied in adults. The presence of serum IgE in addition to IgE and IgG anti-VZV antibody in sera were studied in children (N=12) (0-16 y/o) and adults (N=9) (32-76 y/o) with either a past history of (wild type) chicken pox (N=7 children, 9 adults) or 5 years after vaccination with varicella zoster (N=2 children) (Varicella virus vaccine live, Oka/Merck), as well as in non-infected subjects (N=3 children). Of the patients who had a positive history of chicken pox 13 of 16 (81%) contained IgE anti-VZV antibodies; they were both serum IgEHi (>100 IU/ml) and IgELo (<100 IU/ml). Of the patients who were vaccinated, IgE anti-VZV antibodies were undetected. In contrast, serum from the patients without a history of chicken pox or vaccination did not make either IgE or IgG anti-VZV antibodies. This is the first demonstration of the existence of IgE anti-VZV antibodies, and its long-term persistence in serum of previously infected subjects. Future studies regarding the functional role of anti-viral IgE and its relationship to VZV are warranted.

Rooting response of azalea cultivars to hot water treatment used for pathogen conrol

USDA-ARS?s Scientific Manuscript database

Submerging terminal leafy cuttings of Rhododendron L. 'Gumpo White' ('Gumpo White' azalea) in 50 °C water for 21 min was previously shown to eliminate binucleate Rhizoctonia species, the cause of azalea web blight, from plant tissues. Prior to considering commercial use of this practice, a better un...

Tracking the footsteps of an invasive plant pathogen: Intercontinental phylogeographic structure of the white-pine-blister-rust fungus, Cronartium ribicola

Treesearch

Bryce A. Richardson; Mee-Sook Kim; Ned B. Klopfenstein; Yuko Ota; Kwan Soo Woo; Richard C. Hamelin

2009-01-01

Presently, little is known about the worldwide genetic structure, diversity, or evolutionary relationships of the white-pineblister-rust fungus, Cronartium ribicola. A collaborative international effort is underway to determine the phylogeographic relationships among Asian, European, and North American sources of C. ribicola and...

Recent change in the nomenclature of Phellinus pini: What is Porodaedalea?

Treesearch

Jessie A. Glaeser; Karen K. Nakasone

2010-01-01

The white-rot genus Phellinus contains many important forest pathogens and saprotrophs, including those that produce heartrot, saprot, and root-rot or butt-rot. One of the most notorious species is Phellinus pini, the causal agent of "red ring decay" or "white fleck," which primarily affects older stands of...

White-Nose Syndrome Fungus in a 1918 Bat Specimen from France.

PubMed

Campana, Michael G; Kurata, Naoko P; Foster, Jeffrey T; Helgen, Lauren E; Reeder, DeeAnn M; Fleischer, Robert C; Helgen, Kristofer M

2017-09-01

White-nose syndrome, first diagnosed in North America in 2006, causes mass deaths among bats in North America. We found the causative fungus, Pseudogymnoascus destructans, in a 1918 sample collected in Europe, where bats have now adapted to the fungus. These results are consistent with a Eurasian origin of the pathogen.

White-nose syndrome pathology grading in Nearctic and Palearctic bats

Treesearch

Jiri Pikula; Sybill K. Amelon; Hana Bandouchova; Tomáš Bartonička; Hana Berkova; Jiri Brichta; Sarah Hooper; Tomasz Kokurewicz; Miroslav Kolarik; Bernd Köllner; Veronika Kovacova; Petr Linhart; Vladimir Piacek; Gregory G. Turner; Jan Zukal; Natália Martínková; Sharon Swartz

2017-01-01

While white-nose syndrome (WNS) has decimated hibernating bat populations in the Nearctic, species from the Palearctic appear to cope better with the fungal skin infection causing WNS. This has encouraged multiple hypotheses on the mechanisms leading to differential survival of species exposed to the same pathogen. To facilitate intercontinental comparisons, we...

A summary of white pine blister rust research in the Lake States.

Treesearch

Ralph L. Anderson

1973-01-01

Summarizes white pine blister rust research in the Lake States and present status of knowledge. Important microclimatic relations are described. Antibiotics are not effective, whereas pruning provides some control. Genetic resistance shows much promise but may be complicated by pathogenic races. The effectiveness of ribes eradication is open to question.

Pedicularis and Castilleja are natural hosts of Cronartium ribicola in North America: A first report

Treesearch

Geral I. McDonald; Bryce A. Richardson; Paul J. Zambino; Ned B. Klopfenstein; Mee-Sook Kim

2006-01-01

White pine blister rust disease, caused by the introduced pathogen Cronartium ribicola, has severely disrupted five-needled pine ecosystems in North America. A 100-year effort to manage this disease was predicated in part on the premise that the pathogen utilizes only species of Ribes (Grossulariaceae) as...

Evidence of Powassan/deer tick virus in adult black-legged ticks (Ixodes scapularis) recovered from hunter-harvested white-tailed deer (Odocoileus virginianus) in Pennsylvania: A public health perspective.

PubMed

Campagnolo, E R; Tewari, D; Farone, T S; Livengood, J L; Mason, K L

2018-04-29

Studies reporting tick infection rates for Powassan virus (POWV), an emerging zoonotic arthropod-borne pathogen responsible for POWV disease in the Commonwealth of Pennsylvania, are limited. To determine the presence and ascertain a statewide prevalence of POWV, ticks were collected from 9,912 hunter-harvested white-tailed deer (Odocoileus virginianus) heads presented to six regional Pennsylvania Game Commission Chronic Wasting Disease sampling stations in early December of 2013, 2014 and 2015. Of the 2,973 ticks recovered, 1,990 (66.9%) were identified as adult Ixodes scapularis (black-legged tick). The 1,990 I. scapularis ticks were PCR-tested for the presence of POWV. The ticks had a statewide Powassan/deer tick virus infection rate of 0.05%, providing evidence of this pathogen in Pennsylvania's adult I. scapularis ticks and supporting the need for more comprehensive pathogen prevalence assessment strategies, as well as increased public health awareness for this emerging zoonotic arthropod-borne pathogen of public health concern. © 2018 Blackwell Verlag GmbH.

The importance of drought-pathogen interactions in driving oak mortality events in the Ozark Border Region

NASA Astrophysics Data System (ADS)

Wood, Jeffrey D.; Knapp, Benjamin O.; Muzika, Rose-Marie; Stambaugh, Michael C.; Gu, Lianhong

2018-01-01

Forests are expected to become more vulnerable to drought-induced tree mortality owing to rising temperatures and changing precipitation patterns that amplify drought lethality. There is a crucial knowledge gap regarding drought-pathogen interactions and their effects on tree mortality. The objectives of this research were to examine whether stand dynamics and ‘background’ mortality rates were affected by a severe drought in 2012; and to evaluate the importance of drought-pathogen interactions within the context of a mortality event that killed 10.0% and 26.5% of white (Quercus alba L.) and black (Q. velutina Lam.) oak stems, respectively, in a single year. We synthesized (i) forest inventory data (24 years), (ii) 11 years of ecosystem flux data with supporting biological data including predawn leaf water potential and annual forest inventories, (iii) tree-ring analyses of individual white oaks that were alive and ones that died in 2013, and (iv) documentation of a pathogen infection. This forest displayed stand dynamics consistent with expected patterns of decreasing tree density and increasing basal area. Continued basal area growth outpaced mortality implying a net accumulation of live biomass, which was supported by eddy covariance ecosystem carbon flux observations. Individual white and black oaks that died in 2013 displayed historically lower growth with the majority of dead trees exhibiting Biscogniauxia cankers. Our observations point to the importance of event-based oak mortality and that drought-Biscogniauxia interactions are important in shaping oak stand dynamics in this region. Although forest function has not been significantly impaired, these drought-pathogen interactions could amplify mortality under future climate conditions and thus warrant further investigation.

The importance of drought–pathogen interactions in driving oak mortality events in the Ozark Border Region

DOE PAGES

Wood, Jeffrey D.; Knapp, Benjamin O.; Muzika, Rose-Marie; ...

2017-10-20

Forests are expected to become more vulnerable to drought-induced tree mortality owing to rising temperatures and changing precipitation patterns that amplify drought lethality. There is a crucial knowledge gap regarding drought–pathogen interactions and their effects on tree mortality. The objectives of this research were to examine whether stand dynamics and 'background' mortality rates were affected by a severe drought in 2012; and to evaluate the importance of drought–pathogen interactions within the context of a mortality event that killed 10.0% and 26.5% of white (Quercus alba L.) and black (Q. velutina Lam.) oak stems, respectively, in a single year. We synthesizedmore » (i) forest inventory data (24 years), (ii) 11 years of ecosystem flux data with supporting biological data including predawn leaf water potential and annual forest inventories, (iii) tree-ring analyses of individual white oaks that were alive and ones that died in 2013, and (iv) documentation of a pathogen infection. This forest displayed stand dynamics consistent with expected patterns of decreasing tree density and increasing basal area. Continued basal area growth outpaced mortality implying a net accumulation of live biomass, which was supported by eddy covariance ecosystem carbon flux observations. Individual white and black oaks that died in 2013 displayed historically lower growth with the majority of dead trees exhibiting Biscogniauxia cankers. Our observations point to the importance of event-based oak mortality and that drought–Biscogniauxia interactions are important in shaping oak stand dynamics in this region. Although forest function has not been significantly impaired, these drought–pathogen interactions could amplify mortality under future climate conditions and thus warrant further investigation.« less

The importance of drought–pathogen interactions in driving oak mortality events in the Ozark Border Region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wood, Jeffrey D.; Knapp, Benjamin O.; Muzika, Rose-Marie

Forests are expected to become more vulnerable to drought-induced tree mortality owing to rising temperatures and changing precipitation patterns that amplify drought lethality. There is a crucial knowledge gap regarding drought–pathogen interactions and their effects on tree mortality. The objectives of this research were to examine whether stand dynamics and 'background' mortality rates were affected by a severe drought in 2012; and to evaluate the importance of drought–pathogen interactions within the context of a mortality event that killed 10.0% and 26.5% of white (Quercus alba L.) and black (Q. velutina Lam.) oak stems, respectively, in a single year. We synthesizedmore » (i) forest inventory data (24 years), (ii) 11 years of ecosystem flux data with supporting biological data including predawn leaf water potential and annual forest inventories, (iii) tree-ring analyses of individual white oaks that were alive and ones that died in 2013, and (iv) documentation of a pathogen infection. This forest displayed stand dynamics consistent with expected patterns of decreasing tree density and increasing basal area. Continued basal area growth outpaced mortality implying a net accumulation of live biomass, which was supported by eddy covariance ecosystem carbon flux observations. Individual white and black oaks that died in 2013 displayed historically lower growth with the majority of dead trees exhibiting Biscogniauxia cankers. Our observations point to the importance of event-based oak mortality and that drought–Biscogniauxia interactions are important in shaping oak stand dynamics in this region. Although forest function has not been significantly impaired, these drought–pathogen interactions could amplify mortality under future climate conditions and thus warrant further investigation.« less

Colonization history, host distribution, anthropogenic influence and landscape features shape populations of white pine blister rust, an invasive alien tree pathogen.

PubMed

Brar, Simren; Tsui, Clement K M; Dhillon, Braham; Bergeron, Marie-Josée; Joly, David L; Zambino, P J; El-Kassaby, Yousry A; Hamelin, Richard C

2015-01-01

White pine blister rust is caused by the fungal pathogen Cronartium ribicola J.C. Fisch (Basidiomycota, Pucciniales). This invasive alien pathogen was introduced into North America at the beginning of the 20th century on pine seedlings imported from Europe and has caused serious economic and ecological impacts. In this study, we applied a population and landscape genetics approach to understand the patterns of introduction and colonization as well as population structure and migration of C. ribicola. We characterized 1,292 samples of C. ribicola from 66 geographic locations in North America using single nucleotide polymorphisms (SNPs) and evaluated the effect of landscape features, host distribution, and colonization history on the structure of these pathogen populations. We identified eastern and western genetic populations in North America that are strongly differentiated. Genetic diversity is two to five times higher in eastern populations than in western ones, which can be explained by the repeated accidental introductions of the pathogen into northeastern North America compared with a single documented introduction into western North America. These distinct genetic populations are maintained by a barrier to gene flow that corresponds to a region where host connectivity is interrupted. Furthermore, additional cryptic spatial differentiation was identified in western populations. This differentiation corresponds to landscape features, such as mountain ranges, and also to host connectivity. We also detected genetic differentiation between the pathogen populations in natural stands and plantations, an indication that anthropogenic movement of this pathogen still takes place. These results highlight the importance of monitoring this invasive alien tree pathogen to prevent admixture of eastern and western populations where different pathogen races occur.

Using the Ground Squirrel (Marmota bobak) as an Animal Model to Assess Monkeypox Drug Efficacy.

PubMed

Sergeev, A A; Kabanov, A S; Bulychev, L E; Sergeev, A A; Pyankov, O V; Bodnev, S A; Galahova, D O; Zamedyanskaya, A S; Titova, K A; Glotova, T I; Taranov, O S; Omigov, V V; Shishkina, L N; Agafonov, A P; Sergeev, A N

2017-02-01

In experiments to study the sensitivity of ground squirrels (Marmota bobak) to monkeypox virus (MPXV) at intranasal challenge, expressed pox-like clinical symptoms (hyperthermia, lymphadenitis, skin rash all over the body and mucous membranes and others) were observed 7-9 days post-infection. The 50% infective dose (ID 50 ) of MPXV for these marmots determined by the presence of clinical signs of the disease was 2.2 log 10 PFU. Some diseased marmots (about 40%) died 13-22 days post-infection, and the mortality rate was weakly dependent on MPXV infective dose. Lungs with trachea were primary target organs of marmots challenged intranasally (with ~30 ID 50 ). The pathogen got to secondary target organs of the animals mainly via the lymphatic way (with replication in bifurcation lymph nodes). Lungs with trachea, nasal mucosa and skin were the organs where the maximum MPXV amounts accumulated in these animals. Evidences of the pathogen presence and replication were revealed in these and subcutaneously infected marmots in the traditional primary target cells for MPXV (macrophages and respiratory tract epitheliocytes), as well as in some other cells (endotheliocytes, plasmocytes, fibroblasts, reticular and smooth muscle cells). Our use of this animal species to assess the antiviral efficacy of some drugs demonstrated the agreement of the obtained results with those described in scientific literature, which opens up the prospects of using marmots as animal models for monkeypox to develop therapeutic and preventive anti-smallpox drugs. © 2015 Blackwell Verlag GmbH.

NK cells and poxvirus infection

PubMed Central

Burshtyn, Deborah N.

2013-01-01

In recent years, our understanding of the role of natural killer (NK) cells in the response to viral infection has grown rapidly. Not only do we realize viruses have many immune-evasion strategies to escape NK cell responses, but that stimulation of NK cell subsets during an antiviral response occurs through receptors seemingly geared directly at viral products and that NK cells can provide a memory response to viral pathogens. Tremendous knowledge has been gained in this area through the study of herpes viruses, but appreciation for the significance of NK cells in the response to other types of viral infections is growing. The function of NK cells in defense against poxviruses has emerged over several decades beginning with the early seminal studies showing the role of NK cells and the NK gene complex in susceptibility of mouse strains to ectromelia, a poxvirus pathogen of mice. More recently, greater understanding has emerged of the molecular details of the response. Given that human diseases caused by poxviruses can be as lethal as smallpox or as benign as Molluscum contagiosum, and that vaccinia virus, the prototypic member of the pox family, persists as a mainstay of vaccine design and has potential as an oncolytic virus for tumor therapy, further research in this area remains important. This review focuses on recent advances in understanding the role of NK cells in the immune response to poxviruses, the receptors involved in activation of NK cells during poxvirus infection, and the viral evasion strategies poxviruses employ to avoid the NK response. PMID:23372568

Isolation of poxvirus from debilitating cutaneous lesions on four immature grackles (Quiscalus sp.)

USGS Publications Warehouse

Docherty, D.E.; Long, R.I.; Flickinger, Edward L.; Locke, L.N.

1991-01-01

Poxvirus was isolated from nodules on four immature grackles (Quiscalus sp.) collected in two residential areas of Victoria, Texas. All of the birds were emaciated and had nodules on the eyelids, bill, legs, toes, and areas of the skin on the wings, neck, and ventral abdomen. These pox nodules were extensive and probably interfered with both sight and flight. The preliminary diagnosis was confirmed by virus isolation, histopathology, and electron microscopy. Poxvirus was isolated on the chorioallantoic membrane of embryonated hen's eggs and in Muscovy duck embryo fibroblast cell culture. Phaenicia calliphoridae (blowfly) larvae were found in one of the pox nodules, raising the possibility of mechanical transmission of the virus by contaminated adult blowflies.

Collisional excitation of interstellar PO(X2Π) by He: new ab initio potential energy surfaces and scattering calculations

NASA Astrophysics Data System (ADS)

Lique, François; Jiménez-Serra, Izaskun; Viti, Serena; Marinakis, Sarantos

2018-01-01

We present the first ab initio potential energy surfaces (PESs) for the PO(X2Π)-He van der Waals system. The PESs were obtained using the open-shell partially spin-restricted coupled cluster approach with single, double and perturbative triple excitations [UCCSD(T)]. The augmented correlation-consistent polarized valence triple-zeta (aug-cc-pVTZ) basis set was employed supplemented by mid-bond functions. Integral and differential cross sections for the rotational excitation in PO-He collisions were calculated using the new PES and compared with results in similar systems. Finally, our work presents the first hyperfine-resolved cross sections for this system that are needed for accurate modelling in astrophysical environments.

Impact of vacuum anneal at low temperature on Al2O3/In-based III-V interfaces

NASA Astrophysics Data System (ADS)

Martinez, E.; Grampeix, H.; Desplats, O.; Herrera-Gomez, A.; Ceballos-Sanchez, O.; Guerrero, J.; Yckache, K.; Martin, F.

2012-06-01

We report on the effect of vacuum anneal on interfacial oxides formed between Al2O3 and III-V semiconductors. On InGaAs, no interfacial oxide is detected after annealing at 600 °C under UHV whereas annealing under secondary vacuum favours the regrowth of thin InGaOx interfacial oxide. Lowering the temperature at 400 °C highlights the effect of III-V substrates since In-OH bonds are only formed on InAs by OH release from TMA/H2O deposited alumina. On InGaAs, regrowth of InGaOx is observed, as a result of preferential oxidation of Ga. On InP, a transition from InPOx to POx is highlighted.

Periorbital varicella gangrenosa: A rare complication of chicken pox.

PubMed

Jain, Jagriti; Thatte, Shreya; Singhai, Prakhar

2015-01-01

A previously healthy six year old male child presented in pediatrics ICU in state of shock with history of fever and rashes and later was diagnosed as chicken pox. He developed right sided periorbital varicella gangrenosa which is a form of necrotizing fasciitis secondary to skin infection. Patient was treated with intravenous acyclovir, antibiotics, amphotericin B, extensive debridement and later reconstruction of upper eyelid with skin grafting. Aggressive treatment helped preventing the eyeball and orbital involvement which would have necessitated orbital exenteration. However delayed presentation resulted in necrosis of orbicularis oculi and underlying tissue which resulted in graft retraction and lid dysfunction. Clinicians should be aware of this rare but fulminating condition to minimise the sight and life threatening complications associated with it.

Edwardsiella tarda Endocarditis Confirmed by Indium-111 White Blood Cell Scan: An Unusual Pathogen and Diagnostic Modality.

PubMed

Litton, Kayleigh M; Rogers, Bret A

2016-01-01

Edwardsiella tarda is a freshwater marine member of the family Enterobacteriaceae which often colonizes fish, lizards, snakes, and turtles but is an infrequent human pathogen. Indium-111- ((111)In-) labeled white blood cell (WBC) scintigraphy is an imaging modality which has a wide range of reported sensitivity and specificity (from 60 to 100% and from 68 to 92%, resp.) for diagnosing acute and chronic infection. We describe a case of suspected E. tarda prosthetic aortic valve and mitral valve endocarditis with probable vegetations and new mitral regurgitation on transthoracic and transesophageal echocardiograms which was supported with the use of (111)In-labeled WBC scintigraphy.

Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

NASA Astrophysics Data System (ADS)

Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

2014-03-01

Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

Resource capture and competitive ability of non-pathogenic Pseudogymnoascus spp. and P. destructans, the cause of white-nose syndrome in bats

PubMed Central

Wilson, Michael B.; Held, Benjamin W.; Freiborg, Amanda H.; Blanchette, Robert A.

2017-01-01

White-nose syndrome (WNS) is a devastating fungal disease that has been causing the mass mortality of hibernating bats in North America since 2006 and is caused by the psychrophilic dermatophyte Pseudogymnoascus destructans. Infected bats shed conidia into hibernaculum sediments and surfaces, but it is unknown if P. destructans can form stable, reproductive populations outside its bat hosts. Previous studies have found non-pathogenic Pseudogymnoascus in bat hibernacula, and these fungi may provide insight into the natural history of P. destructans. We compared the relatedness, resource capture, and competitive ability of non-pathogenic Pseudogymnoascus isolates with P. destructans to determine if they have similar adaptations for survival in hibernacula sediment. All non-pathogenic Pseudogymnoascus isolates grew faster, utilized a broader range of substrates with higher efficiency, and were generally more resistant to antifungals compared to P. destructans. All isolates also showed the ability to displace P. destructans in co-culture assays, but only some produced extractible antifungal metabolites. These results suggest that P. destructans would perform poorly in the same environmental niche as non-pathogenic Pseudogymnoascus, and must have an alternative saprophytic survival strategy if it establishes active populations in hibernaculum sediment and non-host surfaces. PMID:28617823

Resource capture and competitive ability of non-pathogenic Pseudogymnoascus spp. and P. destructans, the cause of white-nose syndrome in bats.

PubMed

Wilson, Michael B; Held, Benjamin W; Freiborg, Amanda H; Blanchette, Robert A; Salomon, Christine E

2017-01-01

White-nose syndrome (WNS) is a devastating fungal disease that has been causing the mass mortality of hibernating bats in North America since 2006 and is caused by the psychrophilic dermatophyte Pseudogymnoascus destructans. Infected bats shed conidia into hibernaculum sediments and surfaces, but it is unknown if P. destructans can form stable, reproductive populations outside its bat hosts. Previous studies have found non-pathogenic Pseudogymnoascus in bat hibernacula, and these fungi may provide insight into the natural history of P. destructans. We compared the relatedness, resource capture, and competitive ability of non-pathogenic Pseudogymnoascus isolates with P. destructans to determine if they have similar adaptations for survival in hibernacula sediment. All non-pathogenic Pseudogymnoascus isolates grew faster, utilized a broader range of substrates with higher efficiency, and were generally more resistant to antifungals compared to P. destructans. All isolates also showed the ability to displace P. destructans in co-culture assays, but only some produced extractible antifungal metabolites. These results suggest that P. destructans would perform poorly in the same environmental niche as non-pathogenic Pseudogymnoascus, and must have an alternative saprophytic survival strategy if it establishes active populations in hibernaculum sediment and non-host surfaces.

Isolation and characterization of a novel cervid adenovirus from white-tailed deer (Odocoileus virginianus) fawns in a captive herd

USDA-ARS?s Scientific Manuscript database

A novel adenovirus was isolated from buffy coat and serum samples from two captive white-tailed deer (Odocoileus virginianus) fawns. The isolation was incidental finding in the course of screening animals for use in a research study on an unrelated pathogen. In the screening process, virus isolati...

Inadequate protection of ducks and geese against H5N1 high pathogenicity avian influenza virus by a single vaccination

USDA-ARS?s Scientific Manuscript database

Ducks and geese are an important sustainable food source in developing countries. Few studies have been conducted to test vaccine efficacy in either ducks or geese. This study was conducted to investigate whether a single vaccination could protect White Pekin ducks and White Chinese geese against ...

Frequency of hypersensitive-like reaction and stem infections in a large full-sib family of Pinus monticola

Treesearch

Robert S. Danchok; R.A. Sniezko; S. Long; A. Kegley; D. Savin; J.B. Mayo; J.J. Liu; J. Hill

2012-01-01

Western white pine (WWP) (Pinus monticola Douglas ex D. Don) is a long-lived forest tree species with a large native range in western North America. The tree species is highly susceptible to the non-native fungal pathogen, Cronartium ribicola, the causative agent of white pine blister rust (WPBR)....

Molecular dissection of white pine genetic resistance to Cronartium ribicola

Treesearch

Jun-Jun Liu; Richard Sniezko

2011-01-01

Pinus monticola (Dougl. ex D. Don.) maintains a complex defence system that detects white pine blister rust pathogen (Cronartium ribicola J.C.Fisch.) and activates resistance responses. A thorough understanding of how it functions at the molecular level would provide us new strategies for creating forest trees with durable disease resistance. Our research focuses on...

A natural history of Cronartium ribicola

Treesearch

Brian W. Geils; Detlev R. Vogler

2011-01-01

Cronartium ribicola is a fungal pathogen that causes a blister rust disease of white pines, Ribes, and other hosts in the genera Castilleja and Pedicularis. Although blister rust can damage white pine trees and stands, the severity and significance of these impacts vary with time, place, and management. We use a natural history approach to describe the history, biology...

High elevation white pines educational website

Treesearch

Anna W. Schoettle; Michele Laskowski

2011-01-01

The high elevation five-needle white pines are facing numerous challenges ranging from climate change to invasion by a non-native pathogen to escalation of pest outbreaks. This website (http://www.fs.fed.us/rm/highelevationwhitepines/) serves as a primer for managers and the public on the high elevation North American five-needle pines. It presents information on each...

White pine blister rust resistance in limber pine: Evidence for a major gene

Treesearch

A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns

2014-01-01

Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

Transcriptome analyses suggest a disturbance of iron homeostasis in soybean leaves during white mould disease establishment

USDA-ARS?s Scientific Manuscript database

Sclerotinia sclerotiorum is a serious pathogen of numerous crops around the world. The major virulence factor of this pathogen is oxalic acid (OA). Mutants that cannot produce OA do not cause disease, and plants that express enzymes that degrade OA, such as oxalate oxidase (OxO) are very resistant t...

Functional properties of peanut fractions on the growth of probiotics and foodborne bacterial pathogens.

PubMed

Peng, Mengfei; Bitsko, Elizabeth; Biswas, Debabrata

2015-03-01

Various compounds found in peanut (Arachis hypogaea) have been shown to provide multiple benefits to human health and may influence the growth of a broad range of gut bacteria. In this study, we investigated the effects of peanut white kernel and peanut skin on 3 strains of Lactobacillus and 3 major foodborne enteric bacterial pathogens. Significant (P < 0.05) growth stimulation of Lactobacillus casei and Lactobacillus rhamnosus was observed in the presence of 0.5% peanut flour (PF) made from peanut white kernel, whereas 0.5% peanut skin extract (PSE) exerted the inhibitory effect on the growth of these beneficial microbes. We also found that within 72 h, PF inhibited growth of enterohemorrhagic Escherichia coli O157:H7 (EHEC), while PSE significantly (P < 0.05) inhibited Listeria monocytogenes but promoted the growth of both EHEC and Salmonella Typhimurium. The cell adhesion and invasion abilities of 3 pathogens to the host cells were also significantly (P < 0.05) reduced by 0.5% PF and 0.5% PSE. These results suggest that peanut white kernel might assist in improving human gut flora as well as reducing EHEC, whereas the beneficial effects of peanut skins require further research and investigation. © 2015 Institute of Food Technologists®

Analysis of the expression of putative heat-stress related genes in relation to thermotolerance of cork oak.

PubMed

Correia, Barbara; Rodriguez, José Luis; Valledor, Luis; Almeida, Tânia; Santos, Conceição; Cañal, Maria Jesús; Pinto, Glória

2014-03-15

Cork oak (Quercus suber L.) is a research priority in the Mediterranean area and because of cork oaks' distribution these stands are experiencing daily stress. Based on projections of intensifying climate change and considering the key role of exploring the recovery abilities, cork oak seedlings were subjected to a cumulative temperature increase from 25°C to 55°C and subsequent recovery. CO2 assimilation rate, chlorophyll fluorescence, anthocyanins, proline and lipid peroxidation were used to evaluate plant performance, while the relative abundance of seven genes encoding for proteins of cork oak with a putative role in thermal/stress regulation (POX1, POX2, HSP10.4, HSP17a.22, CHS, MTL and RBC) was analyzed by qPCR (quantitative Polymerase Chain Reaction). A temperature change to 35°C showed abundance alterations in the tested genes; at 45°C, the molecular changes were associated with an antioxidant response, possibly modulated by anthocyanins. At 55°C, HSP17a.22, MTL and proline accumulation were evident. After recovery, physiological balance was restored, whereas POX1, HSP10.4 and MTL abundances were suggested to be involved in increased thermotolerance. The data presented here are expected to pinpoint some pathways changes occurring during such stress and further recovery in this particular Mediterranean species. Copyright © 2013 Elsevier GmbH. All rights reserved.

Detection of plum pox virus infection in selection plum trees using spectral imaging

NASA Astrophysics Data System (ADS)

Angelova, Liliya; Stoev, Antoniy; Borisova, Ekaterina; Avramov, Latchezar

2016-01-01

Plum pox virus (PPV) is among the most studied viral diseases in the world in plants. It is considered to be one of the most devastating diseases of stone fruits in terms of agronomic impact and economic importance. Noninvasive, fast and reliable techniques are required for evaluation of the pathology in selection trees with economic impact. Such advanced tools for PPV detection could be optical techniques as light-induced fluorescence and diffuse reflectance spectroscopies. Specific regions in the electromagnetic spectra have been found to provide information about the physiological stress in plants, and consequently, diseased plants usually exhibit different spectral signature than non-stressed healthy plants in those specific ranges. In this study spectral reflectance and chlorophyll fluorescence were used for the identification of biotic stress caused by the pox virus on plum trees. The spectral responses of healthy and infected leaves from cultivars, which are widespread in Bulgaria were investigated. The two applied techniques revealed statistically significant differences between the spectral data of healthy plum leaves and those infected by PPV in the visible and near-infrared spectral ranges. Their application for biotic stress detection helps in monitoring diseases in plants using the different plant spectral properties in these spectral ranges. The strong relationship between the results indicates the applicability of diffuse reflectance and fluorescence techniques for conducting health condition assessments of vegetation and their importance for plant protection practices.

Low Impact of Avian Pox on Captive-Bred Houbara Bustard Breeding Performance.

PubMed

Le Loc'h, Guillaume; Souley, Mam-Noury Amadou; Bertagnoli, Stéphane; Paul, Mathilde C

2017-01-01

Avian pox, a disease caused by avipoxviruses, is a major cause of decline of some endangered bird species. While its impact has been assessed in several species in the wild, effects of the disease in conservation breeding have never been studied. Houbara bustard species ( Chlamydotis undulata and Chlamydotis macqueenii ), whose populations declined in the last decades, have been captive bred for conservation purposes for more than 20 years. While mortality and morbidity induced by avipoxviruses can be controlled by appropriate management, the disease might still affect bird breeding performance and jeopardize the production objectives of conservation programs. Impacts of the disease was studied during two outbreaks in captive-bred juvenile Houbara bustards in Morocco in 2009-2010 and 2010-2011, by modeling the effect of the disease on individual breeding performance (male display and female egg production) of 2,797 birds during their first breeding season. Results showed that the impact of avian pox on the ability of birds to reproduce and on the count of displays or eggs is low and mainly non-significant. The absence of strong impact compared to what could be observed in other species in the wild may be explained by the controlled conditions provided by captivity, especially the close veterinary monitoring of each bird. Those results emphasize the importance of individual management to prevent major disease emergence and their effects in captive breeding of endangered species.

Outbreaks of Pox Disease Due to Canarypox-Like and Fowlpox-Like Viruses in Large-Scale Houbara Bustard Captive-Breeding Programmes, in Morocco and the United Arab Emirates.

PubMed

Le Loc'h, G; Paul, M C; Camus-Bouclainville, C; Bertagnoli, S

2016-12-01

Infectious diseases can be serious threats for the success of reinforcement programmes of endangered species. Houbara Bustard species (Chlamydotis undulata and Chlamydotis macqueenii), whose populations declined in the last decades, have been captive-bred for conservation purposes for more than 15 years in North Africa and the Middle East. Field observations show that pox disease, caused by avipoxviruses (APV), regularly emerges in conservation projects of Houbara Bustard, despite a very strict implementation of both vaccination and biosecurity. Data collected from captive flocks of Houbara Bustard in Morocco from 2006 through 2013 and in the United Arab Emirates from 2011 through 2013 were analysed, and molecular investigations were carried out to define the virus strains involved. Pox cases (n = 2311) were observed during more than half of the year (88% of the months in Morocco, 54% in the United Arab Emirates). Monthly morbidity rates showed strong variations across the time periods considered, species and study sites: Four outbreaks were described during the study period on both sites. Molecular typing revealed that infections were mostly due to canarypox-like viruses in Morocco while fowlpox-like viruses were predominant in the United Arab Emirates. This study highlights that APV remain a major threat to consider in bird conservation initiatives. © 2015 Blackwell Verlag GmbH.

A Nonluminescent and Highly Virulent Vibrio harveyi Strain Is Associated with “Bacterial White Tail Disease” of Litopenaeus vannamei Shrimp

PubMed Central

Zhou, Junfang; Fang, Wenhong; Yang, Xianle; Zhou, Shuai; Hu, Linlin; Li, Xincang; Qi, Xinyong; Su, Hang; Xie, Layue

2012-01-01

Recurrent outbreaks of a disease in pond-cultured juvenile and subadult Litopenaeus vannamei shrimp in several districts in China remain an important problem in recent years. The disease was characterized by “white tail” and generally accompanied by mass mortalities. Based on data from the microscopical analyses, PCR detection and 16S rRNA sequencing, a new Vibrio harveyi strain (designated as strain HLB0905) was identified as the etiologic pathogen. The bacterial isolation and challenge tests demonstrated that the HLB0905 strain was nonluminescent but highly virulent. It could cause mass mortality in affected shrimp during a short time period with a low dose of infection. Meanwhile, the histopathological and electron microscopical analysis both showed that the HLB0905 strain could cause severe fiber cell damages and striated muscle necrosis by accumulating in the tail muscle of L. vannamei shrimp, which led the affected shrimp to exhibit white or opaque lesions in the tail. The typical sign was closely similar to that caused by infectious myonecrosis (IMN), white tail disease (WTD) or penaeid white tail disease (PWTD). To differentiate from such diseases as with a sign of “white tail” but of non-bacterial origin, the present disease was named as “bacterial white tail disease (BWTD)”. Present study revealed that, just like IMN and WTD, BWTD could also cause mass mortalities in pond-cultured shrimp. These results suggested that some bacterial strains are changing themselves from secondary to primary pathogens by enhancing their virulence in current shrimp aquaculture system. PMID:22383954

A method for aircraft afterburner combustion without flameholders

NASA Astrophysics Data System (ADS)

Birmaher, Shai

2009-12-01

State of the art aircraft afterburners employ spray bars to inject fuel and flameholders to stabilize the combustion process. Such afterburner designs significantly increase the length (and thus weight), pressure losses, and observability of the engine. This thesis presents a feasibility study of a compact 'prime and trigger' (PAT) afterburner concept that eliminates the fuel spray bars and flameholders and, thus, eliminates the above-mentioned problems. In this concept, afterburner fuel is injected just upstream or in between the turbine stages. As the fuel travels through the turbine stages, it evaporates, mixes with the bulk flow, and undergoes some chemical reactions without any significant heat release, a process referred to as 'priming'. Downstream of the turbine stages, combustion could take place through autoignition. However, if fuel autoignition does not occur or if autoignition does not produce a combustion zone that is stable and highly efficient, then a low power pilot, or 'trigger', can be used to control the combustion process. The envisioned trigger for the PAT concept is a jet of product gas from ultra-rich hydrocarbon/air combustion that is injected through the afterburner liner. This 'partial oxidation' (POx) gas, which consists mostly of H2, CO, and diluents, rapidly produces radicals and heat that accelerate the autoignition of the primed mixture and, thus, provide an anchor point for the afterburner combustion process. The objective of this research was to demonstrate the feasibility of the PAT concept by showing that (1) combustion of fuel injected within or upstream of turbine stages can occur only downstream of the turbine stages, and (2) the combustion zone is compact, stable and efficient. This was accomplished using two experimental facilities, a developed theoretical model, and Chemkin simulations. The first facility, termed the Afterburner Facility (AF), simulated the bulk flow temperature, velocity and O2 content through a turbojet combustor, turbine stage and afterburner. To model the PAT concept, Jet-A was injected upstream of the simulated turbine stage and a H2 jet was used to trigger the primed Jet-A combustion process downstream of the turbine stage. H2 was used because POx gas was not available for experiments. The second facility, termed the Propane Autoignition Combustor (PAC), was essentially a scaled-down, simplified version of the AF. The PAC experiments focused on the trigger stage of the PAT concept, using H 2 in lieu of POx gas and employing measurement techniques that were in some ways more detailed than in the AF experiments. The developed model simulated the physics of fuel priming in the AF and predicted the Jet-A autoignition location. It was used to predict and interpret the AF results and to study the feasibility of the PAT concept at pressures outside the AF operating range. Finally, the Chemkin simulations were used to examine the effect of several POx gas compositions on the Jet-A/vitiated-air autoignition process; to compare the POx and H2 triggers; and to explore several reasons for why POx gas and H2 are suitable trigger mechanisms. he experimental, theoretical, and numerical results obtained in this investigation indicated that the PAT concept provides a feasible approach to afterburner combustion. The experiments in the AF showed that the ignition delay of Jet-A is sufficiently long to allow fuel injection within turbine stages without significant heat release upstream of the afterburner. In the AF experiments without the H2 trigger, Jet-A combustion was achieved through autoignition; however, the autoignition combustion zone exhibited large axial fluctuations and low combustion efficiency. The H2 trigger was able to shift the combustion zone upstream, make it more compact, reduce fluctuations in its axial position, and raise the combustion efficiency to nearly 100%. The PAC experiments also showed that a H2 trigger can shift the combustion zone upstream, make it more compact, and increase the combustion efficiency. The PAC results were obtained with lower O 2 content and higher equivalence ratios than in the AF. Therefore, the combined AF and PAC results suggested that the PAT concept is feasible over a wide range of operating conditions. The developed model showed good agreement with the AF results. It also predicted that the PAT concept is feasible at bulk flow pressures outside the AF operating range. Finally, the Chemkin results showed that both the H2 and POx gas triggers can significantly reduce the ignition delay time of primed Jet-A/vitiated air mixtures. Thus, POx gas is a suitable trigger for the PAT concept and should be tested in future experimental investigations.

Use of multiple sequencing technologies to produce a high-quality genome of the fungus Pseudogymnoascus destructans, the causative agent of bat White-Nose syndrome

USGS Publications Warehouse

Drees, Kevin P.; Palmer, Jonathan M.; Sebra, Robert; Lorch, Jeffrey M.; Chen, Cynthia; Wu, ChengCang; Bok, Jin Woo; Keller, Nancy F.; Blehert, David; Cuomo, Christina A.; Linder, Daniel L.; Foster, Jeffrey T.

2016-01-01

White-Nose syndrome has recently emerged as one of the most devastating wildlife diseases recorded, causing widespread mortality in numerous bat species throughout eastern North America. Here, we present an improvised reference genome of the fungal pathogen Pseudogymnoascus destructans for use in comparative genomic studies.

Synoptic climatology of the long-distance dispersal of white pine blister rust II. Combination of surface and upper level conditions

Treesearch

K. L. Frank; B. W. Geils; L. S. Kalkstein; H. W. Thistle

2008-01-01

An invasive forest pathogen, Cronartium ribicola, white pine blister rust (WPBR), is believed to have arrived in the Sacramento Mountains of south-central New Mexico about 1970. Epidemiological and genetic evidence supports the hypothesis that introduction was the result of long-distance dispersal (LDD) by atmospheric transport from California. This...

Distribution and frequency of a gene for resistance to white pine blister rust in natural populations of sugar pine

Treesearch

Bohun B. Kinloch Jr.

1992-01-01

The gametic frequency of a dominant allcle (R) for resistance to white pine blister rust, a disease caused by an introduced pathogen (Cronartium ribicola), in natural populations of sugar pine was estimated by the kind of leaf symptom expressed after artificial inoculation of wind-pollinated seedlings from susceptible seed-parent...

Use of Multiple Sequencing Technologies To Produce a High-Quality Genome of the Fungus Pseudogymnoascus destructans, the Causative Agent of Bat White-Nose Syndrome

PubMed Central

Sebra, Robert; Lorch, Jeffrey M.; Chen, Cynthia; Wu, Cheng-Cang; Bok, Jin Woo; Keller, Nancy P.; Blehert, David S.; Lindner, Daniel L.

2016-01-01

White-nose syndrome has recently emerged as one of the most devastating wildlife diseases recorded, causing widespread mortality in numerous bat species throughout eastern North America. Here, we present an improved reference genome of the fungal pathogen Pseudogymnoascus destructans for use in comparative genomic studies. PMID:27365344

The relationship between whitebark pine health, cone production, and nutcracker occurrence across four National Parks

Treesearch

Lauren E. Barringer; Diana F. Tomback; Michael B. Wunder

2011-01-01

Whitebark pine (Pinus albicaulis) is declining in the central and northern Rocky Mountains from infection by the exotic pathogen Cronartium ribicola, which causes white pine blister rust, and from outbreaks of mountain pine beetle (Dendroctonus ponderosae). White pine blister rust has been present in Glacier and Waterton Lakes National Parks (NP) about two decades...

Assessing host specialization among aecial and telial hosts of the white pine blister rust fungus, Cronartium ribicola

Treesearch

Bryce A. Richardson; Paul J. Zambino; Ned B. Klopfenstein; Geral I. McDonald; Lori M. Carris

2007-01-01

The white-pine blister rust fungus, Cronartium ribicola Fisch. in Rabenh., continues to spread in North America, utilizing various aecial (primary) and telial (alternate) hosts, some of which have only recently been discovered. This introduced pathogen has been characterized as having low genetic diversity in North America, yet it has demonstrated a...

Use of multiple sequencing technologies to produce a high-quality genome of the fungus Pseudogymnoascus destructans, the causative agent of bat white-nose syndrome

Treesearch

Kevin P. Drees; Jonathan M. Palmer; Robert Sebra; Jeffrey M. Lorch; Cynthia Chen; Cheng-Cang Wu; Jin Woo Bok; Nancy P. Keller; David S. Blehert; Christina A. Cuomo; Daniel L. Lindner; Jeffrey T. Foster

2016-01-01

White-nose syndrome has recently emerged as one of the most devastating wildlife diseases recorded, causing widespread mortality in numerous bat species throughout eastern North America. Here, we present an improved reference genome of the fungal pathogen Pseudogymnoascus destructans for use in comparative genomic studies.

White spot syndrome virus inactivation study by using gamma irradiation

NASA Astrophysics Data System (ADS)

Heidareh, Marzieh; Sedeh, Farahnaz Motamedi; Soltani, Mehdi; Rajabifar, Saeed; Afsharnasab, Mohammad; Dashtiannasab, Aghil

2014-09-01

The present study was conducted to investigate the effect of gamma irradiation on white spot syndrome virus (WSSV). White spot syndrome virus is a pathogen of major economic importance in cultured penaeid shrimp industries. White spot disease can cause mortalities reaching 100% within 3-10 days of gross signs appearing. During the period of culture, immunostimulant agents and vaccines may provide potential methods to protect shrimps from opportunistic and pathogenic microrganisms. In this study, firstly, WSSV was isolated from infected shrimp and then multiplied in crayfish. WSSV was purified from the infected crayfish haemolymph by sucrose gradient and confirmed by transmission electron microscopy. In vivo virus titration was performed in shrimp, Penaeus semisulcatus. The LD50 of live virus stock was calculated 10 5.4/mL. Shrimp post-larvae (1-2 g) were treated with gamma-irradiated (different doses) WSSV (100 to 10-4 dilutions) for a period of 10 days. The dose/survival curve for irradiated and un-irradiated WSSV was drawn; the optimum dose range for inactivation of WSSV and unaltered antigenicity was obtained 14-15 kGy. This preliminary information suggests that shrimp appear to benefit from treatment with gammairradiated WSSV especially at 14-15 KGy.

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2011 CFR

2011-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND...-mouth disease virus; Goat pox virus; Japanese encephalitis virus; Lumpy skin disease virus; Malignant...

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2012 CFR

2012-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND...-mouth disease virus; Goat pox virus; Japanese encephalitis virus; Lumpy skin disease virus; Malignant...

Fifth Disease

MedlinePlus

... past. The others included measles, rubella (German measles), chicken pox, scarlet fever, and roseola. Fifth disease is ... The first signs of fifth disease are mild flu- or cold-like symptoms, including: low-grade fever ...

Remedial Investigation Report for Lake City Army Ammunition Plant. Volume 1

DTIC Science & Technology

1990-06-01

EXPLOSIVE COMPOUNDS 1 3-DNB ɘ 61 ɘ.61 ɘ.61 ɘ.61 ɘ.61 1 73 135-7N6 11 7 ɘ.56 ɘ.56 ɘ.56 ɘ.56 0.7 *J 3.24 ə 30 ə 30 ə,30 ə.30 ə.30 POX ɘ...COMPOUNDS * 5- TNB I37 ɘ.56 ɘ. 56 ɘ 56 ɘ. 56 ɘ,56 HMX 17 4 ə.,30 ə 30 < 1 340 ᝻,30 ə.30 POX IS0 1.67 ɘ.63 ɘ.63 ɘ.63 1 84 OTHERS (ALL NO OR...Torkelson and Rowe 1031 5-209 Evidence suggests that 1,1,2-TCA is embryo toxic to chicken eggs (Elovaara 1979). I,I,2-TCA was found to be weakly mutagenic

XMM-Newton Proposal 03024201

NASA Astrophysics Data System (ADS)

Barth, Aaron

2004-10-01

POX 52 is a Narrow-Line Seyfert 1 galaxy with extreme and unusual properties. Its black hole mass, estimated from the optical spectrum of the AGN, is only ~10^5 solar masses; its host galaxy is a dwarf elliptical with a velocity dispersion of only 36+/-5 km/s; and it is radiating at L/L_Edd ~ 1. POX 52 offers a unique opportunity to study black hole accretion at high accretion rates in a mass range that has barely been explored previously. We request 100 ksec of EPIC-pn observations of this unique AGN in order to characterize its X-ray spectrum and absorption, to search for Fe K line emission, to study its variability properties, and to search for quasi-periodic oscillations with the aim of better constraining the black hole mass.

The gas-phase on-line production of phosphoryl halides, POX 3 and their identification by infrared spectroscopy

NASA Astrophysics Data System (ADS)

Allaf, Abdul W.

1998-07-01

A new route has been devised, leading to the production of POX 3 molecules where X=F, Br and I by an on-line process using phosphoryl chloride, POCl 3 as a starting material passed over heated sodium fluoride, NaF, potassium bromide, KBr and potassium iodide, KI at 535, 690 and 480°C, respectively. The products have been characterised by the infrared (IR) spectra of their vapours. The low resolution gas-phase Fourier transform infrared spectra reported for the first time show strong bands centered at 1416.6, 1312.9, 1297.9 and 1285 cm -1, assigned to ν1(a 1), the OP stretching fundamental of POF 3, POCl 3, POBr 3 and POI 3, respectively.

Molecular epidemiology of Plum pox virus in Japan.

PubMed

Maejima, Kensaku; Himeno, Misako; Komatsu, Ken; Takinami, Yusuke; Hashimoto, Masayoshi; Takahashi, Shuichiro; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

2011-05-01

For a molecular epidemiological study based on complete genome sequences, 37 Plum pox virus (PPV) isolates were collected from the Kanto region in Japan. Pair-wise analyses revealed that all 37 Japanese isolates belong to the PPV-D strain, with low genetic diversity (less than 0.8%). In phylogenetic analysis of the PPV-D strain based on complete nucleotide sequences, the relationships of the PPV-D strain were reconstructed with high resolution: at the global level, the American, Canadian, and Japanese isolates formed their own distinct monophyletic clusters, suggesting that the routes of viral entry into these countries were independent; at the local level, the actual transmission histories of PPV were precisely reconstructed with high bootstrap support. This is the first description of the molecular epidemiology of PPV based on complete genome sequences.

[Acute illness following chicken pox: spleen infarction as a complication of varicella zoster infection].

PubMed

Teeninga, Nynke; Willemze, Annemieke J; Emonts, Marieke; Appel, Inge M

2011-01-01

Varicella zoster virus (VZV) infection can cause temporary acquired protein S or C deficiency via cross reacting antibodies and consequently inducing a hypercoagulable state. A 6-year-old girl with a history of congenital cardiac disease was seen at an Emergency Department with acute chest pain, dyspnoea and fever, seven days after developing chicken pox. Diagnostic tests revealed massive infarction of the spleen, and a protein S and C deficiency. In addition, blood cultures revealed a Lancefield group A β-haemolytic streptococcus (GABHS). The patient recovered fully after treatment with low molecular weight heparin and antibiotics. In this patient, septic emboli caused splenic infarction. Thromboembolic complications should be suspected in children with VZV who present with acute symptoms, in particular if bacterial superinfection is found.

Enhanced selectivity for the hydrolysis of block copoly(2-oxazoline)s in ethanol-water resulting in linear poly(ethylene imine) copolymers.

PubMed

van Kuringen, Huub P C; de la Rosa, Victor R; Fijten, Martin W M; Heuts, Johan P A; Hoogenboom, Richard

2012-05-14

The ability of merging the properties of poly(2-oxazoline)s and poly(ethylene imine) is of high interest for various biomedical applications, including gene delivery, biosensors, and switchable surfaces and nanoparticles. In the present research, a methodology for the controlled and selective hydrolysis of (co)poly(2-oxazoline)s is developed in an ethanol-water solvent mixture, opening the path toward a wide range of block poly(2-oxazoline-co-ethylene imine) (POx-PEI) copolymers with tunable properties. The unexpected influence of the selected ethanol-water binary solvent mixture on the hydrolysis kinetics and selectivity is highlighted in the pursue of well-defined POx-PEI block copolymers. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Influence of the erineum strain of Colomerus vitis (Acari: Eriophyidae) on grape (Vitis vinifera) defense mechanisms.

PubMed

Javadi Khederi, Saeid; Khanjani, Mohammad; Gholami, Mansur; Panzarino, Onofrio; de Lillo, Enrico

2018-05-01

Grape (Vitis vinifera) is commonly affected by the erineum strain of Colomerus vitis (GEM) in Iran and the susceptibility of grape cultivars to GEM is poorly understood. In order to evaluate the impact of GEM on grape and its defense mechanisms against the mite, an exploratory study was carried out on 19 cultivars (18 Iranian and the non-native Muscat Gordo). The differential susceptibility of cultivars to GEM was compared on the basis of the area of leaf damage induced by GEM. The cultivars White Thompson seedless of Bovanat, Atabaki Zarghan, Koladari Ghoochan and Sahebi Uroomie were less susceptible to GEM, whereas Ghalati Dodaj, Rishbaba, Muscat Gordo and Neyshaboori Birjand appeared to be the most affected by the mite. In a no-choice setup, plants of selected cultivars of these two groups were infested by GEM and assayed for 10 biomarkers usually related to plant stress mechanisms against plant feeders: the activity of defense enzymes-peroxidase (POX), polyphenol oxidase (PPO), superoxide dismutase (SOD), phenylalanine ammonia-lyase (PAL), catalase (CAT), the amount of total polyphenolics, total flavonoids, total soluble carbohydrates, hydrogen peroxide (H 2 O 2 ), and malondialdehyde (MDA) expressing lipid peroxidation. The biomarkers were assessed in grape leaves 7 days before releasing the mites, as well as 7, 14 and 28 days after infestation (DAI). The activity of the enzymes and the amount of the compounds usually increased in percentage after mite infestation. A significant negative correlation was found between the area of leaf damage and PPO, POX, SOD, MDA and H 2 O 2 for all sampling dates. The area of leaf damage showed a significant positive correlation with total soluble carbohydrates at 28 DAI, and significant negative correlations with CAT (at 14 and 28 DAI), PAL and total flavonoids (at 7 DAI). No correlation was observed between area of leaf damage and total polyphenolics. The biomarkers PPO, SOD, CAT activity and H 2 O 2 provided the best explanation for the response of grape cultivars to GEM infestation.

Bat white-nose syndrome in North America

USGS Publications Warehouse

Blehert, David S.; Lorch, Jeffrey M.; Ballmann, Anne E.; Cryan, Paul M.; Meteyer, Carol U.

2011-01-01

* The newly described fungus, Geomyces destructans, causes an invasive skin infection in bats and is the likely agent of white-nose syndrome (WNS). * With immune system functions and body temperatures reduced during hibernation, bats may be unusually susceptible to a pathogenic fungus such as G. destructans. * WNS was first observed in a popular show cave near Albany, New York, leading some investigators to suspect that a visitor inadvertently introduced G. destructans at this site, triggering a wider WNS outbreak in North America. * Biologists trying to manage WNS within North American bat populations face major challenges, including the variety of susceptible host species, incredible dispersal capabilities of bats, difficulties in treating such populations, and persistence of the pathogen in their vulnerable underground habitats.

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2013 CFR

2013-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND... fever virus; *Foot-and-mouth disease virus; Goat pox virus; Lumpy skin disease virus; Mycoplasma...

9 CFR 121.3 - VS select agents and toxins.

Code of Federal Regulations, 2014 CFR

2014-01-01

... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS POSSESSION, USE, AND... fever virus; *Foot-and-mouth disease virus; Goat pox virus; Lumpy skin disease virus; Mycoplasma...

Chickenpox

MedlinePlus

Varicella; Chicken pox ... Chickenpox is caused by the varicella-zoster virus. It is a member of the herpesvirus family. The same virus also causes shingles in adults. Chickenpox can be spread very easily to others from ...

IL-4 and IL-13 mediated down-regulation of CD8 expression levels can dampen anti-viral CD8⁺ T cell avidity following HIV-1 recombinant pox viral vaccination.

PubMed

Wijesundara, Danushka K; Jackson, Ronald J; Tscharke, David C; Ranasinghe, Charani

2013-09-23

We have shown that mucosal HIV-1 recombinant pox viral vaccination can induce high, avidity HIV-specific CD8(+) T cells with reduced interleukin (IL)-4 and IL-13 expression compared to, systemic vaccine delivery. In the current study how these cytokines act to regulate anti-viral CD8(+) T, cell avidity following HIV-1 recombinant pox viral prime-boost vaccination was investigated. Out of a panel of T cell avidity markers tested, only CD8 expression levels were found to be enhanced on, KdGag197-205 (HIV)-specific CD8(+) T cells obtained from IL-13(-/-), IL-4(-/-) and signal transducer and, activator of transcription of 6 (STAT6)(-/-) mice compared to wild-type (WT) controls following, vaccination. Elevated CD8 expression levels in this instance also correlated with polyfunctionality, (interferon (IFN)-γ, tumour necorsis factor (TNF)-α and IL-2 production) and the avidity of HIVspecific CD8(+) T cells. Furthermore, mucosal vaccination and vaccination with the novel adjuvanted IL-13 inhibitor (i.e. IL-13Rα2) vaccines significantly enhanced CD8 expression levels on HIV-specific CD8(+), T cells, which correlated with avidity. Using anti-CD8 antibodies that blocked CD8 availability on CD8(+), T cells, it was established that CD8 played an important role in increasing HIV-specific CD8(+) T cell avidity and polyfunctionality in IL-4(-/-), IL-13(-/-) and STAT6(-/-) mice compared to WT controls, following vaccination. Collectively, our data demonstrate that IL-4 and IL-13 dampen CD8 expression levels on anti-viral CD8(+) T cells, which can down-regulate anti-viral CD8(+) T cell avidity and, polyfunctionality following HIV-1 recombinant pox viral vaccination. These findings can be exploited to, design more efficacious vaccines not only against HIV-1, but many chronic infections where high, avidity CD8(+) T cells help protection. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effective Surface Passivation of InP Nanowires by Atomic-Layer-Deposited Al2O3 with POx Interlayer

PubMed Central

2017-01-01

III/V semiconductor nanostructures have significant potential in device applications, but effective surface passivation is critical due to their large surface-to-volume ratio. For InP such passivation has proven particularly difficult, with substantial depassivation generally observed following dielectric deposition on InP surfaces. We present a novel approach based on passivation with a phosphorus-rich interfacial oxide deposited using a low-temperature process, which is critical to avoid P-desorption. For this purpose we have chosen a POx layer deposited in a plasma-assisted atomic layer deposition (ALD) system at room temperature. Since POx is known to be hygroscopic and therefore unstable in atmosphere, we encapsulate this layer with a thin ALD Al2O3 capping layer to form a POx/Al2O3 stack. This passivation scheme is capable of improving the photoluminescence (PL) efficiency of our state-of-the-art wurtzite (WZ) InP nanowires by a factor of ∼20 at low excitation. If we apply the rate equation analysis advocated by some authors, we derive a PL internal quantum efficiency (IQE) of 75% for our passivated wires at high excitation. Our results indicate that it is more reliable to calculate the IQE as the ratio of the integrated PL intensity at room temperature to that at 10 K. By this means we derive an IQE of 27% for the passivated wires at high excitation (>10 kW cm–2), which constitutes an unprecedented level of performance for undoped InP nanowires. This conclusion is supported by time-resolved PL decay lifetimes, which are also shown to be significantly higher than previously reported for similar wires. The passivation scheme displays excellent long-term stability (>7 months) and is additionally shown to substantially improve the thermal stability of InP surfaces (>300 °C), significantly expanding the temperature window for device processing. Such effective surface passivation is a key enabling technology for InP nanowire devices such as nanolasers and solar cells. PMID:28885032

Extensive white piedra of the scalp caused by Trichosporon inkin: A case report and review of literature.

PubMed

Shivaprakash, M R; Singh, Gagandeep; Gupta, Prerna; Dhaliwal, Manpreet; Kanwar, A J; Chakrabarti, A

2011-12-01

Trichosporon species cause wide varieties of fungal infections. White piedra, a superficial fungal infection on the hair shaft, is caused by Trichosporon species. We report here a case of white piedra over the scalp due to T. inkin, a rarely isolated pathogen from such a lesion. The identification of the fungus was confirmed on the basis of morphology, carbohydrate assimilation tests, and sequencing of the ITS region of rDNA. The available literature on infections due to T. inkin is also reviewed.

Use of Multiple Sequencing Technologies To Produce a High-Quality Genome of the Fungus Pseudogymnoascus destructans, the Causative Agent of Bat White-Nose Syndrome.

PubMed

Drees, Kevin P; Palmer, Jonathan M; Sebra, Robert; Lorch, Jeffrey M; Chen, Cynthia; Wu, Cheng-Cang; Bok, Jin Woo; Keller, Nancy P; Blehert, David S; Cuomo, Christina A; Lindner, Daniel L; Foster, Jeffrey T

2016-06-30

White-nose syndrome has recently emerged as one of the most devastating wildlife diseases recorded, causing widespread mortality in numerous bat species throughout eastern North America. Here, we present an improved reference genome of the fungal pathogen Pseudogymnoascus destructans for use in comparative genomic studies. Copyright © 2016 Drees et al.

Emerging infectious disease implications of invasive mammalian species: the greater white-toothed shrew (Crocidura russula) is associated with a novel serovar of pathogenic Leptospira in Ireland

USDA-ARS?s Scientific Manuscript database

The greater white-toothed shrew (Crocidura russula) is an invasive mammalian species that was first recorded in Ireland in 2007. It currently occupies an area of approximately 7,600 km2 on the island. C. russula is normally distributed in Northern Africa and Western Europe, and was previously absent...

Birefringent Crystals and Abdominal Discoloration in the Predatory Mite Phytoseiulus persimilis (Acari: Phytoseiidae)

PubMed

Bjørnson; Steiner; Keddie

1997-03-01

In response to grower complaints of poor performance of Phytoseiulus persimilis, mites from 14 commercial insectaries and research colonies were examined for pathogens. Some were found to have abdominal discolorations, manifested initially as two white stripes along the dorsal sides of the body within the Malpighian tubules. Advanced signs appeared as a large, centrally located, white spot or U-shaped discoloration in the distal opisthosoma within the rectum/anal atrium. White material often accumulated and hardened within the anus and formed a rectal plug that inhibited further excretion. Most affected mites were lethargic. Adults and immatures with abdominal discoloration contained numerous densely packed, birefringent, dumbbell-shaped entities. Though occasionally observed in the colon, they occurred most frequently within the Malpighian tubules and/or rectum and anal atrium. Dumbbells measured 2-4 &mgr;m long and contained prominent concentric rings. When observed by transmission electron microscopy, the entities lacked cellular organelles. Asymptomatic mites contained few or no such entities. Dumbbell-shaped inclusions were observed in P. persimilis from all sources examined. High levels of potassium, low levels of phosphorous and sulfur, and traces of chlorine were detected by energy-dispersive X-ray analysis. Guanine and uric acid, known nitrogenous wastes of arachnids, do not contain these elements. The chemical composition and structure indicate that the dumbbells are crystals. Both asymptomatic mites and those specimens exhibiting abdominal discoloration were examined for pathogens using light and transmission electron microscopy. Microsporidia, virus-like particles, and a rickettsia (genus Wolbachia) were observed in some mites but showed no correlation with white abdominal discoloration or associated crystal formation. Neither were pathogens always detected in symptomatic mites. Although birefringent crystals may be naturally occurring excretory products, the cause of white abdominal signs associated with crystal accumulation in P. persimilis is unknown. These signs indicate overall poor health.

Discovery of a “White-Gray-Opaque” Tristable Phenotypic Switching System in Candida albicans: Roles of Non-genetic Diversity in Host Adaptation

PubMed Central

Guan, Guobo; Dai, Yu; Nobile, Clarissa J.; Liang, Weihong; Cao, Chengjun; Zhang, Qiuyu; Zhong, Jin; Huang, Guanghua

2014-01-01

Non-genetic phenotypic variations play a critical role in the adaption to environmental changes in microbial organisms. Candida albicans, a major human fungal pathogen, can switch between several morphological phenotypes. This ability is critical for its commensal lifestyle and for its ability to cause infections. Here, we report the discovery of a novel morphological form in C. albicans, referred to as the “gray” phenotype, which forms a tristable phenotypic switching system with the previously reported white and opaque phenotypes. White, gray, and opaque cell types differ in a number of aspects including cellular and colony appearances, mating competency, secreted aspartyl proteinase (Sap) activities, and virulence. Of the three cell types, gray cells exhibit the highest Sap activity and the highest ability to cause cutaneous infections. The three phenotypes form a tristable phenotypic switching system, which is independent of the regulation of the mating type locus (MTL). Gray cells mate over 1,000 times more efficiently than do white cells, but less efficiently than do opaque cells. We further demonstrate that the master regulator of white-opaque switching, Wor1, is essential for opaque cell formation, but is not required for white-gray transitions. The Efg1 regulator is required for maintenance of the white phenotype, but is not required for gray-opaque transitions. Interestingly, the wor1/wor1 efg1/efg1 double mutant is locked in the gray phenotype, suggesting that Wor1 and Efg1 could function coordinately and play a central role in the regulation of gray cell formation. Global transcriptional analysis indicates that white, gray, and opaque cells exhibit distinct gene expression profiles, which partly explain their differences in causing infections, adaptation ability to diverse host niches, metabolic profiles, and stress responses. Therefore, the white-gray-opaque tristable phenotypic switching system in C. albicans may play a significant role in a wide range of biological aspects in this common commensal and pathogenic fungus. PMID:24691005

Discovery of a "white-gray-opaque" tristable phenotypic switching system in candida albicans: roles of non-genetic diversity in host adaptation.

PubMed

Tao, Li; Du, Han; Guan, Guobo; Dai, Yu; Nobile, Clarissa J; Liang, Weihong; Cao, Chengjun; Zhang, Qiuyu; Zhong, Jin; Huang, Guanghua

2014-04-01

Non-genetic phenotypic variations play a critical role in the adaption to environmental changes in microbial organisms. Candida albicans, a major human fungal pathogen, can switch between several morphological phenotypes. This ability is critical for its commensal lifestyle and for its ability to cause infections. Here, we report the discovery of a novel morphological form in C. albicans, referred to as the "gray" phenotype, which forms a tristable phenotypic switching system with the previously reported white and opaque phenotypes. White, gray, and opaque cell types differ in a number of aspects including cellular and colony appearances, mating competency, secreted aspartyl proteinase (Sap) activities, and virulence. Of the three cell types, gray cells exhibit the highest Sap activity and the highest ability to cause cutaneous infections. The three phenotypes form a tristable phenotypic switching system, which is independent of the regulation of the mating type locus (MTL). Gray cells mate over 1,000 times more efficiently than do white cells, but less efficiently than do opaque cells. We further demonstrate that the master regulator of white-opaque switching, Wor1, is essential for opaque cell formation, but is not required for white-gray transitions. The Efg1 regulator is required for maintenance of the white phenotype, but is not required for gray-opaque transitions. Interestingly, the wor1/wor1 efg1/efg1 double mutant is locked in the gray phenotype, suggesting that Wor1 and Efg1 could function coordinately and play a central role in the regulation of gray cell formation. Global transcriptional analysis indicates that white, gray, and opaque cells exhibit distinct gene expression profiles, which partly explain their differences in causing infections, adaptation ability to diverse host niches, metabolic profiles, and stress responses. Therefore, the white-gray-opaque tristable phenotypic switching system in C. albicans may play a significant role in a wide range of biological aspects in this common commensal and pathogenic fungus.

Toxic effects of boron on growth and antioxidant system parameters of maize (Zea mays L.) roots.

PubMed

Esim, Nevzat; Tiryaki, Deniz; Karadagoglu, Omer; Atici, Okkes

2013-10-01

The aim of this study was to investigate the possible oxidative stress and the antioxidant response, which were caused on maize by boron (B). For this, 11- and 15-day-old maize seedlings were subjected to 2 or 4 mM B in the form of boric acid (H₃BO₃) for 2 and/or 6 days. At the end of the treatment period, root length, hydrogen peroxide (H₂O₂) content, malondialdehyde (MDA) content and the antioxidant enzymes superoxide dismutase (SOD), peroxidase (POX) and catalase (CAT) were measured. The results revealed that root length of plants, activity of antioxidative enzymes such as SOD, POX and CAT and also H₂O₂ contents and MDA levels were seriously affected by excess B. These results suggested that the oxidative stress occurred due to the toxic effect of B.

Poly(1,3,4-oxadiazoles) via aromatic nucleophilic displacement

NASA Technical Reports Server (NTRS)

Connell, John W. (Inventor); Hergenrother, Paul M. (Inventor); Wolf, Peter (Inventor)

1992-01-01

Poly(1,3,4-oxadiazoles) (POX) are prepared by the aromatic nucleophilic displacement reaction of di(hydroxyphenyl) 1,3,4-oxadiazole monomers with activated aromatic dihalides or activated aromatic dinitro compounds. The polymerizations are carried out in polar aprotic solvents such as sulfolane or diphenylsulfone using alkali metal bases such as potassium carbonate at elevated temperatures under nitrogen. The di(hydroxyphenyl) 1,3,4-oxadiazole monomers are synthesized by reacting 4-hydroxybenzoic hydrazide with phenyl 4-hydrobenzoate in the melt and also by reacting aromatic dihydrazides with two moles of phenyl 4-hydroxybenzoate in the melt. This synthetic route has provided high molecular weight POX of new chemical structure, is economically and synthetically more favorable than other routes, and allows for facile chemical structure variation due to the large variety of activated aromatic dihalides which are available.

THE INFLUENCE PRODUCED BY HIGH GAMMA-RAY DOSES ON SOME PROPERTIES OF THE VIRUSES (in Russian)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bektemirov, T.A.

1961-10-01

The effects produced by gamma rays on infectious, hemagglutinating, and antigenic properties common to the viruses of sneall-pox vaccine and those of infiuenze (grippe) and poliomyelitis were studied. All the viruses were grown on a monostratal culture of a renal epithelium taken from semians. Complete suppression of the vital activity appeared with a dose of 15 x 10/sup 5/ gm for the virus of influenza, 20 x 10/sup 5/ for the virus of small-pox, and 40 x 10/ sup 5/ for that of poliomyelitis. Hemagglutinins of the infiuenza and smallpox viruses became fulIy destroyed at a dose of 30 xmore » 10/sup 5/ gm. The irradiation caused the antigenic properties of the viruses under study to decline. (auth)« less

A Multiwavelength Study of POX 52, a Dwarf Seyfert Galaxy with an Intermediate Mass Black Hole

NASA Astrophysics Data System (ADS)

Barth, Aaron

2004-09-01

POX 52 is a Seyfert 1 galaxy with unprecedented properties: its host galaxy is a dwarf elliptical, and its stellar velocity dispersion is only 36 km/s. The stellar velocity dispersion and the broad emission-line widths both suggest a black hole mass of order 10^5 solar masses. We request HST ACS/HRC imaging to perform a definitive measurement of the host galaxy structure; STIS UV and optical spectroscopy to study the nonstellar continuum and the structure of the broad-line region; and Chandra ACIS imaging to investigate the spectral and variability properties of the X-ray emission. The results of this program will give a detailed understanding of the host galaxy and accretion properties of one of the very few known black holes in the mass range around 10^5 solar masses.

[Apical petrositis, osteomyelitis of the base of the skull bones and of the first cervical vertebra in a 5 year-old children following chicken pox].

PubMed

Bogomil'sky, M R; Polunin, M M; Zelikovich, E I; Soldatsky, Yu L; Burova, O V

2016-01-01

This publication was designed to describe a rare case of development of apicalpetrositis in a child presenting with acute otitis mediafollowing chicken pox experienced in the preceding period. We carried out the study with the use of computed tomography (CT) that demonstrated destruction of the temporal bone, bones of the base of the skull and of the first cervical vertebra. The treatment strategy chosen for the management of this condition that included antibiotic therapy and expectant observation proved justified and can be recommended as an algorithm of choice taking into consideration the difficulty of surgical approach to the apex of the petrous pyramid. However, this approach is associated with the high risk of disability arising from the potential injury to the craniocerebral nerves.

Cross-Dehydrogenative Coupling Reactions Between P(O)-H and X-H (X = S, N, O, P) Bonds.

PubMed

Hosseinian, Akram; Farshbaf, Sepideh; Fekri, Leila Zare; Nikpassand, Mohammad; Vessally, Esmail

2018-05-26

P(O)-X (X = S, N, O, P) bond-containing compounds have extensive application in medicinal chemistry, agrochemistry, and material chemistry. These useful organophosphorus compounds also have many applications in organic synthesis. In light of the importance of titled compounds, there is continuing interest in the development of synthetic methods for P(O)-X bonds construction. In the last 4 years, the direct coupling reaction of P(O)-H compounds with thiols, alcohols, and amines/amides has received much attention because of the atom-economic character. This review aims to give an overview of new developments in cross-dehydrogenative coupling reactions between P(O)-H and X-H (X = S, N, O, P) bonds, with special emphasis on the mechanistic aspects of the reactions.

Early plant growth and biochemical responses induced by Azospirillum brasilense Sp245 lipopolysaccharides in wheat (Triticum aestivum L.) seedlings are attenuated by procyanidin B2.

PubMed

Vallejo-Ochoa, Juan; López-Marmolejo, Mariel; Hernández-Esquivel, Alma Alejandra; Méndez-Gómez, Manuel; Suárez-Soria, Laura Nicolasa; Castro-Mercado, Elda; García-Pineda, Ernesto

2018-03-01

This study analyzes the effects of procyanidin B2 on early wheat plant growth and plant biochemical responses promoted by lipopolysaccharides (LPS) derived from the rhizobacteria Azospirillum brasilense Sp245. Measurements of leaf, root length, fresh weight, and dry weight showed in vitro plant growth stimulation 4 days after treatment with A. brasilense as well as LPS. Superoxide anion (O 2 ·- ) and hydrogen peroxide (H 2 O 2 ) levels increased in seedling roots treated with LPS (100 μg mL -1 ). The chlorophyll content in leaf decreased while the starch content increased 24 h after treatment in seedling roots. The LPS treatment induced a high increase in total peroxidase (POX) (EC 1.11.1.7) activity and ionically bound cell wall POX content in roots, when compared to respective controls. Early plant growth and biochemical responses observed in wheat seedlings treated with LPS were inhibited by the addition of procyanidin B2 (5 μg mL -1 ), a B type proanthocyanidin (PAC), plant-derived polyphenolic compound with binding properties of LPS. All results suggest first that the ionically bound cell wall POX enzymes could be a molecular target of A. brasilense LPS, and second that the recognition or association of LPS by plant cells is required to activate plant responses. This last event could play a critical role during plant growth regulation by A. brasilense LPS.

Effects of UV-B irradiation on isoforms of antioxidant enzymes and their activities in red alga Grateloupia filicina (Rhodophyta)

NASA Astrophysics Data System (ADS)

Zhao, Jiqiang; Li, Lixia

2014-11-01

Macroalgae in a littoral zone are inevitably exposed to UV-B irradiance. We analyzed the effects of UV-B on isoenzyme patterns and activities of superoxide dismutase (SOD), peroxidase (POX), catalase (CAT), and ascorbate peroxidase (APX) of red algae Grateloupia filicina (Lamour.) C. Agardh. The activities of SOD, CAT, and APX changed in response to UV-B in a time- and dose-dependent manner. POX activity increased significantly under all three UV-B treatments. The enzymatic assay showed three distinct bands of SODI (Mn-SOD), SODII (Fe-SOD), and SODIII (CuZn-SOD) under a low (Luv) and medium (Muv) dose of UV-B irradiation, while SODI and SODIII activities decreased significantly when exposed to a high dose of UV-B irradiation (Huv). The activity of POX isoenzymes increased significantly after exposure to UV-B, which is consistent with the total activity. In addition, a clear decrease in activity of CATIV was detected in response to all the three doses of UV treatments. Some bands of APX isoenzyme were also clearly influenced by UV-B irradiation. Correspondingly, the daily growth rate declined under all the three exposure doses, and was especially significant under Muv and Huv treatments. These data suggest that, although the protection mechanisms of antioxidant defense system are partly inducible by UV-B to prevent the damage, G. filicina has incomplete tolerance to higher UV-B irradiation stress.

Prevalence of renal lesions in slaughtered cattle in Shiraz, Iran, and detection of Leptospira in them by nested PCR-RFLP.

PubMed

Taghadosi, Vahideh; Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Samiei, Azadeh

2016-12-01

Renal diseases in cattle are frequently not recognized due to the subclinical conditions. Some species of Leptospira are the main cause of infectious agents that damage the kidneys and lead to abortion and economic losses in cattle and are also of major concern in the public health. This study was aimed to assess the prevalence of renal lesions of slaughtered cattle in the Shiraz abattoir and to determine the correlation between rejected kidneys and infection with Leptospira using nested PCR-restriction fragment length polymorphism (RFLP) techniques. Out of 1000 inspected animals, 205 (20.5 %) revealed the renal lesions. Chronic nephritis (7.5 %), white-spotted kidney (7.3 %), and petechial hemorrhage (3.5 %) were the most prevalent forms of the lesions. A direct correlation between increasing the age and significant increase in the rate of lesions was also observed (P = 0.03). Using nested PCR-RFLP assay, 40.8 % of the tested kidneys were turned to be infected to the pathogenic species of Leptospira. The risk of infection of the kidneys with white spot to pathogenic species of Leptospira (53.8 %) was more than that of the kidneys with other lesions (25.0 %) (P = 0.014). The odd ratio indicates that the kidneys with white spot lesions are likely to be infected with pathogenic species of Leptospira, five times greater than other lesions. This study showed that renal lesions especially white-spotted kidney, which were considerably associated with Leptospira in slaughtered cattle in Shiraz, were very high. This is important in terms of public health and in particular, increases the risk of transmission of disease to human specially in the high-risk careers including farmers, veterinarians, and abattoir workers.

Reductions in human Lyme disease risk due to the effects of oral vaccination on tick-to-mouse and mouse-to-tick transmission.

PubMed

Voordouw, Maarten J; Tupper, Haley; Önder, Özlem; Devevey, Godefroy; Graves, Christopher J; Kemps, Brian D; Brisson, Dustin

2013-04-01

Vaccinating wildlife is becoming an increasingly popular method to reduce human disease risks from pathogens such as Borrelia burgdorferi, the causative agent of Lyme disease. To successfully limit human disease risk, vaccines targeting the wildlife reservoirs of B. burgdorferi must be easily distributable and must effectively reduce pathogen transmission from infected animals, given that many animals in nature will be infected prior to vaccination. We assessed the efficacy of an easily distributable oral bait vaccine based on the immunogenic outer surface protein A (OspA) to protect uninfected mice from infection and to reduce transmission from previously infected white-footed mice, an important reservoir host of B. burgdorferi. Oral vaccination of white-footed mice effectively reduces transmission of B. burgdorferi at both critical stages of the Lyme disease transmission cycle. First, oral vaccination of uninfected white-footed mice elicits an immune response that protects mice from B. burgdorferi infection. Second, oral vaccination of previously infected mice significantly reduces the transmission of B. burgdorferi to feeding ticks despite a statistically nonsignificant immune response. We used the estimates of pathogen transmission to and from vaccinated and unvaccinated mice to model the efficacy of an oral vaccination campaign targeting wild white-footed mice. Projection models suggest that the effects of the vaccine on both critical stages of the transmission cycle of B. burgdorferi act synergistically in a positive feedback loop to reduce the nymphal infection prevalence, and thus human Lyme disease risk, well below what would be expected from either effect alone. This study suggests that oral immunization of wildlife with an OspA-based vaccine can be a promising long-term strategy to reduce human Lyme disease risk.

Sequencing and de novo analysis of the hemocytes transcriptome in Litopenaeus vannamei response to white spot syndrome virus infection.

PubMed

Xue, Shuxia; Liu, Yichen; Zhang, Yichen; Sun, Yan; Geng, Xuyun; Sun, Jinsheng

2013-01-01

White spot syndrome virus (WSSV) is a causative pathogen found in most shrimp farming areas of the world and causes large economic losses to the shrimp aquaculture. The mechanism underlying the molecular pathogenesis of the highly virulent WSSV remains unknown. To better understand the virus-host interactions at the molecular level, the transcriptome profiles in hemocytes of unchallenged and WSSV-challenged shrimp (Litopenaeus vannamei) were compared using a short-read deep sequencing method (Illumina). RNA-seq analysis generated more than 25.81 million clean pair end (PE) reads, which were assembled into 52,073 unigenes (mean size = 520 bp). Based on sequence similarity searches, 23,568 (45.3%) genes were identified, among which 6,562 and 7,822 unigenes were assigned to gene ontology (GO) categories and clusters of orthologous groups (COG), respectively. Searches in the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG) mapped 14,941 (63.4%) unigenes to 240 KEGG pathways. Among all the annotated unigenes, 1,179 were associated with immune-related genes. Digital gene expression (DGE) analysis revealed that the host transcriptome profile was slightly changed in the early infection (5 hours post injection) of the virus, while large transcriptional differences were identified in the late infection (48 hpi) of WSSV. The differentially expressed genes mainly involved in pattern recognition genes and some immune response factors. The results indicated that antiviral immune mechanisms were probably involved in the recognition of pathogen-associated molecular patterns. This study provided a global survey of host gene activities against virus infection in a non-model organism, pacific white shrimp. Results can contribute to the in-depth study of candidate genes in white shrimp, and help to improve the current understanding of host-pathogen interactions.

Direct Detection of Fungal Siderophores on Bats with White-Nose Syndrome via Fluorescence Microscopy-Guided Ambient Ionization Mass Spectrometry

PubMed Central

Mascuch, Samantha J.; Moree, Wilna J.; Hsu, Cheng-Chih; Turner, Gregory G.; Cheng, Tina L.; Blehert, David S.; Kilpatrick, A. Marm; Frick, Winifred F.; Meehan, Michael J.; Dorrestein, Pieter C.; Gerwick, Lena

2015-01-01

White-nose syndrome (WNS) caused by the pathogenic fungus Pseudogymnoascus destructans is decimating the populations of several hibernating North American bat species. Little is known about the molecular interplay between pathogen and host in this disease. Fluorescence microscopy ambient ionization mass spectrometry was used to generate metabolic profiles from the wings of both healthy and diseased bats of the genus Myotis. Fungal siderophores, molecules that scavenge iron from the environment, were detected on the wings of bats with WNS, but not on healthy bats. This work is among the first examples in which microbial molecules are directly detected from an infected host and highlights the ability of atmospheric ionization methodologies to provide direct molecular insight into infection. PMID:25781976

Direct detection of fungal siderophores on bats with white-nose syndrome via fluorescence microscopy-guided ambient ionization mass spectrometry

USGS Publications Warehouse

Mascuch, Samantha J.; Moree, Wilna J.; Cheng-Chih Hsu, Cheng-Chih; Turner, Gregory G.; Cheng, Tina L.; Blehert, David S.; Kilpatrick, A. Marm; Frick, Winifred F.; Meehan, Michael J.; Dorrestein, Pieter C.; Gerwick, Lena

2015-01-01

White-nose syndrome (WNS) caused by the pathogenic fungus Pseudogymnoascus destructans is decimating the populations of several hibernating North American bat species. Little is known about the molecular interplay between pathogen and host in this disease. Fluorescence microscopy ambient ionization mass spectrometry was used to generate metabolic profiles from the wings of both healthy and diseased bats of the genus Myotis. Fungal siderophores, molecules that scavenge iron from the environment, were detected on the wings of bats with WNS, but not on healthy bats. This work is among the first examples in which microbial molecules are directly detected from an infected host and highlights the ability of atmospheric ionization methodologies to provide direct molecular insight into infection.

Conservation implications of physiological carry-over effects in bats recovering from white-nose syndrome.

PubMed

Davy, Christina M; Mastromonaco, Gabriela F; Riley, Julia L; Baxter-Gilbert, James H; Mayberry, Heather; Willis, Craig K R

2017-06-01

Although it is well documented that infectious diseases can pose threats to biodiversity, the potential long-term consequences of pathogen exposure on individual fitness and its effects on population viability have rarely been studied. We tested the hypothesis that pathogen exposure causes physiological carry-over effects with a pathogen that is uniquely suited to this question because the infection period is specific and time limited. The fungus Pseudogymnoascus destructans causes white-nose syndrome (WNS) in hibernating bats, which either die due to the infection while hibernating or recover following emergence from hibernation. The fungus infects all exposed individuals in an overwintering site simultaneously, and bats that survive infection during hibernation clear the pathogen within a few weeks following emergence. We quantified chronic stress during the active season, when bats are not infected, by measuring cortisol in bat claws. Free-ranging Myotis lucifugus who survived previous exposure to P. destructans had significantly higher levels of claw cortisol than naïve individuals. Thus, cryptic physiological carry-over effects of pathogen exposure may persist in asymptomatic, recovered individuals. If these effects result in reduced survival or reproductive success, they could also affect population viability and even act as a third stream in the extinction vortex. For example, significant increases in chronic stress, such as those indicated here, are correlated with reduced reproductive success in a number of species. Future research should directly explore the link between pathogen exposure and the viability of apparently recovered populations to improve understanding of the true impacts of infectious diseases on threatened populations. © 2016 Society for Conservation Biology.

Effects of Grosmannia clavigera and Leptographium longiclavatum on Western White Pine seedlings and the fungicidal activity of Alamo®, Arbotect®, and TREE-age®

Treesearch

Stephen A. Wyka; Joseph J. Doccola; Brian L. Strom; Sheri L. Smith; Douglas W. McPherson; Srdan G. Acimovic; Kier D. Klepzig

2016-01-01

Bark beetles carry a number of associated organisms that are transferred to the host tree upon attack that are thought to play a role in tree decline. To assess the pathogenicity to western white pine (WWP; Pinus monticola) of fungi carried by the mountain pine beetle (MPB; Dendroctonus ponderosae), and to evaluate the...

A method for estimating white pine blister rust canker age on limber pine in the central Rocky Mountains

Treesearch

Holly S. J. Kearns; William R. Jacobi; Brian W. Geils

2009-01-01

Epidemiological studies of white pine blister rust on limber pine require a temporal component to explain variations in incidence of infection and mortality. Unfortunately, it is not known how long the pathogen has been present at various sites in the central Rocky Mountains of North America. Canker age, computed from canker length and average expansion rate, can be...

Past and current investigations of the genetic resistance to cronartium ribicola in high-elevation five-needle pines

Treesearch

Richard A. Sniezko; Mary F. Mahalovich; Anna W. Schoettle; Detlev R. Vogler

2011-01-01

All nine species of white pines native to the U.S. or Canada are susceptible to the introduced pathogen Cronartium ribicola. Of the six high elevation white pine species, the severe infection and mortality levels of Pinus albicaulis have been the most documented, but blister rust also impacts P. aristata, P. balfouriana, P. flexilis and P. strobiformis; only P....

Biophysical characteristics influencing growth and abundance of western white pine (Pinus monticola) across spatial scales in the Coeur d'Alene River Basin, Idaho

Treesearch

Theresa Jain

2001-01-01

During the past 50 years the moist forests of northern Idaho changed from being dominated by western white pine (Pinus monticola), an early sera! species, to ones dominated by late serial species, grand fir (Abies grandis) and western hemlock (Tsuga heterophylla). Variable fire regimes, successional processes and endemic insects and pathogens worked in concert to...

Effects of tick control by acaricide self-treatement of white-tailed deer on host-seeking tick infection prevalence and entomologic risk for Ixodes scapularis-borne pathogens

USDA-ARS?s Scientific Manuscript database

We evaluated the effects of tick control by acaricide self-treatment of white-tailed deer on the infection prevalence and entomologic risk for three I. scapularis-borne bacteria in host-seeking ticks. Ticks were collected from vegetation in areas treated with the ‘4-Poster’ device and from control a...

Thermal inactivation of H5N2 high-pathogenicity avian influenza virus in dried egg white with 7.5% moisture.

PubMed

Thomas, Colleen; Swayne, David E

2009-09-01

High-pathogenicity avian influenza viruses (HPAIV) cause severe systemic disease with high mortality in chickens. Isolation of HPAIV from the internal contents of chicken eggs has been reported, and this is cause for concern because HPAIV can be spread by movement of poultry products during marketing and trade activity. This study presents thermal inactivation data for the HPAIV strain A/chicken/PA/1370/83 (H5N2) (PA/83) in dried egg white with a moisture content (7.5%) similar to that found in commercially available spray-dried egg white products. The 95% upper confidence limits for D-values calculated from linear regression of the survival curves at 54.4, 60.0, 65.5, and 71.1 degrees C were 475.4, 192.2, 141.0, and 50.1 min, respectively. The line equation y = [0.05494 x degrees C] + 5.5693 (root mean square error = 0.0711) was obtained by linear regression of experimental D-values versus temperature. Conservative predictions based on the thermal inactivation data suggest that standard industry pasteurization protocols would be very effective for HPAIV inactivation in dried egg white. For example, these calculations predict that a 7-log reduction would take only 2.6 days at 54.4 degrees C.

Protection of White Leghorn chickens by U.S. emergency H5 vaccines against clade 2.3.4.4 H5N2 high pathogenicity avian influenza virus

USDA-ARS?s Scientific Manuscript database

During December 2014-June 2015, the U.S. experienced a high pathogenicity avian influenza (HPAI) outbreak caused by clade 2.3.4.4 H5Nx Goose/Guangdong lineage viruses which was the worst HPAI event for the poultry industry. Three vaccines, developed based on updating existing registered vaccines or ...

Evaluation of Three Vaccine Technologies to Protect White leghorn Chickens from H5N2 clade 2.3.4.4 Gs/GD High Pathogenicity Avian Influenza

USDA-ARS?s Scientific Manuscript database

During December 2014-June 2015, the USA experienced a high pathogenicity avian influenza (HPAI) outbreak caused by clade 2.3.4.4 H5Nx Goose/Guangdong lineage viruses which was the worst HPAI event for the USA’s poultry industries. Three emergency vaccines, based on updating existing registered vacc...

Developing proactive management options to sustain bristlecone and limber pine ecosystems in the presence of a non-native pathogen

Treesearch

A. W. Schoettle

2004-01-01

Limber pine and Rocky Mountain bristlecone pine are currently threatened by the non-native pathogen white pine blister rust (WPBR). Limber pine is experiencing mortality in the Northern Rocky Mountains and the infection front continues to move southward. The first report of WPBR on Rocky Mountain bristlecone pine was made in 2003 (Blodgett and Sullivan 2004), at a site...

Long-Term Persistence of Pseudogymnoascus destructans, the Causative Agent of White-Nose Syndrome, in the Absence of Bats.

PubMed

Hoyt, Joseph R; Langwig, Kate E; Okoniewski, Joseph; Frick, Winifred F; Stone, Ward B; Kilpatrick, A Marm

2015-06-01

Wildlife diseases have been implicated in the declines and extinctions of several species. The ability of a pathogen to persist outside its host, existing as an "environmental reservoir", can exacerbate the impact of a disease and increase the likelihood of host extinction. Pseudogymnoascus destructans, the fungal pathogen that causes white-nose syndrome in bats, has been found in cave soil during the summer when hibernating bats had likely been absent for several months. However, whether the pathogen can persist over multiple years in the absence of bats is unknown, and long-term persistence of the pathogen can influence whether hibernacula where bats have been locally extirpated due to disease can be subsequently recolonized. Here, we show that P. destructans is capable of long-term persistence in the laboratory in the absence of bats. We cultured P. destructans from dried agar plates that had been kept at 5°C and low humidity conditions (30-40% RH) for more than 5 years. This suggests that P. destructans can persist in the absence of bats for long periods which may prevent the recolonization of hibernation, sites where bat populations were extirpated. This increases the extinction risk of bats affected by this disease.

Host and pathogen ecology drive the seasonal dynamics of a fungal disease, white-nose syndrome.

PubMed

Langwig, Kate E; Frick, Winifred F; Reynolds, Rick; Parise, Katy L; Drees, Kevin P; Hoyt, Joseph R; Cheng, Tina L; Kunz, Thomas H; Foster, Jeffrey T; Kilpatrick, A Marm

2015-01-22

Seasonal patterns in pathogen transmission can influence the impact of disease on populations and the speed of spatial spread. Increases in host contact rates or births drive seasonal epidemics in some systems, but other factors may occasionally override these influences. White-nose syndrome, caused by the emerging fungal pathogen Pseudogymnoascus destructans, is spreading across North America and threatens several bat species with extinction. We examined patterns and drivers of seasonal transmission of P. destructans by measuring infection prevalence and pathogen loads in six bat species at 30 sites across the eastern United States. Bats became transiently infected in autumn, and transmission spiked in early winter when bats began hibernating. Nearly all bats in six species became infected by late winter when infection intensity peaked. In summer, despite high contact rates and a birth pulse, most bats cleared infections and prevalence dropped to zero. These data suggest the dominant driver of seasonal transmission dynamics was a change in host physiology, specifically hibernation. Our study is the first, to the best of our knowledge, to describe the seasonality of transmission in this emerging wildlife disease. The timing of infection and fungal growth resulted in maximal population impacts, but only moderate rates of spatial spread. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Host and pathogen ecology drive the seasonal dynamics of a fungal disease, white-nose syndrome

PubMed Central

Langwig, Kate E.; Frick, Winifred F.; Reynolds, Rick; Parise, Katy L.; Drees, Kevin P.; Hoyt, Joseph R.; Cheng, Tina L.; Kunz, Thomas H.; Foster, Jeffrey T.; Kilpatrick, A. Marm

2015-01-01

Seasonal patterns in pathogen transmission can influence the impact of disease on populations and the speed of spatial spread. Increases in host contact rates or births drive seasonal epidemics in some systems, but other factors may occasionally override these influences. White-nose syndrome, caused by the emerging fungal pathogen Pseudogymnoascus destructans, is spreading across North America and threatens several bat species with extinction. We examined patterns and drivers of seasonal transmission of P. destructans by measuring infection prevalence and pathogen loads in six bat species at 30 sites across the eastern United States. Bats became transiently infected in autumn, and transmission spiked in early winter when bats began hibernating. Nearly all bats in six species became infected by late winter when infection intensity peaked. In summer, despite high contact rates and a birth pulse, most bats cleared infections and prevalence dropped to zero. These data suggest the dominant driver of seasonal transmission dynamics was a change in host physiology, specifically hibernation. Our study is the first, to the best of our knowledge, to describe the seasonality of transmission in this emerging wildlife disease. The timing of infection and fungal growth resulted in maximal population impacts, but only moderate rates of spatial spread. PMID:25473016

Recent insights into host-pathogen interaction in white spot syndrome virus infected penaeid shrimp.

PubMed

Shekhar, M S; Ponniah, A G

2015-07-01

Viral disease outbreaks are a major concern impeding the development of the shrimp aquaculture industry. The viral disease due to white spot syndrome virus (WSSV) observed in early 1990s still continues unabated affecting the shrimp farms and cause huge economic loss to the shrimp aquaculture industry. In the absence of effective therapeutics to control WSSV, it is important to understand viral pathogenesis and shrimp response to WSSV at the molecular level. Identification and molecular characterization of WSSV proteins and receptors may facilitate in designing and development of novel therapeutics and antiviral drugs that may inhibit viral replication. Investigations into host-pathogen interactions might give new insights to viral infectivity, tissue tropism and defence mechanism elicited in response to WSSV infection. However, due to the limited information on WSSV gene function and host immune response, the signalling pathways which are associated in shrimp pathogen interaction have also not been elucidated completely. In the present review, the focus is on those shrimp proteins and receptors that are potentially involved in virus infection or in the defence mechanism against WSSV. In addition, the major signalling pathways involved in the innate immune response and the role of apoptosis in host-pathogen interaction is discussed. © 2014 John Wiley & Sons Ltd.

SWINE INFLUENZA

PubMed Central

Lewis, Paul A.; Shope, Richard E.

1931-01-01

1. A hemophilic bacillus has been regularly obtained in culture from the respiratory tract of a series of swine experimentally infected with swine influenza and from a small number of spontaneous field cases of the disease. It has not been observed in respiratory tract cultures from a group of swine free from influenza. 2. The cultural and morphological characters of the organism have been described and the name Hemophilus influenzas (variety suis) suggested. The organism exhibits marked serological diversity, since only two out of eight strains studied were serologically identical. It is usually non-pathogenic for rabbits and white rats, and irregularly pathogenic for white mice. One strain of the organism was pathogenic for guinea pigs while two others were not. 3. Eleven out of thirteen attempts to induce symptoms of disease in swine by intranasal inoculation with pure cultures of H. influenzae suis were entirely negative. The remaining two attempts which suggested a positive result have been discussed. 4. Attention has been called to the marked similarity which exists between non-indol-producing strains of H. influenzae and H. influenzae suis. PMID:19869923

Varicella zoster virus vaccines: potential complications and possible improvements.

PubMed

Silver, Benjamin; Zhu, Hua

2014-10-01

Varicella zoster virus (VZV) is the causative agent of varicella (chicken pox) and herpes zoster (shingles). After primary infection, the virus remains latent in sensory ganglia, and reactivates upon weakening of the cellular immune system due to various conditions, erupting from sensory neurons and infecting the corresponding skin tissue. The current varicella vaccine (v-Oka) is highly attenuated in the skin, yet retains its neurovirulence and may reactivate and damage sensory neurons. The reactivation is sometimes associated with postherpetic neuralgia (PHN), a severe pain along the affected sensory nerves that can linger for years, even after the herpetic rash resolves. In addition to the older population that develops a secondary infection resulting in herpes zoster, childhood breakthrough herpes zoster affects a small population of vaccinated children. There is a great need for a neuro-attenuated vaccine that would prevent not only the varicella manifestation, but, more importantly, any establishment of latency, and therefore herpes zoster. The development of a genetically-defined live-attenuated VZV vaccine that prevents neuronal and latent infection, in addition to primary varicella, is imperative for eventual eradication of VZV, and, if fully understood, has vast implications for many related herpesviruses and other viruses with similar pathogenic mechanisms.

A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'

PubMed Central

Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

2016-01-01

Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum (‘Ca. P. prunorum’) detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor ‘Ca. P. prunorum’ infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect ‘Ca. P. prunorum’ and Plum pox virus (PPV) in Prunus. PMID:26742106

Bat white-nose syndrome: An emerging fungal pathogen?

USGS Publications Warehouse

Blehert, D.S.; Hicks, A.C.; Behr, M.; Meteyer, C.U.; Berlowski-Zier, B. M.; Buckles, E.L.; Coleman, J.T.H.; Darling, S.R.; Gargas, A.; Niver, R.; Okoniewski, J.C.; Rudd, R.J.; Stone, W.B.

2009-01-01

White-nose syndrome (WNS) is a condition associated with an unprecedented bat mortality event in the northeastern United States. Since the winter of 2006*2007, bat declines exceeding 75% have been observed at surveyed hibernacula. Affected bats often present with visually striking white fungal growth on their muzzles, ears, and/or wing membranes. Direct microscopy and culture analyses demonstrated that the skin of WNS-affected bats is colonized by a psychro-philic fungus that is phylogenetically related to Geomyces spp. but with a conidial morphology distinct from characterized members of this genus. This report characterizes the cutaneous fungal infection associated with WNS.

Radiation resistances and decontamination of common pathogenic bacteria contaminated in white scar oyster ( Crassostrea belcheri) in Thailand

NASA Astrophysics Data System (ADS)

Thupila, Nunticha; Ratana-arporn, Pattama; Wilaipun, Pongtep

2011-07-01

In Thailand, white scar oyster ( Crassostrea belcheri) was ranked for premium quality, being most expensive and of high demand. This oyster is often eaten raw, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. As limited alternative methods are available to sterilize the oyster while preserving the raw characteristic, irradiation may be considered as an effective method for decontamination. In this study, the radiation resistance of pathogenic bacteria commonly contaminating the oyster and the optimum irradiation doses for sterilization of the most radiation resistant bacteria were investigated. The radiation decimal reduction doses ( D10) of Salmonella Weltevreden DMST 33380, Vibrio parahaemolyticus ATCC 17802 and Vibrio vulnificus DMST 5852 were determined in broth culture and inoculated oyster homogenate. The D10 values of S. Weltevreden, V. parahaemolyticus and V. vulnificus in broth culture were 0.154, 0.132 and 0.059 kGy, while those of inoculated oyster homogenate were 0.330, 0.159 and 0.140 kGy, respectively. It was found that among the pathogens tested, S. Weltevreden was proved to be the most resistant species. An irradiation dose of 1.5 kGy reduced the counts of 10 5 CFU/g S. Weltevreden inoculated in oyster meat to an undetectable level. The present study indicated that a low-dose irradiation can improve the microbial quality of oyster and further reduce the risks from the food-borne pathogens without adversely affecting the sensory attributes.

Sugars and organic acids in plum fruit affected by Plum pox virus.

PubMed

Usenik, Valentina; Marn, Mojca Virscek

2017-05-01

Plum pox virus (PPV) causes severe economic losses in stone fruit production, but little is known about its effect on plum fruit composition. In this study, the influence of PPV on sugars and organic acids was evaluated in a susceptible plum (Prunus domestica L.) cultivar. PPV infection significantly affected the content and composition of sugars and organic acids. The composition of necrotic tissue was modified the most. A short-time infected tree yielded fruit with similar sugar composition to fruit from a healthy tree, but the decline of organic acids was faster. Prematurely ripened symptomatic fruit had reduced fruit weight and low sugar content. Infected trees of the studied cultivar produce fruit of inferior quality. Fruits are not suitable for processing, especially when most of them exhibit visual symptoms of PPV infection. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Multiwavelength Observations of the Dwarf Seyfert 1 Galaxy POX 52

NASA Astrophysics Data System (ADS)

Thornton, Carol E.; Barth, A. J.; Ho, L. C.; Rutledge, R. E.; Greene, J. E.

2006-12-01

POX 52 is an unusual narrow-line Seyfert 1 galaxy, having an estimated black hole mass of order 105 solar masses and a dwarf host galaxy with an absolute magnitude of only MV = -17.6, which gives us a unique opportunity to study black hole-bulge relations in the low-mass regime. We present new observations from a multiwavelength campaign to study its active nucleus and host galaxy. The data include observations from the Chandra and XMM-Newton Observatories, the Hubble Space Telescope, and the Very Large Array. Chandra data show a highly variable point source with a 2.0 10.0 keV luminosity of 0.7 * 1042 ergs/s. We will also describe the X-ray spectral shape, the structure of the host galaxy as determined from GALFIT modeling of the HST ACS/HRC images, and the spectral energy distribution of the active nucleus.

Efficiency of a solid polymer fuel cell operating on ethanol

NASA Astrophysics Data System (ADS)

Ioannides, Theophilos; Neophytides, Stylianos

The efficiency of a solid polymer fuel cell (SPFC) system operating on ethanol fuel has been analyzed as a function of operating parameters focusing on vehicle and stationary applications. Two types of ethanol processors — employing either steam reforming or partial oxidation (POX) steps — have been considered and their performance has been investigated by thermodynamic analysis. SPFC operation has been analyzed by an available parametric model. It has been found that dilute ethanol-water mixtures (˜55% v/v EtOH) are the most suitable for stationary applications with a steam reformer (SR)-SPFC system. Regarding vehicle applications, pure ethanol (˜95% v/v EtOH) appears to be the best fuel with a POX-SPFC system. Efficiencies in the case of an ideal ethanol processor can be of the order of 60% under low load conditions and 30-35% at peak power, while efficiencies with an actual processor are 80-85% of the above values.

POX 186: the ultracompact blue compact dwarf galaxy reveals its nature

NASA Astrophysics Data System (ADS)

Doublier, V.; Kunth, D.; Courbin, F.; Magain, P.

2000-01-01

High resolution, ground based R and I band observations of the ultra compact dwarf galaxy POX 186 are presented. The data, obtained with the ESO New Technology Telescope (NTT), are analyzed using a new deconvolution algorithm which allows one to resolve the innermost regions of this stellar-like object into three Super-Star Clusters (SSC). Upper limits to both masses (M ~ 105 Msun) and physical sizes (<=60pc) of the SSCs are set. In addition, and maybe most importantly, extended light emission underlying the compact star-forming region is clearly detected in both bands. The R-I color rules out nebular Hα contamination and is consistent with an old stellar population. This casts doubt on the hypothesis that Blue Compact Dwarf Galaxies (BCDG) are young galaxies. based on observations carried out at NTT in La Silla, operated by the European Southern Observatory, during Director's Discretionary Time.

Synergistic Combinations of Multiple Chemotherapeutic Agents in High Capacity Poly(2-oxazoline) Micelles

PubMed Central

Han, Yingchao; He, Zhijian; Schulz, Anita; Bronich, Tatiana K.; Jordan, Rainer; Luxenhofer, Robert; Kabanov, Alexander V.

2012-01-01

Many effective drugs for cancer treatment are poorly water-soluble. In combination chemotherapy, needed excipients in additive formulations are often toxic and restrict their applications in clinical intervention. Here, we report on amphiphilic poly(2-oxazoline)s (POx) micelles as a promising high capacity delivery platform for multi-drug cancer chemotherapy. A variety of binary and ternary drugs combinations of paclitaxel (PTX), docetaxel (DTX), 17-allylamino-17-demethoxygeldanamycin (17-AAG), etoposide (ETO) and bortezomib (BTZ) were solubilized in defined polymeric micelles achieving unprecedented high total loading capacities of up to 50 wt.% drug per final formulation. Multi-drug loaded POx micelles showed enhanced stability in comparison to single-drug loaded micelles. Drug ratio dependent synergistic cytotoxicity of micellar ETO/17-AAG was observed in MCF-7 cancer cells and of micellar BTZ/17-AAG in MCF-7, PC3, MDA-MB-231 and HepG2 cells. PMID:22681126

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

How arbuscular mycorrhizal fungi influence the defense system of sunflower during different abiotic stresses.

PubMed

Mayer, Zoltán; Duc, Nguyen Hong; Sasvári, Zita; Posta, Katalin

2017-12-01

The association between terrestrial plants and arbuscular mycorrhizal (AM) fungi is one of the most common and widespread mutualistic plant-fungi interaction. AM fungi are of beneficial effects on the water and nutrient uptake of plants and increase plant defense mechanisms to alleviate different stresses. The aim of this study was to determine the level of polyphenol oxidase (PPO), guaiacol peroxidase (POX) and glutathione S-transferase (GST) enzyme activities and to track the expression of glutathione S-transferase (GST) gene in plant-arbuscular mycorrhizal system under temperature- and mechanical stress conditions. Our results suggest that induced tolerance of mycorrhizal sunflower to high temperature may be attributed to the induction of GST, POX and PPO enzyme activities as well as to the elevated expression of GST. However, the degree of tolerance of the plant is significantly influenced by the age which is probably justified by the energy considerations.

THE BEHAVIOR OF POX VIRUSES IN THE RESPIRATORY TRACT

PubMed Central

Nelson, John B.

1941-01-01

Fowl pox virus from active skin lesions was established in the upper respiratory tract of normal chickens by nasal instillation and maintained for 12 successive passages. The nasal infection was not communicable by direct contact but did afford protection, for at least 6 weeks, against subsequent development of the virus in the skin. Multiplication of the virus in the nasal passages was only irregularly attended by specific mucosal changes and was not accompanied by the vigorous counter-reaction engendered by the causal agents of roup. The same strain of virus on propagation in embryonated eggs also survived and multiplied in the nasal tract but with somewhat reduced activity, the 34th egg transfer failing to afford complete protection. Nasal instillation in mice was followed only by a reaction in the lung from which the virus was recoverable through the 7th day. PMID:19871128

Multicolor quantum dot-encoded microspheres for the fluoroimmunoassays of chicken newcastle disease and goat pox virus.

PubMed

Yuan, Pingfan; Ma, Qiang; Meng, Rizeng; Wang, Chao; Dou, Wenchao; Wang, Guannan; Su, Xingguang

2009-05-01

Semiconductor nanocrystals (or quantum dots, QDs) have the potential to overcome some of the limitations encountered by traditional fluorophores in fluorescence labeling applications. The unique spectroscopic properties of QDs make them hold immense promise as versatile labels for biological applications. In this work, we employ the layer-by-layer (LbL) method for the construction of bio-functional multicolor QD-encoded microspheres. Polystyrene microspheres with diameter of 3 microm were used as templates for the deposition of different sized CdTe QDs/polyelectrolyte multilayers. Two different antigens, Chicken newcastle disease (CND) antigen and goat pox virus (GPV) antigen, were conjugated to two kinds of biofunctional multicolor microspheres with different optical encoding. The multicolor microspheres can capture corresponding antibodies labeled with QDs, QDs-CND antibody and QDs-GPV antibody in the fluoroimmunoassays. The microspheres can be distinguished from each other based on their optical encoding.

Production of Lycopene in the Non-Carotenoid-Producing Yeast Yarrowia lipolytica

PubMed Central

Ketelhot, Markus; Gatter, Michael; Barth, Gerold

2014-01-01

The codon-optimized genes crtB and crtI of Pantoea ananatis were expressed in Yarrowia lipolytica under the control of the TEF1 promoter of Y. lipolytica. Additionally, the rate-limiting genes for isoprenoid biosynthesis in Y. lipolytica, GGS1 and HMG1, were overexpressed to increase the production of lycopene. All of the genes were also expressed in a Y. lipolytica strain with POX1 to POX6 and GUT2 deleted, which led to an increase in the size of lipid bodies and a further increase in lycopene production. Lycopene is located mainly within lipid bodies, and increased lipid body formation leads to an increase in the lycopene storage capacity of Y. lipolytica. Growth-limiting conditions increase the specific lycopene content. Finally, a yield of 16 mg g−1 (dry cell weight) was reached in fed-batch cultures, which is the highest value reported so far for a eukaryotic host. PMID:24375130

Plague, pox and the physician in Aberdeen, 1495-1516.

PubMed

Jillings, K

2010-03-01

This article discusses responses to disease in Aberdeen during a formative period in the provision of healthcare within the city. The foundation of King's College was followed, in 1497, by the establishment of the first royally endowed university Chair of Medicine in the British Isles, and its first incumbent, James Cumming, was employed by the local government as the first city doctor in 1503. His appointment had been preceded in 1497 by another legislative innovation in Aberdeen, when its council became the first civic body in the British Isles to implement regulations against the threat of the Great Pox (usually considered to be syphilis). It had subsequently to pass measures to prevent the spread of plague to the city, and these were typical of those already imposed elsewhere in Scotland and on the continent. Their apparent success in staving off plague lasted until 1514, when the city was struck by a severe outbreak which lasted two years.

Blister rust resistance among 19 families of whitebark pine, Pinus albicaulis, from Oregon and Washington – early results from an artificial inoculation trial

Treesearch

Angelia Kegley; Richard A. Sniezko; Robert Danchok; Douglas P. Savin

2012-01-01

Whitebark pine is considered one of the most susceptible white pine species to white pine blister rust, the disease caused by the non-native pathogen Cronartium ribicola. High mortality from blister rust and other factors in much of the range in the United States and Canada have raised serious concerns about the future viability of this high-...

[Experimental study of the effects of impulse-electric discharge on chemotaxis and cytoadhesion of urinary infection pathogens].

PubMed

Kuderinov, S K; Azizov, I S; Turgunov, E M; Shambilova, N A

2006-01-01

The aim of the experimental study was to evaluate effects of impulse-electric discharge in liquid on chemotaxis and cytoadhesion of urinary infection pathogens. Chemotaxis was determined in respect to the lung, liver, spleen, kidney, ureter, urinary bladder, urethra of white mice by S. Likholetov's modified method. Cytoadhesion was assessed by V. Brilis. The experiments show that the impulse-electric discharge holds promise for urological practice.

Molecular Mechanisms of White Spot Syndrome Virus Infection and Perspectives on Treatments

PubMed Central

Verbruggen, Bas; Bickley, Lisa K.; van Aerle, Ronny; Bateman, Kelly S.; Stentiford, Grant D.; Santos, Eduarda M.; Tyler, Charles R.

2016-01-01

Since its emergence in the 1990s, White Spot Disease (WSD) has had major economic and societal impact in the crustacean aquaculture sector. Over the years shrimp farming alone has experienced billion dollar losses through WSD. The disease is caused by the White Spot Syndrome Virus (WSSV), a large dsDNA virus and the only member of the Nimaviridae family. Susceptibility to WSSV in a wide range of crustacean hosts makes it a major risk factor in the translocation of live animals and in commodity products. Currently there are no effective treatments for this disease. Understanding the molecular basis of disease processes has contributed significantly to the treatment of many human and animal pathogens, and with a similar aim considerable efforts have been directed towards understanding host–pathogen molecular interactions for WSD. Work on the molecular mechanisms of pathogenesis in aquatic crustaceans has been restricted by a lack of sequenced and annotated genomes for host species. Nevertheless, some of the key host–pathogen interactions have been established: between viral envelope proteins and host cell receptors at initiation of infection, involvement of various immune system pathways in response to WSSV, and the roles of various host and virus miRNAs in mitigation or progression of disease. Despite these advances, many fundamental knowledge gaps remain; for example, the roles of the majority of WSSV proteins are still unknown. In this review we assess current knowledge of how WSSV infects and replicates in its host, and critique strategies for WSD treatment. PMID:26797629

Thermoresponsive Polymers for Nuclear Medicine: Which Polymer Is the Best?

PubMed

Sedláček, Ondřej; Černoch, Peter; Kučka, Jan; Konefal, Rafał; Štěpánek, Petr; Vetrík, Miroslav; Lodge, Timothy P; Hrubý, Martin

2016-06-21

Thermoresponsive polymers showing cloud point temperatures (CPT) in aqueous solutions are very promising for the construction of various systems in biomedical field. In many of these applications these polymers get in contact with ionizing radiation, e.g., if they are used as carriers for radiopharmaceuticals or during radiation sterilization. Despite this fact, radiosensitivity of these polymers is largely overlooked to date. In this work, we describe the effect of electron beam ionizing radiation on the physicochemical and phase separation properties of selected thermoresponsive polymers with CPT between room and body temperature. Stability of the polymers to radiation (doses 0-20 kGy) in aqueous solutions increased in the order poly(N-vinylcaprolactam) (PVCL, the least stable) ≪ poly[N-(2,2-difluoroethyl)acrylamide] (DFP) < poly(N-isopropylacrylamide) (PNIPAM) ≪ poly(2-isopropyl-2-oxazoline-co-2-n-butyl-2-oxazoline) (POX). Even low doses of β radiation (1 kGy), which are highly relevant to the storage of polymer radiotherapeutics and sterilization of biomedical systems, cause significant increase in molecular weight due to cross-linking (except for POX, where this effect is weak). In the case of PVCL irradiated with low doses, the increase in molecular weight induced an increase in the CPT of the polymer. For PNIPAM and DFP, there is strong chain hydrophilization leading to an increase in CPT. From this perspective, POX is the most suitable polymer for the construction of delivery systems that experience exposure to radiation, while PVCL is the least suitable and PNIPAM and DFP are suitable only for low radiation demands.

Nascent Phosphorus Oxide

NASA Astrophysics Data System (ADS)

Sumida, David Shuji

PO(X('2)(PI)) is produced via the collision-free infrared multiple photon dissociation (IRMPD) of volatile organophosphorus molecules, and is detected by 2-frequency 2-photon ionization, using the B('2)(SIGMA)('+) state to provide a spectral signature from which X('2)(PI) populations are obtained. Sequential dissociations occur during the IR laser photolysis, in which nascent fragments continue to undergo IRMPD, and PO(X('2)(PI)) accrues from a series of bond fission reactions. Nascent vibrational, rotational, and translational excitations are in sensible accord with this mechanism, except for a few rotational states near J = 19.5. Unlike the nuclear degrees of freedom, the PO(X('2)(PI)) spin-orbit states are populated quite selectively. The ('2)(PI)(,3/2) state, lying only 224 cm('-1) above the ('2)(PI)(,1/2) ground state, contains only (TURN)11% of the population, compared to 34% for a 300K sample. This result is unambiguous; it persists with all precursors, laser fluences, etc., and is verified by comparisons to spectra obtained using a microwave discharge, a flame, and when thermalizing nascent excitations with an inert diluent. This result underscores the sanctity of the separate potential surfaces which correlate to the product spin -orbit states, and the small amount of ('2)(PI)(,3/2) population can be accounted for by non-adiabatic coupling during dissociation, and/or 'freezing' the amount of S(,1) character in an excited precursor in which S(,0) and S(,1) are coupled non-radiatively. We note that such electronic specificity should be dealt with in the analogous recombination reactions. (Copies available exclusively from Micrographics Department, Doheny Library, USC, Los Angeles, CA 90089.).

Molecular Smallpox Vaccine Delivered by Alphavirus Replicons Elicits Protective Immunity in Mice and Non-human Primates

PubMed Central

Hooper, Jay W.; Ferro, Anthony M.; Golden, Joseph W.; Silvera, Peter; Dudek, Jeanne; Alterson, Kim; Custer, Max; Rivers, Bryan; Morris, John; Owens, Gary; Smith, Jonathan F.; Kamrud, Kurt I.

2009-01-01

Naturally occurring smallpox was eradicated as a result of successful vaccination campaigns during the 1960s and 70s. Because of its highly contagious nature and high mortality rate, smallpox has significant potential as a biological weapon. Unfortunately, the current vaccine for orthopoxviruses is contraindicated for large portions of the population. Thus, there is a need for new, safe, and effective orthopoxvirus vaccines. Alphavirus replicon vectors, derived from strains of Venezuelan equine encephalitis virus, are being used to develop alternatives to the current smallpox vaccine. Here, we demonstrated that virus-like replicon particles (VRP) expressing the vaccinia virus A33R, B5R, A27L, and L1R genes elicited protective immunity in mice comparable to vaccination with live-vaccinia virus. Furthermore, cynomolgus macaques vaccinated with a combination of the four poxvirus VRPs (4pox-VRP) developed antibody responses to each antigen. These antibody responses were able to neutralize and inhibit the spread of both vaccinia virus and monkeypox virus. Macaques vaccinated with 4pox-VRP, flu HA VRP (negative control), or live-vaccinia virus (positive control) were challenged intravenously with 5 × 106 PFU of monkeypox virus 1 month after the second VRP vaccination. Four of the six negative control animals succumbed to monkeypox and the remaining two animals demonstrated either severe or grave disease. Importantly, all 10 macaques vaccinated with the 4pox-VRP vaccine survived without developing severe disease. These findings revealed that a single-boost VRP smallpox vaccine shows promise as a safe alternative to the currently licensed live-vaccinia virus smallpox vaccine. PMID:19833247

Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533.

PubMed

Hertzberger, Rosanne Y; Pridmore, R David; Gysler, Christof; Kleerebezem, Michiel; Teixeira de Mattos, M Joost

2013-01-01

Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533. The probiotic Lactobacillus johnsonii NCC 533 is relatively sensitive to oxidative stress; the presence of oxygen causes a lower biomass yield due to early growth stagnation. We show however that oxygen can also be beneficial to this organism as it relieves the requirement for acetate and CO2 during growth. Both on agar- and liquid-media, anaerobic growth of L. johnsonii NCC 533 requires CO2 supplementation of the gas phase. Switching off the CO2 supply induces growth arrest and cell death. The presence of molecular oxygen overcomes the CO2 dependency. Analogously, L. johnsonii NCC 533 strictly requires media with acetate to sustain anaerobic growth, although supplementation at a level that is 100-fold lower (120 microM) than the concentration in regular growth medium for lactobacilli already suffices for normal growth. Analogous to the CO2 requirement, oxygen supply relieves this acetate-dependency for growth. The L. johnsonii NCC 533 genome indicates that this organism lacks genes coding for pyruvate formate lyase (PFL) and pyruvate dehydrogenase (PDH), both CO2 and acetyl-CoA producing systems. Therefore, C1- and C2- compound production is predicted to largely depend on pyruvate oxidase activity (POX). This proposed role of POX in C2/C1-generation is corroborated by the observation that in a POX deficient mutant of L. johnsonii NCC 533, oxygen is not able to overcome acetate dependency nor does it relieve the CO2 dependency.

Influence of growth conditions on subsequent submonolayer oxide decomposition on Si(111)

NASA Astrophysics Data System (ADS)

Shklyaev, A. A.; Aono, Masakazu; Suzuki, Takanori

1996-10-01

The decomposition kinetics of oxide with a coverage between 0.1 and 0.5 ML, grown by oxidation of the Si(111)-7×7 surface at temperatures between 550 and 800 °C for oxygen pressures (Pox) between 3×10-8 and 2×10-6 Torr, is investigated with optical second-harmonic generation. Through the analysis of the pressure dependence of the initial oxide-growth rate, we separate the conditions for a slow oxide growth at Pox near Ptr(T) and for a rapid oxide growth at Pox>3Ptr(T), where Ptr(T) is the transition pressure to Si-etching regime without oxide growth. For the rapidly grown oxide, the oxide decomposition rate decreases with increasing oxide coverage, whereas the activation energy of about 3 eV does not change significantly. While in the case when the oxide is desorbed at the same temperature as are used for oxide growth, the oxide decomposition is described by an apparent activation energy of 1.5 eV. For the slowly grown oxide of 0.1 ML coverage, the oxide desorption kinetics shows a rapid decomposition stage followed by a slow stage. For the slowly grown oxide of 0.3 ML coverage, the slow stage with a large activation energy of 4.1 eV becomes dominant in the latter part of decomposition. The dependence of the desorption kinetics on the oxide-growth conditions described here could be a reason for the scattering of the kinetic parameters in the literature for O2 interaction with silicon at elevated temperatures.

Comparison of responses of salivary antioxidant markers to exhaustive aerobic exercise in smoker and non-smoker young girls.

PubMed

Arazi, Hamid; Simaei, Esmat; Taati, Behzad

2016-10-01

Smoking is known as a serious global public health problem, and is also an important risk factor for oral diseases and cause of oxidative stress and cellular damage. Saliva is the first biological medium encountered during inhalation of cigarette smoke. Additionally, previous studies demonstrated that exhaustive aerobic exercise could increase oxidative stress and cellular damage. Therefore, the main aim of this study was to compare the response of salivary antioxidants (peroxides (POX), uric acid (UA), 1-1dipheny l-2-picrylhydrazyl hydrate (DPPH) of exhaustive aerobic exercise between healthy smoker and non-smoker young girls. Ten smokers and 10 non-smokers were enrolled for this study. Subjects performed a progressive cycle ergometer with an initial load of 50 W that was increased 50Wevery 3 minutes at the speed of 60rpm, until exhaustion. Un-stimulated saliva samples were collected before, immediately and 1 hour after exercise. The results showed that POX activity and UA concentration significantly increased immediately after exercise in both groups when compared to the pre exercise values (P<0.01). The level of salivary POX of non-smokers were greater than smokers immediately after exercise (P<0.01). Aerobic exercise caused a decrease in salivary DPPH activity immediately and 1 h after exercise in both groups (P<0.01). When the DPPH values were compared between smoker and non-smoker subjects, a significant decrease was observed in smokers immediately and 1 h after exercise (P<0.01). In conclusion, aerobic exercise was induced oxidative stress in both groups but oxidative stress in smoking females was greater.

Follow-up of pregnant women exposed to chicken pox: an audit of relationship between level of antibody and development of chicken pox.

PubMed

Boxall, E H; Maple, P A C; Rathod, P; Smit, E

2011-10-01

The purpose of this study was to validate through natural exposure a cut-off level of varicella zoster IgG as protective against infection with varicella zoster virus (VZV). Laboratory testing to determine VZV immune status of pregnant women exposed to varicella is recommended. Quantitative assays are now available which are sensitive and specific. More than 200 consecutive requests for screening in pregnant patients with recent varicella contacts were followed-up by questionnaire. DiaSorin LIAISON and VZV time resolved fluorescence immuno assay (VZV TRFIA) were used to measure VZV antibody level. One hundred fifty out of 209 (72%) questionnaires were returned; 14 patients developed varicella, 129 did not and seven were not known. Patients who had been given VZIG and developed varicella on follow-up had a mean antibody level before VZIG of 28 mIU/ml and 62 mIU/ml, by LIAISON and TRFIA, respectively. The mean IgG level of those that did not develop varicella was 885 and 866 mIU/ml by LIAISON and TRFIA, respectively. Those with levels <100 mIU/ml were more likely to develop chicken pox than those with levels >100 mIU/ml (relative risk of 10.4 for LIAISON and 8.8 for TRFIA). On the basis of the relatively small numbers in this study, quantitative assays, using a 100mIU/ml cut-off, can differentiate between those who are susceptible and those who are protected against exposure, however follow-up studies should include sampling for VZV DNA and IgM.

Protective effect of metoclopramide against organophosphate-induced apoptosis in the murine skin fibroblast L929.

PubMed

Jaber, Basem M; Petroianu, Georg A; Rizvi, Syed A; Borai, Anwar; Saleh, Nada A; Hala, Sharif M; Saleh, Ayman M

2018-03-01

This study was performed to evaluate the protective efficacy of metoclopramide (MCP) against the organophosphates paraoxon (POX)- and malathion (MLT)-induced apoptosis in the murine L929 skin fibroblasts. L929 cells were exposed to either POX (10 nm) or 1.0 μm MLT in the absence and presence of increased concentrations of MCP. The protective effect of MCP on these organophosphate-stimulated apoptotic events was evaluated by flow cytometry analysis after staining with annexin-V/propidium iodide, processing and activation of the executioner caspase-3, cleavage of the poly-ADP ribose polymerase, fragmentation of the nucleosomal DNA and disruption of the mitochondrial membrane potential (Δψ). Our results showed that increased doses of MCP alone (≥10 μm) did not induce apoptosis or activation of caspase-3. Pretreatment of the cells with MCP attenuated all the apoptotic events triggered by the organophosphate compounds in a dose-dependent manner reaching ~70-80% protection when they were preincubated at 1 and 5 μm of the drug before the addition of POX and MLT, respectively. Interestingly, MCP did not offer a significant protective effect against the cytotoxicity of tumor necrosis factor-α, cisplatinum, etoposide or paclitaxel, which stimulate apoptosis by various mechanisms, suggesting that the anti-apoptotic effect of the drug is specific to organophosphates. The strong and specific anti-apoptotic activity of subclinical doses of MCP against the cytotoxicity of organophosphate compounds suggests its potential clinical application in treating their poisoning. Copyright © 2017 John Wiley & Sons, Ltd.

Oxygen Relieves the CO2 and Acetate Dependency of Lactobacillus johnsonii NCC 533

PubMed Central

Hertzberger, Rosanne Y.; Pridmore, R. David; Gysler, Christof; Kleerebezem, Michiel; Teixeira de Mattos, M. Joost

2013-01-01

Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533. The probiotic Lactobacillus johnsonii NCC 533 is relatively sensitive to oxidative stress; the presence of oxygen causes a lower biomass yield due to early growth stagnation. We show however that oxygen can also be beneficial to this organism as it relieves the requirement for acetate and CO2 during growth. Both on agar- and liquid-media, anaerobic growth of L. johnsonii NCC 533 requires CO2 supplementation of the gas phase. Switching off the CO2 supply induces growth arrest and cell death. The presence of molecular oxygen overcomes the CO2 dependency. Analogously, L. johnsonii NCC 533 strictly requires media with acetate to sustain anaerobic growth, although supplementation at a level that is 100-fold lower (120 microM) than the concentration in regular growth medium for lactobacilli already suffices for normal growth. Analogous to the CO2 requirement, oxygen supply relieves this acetate-dependency for growth. The L. johnsonii NCC 533 genome indicates that this organism lacks genes coding for pyruvate formate lyase (PFL) and pyruvate dehydrogenase (PDH), both CO2 and acetyl-CoA producing systems. Therefore, C1- and C2- compound production is predicted to largely depend on pyruvate oxidase activity (POX). This proposed role of POX in C2/C1-generation is corroborated by the observation that in a POX deficient mutant of L. johnsonii NCC 533, oxygen is not able to overcome acetate dependency nor does it relieve the CO2 dependency. PMID:23468944

Pandemic Flu and Medical Biodefense Countermeasure Liability Limitation

DTIC Science & Technology

2010-02-12

covering countermeasures against other strains of influenza (including H1N1), anthrax, botulism , small pox, and acute radiation syndrome...Secretary of HHS has issued additional declarations covering various countermeasures against anthrax, botulism , acute radiation syndrome, smallpox, and

Export Controls: Controls Over the Export Licensing Process for Chemical and Biological Items

DTIC Science & Technology

2005-03-30

Akabane virus Bovine spongiform encephalopathy agent Camel pox virus Central European tick-borne encephalitis Cercopithecine herpesvirus 1...Herpes B virus) Coccidioides immitis Coccidioides posadasii Cowdria ruminantium (Heartwater) Far Eastern tick-borne encephalitis Liberobacter

Evidence that the Ceratobasidium-like white-thread blight and black rot fungal pathogens from persimmon and tea crops in the Brazilian Atlantic Forest agroecosystem are two distinct phylospecies.

PubMed

Ceresini, Paulo C; Costa-Souza, Elaine; Zala, Marcello; Furtado, Edson L; Souza, Nilton L

2012-04-01

The white-thread blight and black rot (WTBR) caused by basidiomycetous fungi of the genus Ceratobasidium is emerging as an important plant disease in Brazil, particularly for crop species in the Ericales such as persimmon (Diospyros kaki) and tea (Camellia sinensis). However, the species identity of the fungal pathogen associated with either of these hosts is still unclear. In this work, we used sequence variation in the internal transcribed spacer regions, including the 5.8S coding region of rDNA (ITS-5.8S rDNA), to determine the phylogenetic placement of the local white-thread-blight-associated populations of Ceratobasidium sp. from persimmon and tea, in relation to Ceratobasidium species already described world-wide. The two sister populations of Ceratobasidium sp. from persimmon and tea in the Brazilian Atlantic Forest agroecosystem most likely represent distinct species within Ceratobasidium and are also distinct from C. noxium, the etiological agent of the first description of white-thread blight disease that was reported on coffee in India. The intraspecific variation for the two Ceratobasidium sp. populations was also analyzed using three mitochondrial genes (ATP6, nad1 and nad2). As reported for other fungi, variation in nuclear and mitochondrial DNA was incongruent. Despite distinct variability in the ITS-rDNA region these two populations shared similar mitochondrial DNA haplotypes.

Epigallocatechin-3-gallate protects Kuruma shrimp Marsupeneaus japonicus from white spot syndrome virus and Vibrio alginolyticus.

PubMed

Wang, Zhi; Sun, Baozhen; Zhu, Fei

2018-07-01

Epigallocatechin-3-gallate (EGCG) is the most abundant catechin in green tea and exhibits potential antibacterial and anticancer activities. In this study, EGCG was used in pathogen-challenge experiments in shrimp to discover its effect on the innate immune system of an invertebrate. Kuruma shrimp Marsupeneaus japonicus was used as an experimental model and challenged with white spot syndrome virus (WSSV) and the Gram-negative bacterium Vibrio alginolyticus. Pathogen-challenge experiments showed that EGCG pretreatment significantly delayed and reduced mortality upon WSSV and V. alginolyticus infection, with VP-28 copies of WSSV also reduced. Quantitative reverse transcription polymerase chain reaction revealed the positive influence of EGCG on several innate immune-related genes, including IMD, proPO, QM, myosin, Rho, Rab7, p53, TNF-alpha, MAPK, and NOS, and we observed positive influences on three immune parameters, including total hemocyte count and phenoloxidase and superoxide dismutase activities, by EGCG treatment. Additionally, results showed that EGCG treatment significantly reduced apoptosis upon V. alginolyticus challenge. These results indicated the positive role of EGCG in the shrimp innate immune system as an enhancer of immune parameters and an inhibitor of apoptosis, thereby delaying and reducing mortality upon pathogen challenge. Our findings provide insight into potential therapeutic or preventive functions associated with EGCG to enhance shrimp immunity and protect shrimp from pathogen infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

Detection of human pathogenic Ehrlichia muris-like agent in Peromyscus leucopus.

PubMed

Castillo, Caroline G; Eremeeva, Marina E; Paskewitz, Susan M; Sloan, Lynne M; Lee, Xia; Irwin, William E; Tonsberg, Stefan; Pritt, Bobbi S

2015-03-01

An Ehrlichia muris-like (EML) bacterium was recently detected in humans and Ixodes scapularis ticks in Minnesota and Wisconsin. The reservoir for this agent is unknown. To investigate the occurrence of the EML agent, groEL PCR testing and sequencing was performed on blood from small mammals and white-tailed deer that were collected in areas where human and tick infections were previously demonstrated. DNA of the EML agent was detected in two Peromyscus leucopus of 146 small mammals (1.4%); while 181 O. virginianus tested negative. This report provides the first evidence that DNA from the EML agent is found in P. leucopus, the same animal that is a reservoir for Anaplasma phagocytophilum in this region. The role of white-tailed deer remains inconclusive. Further sampling is warranted to understand the spatial and temporal distribution, transmission and maintenance of this pathogen. Copyright © 2014 Elsevier GmbH. All rights reserved.

Control of Xiphinema index populations by fallow plants under greenhouse and field conditions.

PubMed

Villate, Laure; Morin, Elisa; Demangeat, Gérard; Van Helden, Maarten; Esmenjaud, Daniel

2012-06-01

The dagger nematode Xiphinema index has a high economic impact in vineyards by direct pathogenicity and above all by transmitting the Grapevine fanleaf virus (GFLV). Agrochemicals have been largely employed to restrict the spread of GFLV by reducing X. index populations but are now banned. As an alternative to nematicides, the use of fallow plants between two successive vine crops was assessed. We selected plant species adapted to vineyard soils and exhibiting negative impact on nematodes and we evaluated their antagonistic effect on X. index in greenhouse using artificially infested soil, and in naturally infested vineyard conditions. The screening was conducted with plants belonging to the families Asteraceae (sunflower, marigold, zinnia, and nyjer), Poaceae (sorghum and rye), Fabaceae (white lupin, white melilot, hairy vetch, and alfalfa), Brassicaceae (rapeseed and camelina), and Boraginaceae (phacelia). In the greenhouse controlled assay, white lupin, nyjer, and marigold significantly reduced X. index populations compared with that of bare soil. The vineyard assay, designed to take into account the aggregative pattern of X. index distribution, revealed that marigold and hairy vetch are good candidates as cover crops to reduce X. index populations in vineyard. Moreover, this original experimental design could be applied to manage other soilborne pathogens.

Host species heterogeneity in the epidemiology of Nesopora caninum

PubMed Central

Pomeroy, Laura W.; Moritz, Mark; Saville, William; Wolfe, Barbara; Garabed, Rebecca

2017-01-01

Pathogen transmission across species drives disease emergence; however, mechanisms by which multi-host pathogens cross species boundaries are not well identified. This knowledge gap prevents integrated and targeted control in an epidemiologically continuous ecosystem. Our goal is to describe the impact of host species heterogeneity on the epidemiology of Neospora caninum circulating between livestock and wildlife in southeastern Ohio. We collected biological samples from Père David’s deer (Elaphurus davidianus) located at an outdoor wildlife conservation center; from cattle raised at farms adjacent to the center; and from wild white-tailed deer that roamed across farm and center boundaries. We designed nested infectious disease models of competing hypotheses about transmission and used collected data to fit the models, thereby estimating important immunological and transmission quantities which describe the species-specific contribution to the persistence of this pathogen in the community. We applied these data and models to suggest appropriate species-specific disease control methods. Results show that immunity in cattle and Pére David’s deer wanes over time, while in white-tailed deer immunity appears to be lifelong. Transmission quantities for cattle were estimated at values below the threshold for an outbreak (Rt < 1), meaning that chains of transmission are not maintained within this population and infections must occur due to reintroduction from an outside source. Pére David’s deer and white-tailed deer both could maintain continuous chains of transmission within their group (Rt > 1). Therefore, we propose that control of contact with outside sources will be useful for disease control in cattle; boosting immunity with vaccines might be an avenue to prevent infection in cattle and Père David’s deer. White-tailed deer are a potential maintenance host for infection and require further study to determine optimal control methods. Community-level investigations like this allow us to better evaluate heterogeneities in transmission processes that ultimately guide targeted control. PMID:28850580

First characterization of bacterial pathogen, Vibrio alginolyticus, for Porites andrewsi White syndrome in the South China Sea.

PubMed

Zhenyu, Xie; Shaowen, Ke; Chaoqun, Hu; Zhixiong, Zhu; Shifeng, Wang; Yongcan, Zhou

2013-01-01

White syndrome, a term for scleractinian coral disease with progressive tissue loss, is known to cause depressed growth and increased morality of coral reefs in the major oceans around the world, and the occurrence of this disease has been frequently reported in the past few decades. Investigations during April to September in both 2010 and 2011 identified widespread Porites andrewsi White syndrome (PAWS) in Xisha Archipelago, South China Sea. However, the causes and etiology of PAWS have been unknown. A transmission experiment was performed on P. andrewsi in the Qilianyu Subgroup (QLY). The results showed that there was a significant (P ≤ 0.05) difference between test and control groups after 28 days if the invalid replicates were excluded. Rates of tissue loss ranged from 0.90-10.76 cm(2) d(-1) with a mean of 5.40 ± 3.34 cm(2) d(-1) (mean ± SD). Bacterial strains were isolated from the PAWS corals at the disease outbreak sites in QLY of the Xisha Archipelago, South China Sea, and included in laboratory-based infection trials to satisfy Koch's postulates for establishing causality. Following exposure to bacterial concentrations of 10(5) cells mL(-1), the infected colonies exhibited similar signs to those observed in the field. Using phylogenetic 16S rRNA gene analysis, classical phenotypic trait comparison, Biolog automatic identification system, MALDI-TOF mass spectrometry and MALDI Biotyper method, two pathogenic strains were identified as Vibrio alginolyticus . This is the first report of V. alginolyticus as a pathogenic agent of PAWS in the South China Sea. Our results point out an urgent need to develop sensitive detection methods for V. alginolyticus virulence strains and robust diagnostics for coral disease caused by this and Vibrio pathogenic bacterium in the South China Sea.

First Characterization of Bacterial Pathogen, Vibrio alginolyticus, for Porites andrewsi White Syndrome in the South China Sea

PubMed Central

Chaoqun, Hu; Zhixiong, Zhu; Shifeng, Wang; Yongcan, Zhou

2013-01-01

Background White syndrome, a term for scleractinian coral disease with progressive tissue loss, is known to cause depressed growth and increased morality of coral reefs in the major oceans around the world, and the occurrence of this disease has been frequently reported in the past few decades. Investigations during April to September in both 2010 and 2011 identified widespread Porites andrewsi White syndrome (PAWS) in Xisha Archipelago, South China Sea. However, the causes and etiology of PAWS have been unknown. Methodology/Principal Findings A transmission experiment was performed on P . andrewsi in the Qilianyu Subgroup (QLY). The results showed that there was a significant (P ≤ 0.05) difference between test and control groups after 28 days if the invalid replicates were excluded. Rates of tissue loss ranged from 0.90-10.76 cm2 d-1 with a mean of 5.40 ± 3.34 cm2 d-1 (mean ± SD). Bacterial strains were isolated from the PAWS corals at the disease outbreak sites in QLY of the Xisha Archipelago, South China Sea, and included in laboratory-based infection trials to satisfy Koch’s postulates for establishing causality. Following exposure to bacterial concentrations of 105 cells mL-1, the infected colonies exhibited similar signs to those observed in the field. Using phylogenetic 16S rRNA gene analysis, classical phenotypic trait comparison, Biolog automatic identification system, MALDI-TOF mass spectrometry and MALDI Biotyper method, two pathogenic strains were identified as Vibrio alginolyticus . Conclusion/Significance This is the first report of V . alginolyticus as a pathogenic agent of PAWS in the South China Sea. Our results point out an urgent need to develop sensitive detection methods for V . alginolyticus virulence strains and robust diagnostics for coral disease caused by this and Vibrio pathogenic bacterium in the South China Sea. PMID:24086529

Phylogenetics of a Fungal Invasion: Origins and Widespread Dispersal of White-Nose Syndrome.

PubMed

Drees, Kevin P; Lorch, Jeffrey M; Puechmaille, Sebastien J; Parise, Katy L; Wibbelt, Gudrun; Hoyt, Joseph R; Sun, Keping; Jargalsaikhan, Ariunbold; Dalannast, Munkhnast; Palmer, Jonathan M; Lindner, Daniel L; Marm Kilpatrick, A; Pearson, Talima; Keim, Paul S; Blehert, David S; Foster, Jeffrey T

2017-12-12

Globalization has facilitated the worldwide movement and introduction of pathogens, but epizoological reconstructions of these invasions are often hindered by limited sampling and insufficient genetic resolution among isolates. Pseudogymnoascus destructans , a fungal pathogen causing the epizootic of white-nose syndrome in North American bats, has exhibited few genetic polymorphisms in previous studies, presenting challenges for both epizoological tracking of the spread of this fungus and for determining its evolutionary history. We used single nucleotide polymorphisms (SNPs) from whole-genome sequencing and microsatellites to construct high-resolution phylogenies of P. destructans Shallow genetic diversity and the lack of geographic structuring among North American isolates support a recent introduction followed by expansion via clonal reproduction across the epizootic zone. Moreover, the genetic relationships of isolates within North America suggest widespread mixing and long-distance movement of the fungus. Genetic diversity among isolates of P. destructans from Europe was substantially higher than in those from North America. However, genetic distance between the North American isolates and any given European isolate was similar to the distance between the individual European isolates. In contrast, the isolates we examined from Asia were highly divergent from both European and North American isolates. Although the definitive source for introduction of the North American population has not been conclusively identified, our data support the origin of the North American invasion by P. destructans from Europe rather than Asia. IMPORTANCE This phylogenetic study of the bat white-nose syndrome agent, P. destructans , uses genomics to elucidate evolutionary relationships among populations of the fungal pathogen to understand the epizoology of this biological invasion. We analyze hypervariable and abundant genetic characters (microsatellites and genomic SNPs, respectively) to reveal previously uncharacterized diversity among populations of the pathogen from North America and Eurasia. We present new evidence supporting recent introduction of the fungus to North America from a diverse Eurasian population, with limited increase in genetic variation in North America since that introduction. Copyright © 2017 Drees et al.

Habitat, wildlife and one health: Arcanobacterium pyogenes in Maryland and Upper Eastern Shore white-tailed deer populations

USGS Publications Warehouse

Turner, Melissa M.; DePerno, Christopher S.; Conner, Mark C.; Eyler, T. Brian; Lancia, Richard A.; Klaver, Robert W.; Stoskopf, Michael K.

2013-01-01

Conclusion: Our study indicates A. pyogenes may be carried widely among white-tailed deer regardless of sex or age class, but we found no evidence the pathogen is acquired in utero. The distribution of A. pyogenes across regions and concentration in a region with low livestock levels suggests the potential for localized endemicity of the organism and the possibility that deer may serve as a maintenance reservoir for an emerging one health concern.

Poleward expansion of the white-footed mouse (Peromyscus leucopus) under climate change: implications for the spread of lyme disease.

PubMed

Roy-Dufresne, Emilie; Logan, Travis; Simon, Julie A; Chmura, Gail L; Millien, Virginie

2013-01-01

The white-footed mouse (Peromyscus leucopus) is an important reservoir host for Borrelia burgdorferi, the pathogen responsible for Lyme disease, and its distribution is expanding northward. We used an Ecological Niche Factor Analysis to identify the climatic factors associated with the distribution shift of the white-footed mouse over the last 30 years at the northern edge of its range, and modeled its current and potential future (2050) distributions using the platform BIOMOD. A mild and shorter winter is favouring the northern expansion of the white-footed mouse in Québec. With more favorable winter conditions projected by 2050, the distribution range of the white-footed mouse is expected to expand further northward by 3° latitude. We also show that today in southern Québec, the occurrence of B. burgdorferi is associated with high probability of presence of the white-footed mouse. Changes in the distribution of the white-footed mouse will likely alter the geographical range of B. burgdorferi and impact the public health in northern regions that have yet to be exposed to Lyme disease.

The activity of antioxidant enzymes in response to salt stress in safflower (Carthamus tinctorius L.) and sunflower (Helianthus annuus L.) seedlings raised from seed treated with chitosan.

PubMed

Jabeen, Nusrat; Ahmad, Rafiq

2013-05-01

Salt tolerance is a complex trait which involves the coordinated action of many genes that perform a variety of functions, such as ion sequestration, metabolic adjustment, osmotic adjustment and antioxidative defence. In this article, the growth and the generation and scavenging of reactive oxygen species (ROS) under normal (ECiw [Electrical conductivity of irrigation water] = 0.5 dS m(-1)) and salt stress conditions (ECiw = 3.4, 6.1, 8.6 and 10.8 dS m(-1) ) in relation to the priming of seeds of the two important oil yielding crops, i.e. safflower and sunflower, with different concentrations of chitosan [0% (control), 0.25%, 0.50%, 0.75%] is discussed. Induced salinity stress significantly decreased germination percentage, germination rate, length and weight of root and shoot, and protein content. Proline content, malondialdehyde content (MDA), catalase (CAT) and peroxidase (POX) activity increased at 10.8 dS m(-1). Under control conditions there were no significant differences in germination percentage among different concentrations of chitosan, whereas CAT and POX activity were increased by low concentrations of chitosan. With increasing salt stress, low concentrations of chitosan increased germination percentage but decreased MDA and proline contents and CAT and POX activity. Generation of ROS seems to be unavoidable under normal conditions and the activity of antioxidant enzymes in plants varies in terms of ROS generation under salt stress. However, the data indicate that plants subjected to salt stress-induced oxidative stress and the low concentrations of chitosan exhibited positive effects on salt stress alleviation through the reduction of enzyme activity in both crops. © 2012 Society of Chemical Industry.

Enzymatic and non-enzymatic comparison of two different industrial tomato (Solanum lycopersicum) varieties against drought stress.

PubMed

Çelik, Özge; Ayan, Alp; Atak, Çimen

2017-12-01

The aim of this study is to compare the tolerance mechanisms of two industrial tomato varieties (X5671R and 5MX12956) under drought stress. 14 days-old tomato seedlings were subjected to 7 days-long drought stress by withholding irrigation. The effects of stress were determined by enzymatic and non-enzymatic parameters. The physiological damages were evaluated via lipid peroxidation ratio, total protein content, relative water content, chlorophyll content and proline accumulation. Enzymatic responses were determined by biochemical analysis and electrophoresis of SOD, APX, POX and CAT enzymes. Relative water contents of X5671R and 5MX12956 varieties at 7th day of drought were decreased to 8.4 and 12.2%, respectively. Applied drought decreased all photosynthetic pigments of X5671R and 5MX12956 varieties during the treatment period significantly comparing to the Day 0 as the control. Total protein content, lipid peroxidation and proline accumulation presented increased values in both varieties in accordance with the increasing stress intensity. According to lipid peroxidation analysis, 5MX12956 tomato variety was found more drought sensitive than X5671R variety. Antioxidative enzyme activities showed increases in both varieties as a response to drought stress, although CAT and APX activities presented decrease on the 7th day of applied stress. 7 days long drought stress differentially altered POX, APX and SOD isozyme patterns. Same POX bands were observed in both varieties with different band intensities. However, main isozyme pattern differences were obtained for SOD and APX. APX1, Fe-SOD and Cu/Zn-SOD2 isozyme bands should be evaluated to define their main role in the tolerance mechanism of both tomato varieties.

Pre-treatment with melatonin decreases abamectin induced toxicity in a nocturnal insect Spodoptera litura (Lepidoptera: Noctuidae).

PubMed

Subala, Subramanian P; Zubero, Eduardo E; Alatorre-Jimenez, Moises A; Shivakumar, Muthugounder S

2017-12-01

Oxidative stress is an important component of the mechanism of pesticide toxicity. The aim of the present study was to investigate the time-dependent melatonin effects against abamectin-induced oxidative stress in a S.litura model. Larvae were divided into 5 different groups; (1) control group,(2) Melatonin group (4.3×10 -5 M/100ml diet), (3) Abamectin group 1.5ml/L, (4) Pre-melatonin treated group (PM) (4.3×10 -5 M/100ml diet) before abamectin exposure 1.5ml/L, (5) Post-melatonin treated group (TM) after abamectin exposure. Melatonin was supplemented via artificial diet in PM and TM animals during 24h. Midgut, fatbody, and hemolymph, were collected for the analysis of oxidative stress markers (Total ROS, GSH, nitrite, TBARS, LPO), antioxidant enzyme levels (SOD, GST, CAT, POX, APOX) in fifth instar larvae. Midgut damage was examined by using morphological analysis. Our results observed that ABA group showed significant changes (p<0.001) in the ROS and carbonyl content in midgut. The increase of antioxidant enzyme levels (SOD, CAT, POX, and APOX) in midgut was led by the continuous free radical scavenger cascade of melatonin. Significant (p<0.01) increases in CAT and APOX levels were seen in the fatbody of PM and TM treated insects. In conclusion, the results of the study revealed that abamectin toxicity generates oxidative stress in the insect, while pre-melatonin treatment reduces this damage due to its antioxidant properties, especially POX levels in midgut, fatbody, and hemolymph. Therefore, indoleamine can play a vital role curtailing the abamectin toxicity in time dependent manner in S.litura. Copyright © 2017 Elsevier B.V. All rights reserved.

Properties of Low-mass AGN as They Relate to Unification and Massive AGN

NASA Astrophysics Data System (ADS)

Hood, Carol E.

2011-01-01

Current unification models of AGN suggest the observational differences between Type 1 and Type 2 objects are solely due to the orientation angle of the object. Observations have proved consistent with predictions and continue to strengthen the case for unification, however, many are still searching for "true" Type 2 objects, including predictions of their formation due to low luminosity or low accretion rate. Low-mass (< 106solar masses) AGN provide interesting environments in which these unification models can be studied. We also aim to compare the properties of low-mass AGN with their more massive counterparts to look for structural similarities and differences over a more substantial range of luminosities and accretion rates than previously studied. We present an in-depth multi-wavelength study of one of the prototypical low-mass AGN, POX 52, investigating the properties of the central engine along with that of the host galaxy. This includes data from the VLA, Spitzer, 2MASS, HST, GALEX, XMM, and Chandra, providing us with one of the most comprehensive looks into low-mass AGN. Unlike the other prototypical low-mass AGN, NGC 4395, POX 52 resides in a dwarf elliptical galaxy, accreting at ≈ 0.35 the Eddington limit. Additionally, we examine a sample 41 Type 1 and Type 2 objects, including POX 52 and NGC 4395, with the Spitzer IRS and a sub-sample of those with XMM to study the absorption properties of low-mass AGN, to test the validity of unification models in the low-mass regime, and to investigate possible structural differences between objects with low and high mass black holes and accretion rates. We will discuss the IR spectral shape and present emission-line diagnostics for Type 1 and Type 2 AGNs at low masses.

Pock forming ability of fowl pox virus isolated from layer chicken and its adaptation in chicken embryo fibroblast cell culture

PubMed Central

Gilhare, Varsha Rani; Hirpurkar, S. D.; Kumar, Ashish; Naik, Surendra Kumar; Sahu, Tarini

2015-01-01

Aim: The objective of the present study was to examine pock forming ability of field strain and vaccine strain of fowl pox virus (FPV) in chorioallantoic membrane (CAM) of embryonated chicken eggs and its adaptation in chicken embryo fibroblast (CEF) cell culture. Materials and Methods: Dry scabs were collected from 25 affected birds in glycerin-saline and preserved at 4°C until processed. Virus was isolated in 10-day-old embryonated chicken eggs by dropped CAM method. The identity of the virus is confirmed by clinical findings of affected birds, pock morphology and histopathology of infected CAM. In addition one field isolate and vaccine strain of FPV was adapted to CEF cell culture. CEF cell culture was prepared from 9-day-old embryonated chicken eggs. Result: Clinical symptoms observed in affected birds include pox lesion on comb, wattle, eyelids and legs, no internal lesions were observed. All field isolates produced similar findings in CAM. Pocks produced by field isolates ranged from 3 mm to 5 mm at the third passage while initial passages edematous thickening and necrosis of CAM was observed. Pocks formed by lyophilized strain were ranges from 0.5 mm to 2.5 mm in diameter scattered all over the membrane at the first passage. Intra-cytoplasmic inclusion bodies are found on histopathology of CAM. At third passage level, the CEF inoculated with FPV showed characteristic cytopathic effect (CPE) included aggregation of cells, syncytia and plaque formation. Conclusion: FPV field isolates and vaccine strain produced distinct pock lesions on CAMs. Infected CAM showed intracytoplasmic inclusion bodies. The CEF inoculated with FPV field isolate as well as a vaccine strain showed characteristic CPE at third passage level. PMID:27047081

Pock forming ability of fowl pox virus isolated from layer chicken and its adaptation in chicken embryo fibroblast cell culture.

PubMed

Gilhare, Varsha Rani; Hirpurkar, S D; Kumar, Ashish; Naik, Surendra Kumar; Sahu, Tarini

2015-03-01

The objective of the present study was to examine pock forming ability of field strain and vaccine strain of fowl pox virus (FPV) in chorioallantoic membrane (CAM) of embryonated chicken eggs and its adaptation in chicken embryo fibroblast (CEF) cell culture. Dry scabs were collected from 25 affected birds in glycerin-saline and preserved at 4°C until processed. Virus was isolated in 10-day-old embryonated chicken eggs by dropped CAM method. The identity of the virus is confirmed by clinical findings of affected birds, pock morphology and histopathology of infected CAM. In addition one field isolate and vaccine strain of FPV was adapted to CEF cell culture. CEF cell culture was prepared from 9-day-old embryonated chicken eggs. Clinical symptoms observed in affected birds include pox lesion on comb, wattle, eyelids and legs, no internal lesions were observed. All field isolates produced similar findings in CAM. Pocks produced by field isolates ranged from 3 mm to 5 mm at the third passage while initial passages edematous thickening and necrosis of CAM was observed. Pocks formed by lyophilized strain were ranges from 0.5 mm to 2.5 mm in diameter scattered all over the membrane at the first passage. Intra-cytoplasmic inclusion bodies are found on histopathology of CAM. At third passage level, the CEF inoculated with FPV showed characteristic cytopathic effect (CPE) included aggregation of cells, syncytia and plaque formation. FPV field isolates and vaccine strain produced distinct pock lesions on CAMs. Infected CAM showed intracytoplasmic inclusion bodies. The CEF inoculated with FPV field isolate as well as a vaccine strain showed characteristic CPE at third passage level.

The Different Physiological and Antioxidative Responses of Zucchini and Cucumber to Sewage Sludge Application.

PubMed

Wyrwicka, Anna; Urbaniak, Magdalena

2016-01-01

The present study investigates the effect of soil amended with sewage sludge on oxidative changes in zucchini and cucumber plants (Cucurbitaceae) and the consequent activation of their antioxidative systems and detoxification mechanisms. The plants were grown in pots containing soil amended with three concentrations of sewage sludge (1.8 g, 5.4 g and 10.8 g per pot), while controls were potted with vegetable soil. The activities of three antioxidative enzymes, ascorbate peroxidase (APx), catalase (CAT) and guaiacol peroxidase (POx), were assessed, as well as of the detoxifying enzyme S-glutathione transferase (GST). Lipid peroxidation was evaluated by measuring the extent of oxidative damage; α-tocopherol content, the main lipophilic antioxidant, was also measured. Visible symptoms of leaf blade damage after sewage sludge application occurred only on the zucchini plants. The zucchini and cucumber plants showed a range of enzymatic antioxidant responses to sewage sludge application. While APx and POx activities increased significantly with increasing sludge concentration in the zucchini plants, they decreased in the cucumber plants. Moreover, although the activity of these enzymes increased gradually with increasing doses of sewage sludge, these levels fell at the highest dose. An inverse relationship between peroxidases activity and CAT activity was observed in both investigated plant species. In contrast, although GST activity increased progressively with sludge concentration in both the zucchini and cucumber leaves, the increase in GST activity was greater in the zucchini plants, being visible at the lowest dose used. The results indicate that signs of sewage sludge toxicity were greater in zucchini than cucumber, and its defense reactions were mainly associated with increases in APx, POx and GST activity.

The Different Physiological and Antioxidative Responses of Zucchini and Cucumber to Sewage Sludge Application

PubMed Central

Wyrwicka, Anna; Urbaniak, Magdalena

2016-01-01

The present study investigates the effect of soil amended with sewage sludge on oxidative changes in zucchini and cucumber plants (Cucurbitaceae) and the consequent activation of their antioxidative systems and detoxification mechanisms. The plants were grown in pots containing soil amended with three concentrations of sewage sludge (1.8 g, 5.4 g and 10.8 g per pot), while controls were potted with vegetable soil. The activities of three antioxidative enzymes, ascorbate peroxidase (APx), catalase (CAT) and guaiacol peroxidase (POx), were assessed, as well as of the detoxifying enzyme S-glutathione transferase (GST). Lipid peroxidation was evaluated by measuring the extent of oxidative damage; α-tocopherol content, the main lipophilic antioxidant, was also measured. Visible symptoms of leaf blade damage after sewage sludge application occurred only on the zucchini plants. The zucchini and cucumber plants showed a range of enzymatic antioxidant responses to sewage sludge application. While APx and POx activities increased significantly with increasing sludge concentration in the zucchini plants, they decreased in the cucumber plants. Moreover, although the activity of these enzymes increased gradually with increasing doses of sewage sludge, these levels fell at the highest dose. An inverse relationship between peroxidases activity and CAT activity was observed in both investigated plant species. In contrast, although GST activity increased progressively with sludge concentration in both the zucchini and cucumber leaves, the increase in GST activity was greater in the zucchini plants, being visible at the lowest dose used. The results indicate that signs of sewage sludge toxicity were greater in zucchini than cucumber, and its defense reactions were mainly associated with increases in APx, POx and GST activity. PMID:27327659

Effects of Recurring Droughts on Extracellular Enzyme Activity in Mountain Grassland

NASA Astrophysics Data System (ADS)

Fuchslueger, L.; Bahn, M.; Kienzl, S.; Hofhansl, F.; Schnecker, J.; Richter, A.

2015-12-01

Water availability is a key factor for biogeochemical processes and determines microbial activity and functioning, and thereby organic matter decomposition in soils by affecting the osmotic potential, soil pore connectivity, substrate diffusion and nutrient availability. Low water availability during drought periods therefore directly affects microbial activity. Recurring drought periods likely induce shifts in microbial structure that might be reflected in altered responses of microbial turnover of organic matter by extracellular enzymes. To study this we measured a set of potential extracellular enzyme activity rates (cellobiohydrolase CBH; leucine-amino-peptidase LAP; phosphatase PHOS; phenoloxidase POX), in grassland soils that were exposed to extreme experimental droughts during the growing seasons of up to five subsequent years. During the first drought period after eight weeks of rain exclusion all measured potential enzyme activities were significantly decreased. In parallel, soil extractable organic carbon and nitrogen concentrations increased and microbial community structure, determined by phospholipid fatty acid analysis, changed. In soils that were exposed to two and three drought periods only PHOS decreased. After four years of drought again CBH, PHOS and POX decreased, while LAP was unaffected; after five years of drought PHOS and POX decreased and CBH and LAP remained stable. Thus, our results suggest that recurring extreme drought events can cause different responses of extracellular enzyme activities and that the responses change over time. We will discuss whether and to what degree these changes were related to shifts in microbial community composition. However, independent of whether a solitary or a recurrent drought was imposed, in cases when enzyme activity rates were altered during drought, they quickly recovered after rewetting. Overall, our data suggest that microbial functioning in mountain grassland is sensitive to drought, but highly resilient even after five years of drought.

Tuning the light emission of novel donor-acceptor phenoxazine dye-based materials towards the red spectral range

NASA Astrophysics Data System (ADS)

Damaceanu, Mariana-Dana; Constantin, Catalin-Paul

2018-04-01

A novel red fluorescent push-pull system able to generate an intramolecular charge-transfer (ICT) complex was synthesized. The novel dye (R-POX) combines some structural features which are rarely encountered in the design of other push-pull systems: hexyl-substituted phenoxazine as donor moiety, divinylketone as π-linker, and p-fluorobenzene as electron acceptor group. The relationship between the structural motif, photo-physical and electrochemical properties by UV-Vis absorption, photoluminescence and cyclic voltammetry was thoroughly investigated both as red dopant in poly(methylmethacrylate) (PMMA) or polyimide (PI) matrix, and non-doped host emitter. The molecular rigid cores of the synthesized dye formed supramolecular rod-like structures in condensed phase with a strong impact on the emissive centers. The aggregation was totally suppressed when the dye was used as dopant in an amorphous polymeric matrix, such as PMMA or PI. Electrochemical measurements revealed the dye ability for both hole and electron injection and transport. The fluorescence emission was found to be highly sensitive to solvent polarity, rendering blue-green, yellow, orange and red light emission in different organic solvents. The absolute fluorescence quantum yield reached 39.57% in solution, and dropped to 1.2% in solid state and to 14.01% when the dye was used as dopant in PMMA matrix. According to the available CIE 1931 standard, R-POX emitted pure and saturated red light of single wavelength with chromaticity coordinates very close to those of National Television System Committee (NTSC) standard red colour. The R-POX photo-optical features were compared to those of the commercial red emitter 6, 13-diphenylpentacene.

Thesaurus of DDC Descriptors

DTIC Science & Technology

1966-06-01

BIRDS BLASTOMYCES BLATTIDAE BOVINES CANDIDA CANNABIS CARNIVORA CATS CEPHALOPODA CEREALS CETACEA CHICKENS CHILDREN CHIMPANZEES CHLORELLA...POLIOMYELITIS VIRUS POX VIRUSES PROTEUS PROTEUS VULGAR1S PROTOZOA PSEUOOMONADACEAE PSEUUOMONADALES PSEUDOMONAS PSEUDOMONAS AEROGINOSA RABIES VIRUS...ISLANUS MARYLAND MASSACHUSETTS MASSACHUSETTS BAY MEDITERRANEAN SEA MEDITERRANEAN SEA ISLANDS MELANESIA MEXICO MEXICO GULF MICHIGAN MICRONESIA

Grand Bay-Banks Lake Stewardship Partnership - Phase 2

DTIC Science & Technology

2006-11-01

including smallpox, measles, typhus, tuberculosis, chicken pox and influenza, any of which could prove fatal. When the southeastern Indians were hit...Gulf of Mexico coastal plain within southeast Mississippi, Alabama, and southwest Georgia where they are called "Grady Ponds" because of the Grady

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

21 CFR 866.3900 - Varicella-zoster virus serological reagents.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Varicella-zoster virus serological reagents. 866... Varicella-zoster virus serological reagents. (a) Identification. Varicella-zoster virus serological reagents... viruses and provides epidemiological information on these diseases. Varicella (chicken pox) is a mild...

7 CFR 301.74-1 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 5 2010-01-01 2010-01-01 false Definitions. 301.74-1 Section 301.74-1 Agriculture..., DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Plum Pox § 301.74-1 Definitions. The following definitions apply to this subpart. Administrator. The Administrator, Animal and Plant Health Inspection...

Going Out on a Limb: Do Not Delay Diagnosis of Necrotizing Fasciitis in Varicella Infection.

PubMed

Sturgeon, Jonathan P; Segal, Laura; Verma, Anita

2015-07-01

Necrotizing fasciitis (NF) is a rare complication of varicella zoster (chicken pox) infection. Its diagnosis can be delayed or missed, which increases mortality and morbidity, because it initially presents similarly to cellulitis. We present the case of a 5-year-old boy who presented with a swollen leg, the difficulties in the diagnosis of NF, and a review of the literature. Necrotizing fasciitis complicating varicella zoster in children is associated with 3.4% mortality, although this rises to 13.6% in streptococcal toxic shock syndrome. Seventy-one percent of cases are confirmed as being caused by group A β-hemolytic Streptococcus. The association of NF with chicken pox is discussed along with the difficulties in diagnosis and treatment options. Necrotizing fasciitis is a surgical emergency and should be considered by all emergency department acute care practitioners in cases of varicella in which fever is enduring and swelling or pain is disproportionate. Because of the difficulty in diagnosis, senior opinion should be sought early.

Identification of Immunogenic Hot Spots within Plum Pox Potyvirus Capsid Protein for Efficient Antigen Presentation

PubMed Central

Fernández-Fernández, M. Rosario; Martínez-Torrecuadrada, Jorge L.; Roncal, Fernando; Domínguez, Elvira; García, Juan Antonio

2002-01-01

PEPSCAN analysis has been used to characterize the immunogenic regions of the capsid protein (CP) in virions of plum pox potyvirus (PPV). In addition to the well-known highly immunogenic N- and C-terminal domains of CP, regions within the core domain of the protein have also shown high immunogenicity. Moreover, the N terminus of CP is not homogeneously immunogenic, alternatively showing regions frequently recognized by antibodies and others that are not recognized at all. These results have helped us to design efficient antigen presentation vectors based on PPV. As predicted by PEPSCAN analysis, a small displacement of the insertion site in a previously constructed vector, PPV-γ, turned the derived chimeras into efficient immunogens. Vectors expressing foreign peptides at different positions within a highly immunogenic region (amino acids 43 to 52) in the N-terminal domain of CP were the most effective at inducing specific antibody responses against the foreign sequence. PMID:12438590

Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

PubMed

Vozárová, Z; Žilová, M; Šubr, Z

2015-12-01

Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

An intermediate-mass black hole in the darf galaxy Pox 52

NASA Astrophysics Data System (ADS)

Barth, Aaron

2005-01-01

Do dwarf elliptical and dwarf spiral galaxies contain central black holes with masses below 106 solar masses? Beyond the Local Group dynamical searches for black holes in this mass range are very difficult but the detection of accretion-powered nuclear activity could be used to infer the presence of a black hole. The nearby dwarf spiral galaxy NGC 4395 hosts a faint Seyfert 1 nucleus with a likely black hole mass in the range 104-105 solar masses and for more than a decade it has been the only known example of a Seyfert 1 nucleus in a dwarf galaxy. I will present new Keck spectra of the dwarf galaxy POX 52 which demonstrate that it has a Seyfert 1 spectrum nearly identical to that of NGC 4395. Its velocity dispersion is 37 km/s suggesting a possible black hole mass of order 105 solar masses. I will discuss the prospects for systematic searches for nuclear activity in dwarf galaxies and the implications for black hole demographics.

New highly divergent Plum pox virus isolates infecting sour cherry in Russia.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna; Zakubanskiy, Alexander; Osipov, Gennady

2017-02-01

Unusual Plum pox virus (PPV) isolates (named Tat isolates) were discovered on sour cherry (Prunus cerasus) in Russia. They failed to be recognized by RT-PCR using commonly employed primers specific to the strains C or CR (the only ones that proved able to infect sour cherry) as well as to the strains M and W. Some of them can be detected by RT-PCR using the PPV-D-specific primers P1/PD or by TAS-ELISA with the PPV-C-specific monoclonal antibody AC. Phylogenetic analysis of the 3'-terminal genomic region assigned the Tat isolates into the cluster of cherry-adapted strains. However, they grouped separately from the C and CR strains and from each other as well. The sequence divergence of the Tat isolates is comparable to the differences between the known PPV strains. They may represent new group(s) of cherry-adapted isolates which do not seem to belong to any known strain of the virus. Copyright © 2016. Published by Elsevier Inc.

An Intermediate-Mass Black Hole in the Dwarf Galaxy Pox 52

NASA Astrophysics Data System (ADS)

Barth, Aaron

Do dwarf elliptical and dwarf spiral galaxies contain central black holes with masses below 106 solar masses? Beyond the Local Group dynamical searches for black holes in this mass range are very difficult but the detection of accretion-powered nuclear activity could be used to infer the presence of a black hole. The nearby dwarf spiral galaxy NGC 4395 hosts a faint Seyfert 1 nucleus with a likely black hole mass in the range 104-105 solar masses and for more than a decade it has been the only known example of a Seyfert 1 nucleus in a dwarf galaxy. I will present new Keck spectra of the dwarf galaxy POX 52 which demonstrate that it has a Seyfert 1 spectrum nearly identical to that of NGC 4395. Its velocity dispersion is 37 km/s suggesting a possible black hole mass of order 105 solar masses. I will discuss the prospects for systematic searches for nuclear activity in dwarf galaxies and the implications for black hole demographics.

Tracking the potyviral P1 protein in Nicotiana benthamiana plants during plum pox virus infection.

PubMed

Vozárová, Z; Glasa, M; Šubr, Z W

The P1 protein is derived from the N terminus of potyvirus-coded polyprotein. In addition to the proteolytic activity essential for its maturation, it probably participates in suppression of host defense and/or in virus replication. Clear validation of the P1 in vivo function(s), however, is not yet available. We applied an infectious cDNA clone of plum pox virus (PPV), where the P1 was N-fused with a hexahistidine tag, to trace this protein in Nicotiana benthamiana plants during the PPV infection. Immunoblot analysis with the anti-his antibody showed a diffuse band corresponding to the molecular weight about 70-80 kDa (about twice larger than expected) in the root samples from early stage of infection. This signal culminated on the sixth day post inoculation, later it rapidly disappeared. Sample denaturation by boiling in SDS before centrifugal clarification was essential, indicating strong affinity of P1-his to some plant compound sedimenting with the tissue and cell debris.