Sample records for x-ray diffraction preliminary

  1. Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

    The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

  2. Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.

    2008-09-15

    A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

  3. Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

    2017-11-01

    The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

  4. Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

    2006-04-01

    Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

  5. Synchrotron X-Ray Diffraction Analysis of Meteorites in Thin Section: Preliminary Results

    NASA Technical Reports Server (NTRS)

    Treiman, A. H.; Lanzirotti, A.; Xirouchakis, D.

    2004-01-01

    X-ray diffraction is the pre-eminent technique for mineral identification and structure determination, but is difficult to apply to grains in thin section, the standard meteorite preparation. Bright focused X-ray beams from synchrotrons have been used extensively in mineralogy and have been applied to extraterrestrial particles. The intensity and small spot size achievable in synchrotron X-ray beams makes them useful for study of materials in thin sections. Here, we describe Synchrotron X-ray Diffraction (SXRD) in thin section as done at the National Synchrotron Light Source, and cite examples of its value for studies of meteorites in thin section.

  6. Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando

    The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less

  7. Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

    2017-11-01

    The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

  8. Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balotra, Sahil; Newman, Janet; French, Nigel G.

    2014-02-19

    The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

  9. Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

    PubMed Central

    Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

    2006-01-01

    The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

  10. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

    PubMed Central

    Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

    2009-01-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

  11. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

    PubMed

    Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

    2009-10-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  12. Crystallization and preliminary X-ray diffraction analysis of the sialic acid-binding domain (VP8*) of porcine rotavirus strain CRW-8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scott, Stacy A.; Holloway, Gavan; Coulson, Barbara S.

    2005-06-01

    The sialic acid-binding domain (VP8*) component of the porcine CRW-8 rotavirus spike protein has been overexpressed in E. coli, purified and co-crystallized with an N-acetylneuraminic acid derivative. X-ray diffraction data have been collected to 2.3 Å, which has enabled determination of the structure by molecular replacement. Rotavirus recognition and attachment to host cells involves interaction with the spike protein VP4 that projects outwards from the surface of the virus particle. An integral component of these spikes is the VP8* domain, which is implicated in the direct recognition and binding of sialic acid-containing cell-surface carbohydrates and facilitates subsequent invasion by themore » virus. The expression, purification, crystallization and preliminary X-ray diffraction analysis of VP8* from porcine CRW-8 rotavirus is reported. Diffraction data have been collected to 2.3 Å resolution, enabling the determination of the VP8* structure by molecular replacement.« less

  13. Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.

    PubMed

    Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D

    2012-12-01

    Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.

  14. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

    PubMed

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-10-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

  15. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

    PubMed Central

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-01-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

  16. Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Feifei; Gao, Feng; Li, Honglin

    The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

  17. Toward in situ x-ray diffraction imaging at the nanometer scale

    NASA Astrophysics Data System (ADS)

    Zatsepin, Nadia A.; Dilanian, Ruben A.; Nikulin, Andrei Y.; Gable, Brian M.; Muddle, Barry C.; Sakata, Osami

    2008-08-01

    We present the results of preliminary investigations determining the sensitivity and applicability of a novel x-ray diffraction based nanoscale imaging technique, including simulations and experiments. The ultimate aim of this nascent technique is non-destructive, bulk-material characterization on the nanometer scale, involving three dimensional image reconstructions of embedded nanoparticles and in situ sample characterization. The approach is insensitive to x-ray coherence, making it applicable to synchrotron and laboratory hard x-ray sources, opening the possibility of unprecedented nanometer resolution with the latter. The technique is being developed with a focus on analyzing a technologically important light metal alloy, Al-xCu (where x is 2.0-5.0 %wt). The mono- and polycrystalline samples contain crystallographically oriented, weakly diffracting Al2Cu nanoprecipitates in a sparse, spatially random dispersion within the Al matrix. By employing a triple-axis diffractometer in the non-dispersive setup we collected two-dimensional reciprocal space maps of synchrotron x-rays diffracted from the Al2Cu nanoparticles. The intensity profiles of the diffraction peaks confirmed the sensitivity of the technique to the presence and orientation of the nanoparticles. This is a fundamental step towards in situ observation of such extremely sparse, weakly diffracting nanoprecipitates embedded in light metal alloys at early stages of their growth.

  18. Purification, crystallization and preliminary X-ray diffraction of the N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Qin, E-mail: yang@crystal.harvard.edu; Brüschweiler, Sven; Chou, James J., E-mail: yang@crystal.harvard.edu

    2013-12-24

    The N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1 was crystallized in the presence of Ca{sup 2+}. X-ray diffraction data were collected to 2.9 Å resolution from crystals which belonged to space group P6{sub 2}22.

  19. Preliminary crystallographic analysis of ADP-glucose pyrophosphorylase from Agrobacterium tumefaciens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cupp-Vickery, Jill R., E-mail: jvickery@uci.edu; Igarashi, Robert Y.; Meyer, Christopher R.

    2005-03-01

    Crystallization and X-ray diffraction methods for native A. tumefaciens ADP-glucose pyrophosphorylase and its selenomethionyl derivative are described. Two crystal forms are identified, both of which diffract to 2 Å.

  20. Conceptual Design for Time-Resolved X-ray Diffraction in a Single Laser-Driven Compression Experiment

    NASA Astrophysics Data System (ADS)

    Benedetti, Laura Robin; Eggert, J. H.; Kilkenny, J. D.; Bradley, D. K.; Bell, P. M.; Palmer, N. E.; Rygg, J. R.; Boehly, T. R.; Collins, G. W.; Sorce, C.

    2017-06-01

    Since X-ray diffraction is the most definitive method for identifying crystalline phases of a material, it is an important technique for probing high-energy-density materials during laser-driven compression experiments. We are developing a design for collecting several x-ray diffraction datasets during a single laser-driven experiment, with a goal of achieving temporal resolution better than 1ns. The design combines x-ray streak cameras, for a continuous temporal record of diffraction, with fast x-ray imagers, to collect several diffraction patterns with sufficient solid angle range and resolution to identify crystalline texture. Preliminary experiments will be conducted at the Omega laser and then implemented at the National Ignition Facility. We will describe the status of the conceptual design, highlighting tradeoffs in the design process. We will also discuss the technical issues that must be addressed in order to develop a successful experimental platform. These include: Facility-specific geometric constraints such as unconverted laser light and target alignment; EMP issues when electronic diagnostics are close to the target; X-ray source requirements; and detector capabilities. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344, LLNL-ABS-725146.

  1. Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hou, Jing; Li, Ming; Chen, Jiashu

    Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

  2. X-Ray Diffraction Study of Elemental Erbium to 65 GPa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pravica, M.G.; Lipinska-Kalita, K.; Quine, Z.

    2006-02-02

    We have investigated phase transitions in elemental erbium in a diamond anvil cell up to 65 GPa using x-ray powder diffraction methods. We present preliminary evidence of a series of phase transitions that appear to follow the expected hcp {yields} Sm-type {yields} dhcp {yields} distorted fcc sequence. In particular, we believe that we have evidence for the predicted dhcp {yields} distorted fcc transition between 43 GPa and 65 GPa.

  3. Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

  4. Serial femtosecond X-ray diffraction of enveloped virus microcrystals

    DOE PAGES

    Lawrence, Robert M.; Conrad, Chelsie E.; Zatsepin, Nadia A.; ...

    2015-08-20

    Serial femtosecond crystallography (SFX) using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ~700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ~40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is a pertinent step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.

  5. Crystallization and preliminary X-ray diffraction analysis of a myotoxic Lys49-PLA{sub 2} from Bothrops jararacussu venom complexed with p-bromophenacyl bromide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchi-Salvador, D. P.; Fernandes, C. A. H.; Amui, S. F.

    2006-06-01

    A non-catalytic and myotoxic Lys49-PLA{sub 2} from B. jararacussu venom was crystallized with BPB inhibitor and X-ray diffraction data were collected. Preliminary analysis indicates that the ligand is bound to the His48 residue. Structure determination may provide insights into the myotoxic and cytotoxic mechanisms of Lys49-PLA{sub 2}s. For the first time, a non-catalytic and myotoxic Lys49-PLA{sub 2} (BthTX-I from Bothrops jararacussu venom) has been crystallized with BPB inhibitor. X-ray diffraction data were collected and electron-density calculations showed that the ligand is bound to the His48 residue. BthTX-I with His48 chemically modified by BPB shows strongly reduced myotoxic and cytotoxic activities.more » This suggests a biological correlation between the modification of His48, which is associated with catalytic activity of PLA{sub 2}s, and other toxicological activities of Lys49-PLA{sub 2}s.« less

  6. Purification, crystallization and preliminary X-ray analysis of Enterococcus faecium aminoglycoside-2′′-phosphotransferase-Ib [APH(2′′)-Ib

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walanj, Rupa; Young, Paul; Baker, Heather M.

    2005-04-01

    APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less

  7. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

    PubMed

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-12-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

  8. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

    PubMed Central

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-01-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

  9. Detection Limit of Smectite by Chemin IV Laboratory Instrument: Preliminary Implications for Chemin on the Mars Science Laboratory Mission

    NASA Technical Reports Server (NTRS)

    Archilles, Cherie; Ming, D. W.; Morris, R. V.; Blake, D. F.

    2011-01-01

    The CheMin instrument on the Mars Science Laboratory (MSL) is an miniature X-ray diffraction (XRD) and X-ray fluorescence (XRF) instrument capable of detecting the mineralogical and elemental compositions of rocks, outcrops and soils on the surface of Mars. CheMin uses a microfocus-source Co X-ray tube, a transmission sample cell, and an energy-discriminating X-ray sensitive CCD to produce simultaneous 2-D XRD patterns and energy-dispersive X-ray histograms from powdered samples. CRISM and OMEGA have identified the presence of phyllosilicates at several locations on Mars including the four candidate MSL landing sites. The objective of this study was to conduct preliminary studies to determine the CheMin detection limit of smectite in a smectite/olivine mixed mineral system.

  10. Crystallization and preliminary X-ray diffraction study of thermostable RNase HIII from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi

    2005-03-01

    A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.

  11. Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

    PubMed

    Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

    2014-09-01

    TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

  12. Crystallization and preliminary X-ray diffraction studies of θ-toxin (perfringolysin O), a pore-forming cytolysin of Clostridium perfringens

    NASA Astrophysics Data System (ADS)

    Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio

    1996-10-01

    θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.

  13. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-11-01

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  14. Preliminary X-ray crystallographic analysis of glutathione transferase zeta 1 (GSTZ1a-1a)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boone, Christopher D.; Zhong, Guo; Smeltz, Marci

    2014-01-21

    Crystals of glutathione transferase zeta 1 were grown and shown to diffract X-rays to 3.1 Å resolution. They belonged to space group P1, with unit-cell parameters a = 42.0, b = 49.6, c = 54.6 Å, α = 82.9, β = 69.9, γ = 73.4°.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

    Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

  16. Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir

    2005-11-01

    The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less

  17. Production, purification, crystallization and preliminary X-ray analysis of adeno-associated virus serotype 8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lane, Michael Douglas; Nam, Hyun-Joo; Padron, Eric

    2005-06-01

    The production, purification, crystallization and preliminary X-ray crystallographic analysis of adeno-associated virus serotype 8 is reported. Adeno-associated viruses (AAVs) are actively being developed for clinical gene-therapy applications and the efficiencies of the vectors could be significantly improved by a detailed understanding of their viral capsid structures and the structural determinants of their tissue-transduction interactions. AAV8 is ∼80% identical to the more widely studied AAV2, but its liver-transduction efficiency is significantly greater than that of AAV2 and other serotypes. The production, purification, crystallization and preliminary X-ray crystallographic analysis of AAV8 viral capsids are reported. The crystals diffract X-rays to 3.0 Åmore » resolution using synchrotron radiation and belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = 257.5, c = 443.5 Å. The unit cell contains two viral particles, with ten capsid viral protein monomers per crystallographic asymmetric unit.« less

  18. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

  19. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

    PubMed Central

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-01-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

  20. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

    PubMed

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-11-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

  1. Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan

    2007-12-01

    Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less

  2. Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

    2006-12-01

    UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

  3. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

  4. Crystallisation and preliminary X-ray diffraction analysis of the protease from Southampton norovirus complexed with a Michael-acceptor inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coates, Leighton; Cooper, Jon; Hussey, Robert

    2008-01-01

    Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. While the native crystals were found to diffract only to medium resolution (2.9 {angstrom}), cocrystals of an inhibitor complex diffracted X-rays to 1.7 {angstrom} resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end.

  5. Data preparation and evaluation techniques for x-ray diffraction microscopy.

    PubMed

    Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; Marchesini, Stefano; Shapiro, David; Turner, Joshua J; Jacobsen, Chris

    2010-08-30

    The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. We show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffraction patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.

  6. Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

    2010-11-12

    Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

  7. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

    PubMed

    Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

    2008-06-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

  8. Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

    2006-05-01

    The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

  9. Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

    2007-09-01

    A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

  10. Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

    PubMed

    Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

    1993-12-20

    gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

  11. Crystallization and preliminary X-ray diffraction analysis of a Lys49-phospholipase A2 complexed with caffeic acid, a molecule with inhibitory properties against snake venoms

    PubMed Central

    Shimabuku, Patrícia S.; Fernandes, Carlos A. H.; Magro, Angelo J.; Costa, Tássia R.; Soares, Andreimar M.; Fontes, Marcos R. M.

    2011-01-01

    Phospholipases A2 (PLA2s) are one of the main components of bothropic venoms; in addition to their phospholipid hydrolysis action, they are involved in a wide spectrum of pharmacological activities, including neurotoxicity, myo­toxicity and cardiotoxicity. Caffeic acid is an inhibitor that is present in several plants and is employed for the treatment of ophidian envenomations in the folk medicine of many developing countries; as bothropic snake bites are not efficiently neutralized by conventional serum therapy, it may be useful as an antivenom. In this work, the cocrystallization and preliminary X-ray diffraction analysis of the Lys49-PLA2 piratoxin I from Bothrops pirajai venom in the presence of the inhibitor caffeic acid (CA) are reported. The crystals diffracted X-rays to 1.65 Å resolution and the structure was solved by molecular-replacement techniques. The electron-density map unambiguously indicated the presence of three CA molecules that interact with the C-terminus of the protein. This is the first time a ligand has been observed bound to this region and is in agreement with various experiments previously reported in the literature. PMID:21301098

  12. Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.

    PubMed

    Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P

    1996-11-15

    Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.

  13. Production, Purification and Preliminary X-ray Crystallographic Studies of Adeno-Associated Virus Serotype 9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitchell, M.; Nam, H; Carter, A

    2009-01-01

    Adeno-associated virus (AAV) serotype 9, which is under development for gene-delivery applications, shows significantly enhanced capsid-associated transduction efficiency in muscle compared with other AAV serotypes. With the aim of characterizing the structural determinants of this property, the purification, crystallization and preliminary X-ray crystallographic analyses of the AAV9 viral capsid are reported. The crystals diffracted X-rays to 2.8 A resolution using synchrotron radiation and belonged to the trigonal space group P32, with unit-cell parameters a = b = 251.0, c = 640.0 A. There are three complete viral capsids in the crystal unit cell. The orientation and position of the asymmetricmore » unit capsid have been determined by molecular-replacement methods and structure determination is in progress.« less

  14. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* carbohydrate-binding protein of the human rotavirus strain Wa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan

    2005-11-01

    The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less

  15. a-Si:H TFT-silicon hybrid low-energy x-ray detector

    DOE PAGES

    Shin, Kyung -Wook; Karim, Karim S.

    2017-03-15

    Direct conversion crystalline silicon X-ray imagers are used for low-energy X-ray photon (4-20 keV) detection in scientific research applications such as protein crystallography. In this paper, we demonstrate a novel pixel architecture that integrates a crystalline silicon X-ray detector with a thin-film transistor amorphous silicon pixel readout circuit. We describe a simplified two-mask process to fabricate a complete imaging array and present preliminary results that show the fabricated pixel to be sensitive to 5.89-keV photons from a low activity Fe-55 gamma source. Furthermore, this paper presented can expedite the development of high spatial resolution, low cost, direct conversion imagers formore » X-ray diffraction and crystallography applications.« less

  16. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

    PubMed Central

    Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

    2008-01-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

  17. Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

    2007-07-01

    P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

  18. Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

    PubMed Central

    Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

    2008-01-01

    Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441

  19. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

    PubMed

    Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

    2014-11-01

    Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  20. Preliminary experiments on the reduction of the uranyl ion to uraninite by carbonaceous substances

    USGS Publications Warehouse

    Breger, Irving A.; Moore, Richard T.

    1955-01-01

    An aqueous solution of uranyl sulfate containing a suspension of subbituminous coal has been heated at 210 C for three days. Examination of the coal at the end of the experiment showed it to contain 31.8 percent uranium recognizable as uraninite by a sharp, strong X-ray diffraction pattern. A similar experiment with degraded spruce wood also led to the formation of uraninite but in lesser quantity and with broader lines in the X-ray diffraction pattern. The ability of coal or wood to reduce the uranyl ion is a critical factor in the correlation of studies of uraniferous coals containing the uranyl ion with studies of uraninite-bearing coalified wood from the Colorado Plateau. Although these results are based an preliminary experiments, they are extremely important geochemically and warrant the development of the series of controlled studies that are proposed.

  1. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    PubMed

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-04-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

  2. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    PubMed Central

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-01-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

  3. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

  4. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

    2017-01-01

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shin, Kyung -Wook; Karim, Karim S.

    Direct conversion crystalline silicon X-ray imagers are used for low-energy X-ray photon (4-20 keV) detection in scientific research applications such as protein crystallography. In this paper, we demonstrate a novel pixel architecture that integrates a crystalline silicon X-ray detector with a thin-film transistor amorphous silicon pixel readout circuit. We describe a simplified two-mask process to fabricate a complete imaging array and present preliminary results that show the fabricated pixel to be sensitive to 5.89-keV photons from a low activity Fe-55 gamma source. Furthermore, this paper presented can expedite the development of high spatial resolution, low cost, direct conversion imagers formore » X-ray diffraction and crystallography applications.« less

  6. Purification, crystallization and preliminary X-ray diffraction analysis of aspartate semialdehyde dehydrogenase (Rv3708c) from Mycobacterium tuberculosis

    PubMed Central

    Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.

    2008-01-01

    Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599

  7. Data preparation and evaluation techniques for x-ray diffraction microscopy

    DOE PAGES

    Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; ...

    2010-01-01

    The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. In addition, we show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffractionmore » patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.« less

  8. Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

    2006-10-01

    Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

  9. Preliminary studies of enhanced contrast radiography in anatomy and embryology of insects with Elettra synchrotron light

    NASA Astrophysics Data System (ADS)

    Hönnicke, M. G.; Foerster, L. A.; Navarro-Silva, M. A.; Menk, R.-H.; Rigon, L.; Cusatis, C.

    2005-08-01

    Enhanced contrast X-ray imaging is achieved by exploiting the real part of the refraction index, which is responsible for the phase shifts, in addition to the imaginary part, which is responsible for the absorption. Such techniques are called X-ray phase contrast imaging. An analyzer-based X-ray phase contrast imaging set-up with Diffraction Enhanced Imaging processing (DEI) were used for preliminary studies in anatomy and embryology of insects. Parasitized stinkbug and moth eggs used as control agents of pests in vegetables and adult stinkbugs and mosquitoes ( Aedes aegypti) were used as samples. The experimental setup was mounted in the SYRMEP beamline at ELETTRA. Images were obtained using a high spatial resolution CCD detector (pixel size 14×14 μm 2) coupled with magnifying optics. Analyzer-based X-ray phase contrast images (PCI) and edge detection images show contrast and details not observed with conventional synchrotron radiography and open the possibility for future study in the embryonic development of insects.

  10. Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

    NASA Technical Reports Server (NTRS)

    Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

    1999-01-01

    Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

  11. Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

    2008-04-01

    Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

  12. Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

    NASA Astrophysics Data System (ADS)

    Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

    2015-11-01

    HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

  13. Crystallization and preliminary X-ray diffraction analysis of a novel Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000

    2007-07-01

    A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less

  14. Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

    PubMed Central

    Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

    2014-01-01

    Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

  15. Crystallization and preliminary X-ray diffraction analysis of West Nile virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

    2010-05-25

    West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

  16. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less

  17. Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

    PubMed

    Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

    2003-08-01

    UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

  18. Off-plane x-ray reflection grating fabrication

    NASA Astrophysics Data System (ADS)

    Peterson, Thomas J.; DeRoo, Casey T.; Marlowe, Hannah; McEntaffer, Randall L.; Miles, Drew M.; Tutt, James H.; Schultz, Ted B.

    2015-09-01

    Off-plane X-ray diffraction gratings with precision groove profiles at the submicron scale will be used in next generation X-ray spectrometers. Such gratings will be used on a current NASA suborbital rocket mission, the Off-plane Grating Rocket Experiment (OGRE), and have application for future grating missions. The fabrication of these gratings does not come without challenges. High performance off-plane gratings must be fabricated with precise radial grating patterns, optically at surfaces, and specific facet angles. Such gratings can be made using a series of common micro-fabrication techniques. The resulting process is highly customizable, making it useful for a variety of different mission architectures. In this paper, we detail the fabrication method used to produce high performance off-plane gratings and report the results of a preliminary qualification test of a grating fabricated in this manner. The grating was tested in the off-plane `Littrow' configuration, for which the grating is most efficient for a given diffraction order, and found to achieve 42% relative efficiency in the blaze order with respect to all diffracted light.

  19. Purification, crystallization and preliminary X-ray diffraction analysis of the human mismatch repair protein MutS[beta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tseng, Quincy; Orans, Jillian; Hast, Michael A.

    2012-03-16

    MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification ofmore » recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.« less

  20. Diffraction leveraged modulation of X-ray pulses using MEMS-based X-ray optics

    DOEpatents

    Lopez, Daniel; Shenoy, Gopal; Wang, Jin; Walko, Donald A.; Jung, Il-Woong; Mukhopadhyay, Deepkishore

    2016-08-09

    A method and apparatus are provided for implementing Bragg-diffraction leveraged modulation of X-ray pulses using MicroElectroMechanical systems (MEMS) based diffractive optics. An oscillating crystalline MEMS device generates a controllable time-window for diffraction of the incident X-ray radiation. The Bragg-diffraction leveraged modulation of X-ray pulses includes isolating a particular pulse, spatially separating individual pulses, and spreading a single pulse from an X-ray pulse-train.

  1. Expression, purification and preliminary crystallographic analysis of Mycobacterium tuberculosis CysQ, a phosphatase involved in sulfur metabolism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Erickson, Anna I.; Sarsam, Reta D.; Fisher, Andrew J., E-mail: ajfisher@ucdavis.edu

    The cysQ gene from Mycobacterium tuberculosis was cloned and the expressed protein, a 3′-phosphoadenosine-5′’-phosphatase, was purified and crystallized. X-ray diffraction data were collected to 1.7 Å resolution.

  2. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

    2014-10-25

    The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

  3. Purification, crystallization and preliminary X-ray diffraction analysis of adenosine triphosphate sulfurylase (ATPS) from the sulfate-reducing bacterium Desulfovibrio desulfuricans ATCC 27774

    PubMed Central

    Gavel, Olga Yu.; Kladova, Anna V.; Bursakov, Sergey A.; Dias, João M.; Texeira, Susana; Shnyrov, Valery L.; Moura, José J. G.; Moura, Isabel; Romão, Maria J.; Trincão, José

    2008-01-01

    Native zinc/cobalt-containing ATP sulfurylase (ATPS; EC 2.7.7.4; MgATP:sulfate adenylyltransferase) from Desulfovibrio desulfuricans ATCC 27774 was purified to homogeneity and crystallized. The orthorhombic crystals diffracted to beyond 2.5 Å resolution and the X-ray data collected should allow the determination of the structure of the zinc-bound form of this ATPS. Although previous biochemical studies of this protein indicated the presence of a homotrimer in solution, a dimer was found in the asymmetric unit. Elucidation of this structure will permit a better understanding of the role of the metal in the activity and stability of this family of enzymes. PMID:18607083

  4. Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Michael R.; Selby, Thomas L.

    2012-10-30

    A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

  5. Quantitative energy-dispersive x-ray diffraction for identification of counterfeit medicines: a preliminary study

    NASA Astrophysics Data System (ADS)

    Crews, Chiaki C. E.; O'Flynn, Daniel; Sidebottom, Aiden; Speller, Robert D.

    2015-06-01

    The prevalence of counterfeit and substandard medicines has been growing rapidly over the past decade, and fast, nondestructive techniques for their detection are urgently needed to counter this trend. In this study, energy-dispersive X-ray diffraction (EDXRD) combined with chemometrics was assessed for its effectiveness in quantitative analysis of compressed powder mixtures. Although EDXRD produces lower-resolution diffraction patterns than angular-dispersive X-ray diffraction (ADXRD), it is of interest for this application as it carries the advantage of allowing the analysis of tablets within their packaging, due to the higher energy X-rays used. A series of caffeine, paracetamol and microcrystalline cellulose mixtures were prepared with compositions between 0 - 100 weight% in 20 weight% steps (22 samples in total, including a centroid mixture), and were pressed into tablets. EDXRD spectra were collected in triplicate, and a principal component analysis (PCA) separated these into their correct positions in the ternary mixture design. A partial least-squares (PLS) regression model calibrated using this training set was validated using both segmented cross-validation, and with a test set of six samples (mixtures in 8:1:1 and 5⅓:2⅓:2⅓ ratios) - the latter giving a root-mean square error of prediction (RMSEP) of 1.30, 2.25 and 2.03 weight% for caffeine, paracetamol and cellulose respectively. These initial results are promising, with RMSEP values on a par with those reported in the ADXRD literature.

  6. Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DiMattia, Michael; Govindasamy, Lakshmanan; Levy, Hazel C.

    2005-10-01

    The production, purification, crystallization and preliminary crystallographic analysis of empty adeno-associated virus serotype 5 capsids are reported. Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Å resolution using synchrotron radiation and belong to the orthorhombicmore » space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c = 629.7 Å. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

  7. Simulation and modeling of silicon pore optics for the ATHENA x-ray telescope

    NASA Astrophysics Data System (ADS)

    Spiga, D.; Christensen, F. E.; Bavdaz, M.; Civitani, M. M.; Conconi, P.; Della Monica Ferreira, D.; Knudsen, E. B.; Massahi, S.; Pareschi, G.; Salmaso, B.; Shortt, B.; Tayabaly, K.; Westergaard, N. J.; Wille, E.

    2016-07-01

    The ATHENA X-ray observatory is a large-class ESA approved mission, with launch scheduled in 2028. The technology of silicon pore optics (SPO) was selected as baseline to assemble ATHENA's optic with more than 1000 mirror modules, obtained by stacking wedged and ribbed silicon wafer plates onto silicon mandrels to form the Wolter-I configuration. Even if the current baseline design fulfills the required effective area of 2 m2 at 1 keV on-axis, alternative design solutions, e.g., privileging the field of view or the off-axis angular resolution, are also possible. Moreover, the stringent requirement of a 5 arcsec HEW angular resolution at 1 keV entails very small profile errors and excellent surface smoothness, as well as a precise alignment of the 1000 mirror modules to avoid imaging degradation and effective area loss. Finally, the stray light issue has to be kept under control. In this paper we show the preliminary results of simulations of optical systems based on SPO for the ATHENA X-ray telescope, from pore to telescope level, carried out at INAF/OAB and DTU Space under ESA contract. We show ray-tracing results, including assessment of the misalignments of mirror modules and the impact of stray light. We also deal with a detailed description of diffractive effects expected in an SPO module from UV light, where the aperture diffraction prevails, to X-rays where the surface diffraction plays a major role. Finally, we analyze the results of X-ray tests performed at the BESSY synchrotron, we compare them with surface finishing measurements, and we estimate the expected HEW degradation caused by the X-ray scattering.

  8. Refolding, crystallization and preliminary X-ray crystallographic studies of the β-barrel domain of BamA, a membrane protein essential for outer membrane protein biogenesis.

    PubMed

    Ni, Dongchun; Yang, Kun; Huang, Yihua

    2014-03-01

    In Gram-negative bacteria, the assembly of outer membrane proteins (OMPs) requires a five-protein β-barrel assembly machinery (BAM) complex, of which BamA is an essential and evolutionarily conserved integral outer membrane protein. Here, the refolding, crystallization and preliminary X-ray crystallographic characterization of the β-barrel domain of BamA from Escherichia coli (EcBamA) are reported. Native and selenomethionine-substituted EcBamA proteins were crystallized at 16°C and X-ray diffraction data were collected to 2.6 and 3.7 Å resolution, respectively. The native crystals belonged to space group P21212, with unit-cell parameters a = 118.492, b = 159.883, c = 56.000 Å and two molecules in one asymmetric unit; selenomethionine-substituted protein crystals belonged to space group P4322, with unit-cell parameters a = b = 163.162, c = 46.388 Å and one molecule in one asymmetric unit. Initial phases for EcBamA β-barrel domain were obtained from a SeMet SAD data set. These preliminary X-ray crystallographic studies paved the way for further structural determination of the β-barrel domain of EcBamA.

  9. Influence of preliminary deformation on the hardening effect upon aging of Al-Cu-Li alloys

    NASA Astrophysics Data System (ADS)

    Betsofen, S. Ya.; Ashmarin, A. A.; Knyazev, M. I.; Dolgova, M. I.

    2016-09-01

    The influence of preliminary deformation upon rolling of wedge specimens on the mechanical properties and the structural phase state of Al-Cu-Li alloys are studied by X-ray diffraction and hardness measurements. Strong dependence of the hardening effect upon aging on the reduction upon rolling has been revealed. Deformation weakly influences the hardness and significantly increases the hardening upon aging. Herewith, the hardening effect is nearly absent at the minimum deformation ratio of 1% and increases with its increase. It is demonstrated that the content of T1 phase increases from 2 to 4% in the range of a preliminary deformation ratio of 6-10% and the content of δ' phase is 17% at a deformation ratio in the range 1‒6% and increases to 18-19% at a deformation ratio of 6-10%. The δ' phase in an alloy contains <20% nanocrystalline particles with 6-20 nm in size, and the remaining part consists of amorphous particles (as detected by X-ray diffraction) <5 nm in size, which precipitate coherently from the matrix and have the same orientation as the nanocrystalline particles and the solid solution.

  10. Preliminary neutron and X-ray crystallographic studies of equine cyanomethemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovalevsky, A.Y.; Fisher, S.Z.; Seaver, S.

    2010-08-18

    Room-temperature and 100 K X-ray and room-temperature neutron diffraction data have been measured from equine cyanomethemoglobin to 1.7 {angstrom} resolution using a home source, to 1.6 {angstrom} resolution on NE-CAT at the Advanced Photon Source and to 2.0 {angstrom} resolution on the PCS at Los Alamos Neutron Science Center, respectively. The cyanomethemoglobin is in the R state and preliminary room-temperature electron and neutron scattering density maps clearly show the protonation states of potential Bohr groups. Interestingly, a water molecule that is in the vicinity of the heme group and coordinated to the distal histidine appears to be expelled from thismore » site in the low-temperature structure.« less

  11. Purification, crystallization, small-angle X-ray scattering and preliminary X-ray diffraction analysis of the SH2 domain of the Csk-homologous kinase.

    PubMed

    Gunn, Natalie J; Gorman, Michael A; Dobson, Renwick C J; Parker, Michael W; Mulhern, Terrence D

    2011-03-01

    The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a=25.8, b=34.6, c=63.2 Å, β=99.4°.

  12. Purification, crystallization and X-ray diffraction analysis of a novel ring-cleaving enzyme (BoxC{sub C}) from Burkholderia xenovorans LB400

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bains, Jasleen; Boulanger, Martin J., E-mail: mboulang@uvic.ca

    2008-05-01

    Preliminary X-ray diffraction studies of a novel ring-cleaving enzyme from B. xenovorans LB400 encoded by the benzoate-oxidation (box) pathway. The assimilation of aromatic compounds by microbial species requires specialized enzymes to cleave the thermodynamically stable ring. In the recently discovered benzoate-oxidation (box) pathway in Burkholderia xenovorans LB400, this is accomplished by a novel dihydrodiol lyase (BoxC{sub C}). Sequence analysis suggests that BoxC{sub C} is part of the crotonase superfamily but includes an additional uncharacterized region of approximately 115 residues that is predicted to mediate ring cleavage. Processing of X-ray diffraction data to 1.5 Å resolution revealed that BoxC{sub C} crystallizedmore » with two molecules in the asymmetric unit of the P2{sub 1}2{sub 1}2{sub 1} space group, with a solvent content of 47% and a Matthews coefficient of 2.32 Å{sup 3} Da{sup −1}. Selenomethionine BoxC{sub C} has been purified and crystals are currently being refined for anomalous dispersion studies.« less

  13. Micro X-ray diffraction analysis of thin films using grazing-exit conditions.

    PubMed

    Noma, T; Iida, A

    1998-05-01

    An X-ray diffraction technique using a hard X-ray microbeam for thin-film analysis has been developed. To optimize the spatial resolution and the surface sensitivity, the X-ray microbeam strikes the sample surface at a large glancing angle while the diffracted X-ray signal is detected with a small (grazing) exit angle. Kirkpatrick-Baez optics developed at the Photon Factory were used, in combination with a multilayer monochromator, for focusing X-rays. The focused beam size was about 10 x 10 micro m. X-ray diffraction patterns of Pd, Pt and their layered structure were measured. Using a small exit angle, the signal-to-background ratio was improved due to a shallow escape depth. Under the grazing-exit condition, the refraction effect of diffracted X-rays was observed, indicating the possibility of surface sensitivity.

  14. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less

  15. Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.

    PubMed

    Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B

    1994-05-13

    Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.

  16. Performance of the x-ray free-electron laser oscillator with crystal cavity

    NASA Astrophysics Data System (ADS)

    Lindberg, R. R.; Kim, K.-J.; Shvyd'Ko, Yu.; Fawley, W. M.

    2011-01-01

    Simulations of the x-ray free-electron laser (FEL) oscillator are presented that include the frequency-dependent Bragg crystal reflectivity and the transverse diffraction and focusing using the two-dimensional FEL code GINGER. A review of the physics of Bragg crystal reflectors and the x-ray FEL oscillator is made, followed by a discussion of its numerical implementation in GINGER. The simulation results for a two-crystal cavity and realistic FEL parameters indicate ˜109 photons in a nearly Fourier-limited, ps pulse. Compressing the electron beam to 100 A and 100 fs results in comparable x-ray characteristics for relaxed beam emittance, energy spread, and/or undulator parameters, albeit in a larger radiation bandwidth. Finally, preliminary simulation results indicate that the four-crystal FEL cavity can be tuned in energy over a range of a few percent.

  17. Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

    2008-07-01

    Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

  18. Production, Purification, Crystallization and Preliminary X-ray Structural Studies of Adeno-Associated Virus Serotype 5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DiMattia,M.; Govindasamy, L.; Levy, H.

    2005-01-01

    Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Angstroms resolution using synchrotron radiation and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c =more » 629.7 Angstroms. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

  19. Preliminary in situ and real-time study of directional solidification of metallic alloys by x-ray imaging techniques

    NASA Astrophysics Data System (ADS)

    Nguyen Thi, H.; Jamgotchian, H.; Gastaldi, J.; Härtwig, J.; Schenk, T.; Klein, H.; Billia, B.; Baruchel, J.; Dabo, Y.

    2003-05-01

    During directional solidification of a binary alloy, the solid-liquid interface exhibits a variety of patterns that are due to the Mullins-Sekerka instability and governed by the growth conditions. It is well known that properties of the grown material are largely controlled by the microstructures left in the solid during processing. Thus, a precise mastering of the solidification is essential to tailor products in a reproducible fashion to a specified quality. One major difficulty for this study is the real-time and in situ observation of the interface, especially for metallic alloys. A possibility is to use an intense and coherent third generation x-ray beam. By combining different x-ray imaging techniques (absorption/phase contrast radiography and diffraction topography), we have studied the directional melting and solidification of aluminium-based alloys. The preliminary results show the great potential of these techniques for the study of the coupling between stress effects and microstructure formation in solidification processing.

  20. Micromorphology of sialoliths in submandibular salivary gland: a scanning electron microscope and X-ray diffraction analysis.

    PubMed

    Kasaboğlu, Oğuzcan; Er, Nuray; Tümer, Celal; Akkocaoğlu, Murat

    2004-10-01

    Sialoliths are common in the submandibular gland and its duct system. The exact cause of formation of a sialolith is still a matter of debate. The aim of this study was to analyze 6 sialoliths ultrastructurally to determine their development mechanism in the submandibular salivary glands. Six sialoliths retrieved from the hilus and duct of the submandibular salivary glands of 6 patients with sialadenitis were analyzed ultrastructurally by scanning electron microscope and x-ray diffractometer. Scanning electron microscope revealed mainly irregular, partly rudely hexagonal, needle-like and plate-shaped crystals. The cross-section from the surface to the inner part of the sialoliths showed no organic material. X-ray diffraction showed that the sialoliths were composed of hydroxyapatite crystals. Energy dispersive x-ray microanalysis showed that all of the samples contained high levels of Ca and P, and small amounts of Mg, Na, Cl, Si, Fe, and K. The main structures of the submandibular sialoliths were found to be hydroxyapatite crystals. No organic cores were observed in the central parts of the sialoliths. In accordance with these preliminary results, sialoliths in the submandibular salivary glands may arise secondary to sialadenitis, but not via a luminal organic nidus.

  1. X-ray transparent microfluidic chips for high-throughput screening and optimization of in meso membrane protein crystallization

    PubMed Central

    Schieferstein, Jeremy M.; Pawate, Ashtamurthy S.; Wan, Frank; Sheraden, Paige N.; Broecker, Jana; Ernst, Oliver P.; Gennis, Robert B.

    2017-01-01

    Elucidating and clarifying the function of membrane proteins ultimately requires atomic resolution structures as determined most commonly by X-ray crystallography. Many high impact membrane protein structures have resulted from advanced techniques such as in meso crystallization that present technical difficulties for the set-up and scale-out of high-throughput crystallization experiments. In prior work, we designed a novel, low-throughput X-ray transparent microfluidic device that automated the mixing of protein and lipid by diffusion for in meso crystallization trials. Here, we report X-ray transparent microfluidic devices for high-throughput crystallization screening and optimization that overcome the limitations of scale and demonstrate their application to the crystallization of several membrane proteins. Two complementary chips are presented: (1) a high-throughput screening chip to test 192 crystallization conditions in parallel using as little as 8 nl of membrane protein per well and (2) a crystallization optimization chip to rapidly optimize preliminary crystallization hits through fine-gradient re-screening. We screened three membrane proteins for new in meso crystallization conditions, identifying several preliminary hits that we tested for X-ray diffraction quality. Further, we identified and optimized the crystallization condition for a photosynthetic reaction center mutant and solved its structure to a resolution of 3.5 Å. PMID:28469762

  2. Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

    PubMed Central

    Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

    2006-01-01

    Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

  3. Design and analysis of multilayer x ray/XUV microscope

    NASA Technical Reports Server (NTRS)

    Shealy, David L.

    1990-01-01

    The design and analysis of a large number of normal incidence multilayer x ray microscopes based on the spherical mirror Schwarzschild configuration is examined. Design equations for the spherical mirror Schwarzschild microscopes are summarized and used to evaluate mirror parameters for microscopes with magnifications ranging from 2 to 50x. Ray tracing and diffraction analyses are carried out for many microscope configurations to determine image resolution as a function of system parameters. The results are summarized in three publication included herein. A preliminary study of advanced reflecting microscope configurations, where aspherics are used in place of the spherical microscope mirror elements, has indicated that the aspherical elements will improve off-axis image resolution and increase the effective field of view.

  4. X-ray diffraction from shock-loaded polycrystals.

    PubMed

    Swift, Damian C

    2008-01-01

    X-ray diffraction was demonstrated from shock-compressed polycrystalline metals on nanosecond time scales. Laser ablation was used to induce shock waves in polycrystalline foils of Be, 25-125 microm thick. A second laser pulse was used to generate a plasma x-ray source by irradiation of a Ti foil. The x-ray source was collimated to produce a beam of controllable diameter, which was directed at the Be sample. X-rays were diffracted from the sample, and detected using films and x-ray streak cameras. The diffraction angle was observed to change with shock pressure. The diffraction angles were consistent with the uniaxial (elastic) and isotropic (plastic) compressions expected for the loading conditions used. Polycrystalline diffraction will be used to measure the response of the crystal lattice to high shock pressures and through phase changes.

  5. Single-pulse x-ray diffraction using polycapillary optics for in situ dynamic diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maddox, B. R., E-mail: maddox3@llnl.gov; Akin, M. C., E-mail: akin1@llnl.gov; Teruya, A.

    2016-08-15

    Diagnostic use of single-pulse x-ray diffraction (XRD) at pulsed power facilities can be challenging due to factors such as the high flux and brightness requirements for diffraction and the geometric constraints of experimental platforms. By necessity, the x-ray source is usually positioned very close, within a few inches of the sample. On dynamic compression platforms, this puts the x-ray source in the debris field. We coupled x-ray polycapillary optics to a single-shot needle-and-washer x-ray diode source using a laser-based alignment scheme to obtain high-quality x-ray diffraction using a single 16 ns x-ray pulse with the source >1 m from themore » sample. The system was tested on a Mo sample in reflection geometry using 17 keV x-rays from a Mo anode. We also identified an anode conditioning effect that increased the x-ray intensity by 180%. Quantitative measurements of the x-ray focal spot produced by the polycapillary yielded a total x-ray flux on the sample of 3.3 ± 0.5 × 10{sup 7} molybdenum Kα photons.« less

  6. Development of an X-ray prism for a combined diffraction enhanced imaging and fluorescence imaging system

    NASA Astrophysics Data System (ADS)

    Bewer, Brian E.

    Analyzer crystal based imaging techniques such as diffraction enhanced imaging (DEI) and multiple imaging radiography (MIR) utilize the Bragg peak of perfect crystal diffraction to convert angular changes into intensity changes. These X-ray techniques extend the capability of conventional radiography, which derives image contrast from absorption, by providing a large change in intensity for a small angle change introduced by the X-ray beam traversing the sample. Objects that have very little absorption contrast may have considerable refraction and ultra small angle X-ray scattering (USAXS) contrast thus improving visualization and extending the utility of X-ray imaging. To improve on the current DEI technique this body of work describes the design of an X-ray prism (XRP) included in the imaging system which allows the analyzer crystal to be aligned anywhere on the rocking curve without moving the analyzer from the Bragg angle. By using the XRP to set the rocking curve alignment rather than moving the analyzer crystal physically the needed angle sensitivity is changed from muradians for direct mechanical movement of the analyzer crystal to milliradian control for movement the XRP angle. In addition to using an XRP for the traditional DEI acquisition method of two scans on opposite sides of the rocking curve preliminary tests will be presented showing the potential of using an XRP to scan quickly through the entire rocking curve. This has the benefit of collecting all the required data for image reconstruction in a single fast measurement thus removing the occurrence of motion artifacts for each point or line used during a scan. The XRP design is also intended to be compatible with combined imaging systems where more than one technique is used to investigate a sample. Candidates for complimentary techniques are investigated and measurements from a combined X-ray imaging system are presented.

  7. X-Ray Diffraction Apparatus

    NASA Technical Reports Server (NTRS)

    Blake, David F. (Inventor); Bryson, Charles (Inventor); Freund, Friedmann (Inventor)

    1996-01-01

    An x-ray diffraction apparatus for use in analyzing the x-ray diffraction pattern of a sample is introduced. The apparatus includes a beam source for generating a collimated x-ray beam having one or more discrete x-ray energies, a holder for holding the sample to be analyzed in the path of the beam, and a charge-coupled device having an array of pixels for detecting, in one or more selected photon energy ranges, x-ray diffraction photons produced by irradiating such a sample with said beam. The CCD is coupled to an output unit which receives input information relating to the energies of photons striking each pixel in the CCD, and constructs the diffraction pattern of photons within a selected energy range striking the CCD.

  8. A Novel X-ray Diffractometer for the Florida Split Coil 25 Tesla Magnet

    NASA Astrophysics Data System (ADS)

    Wang, Shengyu; Kovalev, Alexey; Suslov, Alexey; Siegrist, Theo

    2014-03-01

    At National High Magnetic Field Laboratory (NHMFL), we are developing a unique X-ray diffractometer for the 25 Tesla Florida Split Coil Magnet for scattering experiments under extremely high static magnetic fields. The X-ray source is a sealed tube (copper or molybdenum anode), connected to the magnet by an evacuated beam tunnel. The detectors are either an image plate or a silicon drift detector, with the data acquisition system based on LabVIEW. Our preliminary experimental results showed that the performance of the detector electronics and the X-ray generator is reliable in the fringe magnetic fields produced at the highest field of 25 T. Using this diffractometer, we will make measurements on standard samples, such as LaB6, Al2O3 and Si, to calibrate the diffraction system. Magnetic samples, such as single crystal HoMnO3 and stainless steel 301 alloys will be measured subsequently. The addition of X-ray diffraction to the unique split coil magnet will significantly expand the NHMFL experimental capabilities. Therefore, external users will be able to probe spin - lattice interactions at static magnetic fields up to 25T. This project is supported by NSF-DMR Award No.1257649. NHMFL is supported by NSF Cooperative Agreement No. DMR-1157490, the State of Florida, and the U.S. DoE.

  9. Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

    Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

  10. Toward Sodium X-Ray Diffraction in the High-Pressure Regime

    NASA Astrophysics Data System (ADS)

    Gong, X.; Polsin, D. N.; Rygg, J. R.; Boehly, T. R.; Crandall, L.; Henderson, B. J.; Hu, S. X.; Huff, M.; Saha, R.; Collins, G. W.; Smith, R.; Eggert, J.; Lazicki, A. E.; McMahon, M.

    2017-10-01

    We are working to quasi-isentropically compress sodium into the terapascal regime to test theoretical predictions that sodium transforms to an electride. A series of hydrodynamic simulations have been performed to design experiments to investigate the structure and optical properties of sodium at pressures up to 500 GPa. We show preliminary results where sodium samples, sandwiched between diamond plates and lithium-fluoride windows, are ramp compressed by a gradual increase in the drive-laser intensity. The low sound speed in sodium makes it particularly susceptible to forming a shock; therefore, it is difficult to compress without melting the sample. Powder x-ray diffraction is used to provide information on the structure of sodium at these high pressures. This material is based upon work supported by the Department of Energy National Nuclear Security Administration under Award Number DE-NA0001944.

  11. Crystallization and preliminary X-ray diffraction analysis of crotoxin B from Crotalus durissus collilineatus venom

    PubMed Central

    Salvador, G. H. M.; Fernandes, C. A. H.; Corrêa, L. C.; Santos-Filho, N. A.; Soares, A. M.; Fontes, M. R. M.

    2009-01-01

    Crotoxin B is a basic phospholipase A2 found in the venom of several Crotalus durissus ssp. rattlesnakes and is one of the subunits that constitute crotoxin, the main component of the venom of these snakes. This heterodimeric toxin is related to important envenomation effects such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, the first structural data only became available in 2007 (for crotoxin B from C. durissus terrificus) and showed an ambiguous result for the biological assembly, which could be either dimeric or tetrameric. In this work, the crystallization, X-ray diffraction data collection at 2.2 Å resolution and molecular-replacement solution of a dimeric complex formed by two crotoxin B isoforms from C. durissus collilineatus venom is presented. PMID:19851009

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiyota, Eduardo; Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP; Sousa, Sylvia Morais de

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automatedmore » molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.« less

  13. Real-time X-ray Diffraction: Applications to Materials Characterization

    NASA Technical Reports Server (NTRS)

    Rosemeier, R. G.

    1984-01-01

    With the high speed growth of materials it becomes necessary to develop measuring systems which also have the capabilities of characterizing these materials at high speeds. One of the conventional techniques of characterizing materials was X-ray diffraction. Film, which is the oldest method of recording the X-ray diffraction phenomenon, is not quite adequate in most circumstances to record fast changing events. Even though conventional proportional counters and scintillation counters can provide the speed necessary to record these changing events, they lack the ability to provide image information which may be important in some types of experiment or production arrangements. A selected number of novel applications of using X-ray diffraction to characterize materials in real-time are discussed. Also, device characteristics of some X-ray intensifiers useful in instantaneous X-ray diffraction applications briefly presented. Real-time X-ray diffraction experiments with the incorporation of image X-ray intensification add a new dimension in the characterization of materials. The uses of real-time image intensification in laboratory and production arrangements are quite unlimited and their application depends more upon the ingenuity of the scientist or engineer.

  14. Radiation damage free ghost diffraction with atomic resolution

    DOE PAGES

    Li, Zheng; Medvedev, Nikita; Chapman, Henry N.; ...

    2017-12-21

    The x-ray free electron lasers can enable diffractive structural determination of protein nanocrystals and single molecules that are too small and radiation-sensitive for conventional x-ray diffraction. However the electronic form factor may be modified during the ultrashort x-ray pulse due to photoionization and electron cascade caused by the intense x-ray pulse. For general x-ray imaging techniques, the minimization of the effects of radiation damage is of major concern to ensure reliable reconstruction of molecular structure. Here in this paper, we show that radiation damage free diffraction can be achieved with atomic spatial resolution by using x-ray parametric down-conversion and ghostmore » diffraction with entangled photons of x-ray and optical frequencies. We show that the formation of the diffraction patterns satisfies a condition analogous to the Bragg equation, with a resolution that can be as fine as the crystal lattice length scale of several Ångstrom. Since the samples are illuminated by low energy optical photons, they can be free of radiation damage.« less

  15. Radiation damage free ghost diffraction with atomic resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zheng; Medvedev, Nikita; Chapman, Henry N.

    The x-ray free electron lasers can enable diffractive structural determination of protein nanocrystals and single molecules that are too small and radiation-sensitive for conventional x-ray diffraction. However the electronic form factor may be modified during the ultrashort x-ray pulse due to photoionization and electron cascade caused by the intense x-ray pulse. For general x-ray imaging techniques, the minimization of the effects of radiation damage is of major concern to ensure reliable reconstruction of molecular structure. Here in this paper, we show that radiation damage free diffraction can be achieved with atomic spatial resolution by using x-ray parametric down-conversion and ghostmore » diffraction with entangled photons of x-ray and optical frequencies. We show that the formation of the diffraction patterns satisfies a condition analogous to the Bragg equation, with a resolution that can be as fine as the crystal lattice length scale of several Ångstrom. Since the samples are illuminated by low energy optical photons, they can be free of radiation damage.« less

  16. Synchrotron Radiation X-ray Diffraction Techniques Applied to Insect Flight Muscle.

    PubMed

    Iwamoto, Hiroyuki

    2018-06-13

    X-ray fiber diffraction is a powerful tool used for investigating the molecular structure of muscle and its dynamics during contraction. This technique has been successfully applied not only to skeletal and cardiac muscles of vertebrates but also to insect flight muscle. Generally, insect flight muscle has a highly ordered structure and is often capable of high-frequency oscillations. The X-ray diffraction studies on muscle have been accelerated by the advent of 3rd-generation synchrotron radiation facilities, which can generate brilliant and highly oriented X-ray beams. This review focuses on some of the novel experiments done on insect flight muscle by using synchrotron radiation X-rays. These include diffraction recordings from single myofibrils within a flight muscle fiber by using X-ray microbeams and high-speed diffraction recordings from the flight muscle during the wing-beat of live insects. These experiments have provided information about the molecular structure and dynamic function of flight muscle in unprecedented detail. Future directions of X-ray diffraction studies on muscle are also discussed.

  17. The effect of preliminary hydrolysis on the properties of ZrO2-7% Y2O3 powders prepared by hydroxide precipitation

    NASA Astrophysics Data System (ADS)

    Zhirenkina, Nina V.; Mashkovtsev, Maxim A.; Bereskina, Polina A.; Zakirov, Ilsur F.; Baksheev, Evgenie O.; Bujnachev, Sergey V.; Vereshchagin, Artem O.

    2017-09-01

    In this study, the effect of preliminary hydrolysis of zirconyl oxysulfate on the properties of ZrO2-7 % Y2O3 powders prepared by hydroxides precipitation at a constant pH of 5 was studied. X-ray diffraction analysis showed the monophasic nature of the samples and the insignificant difference between CSR (coherent scattering regions). Samples differed in particle size distribution, porosity and morphology.

  18. Dynamic fracture toughness of cellulose-fiber-reinforced polypropylene : preliminary investigation of microstructural effects

    Treesearch

    Craig M. Clemons; Daniel F. Caulfield; A. Jeffrey Giacomin

    1999-10-01

    In this study, the microstructure of injection-molded polypropylene reinforced with cellulose fiber was investigated. Scanning electron microscopy of the fracture surfaces and X-ray diffraction were used to investigate fiber orientation. The polypropylene matrix was removed by solvent extraction, and the lengths of the residual fibers were optically determined. Fiber...

  19. Combining experiment and optical simulation in coherent X-ray nanobeam characterization of Si/SiGe semiconductor heterostructures

    DOE PAGES

    Tilka, J. A.; Park, J.; Ahn, Y.; ...

    2016-07-06

    Here, the highly coherent and tightly focused x-ray beams produced by hard x-ray light sources enable the nanoscale characterization of the structure of electronic materials but are accompanied by significant challenges in the interpretation of diffraction and scattering patterns. X-ray nanobeams exhibit optical coherence combined with a large angular divergence introduced by the x-ray focusing optics. The scattering of nanofocused x-ray beams from intricate semiconductor heterostructures produces a complex distribution of scattered intensity. We report here an extension of coherent xray optical simulations of convergent x-ray beam diffraction patterns to arbitrary x-ray incident angles to allow the nanobeam diffraction patternsmore » of complex heterostructures to be simulated faithfully. These methods are used to extract the misorientation of lattice planes and the strain of individual layers from synchrotron x-ray nanobeam diffraction patterns of Si/SiGe heterostructures relevant to applications in quantum electronic devices. The systematic interpretation of nanobeam diffraction patterns from semiconductor heterostructures presents a new opportunity in characterizing and ultimately designing electronic materials.« less

  20. Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Edward B.; Gurda-Whitaker, Brittney; Govindasamy, Lakshmanan

    2006-12-01

    Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. The diffraction data were subsequently processed and reduced with an overall R{sub sym} of 12.3% and a completeness of 89.0%. Based on the unit-cellmore » volume, rotation-function and translation-function results and packing considerations, there is one virus capsid (60 viral proteins) per unit cell and there are ten viral proteins per crystallographic asymmetric unit. The AAV1 capsid shares both the twofold and threefold crystallographic symmetry operators. The AAV1 data have been initially phased using a polyalanine model (based on the crystal structure of AAV4) to 4.0 Å resolution and the structure determination and refinement is in progress using tenfold noncrystallographic symmetry electron-density averaging.« less

  1. Fabrication and testing of a newly designed slit system for depth-resolved X-ray diffraction measurements

    DOE PAGES

    Sinsheimer, John; Bouet, Nathalie; Ghose, Sanjit; ...

    2016-10-06

    A new system of slits called `spiderweb slits' have been developed for depth-resolved powder or polycrystalline X-ray diffraction measurements. The slits act on diffracted X-rays to select a particular gauge volume of sample, while absorbing diffracted X-rays from outside of this volume. Although the slit geometry is to some extent similar to that of previously developed conical slits or spiral slits, this new design has advantages over the previous ones in use for complex heterogeneous materials and in situ and operando diffraction measurements. For example, the slits can measure a majority of any diffraction cone for any polycrystalline material, overmore » a continuous range of diffraction angles, and work for X-ray energies of tens to hundreds of kiloelectronvolts. In addition, the design is generated and optimized using ray-tracing simulations, and fabricated through laser micromachining. The first prototype was successfully tested at the X17A beamline at the National Synchrotron Light Source, and shows similar performance to simulations, demonstrating gauge volume selection for standard powders, for all diffraction peaks over angles of 2–10°. A similar, but improved, design will be implemented at the X-ray Powder Diffraction beamline at the National Synchrotron Light Source II.« less

  2. Cloning, expression, purification and preliminary crystallographic characterization of a shikimate dehydrogenase from Corynebacterium glutamicum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schoepe, Jan, E-mail: jschoepe@smail.uni-koeln.de; Niefind, Karsten; Chatterjee, Shivani

    2006-07-01

    The crystallization and preliminary X-ray characterization of a shikimate dehydrogenase from C. glutamicum is presented. The shikimate dehydrogenase from Corynebacterium glutamicum has been cloned into an Escherichia coli expression vector, overexpressed and purified. Native crystals were obtained by the vapour-diffusion technique using 2-methyl-2,4-pentanediol as a precipitant. The crystals belong to the centred monoclinic space group C2, with unit-cell parameters a = 118.77, b = 63.17, c = 35.67 Å, β = 92.26° (at 100 K), and diffract to 1.64 Å on a synchrotron X-ray source. The asymmetric unit is likely to contain one molecule, corresponding to a packing density ofmore » 2.08 Å{sup 3} Da{sup −1} and a solvent content of about 41%.« less

  3. Dynamical scattering in coherent hard x-ray nanobeam Bragg diffraction

    NASA Astrophysics Data System (ADS)

    Pateras, A.; Park, J.; Ahn, Y.; Tilka, J. A.; Holt, M. V.; Kim, H.; Mawst, L. J.; Evans, P. G.

    2018-06-01

    Unique intensity features arising from dynamical diffraction arise in coherent x-ray nanobeam diffraction patterns of crystals having thicknesses larger than the x-ray extinction depth or exhibiting combinations of nanoscale and mesoscale features. We demonstrate that dynamical scattering effects can be accurately predicted using an optical model combined with the Darwin theory of dynamical x-ray diffraction. The model includes the highly divergent coherent x-ray nanobeams produced by Fresnel zone plate focusing optics and accounts for primary extinction, multiple scattering, and absorption. The simulation accurately reproduces the dynamical scattering features of experimental diffraction patterns acquired from a GaAs/AlGaAs epitaxial heterostructure on a GaAs (001) substrate.

  4. Coherent x-ray diffraction imaging with nanofocused illumination.

    PubMed

    Schroer, C G; Boye, P; Feldkamp, J M; Patommel, J; Schropp, A; Schwab, A; Stephan, S; Burghammer, M; Schöder, S; Riekel, C

    2008-08-29

    Coherent x-ray diffraction imaging is an x-ray microscopy technique with the potential of reaching spatial resolutions well beyond the diffraction limits of x-ray microscopes based on optics. However, the available coherent dose at modern x-ray sources is limited, setting practical bounds on the spatial resolution of the technique. By focusing the available coherent flux onto the sample, the spatial resolution can be improved for radiation-hard specimens. A small gold particle (size <100 nm) was illuminated with a hard x-ray nanobeam (E=15.25 keV, beam dimensions approximately 100 x 100 nm2) and is reconstructed from its coherent diffraction pattern. A resolution of about 5 nm is achieved in 600 s exposure time.

  5. Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

    PubMed

    Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

    2011-02-01

    Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

  6. DynAMITe: a prototype large area CMOS APS for breast cancer diagnosis using x-ray diffraction measurements

    NASA Astrophysics Data System (ADS)

    Konstantinidis, A.; Anaxagoras, T.; Esposito, M.; Allinson, N.; Speller, R.

    2012-03-01

    X-ray diffraction studies are used to identify specific materials. Several laboratory-based x-ray diffraction studies were made for breast cancer diagnosis. Ideally a large area, low noise, linear and wide dynamic range digital x-ray detector is required to perform x-ray diffraction measurements. Recently, digital detectors based on Complementary Metal-Oxide- Semiconductor (CMOS) Active Pixel Sensor (APS) technology have been used in x-ray diffraction studies. Two APS detectors, namely Vanilla and Large Area Sensor (LAS), were developed by the Multidimensional Integrated Intelligent Imaging (MI-3) consortium to cover a range of scientific applications including x-ray diffraction. The MI-3 Plus consortium developed a novel large area APS, named as Dynamically Adjustable Medical Imaging Technology (DynAMITe), to combine the key characteristics of Vanilla and LAS with a number of extra features. The active area (12.8 × 13.1 cm2) of DynaMITe offers the ability of angle dispersive x-ray diffraction (ADXRD). The current study demonstrates the feasibility of using DynaMITe for breast cancer diagnosis by identifying six breast-equivalent plastics. Further work will be done to optimize the system in order to perform ADXRD for identification of suspicious areas of breast tissue following a conventional mammogram taken with the same sensor.

  7. Resolution enhancement in coherent x-ray diffraction imaging by overcoming instrumental noise.

    PubMed

    Kim, Chan; Kim, Yoonhee; Song, Changyong; Kim, Sang Soo; Kim, Sunam; Kang, Hyon Chol; Hwu, Yeukuang; Tsuei, Ku-Ding; Liang, Keng San; Noh, Do Young

    2014-11-17

    We report that reference objects, strong scatterers neighboring weak phase objects, enhance the phase retrieval and spatial resolution in coherent x-ray diffraction imaging (CDI). A CDI experiment with Au nano-particles exhibited that the reference objects amplified the signal-to-noise ratio in the diffraction intensity at large diffraction angles, which significantly enhanced the image resolution. The interference between the diffracted x-ray from reference objects and a specimen also improved the retrieval of the phase of the diffraction signal. The enhancement was applied to image NiO nano-particles and a mitochondrion and confirmed in a simulation with a bacteria phantom. We expect that the proposed method will be of great help in imaging weakly scattering soft matters using coherent x-ray sources including x-ray free electron lasers.

  8. Crystallization and preliminary crystallographic analysis of a family 43 β-d-xylosidase from Geobacillus stearothermophilus T-6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brüx, Christian; Niefind, Karsten; Ben-David, Alon

    2005-12-01

    The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less

  9. Biological imaging by soft X-ray diffraction microscopy

    NASA Astrophysics Data System (ADS)

    Shapiro, David

    We have developed a microscope for soft x-ray diffraction imaging of dry or frozen hydrated biological specimens. This lensless imaging system does not suffer from the resolution or specimen thickness limitations that other short wavelength microscopes experience. The microscope, currently situated at beamline 9.0.1 of the Advanced Light Source, can collect diffraction data to 12 nm resolution with 750 eV photons and 17 nm resolution with 520 eV photons. The specimen can be rotated with a precision goniometer through an angle of 160 degrees allowing for the collection of nearly complete three-dimensional diffraction data. The microscope is fully computer controlled through a graphical user interface and a scripting language automates the collection of both two-dimensional and three-dimensional data. Diffraction data from a freeze-dried dwarf yeast cell, Saccharomyces cerevisiae carrying the CLN3-1 mutation, was collected to 12 run resolution from 8 specimen orientations spanning a total rotation of 8 degrees. The diffraction data was phased using the difference map algorithm and the reconstructions provide real space images of the cell to 30 nm resolution from each of the orientations. The agreement of the different reconstructions provides confidence in the recovered, and previously unknown, structure and indicates the three dimensionality of the cell. This work represents the first imaging of the natural complex refractive contrast from a whole unstained cell by the diffraction microscopy method and has achieved a resolution superior to lens based x-ray tomographic reconstructions of similar specimens. Studies of the effects of exposure to large radiation doses were also carried out. It was determined that the freeze-dried cell suffers from an initial collapse, which is followed by a uniform, but slow, shrinkage. This structural damage to the cell is not accompanied by a diminished ability to see small features in the specimen. Preliminary measurements on frozen-hydrated yeast indicate that the frozen specimens do not exhibit these changes even with doses as high as 5 x 109 Gray.

  10. Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu

    2006-12-01

    Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less

  11. Fabrication and testing of a newly designed slit system for depth-resolved X-ray diffraction measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinsheimer, John; Bouet, Nathalie; Ghose, Sanjit

    2016-10-06

    A new system of slits called `spiderweb slits' have been developed for depth-resolved powder or polycrystalline X-ray diffraction measurements. The slits act on diffracted X-rays to select a particular gauge volume of sample, while absorbing diffracted X-rays from outside of this volume. Although the slit geometry is to some extent similar to that of previously developed conical slits or spiral slits, this new design has advantages over the previous ones in use for complex heterogeneous materials andin situandoperandodiffraction measurements. For example, the slits can measure a majority of any diffraction cone for any polycrystalline material, over a continuous range ofmore » diffraction angles, and work for X-ray energies of tens to hundreds of kiloelectronvolts. The design is generated and optimized using ray-tracing simulations, and fabricated through laser micromachining. The first prototype was successfully tested at the X17A beamline at the National Synchrotron Light Source, and shows similar performance to simulations, demonstrating gauge volume selection for standard powders, for all diffraction peaks over angles of 2–10°. A similar, but improved, design will be implemented at the X-ray Powder Diffraction beamline at the National Synchrotron Light Source II.« less

  12. Local terahertz field enhancement for time-resolved x-ray diffraction

    DOE PAGES

    Kozina, M.; Pancaldi, M.; Bernhard, C.; ...

    2017-02-20

    We report local field strength enhancement of single-cycle terahertz (THz) pulses in an ultrafast time-resolved x-ray diffraction experiment. We show that patterning the sample with gold microstructures increases the THz field without changing the THz pulse shape or drastically affecting the quality of the x-ray diffraction pattern. Lastly, we find a five-fold increase in THz-induced x-ray diffraction intensity change in the presence of microstructures on a SrTiO 3 thin-film sample.

  13. Local terahertz field enhancement for time-resolved x-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kozina, M.; Pancaldi, M.; Bernhard, C.

    We report local field strength enhancement of single-cycle terahertz (THz) pulses in an ultrafast time-resolved x-ray diffraction experiment. We show that patterning the sample with gold microstructures increases the THz field without changing the THz pulse shape or drastically affecting the quality of the x-ray diffraction pattern. Lastly, we find a five-fold increase in THz-induced x-ray diffraction intensity change in the presence of microstructures on a SrTiO 3 thin-film sample.

  14. Thermal x-ray diffraction and near-field phase contrast imaging

    NASA Astrophysics Data System (ADS)

    Li, Zheng; Classen, Anton; Peng, Tao; Medvedev, Nikita; Wang, Fenglin; Chapman, Henry N.; Shih, Yanhua

    2017-10-01

    Using higher-order coherence of thermal light sources, the resolution power of standard x-ray imaging techniques can be enhanced. In this work, we applied the higher-order measurement to far-field x-ray diffraction and near-field phase contrast imaging (PCI), in order to achieve superresolution in x-ray diffraction and obtain enhanced intensity contrast in PCI. The cost of implementing such schemes is minimal compared to the methods that achieve similar effects by using entangled x-ray photon pairs.

  15. Thermal x-ray diffraction and near-field phase contrast imaging

    DOE PAGES

    Li, Zheng; Classen, Anton; Peng, Tao; ...

    2017-12-27

    Using higher-order coherence of thermal light sources, the resolution power of standard x-ray imaging techniques can be enhanced. Here in this work, we applied the higher-order measurement to far-field x-ray diffraction and near-field phase contrast imaging (PCI), in order to achieve superresolution in x-ray diffraction and obtain enhanced intensity contrast in PCI. The cost of implementing such schemes is minimal compared to the methods that achieve similar effects by using entangled x-ray photon pairs.

  16. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    PubMed Central

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-01-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

  17. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

    PubMed

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-11-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

  18. X-ray diffraction studies of enkephalins. Crystal structure of [(4'-bromo) Phe4,Leu5]enkephalin.

    PubMed Central

    Ishida, T; Kenmotsu, M; Mino, Y; Inoue, M; Fujiwara, T; Tomita, K; Kimura, T; Sakakibara, S

    1984-01-01

    In order to investigate the structure-activity relationship of [Leu5]- and [Met5]enkephalins, [(4'-bromo)Phe4, Leu5]-, [(4'-bromo)Phe4, Met5]- and [Met5] enkephalins were synthesized and crystallized. The crystal structure of [(4'-bromo) Phe4, Leu5]- enkephalin was determined by X-ray diffraction method using the heavy atom method and refined to R = 0.092 by the least-squares method. The molecule in this crystal took essentially the same type I' beta-turn conformation found in [Leu5]enkephalin [Smith & Griffin (1978) Science 199, 1214-1216). On the other hand, the preliminary three-dimensional Patterson analyses showed that the most probable conformations of [(4'-bromo)Phe4,Met5]- and [Met5]enkephalins are both the dimeric extended forms. Based on these insights, the biologically active conformation of enkephalin was discussed in relation to the mu- and delta-receptors. PMID:6721829

  19. Isolation, crystallization in the macrogravitation field, preliminary X-ray investigation of uridine phosphorylase from Escherichia coli K-12.

    PubMed

    Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S

    1992-03-01

    Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.

  20. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

    2006-01-01

    Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

  1. Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com

    Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less

  2. Strategies for Time-resolved X-ray Diffraction of Phase Transitions with Laser Compression

    NASA Astrophysics Data System (ADS)

    Benedetti, Laura Robin; Eggert, J. H.; Bradley, D. K.; Bell, P. M.; Kilkenny, J. D.; Palmer, N.; Petre, R. B.; Rygg, J. R.; Sorce, C.; Collins, G. W.; Boehly, T. R.

    2017-10-01

    As part of a program to document kinetics of phase transitions under laser-driven dynamic compression, we are designing a platform to make multiple x-ray diffraction measurements during a single laser experiment. Our plans include experimental development at Omega-EP and eventual implementation at NIF. We will present our strategy for designing a robust platform that can effectively document a wide variety of phase transformations by utilizing both streaked and multiple-frame imaging detectors. Preliminary designs utilize a novel CMOS detector designed by Sandia National Lab. Our initial experiments include scoping studies that will focus on photometrics and shielding requirements in the high EMP environment close to the target. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. Lawrence Livermore National Security, LLC, LLNL-ABS-734470.

  3. An image focusing means by using an opaque object to diffract x-rays

    DOEpatents

    Sommargren, Gary E.; Weaver, H. Joseph

    1991-01-01

    The invention provides a method and apparatus for focusing and imaging x-rays. An opaque sphere is used as a diffractive imaging element to diffract x-rays from an object so that the divergent x-ray wavefronts are transformed into convergent wavefronts and are brought to focus to form an image of the object with a large depth of field.

  4. Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

    2014-02-19

    The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

  5. Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell

    DOE PAGES

    Huang, Xiaojing; Nelson, Johanna; Kirz, Janos; ...

    2009-11-01

    We report the first image of an intact, frozen hydrated eukaryotic cell using x-ray diffraction microscopy, or coherent x-ray diffraction imaging. By plunge freezing the specimen in liquid ethane and maintaining it below -170 °C, artifacts due to dehydration, ice crystallization, and radiation damage are greatly reduced. In this example, coherent diffraction data using 520 eV x rays were recorded and reconstructed to reveal a budding yeast cell at a resolution better than 25 nm. This demonstration represents an important step towards high resolution imaging of cells in their natural, hydrated state, without limitations imposed by x-ray optics.

  6. Expression, purification and preliminary X-ray diffraction studies of VERNALIZATION1208–341 from Arabidopsis thaliana

    PubMed Central

    King, Gordon; Hill, Justine M.; Martin, Jennifer L.; Mylne, Joshua S.

    2009-01-01

    VERNALIZATION1 (VRN1) is required in the model plant Arabidopsis thaliana for the epigenetic suppression of the floral repressor FLC by prolonged cold treatment. Stable suppression of FLC accelerates flowering, a physiological process known as vernalization. VRN1 is a 341-residue DNA-binding protein that contains two plant-specific B3 domains (B3a and B3b), a putative nuclear localization sequence (NLS) and two putative PEST domains. VRN1208–341 includes the second B3 domain and a region upstream that is highly conserved in the VRN1 orthologues of other dicotyledonous plants. VRN1208–341 was crystallized by the hanging-drop method in 0.05 M sodium acetate pH 6.0 containing 1.0 M NaCl and 18%(w/v) PEG 3350. Preliminary X-ray diffraction data analysis revealed that the VRN1208–341 crystal diffracted to 2.1 Å and belonged to space group C2, with unit-cell parameters a = 105.2, b = 47.9, c = 61.2 Å, α = 90.0, β = 115.4, γ = 90.0°. Assuming that two molecules occupy the asymmetric unit, a Matthews coefficient of 2.05 Å3 Da−1 and a solvent content of 40.1% were calculated. PMID:19255487

  7. [Fine stereo structure for natural organic molecules, a preliminary study. II. Melting point influenced by structure factors].

    PubMed

    Lu, Y; Zheng, Q; Lu, D; Ma, P; Chen, Y

    1995-06-01

    Crystal structures of two compounds from Tripterygium wilfordii Hook f. have been determined by X-ray diffraction method. Structure factors influencing melting point of solid state have been analysed. Crystal class (or space group), recrystallization solvent, force between molecules and fine changes of molecular structures will all cause melting point changes of crystal substance.

  8. Application of focused-beam flat-sample method to synchrotron powder X-ray diffraction with anomalous scattering effect

    NASA Astrophysics Data System (ADS)

    Tanaka, M.; Katsuya, Y.; Matsushita, Y.

    2013-03-01

    The focused-beam flat-sample method (FFM), which is a method for high-resolution and rapid synchrotron X-ray powder diffraction measurements by combination of beam focusing optics, a flat shape sample and an area detector, was applied for diffraction experiments with anomalous scattering effect. The advantages of FFM for anomalous diffraction were absorption correction without approximation, rapid data collection by an area detector and good signal-to-noise ratio data by focusing optics. In the X-ray diffraction experiments of CoFe2O4 and Fe3O4 (By FFM) using X-rays near the Fe K absorption edge, the anomalous scattering effect between Fe/Co or Fe2+/Fe3+ can be clearly detected, due to the change of diffraction intensity. The change of observed diffraction intensity as the incident X-ray energy was consistent with the calculation. The FFM is expected to be a method for anomalous powder diffraction.

  9. Rietveld analysis using powder diffraction data with anomalous scattering effect obtained by focused beam flat sample method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Masahiko, E-mail: masahiko@spring8.or.jp; Katsuya, Yoshio, E-mail: katsuya@spring8.or.jp; Sakata, Osami, E-mail: SAKATA.Osami@nims.go.jp

    2016-07-27

    Focused-beam flat-sample method (FFM) is a new trial for synchrotron powder diffraction method, which is a combination of beam focusing optics, flat shape powder sample and area detectors. The method has advantages for X-ray diffraction experiments applying anomalous scattering effect (anomalous diffraction), because of 1. Absorption correction without approximation, 2. High intensity X-rays of focused incident beams and high signal noise ratio of diffracted X-rays 3. Rapid data collection with area detectors. We applied the FFM to anomalous diffraction experiments and collected synchrotron X-ray powder diffraction data of CoFe{sub 2}O{sub 4} (inverse spinel structure) using X-rays near Fe K absorptionmore » edge, which can distinguish Co and Fe by anomalous scattering effect. We conducted Rietveld analyses with the obtained powder diffraction data and successfully determined the distribution of Co and Fe ions in CoFe{sub 2}O{sub 4} crystal structure.« less

  10. Characteristics of Volcanic Soils in Landslide during the 2016 Kumamoto Earthquake, Japan

    NASA Astrophysics Data System (ADS)

    Hazarika, H.; Fukuoka, H.; Kokusho, T.; Sumartini, O.; Bhoopendra, D.

    2017-12-01

    There were many seismic subsidence, debris flows, landslides and slope failures, which occurred in Aso area due to the 2016 Kumamoto earthquake, Japan. This research aims to determine the failure mechanism of many mild slopes, and elucidate the strength characteristics of volcanic soils collected from the sites. A series of undrained static and cyclic triaxial tests, ring shear tests and direct shear tests were performed. Also, for further understanding of volcanic soils' material strength, X-ray powder diffraction analysis (XRD), X-ray fluorescence analysis (XRF), and Scanning electron microscope analysis (SEM) were performed. In this paper, preliminary results of the experimental testing program are discussed.

  11. Characterization, crystallization and preliminary X-ray diffraction analysis of an (S)-specific esterase (pfEstA) from Pseudomonas fluorescens KCTC 1767: enantioselectivity for potential industrial applications.

    PubMed

    Kim, Seulgi; Ngo, Tri Duc; Kim, Kyeong Kyu; Kim, T Doohun

    2012-11-01

    The structures and reaction mechanisms of enantioselective hydrolases, which can be used in industrial applications such as biotransformations, are largely unknown. Here, the X-ray crystallographic study of a novel (S)-specific esterase (pfEstA) from Pseudomonas fluorescens KCTC 1767, which can be used in the production of (S)-ketoprofen, is described. Multiple sequence alignments with other hydrolases revealed that pfEstA contains a conserved Ser67 within the S-X-X-K motif as well as a highly conserved Tyr156. Recombinant protein containing an N-terminal His tag was expressed in Escherichia coli, purified to homogeneity and characterized using SDS-PAGE, MALDI-TOF MS and enantioselective analysis. pfEstA was crystallized using a solution consisting of 1 M sodium citrate, 0.1 M CHES pH 9.5, and X-ray diffraction data were collected to a resolution of 1.9 Å with an Rmerge of 7.9%. The crystals of pfEstA belonged to space group P2(1)2(1)2(1), with unit-cell parameters a=65.31, b=82.13, c=100.41 Å, α=β=γ=90°.

  12. Dynamical effects in Bragg coherent x-ray diffraction imaging of finite crystals

    NASA Astrophysics Data System (ADS)

    Shabalin, A. G.; Yefanov, O. M.; Nosik, V. L.; Bushuev, V. A.; Vartanyants, I. A.

    2017-08-01

    We present simulations of Bragg coherent x-ray diffractive imaging (CXDI) data from finite crystals in the frame of the dynamical theory of x-ray diffraction. The developed approach is based on a numerical solution of modified Takagi-Taupin equations and can be applied for modeling of a broad range of x-ray diffraction experiments with finite three-dimensional crystals of arbitrary shape also in the presence of strain. We performed simulations for nanocrystals of a cubic and hemispherical shape of different sizes and provided a detailed analysis of artifacts in the Bragg CXDI reconstructions introduced by the dynamical diffraction. Based on our theoretical analysis we developed an analytical procedure to treat effects of refraction and absorption in the reconstruction. Our results elucidate limitations for the kinematical approach in the Bragg CXDI and suggest a natural criterion to distinguish between kinematical and dynamical cases in coherent x-ray diffraction on a finite crystal.

  13. Crystallization and Preliminary X-ray Analysis of the Human Long Myosin Light-Chain Kinase 1-Specific Domain IgCAM3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    W Vallen Graham; A Magis; K Bailey

    2011-12-31

    Myosin light-chain kinase-dependent tight junction regulation is a critical event in inflammatory cytokine-induced increases in epithelial paracellular permeability. MLCK is expressed in human intestinal epithelium as two isoforms, long MLCK1 and long MLCK2, and MLCK1 is specifically localized to the tight junction, where it regulates paracellular permeability. The sole difference between these long MLCK splice variants is the presence of an immunoglobulin-like cell-adhesion molecule domain, IgCAM3, in MLCK1. To gain insight into the structure of the IgCAM3 domain, the IgCAM3 domain of MLCK1 has been expressed, purified and crystallized. Preliminary X-ray diffraction data were collected to 2.0 {angstrom} resolution andmore » were consistent with the primitive trigonal space group P2{sub 1}2{sub 1}2{sub 1}.« less

  14. Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu

    PubMed Central

    Kondou, Youhei; Kitazawa, Daisuke; Takeda, Shigeki; Yamashita, Eiki; Mizuguchi, Mineyuki; Kawano, Keiichi; Tsukihara, Tomitake

    2005-01-01

    Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-­rays to at least 2.1 Å resolution and are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan. PMID:16508104

  15. A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

    NASA Technical Reports Server (NTRS)

    Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

    1992-01-01

    Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

  16. Instrument and method for X-ray diffraction, fluorescence, and crystal texture analysis without sample preparation

    NASA Technical Reports Server (NTRS)

    Gendreau, Keith (Inventor); Martins, Jose Vanderlei (Inventor); Arzoumanian, Zaven (Inventor)

    2010-01-01

    An X-ray diffraction and X-ray fluorescence instrument for analyzing samples having no sample preparation includes a X-ray source configured to output a collimated X-ray beam comprising a continuum spectrum of X-rays to a predetermined coordinate and a photon-counting X-ray imaging spectrometer disposed to receive X-rays output from an unprepared sample disposed at the predetermined coordinate upon exposure of the unprepared sample to the collimated X-ray beam. The X-ray source and the photon-counting X-ray imaging spectrometer are arranged in a reflection geometry relative to the predetermined coordinate.

  17. Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rong, Hui; Li, Yan; Lou, Xiao-hua

    2007-02-01

    A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

  18. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* sialic acid-binding domain of porcine rotavirus strain OSU

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui

    2007-02-01

    Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less

  19. Philip A. Parilla | NREL

    Science.gov Websites

    atomic layer deposition for applications. He also manages the majority of X-ray characterization equipment at NREL, specifically X-ray diffraction and X-ray fluorescence instrumentation. Additionally, he for EERE's Hydrogen Storage program. He is also an expert in X-ray diffraction and X-ray fluorescence

  20. Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources.

    PubMed

    Tang, M X; Zhang, Y Y; E, J C; Luo, S N

    2018-05-01

    Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic-plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of the diffraction patterns is discussed.

  1. Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, M. X.; Zhang, Y. Y.; E, J. C.

    Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic–plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of themore » diffraction patterns is discussed.« less

  2. Coherent X-ray diffraction imaging of nanoengineered polymeric capsules

    NASA Astrophysics Data System (ADS)

    Erokhina, S.; Pastorino, L.; Di Lisa, D.; Kiiamov, A. G.; Faizullina, A. R.; Tayurskii, D. A.; Iannotta, S.; Erokhin, V.

    2017-10-01

    For the first time, nanoengineered polymeric capsules and their architecture have been studied with coherent X-ray diffraction imaging technique. The use of coherent X-ray diffraction imaging technique allowed us to analyze the samples immersed in a liquid. We report about the significant difference between polymeric capsule architectures under dry and liquid conditions.

  3. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, Thomas D.; Johns Hopkins University School of Medicine, Baltimore, MD 21205; Lyubimov, Artem Y.

    A highly X-ray-transparent, silicon nitride-based device has been designed and fabricated to harvest protein microcrystals for high-resolution X-ray diffraction data collection using microfocus beamlines and XFELs. Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming themore » challenges intrinsic to microcrystal analysis is to pair so-called ‘fixed-target’ sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

  4. X-Ray Structure determination of the Glycine Cleavage System Protein H of Mycobacterium tuberculosis Using An Inverse Compton Synchrotron X-Ray Source

    PubMed Central

    Abendroth, Jan; McCormick, Michael S.; Edwards, Thomas E.; Staker, Bart; Loewen, Roderick; Gifford, Martin; Rifkin, Jeff; Mayer, Chad; Guo, Wenjin; Zhang, Yang; Myler, Peter; Kelley, Angela; Analau, Erwin; Hewitt, Stephen Nakazawa; Napuli, Alberto J.; Kuhn, Peter; Ruth, Ronald D.; Stewart, Lance J.

    2010-01-01

    Structural genomics discovery projects require ready access to both X-ray and NMR instrumentation which support the collection of experimental data needed to solve large numbers of novel protein structures. The most productive X-ray crystal structure determination laboratories make extensive frequent use of tunable synchrotron X-ray light to solve novel structures by anomalous diffraction methods. This requires that frozen cryo-protected crystals be shipped to large government-run synchrotron facilities for data collection. In an effort to eliminate the need to ship crystals for data collection, we have developed the first laboratory-scale synchrotron light source capable of performing many of the state-of-the-art synchrotron applications in X-ray science. This Compact Light Source is a first-in-class device that uses inverse Compton scattering to generate X-rays of sufficient flux, tunable wavelength and beam size to allow high-resolution X-ray diffraction data collection from protein crystals. We report on benchmarking tests of X-ray diffraction data collection with hen egg white lysozyme, and the successful high-resolution X-ray structure determination of the Glycine cleavage system protein H from Mycobacterium tuberculosis using diffraction data collected with the Compact Light Source X-ray beam. PMID:20364333

  5. Crystallization and preliminary X-ray crystallographic analysis of YfcM: an important factor for EF-P hydroxylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro

    2014-08-27

    E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less

  6. Overexpression, crystallization and preliminary X-ray crystallographic analysis of phosphopantetheine adenylyltransferase from Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Ji Yong; Lee, Hyung Ho; Yoon, Hye Jin

    2006-11-01

    Phosphopantetheine adenylyltransferase from En. faecalis was crystallized and X-ray diffraction data were collected to 2.70 Å resolution. Phosphopantetheine adenylyltransferase, an essential enzyme in the coenzyme A biosynthetic pathway, catalyzes the reversible transfer of an adenylyl group from ATP to 4′-phosphopantetheine, yielding 3′-dephospho-CoA and pyrophosphate. Enterococcus faecalis PPAT has been overexpressed in Escherichia coli as a fusion with a C-terminal purification tag and crystallized at 297 K using a reservoir solution consisting of 0.1 M sodium HEPES pH 7.5, 0.8 M sodium dihydrogen phosphate and 0.8 M potassium dihydrogen phosphate. X-ray diffraction data were collected to 2.70 Å at 100 K.more » The crystals belong to the primitive tetragonal space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 160.81, c = 225.68 Å. Four copies of the hexameric molecule are likely to be present in the asymmetric unit, giving a crystal volume per protein weight (V{sub M}) of 3.08 Å{sup 3} Da{sup −1} and a solvent content of 60.1%.« less

  7. Preliminary X-ray crystallographic studies of a tetrameric phospholipase A{sub 2} formed by two isoforms of crotoxin B from Crotalus durissus terrificus venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchi-Salvador, D. P.; Corrêa, L. C.; Salvador, G. H. M.

    2007-12-01

    Crotoxin B is a basic phospholipase A{sub 2} found in the venom of C. durissus terrificus and is one of the subunits that constitute crotoxin. Here, the crystallization, X-ray diffraction data collection and molecular-replacement solution of a novel tetrameric complex formed by two dimers of crotoxin B isoforms are presented. Crotoxin B is a basic phospholipase A{sub 2} found in the venom of Crotalus durissus terrificus and is one of the subunits that constitute crotoxin. This heterodimeric toxin, which is the main component of C. d. terrificus venom, is completed by an acidic, nontoxic and non-enzymatic component (crotoxin A) andmore » is involved in important envenomation effects, such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, no crystal structure is currently available for crotoxin, crotoxin A or crotoxin B. In this work, the crystallization, X-ray diffraction data collection to 2.28 Å resolution and molecular-replacement solution of a novel tetrameric complex formed by two dimers of crotoxin B isoforms (CB1 and CB2) is presented.« less

  8. Crystallization and preliminary X-ray characterization of the genetically encoded fluorescent calcium indicator protein GCaMP2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rodríguez Guilbe, María M.; Protein Research and Development Center, University of Puerto Rico; Alfaro Malavé, Elisa C.

    The genetically encoded fluorescent calcium-indicator protein GCaMP2 was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution and the structure was solved by molecular replacement. Fluorescent proteins and their engineered variants have played an important role in the study of biology. The genetically encoded calcium-indicator protein GCaMP2 comprises a circularly permuted fluorescent protein coupled to the calcium-binding protein calmodulin and a calmodulin target peptide, M13, derived from the intracellular calmodulin target myosin light-chain kinase and has been used to image calcium transients in vivo. To aid rational efforts to engineer improved variants of GCaMP2, thismore » protein was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 126.1, b = 47.1, c = 68.8 Å, β = 100.5° and one GCaMP2 molecule in the asymmetric unit. The structure was phased by molecular replacement and refinement is currently under way.« less

  9. Anti-contamination device for cryogenic soft X-ray diffraction microscopy

    DOE PAGES

    Huang, Xiaojing; Miao, Huijie; Nelson, Johanna; ...

    2011-05-01

    Cryogenic microscopy allows one to view frozen hydrated biological and soft matter specimens with good structural preservation and a high degree of stability against radiation damage. We describe a liquid nitrogen-cooled anti-contamination device for cryogenic X-ray diffraction microscopy. The anti-contaminator greatly reduces the buildup of ice layers on the specimen due to condensation of residual water vapor in the experimental vacuum chamber. We show by coherent X-ray diffraction measurements that this leads to fivefold reduction of background scattering, which is important for far-field X-ray diffraction microscopy of biological specimens.

  10. Observation of electromigration in a Cu thin line by in situ coherent x-ray diffraction microscopy

    NASA Astrophysics Data System (ADS)

    Takahashi, Yukio; Nishino, Yoshinori; Furukawa, Hayato; Kubo, Hideto; Yamauchi, Kazuto; Ishikawa, Tetsuya; Matsubara, Eiichiro

    2009-06-01

    Electromigration (EM) in a 1-μm-thick Cu thin line was investigated by in situ coherent x-ray diffraction microscopy (CXDM). Characteristic x-ray speckle patterns due to both EM-induced voids and thermal deformation in the thin line were observed in the coherent x-ray diffraction patterns. Both parts of the voids and the deformation were successfully visualized in the images reconstructed from the diffraction patterns. This result not only represents the first demonstration of the visualization of structural changes in metallic materials by in situ CXDM but is also an important step toward studying the structural dynamics of nanomaterials using x-ray free-electron lasers in the near future.

  11. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

    PubMed

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-08-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

  12. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

    PubMed Central

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-01-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

  13. Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

    PubMed Central

    Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

    2006-01-01

    Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

  14. Note: application of a pixel-array area detector to simultaneous single crystal X-ray diffraction and X-ray absorption spectroscopy measurements.

    PubMed

    Sun, Cheng-Jun; Zhang, Bangmin; Brewe, Dale L; Chen, Jing-Sheng; Chow, G M; Venkatesan, T; Heald, Steve M

    2014-04-01

    X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr0.67Sr0.33MnO3 film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam.

  15. X-Ray Diffraction Wafer Mapping Method for Rhombohedral Super-Hetero-Epitaxy

    NASA Technical Reports Server (NTRS)

    Park, Yoonjoon; Choi, Sang Hyouk; King, Glen C.; Elliott, James R.; Dimarcantonio, Albert L.

    2010-01-01

    A new X-ray diffraction (XRD) method is provided to acquire XY mapping of the distribution of single crystals, poly-crystals, and twin defects across an entire wafer of rhombohedral super-hetero-epitaxial semiconductor material. In one embodiment, the method is performed with a point or line X-ray source with an X-ray incidence angle approximating a normal angle close to 90 deg, and in which the beam mask is preferably replaced with a crossed slit. While the wafer moves in the X and Y direction, a narrowly defined X-ray source illuminates the sample and the diffracted X-ray beam is monitored by the detector at a predefined angle. Preferably, the untilted, asymmetric scans are of {440} peaks, for twin defect characterization.

  16. Diffraction based method to reconstruct the spectrum of the Thomson scattering x-ray source

    NASA Astrophysics Data System (ADS)

    Chi, Zhijun; Yan, Lixin; Zhang, Zhen; Zhou, Zheng; Zheng, Lianmin; Wang, Dong; Tian, Qili; Wang, Wei; Nie, Zan; Zhang, Jie; Du, Yingchao; Hua, Jianfei; Shi, Jiaru; Pai, Chihao; Lu, Wei; Huang, Wenhui; Chen, Huaibi; Tang, Chuanxiang

    2017-04-01

    As Thomson scattering x-ray sources based on the collision of intense laser and relativistic electrons have drawn much attention in various scientific fields, there is an increasing demand for the effective methods to reconstruct the spectrum information of the ultra-short and high-intensity x-ray pulses. In this paper, a precise spectrum measurement method for the Thomson scattering x-ray sources was proposed with the diffraction of a Highly Oriented Pyrolytic Graphite (HOPG) crystal and was demonstrated at the Tsinghua Thomson scattering X-ray source. The x-ray pulse is diffracted by a 15 mm (L) ×15 mm (H)× 1 mm (D) HOPG crystal with 1° mosaic spread. By analyzing the diffraction pattern, both x-ray peak energies and energy spectral bandwidths at different polar angles can be reconstructed, which agree well with the theoretical value and simulation. The higher integral reflectivity of the HOPG crystal makes this method possible for single-shot measurement.

  17. Diffraction based method to reconstruct the spectrum of the Thomson scattering x-ray source.

    PubMed

    Chi, Zhijun; Yan, Lixin; Zhang, Zhen; Zhou, Zheng; Zheng, Lianmin; Wang, Dong; Tian, Qili; Wang, Wei; Nie, Zan; Zhang, Jie; Du, Yingchao; Hua, Jianfei; Shi, Jiaru; Pai, Chihao; Lu, Wei; Huang, Wenhui; Chen, Huaibi; Tang, Chuanxiang

    2017-04-01

    As Thomson scattering x-ray sources based on the collision of intense laser and relativistic electrons have drawn much attention in various scientific fields, there is an increasing demand for the effective methods to reconstruct the spectrum information of the ultra-short and high-intensity x-ray pulses. In this paper, a precise spectrum measurement method for the Thomson scattering x-ray sources was proposed with the diffraction of a Highly Oriented Pyrolytic Graphite (HOPG) crystal and was demonstrated at the Tsinghua Thomson scattering X-ray source. The x-ray pulse is diffracted by a 15 mm (L) ×15 mm (H)× 1 mm (D) HOPG crystal with 1° mosaic spread. By analyzing the diffraction pattern, both x-ray peak energies and energy spectral bandwidths at different polar angles can be reconstructed, which agree well with the theoretical value and simulation. The higher integral reflectivity of the HOPG crystal makes this method possible for single-shot measurement.

  18. Gas gun shock experiments with single-pulse x-ray phase contrast imaging and diffraction at the Advanced Photon Source

    NASA Astrophysics Data System (ADS)

    Luo, S. N.; Jensen, B. J.; Hooks, D. E.; Fezzaa, K.; Ramos, K. J.; Yeager, J. D.; Kwiatkowski, K.; Shimada, T.

    2012-07-01

    The highly transient nature of shock loading and pronounced microstructure effects on dynamic materials response call for in situ, temporally and spatially resolved, x-ray-based diagnostics. Third-generation synchrotron x-ray sources are advantageous for x-ray phase contrast imaging (PCI) and diffraction under dynamic loading, due to their high photon fluxes, high coherency, and high pulse repetition rates. The feasibility of bulk-scale gas gun shock experiments with dynamic x-ray PCI and diffraction measurements was investigated at the beamline 32ID-B of the Advanced Photon Source. The x-ray beam characteristics, experimental setup, x-ray diagnostics, and static and dynamic test results are described. We demonstrate ultrafast, multiframe, single-pulse PCI measurements with unprecedented temporal (<100 ps) and spatial (˜2 μm) resolutions for bulk-scale shock experiments, as well as single-pulse dynamic Laue diffraction. The results not only substantiate the potential of synchrotron-based experiments for addressing a variety of shock physics problems, but also allow us to identify the technical challenges related to image detection, x-ray source, and dynamic loading.

  19. X-ray and neutron diffraction studies of crystallinity in hydroxyapatite coatings.

    PubMed

    Girardin, E; Millet, P; Lodini, A

    2000-02-01

    To standardize industrial implant production and make comparisons between different experimental results, we have to be able to quantify the crystallinity of hydroxyapatite. Methods of measuring crystallinity ratio were developed for various HA samples before and after plasma spraying. The first series of methods uses X-ray diffraction. The advantage of these methods is that X-ray diffraction equipment is used widely in science and industry. In the second series, a neutron diffraction method is developed and the results recorded are similar to those obtained by the modified X-ray diffraction methods. The advantage of neutron diffraction is the ability to obtain measurements deep inside a component. It is a nondestructive method, owing to the very low absorption of neutrons in most materials. Copyright 2000 John Wiley & Sons, Inc.

  20. X-ray Diffraction Gratings for Astrophysics

    NASA Astrophysics Data System (ADS)

    Paerels, Frits

    2010-12-01

    Over the past year, we have celebrated the tenth anniversary of the Chandra and XMM-Newton X-ray observatories. Both carry powerful, novel diffraction grating spectrometers, which have opened true X-ray spectroscopy for astrophysics. I will describe the design and operation of these instruments, as the background to some of the beautiful results they have produced. But these designs do not exhaust the versatility and essential simplicity of diffraction grating spectrometers, and I will discuss applications for the International X-ray Observatory IXO.

  1. Amorphous boron gasket in diamond anvil cell research

    NASA Astrophysics Data System (ADS)

    Lin, Jung-Fu; Shu, Jinfu; Mao, Ho-kwang; Hemley, Russell J.; Shen, Guoyin

    2003-11-01

    Recent advances in high-pressure diamond anvil cell experiments include high-energy synchrotron x-ray techniques as well as new cell designs and gasketing procedures. The success of high-pressure experiments usually depends on a well-prepared sample, in which the gasket plays an important role. Various gasket materials such as diamond, beryllium, rhenium, and stainless steel have been used. Here we introduce amorphous boron as another gasket material in high-pressure diamond anvil cell experiments. We have applied the boron gasket for laser-heating x-ray diffraction, radial x-ray diffraction, nuclear resonant inelastic x-ray scattering, and inelastic x-ray scattering. The high shear strength of the amorphous boron maximizes the thickness of the sample chamber and increases the pressure homogeneity, improving the quality of high-pressure data. Use of amorphous boron avoids unwanted x-ray diffraction peaks and reduces the absorption of incident and x rays exiting the gasket material. The high quality of the diffraction patterns makes it possible to refine the cell parameters with powder x-ray diffraction data under high pressure and high temperature. The reactivity of boron prevents its use at high temperatures, however. When heated, boron may also react with the specimen to produce unwanted phases. The relatively porous boron starting material at ambient conditions also poses some challenges for sample preparation.

  2. X-Ray Sum Frequency Diffraction for Direct Imaging of Ultrafast Electron Dynamics

    NASA Astrophysics Data System (ADS)

    Rouxel, Jérémy R.; Kowalewski, Markus; Bennett, Kochise; Mukamel, Shaul

    2018-06-01

    X-ray diffraction from molecules in the ground state produces an image of their charge density, and time-resolved x-ray diffraction can thus monitor the motion of the nuclei. However, the density change of excited valence electrons upon optical excitation can barely be monitored with regular diffraction techniques due to the overwhelming background contribution of the core electrons. We present a nonlinear x-ray technique made possible by novel free electron laser sources, which provides a spatial electron density image of valence electron excitations. The technique, sum frequency generation carried out with a visible pump and a broadband x-ray diffraction pulse, yields snapshots of the transition charge densities, which represent the electron density variations upon optical excitation. The technique is illustrated by ab initio simulations of transition charge density imaging for the optically induced electronic dynamics in a donor or acceptor substituted stilbene.

  3. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jens, Jason; Raghunathan, Kannan; Vago, Frank

    2010-01-12

    EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

  4. Preliminary joint X-ray and neutron protein crystallographic studies of endoxylanase II from the fungus Trichoderma longibrachiatum

    PubMed Central

    Kovalevsky, Andrey Y.; Hanson, B. Leif; Seaver, Sean; Fisher, S. Zoë; Mustyakimov, Marat; Langan, Paul

    2011-01-01

    Room-temperature X-ray and neutron diffraction data were measured from a family 11 endoxylanase holoenzyme (XynII) originating from the filamentous fungus Trichoderma longibrachiatum to 1.55 Å resolution using a home source and to 1.80 Å resolution using the Protein Crystallography Station at LANSCE. Crystals of XynII, which is an important enzyme for biofuel production, were grown at pH 8.5 in order to examine the effect of basic conditions on the protonation-state distribution in the active site and throughout the protein molecule and to provide insights for rational engineering of catalytically improved XynII for industrial applications. PMID:21301107

  5. SU-E-I-44: Some Preliminary Analysis of Angular Distribution of X-Ray Scattered On Soft Tissues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ganezer, K; Krmar, M; Cvejic, Z

    2015-06-15

    Purpose: The angular distribution of x-radiation scattered at small angles (up to 16 degrees) from several different animal soft tissue (skin, fat, muscle, retina, etc) were measured using standard equipment devoted to study of crystal structure which provides excellent geometry conditions of measurements. showed measurable differences for different tissues. In the simplest possible case when measured samples do not differ in structure (different concentration solutions) it can be seen that intensity of scattered radiation is decreasing function of the concentration and the peak of the maximum of scattering distribution depends on the concentration as well. Methods: An x-ray scattering profilemore » usually consists of sharp diffraction peak; however some properties of the spatial profiles of scattered radiation as intensity, the peak position, height, area, FWHM, the ratio of peak heights, etc. Results: The data contained measurable differences for different tissues. In the simplest possible case when measured samples do not differ in structure (different concentration solutions) it can be seen that intensity of scattered radiation is decreasing function of the concentration and the peak of the maximum of scattering distribution depends on the concentration as well. Measurements of different samples in the very preliminary phase showed that simple biological material used in study showed slightly different scattering pattern, especially at higher angles (around 10degrees). Intensity of radiation scattered from same tissue type is very dependent on water content and several more parameters. Conclusion: This preliminary study using animal soft tissues on the angular distributions of scattered x-rays suggests that angular distributions of X-rays scattered off of soft tissues might be useful in distinguishing healthy tissue from malignant soft tissue.« less

  6. Insect-cell expression, crystallization and X-ray data collection of the bradyzoite-specific antigen BSR4 from Toxoplasma gondii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grujic, Ognjen; Grigg, Michael E.; Boulanger, Martin J., E-mail: mboulang@uvic.ca

    2008-05-01

    Preliminary X-ray diffraction studies of the bradyzoite-specific surface antigen BSR4 from T. gondii are described. Toxoplasma gondii is an important global pathogen that infects nearly one third of the world’s adult population. A family of developmentally expressed structurally related surface-glycoprotein adhesins (SRSs) mediate attachment to and are utilized for entry into host cells. The latent bradyzoite form of T. gondii persists for the life of the host and expresses a distinct family of SRS proteins, of which the bradyzoite-specific antigen BSR4 is a prototypical member. Structural studies of BSR4 were initiated by first recombinantly expressing BSR4 in insect cells, whichmore » was followed by crystallization and preliminary X-ray data collection to 1.95 Å resolution. Data processing showed that BSR4 crystallized with one molecule in the asymmetric unit of the P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2 space group, with a solvent content of 60% and a corresponding Matthews coefficient of 2.98 Å{sup 3} Da{sup −1}.« less

  7. Development of an adaptable coherent x-ray diffraction microscope with the emphasis on imaging hydrated specimens.

    PubMed

    Nam, Daewoong; Park, Jaehyun; Gallagher-Jones, Marcus; Shimada, Hiroki; Kim, Sangsoo; Kim, Sunam; Kohmura, Yoshiki; Ishikawa, Tetsuya; Song, Changyong

    2013-11-01

    This paper describes the development of a versatile coherent x-ray diffraction microscope capable of imaging biological specimens in solution. The microscope is a flexible platform accommodating various conditions, from low vacuum (10(-2) Pa) to helium gas filled ambient pressure. This flexibility greatly expands the application area, from in situ materials science to biology systems in their native state, by significantly relaxing restrictions to the sample environment. The coherent diffraction microscope has been used successfully to image a yeast cell immersed in buffer solution. We believe that the design of this coherent diffraction microscope can be directly adapted to various platforms such as table top soft x-ray laser, synchrotron x-ray sources, and x-ray free electron laser with minor relevant adjustments.

  8. Development of an adaptable coherent x-ray diffraction microscope with the emphasis on imaging hydrated specimens

    NASA Astrophysics Data System (ADS)

    Nam, Daewoong; Park, Jaehyun; Gallagher-Jones, Marcus; Shimada, Hiroki; Kim, Sangsoo; Kim, Sunam; Kohmura, Yoshiki; Ishikawa, Tetsuya; Song, Changyong

    2013-11-01

    This paper describes the development of a versatile coherent x-ray diffraction microscope capable of imaging biological specimens in solution. The microscope is a flexible platform accommodating various conditions, from low vacuum (10-2 Pa) to helium gas filled ambient pressure. This flexibility greatly expands the application area, from in situ materials science to biology systems in their native state, by significantly relaxing restrictions to the sample environment. The coherent diffraction microscope has been used successfully to image a yeast cell immersed in buffer solution. We believe that the design of this coherent diffraction microscope can be directly adapted to various platforms such as table top soft x-ray laser, synchrotron x-ray sources, and x-ray free electron laser with minor relevant adjustments.

  9. Thin Film Research. Volume 1

    DTIC Science & Technology

    1985-05-30

    Order (FECO) ......... 23 3. X -Ray Diffraction ............................... 26 4. Transmission Electron Microscopy (TEM) ............... 26 5...remained amorphous after bombardment, as evidenced by X - ray diffraction, and showed no other changes. 0 (2) For Sb203, the crystallite size was reduced...main effect on MgF2 was the reduction in crystallite size. The films were too thir. for meaningful x - ray diffraction analysis. Durability and

  10. X-Ray Diffraction and the Discovery of the Structure of DNA

    ERIC Educational Resources Information Center

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  11. High Resolution X-Ray Diffraction of Macromolecules with Synchrotron Radiation

    NASA Technical Reports Server (NTRS)

    Stojanoff, Vivian; Boggon, Titus; Helliwell, John R.; Judge, Russell; Olczak, Alex; Snell, Edward H.; Siddons, D. Peter; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    We recently combined synchrotron-based monochromatic X-ray diffraction topography methods with triple axis diffractometry and rocking curve measurements: high resolution X-ray diffraction imaging techniques, to better understand the quality of protein crystals. We discuss these methods in the light of results obtained on crystals grown under different conditions. These non destructive techniques are powerful tools in the characterization of the protein crystals and ultimately will allow to improve, develop, and understand protein crystal growth. High resolution X-ray diffraction imaging methods will be discussed in detail in light of recent results obtained on Hen Egg White Lysozyme crystals and other proteins.

  12. Hard X-ray polarizer to enable simultaneous three-dimensional nanoscale imaging of magnetic structure and lattice strain

    DOE PAGES

    Logan, Jonathan; Harder, Ross; Li, Luxi; ...

    2016-01-01

    Recent progress in the development of dichroic Bragg coherent diffractive imaging, a new technique for simultaneous three-dimensional imaging of strain and magnetization at the nanoscale, is reported. This progress includes the installation of a diamond X-ray phase retarder at beamline 34-ID-C of the Advanced Photon Source. Here, the performance of the phase retarder for tuning X-ray polarization is demonstrated with temperature-dependent X-ray magnetic circular dichroism measurements on a gadolinium foil in transmission and on a Gd 5Si 2Ge 2crystal in diffraction geometry with a partially coherent, focused X-ray beam. Feasibility tests for dichroic Bragg coherent diffractive imaging are presented. Thesemore » tests include (1) using conventional Bragg coherent diffractive imaging to determine whether the phase retarder introduces aberrations using a nonmagnetic gold nanocrystal as a control sample, and (2) collecting coherent diffraction patterns of a magnetic Gd 5Si 2Ge 2nanocrystal with left- and right-circularly polarized X-rays. Future applications of dichroic Bragg coherent diffractive imaging for the correlation of strain and lattice defects with magnetic ordering and inhomogeneities are considered.« less

  13. Three Dimensional Variable-Wavelength X-Ray Bragg Coherent Diffraction Imaging

    DOE PAGES

    Cha, W.; Ulvestad, A.; Allain, M.; ...

    2016-11-23

    Here, we present and demonstrate a formalism by which three-dimensional (3D) Bragg x-ray coherent diffraction imaging (BCDI) can be implemented without moving the sample by scanning the energy of the incident x-ray beam. This capability is made possible by introducing a 3D Fourier transform that accounts for x-ray wavelength variability. We also demonstrate the approach by inverting coherent Bragg diffraction patterns from a gold nanocrystal measured with an x-ray energy scan. Furthermore, variable-wavelength BCDI will expand the breadth of feasible in situ 3D strain imaging experiments towards more diverse materials environments, especially where sample manipulation is difficult.

  14. Three Dimensional Variable-Wavelength X-Ray Bragg Coherent Diffraction Imaging

    NASA Astrophysics Data System (ADS)

    Cha, W.; Ulvestad, A.; Allain, M.; Chamard, V.; Harder, R.; Leake, S. J.; Maser, J.; Fuoss, P. H.; Hruszkewycz, S. O.

    2016-11-01

    We present and demonstrate a formalism by which three-dimensional (3D) Bragg x-ray coherent diffraction imaging (BCDI) can be implemented without moving the sample by scanning the energy of the incident x-ray beam. This capability is made possible by introducing a 3D Fourier transform that accounts for x-ray wavelength variability. We demonstrate the approach by inverting coherent Bragg diffraction patterns from a gold nanocrystal measured with an x-ray energy scan. Variable-wavelength BCDI will expand the breadth of feasible in situ 3D strain imaging experiments towards more diverse materials environments, especially where sample manipulation is difficult.

  15. Three Dimensional Variable-Wavelength X-Ray Bragg Coherent Diffraction Imaging.

    PubMed

    Cha, W; Ulvestad, A; Allain, M; Chamard, V; Harder, R; Leake, S J; Maser, J; Fuoss, P H; Hruszkewycz, S O

    2016-11-25

    We present and demonstrate a formalism by which three-dimensional (3D) Bragg x-ray coherent diffraction imaging (BCDI) can be implemented without moving the sample by scanning the energy of the incident x-ray beam. This capability is made possible by introducing a 3D Fourier transform that accounts for x-ray wavelength variability. We demonstrate the approach by inverting coherent Bragg diffraction patterns from a gold nanocrystal measured with an x-ray energy scan. Variable-wavelength BCDI will expand the breadth of feasible in situ 3D strain imaging experiments towards more diverse materials environments, especially where sample manipulation is difficult.

  16. In-situ X-ray diffraction system using sources and detectors at fixed angular positions

    DOEpatents

    Gibson, David M [Voorheesville, NY; Gibson, Walter M [Voorheesville, NY; Huang, Huapeng [Latham, NY

    2007-06-26

    An x-ray diffraction technique for measuring a known characteristic of a sample of a material in an in-situ state. The technique includes using an x-ray source for emitting substantially divergent x-ray radiation--with a collimating optic disposed with respect to the fixed source for producing a substantially parallel beam of x-ray radiation by receiving and redirecting the divergent paths of the divergent x-ray radiation. A first x-ray detector collects radiation diffracted from the sample; wherein the source and detector are fixed, during operation thereof, in position relative to each other and in at least one dimension relative to the sample according to a-priori knowledge about the known characteristic of the sample. A second x-ray detector may be fixed relative to the first x-ray detector according to the a-priori knowledge about the known characteristic of the sample, especially in a phase monitoring embodiment of the present invention.

  17. Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos-Silva, Teresa; Trincão, José; Carvalho, Ana L.

    2005-11-01

    Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His){sub 4}Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponemamore » pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K{sub 3}Fe(CN){sub 6} belonged to space group P2{sub 1} (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na{sub 2}IrCl{sub 6} belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P2{sub 1} data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed.« less

  18. The effect of exit beam phase aberrations on parallel beam coherent x-ray reconstructions

    NASA Astrophysics Data System (ADS)

    Hruszkewycz, S. O.; Harder, R.; Xiao, X.; Fuoss, P. H.

    2010-12-01

    Diffraction artifacts from imperfect x-ray windows near the sample are an important consideration in the design of coherent x-ray diffraction measurements. In this study, we used simulated and experimental diffraction patterns in two and three dimensions to explore the effect of phase imperfections in a beryllium window (such as a void or inclusion) on the convergence behavior of phasing algorithms and on the ultimate reconstruction. A predictive relationship between beam wavelength, sample size, and window position was derived to explain the dependence of reconstruction quality on beryllium defect size. Defects corresponding to this prediction cause the most damage to the sample exit wave and induce signature error oscillations during phasing that can be used as a fingerprint of experimental x-ray window artifacts. The relationship between x-ray window imperfection size and coherent x-ray diffractive imaging reconstruction quality explored in this work can play an important role in designing high-resolution in situ coherent imaging instrumentation and will help interpret the phasing behavior of coherent diffraction measured in these in situ environments.

  19. The effect of exit beam phase aberrations on parallel beam coherent x-ray reconstructions.

    PubMed

    Hruszkewycz, S O; Harder, R; Xiao, X; Fuoss, P H

    2010-12-01

    Diffraction artifacts from imperfect x-ray windows near the sample are an important consideration in the design of coherent x-ray diffraction measurements. In this study, we used simulated and experimental diffraction patterns in two and three dimensions to explore the effect of phase imperfections in a beryllium window (such as a void or inclusion) on the convergence behavior of phasing algorithms and on the ultimate reconstruction. A predictive relationship between beam wavelength, sample size, and window position was derived to explain the dependence of reconstruction quality on beryllium defect size. Defects corresponding to this prediction cause the most damage to the sample exit wave and induce signature error oscillations during phasing that can be used as a fingerprint of experimental x-ray window artifacts. The relationship between x-ray window imperfection size and coherent x-ray diffractive imaging reconstruction quality explored in this work can play an important role in designing high-resolution in situ coherent imaging instrumentation and will help interpret the phasing behavior of coherent diffraction measured in these in situ environments.

  20. Femtosecond X-ray Diffraction From Two-Dimensional Protein Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank, Matthias; Carlson, David B.; Hunter, Mark

    2014-02-28

    Here we present femtosecond x-ray diffraction patterns from two-dimensional (2-D) protein crystals using an x-ray free electron laser (XFEL). To date it has not been possible to acquire x-ray diffraction from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permits a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy methodology at the Linac Coherent Light Source, we observed Bragg diffraction to better than 8.5 Å resolution for two different 2-D protein crystal samples that were maintained at room temperature. These proof-of-principle results show promisemore » for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.« less

  1. A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

    The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

  2. Influence of gamma ray irradiation on stoichiometry of hydrothermally synthesized bismuth telluride nanoparticles

    NASA Astrophysics Data System (ADS)

    Abishek, N. S.; Naik, K. Gopalakrishna

    2018-05-01

    Bismuth telluride (Bi2Te3) nanoparticles were synthesized by the hydrothermal method at 200 °C for 24 h. The synthesized Bi2Te3 nanoparticles were irradiated with gamma rays at doses of 50 kGy and 100 kGy. The structural characterization of the pre-irradiated and post-irradiated samples was carried out by X-ray diffraction technique and was found to have rhombohedral phase having R3 ¯m (166) space group. The X-ray diffraction peaks were found to shift towards lower diffraction angle with gamma ray irradiation. The morphologies and compositions of the grown Bi2Te3 nanoparticles were studied using Field Emission Scanning Electron Microscope and X-ray energy dispersive analysis, respectively. The possible cause for the shift in the X-ray diffraction peaks with gamma ray irradiation has been discussed in the present work.

  3. High Power Optical Coatings by Atomic Layer Deposition and Signatures of Laser-Induced Damage

    DTIC Science & Technology

    2012-08-28

    diffraction angle 0 into crystal lattice spacing d by the Bragg condition, mX = 2d sin 0. Here X is the x - ray wavelength... angle x - ray diffraction (GAXRD) measurements, which were made at a fixed shallow incidence angle of 0.5°. Detector scans were done to measure the...was finished with 200 hafnia cycles m the fmal half period rather than 400. Crystallinity was measured by x - ray diffraction (XRD) with

  4. Materials identification using a small-scale pixellated x-ray diffraction system

    NASA Astrophysics Data System (ADS)

    O'Flynn, D.; Crews, C.; Drakos, I.; Christodoulou, C.; Wilson, M. D.; Veale, M. C.; Seller, P.; Speller, R. D.

    2016-05-01

    A transmission x-ray diffraction system has been developed using a pixellated, energy-resolving detector (HEXITEC) and a small-scale, mains operated x-ray source (Amptek Mini-X). HEXITEC enables diffraction to be measured without the requirement of incident spectrum filtration, or collimation of the scatter from the sample, preserving a large proportion of the useful signal compared with other diffraction techniques. Due to this efficiency, sufficient molecular information for material identification can be obtained within 5 s despite the relatively low x-ray source power. Diffraction data are presented from caffeine, hexamine, paracetamol, plastic explosives and narcotics. The capability to determine molecular information from aspirin tablets inside their packaging is demonstrated. Material selectivity and the potential for a sample classification model is shown with principal component analysis, through which each different material can be clearly resolved.

  5. Dynamic X-ray diffraction sampling for protein crystal positioning

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

  6. Dynamic X-ray diffraction sampling for protein crystal positioning

    DOE PAGES

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; ...

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

  7. Dynamic X-ray diffraction sampling for protein crystal positioning

    PubMed Central

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; Kissick, David J.; Zhang, Shijie; Newman, Justin A.; Sheedlo, Michael J.; Chowdhury, Azhad U.; Fischetti, Robert F.; Das, Chittaranjan; Buzzard, Gregery T.; Bouman, Charles A.; Simpson, Garth J.

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations. PMID:28009558

  8. Dynamic X-ray diffraction sampling for protein crystal positioning.

    PubMed

    Scarborough, Nicole M; Godaliyadda, G M Dilshan P; Ye, Dong Hye; Kissick, David J; Zhang, Shijie; Newman, Justin A; Sheedlo, Michael J; Chowdhury, Azhad U; Fischetti, Robert F; Das, Chittaranjan; Buzzard, Gregery T; Bouman, Charles A; Simpson, Garth J

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.

  9. Fixture for supporting and aligning a sample to be analyzed in an x-ray diffraction apparatus

    DOEpatents

    Green, L.A.; Heck, J.L. Jr.

    1985-04-23

    A fixture is provided for supporting and aligning small samples of material on a goniometer for x-ray diffraction analysis. A sample-containing capillary is accurately positioned for rotation in the x-ray beam by selectively adjusting the fixture to position the capillary relative to the x and y axes thereof to prevent wobble and position the sample along the z axis or the axis of rotation. By employing the subject fixture relatively small samples of materials can be analyzed in an x-ray diffraction apparatus previously limited to the analysis of much larger samples.

  10. Fixture for supporting and aligning a sample to be analyzed in an X-ray diffraction apparatus

    DOEpatents

    Green, Lanny A.; Heck, Jr., Joaquim L.

    1987-01-01

    A fixture is provided for supporting and aligning small samples of material on a goniometer for X-ray diffraction analysis. A sample-containing capillary is accurately positioned for rotation in the X-ray beam by selectively adjusting the fixture to position the capillary relative to the x and y axes thereof to prevent wobble and position the sample along the z axis or the axis of rotation. By employing the subject fixture relatively small samples of materials can be analyzed in an X-ray diffraction apparatus previously limited to the analysis of much larger samples.

  11. JMFA2—a graphically interactive Java program that fits microfibril angle X-ray diffraction data

    Treesearch

    Steve P. Verrill; David E. Kretschmann; Victoria L. Herian

    2006-01-01

    X-ray diffraction techniques have the potential to decrease the time required to determine microfibril angles dramatically. In this paper, we discuss the latest version of a curve-fitting toll that permits us to reduce the time required to evaluate MFA X-ray diffraction patterns. Further, because this tool reflects the underlying physics more accurately than existing...

  12. Purification, crystallization and preliminary X-ray diffraction analysis of a novel keto-deoxy-d-galactarate (KDG) dehydratase from Agrobacterium tumefaciens

    PubMed Central

    Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha

    2014-01-01

    d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616

  13. Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

    2005-08-01

    Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

  14. Comparative crystallization and preliminary X-ray diffraction studies of locked nucleic acid and RNA stems of a tenascin C-binding aptamer

    PubMed Central

    Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.

    2006-01-01

    The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689

  15. Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

    2006-10-01

    Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

  16. Time-resolved x-ray diffraction and electrical resistance measurements of structural phase transitions in zirconium

    DOE PAGES

    Velisavljevic, N.; Sinogeikin, S.; Saavedra, R.; ...

    2014-05-07

    Here, we have designed a portable pressure controller module to tune compression rates and maximum pressures attainable in a standard gas-membrane diamond anvil cell (DAC). During preliminary experiments, performed on zirconium (Zr) metal sample, pressure jumps of up to 80 GPa were systematically obtained in less than 0.2s (resulting in compression rate of few GPa/s up to more than 400 GPa/s). In-situ x-ray diffraction and electrical resistance measurements were performed simultaneously during this rapid pressure increase to provide the first time resolved data on α → ω → β structural evolution in Zr at high pressures. Direct control of compressionmore » rates and peak pressures, which can be held for prolonged time, allows for investigation of structural evolution and kinetics of structural phase transitions of materials under previously unexplored compression rate-pressure conditions that bridge traditional static and shock/dynamic experimental platforms.« less

  17. Crystallization and preliminary X-ray diffraction analysis of ScrY, a specific bacterial outer membrane porin.

    PubMed

    Forst, D; Schülein, K; Wacker, T; Diederichs, K; Kreutz, W; Benz, R; Welte, W

    1993-01-05

    The sucrose-specific outer membrane porin ScrY of Salmonella typhimurium was isolated from Escherichia coli K-12 strain KS 26 containing the plasmid pPSO112. The protein was purified to homogeneity by differential extraction of the cell envelope in the presence of the detergents sodium dodecyl sulfate and lauryl (dimethyl)-amine oxide (LDAO). The porin had apparent molecular weights of 58 kDa and 120 kDa for the monomer and for the trimer, respectively, on SDS/PAGE. The purified trimers were crystallized using poly(ethylene glycol) 2000 and the detergents octylglucoside (OG) and hexyl-(dimethyl)-amine oxide (C6DAO). X-ray diffraction of the crystals showed reflections to 2.3 A. The space group of the crystals was R3 and the lattice constants of the hexagonal axes were a = b = 112.85 A and c = 149.9 A. The crystal volume per unit of protein molecular weight was 3.47 A3/Da.

  18. Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701

    2005-04-01

    The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less

  19. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

    PubMed

    Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

    2014-03-01

    Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

  20. Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

    2005-11-01

    The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

  1. Purification, crystallization and preliminary X-ray diffraction analysis of the glyoxalase II from Leishmania infantum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trincão, José; Sousa Silva, Marta; Barata, Lídia

    2006-08-01

    A glyoxalase II from L. infantum was cloned, purified and crystallized and its structure was solved by X-ray crystallography. In trypanosomatids, trypanothione replaces glutathione in all glutathione-dependent processes. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I and glyoxalase II, the latter shows absolute specificity towards trypanothione thioester, making this enzyme an excellent model to understand the molecular basis of trypanothione binding. Cloned glyoxalase II from Leishmania infantum was overexpressed in Escherichia coli, purified and crystallized. Crystals belong to space group C222{sub 1} (unit-cell parameters a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyondmore » 2.15 Å using synchrotron radiation. The structure was solved by molecular replacement using the human glyoxalase II structure as a search model. These results, together with future detailed kinetic characterization using lactoyltrypanothione, should shed light on the evolutionary selection of trypanothione instead of glutathione by trypano-somatids.« less

  2. Crystallization and preliminary X-ray diffraction studies of NP24-I, an isoform of a thaumatin-like protein from ripe tomato fruits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in

    2005-08-01

    A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less

  3. Incorporation of tramadol drug into Li-fluorohectorite clay: A preliminary study of a medical nanofluid

    NASA Astrophysics Data System (ADS)

    Valdés, L.; Hernández, D.; de Ménorval, L. Ch.; Pérez, I.; Altshuler, E.; Fossum, J. O.; Rivera, A.

    2016-07-01

    During the last years, clays have been increasingly explored as hosts for drugs. In the present paper, we have been able to host the non-steroidal anti-inflammatory drug, Tramadol, into the clay Li-fluorohectorite (Li-Fh). We preliminary evaluate its incorporation by means of UV spectroscopy and X ray diffraction. Our results indicate that the clay hosts the drug molecule in its interlayer space. We suggest a set of parameters to guarantee an efficient incorporation process. Future studies will concentrate on the release of the drug from the clay nanofluid.

  4. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    DOE PAGES

    Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.; ...

    2015-08-11

    Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called `fixed-target' sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessarymore » to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. In addition, the features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

  5. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.

    Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called `fixed-target' sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessarymore » to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. In addition, the features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

  6. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.

    Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called `fixed-target' sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary tomore » fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15µm) loaded into the chips yielded a complete, high-resolution (<1.6Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

  7. A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

    PubMed Central

    Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.; Vo, Huy; Uervirojnangkoorn, Monarin; Brunger, Axel T.; Berger, James M.

    2015-01-01

    Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called ‘fixed-target’ sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs. PMID:26457423

  8. High-resolution x-ray diffraction microscopy of specifically labeled yeast cells

    PubMed Central

    Nelson, Johanna; Huang, Xiaojing; Steinbrener, Jan; Shapiro, David; Kirz, Janos; Marchesini, Stefano; Neiman, Aaron M.; Turner, Joshua J.; Jacobsen, Chris

    2010-01-01

    X-ray diffraction microscopy complements other x-ray microscopy methods by being free of lens-imposed radiation dose and resolution limits, and it allows for high-resolution imaging of biological specimens too thick to be viewed by electron microscopy. We report here the highest resolution (11–13 nm) x-ray diffraction micrograph of biological specimens, and a demonstration of molecular-specific gold labeling at different depths within cells via through-focus propagation of the reconstructed wavefield. The lectin concanavalin A conjugated to colloidal gold particles was used to label the α-mannan sugar in the cell wall of the yeast Saccharomyces cerevisiae. Cells were plunge-frozen in liquid ethane and freeze-dried, after which they were imaged whole using x-ray diffraction microscopy at 750 eV photon energy. PMID:20368463

  9. High-resolution x-ray diffraction microscopy of specifically labeled yeast cells

    DOE PAGES

    Nelson, Johanna; Huang, Xiaojing; Steinbrener, Jan; ...

    2010-04-20

    X-ray diffraction microscopy complements other x-ray microscopy methods by being free of lens-imposed radiation dose and resolution limits, and it allows for high-resolution imaging of biological specimens too thick to be viewed by electron microscopy. We report here the highest resolution (11-13 nm) x-ray diffraction micrograph of biological specimens, and a demonstration of molecular-specific gold labeling at different depths within cells via through-focus propagation of the reconstructed wavefield. The lectin concanavalin A conjugated to colloidal gold particles was used to label the α-mannan sugar in the cell wall of the yeast Saccharomyces cerevisiae. Cells were plunge-frozen in liquid ethane andmore » freeze-dried, after which they were imaged whole using x-ray diffraction microscopy at 750 eV photon energy.« less

  10. Coherent x-ray zoom condenser lens for diffractive and scanning microscopy.

    PubMed

    Kimura, Takashi; Matsuyama, Satoshi; Yamauchi, Kazuto; Nishino, Yoshinori

    2013-04-22

    We propose a coherent x-ray zoom condenser lens composed of two-stage deformable Kirkpatrick-Baez mirrors. The lens delivers coherent x-rays with a controllable beam size, from one micrometer to a few tens of nanometers, at a fixed focal position. The lens is suitable for diffractive and scanning microscopy. We also propose non-scanning coherent diffraction microscopy for extended objects by using an apodized focused beam produced by the lens with a spatial filter. The proposed apodized-illumination method will be useful in highly efficient imaging with ultimate storage ring sources, and will also open the way to single-shot coherent diffraction microscopy of extended objects with x-ray free-electron lasers.

  11. Scanning force microscope for in situ nanofocused X-ray diffraction studies

    PubMed Central

    Ren, Zhe; Mastropietro, Francesca; Davydok, Anton; Langlais, Simon; Richard, Marie-Ingrid; Furter, Jean-Jacques; Thomas, Olivier; Dupraz, Maxime; Verdier, Marc; Beutier, Guillaume; Boesecke, Peter; Cornelius, Thomas W.

    2014-01-01

    A compact scanning force microscope has been developed for in situ combination with nanofocused X-ray diffraction techniques at third-generation synchrotron beamlines. Its capabilities are demonstrated on Au nano-islands grown on a sapphire substrate. The new in situ device allows for in situ imaging the sample topography and the crystallinity by recording simultaneously an atomic force microscope (AFM) image and a scanning X-ray diffraction map of the same area. Moreover, a selected Au island can be mechanically deformed using the AFM tip while monitoring the deformation of the atomic lattice by nanofocused X-ray diffraction. This in situ approach gives access to the mechanical behavior of nanomaterials. PMID:25178002

  12. X-ray Diffraction Studies of the Structure and Thermochemistry of Alkaline-Earth Oxide-Coated Thermionic Cathodes

    NASA Technical Reports Server (NTRS)

    Karikari, E. K.; Bassey, E.; Wintucky, Edwin G.

    1998-01-01

    NASA LeRC has a broad, active cathode technology development program in which both experimental and theoretical studies are being employed to further development of thermionic cathodes for use as electron sources in vacuum devices for communications and other space applications. One important type of thermionic cathode under development is the alkaline-earth oxide-coated (BaO, SrO, CaO) cathode. Significant improvements in the emission characteristics of this cathode have been obtained through modification of the chemical composition and morphology of the oxide coating, with the best result thus far coming from the addition of In2O3 and Sc2O3. Whereas the In2O3 produces a finer, more uniform particle structure, the exact chemical state and role of the Sc2O3 in the emission enhancement is unknown. The purpose of this cooperative agreement is to combine the studies of the surface chemistry and electron emission at NASA LeRC of chemically modified oxide coatings with a study of the thermochemistry and crystal structure using X-ray diffraction equipment and expertise at Clark Atlanta University (CAU). The study at CAU is intended to provide the description and understanding of the structure and thermochemistry needed for further improvement and optimization of the modified coatings. A description of the experimental procedure, preliminary X-ray diffraction test results, together with the design of an ultrahigh vacuum chamber necessary for high temperature thermochemistry studies will be presented.

  13. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  14. X-ray topography using the forward transmitted beam under multiple-beam diffraction conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsusaka, Y., E-mail: tsusaka@sci.u-hyogo.ac.jp; Takano, H.; Takeda, S.

    2016-02-15

    X-ray topographs are taken for a sapphire wafer with the [0001] surface normal, as an example, by forward transmitted synchrotron x-ray beams combined with two-dimensional electronic arrays in the x-ray detector having a spatial resolution of 1 μm. They exhibit no shape deformation and no position shift of the dislocation lines on the topographs. Since the topography is performed under multiple-beam diffraction conditions, the topographic images of a single diffraction (two-wave approximation condition) or plural diffractions (six-wave approximation condition) can be recorded without large specimen position changes. As usual Lang topographs, it is possible to determine the Burgers vector ofmore » each dislocation line. Because of high parallelism of the incoming x-rays and linear sensitivity of the electronic arrays to the incident x-rays, the present technique can be used to visualize individual dislocations in single crystals of the dislocation density as high as 1 × 10{sup 5} cm{sup −2}.« less

  15. Heteroepitaxial growth of Cd(1-x)Mn(x)Te on GaAs by metalorganic chemical vapor deposition

    NASA Technical Reports Server (NTRS)

    Nouhi, Akbar; Stirn, Richard J.

    1987-01-01

    In this letter, preliminary results are reported of heteroepitaxial growth of the dilute magnetic semiconductor alloy Cd(1-x)Mn(x)Te on GaAs by metalorganic chemical vapor deposition. Dimethylcadmium (DMCd), diethyltellurium (DETe), and tricarbonyl (methylcyclopentadienyl) manganese (TCPMn) were used as source materials. The TCPMn had to be heated to as high as 140 C to provide the required vapor pressure. Films with Mn atomic fractions up to 30 percent have been grown over the temperature range 410-450 C. Results of optical absorption/transmission, photoluminescence, and X-ray diffraction measurements are presented along with a scanning electron micrograph showing good surface morphology of the grown layers.

  16. On the purification and preliminary crystallographic analysis of isoquinoline 1-oxidoreductase from Brevundimonas diminuta 7

    PubMed Central

    Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João

    2005-01-01

    Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115

  17. Transmission x-ray microscopy at Diamond-Manchester I13 Imaging Branchline

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vila-Comamala, Joan, E-mail: joan.vila.comamala@gmail.com; Wagner, Ulrich; Bodey, Andrew J.

    2016-01-28

    Full-field Transmission X-ray Microscopy (TXM) has been shown to be a powerful method for obtaining quantitative internal structural and chemical information from materials at the nanoscale. The installation of a Full-field TXM station will extend the current microtomographic capabilities of the Diamond-Manchester I13 Imaging Branchline at Diamond Light Source (UK) into the sub-100 nm spatial resolution range using photon energies from 8 to 14 keV. The dedicated Full-field TXM station will be built in-house with contributions of Diamond Light Source support divisions and via collaboration with the X-ray Optics Group of Paul Scherrer Institut (Switzerland) which will develop state-of-the-art diffractive X-raymore » optical elements. Preliminary results of the I13 Full-field TXM station are shown. The Full-field TXM will become an important Diamond Light Source direct imaging asset for material science, energy science and biology at the nanoscale.« less

  18. Multiple defocused coherent diffraction imaging: method for simultaneously reconstructing objects and probe using X-ray free-electron lasers.

    PubMed

    Hirose, Makoto; Shimomura, Kei; Suzuki, Akihiro; Burdet, Nicolas; Takahashi, Yukio

    2016-05-30

    The sample size must be less than the diffraction-limited focal spot size of the incident beam in single-shot coherent X-ray diffraction imaging (CXDI) based on a diffract-before-destruction scheme using X-ray free electron lasers (XFELs). This is currently a major limitation preventing its wider applications. We here propose multiple defocused CXDI, in which isolated objects are sequentially illuminated with a divergent beam larger than the objects and the coherent diffraction pattern of each object is recorded. This method can simultaneously reconstruct both objects and a probe from the coherent X-ray diffraction patterns without any a priori knowledge. We performed a computer simulation of the prposed method and then successfully demonstrated it in a proof-of-principle experiment at SPring-8. The prposed method allows us to not only observe broad samples but also characterize focused XFEL beams.

  19. Angular rheology study of colloidal nanocrystals using Coherent X-ray Diffraction

    NASA Astrophysics Data System (ADS)

    Liang, Mengning; Harder, Ross; Robinson, Ian

    2007-03-01

    A new method using coherent x-ray diffraction provides a way to investigate the rotational motion of a colloidal suspension of crystals in real time. Coherent x-ray diffraction uses the long coherence lengths of synchrotron sources to illuminate a nanoscale particle coherently over its spatial dimensions. The penetration of high energy x-rays into various media allows for in-situ measurements making it ideal for suspensions. This technique has been used to image the structure of nanocrystals for some time but also has the capability of providing information about the orientation and dynamics of crystals. The particles are imaged in a specific diffraction condition allowing us to determine their orientation and observe how they rotate in real time with exceptional resolution. Such sensitivity allows for the study of rotational Brownian motion of nanocrystals in various suspensions and conditions. We present a study of the angular rheology of alumina and TiO2 colloidal nanocrystals in media using coherent x-ray diffraction.

  20. Characterization of polycrystalline materials using synchrotron X-ray imaging and diffraction techniques

    NASA Astrophysics Data System (ADS)

    Ludwig, W.; King, A.; Herbig, M.; Reischig, P.; Marrow, J.; Babout, L.; Lauridsen, E. M.; Proudhon, H.; Buffière, J. Y.

    2010-12-01

    The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X-ray diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure at the micrometer length scale. Repeated observation during (interrupted) mechanical tests provide unprecedented insight into crystallographic and grain microstructure related aspects of polycrystalline deformation and degradation mechanisms.

  1. Quantitative analysis of thoria phase in Th-U alloys using diffraction studies

    NASA Astrophysics Data System (ADS)

    Thakur, Shital; Krishna, P. S. R.; Shinde, A. B.; Kumar, Raj; Roy, S. B.

    2017-05-01

    In the present study the quantitative phase analysis of Th-U alloys in bulk form namely Th-52 wt% U and Th-3wt%U has been performed over the data obtained from both X ray diffraction and neutron diffraction technique using Rietveld method of FULLPROF software. Quantifying thoria (ThO2) phase present in bulk of the sample is limited due to surface oxidation and low penetration of x rays in high Z material. Neutron diffraction study probing bulk of the samples has been presented in comparison with x-ray diffraction study.

  2. Selenium single-wavelength anomalous diffraction de novo phasing using an X-ray-free electron laser

    DOE PAGES

    Hunter, Mark S.; Yoon, Chun Hong; DeMirci, Hasan; ...

    2016-11-04

    Structural information about biological macromolecules near the atomic scale provides important insight into the functions of these molecules. To date, X-ray crystallography has been the predominant method used for macromolecular structure determination. However, challenges exist when solving structures with X-rays, including the phase problem and radiation damage. X-ray-free electron lasers (X-ray FELs) have enabled collection of diffraction information before the onset of radiation damage, yet the majority of structures solved at X-ray FELs have been phased using external information via molecular replacement. De novo phasing at X-ray FELs has proven challenging due in part to per-pulse variations in intensity andmore » wavelength. Here we report the solution of a selenobiotinyl-streptavidin structure using phases obtained by the anomalous diffraction of selenium measured at a single wavelength (Se-SAD) at the Linac Coherent Light Source. Finally, our results demonstrate Se-SAD, routinely employed at synchrotrons for novel structure determination, is now possible at X-ray FELs.« less

  3. Macromolecular structures probed by combining single-shot free-electron laser diffraction with synchrotron coherent X-ray imaging.

    PubMed

    Gallagher-Jones, Marcus; Bessho, Yoshitaka; Kim, Sunam; Park, Jaehyun; Kim, Sangsoo; Nam, Daewoong; Kim, Chan; Kim, Yoonhee; Noh, Do Young; Miyashita, Osamu; Tama, Florence; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Tono, Kensuke; Kohmura, Yoshiki; Yabashi, Makina; Hasnain, S Samar; Ishikawa, Tetsuya; Song, Changyong

    2014-05-02

    Nanostructures formed from biological macromolecular complexes utilizing the self-assembly properties of smaller building blocks such as DNA and RNA hold promise for many applications, including sensing and drug delivery. New tools are required for their structural characterization. Intense, femtosecond X-ray pulses from X-ray free-electron lasers enable single-shot imaging allowing for instantaneous views of nanostructures at ambient temperatures. When combined judiciously with synchrotron X-rays of a complimentary nature, suitable for observing steady-state features, it is possible to perform ab initio structural investigation. Here we demonstrate a successful combination of femtosecond X-ray single-shot diffraction with an X-ray free-electron laser and coherent diffraction imaging with synchrotron X-rays to provide an insight into the nanostructure formation of a biological macromolecular complex: RNA interference microsponges. This newly introduced multimodal analysis with coherent X-rays can be applied to unveil nano-scale structural motifs from functional nanomaterials or biological nanocomplexes, without requiring a priori knowledge.

  4. Exploration of New Principles in Spintronics Based on Topological Insulators (Option 1)

    DTIC Science & Technology

    2012-05-14

    on the surface and found that our crystals are exceedingly homogeneous (Supplementary Information). The persistently narrow X - ray diffraction peaks...modified Bridgman method (see Supplementary Information for details). X - ray diffraction measurements indicated the monotonic shrinkage of a and c axis...and annealing at that temperature for 4 days. X - ray diffraction analyses confirmed that all the samples have the same crystal structure (R 3m

  5. Efficient modeling of Bragg coherent x-ray nanobeam diffraction

    DOE PAGES

    Hruszkewycz, S. O.; Holt, M. V.; Allain, M.; ...

    2015-07-02

    X-ray Bragg diffraction experiments that utilize tightly focused coherent beams produce complicated Bragg diffraction patterns that depend on scattering geometry, characteristics of the sample, and properties of the x-ray focusing optic. In this paper, we use a Fourier-transform-based method of modeling the 2D intensity distribution of a Bragg peak and apply it to the case of thin films illuminated with a Fresnel zone plate in three different Bragg scattering geometries. Finally, the calculations agree well with experimental coherent diffraction patterns, demonstrating that nanodiffraction patterns can be modeled at nonsymmetric Bragg conditions with this approach—a capability critical for advancing nanofocused x-raymore » diffraction microscopy.« less

  6. Crystallization and X-ray data analysis of the 10 kDa C-terminal lid subdomain from Caenorhabditis elegans Hsp70

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Worrall, Liam; Walkinshaw, Malcolm D., E-mail: m.walkinshaw@ed.ac.uk

    Crystals of the C-terminal 10 kDa lid subdomain from the C. elegans chaperone Hsp70 have been obtained that diffract X-rays to ∼3.5 Å and belong to space group I2{sub 1}2{sub 1}2{sub 1}. Analysis of X-ray data and initial heavy-atom phasing reveals 24 monomers in the asymmetric unit related by 432 non-crystallographic symmetry. Hsp70 is an important molecular chaperone involved in the regulation of protein folding. Crystals of the C-terminal 10 kDa helical lid domain (residues 542–640) from a Caenorhabditis elegans Hsp70 homologue have been produced that diffract X-rays to ∼3.4 Å. Crystals belong to space group I2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = b = 197, c = 200 Å. The Matthews coefficient, self-rotation function and Patterson map indicate 24 monomers in the asymmetric unit, showing non-crystallographic 432 symmetry. Molecular-replacement studies using the corresponding domain from rat, the only eukaryotic homologue with a known structure, failed and a mercury derivative was obtained. Preliminary MAD phasing using SHELXD and SHARP for location and refinement of the heavy-atom substructure and SOLOMON for density modification produced interpretable maps with a clear protein–solvent boundary. Further density-modification, model-building and refinement are currently under way.« less

  7. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.

    2006-10-01

    The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less

  8. HiSPoD: a program for high-speed polychromatic X-ray diffraction experiments and data analysis on polycrystalline samples

    DOE PAGES

    Sun, Tao; Fezzaa, Kamel

    2016-06-17

    Here, a high-speed X-ray diffraction technique was recently developed at the 32-ID-B beamline of the Advanced Photon Source for studying highly dynamic, yet non-repeatable and irreversible, materials processes. In experiments, the microstructure evolution in a single material event is probed by recording a series of diffraction patterns with extremely short exposure time and high frame rate. Owing to the limited flux in a short pulse and the polychromatic nature of the incident X-rays, analysis of the diffraction data is challenging. Here, HiSPoD, a stand-alone Matlab-based software for analyzing the polychromatic X-ray diffraction data from polycrystalline samples, is described. With HiSPoD,more » researchers are able to perform diffraction peak indexing, extraction of one-dimensional intensity profiles by integrating a two-dimensional diffraction pattern, and, more importantly, quantitative numerical simulations to obtain precise sample structure information.« less

  9. Preliminary X-ray characterization of a novel type of anchoring cohesin from the cellulosome of Ruminococcus flavefaciens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alber, Orly; Noach, Ilit; Lamed, Raphael

    2008-02-01

    The cloning, expression, purification, crystallization and preliminary X-ray characterization of a novel class of cohesin module (type III) from the R. flavefaciens ScaE anchoring scaffoldin are described. Ruminococcus flavefaciens is an anaerobic bacterium that resides in the gastrointestinal tract of ruminants. It produces a highly organized multi-enzyme cellulosome complex that plays a key role in the degradation of plant cell walls. ScaE is one of the critical structural components of its cellulosome that serves to anchor the complex to the cell wall. The seleno-l-methionine-labelled derivative of the ScaE cohesin module has been cloned, expressed, purified and crystallized. The crystals belongmore » to space group C2, with unit-cell parameters a = 155.6, b = 69.3, c = 93.0 Å, β = 123.4°, and contain four molecules in the asymmetric unit. Diffraction data were phased to 1.95 Å using the anomalous signal from the Se atoms.« less

  10. Preliminary report on the clay mineralogy of the Upper Devonian Shales in the southern and middle Appalachian Basin

    USGS Publications Warehouse

    Hosterman, John W.; Loferski, Patricia J.

    1978-01-01

    The distribution of kaolinite in parts of the Devonian shale section is the most significant finding of this work. These shales are composed predominately of 2M illite and illitic mixed-layer clay with minor amounts of chlorite and kaolinite. Preliminary data indicate that kaolinite, the only allogenic clay mineral, is present in successively older beds of the Ohio Shale from south to north in the southern and middle parts of the Appalachian basin. This trend in the distribution of kaolinite shows a paleocurrent direction to the southwest. Three well-known methods of preparing the clay fraction for X-ray diffraction analysis were tested and evaluated. Kaolinite was not identified in two of the methods because of layering due to differing settling rates of the clay minerals. It is suggested that if one of the two settling methods of sample preparation is used, the clay film be thin enough for the X-ray beam to penetrate the entire thickness of clay.

  11. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of bacterioferritin A from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, Vibha; Gupta, Rakesh K.; Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021

    2008-05-01

    The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein productmore » was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.« less

  12. Expression, crystallization and preliminary crystallographic analysis of the extracellular IgV-like domain of the human natural killer cell inhibitory receptor p75/AIRM1.

    PubMed

    Dimasi, Nazzareno; Moretta, Lorenzo; Biassoni, Roberto; Mariuzza, Roy A

    2003-10-01

    p75/AIRM1 (Siglec-7) is a sialic acid-binding Ig-like lectin recently identified as an inhibitory receptor on natural killer cells. The expression, in vitro folding, circular-dichroism spectroscopy, crystallization and preliminary X-ray characterization of the Ig-V like domain of p75/AIRM1 are reported. X-ray data were collected from a single crystal at 100 K, with a maximum useful diffraction pattern extending to 1.45 A resolution on a synchrotron source. The crystal belongs to a primitive monoclinic space group, with unit-cell parameters a = 32.65, b = 49.72, c = 39.79 A, alpha = gamma = 90, beta = 113 degrees. The systematic absences indicate that the space group is P2(1). Assuming one molecule per asymmetric unit, V(M) (the Matthews coefficient) was calculated to be 1.879 A(3) Da(-1) and the solvent content was estimated to be 32.01%.

  13. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

  14. X-ray diffraction and X-ray standing-wave study of the lead stearate film structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blagov, A. E.; Dyakova, Yu. A.; Kovalchuk, M. V.

    2016-05-15

    A new approach to the study of the structural quality of crystals is proposed. It is based on the use of X-ray standing-wave method without measuring secondary processes and considers the multiwave interaction of diffraction reflections corresponding to different harmonics of the same crystallographic reflection. A theory of multiwave X-ray diffraction is developed to calculate the rocking curves in the X-ray diffraction scheme under consideration for a long-period quasi-one-dimensional crystal. This phase-sensitive method is used to study the structure of a multilayer lead stearate film on a silicon substrate. Some specific structural features are revealed for the surface layer ofmore » the thin film, which are most likely due to the tilt of the upper layer molecules with respect to the external normal to the film surface.« less

  15. Molybdenum cell for x-ray diffraction measurements of fluid alkali metals at high temperatures and high pressures

    NASA Astrophysics Data System (ADS)

    Matsuda, Kazuhiro; Tamura, Kozaburo; Katoh, Masahiro; Inui, Masanori

    2004-03-01

    We have developed a sample cell for x-ray diffraction measurements of fluid alkali metals at high temperatures and high pressures. All parts of the cell are made of molybdenum which is resistant to the chemical corrosion of alkali metals. Single crystalline molybdenum disks electrolytically thinned down to 40 μm were used as the walls of the cell through which x rays pass. The crystal orientation of the disks was controlled in order to reduce the background from the cell. All parts of the cell were assembled and brazed together using a high-temperature Ru-Mo alloy. Energy dispersive x-ray diffraction measurements have been successfully carried out for fluid rubidium up to 1973 K and 16.2 MPa. The obtained S(Q) demonstrates the applicability of the molybdenum cell to x-ray diffraction measurements of fluid alkali metals at high temperatures and high pressures.

  16. High-resolution ab initio three-dimensional x-ray diffraction microscopy

    DOE PAGES

    Chapman, Henry N.; Barty, Anton; Marchesini, Stefano; ...

    2006-01-01

    Coherent x-ray diffraction microscopy is a method of imaging nonperiodic isolated objects at resolutions limited, in principle, by only the wavelength and largest scattering angles recorded. We demonstrate x-ray diffraction imaging with high resolution in all three dimensions, as determined by a quantitative analysis of the reconstructed volume images. These images are retrieved from the three-dimensional diffraction data using no a priori knowledge about the shape or composition of the object, which has never before been demonstrated on a nonperiodic object. We also construct two-dimensional images of thick objects with greatly increased depth of focus (without loss of transverse spatialmore » resolution). These methods can be used to image biological and materials science samples at high resolution with x-ray undulator radiation and establishes the techniques to be used in atomic-resolution ultrafast imaging at x-ray free-electron laser sources.« less

  17. Enhancing resolution in coherent x-ray diffraction imaging.

    PubMed

    Noh, Do Young; Kim, Chan; Kim, Yoonhee; Song, Changyong

    2016-12-14

    Achieving a resolution near 1 nm is a critical issue in coherent x-ray diffraction imaging (CDI) for applications in materials and biology. Albeit with various advantages of CDI based on synchrotrons and newly developed x-ray free electron lasers, its applications would be limited without improving resolution well below 10 nm. Here, we review the issues and efforts in improving CDI resolution including various methods for resolution determination. Enhancing diffraction signal at large diffraction angles, with the aid of interference between neighboring strong scatterers or templates, is reviewed and discussed in terms of increasing signal-to-noise ratio. In addition, we discuss errors in image reconstruction algorithms-caused by the discreteness of the Fourier transformations involved-which degrade the spatial resolution, and suggest ways to correct them. We expect this review to be useful for applications of CDI in imaging weakly scattering soft matters using coherent x-ray sources including x-ray free electron lasers.

  18. A portable X-ray diffraction apparatus for in situ analyses of masters' paintings

    NASA Astrophysics Data System (ADS)

    Eveno, Myriam; Duran, Adrian; Castaing, Jacques

    2010-09-01

    It is rare that the analyses of materials in paintings can be carried out by taking micro-samples. Valuable works of art are best studied in situ by non-invasive techniques. For that purpose, a portable X-ray diffraction and fluorescence apparatus has been designed and constructed at the C2RMF. This apparatus has been used for paintings of Rembrandt, Leonardo da Vinci, Van Gogh, Mantegna, etc. Results are given to illustrate the performance of X-ray diffraction, especially when X-ray fluorescence does not bring sufficient information to conclude.

  19. Mössbauer study of iron-based perovskite-type materials as potential catalysts for ethyl acetate oxidation

    NASA Astrophysics Data System (ADS)

    Paneva, D.; Dimitrov, M.; Velinov, N.; Kolev, H.; Kozhukharov, V.; Tsoncheva, T.; Mitov, I.

    2010-03-01

    La-Sr-Fe perovskite-type oxides were prepared by the nitrate-citrate method. The basic object of this study is layered Ruddlesden-Popper phase LaSr3Fe3O10. The phase composition and structural properties of the obtained materials are investigated by Mössbauer spectroscopy, X-ray diffraction (XRD), X-ray Photoelectron Spectroscopy (XPS) and temperature programmed reduction (TPR). The preliminary catalytic tests show a high potential of these materials for volatile organic compounds (VOCs) elimination as they possess high conversion ability and selectivity to total oxidation of ethyl acetate. Catalytic performance of LaSr3Fe3O10 is depended on the stability of structure and Fe4+-oxidation state.

  20. Expression, Purification, Crystallization And Preliminary X-Ray Studies of a Prolyl-4-Hydroxylase Protein From Bacillus Anthracis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, M.A.; Scott, E.E.; Limburg, J.

    2009-05-26

    Collagen prolyl-4-hydroxylase (C-P4H) catalyzes the hydroxylation of specific proline residues in procollagen, which is an essential step in collagen biosynthesis. A new form of P4H from Bacillus anthracis (anthrax-P4H) that shares many characteristics with the type I C-P4H from human has recently been characterized. The structure of anthrax-P4H could provide important insight into the chemistry of C-P4Hs and into the function of this unique homodimeric P4H. X-ray diffraction data of selenomethionine-labeled anthrax-P4H recombinantly expressed in Escherichia coli have been collected to 1.4 {angstrom} resolution.

  1. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

    PubMed Central

    Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis

    2009-01-01

    EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449

  2. Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

    PubMed Central

    Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

    2006-01-01

    A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

  3. X-ray fractography on fatigue fractured surface of austenitic stainless steel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yajima, Zenjiro; Tokuyama, Hideki; Kibayashi, Yasuo

    1995-12-31

    X-ray diffraction observation of the material internal structure beneath fracture surfaces provide fracture analysis with useful information to investigate the conditions and mechanisms of fracture. X-ray fractography is a generic name given to this technique. In the present study, X-ray fractography was applied to fatigue fracture surfaces of austenitic stainless steel (AISI 304) which consisted of solution treatment. The fatigue tests were carried out on compact tension (CT) specimens. The plastic strain on the fracture surface was estimated from measuring the line broadening of X-ray diffraction profiles. The line broadening of X-ray diffraction profiles was measured on and beneath fatiguemore » fracture surfaces. The depth of the plastic zone left on fracture surfaces was evaluated from the line broadening. The results are discussed on the basis of fracture mechanics.« less

  4. Diffraction and Imaging Study of Imperfections of Protein Crystals with Coherent X-rays

    NASA Technical Reports Server (NTRS)

    Hu, Z. W.; Thomas, B. R.; Chernov, A. A.; Chu, Y. S.; Lai, B.

    2004-01-01

    High angular-resolution x-ray diffraction and phase contrast x-ray imaging were combined to study defects and perfection of protein crystals. Imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of a uniformly grown lysozyme crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in diffraction images. X-ray imaging and diffraction characterization of the quality of apoferritin crystals will also be discussed in the presentation.

  5. THE EFFECT OF SATELLITE LINES FROM THE X-RAY SOURCE ON X-RAY DIFFRACTION PEAKS

    EPA Science Inventory

    The article discusses the development of a method for relating reactivity to crystallite size and strain parameters obtained by the Warren-Averbach technique. EPA has been using crystallite size and strain data obtained from x-ray diffraction (XRD) peak profile analysis to predic...

  6. History and Solution of the Phase Problem in theTheory of Structure Determination of Crystals from X-ray Diffraction Experiments

    ScienceCinema

    Wolf, Emil [University of Rochester, Rochester, New York, United States

    2017-12-09

    Since the pioneering work of Max von Laue on interference and diffraction of x-rays, carried out almost 100 years ago, numerous attempts have been made to determine structures of crystalline media from x-ray diffraction experiments. The usefulness of all of them has been limited by the inability of measuring phases of the diffracted beams. In this talk, the most important research carried out in this field will be reviewed and a recently obtained solution of the phase problem will be presented.

  7. Thermal effects on the structural properties of tungsten oxide nanoparticles

    NASA Astrophysics Data System (ADS)

    Yang, Tsung-Yeh; Wu, Chung-Yi; Tsai, Meng-Hung; Lin, Hong-Ming; Tsai, Wen-Li; Hwu, Yeukuang

    2004-06-01

    Tungsten oxide nanoparticles are prepared by evaporating and oxidizing the tungsten boat in helium and oxygen atmosphere and then quenched to the liquid nitrogen temperature. The as-prepared tungsten oxide nanoparticles are porous-free with uniform size. The morphology and particle size distribution of the as-prepared and after sinter treatments tungsten oxide nanoparticles are revealed by TEM and AFM. The long-range order of these nanoparticles can be examined by X-ray diffraction technique. The as-prepared nanoparticles exhibit a mixture structure of monoclinic and hexagonal crystals. Preliminary X-ray diffraction results indicate that the hexagonal structure is transformed to monoclinic structure after annealing to above 600°C. In order to better distinguish the structural properties of the tungsten oxide (WO3- x) nanoparticles before and after annealing, the X-ray absorption spectrum technique is utilized; thus, the detailed local atomic arrangement of oxygen and/or tungsten can be determined. According to the XAS result, the shape of the W L3-edge undergoes no considerable changes. This infers that structural transformation of tungsten oxide nanoparticle may be caused by the migration of oxygen after sintering. From the O K-edge of absorption spectrum, it suggests that a mixture phase structure is obtained when sintered below 300°C. And this result indicates that heat treatment to approximately 600°C produces a stable structure of a monoclinic crystal of WO3.

  8. XRayView: a teaching aid for X-ray crystallography.

    PubMed

    Phillips, G N

    1995-10-01

    A software package, XRayView, has been developed that uses interactive computer graphics to introduce basic concepts of x-ray diffraction by crystals, including the reciprocal lattice, the Ewald sphere construction, Laue cones, the wavelength dependence of the reciprocal lattice, primitive and centered lattices and systematic extinctions, rotation photography. Laue photography, space group determination and Laue group symmetry, and the alignment of crystals by examination of reciprocal space. XRayView is designed with "user-friendliness" in mind, using pull-down menus to control the program. Many of the experiences of using real x-ray diffraction equipment to examine crystalline diffraction can be simulated. Exercises are available on-line to guide the users through many typical x-ray diffraction experiments.

  9. Application of MEMS-based x-ray optics as tuneable nanosecond choppers

    NASA Astrophysics Data System (ADS)

    Chen, Pice; Walko, Donald A.; Jung, Il Woong; Li, Zhilong; Gao, Ya; Shenoy, Gopal K.; Lopez, Daniel; Wang, Jin

    2017-08-01

    Time-resolved synchrotron x-ray measurements often rely on using a mechanical chopper to isolate a set of x-ray pulses. We have started the development of micro electromechanical systems (MEMS)-based x-ray optics, as an alternate method to manipulate x-ray beams. In the application of x-ray pulse isolation, we recently achieved a pulse-picking time window of half a nanosecond, which is more than 100 times faster than mechanical choppers can achieve. The MEMS device consists of a comb-drive silicon micromirror, designed for efficiently diffracting an x-ray beam during oscillation. The MEMS devices were operated in Bragg geometry and their oscillation was synchronized to x-ray pulses, with a frequency matching subharmonics of the cycling frequency of x-ray pulses. The microscale structure of the silicon mirror in terms of the curvature and the quality of crystallinity ensures a narrow angular spread of the Bragg reflection. With the discussion of factors determining the diffractive time window, this report showed our approaches to narrow down the time window to half a nanosecond. The short diffractive time window will allow us to select single x-ray pulse out of a train of pulses from synchrotron radiation facilities.

  10. Fabrication of high-resolution x-ray diffractive optics at King's College London

    NASA Astrophysics Data System (ADS)

    Charalambous, Pambos S.; Anastasi, Peter A. F.; Burge, Ronald E.; Popova, Katia

    1995-09-01

    The fabrication of high resolution x-ray diffractive optics, and Fresnel zone plates (ZPs) in particular, is a very demanding multifaceted technological task. The commissioning of more (and brighter) synchrotron radiation sources, has increased the number of x-ray imaging beam lines world wide. The availability of cheaper and more effective laboratory x-ray sources, has further increased the number of laboratories involved in x-ray imaging. The result is an ever increasing demand for x-ray optics with a very wide range of specifications, reflecting the particular type of x-ray imaging performed at different laboratories. We have been involved in all aspects of high resolution nanofabrication for a number of years, and we have explored many different methods of lithography, which, although unorthodox, open up possibilities, and increase our flexibility for the fabrication of different diffractive optical elements, as well as other types of nanostructures. The availability of brighter x-ray sources, means that the diffraction efficiency of the ZPs is becoming of secondary importance, a trend which will continue in the future. Resolution, however, is important and will always remain so. Resolution is directly related to the accuracy af pattern generation, as well as the ability to draw fine lines. This is the area towards which we have directed most of our efforts so far.

  11. Focused ion beam direct micromachining of DOEs

    NASA Astrophysics Data System (ADS)

    Khan Malek, Chantal; Hartley, Frank T.; Neogi, Jayant

    2000-09-01

    We discuss here the capability of direct manufacture of various high- resolution diffractive optics, in particular regarding micromachining of DOEs in 3D. Preliminary demonstrations were made in 2-D using an automated FIB system operated at 30 KeV with a Gallium liquid metal ion source and equipped with a gas injection system (GIS). Gratings with a 20 nm line width and zone plates with 32 nm outer ring were milled in a reactive atmosphere (iodine) directly through 3.5 (mu) m and 800 nm of gold respectively. Plans for combining FIB and X-ray lithography to make diffractive optical elements (DOEs) for JPL are also mentioned.

  12. Crystallization and preliminary X-ray diffraction data of β-galactosidase from Aspergillus niger.

    PubMed

    Rico-Díaz, Agustín; Vizoso Vázquez, Ángel; Cerdán, M Esperanza; Becerra, Manuel; Sanz-Aparicio, Julia

    2014-11-01

    β-Galactosidase from Aspergillus niger (An-β-Gal), belonging to the family 35 glycoside hydrolases, hydrolyzes the β-galactosidase linkages in lactose and other galactosides. It is extensively used in industry owing to its high hydrolytic activity and safety. The enzyme has been expressed in yeasts and purified by immobilized metal-ion affinity chromatography for crystallization experiments. The recombinant An-β-Gal, deglycosylated to avoid heterogeneity of the sample, has a molecular mass of 109 kDa. Rod-shaped crystals grew using PEG 3350 as the main precipitant agent. A diffraction data set was collected to 1.8 Å resolution.

  13. Two-photon x-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stohr, J.

    The interference pattern of a circular photon source has long been used to define the optical diffraction limit. Here we show the breakdown of conventional x-ray diffraction theory for the fundamental case of a “source”, consisting of a back-illuminated thin film in a circular aperture. When the conventional spontaneous x-ray scattering by atoms in the film is replaced at high incident intensity by stimulated resonant scattering, the film becomes the source of cloned photon twins and the diffraction pattern becomes self-focused beyond the diffraction limit. Furthermore, the case of cloned photon pairs is compared to and distinguished from entangled photonmore » pairs or biphotons.« less

  14. Two-photon x-ray diffraction

    DOE PAGES

    Stohr, J.

    2017-01-11

    The interference pattern of a circular photon source has long been used to define the optical diffraction limit. Here we show the breakdown of conventional x-ray diffraction theory for the fundamental case of a “source”, consisting of a back-illuminated thin film in a circular aperture. When the conventional spontaneous x-ray scattering by atoms in the film is replaced at high incident intensity by stimulated resonant scattering, the film becomes the source of cloned photon twins and the diffraction pattern becomes self-focused beyond the diffraction limit. Furthermore, the case of cloned photon pairs is compared to and distinguished from entangled photonmore » pairs or biphotons.« less

  15. Characterization of X80 and X100 Microalloyed Pipeline Steel Using Quantitative X-ray Diffraction

    NASA Astrophysics Data System (ADS)

    Wiskel, J. B.; Li, X.; Ivey, D. G.; Henein, H.

    2018-06-01

    Quantitative X-ray diffraction characterization of four (4) X80 and three (3) X100 microalloyed steels was undertaken. The effect of through-thickness position, processing parameters, and composition on the measured crystallite size, microstrain, and J index (relative magnitude of crystallographic texture) was determined. Microstructure analysis using optical microscopy, scanning electron microscopy, transmission electron microscopy, and electron-backscattered diffraction was also undertaken. The measured value of microstrain increased with increasing alloy content and decreasing cooling interrupt temperature. Microstructural features corresponding to crystallite size in the X80 steels were both above and below the detection limit for quantitative X-ray diffraction. The X100 steels consistently exhibited microstructure features below the crystallite size detection limit. The yield stress of each steel increased with increasing microstrain. The increase in microstrain from X80 to X100 is also associated with a change in microstructure from predominantly polygonal ferrite to bainitic ferrite.

  16. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

    PubMed

    Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

    2014-06-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

  17. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

    PubMed Central

    Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

    2014-01-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

  18. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    PubMed

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  19. Room Temperature Elastic Moduli and Vickers Hardness of Hot-Pressed LLZO Cubic Garnet

    DTIC Science & Technology

    2012-01-01

    polishing compounds, Leco, St. Joseph, MI). X - ray diffraction and scanning electron microscopy (SEM) The microstructure of the hot-pressed specimens...was examined on uncoated fracture surfaces by SEM with an accelerating voltage of 1 and 3 kV. Phase purity was evaluated from X - ray diffraction data...the micro- structure appeared to be homogenous for the two hot- pressed LLZO specimens included in this study (Fig. 1). X - ray diffraction confirmed that

  20. Method for improve x-ray diffraction determinations of residual stress in nickel-base alloys

    DOEpatents

    Berman, Robert M.; Cohen, Isadore

    1990-01-01

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys which comprises covering part of a predetermined area of the surface of a nickel-base alloy with a dispersion, exposing the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample.

  1. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zhijie; Chakraborty, Sayan; Xu, Guozhou

    Does not respond to nucleotides 1 (DORN1) has recently been identified as the first membrane-integral plant ATP receptor, which is required for ATP-induced calcium response, mitogen-activated protein kinase activation and defense responses inArabidopsis thaliana. In order to understand DORN1-mediated ATP sensing and signal transduction, crystallization and preliminary X-ray studies were conducted on the extracellular domain of DORN1 (atDORN1-ECD) and that of an orthologous protein,Camelina sativalectin receptor kinase I.9 (csLecRK-I.9-ECD or csI.9-ECD). A variety of deglycosylation strategies were employed to optimize the glycosylated recombinant atDORN1-ECD for crystallization. In addition, the glycosylated csI.9-ECD protein was crystallized at 291 K. X-ray diffraction datamore » were collected at 4.6 Å resolution from a single crystal. The crystal belonged to space groupC222 orC222 1, with unit-cell parametersa= 94.7,b= 191.5,c= 302.8 Å. These preliminary studies have laid the foundation for structural determination of the DORN1 and I.9 receptor proteins, which will lead to a better understanding of the perception and function of extracellular ATP in plants.« less

  2. Crystal structure and density of helium to 232 kbar

    NASA Technical Reports Server (NTRS)

    Mao, H. K.; Wu, Y.; Jephcoat, A. P.; Hemley, R. J.; Bell, P. M.; Bassett, W. A.

    1988-01-01

    The properties of helium and hydrogen at high pressure are topics of great interest to the understanding of planetary interiors. These materials constitute 95 percent of the entire solar system. A technique was presented for the measurement of X-ray diffraction from single-crystals of low-Z condenses gases in a diamond-anvil cell at high pressure. The first such single-crystal X-ray diffraction measurements on solid hydrogen to 26.5 GPa were presented. The application of this technique to the problem of the crystal structure, equation of state, and phase diagram of solid helium is reported. Crucial for X-ray diffraction studies of these materials is the use of a synchrotron radiation source which provides high brillance, narrow collimation of the incident and diffracted X-ray beams to reduce the background noise, and energy-dispersive diffraction techniques with polychromatic (white) radiation, which provides high detection efficiency.

  3. Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Veluraja, K., E-mail: veluraja@msuniv.ac.in; Vennila, K.N.; Umamakeshvari, K.

    Research highlights: {yields} Techniques to get oriented mucin fibre. {yields} X-ray fibre diffraction pattern for mucin. {yields} Molecular modeling of mucin based on X-ray fibre diffraction pattern. -- Abstract: The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 A. The high intense d-spacing signal at 4.22 A is attributed to the antiparallel {beta}-sheet structure identified in the fraction of themore » homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 A reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule.« less

  4. A nearly on-axis spectroscopic system for simultaneously measuring UV-visible absorption and X-ray diffraction in the SPring-8 structural genomics beamline.

    PubMed

    Sakaguchi, Miyuki; Kimura, Tetsunari; Nishida, Takuma; Tosha, Takehiko; Sugimoto, Hiroshi; Yamaguchi, Yoshihiro; Yanagisawa, Sachiko; Ueno, Go; Murakami, Hironori; Ago, Hideo; Yamamoto, Masaki; Ogura, Takashi; Shiro, Yoshitsugu; Kubo, Minoru

    2016-01-01

    UV-visible absorption spectroscopy is useful for probing the electronic and structural changes of protein active sites, and thus the on-line combination of X-ray diffraction and spectroscopic analysis is increasingly being applied. Herein, a novel absorption spectrometer was developed at SPring-8 BL26B2 with a nearly on-axis geometry between the X-ray and optical axes. A small prism mirror was placed near the X-ray beamstop to pass the light only 2° off the X-ray beam, enabling spectroscopic analysis of the X-ray-exposed volume of a crystal during X-ray diffraction data collection. The spectrometer was applied to NO reductase, a heme enzyme that catalyzes NO reduction to N2O. Radiation damage to the heme was monitored in real time during X-ray irradiation by evaluating the absorption spectral changes. Moreover, NO binding to the heme was probed via caged NO photolysis with UV light, demonstrating the extended capability of the spectrometer for intermediate analysis.

  5. Investigating the Effects of Low Temperature Annealing of Amorphous Corrosion Resistant Alloys.

    DTIC Science & Technology

    1980-11-01

    Ray Diffraction.................................................... 6 Differential Scanning Calorimetry....................................... 9...17 LIST OF FIGURES Figure 1. X- Ray Diffraction Results From Fe32Ni 36Cr 4P 2 B Annealed for One Hour at...Various Temperatures (Cr Ka Radiation) ................................. 7 Figure 2. X- Ray Diffraction Results From FeU2NiaeCr14SieB Annealed for One

  6. Evidence from x-ray and neutron powder diffraction patterns that the so-called icosahedral and decagonal quasicrystals of MnAl(6) and other alloys are twinned cubic crystals.

    PubMed

    Pauling, L

    1987-06-01

    It is shown that the x-ray powder diffraction patterns of rapidly quenched MnAl(6) and Mg(32)(Al,Zn)(49) and the neutron powder diffraction pattern of MnAl(6) are compatible with the proposed 820-atom primitive cubic structure [Pauling, L. (1987) Phys. Rev. Lett. 58, 365-368]. The values found for the edge of the unit cube are 23.365 A (x-ray) and 23.416 A (neutron) for MnAl(6) and 24.313 A (x-ray) for Mg(32)(Al,Zn)(49).

  7. Evidence from x-ray and neutron powder diffraction patterns that the so-called icosahedral and decagonal quasicrystals of MnAl6 and other alloys are twinned cubic crystals

    PubMed Central

    Pauling, Linus

    1987-01-01

    It is shown that the x-ray powder diffraction patterns of rapidly quenched MnAl6 and Mg32(Al,Zn)49 and the neutron powder diffraction pattern of MnAl6 are compatible with the proposed 820-atom primitive cubic structure [Pauling, L. (1987) Phys. Rev. Lett. 58, 365-368]. The values found for the edge of the unit cube are 23.365 Å (x-ray) and 23.416 Å (neutron) for MnAl6 and 24.313 Å (x-ray) for Mg32(Al,Zn)49. PMID:16593841

  8. High-energy X-ray diffraction using the Pixium 4700 flat-panel detector.

    PubMed

    Daniels, J E; Drakopoulos, M

    2009-07-01

    The Pixium 4700 detector represents a significant step forward in detector technology for high-energy X-ray diffraction. The detector design is based on digital flat-panel technology, combining an amorphous Si panel with a CsI scintillator. The detector has a useful pixel array of 1910 x 2480 pixels with a pixel size of 154 microm x 154 microm, and thus it covers an effective area of 294 mm x 379 mm. Designed for medical imaging, the detector has good efficiency at high X-ray energies. Furthermore, it is capable of acquiring sequences of images at 7.5 frames per second in full image mode, and up to 60 frames per second in binned region of interest modes. Here, the basic properties of this detector applied to high-energy X-ray diffraction are presented. Quantitative comparisons with a widespread high-energy detector, the MAR345 image plate scanner, are shown. Other properties of the Pixium 4700 detector, including a narrow point-spread function and distortion-free image, allows for the acquisition of high-quality diffraction data at high X-ray energies. In addition, high frame rates and shutterless operation open new experimental possibilities. Also provided are the necessary data for the correction of images collected using the Pixium 4700 for diffraction purposes.

  9. Long-Wavelength X-Ray Diffraction and Its Applications in Macromolecular Crystallography.

    PubMed

    Weiss, Manfred S

    2017-01-01

    For many years, diffraction experiments in macromolecular crystallography at X-ray wavelengths longer than that of Cu-K α (1.54 Å) have been largely underappreciated. Effects caused by increased X-ray absorption result in the fact that these experiments are more difficult than the standard diffraction experiments at short wavelengths. However, due to the also increased anomalous scattering of many biologically relevant atoms, important additional structural information can be obtained. This information, in turn, can be used for phase determination, for substructure identification, in molecular replacement approaches, as well as in structure refinement. This chapter reviews the possibilities and the difficulties associated with such experiments, and it provides a short description of two macromolecular crystallography synchrotron beam lines dedicated to long-wavelength X-ray diffraction experiments.

  10. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA.

    PubMed

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi

    2014-05-01

    Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the `diffraction before destruction' scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles.

  11. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    PubMed Central

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi

    2014-01-01

    Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles. PMID:24763651

  12. Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ariza, Antonio; Vickers, Tim J.; Greig, Neil

    2005-08-01

    The detoxification enzyme glyoxalase I from L. major has been crystallized. Preliminary molecular-replacement calculations indicate the presence of three glyoxalase I dimers in the asymmetric unit. Glyoxalase I (GLO1) is a putative drug target for trypanosomatids, which are pathogenic protozoa that include the causative agents of leishmaniasis. Significant sequence and functional differences between Leishmania major and human GLO1 suggest that it may make a suitable template for rational inhibitor design. L. major GLO1 was crystallized in two forms: the first is extremely disordered and does not diffract, while the second, an orthorhombic form, produces diffraction to 2.0 Å. Molecular-replacement calculationsmore » indicate that there are three GLO1 dimers in the asymmetric unit, which take up a helical arrangement with their molecular dyads arranged approximately perpendicular to the c axis. Further analysis of these data are under way.« less

  13. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimentalmore » fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons.« less

  14. An instrument for in situ coherent x-ray studies of metal-organic vapor phase epitaxy of III-nitrides.

    PubMed

    Ju, Guangxu; Highland, Matthew J; Yanguas-Gil, Angel; Thompson, Carol; Eastman, Jeffrey A; Zhou, Hua; Brennan, Sean M; Stephenson, G Brian; Fuoss, Paul H

    2017-03-01

    We describe an instrument that exploits the ongoing revolution in synchrotron sources, optics, and detectors to enable in situ studies of metal-organic vapor phase epitaxy (MOVPE) growth of III-nitride materials using coherent x-ray methods. The system includes high-resolution positioning of the sample and detector including full rotations, an x-ray transparent chamber wall for incident and diffracted beam access over a wide angular range, and minimal thermal sample motion, giving the sub-micron positional stability and reproducibility needed for coherent x-ray studies. The instrument enables surface x-ray photon correlation spectroscopy, microbeam diffraction, and coherent diffraction imaging of atomic-scale surface and film structure and dynamics during growth, to provide fundamental understanding of MOVPE processes.

  15. An instrument for in situ coherent x-ray studies of metal-organic vapor phase epitaxy of III-nitrides

    NASA Astrophysics Data System (ADS)

    Ju, Guangxu; Highland, Matthew J.; Yanguas-Gil, Angel; Thompson, Carol; Eastman, Jeffrey A.; Zhou, Hua; Brennan, Sean M.; Stephenson, G. Brian; Fuoss, Paul H.

    2017-03-01

    We describe an instrument that exploits the ongoing revolution in synchrotron sources, optics, and detectors to enable in situ studies of metal-organic vapor phase epitaxy (MOVPE) growth of III-nitride materials using coherent x-ray methods. The system includes high-resolution positioning of the sample and detector including full rotations, an x-ray transparent chamber wall for incident and diffracted beam access over a wide angular range, and minimal thermal sample motion, giving the sub-micron positional stability and reproducibility needed for coherent x-ray studies. The instrument enables surface x-ray photon correlation spectroscopy, microbeam diffraction, and coherent diffraction imaging of atomic-scale surface and film structure and dynamics during growth, to provide fundamental understanding of MOVPE processes.

  16. Crystallization and preliminary crystallographic analysis of an aminoglycoside kinase from Legionella pneumophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lemke, Christopher T.; Hwang, Jiyoung; Xiong, Bing

    2005-06-01

    Two crystal forms of the antibiotic resistance enzyme APH(9)-Ia from L. pneumophila are reported. 9-Aminoglycoside phosphotransferase type Ia [APH(9)-Ia] is a resistance factor in Legionella pneuemophila, the causative agent of legionnaires’ disease. It is responsible for providing intrinsic resistance to the antibiotic spectinomycin. APH(9)-Ia phosphorylates one of the hydroxyl moieties of spectinomycin in an ATP-dependent manner, abolishing the antibiotic properties of this drug. Here, the crystallization and preliminary X-ray studies of this enzyme in two crystal forms is reported. One of the these crystal forms provides diffraction data to a resolution of 1.7 Å.

  17. Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

    2005-07-01

    Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

  18. Combined X-ray and neutron fibre diffraction studies of biological and synthetic polymers

    NASA Astrophysics Data System (ADS)

    Parrot, I. M.; Urban, V.; Gardner, K. H.; Forsyth, V. T.

    2005-08-01

    The fibrous state is a natural one for polymer molecules which tend to assume regular helical conformations rather than the globular structures characteristic of many proteins. Fibre diffraction therefore has broad application to the study of a wide range of biological and synthetic polymers. The purpose of this paper is to illustrate the general scope of the method and in particular to demonstrate the impact of a combined approach involving both X-ray and neutron diffraction methods. While the flux of modern X-ray synchrotron radiation sources allows high quality datasets to be recorded with good resolution within a very short space of time, neutron studies can provide unique information through the ability to locate hydrogen or deuterium atoms that are often difficult or impossible to locate using X-ray methods. Furthermore, neutron fibre diffraction methods can, through the ability to selectively label specific parts of a structure, be used to highlight novel aspects of polymer structure that can not be studied using X-rays. Two examples are given. The first describes X-ray and neutron diffraction studies of conformational transitions in DNA. The second describes structural studies of the synthetic high-performance polymer poly(p-phenylene terephthalamide) (PPTA), known commercially as Kevlar® or Twaron®.

  19. Atomic pair distribution function at the Brazilian Synchrotron Light Laboratory: application to the Pb 1–x La xZr 0.40Ti 0.60O 3 ferroelectric system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saleta, M. E.; Eleotério, M.; Mesquita, A.

    2017-07-29

    This work reports the setting up of the X-ray diffraction and spectroscopy beamline at the Brazilian Synchrotron Light Laboratory for performing total scattering experiments to be analyzed by atomic pair distribution function (PDF) studies. The results of a PDF refinement for Al 2O 3 standard are presented and compared with data acquired at a beamline of the Advanced Photon Source, where it is common to perform this type of experiment. A preliminary characterization of the Pb 1–xLa xZr 0.40Ti 0.60O 3 ferroelectric system, withx= 0.11, 0.12 and 0.15, is also shown.

  20. IDATEN and G-SITENNO: GUI-assisted software for coherent X-ray diffraction imaging experiments and data analyses at SACLA.

    PubMed

    Sekiguchi, Yuki; Yamamoto, Masaki; Oroguchi, Tomotaka; Takayama, Yuki; Suzuki, Shigeyuki; Nakasako, Masayoshi

    2014-11-01

    Using our custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors, cryogenic coherent X-ray diffraction imaging experiments have been undertaken at the SPring-8 Angstrom Compact free electron LAser (SACLA) facility. To efficiently perform experiments and data processing, two software suites with user-friendly graphical user interfaces have been developed. The first is a program suite named IDATEN, which was developed to easily conduct four procedures during experiments: aligning KOTOBUKI-1, loading a flash-cooled sample into the cryogenic goniometer stage inside the vacuum chamber of KOTOBUKI-1, adjusting the sample position with respect to the X-ray beam using a pair of telescopes, and collecting diffraction data by raster scanning the sample with X-ray pulses. Named G-SITENNO, the other suite is an automated version of the original SITENNO suite, which was designed for processing diffraction data. These user-friendly software suites are now indispensable for collecting a large number of diffraction patterns and for processing the diffraction patterns immediately after collecting data within a limited beam time.

  1. Dynamical diffraction imaging (topography) with X-ray synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Kuriyama, M.; Steiner, B. W.; Dobbyn, R. C.

    1989-01-01

    By contrast to electron microscopy, which yields information on the location of features in small regions of materials, X-ray diffraction imaging can portray minute deviations from perfect crystalline order over larger areas. Synchrotron radiation-based X-ray optics technology uses a highly parallel incident beam to eliminate ambiguities in the interpretation of image details; scattering phenomena previously unobserved are now readily detected. Synchrotron diffraction imaging renders high-resolution, real-time, in situ observations of materials under pertinent environmental conditions possible.

  2. Development of Thin Films as Potential Structural Cathodes to Enable Multifunctional Energy-Storage Structural Composite Batteries for the U.S. Army’s Future Force

    DTIC Science & Technology

    2011-09-01

    glancing angle X - ray diffraction (GAXRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), and electrochemical...Emission SEM FWHM full width at half maximum GAXRD glancing angle X - ray diffraction H3COCH2CH2OH 2-methoxyethanol LiMn2O4 lithium manganese oxide...were characterized by scanning electron microscopy (SEM), X - ray diffraction (XRD), and atomic force microscopy (AFM). In addition,

  3. Simultaneous X-ray fluorescence and scanning X-ray diffraction microscopy at the Australian Synchrotron XFM beamline

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jones, Michael W. M.; Phillips, Nicholas W.; van Riessen, Grant A.

    2016-08-11

    Owing to its extreme sensitivity, quantitative mapping of elemental distributionsviaX-ray fluorescence microscopy (XFM) has become a key microanalytical technique. The recent realisation of scanning X-ray diffraction microscopy (SXDM) meanwhile provides an avenue for quantitative super-resolved ultra-structural visualization. The similarity of their experimental geometries indicates excellent prospects for simultaneous acquisition. Here, in both step- and fly-scanning modes, robust, simultaneous XFM-SXDM is demonstrated.

  4. An Excel Spreadsheet for a One-Dimensional Fourier Map in X-ray Crystallography

    ERIC Educational Resources Information Center

    Clegg, William

    2004-01-01

    The teaching of crystal structure determination with single-crystal X-ray diffraction at undergraduate level faces numerous challenges. Single-crystal X-ray diffraction is used in a vast range of chemical research projects and forms the basis for a high proportion of structural results that are presented to high-school, undergraduate, and graduate…

  5. Laser-induced Multi-energy Processing in Diamond Growth

    DTIC Science & Technology

    2012-05-01

    microscopy (SEM) and energy dispersive X - ray (EDX) measurements, Drs. Yi Liu and Shah Valloppilly from Nebraska Center for Materials and Nanoscience...NCMN) at UNL for help on X - Ray diffraction (XRD) measurements, and Professor Steve W. Martin and Dr. Young Sik Kim from the Department of Material...spectroscopy and X - ray diffraction ................... 62 4.4 Conclusions

  6. Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kondou, Youhei; Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Toyama; Kitazawa, Daisuke

    2005-01-01

    Bacteriophage Mu baseplate protein gene product 44 was crystallized. The crystal belongs to space group R3, with unit-cell parameters a = b = 126.6, c = 64.2 Å. Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution andmore » are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan.« less

  7. Preliminary study on the mode of occurrence of arsenic in high arsenic coals from southwest Guizhou Province

    USGS Publications Warehouse

    Ding, Z.; Zheng, B.; Zhang, Jiahua; Belkin, H.E.; Finkelman, R.B.; Zhao, F.; Zhou, D.; Zhou, Y.; Chen, C.

    1999-01-01

    Coal samples from high arsenic coal areas have been analyzed by electron microprobe analyzer (EMPA), scanning electron microscopy with an energy dispersive X-ray analyzer (SEM-EDX), X-ray diffraction analysis (XRD), low temperature ashing (LTA), transmission electron microscopy (TEM), X-ray absorption fine structure (XAFS), instrument neutron activation analysis (INAA) and wet chemical analysis. Although some As-bearing minerals such as pyrite, arsenopyrite, realgar (?), As-bearing sulfate, and As-bearing clays are found in the high arsenic coals, their contents do not account for the abundance of arsenic in the some coals. Analysis of the coal indicates that arsenic exists mainly in the form of As5+ and As3+, combined with compounds in the organic matrix. The occurrence of such exceptionally high arsenic contents in coal and the fact that the arsenic is dominantly organically associated are unique observations. The modes of occurrence of arsenic in high As-coals are discussed.

  8. Crystallization and preliminary X-ray crystallographic analysis of carboxyl-terminal region 4 of SigR from Streptomyces coelicolor A3(2)

    PubMed Central

    Kim, Keon Young; Kim, Sunmin; Park, Jeong Kuk; Song, HyoJin; Park, SangYoun

    2014-01-01

    Full-length SigR from Streptomyces coelicolor A3(2) was overexpressed in Escherichia coli, purified and submitted to crystallization trials using either polyethylene glycol 3350 or 4000 as a precipitant. X-ray diffraction data were collected to 2.60 Å resolution under cryoconditions using synchrotron X-rays. The crystal packs in space group P43212, with unit-cell parameters a = b = 42.14, c = 102.02 Å. According to the Matthews coefficient, the crystal asymmetric unit cannot contain the full-length protein. Molecular replacement with the known structures of region 2 and region 4 as independent search models indicates that the crystal contains only the −35 element-binding carboxyl-terminal region 4 of full-length SigR. Mass-spectrometric analysis of the harvested crystal confirms this, suggesting a crystal volume per protein weight (V M) of 2.24 Å3 Da−1 and 45.1% solvent content. PMID:24915084

  9. Two-dimensional time-resolved X-ray diffraction study of liquid/solid fraction and solid particle size in Fe-C binary system with an electrostatic levitator furnace

    NASA Astrophysics Data System (ADS)

    Yonemura, M.; Okada, J.; Watanabe, Y.; Ishikawa, T.; Nanao, S.; Shobu, T.; Toyokawa, H.

    2013-03-01

    Liquid state provides functions such as matter transport or a reaction field and plays an important role in manufacturing processes such as refining, forging or welding. However, experimental procedures are significantly difficult for an observation of solidification process of iron and iron-based alloys in order to identify rapid transformations subjected to fast temperature evolution. Therefore, in order to study the solidification in iron and iron-based alloys, we considered a combination of high energy X-ray diffraction measurements and an electrostatic levitation method (ESL). In order to analyze the liquid/solid fraction, the solidification of melted spherical specimens was measured at a time resolution of 0.1 seconds during rapid cooling using the two-dimensional time-resolved X-ray diffraction. Furthermore, the observation of particle sizes and phase identification was performed on a trial basis using X-ray small angle scattering with X-ray diffraction.

  10. Imaging single cells in a beam of live cyanobacteria with an X-ray laser.

    PubMed

    van der Schot, Gijs; Svenda, Martin; Maia, Filipe R N C; Hantke, Max; DePonte, Daniel P; Seibert, M Marvin; Aquila, Andrew; Schulz, Joachim; Kirian, Richard; Liang, Mengning; Stellato, Francesco; Iwan, Bianca; Andreasson, Jakob; Timneanu, Nicusor; Westphal, Daniel; Almeida, F Nunes; Odic, Dusko; Hasse, Dirk; Carlsson, Gunilla H; Larsson, Daniel S D; Barty, Anton; Martin, Andrew V; Schorb, Sebastian; Bostedt, Christoph; Bozek, John D; Rolles, Daniel; Rudenko, Artem; Epp, Sascha; Foucar, Lutz; Rudek, Benedikt; Hartmann, Robert; Kimmel, Nils; Holl, Peter; Englert, Lars; Duane Loh, Ne-Te; Chapman, Henry N; Andersson, Inger; Hajdu, Janos; Ekeberg, Tomas

    2015-02-11

    There exists a conspicuous gap of knowledge about the organization of life at mesoscopic levels. Ultra-fast coherent diffractive imaging with X-ray free-electron lasers can probe structures at the relevant length scales and may reach sub-nanometer resolution on micron-sized living cells. Here we show that we can introduce a beam of aerosolised cyanobacteria into the focus of the Linac Coherent Light Source and record diffraction patterns from individual living cells at very low noise levels and at high hit ratios. We obtain two-dimensional projection images directly from the diffraction patterns, and present the results as synthetic X-ray Nomarski images calculated from the complex-valued reconstructions. We further demonstrate that it is possible to record diffraction data to nanometer resolution on live cells with X-ray lasers. Extension to sub-nanometer resolution is within reach, although improvements in pulse parameters and X-ray area detectors will be necessary to unlock this potential.

  11. Preliminary designs for X-ray source modifications for the Marshall Space Flight Center's X-ray calibration facility

    NASA Technical Reports Server (NTRS)

    Croft, W. L.

    1986-01-01

    The objective of this investigation is to develop preliminary designs for modifications to the X-ray source of the MSFC X-Ray Calibration Facility. Recommendations are made regarding: (1) the production of an unpolarized X-ray beam, (2) modification of the source to provide characteristic X-rays with energies up to 40 keV, and (3) addition of the capability to calibrate instruments in the extreme ultraviolet wavelength region.

  12. Use of X-ray diffraction technique and chemometrics to aid soil sampling strategies in traceability studies.

    PubMed

    Bertacchini, Lucia; Durante, Caterina; Marchetti, Andrea; Sighinolfi, Simona; Silvestri, Michele; Cocchi, Marina

    2012-08-30

    Aim of this work is to assess the potentialities of the X-ray powder diffraction technique as fingerprinting technique, i.e. as a preliminary tool to assess soil samples variability, in terms of geochemical features, in the context of food geographical traceability. A correct approach to sampling procedure is always a critical issue in scientific investigation. In particular, in food geographical traceability studies, where the cause-effect relations between the soil of origin and the final foodstuff is sought, a representative sampling of the territory under investigation is certainly an imperative. This research concerns a pilot study to investigate the field homogeneity with respect to both field extension and sampling depth, taking also into account the seasonal variability. Four Lambrusco production sites of the Modena district were considered. The X-Ray diffraction spectra, collected on the powder of each soil sample, were treated as fingerprint profiles to be deciphered by multivariate and multi-way data analysis, namely PCA and PARAFAC. The differentiation pattern observed in soil samples, as obtained by this fast and non-destructive analytical approach, well matches with the results obtained by characterization with other costly analytical techniques, such as ICP/MS, GFAAS, FAAS, etc. Thus, the proposed approach furnishes a rational basis to reduce the number of soil samples to be collected for further analytical characterization, i.e. metals content, isotopic ratio of radiogenic element, etc., while maintaining an exhaustive description of the investigated production areas. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

    PubMed Central

    Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

    2008-01-01

    Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

  14. Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee,Y.; Kumar, S.; Jobichen, C.

    2007-01-01

    Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

  15. Luminescent properties under X-ray excitation of Ba(1-x)PbxWO4 disordered solid solution

    NASA Astrophysics Data System (ADS)

    Bakiz, B.; Hallaoui, A.; Taoufyq, A.; Benlhachemi, A.; Guinneton, F.; Villain, S.; Ezahri, M.; Valmalette, J.-C.; Arab, M.; Gavarri, J.-R.

    2018-02-01

    A series of polycrystalline barium-lead tungstate Ba1-xPbxWO4 with 0 ≤ x ≤ 1 was synthesized using a classical solid-state method with thermal treatment at 1000 °C. These materials were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), Fourier Transform Raman (FT-Raman) spectroscopy. X-ray diffraction profile analyses were performed using Rietveld method. These materials crystallized in the scheelite tetragonal structure and behaved as quasi ideal solid solution. Raman spectroscopy confirmed the formation of the solid solution. Structural distortions were evidenced in X-ray diffraction profiles and in vibration Raman spectra. The scanning electron microscopy experiments showed large and rounded irregular grains. Luminescence experiments were performed under X-ray excitation. The luminescence emission profiles have been interpreted in terms of four Gaussian components, with a major contribution of blue emission. The integrated intensity of luminescence reached a maximum value in the composition range x = 0.3-0.6, in relation with distortions of crystal lattice.

  16. Amorphous Phase Characterization Through X-Ray Diffraction Profile Modeling: Implications for Amorphous Phases in Gale Crater Rocks and Soils

    NASA Technical Reports Server (NTRS)

    Achilles, C. N.; Downs, G. W.; Downs, R. T.; Morris, R. V.; Rampe, E. B.; Ming, D. W.; Chipera, S. J.; Blake, D. F.; Vaniman, D. T.; Bristow, T. F.; hide

    2018-01-01

    The CheMin X-ray diffraction instrument on the Mars Science Laboratory rover has analyzed 18 rock and soil samples in Gale crater. Diffraction data allow for the identification of major crystalline phases based on the positions and intensities of well-defined peaks and also provides information regarding amorphous and poorly-ordered materials based on the shape and positions of broad scattering humps. The combination of diffraction data, elemental chemistry from APXS (Alpha Particle X-ray Spectrometer) and evolved gas analyses (EGA) from SAM (Sample Analysis at Mars) help constrain possible amorphous materials present in each sample (e.g., glass, opal, iron oxides, sulfates) but are model dependent. We present a novel method to characterize amorphous material in diffraction data and, through this approach, aim to characterize the phases collectively producing the amorphous profiles in CheMin diffraction data. This method may be applied to any diffraction data from samples containing X-ray amorphous materials, not just CheMin datasets, but we re-strict our discussion to Martian-relevant amorphous phases and diffraction data measured by CheMin or CheMin-like instruments.

  17. Synthesis and physico-chemical characterization of a polysialate-hydroxyapatite composite for potential biomedical application

    NASA Astrophysics Data System (ADS)

    Zoulgami, M.; Lucas-Girot, A.; Michaud, V.; Briard, P.; Gaudé, J.; Oudadesse, H.

    2002-09-01

    New composite materials based on aluminosilicate materials were developed to be used in orthopaedic or maxillo-facial surgery. They are called geopolymers or polysialate-siloxo (PSS) and were studied alone or mixed with hydroxyapatite (HAP). The properties of these materials were investigated for potential use in biological or surgery applications. In this work, the chemistry involved in materials preparation was described. Samples were characterized by some physico-chemical methods like X-ray diffraction (XRD), infrared spectrometry (IR) and electron dispersion X-ray spectrometry (EDX). Results indicate that the mixing hydroxyapatite-geopolymer (PSS) leads to a neutral porous composite material with interesting physico-chemical properties. A preliminary evaluation of its cytotoxicity reveals an harmlessness towards fibroblasts. These properties allow to envisage this association as a potential biomaterial.

  18. Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module from family 64 (StX).

    PubMed

    Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

    2015-03-01

    In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.

  19. X-ray Diffraction, Big and Small

    NASA Image and Video Library

    2012-10-30

    A conventional X-ray diffraction instrument left is the size of a large refrigerator, in contrast to the compact size of the Chemistry and Mineralogy CheMin instrument on NASA Curiosity rover top right.

  20. Coherent diffraction of single Rice Dwarf virus particles using hard X-rays at the Linac Coherent Light Source

    PubMed Central

    Munke, Anna; Andreasson, Jakob; Aquila, Andrew; Awel, Salah; Ayyer, Kartik; Barty, Anton; Bean, Richard J.; Berntsen, Peter; Bielecki, Johan; Boutet, Sébastien; Bucher, Maximilian; Chapman, Henry N.; Daurer, Benedikt J.; DeMirci, Hasan; Elser, Veit; Fromme, Petra; Hajdu, Janos; Hantke, Max F.; Higashiura, Akifumi; Hogue, Brenda G.; Hosseinizadeh, Ahmad; Kim, Yoonhee; Kirian, Richard A.; Reddy, Hemanth K.N.; Lan, Ti-Yen; Larsson, Daniel S.D.; Liu, Haiguang; Loh, N. Duane; Maia, Filipe R.N.C.; Mancuso, Adrian P.; Mühlig, Kerstin; Nakagawa, Atsushi; Nam, Daewoong; Nelson, Garrett; Nettelblad, Carl; Okamoto, Kenta; Ourmazd, Abbas; Rose, Max; van der Schot, Gijs; Schwander, Peter; Seibert, M. Marvin; Sellberg, Jonas A.; Sierra, Raymond G.; Song, Changyong; Svenda, Martin; Timneanu, Nicusor; Vartanyants, Ivan A.; Westphal, Daniel; Wiedorn, Max O.; Williams, Garth J.; Xavier, Paulraj Lourdu; Yoon, Chun Hong; Zook, James

    2016-01-01

    Single particle diffractive imaging data from Rice Dwarf Virus (RDV) were recorded using the Coherent X-ray Imaging (CXI) instrument at the Linac Coherent Light Source (LCLS). RDV was chosen as it is a well-characterized model system, useful for proof-of-principle experiments, system optimization and algorithm development. RDV, an icosahedral virus of about 70 nm in diameter, was aerosolized and injected into the approximately 0.1 μm diameter focused hard X-ray beam at the CXI instrument of LCLS. Diffraction patterns from RDV with signal to 5.9 Ångström were recorded. The diffraction data are available through the Coherent X-ray Imaging Data Bank (CXIDB) as a resource for algorithm development, the contents of which are described here. PMID:27478984

  1. Signal-to-noise and radiation exposure considerations in conventional and diffraction x-ray microscopy

    DOE PAGES

    Huang, Xiaojing; Miao, Huijie; Steinbrener, Jan; ...

    2009-01-01

    Using a signal-to-noise ratio estimation based on correlations between multiple simulated images, we compare the dose efficiency of two soft x-ray imaging systems: incoherent brightfield imaging using zone plate optics in a transmission x-ray microscope (TXM), and x-ray diffraction microscopy (XDM) where an image is reconstructed from the far-field coherent diffraction pattern. In XDM one must computationally phase weak diffraction signals; in TXM one suffers signal losses due to the finite numerical aperture and efficiency of the optics. In simulations with objects representing isolated cells such as yeast, we find that XDM has the potential for delivering equivalent resolution imagesmore » using fewer photons. As a result, this can be an important advantage for studying radiation-sensitive biological and soft matter specimens.« less

  2. Utilizing broadband X-rays in a Bragg coherent X-ray diffraction imaging experiment

    DOE PAGES

    Cha, Wonsuk; Liu, Wenjun; Harder, Ross; ...

    2016-07-26

    A method is presented to simplify Bragg coherent X-ray diffraction imaging studies of complex heterogeneous crystalline materials with a two-stage screening/imaging process that utilizes polychromatic and monochromatic coherent X-rays and is compatible with in situ sample environments. Coherent white-beam diffraction is used to identify an individual crystal particle or grain that displays desired properties within a larger population. A three-dimensional reciprocal-space map suitable for diffraction imaging is then measured for the Bragg peak of interest using a monochromatic beam energy scan that requires no sample motion, thus simplifyingin situchamber design. This approach was demonstrated with Au nanoparticles and will enable,more » for example, individual grains in a polycrystalline material of specific orientation to be selected, then imaged in three dimensions while under load.« less

  3. Coherent diffraction of single Rice Dwarf virus particles using hard X-rays at the Linac Coherent Light Source

    DOE PAGES

    Munke, Anna; Andreasson, Jakob; Aquila, Andrew; ...

    2016-08-01

    Single particle diffractive imaging data from Rice Dwarf Virus (RDV) were recorded using the Coherent X-ray Imaging (CXI) instrument at the Linac Coherent Light Source (LCLS). RDV was chosen as it is a well-characterized model system, useful for proof-of-principle experiments, system optimization and algorithm development. RDV, an icosahedral virus of about 70 nm in diameter, was aerosolized and injected into the approximately 0.1 μm diameter focused hard X-ray beam at the CXI instrument of LCLS. Diffraction patterns from RDV with signal to 5.9 Ångström were recorded. Here, the diffraction data are available through the Coherent X-ray Imaging Data Bank (CXIDB)more » as a resource for algorithm development, the contents of which are described here.« less

  4. Influence of neutron irradiation on the microstructure of nuclear graphite: An X-ray diffraction study

    NASA Astrophysics Data System (ADS)

    Zhou, Z.; Bouwman, W. G.; Schut, H.; van Staveren, T. O.; Heijna, M. C. R.; Pappas, C.

    2017-04-01

    Neutron irradiation effects on the microstructure of nuclear graphite have been investigated by X-ray diffraction on virgin and low doses (∼ 1.3 and ∼ 2.2 dpa), high temperature (750° C) irradiated samples. The diffraction patterns were interpreted using a model, which takes into account the turbostratic disorder. Besides the lattice constants, the model introduces two distinct coherent lengths in the c-axis and the basal plane, that characterise the volumes from which X-rays are scattered coherently. The methodology used in this work allows to quantify the effect of irradiation damage on the microstructure of nuclear graphite seen by X-ray diffraction. The results show that the changes of the deduced structural parameters are in agreement with previous observations from electron microscopy, but not directly related to macroscopic changes.

  5. Utilizing broadband X-rays in a Bragg coherent X-ray diffraction imaging experiment.

    PubMed

    Cha, Wonsuk; Liu, Wenjun; Harder, Ross; Xu, Ruqing; Fuoss, Paul H; Hruszkewycz, Stephan O

    2016-09-01

    A method is presented to simplify Bragg coherent X-ray diffraction imaging studies of complex heterogeneous crystalline materials with a two-stage screening/imaging process that utilizes polychromatic and monochromatic coherent X-rays and is compatible with in situ sample environments. Coherent white-beam diffraction is used to identify an individual crystal particle or grain that displays desired properties within a larger population. A three-dimensional reciprocal-space map suitable for diffraction imaging is then measured for the Bragg peak of interest using a monochromatic beam energy scan that requires no sample motion, thus simplifying in situ chamber design. This approach was demonstrated with Au nanoparticles and will enable, for example, individual grains in a polycrystalline material of specific orientation to be selected, then imaged in three dimensions while under load.

  6. Time-spliced X-ray diffraction imaging of magnetism dynamics in a NdNiO3 thin film

    NASA Astrophysics Data System (ADS)

    Beyerlein, Kenneth R.

    2018-03-01

    Diffraction imaging of nonequilibrium dynamics at atomic resolution is becoming possible with X-ray free-electron lasers. However, there are unresolved problems with applying this method to objects that are confined in only one dimension. Here I show that reliable one-dimensional coherent diffraction imaging is possible by splicing together images recovered from different time delays in an optical pump X-ray probe experiment. The time and space evolution of antiferromagnetic order in a vibrationally excited complex oxide heterostructure is recovered from time-resolved measurements of a resonant soft X-ray diffraction peak. Midinfrared excitation of the substrate is shown to lead to a demagnetization front that propagates at a velocity exceeding the speed of sound, a critical observation for the understanding of driven phase transitions in complex condensed matter.

  7. Coherent diffraction of single Rice Dwarf virus particles using hard X-rays at the Linac Coherent Light Source.

    PubMed

    Munke, Anna; Andreasson, Jakob; Aquila, Andrew; Awel, Salah; Ayyer, Kartik; Barty, Anton; Bean, Richard J; Berntsen, Peter; Bielecki, Johan; Boutet, Sébastien; Bucher, Maximilian; Chapman, Henry N; Daurer, Benedikt J; DeMirci, Hasan; Elser, Veit; Fromme, Petra; Hajdu, Janos; Hantke, Max F; Higashiura, Akifumi; Hogue, Brenda G; Hosseinizadeh, Ahmad; Kim, Yoonhee; Kirian, Richard A; Reddy, Hemanth K N; Lan, Ti-Yen; Larsson, Daniel S D; Liu, Haiguang; Loh, N Duane; Maia, Filipe R N C; Mancuso, Adrian P; Mühlig, Kerstin; Nakagawa, Atsushi; Nam, Daewoong; Nelson, Garrett; Nettelblad, Carl; Okamoto, Kenta; Ourmazd, Abbas; Rose, Max; van der Schot, Gijs; Schwander, Peter; Seibert, M Marvin; Sellberg, Jonas A; Sierra, Raymond G; Song, Changyong; Svenda, Martin; Timneanu, Nicusor; Vartanyants, Ivan A; Westphal, Daniel; Wiedorn, Max O; Williams, Garth J; Xavier, Paulraj Lourdu; Yoon, Chun Hong; Zook, James

    2016-08-01

    Single particle diffractive imaging data from Rice Dwarf Virus (RDV) were recorded using the Coherent X-ray Imaging (CXI) instrument at the Linac Coherent Light Source (LCLS). RDV was chosen as it is a well-characterized model system, useful for proof-of-principle experiments, system optimization and algorithm development. RDV, an icosahedral virus of about 70 nm in diameter, was aerosolized and injected into the approximately 0.1 μm diameter focused hard X-ray beam at the CXI instrument of LCLS. Diffraction patterns from RDV with signal to 5.9 Ångström were recorded. The diffraction data are available through the Coherent X-ray Imaging Data Bank (CXIDB) as a resource for algorithm development, the contents of which are described here.

  8. Time-spliced X-ray diffraction imaging of magnetism dynamics in a NdNiO3 thin film.

    PubMed

    Beyerlein, Kenneth R

    2018-02-27

    Diffraction imaging of nonequilibrium dynamics at atomic resolution is becoming possible with X-ray free-electron lasers. However, there are unresolved problems with applying this method to objects that are confined in only one dimension. Here I show that reliable one-dimensional coherent diffraction imaging is possible by splicing together images recovered from different time delays in an optical pump X-ray probe experiment. The time and space evolution of antiferromagnetic order in a vibrationally excited complex oxide heterostructure is recovered from time-resolved measurements of a resonant soft X-ray diffraction peak. Midinfrared excitation of the substrate is shown to lead to a demagnetization front that propagates at a velocity exceeding the speed of sound, a critical observation for the understanding of driven phase transitions in complex condensed matter.

  9. Electron paramagnetic resonance, scanning electron microscopy with energy dispersion X-ray spectrometry, X-ray powder diffraction, and NMR characterization of iron-rich fired clays.

    PubMed

    Presciutti, Federica; Capitani, Donatella; Sgamellotti, Antonio; Brunetti, Brunetto Giovanni; Costantino, Ferdinando; Viel, Stéphane; Segre, Annalaura

    2005-12-01

    The aim of this study is to clarify the structure of an iron-rich clay and the structural changes involved in the firing process as a preliminary step to get information on ancient ceramic technology. To this purpose, illite-rich clay samples fired at different temperatures were characterized using a multitechnique approach, i.e., by electron paramagnetic resonance, scanning electron microscopy with electron dispersion X-ray spectrometry, X-ray powder diffraction, magic angle spinning and multiple quantum magic angle spinning NMR. During firing, four main reaction processes occur: dehydration, dehydroxylation, structural breakdown, and recrystallization. When the results are combined from all characterization methods, the following conclusions could be obtained. Interlayer H2O is located close to aluminum in octahedral sites and is driven off at temperatures lower than 600 degrees C. Between 600 and 700 degrees C dehydroxylation occurs whereas, between 800 and 900 degrees C, the aluminum in octahedral sites disappears, due to the breakdown of the illite structure, and all iron present is oxidized to Fe3+. In samples fired at 1000 and 1100 degrees C iron clustering was observed as well as large single crystals of iron with the occurrence of ferro- or ferrimagnetic effects. Below 900 degrees C the aluminum in octahedral sites presents a continuous distribution of chemical shift, suggesting the presence of slightly distorted sites. Finally, over the whole temperature range, the presence of at least two tetrahedral aluminum sites was revealed, characterized by different values of the quadrupolar coupling constant.

  10. Cryogenic x-ray diffraction microscopy utilizing high-pressure cryopreservation

    NASA Astrophysics Data System (ADS)

    Lima, Enju; Chushkin, Yuriy; van der Linden, Peter; Kim, Chae Un; Zontone, Federico; Carpentier, Philippe; Gruner, Sol M.; Pernot, Petra

    2014-10-01

    We present cryo x-ray diffraction microscopy of high-pressure-cryofixed bacteria and report high-convergence imaging with multiple image reconstructions. Hydrated D. radiodurans cells were cryofixed at 200 MPa pressure into ˜10-μm-thick water layers and their unstained, hydrated cellular environments were imaged by phasing diffraction patterns, reaching sub-30-nm resolutions with hard x-rays. Comparisons were made with conventional ambient-pressure-cryofixed samples, with respect to both coherent small-angle x-ray scattering and the image reconstruction. The results show a correlation between the level of background ice signal and phasing convergence, suggesting that phasing difficulties with frozen-hydrated specimens may be caused by high-background ice scattering.

  11. Synchrotron X-ray powder diffraction data of LASSBio-1515: A new N-acylhydrazone derivative compound

    NASA Astrophysics Data System (ADS)

    Costa, F. N.; Braz, D.; Ferreira, F. F.; da Silva, T. F.; Barreiro, E. J.; Lima, L. M.; Colaço, M. V.; Kuplich, L.; Barroso, R. C.

    2014-02-01

    In this work, synchrotron X-ray powder diffraction data allowed for a successful indexing of LASSBio-1515 compound, candidate to analgesic and anti-inflammatory activity. X-ray powder diffraction data collected in transmission and high-throughput geometries were used to analyze this compound. The X-ray wavelength of the synchrotron radiation used in this study was determined to be λ=1.55054 Å. LASSBio-1515 was found to be monoclinic with space group P21/c and unit cell parameters a=11.26255(16) Å, b=12.59785(16) Å, c=8.8540(1) Å, β=90.5972(7)° and V=1256.17(3) Å3.

  12. High-speed classification of coherent X-ray diffraction patterns on the K computer for high-resolution single biomolecule imaging.

    PubMed

    Tokuhisa, Atsushi; Arai, Junya; Joti, Yasumasa; Ohno, Yoshiyuki; Kameyama, Toyohisa; Yamamoto, Keiji; Hatanaka, Masayuki; Gerofi, Balazs; Shimada, Akio; Kurokawa, Motoyoshi; Shoji, Fumiyoshi; Okada, Kensuke; Sugimoto, Takashi; Yamaga, Mitsuhiro; Tanaka, Ryotaro; Yokokawa, Mitsuo; Hori, Atsushi; Ishikawa, Yutaka; Hatsui, Takaki; Go, Nobuhiro

    2013-11-01

    Single-particle coherent X-ray diffraction imaging using an X-ray free-electron laser has the potential to reveal the three-dimensional structure of a biological supra-molecule at sub-nanometer resolution. In order to realise this method, it is necessary to analyze as many as 1 × 10(6) noisy X-ray diffraction patterns, each for an unknown random target orientation. To cope with the severe quantum noise, patterns need to be classified according to their similarities and average similar patterns to improve the signal-to-noise ratio. A high-speed scalable scheme has been developed to carry out classification on the K computer, a 10PFLOPS supercomputer at RIKEN Advanced Institute for Computational Science. It is designed to work on the real-time basis with the experimental diffraction pattern collection at the X-ray free-electron laser facility SACLA so that the result of classification can be feedback for optimizing experimental parameters during the experiment. The present status of our effort developing the system and also a result of application to a set of simulated diffraction patterns is reported. About 1 × 10(6) diffraction patterns were successfully classificatied by running 255 separate 1 h jobs in 385-node mode.

  13. High-speed classification of coherent X-ray diffraction patterns on the K computer for high-resolution single biomolecule imaging

    PubMed Central

    Tokuhisa, Atsushi; Arai, Junya; Joti, Yasumasa; Ohno, Yoshiyuki; Kameyama, Toyohisa; Yamamoto, Keiji; Hatanaka, Masayuki; Gerofi, Balazs; Shimada, Akio; Kurokawa, Motoyoshi; Shoji, Fumiyoshi; Okada, Kensuke; Sugimoto, Takashi; Yamaga, Mitsuhiro; Tanaka, Ryotaro; Yokokawa, Mitsuo; Hori, Atsushi; Ishikawa, Yutaka; Hatsui, Takaki; Go, Nobuhiro

    2013-01-01

    Single-particle coherent X-ray diffraction imaging using an X-ray free-electron laser has the potential to reveal the three-dimensional structure of a biological supra-molecule at sub-nanometer resolution. In order to realise this method, it is necessary to analyze as many as 1 × 106 noisy X-ray diffraction patterns, each for an unknown random target orientation. To cope with the severe quantum noise, patterns need to be classified according to their similarities and average similar patterns to improve the signal-to-noise ratio. A high-speed scalable scheme has been developed to carry out classification on the K computer, a 10PFLOPS supercomputer at RIKEN Advanced Institute for Computational Science. It is designed to work on the real-time basis with the experimental diffraction pattern collection at the X-ray free-electron laser facility SACLA so that the result of classification can be feedback for optimizing experimental parameters during the experiment. The present status of our effort developing the system and also a result of application to a set of simulated diffraction patterns is reported. About 1 × 106 diffraction patterns were successfully classificatied by running 255 separate 1 h jobs in 385-node mode. PMID:24121336

  14. Elucidating the Wavelength Dependence of Phonon Scattering in Nanoparticle-Matrix Composites using Phonon Spectroscopy

    DTIC Science & Technology

    2016-07-11

    composites with x - ray diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), Rutherford backscattering spectroscopy...RBS), particle-induced x - ray emission (PIXE), and energy dispersive x - ray spectroscopy (EDX). This work complements earlier works on CdSe...sample shows only In2Se3 and CdIn2Se4 XRD peaks (Figure 1.4e), it is stoichiometrically   Figure 1.4. X - ray diffraction patterns of (a) γ-In2Se3

  15. Applications of High Throughput (Combinatorial) Methodologies to Electronic, Magnetic, Optical, and Energy-Related Materials

    DTIC Science & Technology

    2013-06-17

    of the films without having to fabricate capacitors. In addition, the use of X - ray diffraction (XRD) analysis enabled Chikyow et al.40 to identify an...effects of Al doping and annealing on the thermal stabil- ity of the Y2O3/Si gate stack were studied by X - ray photoemission spectroscopy (XPS) and X - ray ...the major diffraction features in the phase distribution. For a given structural phase, the X - ray peak intensity allows one to track the compositional

  16. Aplanatic and quasi-aplanatic diffraction gratings

    DOEpatents

    Hettrick, M.C.

    1987-09-14

    A reflection diffraction grating having a series of transverse minute grooves of progressively varying spacing along a concave surface enables use of such gratings for x-ray or longer wavelength imaging of objects. The variable groove spacing establishes aplanatism or substantially uniform magnetification across the optical aperture. The grating may be sued, for example, in x-ray microscopes or telescopes of the imaging type and in x-ray microprobed. Increased spatial resolution and field of view may be realized in x-ray imaging. 5 figs.

  17. An instrument for in situ coherent x-ray studies of metal-organic vapor phase epitaxy of III-nitrides

    DOE PAGES

    Ju, Guangxu; Highland, Matthew J.; Yanguas-Gil, Angel; ...

    2017-03-21

    Here, we describe an instrument that exploits the ongoing revolution in synchrotron sources, optics, and detectors to enable in situ studies of metal-organic vapor phase epitaxy (MOVPE) growth of III-nitride materials using coherent x-ray methods. The system includes high-resolution positioning of the sample and detector including full rotations, an x-ray transparent chamber wall for incident and diffracted beam access over a wide angular range, and minimal thermal sample motion, giving the sub-micron positional stability and reproducibility needed for coherent x-ray studies. The instrument enables surface x-ray photon correlation spectroscopy, microbeam diffraction, and coherent diffraction imaging of atomic-scale surface and filmmore » structure and dynamics during growth, to provide fundamental understanding of MOVPE processes.« less

  18. Towards shot-noise limited diffraction experiments with table-top femtosecond hard x-ray sources.

    PubMed

    Holtz, Marcel; Hauf, Christoph; Weisshaupt, Jannick; Salvador, Antonio-Andres Hernandez; Woerner, Michael; Elsaesser, Thomas

    2017-09-01

    Table-top laser-driven hard x-ray sources with kilohertz repetition rates are an attractive alternative to large-scale accelerator-based systems and have found widespread applications in x-ray studies of ultrafast structural dynamics. Hard x-ray pulses of 100 fs duration have been generated at the Cu K α wavelength with a photon flux of up to 10 9 photons per pulse into the full solid angle, perfectly synchronized to the sub-100-fs optical pulses from the driving laser system. Based on spontaneous x-ray emission, such sources display a particular noise behavior which impacts the sensitivity of x-ray diffraction experiments. We present a detailed analysis of the photon statistics and temporal fluctuations of the x-ray flux, together with experimental strategies to optimize the sensitivity of optical pump/x-ray probe experiments. We demonstrate measurements close to the shot-noise limit of the x-ray source.

  19. Towards shot-noise limited diffraction experiments with table-top femtosecond hard x-ray sources

    PubMed Central

    Holtz, Marcel; Hauf, Christoph; Weisshaupt, Jannick; Salvador, Antonio-Andres Hernandez; Woerner, Michael; Elsaesser, Thomas

    2017-01-01

    Table-top laser-driven hard x-ray sources with kilohertz repetition rates are an attractive alternative to large-scale accelerator-based systems and have found widespread applications in x-ray studies of ultrafast structural dynamics. Hard x-ray pulses of 100 fs duration have been generated at the Cu Kα wavelength with a photon flux of up to 109 photons per pulse into the full solid angle, perfectly synchronized to the sub-100-fs optical pulses from the driving laser system. Based on spontaneous x-ray emission, such sources display a particular noise behavior which impacts the sensitivity of x-ray diffraction experiments. We present a detailed analysis of the photon statistics and temporal fluctuations of the x-ray flux, together with experimental strategies to optimize the sensitivity of optical pump/x-ray probe experiments. We demonstrate measurements close to the shot-noise limit of the x-ray source. PMID:28795079

  20. Crystallization and preliminary X-ray characterization of arylamine N-acetyltransferase C (BanatC) from Bacillus anthracis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pluvinage, Benjamin; Li de la Sierra-Gallay, Inés; Martins, Marta

    2007-10-01

    Bacillus anthracis arylamine N-acetyltransferase C (BanatC) is an enzyme that metabolizes the drug sulfamethoxazole. Crystals of the purified enzyme that diffract at 1.95 Å are reported. The arylamine N-acetyltransferase (NAT) enzymes are xenobiotic metabolizing enzymes that have been found in a large range of eukaryotes and prokaryotes. These enzymes catalyse the acetylation of arylamine drugs and/or pollutants. Recently, a Bacillus anthracis NAT isoform (BanatC) has been cloned and shown to acetylate the sulfonamide antimicrobial sulfamethoxazole (SMX). Subsequently, it was shown that BanatC contributes to the resistance of this bacterium to SMX. Here, the crystallization and the X-ray characterization of BanatCmore » (Y38F mutant) are reported. The crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 53.70, c = 172.40 Å, and diffract to 1.95 Å resolution on a synchrotron source.« less

  1. Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

    Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

  2. Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Logsdon, Naomi J.; Allen, Christopher E.; Rajashankar, Kanagalaghatta R.

    2012-02-08

    Interleukin-20 (IL-20) is an IL-10-family cytokine that regulates innate and adaptive immunity in skin and other tissues. In addition to protecting the host from various external pathogens, dysregulated IL-20 signaling has been shown to contribute to the pathogenesis of human psoriasis. IL-20 signals through two cell-surface receptor heterodimers, IL-20R1-IL-20R2 and IL-22R1-IL-20R2. In this report, crystals of the IL-20-IL-20R1-IL-20R2 ternary complex have been grown from polyethylene glycol solutions. The crystals belonged to space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = 111, c = 135 {angstrom}, and diffracted X-rays to 3 {angstrom} resolution. The crystallographic asymmetricmore » unit contains one IL-20-IL-20R1-IL-20R2 complex, corresponding to a solvent content of approximately 54%.« less

  3. Solvent and temperature effects on crambin, a hydrophobic protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Llinas, M.; Lecomte, J.T.J.; De Marco, A.

    1980-10-01

    Crambin, a 5000-mol. wt. water-insoluble protein found in crambe abyssinica seeds is presently being studied by x-ray diffraction to 0.9 A resolution and /sup 1/H-nuclear magnetic resonance (NMR) spectroscopy. Preliminary /sup 1/H-NMR data at 250 and 600 MHz have suggested that this hydrophobic protein retains a similar globular conformation in both glacial acetic acid (AA), a Bronsted acid, and dimethylformamide (DMF), a Lewis base. These observations suggest that the globular conformation observed in these organic solvents is most likely the native structure present in the crystalline state. As suggested by the high intrinsic resolution of the crystallographic x-ray diffraction pattern,more » and demonstrated by the NMR data, crambin is a very rigid protein. Work is in progress to assign the /sup 1/H-resonances and to correlate H and /sup 13/C NMR dynamic data with the crystallographic model. It is hoped that unravelling conformational features of this hydrophobic protein will provide clues to help us understand other membrane-bound functional proteins.« less

  4. Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

    2005-08-01

    This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

  5. Preliminary crystallographic analysis of avian infectious bronchitis virus main protease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jun; Shen, Wei; Liao, Ming, E-mail: mliao@scau.edu.cn

    The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed inmore » Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.« less

  6. X-ray shearing interferometer

    DOEpatents

    Koch, Jeffrey A [Livermore, CA

    2003-07-08

    An x-ray interferometer for analyzing high density plasmas and optically opaque materials includes a point-like x-ray source for providing a broadband x-ray source. The x-rays are directed through a target material and then are reflected by a high-quality ellipsoidally-bent imaging crystal to a diffraction grating disposed at 1.times. magnification. A spherically-bent imaging crystal is employed when the x-rays that are incident on the crystal surface are normal to that surface. The diffraction grating produces multiple beams which interfere with one another to produce an interference pattern which contains information about the target. A detector is disposed at the position of the image of the target produced by the interfering beams.

  7. Symposium N: Materials and Devices for Thermal-to-Electric Energy Conversion

    DTIC Science & Technology

    2010-08-24

    X - ray diffraction, transmission electron microscopy, scanning electron microscopy, and dynamic light scattering. Thermal conductivity measurements...SEM), X - ray diffraction (XRD) measurements as well as Raman spectroscopy. The results from these techniques indicate a clear modification...was examined by using scanning electron microscope (SEM; HITACHI S-4500 model) attached with an energy dispersive x - ray spectroscopy. The electrical

  8. Structural Transitions in Nanosized Zn0.97Al0.03O Powders under High Pressure Analyzed by in Situ Angle-Dispersive X-ray Diffraction

    PubMed Central

    Lin, Chih-Ming; Liu, Hsin-Tzu; Zhong, Shi-Yao; Hsu, Chia-Hung; Chiu, Yi-Te; Tai, Ming-Fong; Juang, Jenh-Yih; Chuang, Yu-Chun; Liao, Yen-Fa

    2016-01-01

    Nanosized aluminum-doped zinc oxide Zn1−xAlxO (AZO) powders (AZO-NPs) with x = 0.01, 0.03, 0.06, 0.09 and 0.11 were synthesized by chemical precipitation method. The thermogravimetric analysis (TGA) indicated that the precursors were converted to oxides from hydroxides near 250 °C, which were then heated to 500 °C for subsequent thermal processes to obtain preliminary powders. The obtained preliminary powders were then calcined at 500 °C for three hours. The structure and morphology of the products were measured and characterized by angle-dispersive X-ray diffraction (ADXRD) and scanning electron microscopy (SEM). ADXRD results showed that AZO-NPs with Al content less than 11% exhibited würtzite zinc oxide structure and there was no other impurity phase in the AZO-NPs, suggesting substitutional doping of Al on Zn sites. The Zn0.97Al0.03O powders (A3ZO-NPs) with grain size of about 21.4 nm were used for high-pressure measurements. The in situ ADXRD measurements revealed that, for loading run, the pressure-induced würtzite (B4)-to-rocksalt (B1) structural phase transition began at 9.0(1) GPa. Compared to the predicted phase-transition pressure of ~12.7 GPa for pristine ZnO nanocrystals of similar grain size (~21.4 nm), the transition pressure for the present A3ZO-NPs exhibited a reduction of ~3.7 GPa. The significant reduction in phase-transition pressure is attributed to the effects of highly selective site occupation, namely Zn2+ and Al3+, were mainly found in tetrahedral and octahedral sites, respectively. PMID:28773683

  9. In situ electrochemical high-energy X-ray diffraction using a capillary working electrode cell geometry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Young, Matthias J.; Bedford, Nicholas M.; Jiang, Naisheng

    The ability to generate new electrochemically active materials for energy generation and storage with improved properties will likely be derived from an understanding of atomic-scale structure/function relationships during electrochemical events. Here, the design and implementation of a new capillary electrochemical cell designed specifically forin situhigh-energy X-ray diffraction measurements is described. By increasing the amount of electrochemically active material in the X-ray path while implementing low-Zcell materials with anisotropic scattering profiles, an order of magnitude enhancement in diffracted X-ray signal over traditional cell geometries for multiple electrochemically active materials is demonstrated. This signal improvement is crucial for high-energy X-ray diffraction measurementsmore » and subsequent Fourier transformation into atomic pair distribution functions for atomic-scale structural analysis. As an example, clear structural changes in LiCoO 2under reductive and oxidative conditions using the capillary cell are demonstrated, which agree with prior studies. Accurate modeling of the LiCoO 2diffraction data using reverse Monte Carlo simulations further verifies accurate background subtraction and strong signal from the electrochemically active material, enabled by the capillary working electrode geometry.« less

  10. In Situ 3D Coherent X-ray Diffraction Imaging of Shock Experiments: Possible?

    NASA Astrophysics Data System (ADS)

    Barber, John

    2011-03-01

    In traditional coherent X-ray diffraction imaging (CXDI), a 2D or quasi-2D object is illuminated by a beam of coherent X-rays to produce a diffraction pattern, which is then manipulated via a process known as iterative phase retrieval to reconstruct an image of the original 2D sample. Recently, there have been dramatic advances in methods for performing fully 3D CXDI of a sample from a single diffraction pattern [Raines et al, Nature 463 214-7 (2010)], and these methods have been used to image samples tens of microns in size using soft X-rays. In this work, I explore the theoretical possibility of applying 3D CXDI techniques to the in situ imaging of the interaction between a shock front and a polycrystal, a far more stringent problem. A delicate trade-off is required between photon energy, spot size, imaging resolution, and the dimensions of the experimental setup. In this talk, I will outline the experimental and computational requirements for performing such an experiment, and I will present images and movies from simulations of one such hypothetical experiment, including both the time-resolved X-ray diffraction patterns and the time-resolved sample imagery.

  11. High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

    DOEpatents

    Smither, Robert K [Hinsdale, IL

    2011-05-17

    A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

  12. Photoluminescence studies on Cd(1-x)Zn(x)S:Mn2+ nanocrystals.

    PubMed

    Sethi, Ruchi; Kumar, Lokendra; Pandey, A C

    2009-09-01

    Highly monodispersed, undoped and doped with Mn2+, binary and ternary (CdS, ZnS, Cd(1-x)Zn(x)S) compound semiconductor nanocrystals have been synthesized by co-precipitation method using citric acid as a stabilizer. As prepared sample are characterized by X-ray diffraction, Small angle X-ray scattering, Transmission electron microscope, Optical absorption and Photoluminescence spectroscopy, for their optical and structural properties. X-ray diffraction, Small angle X-ray scattering and Transmission electron microscope results confirm the preparation of monodispersed nanocrystals. Photoluminescence studies show a significant blue shift in the wavelength with an increasing concentration of Zn in alloy nanocrystals.

  13. Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry.

    PubMed

    Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

    2017-04-01

    X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La 3 Ga 5 SiO 14 ) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space-time modulation of an X-ray beam.

  14. Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry1

    PubMed Central

    Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

    2017-01-01

    X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La3Ga5SiO14) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space–time modulation of an X-ray beam. PMID:28381976

  15. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  16. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  17. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of macrophage growth locus A (MglA) protein from Francisella tularensis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Subburaman, P.; Austin, B.P.; Shaw, G.X.

    2010-11-03

    Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.

  18. Dependence of magnetic permeability on residual stresses in alloyed steels

    NASA Astrophysics Data System (ADS)

    Hristoforou, E.; Ktena, A.; Vourna, P.; Argiris, K.

    2018-04-01

    A method for the monitoring of residual stress distribution in steels has been developed based on non-destructive surface magnetic permeability measurements. In order to investigate the potential utilization of the magnetic method in evaluating residual stresses, the magnetic calibration curves of various ferromagnetic alloyed steels' grade (AISI 4140, TRIP and Duplex) were examined. X-Ray diffraction technique was used for determining surface residual stress values. The overall measurement results have shown that the residual stress determined by the magnetic method was in good agreement with the diffraction results. Further experimental investigations are required to validate the preliminary results and to verify the presence of a unique normalized magnetic stress calibration curve.

  19. Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony

    2006-03-01

    A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less

  20. Method for improving x-ray diffraction determinations of residual stress in nickel-base alloys

    DOEpatents

    Berman, R.M.; Cohen, I.

    1988-04-26

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys is discussed. Part of a predetermined area of the surface of a nickel-base alloy is covered with a dispersion. This exposes the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose, since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample. 2 figs.

  1. Dynamic x-ray imaging of laser-driven nanoplasmas

    NASA Astrophysics Data System (ADS)

    Fennel, Thomas

    2016-05-01

    A major promise of current x-ray science at free electron lasers is the realization of unprecedented imaging capabilities for resolving the structure and ultrafast dynamics of matter with nanometer spatial and femtosecond temporal resolution or even below via single-shot x-ray diffraction. Laser-driven atomic clusters and nanoparticles provide an ideal platform for developing and demonstrating the required technology to extract the ultrafast transient spatiotemporal dynamics from the diffraction images. In this talk, the perspectives and challenges of dynamic x-ray imaging will be discussed using complete self-consistent microscopic electromagnetic simulations of IR pump x-ray probe imaging for the example of clusters. The results of the microscopic particle-in-cell simulations (MicPIC) enable the simulation-assisted reconstruction of corresponding experimental data. This capability is demonstrated by converting recently measured LCLS data into a ultrahigh resolution movie of laser-induced plasma expansion. Finally, routes towards reaching attosecond time resolution in the visualization of complex dynamical processes in matter by x-ray diffraction will be discussed.

  2. Infrastructure development for radioactive materials at the NSLS-II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sprouster, D. J.; Weidner, R.; Ghose, S. K.

    2018-02-01

    The X-ray Powder Diffraction (XPD) Beamline at the National Synchrotron Light Source-II is a multipurpose instrument designed for high-resolution, high-energy X-ray scattering techniques. In this article, the capabilities, opportunities and recent developments in the characterization of radioactive materials at XPD are described. The overarching goal of this work is to provide researchers access to advanced synchrotron techniques suited to the structural characterization of materials for advanced nuclear energy systems. XPD is a new beamline providing high photon flux for X-ray Diffraction, Pair Distribution Function analysis and Small Angle X-ray Scattering. The infrastructure and software described here extend the existing capabilitiesmore » at XPD to accommodate radioactive materials. Such techniques will contribute crucial information to the characterization and quantification of advanced materials for nuclear energy applications. We describe the automated radioactive sample collection capabilities and recent X-ray Diffraction and Small Angle X-ray Scattering results from neutron irradiated reactor pressure vessel steels and oxide dispersion strengthened steels.« less

  3. Infrastructure development for radioactive materials at the NSLS-II

    DOE PAGES

    Sprouster, David J.; Weidner, R.; Ghose, S. K.; ...

    2017-11-04

    The X-ray Powder Diffraction (XPD) Beamline at the National Synchrotron Light Source-II is a multipurpose instrument designed for high-resolution, high-energy X-ray scattering techniques. In this paper, the capabilities, opportunities and recent developments in the characterization of radioactive materials at XPD are described. The overarching goal of this work is to provide researchers access to advanced synchrotron techniques suited to the structural characterization of materials for advanced nuclear energy systems. XPD is a new beamline providing high photon flux for X-ray Diffraction, Pair Distribution Function analysis and Small Angle X-ray Scattering. The infrastructure and software described here extend the existing capabilitiesmore » at XPD to accommodate radioactive materials. Such techniques will contribute crucial information to the characterization and quantification of advanced materials for nuclear energy applications. Finally, we describe the automated radioactive sample collection capabilities and recent X-ray Diffraction and Small Angle X-ray Scattering results from neutron irradiated reactor pressure vessel steels and oxide dispersion strengthened steels.« less

  4. Preliminary X-ray crystallographic studies of BthTX-II, a myotoxic Asp49-phospholipase A{sub 2} with low catalytic activity from Bothrops jararacussu venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Corrêa, L. C.; Marchi-Salvador, D. P.; Cintra, A. C. O.

    2006-08-01

    A myotoxic Asp49-PLA{sub 2} with low catalytic activity from B. jararacussu (BthTX-II) was crystallized in the monoclinic crystal system; a complete X-ray diffraction data set was collected and a molecular-replacement solution was obtained. The oligomeric structure of BthTX-II resembles those of the Asp49-PLA{sub 2} PrTX-III and all bothropic Lys49-PLA{sub 2}s. For the first time, a complete X-ray diffraction data set has been collected from a myotoxic Asp49-phospholipase A{sub 2} (Asp49-PLA{sub 2}) with low catalytic activity (BthTX-II from Bothrops jararacussu venom) and a molecular-replacement solution has been obtained with a dimer in the asymmetric unit. The quaternary structure of BthTX-II resemblesmore » the myotoxin Asp49-PLA{sub 2} PrTX-III (piratoxin III from B. pirajai venom) and all non-catalytic and myotoxic dimeric Lys49-PLA{sub 2}s. In contrast, the oligomeric structure of BthTX-II is different from the highly catalytic and non-myotoxic BthA-I (acidic PLA{sub 2} from B. jararacussu). Thus, comparison between these structures should add insight into the catalytic and myotoxic activities of bothropic PLA{sub 2}s.« less

  5. Illicit drug detection using energy dispersive x-ray diffraction

    NASA Astrophysics Data System (ADS)

    Cook, E. J.; Griffiths, J. A.; Koutalonis, M.; Gent, C.; Pani, S.; Horrocks, J. A.; George, L.; Hardwick, S.; Speller, R.

    2009-05-01

    Illicit drugs are imported into countries in myriad ways, including via the postal system and courier services. An automated system is required to detect drugs in parcels for which X-ray diffraction is a suitable technique as it is non-destructive, material specific and uses X-rays of sufficiently high energy to penetrate parcels containing a range of attenuating materials. A database has been constructed containing the measured powder diffraction profiles of several thousand materials likely to be found in parcels. These include drugs, cutting agents, packaging and other innocuous materials. A software model has been developed using these data to predict the diffraction profiles which would be obtained by X-ray diffraction systems with a range of suggested detector (high purity germanium, CZT and scintillation), source and collimation options. The aim of the model was to identify the most promising system geometries, which was done with the aid of multivariate analysis (MVA). The most promising systems were constructed and tested. The diffraction profiles of a range of materials have been measured and used to both validate the model and to identify the presence of drugs in sample packages.

  6. Wavefront aberrations of x-ray dynamical diffraction beams.

    PubMed

    Liao, Keliang; Hong, Youli; Sheng, Weifan

    2014-10-01

    The effects of dynamical diffraction in x-ray diffractive optics with large numerical aperture render the wavefront aberrations difficult to describe using the aberration polynomials, yet knowledge of them plays an important role in a vast variety of scientific problems ranging from optical testing to adaptive optics. Although the diffraction theory of optical aberrations was established decades ago, its application in the area of x-ray dynamical diffraction theory (DDT) is still lacking. Here, we conduct a theoretical study on the aberration properties of x-ray dynamical diffraction beams. By treating the modulus of the complex envelope as the amplitude weight function in the orthogonalization procedure, we generalize the nonrecursive matrix method for the determination of orthonormal aberration polynomials, wherein Zernike DDT and Legendre DDT polynomials are proposed. As an example, we investigate the aberration evolution inside a tilted multilayer Laue lens. The corresponding Legendre DDT polynomials are obtained numerically, which represent balanced aberrations yielding minimum variance of the classical aberrations of an anamorphic optical system. The balancing of classical aberrations and their standard deviations are discussed. We also present the Strehl ratio of the primary and secondary balanced aberrations.

  7. Langmuir-Blodgett films of random copolymers of fluoroalkyl(meth)acrylate and methacrylic acid: Fabrication and X-ray diffraction study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Safronov, V.; Feigin, L.A.; Budovskaya, L.D.

    1994-12-31

    Langmuir-Blodgett films of amphiphilic fluorinated copolymers were fabricated and studied by X-ray diffraction. Although these films show poor interlayer periodicity, they possess a uniform thickness even in the case of very thin films of one bilayer (22 {angstrom}). This feature was used to obtain complex LB structures (superlattices) with alteration of copolymer and fatty acid bilayers. X-ray diffraction data proved the regular periodical organization of these structures and allowed to calculate electron density distribution across the superlattices.

  8. Simulating Picosecond X-ray Diffraction from shocked crystals by Post-processing Molecular Dynamics Calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kimminau, G; Nagler, B; Higginbotham, A

    2008-06-19

    Calculations of the x-ray diffraction patterns from shocked crystals derived from the results of Non-Equilibrium-Molecular-Dynamics (NEMD) simulations are presented. The atomic coordinates predicted by the NEMD simulations combined with atomic form factors are used to generate a discrete distribution of electron density. A Fast-Fourier-Transform (FFT) of this distribution provides an image of the crystal in reciprocal space, which can be further processed to produce quantitative simulated data for direct comparison with experiments that employ picosecond x-ray diffraction from laser-irradiated crystalline targets.

  9. Framework for three-dimensional coherent diffraction imaging by focused beam x-ray Bragg ptychography.

    PubMed

    Hruszkewycz, Stephan O; Holt, Martin V; Tripathi, Ash; Maser, Jörg; Fuoss, Paul H

    2011-06-15

    We present the framework for convergent beam Bragg ptychography, and, using simulations, we demonstrate that nanocrystals can be ptychographically reconstructed from highly convergent x-ray Bragg diffraction. The ptychographic iterative engine is extended to three dimensions and shown to successfully reconstruct a simulated nanocrystal using overlapping raster scans with a defocused curved beam, the diameter of which matches the crystal size. This object reconstruction strategy can serve as the basis for coherent diffraction imaging experiments at coherent scanning nanoprobe x-ray sources.

  10. Full-aperture x-ray tests of Kirkpatrick-Baez modules: preliminary results

    NASA Astrophysics Data System (ADS)

    Pina, L.; Marsikova, V.; Hudec, R.; Inneman, A.; Marsik, J.; Cash, W.; Shipley, A.; Zeiger, B.

    2011-05-01

    We report on preliminary results of full aperture X-ray optical tests at the X-ray test facility at the University of Colorado (USA) of four test modules of Kirkpatrick-Baez (KB) X-ray optical systems performed in August 2010. Direct experimental comparisons were made between gold-coated optics of two novel substrates: glass foils and silicon wafers. The preliminary results are promising, with full-width half-maxima of full stacks being of order of 30 arcsec in 2D full arrangement. These results justify further efforts to improve KB optics for use in low-cost, high-performance space-borne astronomical imaging instruments for X-ray wavelengths.

  11. Purification, crystallization and preliminary X-ray studies of human augmenter of liver regeneration.

    PubMed

    Ji, Chao-Neng; Cai, Zai-Long; Cao, Gen-Tao; Yin, Gang; Jiao, Bing-Hua; Jiang, Tao; Shu, Guang; Mao, Ji-Fang; Xie, Yi; Mao, Yu-Min

    2002-12-01

    Human augmenter of liver regeneration has been expressed in Escherichia coli, purified and crystallized. The crystals belong to space group C222, with unit-cell parameters a=51.7 A, b=78.8 A, c=63.7 A. Diffraction data were collected to 2.80 A with a completeness of 99.9% (99.9% for the last shell), a R(sym) value of 0.092(0.236) and an I/sigma(I) value of 6.2(2.7).

  12. Three-dimensional imaging of nanoscale materials by using coherent x-rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miao, Jianwei

    X-ray crystallography is currently the primary methodology used to determine the 3D structure of materials and macromolecules. However, many nanostructures, disordered materials, biomaterials, hybrid materials and biological specimens are noncrystalline and, hence, their structures are not accessible by X-ray crystallography. Probing these structures therefore requires the employment of different approaches. A very promising technique currently under rapid development is X-ray diffraction microscopy (or lensless imaging), in which the coherent X-ray diffraction pattern of a noncrystalline specimen is measured and then directly phased to obtain a high-resolution image. Through the DOE support over the past three years, we have applied X-raymore » diffraction microscopy to quantitative imaging of GaN quantum dot particles, and revealed the internal GaN-Ga2O3 core shell structure in three dimensions. By exploiting the abrupt change in the scattering cross-section near electronic resonances, we carried out the first experimental demonstration of resonant X-ray diffraction microscopy for element specific imaging. We performed nondestructive and quantitative imaging of buried Bi structures inside a Si crystal by directly phasing coherent X-ray diffraction patterns acquired below and above the Bi M5 edge. We have also applied X-ray diffraction microscopy to nondestructive imaging of mineral crystals inside biological composite materials - intramuscular fish bone - at the nanometer scale resolution. We identified mineral crystals in collagen fibrils at different stages of mineralization and proposed a dynamic mechanism to account for the nucleation and growth of mineral crystals in the collagen matrix. In addition, we have also discovered a novel 3D imaging modality, denoted ankylography, which allows for complete 3D structure determination without the necessity of sample titling or scanning. We showed that when the diffraction pattern of a finite object is sampled at a sufficiently fine scale on the Ewald sphere, the 3D structure of the object is determined by the 2D spherical pattern. We confirmed the theoretical analysis by performing 3D numerical reconstructions of a sodium silicate glass structure at 2 A resolution from a 2D spherical diffraction pattern alone. As X-ray free electron lasers are under rapid development worldwide, ankylography may open up a new horizon to obtain the 3D structure of a non-crystalline specimen from a single pulse and allow time-resolved 3D structure determination of disordered materials.« less

  13. Microfluidic Chips for In Situ Crystal X-ray Diffraction and In Situ Dynamic Light Scattering for Serial Crystallography.

    PubMed

    Gicquel, Yannig; Schubert, Robin; Kapis, Svetlana; Bourenkov, Gleb; Schneider, Thomas; Perbandt, Markus; Betzel, Christian; Chapman, Henry N; Heymann, Michael

    2018-04-24

    This protocol describes fabricating microfluidic devices with low X-ray background optimized for goniometer based fixed target serial crystallography. The devices are patterned from epoxy glue using soft lithography and are suitable for in situ X-ray diffraction experiments at room temperature. The sample wells are lidded on both sides with polymeric polyimide foil windows that allow diffraction data collection with low X-ray background. This fabrication method is undemanding and inexpensive. After the sourcing of a SU-8 master wafer, all fabrication can be completed outside of a cleanroom in a typical research lab environment. The chip design and fabrication protocol utilize capillary valving to microfluidically split an aqueous reaction into defined nanoliter sized droplets. This loading mechanism avoids the sample loss from channel dead-volume and can easily be performed manually without using pumps or other equipment for fluid actuation. We describe how isolated nanoliter sized drops of protein solution can be monitored in situ by dynamic light scattering to control protein crystal nucleation and growth. After suitable crystals are grown, complete X-ray diffraction datasets can be collected using goniometer based in situ fixed target serial X-ray crystallography at room temperature. The protocol provides custom scripts to process diffraction datasets using a suite of software tools to solve and refine the protein crystal structure. This approach avoids the artefacts possibly induced during cryo-preservation or manual crystal handling in conventional crystallography experiments. We present and compare three protein structures that were solved using small crystals with dimensions of approximately 10-20 µm grown in chip. By crystallizing and diffracting in situ, handling and hence mechanical disturbances of fragile crystals is minimized. The protocol details how to fabricate a custom X-ray transparent microfluidic chip suitable for in situ serial crystallography. As almost every crystal can be used for diffraction data collection, these microfluidic chips are a very efficient crystal delivery method.

  14. Characterization of X-Ray Diffraction System with a Microfocus X-Ray Source and a Polycapillary Optic

    NASA Technical Reports Server (NTRS)

    Gubarev, Mikhail; Marshall, Joy K.; Ciszak, Ewa; Ponomarev, Igor

    2000-01-01

    We present here an optimized microfocus x-ray source and polycapillary optic system designed for diffraction of small protein crystals. The x-ray beam is formed by a 5.5mm focal length capillary collimator coupled with a 40 micron x-ray source operating at 46Watts. Measurements of the x-ray flux, the divergence and the spectral characteristics of the beam are presented, This optimized system provides a seven fold greater flux than our recently reported configuration [M. Gubarev, et al., J. of Applied Crystallography (2000) 33, in press]. We now make a comparison with a 5kWatts rotating anode generator (Rigaku) coupled with confocal multilayer focusing mirrors (Osmic, CMF12- 38Cu6). The microfocus x-ray source and polycapillary collimator system delivers 60% of the x-ray flux from the rotating anode system. Additional ways to improve our microfocus x-ray system, and thus increase the x-ray flux will be discussed.

  15. Specimen preparation for cryogenic coherent X-ray diffraction imaging of biological cells and cellular organelles by using the X-ray free-electron laser at SACLA

    PubMed Central

    Kobayashi, Amane; Sekiguchi, Yuki; Oroguchi, Tomotaka; Okajima, Koji; Fukuda, Asahi; Oide, Mao; Yamamoto, Masaki; Nakasako, Masayoshi

    2016-01-01

    Coherent X-ray diffraction imaging (CXDI) allows internal structures of biological cells and cellular organelles to be analyzed. CXDI experiments have been conducted at 66 K for frozen-hydrated biological specimens at the SPring-8 Angstrom Compact Free-Electron Laser facility (SACLA). In these cryogenic CXDI experiments using X-ray free-electron laser (XFEL) pulses, specimen particles dispersed on thin membranes of specimen disks are transferred into the vacuum chamber of a diffraction apparatus. Because focused single XFEL pulses destroy specimen particles at the atomic level, diffraction patterns are collected through raster scanning the specimen disks to provide fresh specimen particles in the irradiation area. The efficiency of diffraction data collection in cryogenic experiments depends on the quality of the prepared specimens. Here, detailed procedures for preparing frozen-hydrated biological specimens, particularly thin membranes and devices developed in our laboratory, are reported. In addition, the quality of the frozen-hydrated specimens are evaluated by analyzing the characteristics of the collected diffraction patterns. Based on the experimental results, the internal structures of the frozen-hydrated specimens and the future development for efficient diffraction data collection are discussed. PMID:27359147

  16. Specimen preparation for cryogenic coherent X-ray diffraction imaging of biological cells and cellular organelles by using the X-ray free-electron laser at SACLA.

    PubMed

    Kobayashi, Amane; Sekiguchi, Yuki; Oroguchi, Tomotaka; Okajima, Koji; Fukuda, Asahi; Oide, Mao; Yamamoto, Masaki; Nakasako, Masayoshi

    2016-07-01

    Coherent X-ray diffraction imaging (CXDI) allows internal structures of biological cells and cellular organelles to be analyzed. CXDI experiments have been conducted at 66 K for frozen-hydrated biological specimens at the SPring-8 Angstrom Compact Free-Electron Laser facility (SACLA). In these cryogenic CXDI experiments using X-ray free-electron laser (XFEL) pulses, specimen particles dispersed on thin membranes of specimen disks are transferred into the vacuum chamber of a diffraction apparatus. Because focused single XFEL pulses destroy specimen particles at the atomic level, diffraction patterns are collected through raster scanning the specimen disks to provide fresh specimen particles in the irradiation area. The efficiency of diffraction data collection in cryogenic experiments depends on the quality of the prepared specimens. Here, detailed procedures for preparing frozen-hydrated biological specimens, particularly thin membranes and devices developed in our laboratory, are reported. In addition, the quality of the frozen-hydrated specimens are evaluated by analyzing the characteristics of the collected diffraction patterns. Based on the experimental results, the internal structures of the frozen-hydrated specimens and the future development for efficient diffraction data collection are discussed.

  17. Emerging opportunities in structural biology with X-ray free-electron lasers

    PubMed Central

    Schlichting, Ilme; Miao, Jianwei

    2012-01-01

    X-ray free-electron lasers (X-FELs) produce X-ray pulses with extremely brilliant peak intensity and ultrashort pulse duration. It has been proposed that radiation damage can be “outrun” by using an ultra intense and short X-FEL pulse that passes a biological sample before the onset of significant radiation damage. The concept of “diffraction-before-destruction” has been demonstrated recently at the Linac Coherent Light Source, the first operational hard X-ray FEL, for protein nanocrystals and giant virus particles. The continuous diffraction patterns from single particles allow solving the classical “phase problem” by the oversampling method with iterative algorithms. If enough data are collected from many identical copies of a (biological) particle, its three-dimensional structure can be reconstructed. We review the current status and future prospects of serial femtosecond crystallography (SFX) and single-particle coherent diffraction imaging (CDI) with X-FELs. PMID:22922042

  18. Publications - GMC 58 | Alaska Division of Geological & Geophysical Surveys

    Science.gov Websites

    DGGS GMC 58 Publication Details Title: X-ray diffraction and scanning electron microscopy mineral , Michael, and Core Laboratories, 1985, X-ray diffraction and scanning electron microscopy mineral analyses

  19. Observation of divergent-beam X-ray diffraction from a crystal of diamond using synchrotron radiation.

    PubMed

    Glazer, A M; Collins, S P; Zekria, D; Liu, J; Golshan, M

    2004-03-01

    In 1947 Kathleen Lonsdale conducted a series of experiments on X-ray diffraction using a divergent beam external to a crystal sample. Unlike the Kossel technique, where divergent X-rays are excited by the presence of fluorescing atoms within the crystal, the use of an external divergent source made it possible to study non-fluorescing crystals. The resulting photographs not only illustrated the complexity of X-ray diffraction from crystals in a truly beautiful way, but also demonstrated unprecedented experimental precision. This long-forgotten work is repeated here using a synchrotron radiation source and, once again, considerable merit is found in Lonsdale's technique. The results of this experiment suggest that, through the use of modern 'third-generation' synchrotron sources, divergent-beam diffraction could soon enjoy a renaissance for high-precision lattice-parameter determination and the study of crystal perfection.

  20. Soft X-ray spectromicroscopy using ptychography with randomly phased illumination

    NASA Astrophysics Data System (ADS)

    Maiden, A. M.; Morrison, G. R.; Kaulich, B.; Gianoncelli, A.; Rodenburg, J. M.

    2013-04-01

    Ptychography is a form of scanning diffractive imaging that can successfully retrieve the modulus and phase of both the sample transmission function and the illuminating probe. An experimental difficulty commonly encountered in diffractive imaging is the large dynamic range of the diffraction data. Here we report a novel ptychographic experiment using a randomly phased X-ray probe to considerably reduce the dynamic range of the recorded diffraction patterns. Images can be reconstructed reliably and robustly from this setup, even when scatter from the specimen is weak. A series of ptychographic reconstructions at X-ray energies around the L absorption edge of iron demonstrates the advantages of this method for soft X-ray spectromicroscopy, which can readily provide chemical sensitivity without the need for optical refocusing. In particular, the phase signal is in perfect registration with the modulus signal and provides complementary information that can be more sensitive to changes in the local chemical environment.

  1. Thermal analysis, X-ray powder diffraction and electron microscopy data related with the production of 1:1 Caffeine:Glutaric Acid cocrystals.

    PubMed

    Duarte, Íris; Andrade, Rita; Pinto, João F; Temtem, Márcio

    2016-09-01

    The data presented in this article are related to the production of 1:1 Caffeine:Glutaric Acid cocrystals as part of the research article entitled "Green production of cocrystals using a new solvent-free approach by spray congealing" (Duarte et al., 2016) [1]. More specifically, here we present the thermal analysis and the X-ray powder diffraction data for pure Glutaric Acid, used as a raw material in [1]. We also include the X-ray powder diffraction and electron microscopy data obtained for the 1:1 Caffeine:Glutaric Acid cocrystal (form II) produced using the cooling crystallization method reported in "Operating Regions in Cooling Cocrystallization of Caffeine and Glutaric Acid in Acetonitrile" (Yu et al., 2010) [2]. Lastly, we show the X-ray powder diffraction data obtained for assessing the purity of the 1:1 Caffeine:Glutaric cocrystals produced in [1].

  2. Submicron x-ray diffraction and its applications to problems in materials and environmental science

    NASA Astrophysics Data System (ADS)

    Tamura, N.; Celestre, R. S.; MacDowell, A. A.; Padmore, H. A.; Spolenak, R.; Valek, B. C.; Meier Chang, N.; Manceau, A.; Patel, J. R.

    2002-03-01

    The availability of high brilliance third generation synchrotron sources together with progress in achromatic focusing optics allows us to add submicron spatial resolution to the conventional century-old x-ray diffraction technique. The new capabilities include the possibility to map in situ, grain orientations, crystalline phase distribution, and full strain/stress tensors at a very local level, by combining white and monochromatic x-ray microbeam diffraction. This is particularly relevant for high technology industry where the understanding of material properties at a microstructural level becomes increasingly important. After describing the latest advances in the submicron x-ray diffraction techniques at the Advanced Light Source, we will give some examples of its application in material science for the measurement of strain/stress in metallic thin films and interconnects. Its use in the field of environmental science will also be discussed.

  3. Ultrahigh vacuum/high pressure chamber for surface x-ray diffraction experiments

    NASA Astrophysics Data System (ADS)

    Bernard, P.; Peters, K.; Alvarez, J.; Ferrer, S.

    1999-02-01

    We describe an ultrahigh vacuum chamber that can be internally pressurized to several bars and that is designed to perform surface x-ray diffraction experiments on solid-gas interfaces. The chamber has a cylindrical beryllium window that serves as the entrance and exit for the x rays. The sample surface can be ion bombarded with an ancillary ion gun and annealed to 1200 K.

  4. Symposium LL: Nanowires--Synthesis Properties Assembly and Application

    DTIC Science & Technology

    2010-09-10

    dedicated hard x - ray microscopy beamline is operated in partnership with the Advanced Photon Source to provide fluorescence, diffraction, and...characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and X - ray diffraction (XRD) measurements, proving it to be...Investigation of Preferred Growth Direction of GaN Nanorods by Synchrotron X - ray Reciprocal Space Mapping. Yuri Sohn1, Sanghwa Lee1, Chinkyo Kim1 and Dong

  5. X-ray diffraction-based electronic structure calculations and experimental x-ray analysis for medical and materials applications

    NASA Astrophysics Data System (ADS)

    Mahato, Dip Narayan

    This thesis includes x-ray experiments for medical and materials applications and the use of x-ray diffraction data in a first-principles study of electronic structures and hyperfine properties of chemical and biological systems. Polycapillary focusing lenses were used to collect divergent x rays emitted from conventional x-ray tubes and redirect them to form an intense focused beam. These lenses are routinely used in microbeam x-ray fluorescence analysis. In this thesis, their potential application to powder diffraction and focused beam orthovoltage cancer therapy has been investigated. In conventional x-ray therapy, very high energy (˜ MeV) beams are used, partly to reduce the skin dose. For any divergent beam, the dose is necessarily highest at the entry point, and decays exponentially into the tissue. To reduce the skin dose, high energy beams, which have long absorption lengths, are employed, and rotated about the patient to enter from different angles. This necessitates large expensive specialized equipment. A focused beam could concentrate the dose within the patient. Since this is inherently skin dose sparing, lower energy photons could be employed. A primary concern in applying focused beams to therapy is whether the focus would be maintained despite Compton scattering within the tissue. To investigate this, transmission and focal spot sizes as a function of photon energy of two polycapillary focusing lenses were measured. The effects of tissue-equivalent phantoms of different thicknesses on the focal spot size were studied. Scatter fraction and depth dose were calculated. For powder diffraction, the polycapillary optics provide clean Gaussian peaks, which result in angular resolution that is much smaller than the peak width due to the beam convergence. Powder diffraction (also called coherent scatter) without optics can also be used to distinguish between tissue types that, because they have different nanoscale structures, scatter at different angles. Measurements were performed on the development of coherent scatter imaging to provide tissue type information in mammography. Atomic coordinates from x-ray diffraction data were used to study the nuclear quadrupole interactions and nature of molecular binding in DNA/RNA nucleobases and molecular solid BF3 systems.

  6. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity andmore » spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.« less

  7. Curved focusing crystals for hard X-ray astronomy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferrari, C., E-mail: ferrari@imem.cnr.it; Buffagni, E.; Bonnini, E.

    A lens made by a properly arranged array of crystals can be used to focus x-rays of energy ranging from 30 to 500 keV for x-ray astronomy. Mosaic or curved crystals can be employed as x-ray optical elements. In this work self standing curved focusing Si and GaAs crystals in which the lattice bending is induced by a controlled damaging process on one side of planar crystals are characterized. Diffraction profiles in Laue geometry have been measured in crystals at x-ray energies E = 17, 59 and 120 keV. An enhancement of diffraction efficiency is found in asymmetric geometries.

  8. Sealed-tube synthesis and phase diagram of Li{sub x}TiS{sub 2} (0 ≤ x ≤1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ziping; National Laboratory for Superconductivity, Institute of Physics, Chinese Academy of Science, Beijing 100190; Dong, Cheng, E-mail: chengdon@aphy.iphy.ac.cn

    2015-01-15

    Graphical abstract: We reported a new method to prepare Li{sub x}TiS{sub 2} (0 ≤ x ≤ 1) at 600 °C in sealed tube using Li{sub 2}S aslithium source. A schematic phase diagram of the Li{sub x}TiS{sub 2} system has been constructed based on the DTA and XRD data. - Abstract: We reported a new method to prepare Li{sub x}TiS{sub 2} (0 ≤ x ≤ 1) at 600 °C in sealed tube using Li{sub 2}S as lithium source. The Li{sub x}TiS{sub 2} samples were characterized by powder X-ray diffraction, scanning electron microscopy, energy dispersive X-ray spectroscopy, and differential thermal analysis. Themore » variations of the lattice parameters with lithium content x in Li{sub x}TiS{sub 2} were determined by X-ray powder diffraction analysis for both 1T and 3R phases. The phase transition between low-temperature 1T phase and high-temperature 3R phase was confirmed by the powder X-ray diffraction analysis. Based on the differential thermal analysis and X-ray diffraction results, a schematic phase diagram of the Li{sub x}TiS{sub 2} system has been constructed, providing a guideline to synthesize Li{sub x}TiS{sub 2} in 1T structure or 3R structure.« less

  9. X-ray diffraction on radioactive materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schiferl, D.; Roof, R.B.

    1978-01-01

    X-ray diffraction studies on radioactive materials are discussed with the aim of providing a guide to new researchers in the field. Considerable emphasis is placed on the safe handling and loading of not-too-exotic samples. Special considerations such as the problems of film blackening by the gamma rays and changes induced by the self-irradiation of the sample are covered. Some modifications of common diffraction techniques are presented. Finally, diffraction studies on radioactive samples under extreme conditions are discussed, with primary emphasis on high-pressure studies involving diamond-anvil cells.

  10. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    NASA Astrophysics Data System (ADS)

    Van de Voorde, Lien; Vekemans, Bart; Verhaeven, Eddy; Tack, Pieter; De Wolf, Robin; Garrevoet, Jan; Vandenabeele, Peter; Vincze, Laszlo

    2015-08-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg-Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Cheng-Jun, E-mail: cjsun@aps.anl.gov; Brewe, Dale L.; Heald, Steve M.

    X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorptionmore » near edge structure for Pr{sub 0.67}Sr{sub 0.33}MnO{sub 3} film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam.« less

  12. A von Hamos x-ray spectrometer based on a segmented-type diffraction crystal for single-shot x-ray emission spectroscopy and time-resolved resonant inelastic x-ray scattering studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szlachetko, J.; Institute of Physics, Jan Kochanowski University, 25-406 Kielce; Nachtegaal, M.

    2012-10-15

    We report on the design and performance of a wavelength-dispersive type spectrometer based on the von Hamos geometry. The spectrometer is equipped with a segmented-type crystal for x-ray diffraction and provides an energy resolution in the order of 0.25 eV and 1 eV over an energy range of 8000 eV-9600 eV. The use of a segmented crystal results in a simple and straightforward crystal preparation that allows to preserve the spectrometer resolution and spectrometer efficiency. Application of the spectrometer for time-resolved resonant inelastic x-ray scattering and single-shot x-ray emission spectroscopy is demonstrated.

  13. A multi-dataset data-collection strategy produces better diffraction data

    PubMed Central

    Liu, Zhi-Jie; Chen, Lirong; Wu, Dong; Ding, Wei; Zhang, Hua; Zhou, Weihong; Fu, Zheng-Qing; Wang, Bi-Cheng

    2011-01-01

    A multi-dataset (MDS) data-collection strategy is proposed and analyzed for macromolecular crystal diffraction data acquisition. The theoretical analysis indicated that the MDS strategy can reduce the standard deviation (background noise) of diffraction data compared with the commonly used single-dataset strategy for a fixed X-ray dose. In order to validate the hypothesis experimentally, a data-quality evaluation process, termed a readiness test of the X-ray data-collection system, was developed. The anomalous signals of sulfur atoms in zinc-free insulin crystals were used as the probe to differentiate the quality of data collected using different data-collection strategies. The data-collection results using home-laboratory-based rotating-anode X-ray and synchrotron X-ray systems indicate that the diffraction data collected with the MDS strategy contain more accurate anomalous signals from sulfur atoms than the data collected with a regular data-collection strategy. In addition, the MDS strategy offered more advantages with respect to radiation-damage-sensitive crystals and better usage of rotating-anode as well as synchrotron X-rays. PMID:22011470

  14. Effects of rare-earth co-doping on the local structure of rare-earth phosphate glasses using high and low energy X-ray diffraction.

    PubMed

    Cramer, Alisha J; Cole, Jacqueline M; FitzGerald, Vicky; Honkimaki, Veijo; Roberts, Mark A; Brennan, Tessa; Martin, Richard A; Saunders, George A; Newport, Robert J

    2013-06-14

    Rare-earth co-doping in inorganic materials has a long-held tradition of facilitating highly desirable optoelectronic properties for their application to the laser industry. This study concentrates specifically on rare-earth phosphate glasses, (R2O3)x(R'2O3)y(P2O5)(1-(x+y)), where (R, R') denotes (Ce, Er) or (La, Nd) co-doping and the total rare-earth composition corresponds to a range between metaphosphate, RP3O9, and ultraphosphate, RP5O14. Thereupon, the effects of rare-earth co-doping on the local structure are assessed at the atomic level. Pair-distribution function analysis of high-energy X-ray diffraction data (Q(max) = 28 Å(-1)) is employed to make this assessment. Results reveal a stark structural invariance to rare-earth co-doping which bears testament to the open-framework and rigid nature of these glasses. A range of desirable attributes of these glasses unfold from this finding; in particular, a structural simplicity that will enable facile molecular engineering of rare-earth phosphate glasses with 'dial-up' lasing properties. When considered together with other factors, this finding also demonstrates additional prospects for these co-doped rare-earth phosphate glasses in nuclear waste storage applications. This study also reveals, for the first time, the ability to distinguish between P-O and P[double bond, length as m-dash]O bonding in these rare-earth phosphate glasses from X-ray diffraction data in a fully quantitative manner. Complementary analysis of high-energy X-ray diffraction data on single rare-earth phosphate glasses of similar rare-earth composition to the co-doped materials is also presented in this context. In a technical sense, all high-energy X-ray diffraction data on these glasses are compared with analogous low-energy diffraction data; their salient differences reveal distinct advantages of high-energy X-ray diffraction data for the study of amorphous materials.

  15. Crystallization and preliminary X-ray diffraction analysis of the phosphate-binding protein PhoX from Xanthomonas citri

    PubMed Central

    Pegos, Vanessa R.; Medrano, Francisco Javier; Balan, Andrea

    2014-01-01

    Xanthomonas axonopodis pv. citri (X. citri) is an important bacterium that causes citrus canker disease in plants in Brazil and around the world, leading to significant economic losses. Determination of the physiology and mechanisms of pathogenesis of this bacterium is an important step in the development of strategies for its containment. Phosphate is an essential ion in all microrganisms owing its importance during the synthesis of macromolecules and in gene and protein regulation. Interestingly, X. citri has been identified to present two periplasmic binding proteins that have not been further characterized: PstS, from an ATP-binding cassette for high-affinity uptake and transport of phosphate, and PhoX, which is encoded by an operon that also contains a putative porin for the transport of phosphate. Here, the expression, purification and crystallization of the phosphate-binding protein PhoX and X-ray data collection at 3.0 Å resolution are described. Biochemical, biophysical and structural data for this protein will be helpful in the elucidation of its function in phosphate uptake and the physiology of the bacterium. PMID:25484207

  16. {ital In-situ} x-ray investigation of hydrogen charging in thin film bimetallic electrodes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jisrawi, N.M.; Wiesmann, H.; Ruckman, M.W.

    Hydrogen uptake and discharge by thin metallic films under potentiostatic control was studied using x-ray diffraction at the National Synchrotron Light Source (NSLS). The formation of metal-hydrogen phases in Pd, Pd-capped Nb and Pd/Nb multilayer electrode structures was deduced from x-ray diffraction data and correlated with the cyclic voltammetry (CV) peaks. The x-ray data was also used to construct a plot of the hydrogen concentration as a function of cell potential for a multilayered thin film. {copyright} {ital 1997 Materials Research Society.}

  17. Quantitative analysis of crystalline pharmaceuticals in tablets by pattern-fitting procedure using X-ray diffraction pattern.

    PubMed

    Takehira, Rieko; Momose, Yasunori; Yamamura, Shigeo

    2010-10-15

    A pattern-fitting procedure using an X-ray diffraction pattern was applied to the quantitative analysis of binary system of crystalline pharmaceuticals in tablets. Orthorhombic crystals of isoniazid (INH) and mannitol (MAN) were used for the analysis. Tablets were prepared under various compression pressures using a direct compression method with various compositions of INH and MAN. Assuming that X-ray diffraction pattern of INH-MAN system consists of diffraction intensities from respective crystals, observed diffraction intensities were fitted to analytic expression based on X-ray diffraction theory and separated into two intensities from INH and MAN crystals by a nonlinear least-squares procedure. After separation, the contents of INH were determined by using the optimized normalization constants for INH and MAN. The correction parameter including all the factors that are beyond experimental control was required for quantitative analysis without calibration curve. The pattern-fitting procedure made it possible to determine crystalline phases in the range of 10-90% (w/w) of the INH contents. Further, certain characteristics of the crystals in the tablets, such as the preferred orientation, size of crystallite, and lattice disorder were determined simultaneously. This method can be adopted to analyze compounds whose crystal structures are known. It is a potentially powerful tool for the quantitative phase analysis and characterization of crystals in tablets and powders using X-ray diffraction patterns. Copyright 2010 Elsevier B.V. All rights reserved.

  18. Rosalind Franklin's X-ray photo of DNA as an undergraduate optical diffraction experiment

    NASA Astrophysics Data System (ADS)

    Thompson, J.; Braun, G.; Tierney, D.; Wessels, L.; Schmitzer, H.; Rossa, B.; Wagner, H. P.; Dultz, W.

    2018-02-01

    Rosalind Franklin's X-ray diffraction patterns of DNA molecules rendered the important clue that DNA has the structure of a double helix. The most famous X-ray photograph, Photo 51, is still printed in most Biology textbooks. We suggest two optical experiments for undergraduates that make this historic achievement comprehensible for students by using macromodels of DNA and visible light to recreate a diffraction pattern similar to Photo 51. In these macromodels, we replace the double helix both mathematically and experimentally with its two-dimensional (flat) projection and explain why this is permissible. Basic optical concepts are used to infer certain well-known characteristics of DNA from the diffraction pattern.

  19. Femtosecond X-ray diffraction from an aerosolized beam of protein nanocrystals

    DOE PAGES

    Awel, Salah; Kirian, Richard A.; Wiedorn, Max O.; ...

    2018-02-01

    High-resolution Bragg diffraction from aerosolized single granulovirus nanocrystals using an X-ray free-electron laser is demonstrated. The outer dimensions of the in-vacuum aerosol injector components are identical to conventional liquid-microjet nozzles used in serial diffraction experiments, which allows the injector to be utilized with standard mountings. As compared with liquid-jet injection, the X-ray scattering background is reduced by several orders of magnitude by the use of helium carrier gas rather than liquid. Such reduction is required for diffraction measurements of small macromolecular nanocrystals and single particles. High particle speeds are achieved, making the approach suitable for use at upcoming high-repetition-rate facilities.

  20. Incoherent Diffractive Imaging via Intensity Correlations of Hard X Rays

    NASA Astrophysics Data System (ADS)

    Classen, Anton; Ayyer, Kartik; Chapman, Henry N.; Röhlsberger, Ralf; von Zanthier, Joachim

    2017-08-01

    Established x-ray diffraction methods allow for high-resolution structure determination of crystals, crystallized protein structures, or even single molecules. While these techniques rely on coherent scattering, incoherent processes like fluorescence emission—often the predominant scattering mechanism—are generally considered detrimental for imaging applications. Here, we show that intensity correlations of incoherently scattered x-ray radiation can be used to image the full 3D arrangement of the scattering atoms with significantly higher resolution compared to conventional coherent diffraction imaging and crystallography, including additional three-dimensional information in Fourier space for a single sample orientation. We present a number of properties of incoherent diffractive imaging that are conceptually superior to those of coherent methods.

  1. Titration of a Solid Acid Monitored by X-Ray Diffraction

    ERIC Educational Resources Information Center

    Dungey, Keenan E.; Epstein, Paul

    2007-01-01

    An experiment is described to introduce students to an important class of solid-state reactions while reinforcing concepts of titration by using a pH meter and a powder X-ray diffractometer. The experiment was successful in teaching students the abstract concepts of solid-state structure and diffraction by applying the diffraction concepts learned…

  2. Publications - GMC 42 | Alaska Division of Geological & Geophysical Surveys

    Science.gov Websites

    DGGS GMC 42 Publication Details Title: X-ray diffraction clay mineralogy analysis of the J.W. Dalton #1 for more information. Bibliographic Reference Unknown, 1984, X-ray diffraction clay mineralogy

  3. Publications - GMC 297 | Alaska Division of Geological & Geophysical

    Science.gov Websites

    DGGS GMC 297 Publication Details Title: X-ray diffraction analysis of cuttings from the: Texaco Inc information. Bibliographic Reference Unknown, 2001, X-ray diffraction analysis of cuttings from the: Texaco

  4. Publications - GMC 196 | Alaska Division of Geological & Geophysical

    Science.gov Websites

    DGGS GMC 196 Publication Details Title: X-ray diffraction patterns of clay from the following wells for more information. Bibliographic Reference Unknown, 1992, X-ray diffraction patterns of clay from

  5. Publications - GMC 43 | Alaska Division of Geological & Geophysical Surveys

    Science.gov Websites

    DGGS GMC 43 Publication Details Title: X-ray diffraction clay mineralogy analysis of 23 North Slope more information. Bibliographic Reference Unknown, 1983, X-ray diffraction clay mineralogy analysis of

  6. Multiple film plane diagnostic for shocked lattice measurements (invited)

    NASA Astrophysics Data System (ADS)

    Kalantar, Daniel H.; Bringa, E.; Caturla, M.; Colvin, J.; Lorenz, K. T.; Kumar, M.; Stölken, J.; Allen, A. M.; Rosolankova, K.; Wark, J. S.; Meyers, M. A.; Schneider, M.; Boehly, T. R.

    2003-03-01

    Laser-based shock experiments have been conducted in thin Si and Cu crystals at pressures above the Hugoniot elastic limit. In these experiments, static film and x-ray streak cameras recorded x rays diffracted from lattice planes both parallel and perpendicular to the shock direction. These data showed uniaxial compression of Si(100) along the shock direction and three-dimensional compression of Cu(100). In the case of the Si diffraction, there was a multiple wave structure observed, which may be due to a one-dimensional phase transition or a time variation in the shock pressure. A new film-based detector has been developed for these in situ dynamic diffraction experiments. This large-angle detector consists of three film cassettes that are positioned to record x rays diffracted from a shocked crystal anywhere within a full π steradian. It records x rays that are diffracted from multiple lattice planes both parallel and at oblique angles with respect to the shock direction. It is a time-integrating measurement, but time-resolved data may be recorded using a short duration laser pulse to create the diffraction source x rays. This new instrument has been fielded at the OMEGA and Janus lasers to study single-crystal materials shock compressed by direct laser irradiation. In these experiments, a multiple wave structure was observed on many different lattice planes in Si. These data provide information on the structure under compression.

  7. Nanomodulated electron beams via electron diffraction and emittance exchange for coherent x-ray generation

    NASA Astrophysics Data System (ADS)

    Nanni, E. A.; Graves, W. S.; Moncton, D. E.

    2018-01-01

    We present a new method for generation of relativistic electron beams with current modulation on the nanometer scale and below. The current modulation is produced by diffracting relativistic electrons in single crystal Si, accelerating the diffracted beam and imaging the crystal structure, then transferring the image into the temporal dimension via emittance exchange. The modulation period can be tuned by adjusting electron optics after diffraction. This tunable longitudinal modulation can have a period as short as a few angstroms, enabling production of coherent hard x-rays from a source based on inverse Compton scattering with total accelerator length of approximately ten meters. Electron beam simulations from cathode emission through diffraction, acceleration, and image formation with variable magnification are presented along with estimates of the coherent x-ray output properties.

  8. Theoretical calculation of coherent Laue-case conversion between x-rays and ALPs for an x-ray light-shining-through-a-wall experiment

    NASA Astrophysics Data System (ADS)

    Yamaji, T.; Yamazaki, T.; Tamasaku, K.; Namba, T.

    2017-12-01

    Single crystals have high atomic electric fields as much as 1 011 V /m , which correspond to magnetic fields of ˜103 T . These fields can be utilized to convert x-rays into axionlike particles (ALPs) coherently similar to x-ray diffraction. In this paper, we perform the first theoretical calculation of the Laue-case conversion in crystals based on the Darwin dynamical theory of x-ray diffraction. The calculation shows that the Laue-case conversion has longer interaction length than the Bragg case, and that ALPs in the keV range can be resonantly converted by tuning an incident angle of x-rays. ALPs with mass up to O (10 keV ) can be searched by light-shining-through-a-wall (LSW) experiments at synchrotron x-ray facilities.

  9. X-ray phase Identification of Chocolate is Possible

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guthrie,S.; Mazzanti, G.; Idziak, S.

    2005-01-01

    When examining chocolate samples by means of X-ray diffraction, it has become common practice for any sugar to be removed through repeated rinsing in cold water. While necessary in some cases, we show that it is possible to determine the phase of certain dark chocolate samples without sugar removal, through examination of distinctive X-ray diffraction peaks corresponding to lattice spacings of 3.98 and 3.70 Angstroms.

  10. The effect of laser radiation on the diffraction of X-rays in crystals

    NASA Astrophysics Data System (ADS)

    Trushin, V. N.; Chuprunov, E. V.; Khokhlov, A. F.

    1988-10-01

    The effect of laser radiation on the intensity of the X-ray diffraction peaks of KDP, ADP, and CuSO4-5H2O crystals was studied experimentally. This intensity was found to increase as a function of the laser beam power. This result suggests that it is possible to use laser beams to control X-ray intensity in the crystals considered.

  11. X-ray laser–induced electron dynamics observed by femtosecond diffraction from nanocrystals of Buckminsterfullerene

    PubMed Central

    Abbey, Brian; Dilanian, Ruben A.; Darmanin, Connie; Ryan, Rebecca A.; Putkunz, Corey T.; Martin, Andrew V.; Wood, David; Streltsov, Victor; Jones, Michael W. M.; Gaffney, Naylyn; Hofmann, Felix; Williams, Garth J.; Boutet, Sébastien; Messerschmidt, Marc; Seibert, M. Marvin; Williams, Sophie; Curwood, Evan; Balaur, Eugeniu; Peele, Andrew G.; Nugent, Keith A.; Quiney, Harry M.

    2016-01-01

    X-ray free-electron lasers (XFELs) deliver x-ray pulses with a coherent flux that is approximately eight orders of magnitude greater than that available from a modern third-generation synchrotron source. The power density of an XFEL pulse may be so high that it can modify the electronic properties of a sample on a femtosecond time scale. Exploration of the interaction of intense coherent x-ray pulses and matter is both of intrinsic scientific interest and of critical importance to the interpretation of experiments that probe the structures of materials using high-brightness femtosecond XFEL pulses. We report observations of the diffraction of extremely intense 32-fs nanofocused x-ray pulses by a powder sample of crystalline C60. We find that the diffraction pattern at the highest available incident power significantly differs from the one obtained using either third-generation synchrotron sources or XFEL sources operating at low output power and does not correspond to the diffraction pattern expected from any known phase of crystalline C60. We interpret these data as evidence of a long-range, coherent dynamic electronic distortion that is driven by the interaction of the periodic array of C60 molecular targets with intense x-ray pulses of femtosecond duration. PMID:27626076

  12. Near Edge X-Ray Absorption and X-Ray Photoelectron Diffraction Studies of the Structural Environment of Ge-Si Systems

    NASA Astrophysics Data System (ADS)

    Castrucci, P.; Gunnella, R.; Pinto, N.; Bernardini, R.; de Crescenzi, M.; Sacchi, M.

    Near edge X-ray absorption spectroscopy (XAS), X-ray photoelectron diffraction (XPD) and Auger electron diffraction (AED) are powerful techniques for the qualitative study of the structural and electronic properties of several systems. The recent development of a multiple scattering approach to simulating experimental spectra opened a friendly way to the study of structural environments of solids and surfaces. This article reviews recent X-ray absorption experiments using synchrotron radiation which were performed at Ge L edges and core level electron diffraction measurements obtained using a traditional X-ray source from Ge core levels for ultrathin Ge films deposited on silicon substrates. Thermodynamics and surface reconstruction have been found to play a crucial role in the first stages of Ge growth on Si(001) and Si(111) surfaces. Both techniques show the occurrence of intermixing processes even for room-temperature-grown Ge/Si(001) samples and give a straightforward measurement of the overlayer tetragonal distortion. The effects of Sb as a surfactant on the Ge/Si(001) interface have also been investigated. In this case, evidence of layer-by-layer growth of the fully strained Ge overlayer with a reduced intermixing is obtained when one monolayer of Sb is predeposited on the surface.

  13. Compact ultrahigh vacuum sample environments for x-ray nanobeam diffraction and imaging.

    PubMed

    Evans, P G; Chahine, G; Grifone, R; Jacques, V L R; Spalenka, J W; Schülli, T U

    2013-11-01

    X-ray nanobeams present the opportunity to obtain structural insight in materials with small volumes or nanoscale heterogeneity. The effective spatial resolution of the information derived from nanobeam techniques depends on the stability and precision with which the relative position of the x-ray optics and sample can be controlled. Nanobeam techniques include diffraction, imaging, and coherent scattering, with applications throughout materials science and condensed matter physics. Sample positioning is a significant mechanical challenge for x-ray instrumentation providing vacuum or controlled gas environments at elevated temperatures. Such environments often have masses that are too large for nanopositioners capable of the required positional accuracy of the order of a small fraction of the x-ray spot size. Similarly, the need to place x-ray optics as close as 1 cm to the sample places a constraint on the overall size of the sample environment. We illustrate a solution to the mechanical challenge in which compact ion-pumped ultrahigh vacuum chambers with masses of 1-2 kg are integrated with nanopositioners. The overall size of the environment is sufficiently small to allow their use with zone-plate focusing optics. We describe the design of sample environments for elevated-temperature nanobeam diffraction experiments demonstrate in situ diffraction, reflectivity, and scanning nanobeam imaging of the ripening of Au crystallites on Si substrates.

  14. Compact ultrahigh vacuum sample environments for x-ray nanobeam diffraction and imaging

    NASA Astrophysics Data System (ADS)

    Evans, P. G.; Chahine, G.; Grifone, R.; Jacques, V. L. R.; Spalenka, J. W.; Schülli, T. U.

    2013-11-01

    X-ray nanobeams present the opportunity to obtain structural insight in materials with small volumes or nanoscale heterogeneity. The effective spatial resolution of the information derived from nanobeam techniques depends on the stability and precision with which the relative position of the x-ray optics and sample can be controlled. Nanobeam techniques include diffraction, imaging, and coherent scattering, with applications throughout materials science and condensed matter physics. Sample positioning is a significant mechanical challenge for x-ray instrumentation providing vacuum or controlled gas environments at elevated temperatures. Such environments often have masses that are too large for nanopositioners capable of the required positional accuracy of the order of a small fraction of the x-ray spot size. Similarly, the need to place x-ray optics as close as 1 cm to the sample places a constraint on the overall size of the sample environment. We illustrate a solution to the mechanical challenge in which compact ion-pumped ultrahigh vacuum chambers with masses of 1-2 kg are integrated with nanopositioners. The overall size of the environment is sufficiently small to allow their use with zone-plate focusing optics. We describe the design of sample environments for elevated-temperature nanobeam diffraction experiments demonstrate in situ diffraction, reflectivity, and scanning nanobeam imaging of the ripening of Au crystallites on Si substrates.

  15. X-ray characterization of curved crystals for hard x-ray astronomy

    NASA Astrophysics Data System (ADS)

    Buffagni, Elisa; Bonnini, Elisa; Ferrari, Claudio; Virgilli, Enrico; Frontera, Filippo

    2015-05-01

    Among the methods to focus photons the diffraction in crystals results as one of the most effective for high energy photons. An assembling of properly oriented crystals can form a lens able to focus x-rays at high energy via Laue diffraction in transmission geometry; this is a Laue lens. The x-ray diffraction theory provides that the maximum diffraction efficiency is achieved in ideal mosaic crystals, but real mosaic crystals show diffraction efficiencies several times lower than the ideal case due to technological problems. An alternative and convenient approach is the use of curved crystals. We have recently optimized an efficient method based on the surface damage of crystals to produce self-standing uniformly curved Si, GaAs and Ge tiles of thickness up to 2-3 mm and curvature radii R down to a few meters. We show that, for curved diffracting planes, such crystals have a diffraction efficiency nearly forty times higher than the diffraction efficiency of perfect similar flat crystals, thus very close to that of ideal mosaic crystals. Moreover, in an alternative configuration where the diffracting planes are perpendicular to the curved ones, a focusing effect occurs and will be shown. These results were obtained for several energies between 17 and 120 keV with lab sources or at high energy facilities such as LARIX at Ferrara (Italy), ESRF at Grenoble (France), and ANKA at Karlsruhe (Germany).

  16. Publications - GMC 95 | Alaska Division of Geological & Geophysical Surveys

    Science.gov Websites

    DGGS GMC 95 Publication Details Title: X-ray diffraction analysis of seven core samples from the information. Bibliographic Reference Bergman, S.C., and Stuart, C.J., 1988, X-ray diffraction analysis of

  17. X-Ray Topography of Tetragonal Lysozyme Grown by the Temperature-Controlled Technique

    NASA Technical Reports Server (NTRS)

    Stojanoff, V.; Siddons, D. P.; Monaco, Lisa A.; Vekilov, Peter; Rosenberger, Franz

    1997-01-01

    Growth-induced defects in lysozyme crystals were observed by white-beam and monochromatic X-ray topography at the National Synchrotron Light Source (NSLS) at the Brookhaven National Laboratory (BNL). The topographic methods were non-destructive to the extent that traditional diffraction data collection could be performed to high resolution after topography. It was found that changes in growth parameters, defect concentration as detected by X-ray topography, and the diffraction quality obtainable from the crystals were all strongly correlated. In addition, crystals with fewer defects showed lower mosaicity and higher diffraction resolution as expected.

  18. Expression, purification, crystallization, and preliminary X-ray crystallographic analysis of OXA-17, an extended-spectrum β-lactamase conferring severe antibiotic resistance

    NASA Astrophysics Data System (ADS)

    Lee, J. H.; Sohn, S. G.; Jung, H. I.; An, Y. J.; Lee, S. H.

    2013-07-01

    OXA-17, an extended-spectrum β-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates β-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino β-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 Å resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P212121, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 Å. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.

  19. Soft X-ray multilayers produced by sputtering and molecular beam epitaxy (MBE) - Substrate and interfacial roughness

    NASA Astrophysics Data System (ADS)

    Kearney, Patrick A.; Slaughter, J. M.; Powers, K. D.; Falco, Charles M.

    1988-01-01

    Roughness measurements were made on uncoated silicon wafers and float glass using a WYKO TOPO-3D phase shifting interferometry, and the results are reported. The wafers are found to be slightly smoother than the flat glass. The effects of different cleaning methods and of the deposition of silicon 'buffer layers' on substrate roughness are examined. An acid cleaning method is described which gives more consistent results than detergent cleaning. Healing of the roughness due to sputtered silicon buffer layers was not observed on the length scale probed by the WYKO. Sputtered multilayers are characterized using both the WYKO interferometer and low-angle X-ray diffraction in order to yield information about the roughness of the top surface and of the multilayer interfaces. Preliminary results on film growth using molecular beam epitaxy are also presented.

  20. Crystallization and preliminary X-ray analysis of a novel halotolerant feruloyl esterase identified from a soil metagenomic library

    PubMed Central

    Chen, Shang-ke; Wang, Kui; Liu, Yuhuan; Hu, Xiaopeng

    2012-01-01

    Feruloyl esterase cleaves the ester linkage formed between ferulic acid and polysaccharides in plant cell walls and thus has wide potential industrial applications. A novel feruloyl esterase (EstF27) identified from a soil metagenomic library was crystallized and a complete data set was collected from a single cooled crystal using an in-house X-ray source. The crystal diffracted to 2.9 Å resolution and belonged to space group P212121, with unit-cell parameters a = 94.35, b = 106.19, c = 188.51 Å, α = β = γ = 90.00°. A Matthews coefficient of 2.55 Å3 Da−1, with a corresponding solvent content of 51.84%, suggested the presence of ten protein subunits in the asymmetric unit. PMID:22750860

  1. Crystallization and preliminary X-ray diffraction analysis of a high-affinity phosphate-binding protein endowed with phosphatase activity from Pseudomonas aeruginosa PAO1

    PubMed Central

    Djeghader, Ahmed; Gotthard, Guillaume; Suh, Andrew; Gonzalez, Daniel; Scott, Ken; Chabriere, Eric; Elias, Mikael

    2013-01-01

    In prokaryotes, phosphate starvation induces the expression of numerous phosphate-responsive genes, such as the pst operon including the high-affinity phosphate-binding protein (PBP or pstS) and alkaline phosphatases such as PhoA. This response increases the cellular inorganic phosphate import efficiency. Notably, some Pseudomonas species secrete, via a type-2 secretion system, a phosphate-binding protein dubbed LapA endowed with phosphatase activity. Here, the expression, purification, crystallization and X-ray data collection at 0.87 Å resolution of LapA are described. Combined with biochemical and enzymatic characterization, the structure of this intriguing phosphate-binding protein will help to elucidate the molecular origin of its phosphatase activity and to decipher its putative role in phosphate uptake. PMID:24100568

  2. Isolation, purification, crystallization and preliminary X-ray studies of two 30 kDa proteins from silkworm haemolymph.

    PubMed

    Pietrzyk, Agnieszka J; Bujacz, Anna; Łochyńska, Małgorzata; Jaskólski, Mariusz; Bujacz, Grzegorz

    2011-03-01

    Juvenile hormone-binding protein (JHBP) and the low-molecular-mass lipoprotein PBMHP-12 belong to a group of 30 kDa proteins that comprise the major protein component of the haemolymph specific to the fifth-instar larvae stage of the mulberry silkworm Bombyx mori L. Proteins from this group are often essential for the development of the insect. In a project aimed at crystallographic characterization of B. mori JHBP (BmJHBP), it was copurified together with PBMHP-12. Eventually, the two proteins were isolated and crystallized separately. The BmJHBP crystals were orthorhombic (space group C222(1)) and the PBMHP-12 crystals were triclinic. The crystals diffracted X-rays to 2.9 Å (BmJHBP) and 1.3 Å (PBMHP-12) resolution.

  3. Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

    DOE PAGES

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

    2015-08-25

    Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

  4. Coded diffraction system in X-ray crystallography using a boolean phase coded aperture approximation

    NASA Astrophysics Data System (ADS)

    Pinilla, Samuel; Poveda, Juan; Arguello, Henry

    2018-03-01

    Phase retrieval is a problem present in many applications such as optics, astronomical imaging, computational biology and X-ray crystallography. Recent work has shown that the phase can be better recovered when the acquisition architecture includes a coded aperture, which modulates the signal before diffraction, such that the underlying signal is recovered from coded diffraction patterns. Moreover, this type of modulation effect, before the diffraction operation, can be obtained using a phase coded aperture, just after the sample under study. However, a practical implementation of a phase coded aperture in an X-ray application is not feasible, because it is computationally modeled as a matrix with complex entries which requires changing the phase of the diffracted beams. In fact, changing the phase implies finding a material that allows to deviate the direction of an X-ray beam, which can considerably increase the implementation costs. Hence, this paper describes a low cost coded X-ray diffraction system based on block-unblock coded apertures that enables phase reconstruction. The proposed system approximates the phase coded aperture with a block-unblock coded aperture by using the detour-phase method. Moreover, the SAXS/WAXS X-ray crystallography software was used to simulate the diffraction patterns of a real crystal structure called Rhombic Dodecahedron. Additionally, several simulations were carried out to analyze the performance of block-unblock approximations in recovering the phase, using the simulated diffraction patterns. Furthermore, the quality of the reconstructions was measured in terms of the Peak Signal to Noise Ratio (PSNR). Results show that the performance of the block-unblock phase coded apertures approximation decreases at most 12.5% compared with the phase coded apertures. Moreover, the quality of the reconstructions using the boolean approximations is up to 2.5 dB of PSNR less with respect to the phase coded aperture reconstructions.

  5. X-ray absorption microtomography (microCT) and small beam diffraction mapping of sea urchin teeth.

    PubMed

    Stock, S R; Barss, J; Dahl, T; Veis, A; Almer, J D

    2002-07-01

    Two noninvasive X-ray techniques, laboratory X-ray absorption microtomography (microCT) and X-ray diffraction mapping, were used to study teeth of the sea urchin Lytechinus variegatus. MicroCT revealed low attenuation regions at near the tooth's stone part and along the carinar process-central prism boundary; this latter observation appears to be novel. The expected variation of Mg fraction x in the mineral phase (calcite, Ca(1-x)Mg(x)CO(3)) cannot account for all of the linear attenuation coefficient decrease in the two zones: this suggested that soft tissue is localized there. Transmission diffraction mapping (synchrotron X-radiation, 80.8 keV, 0.1 x 0.1mm(2) beam area, 0.1mm translation grid, image plate area detector) simultaneously probed variations in 3-D and showed that the crystal elements of the "T"-shaped tooth were very highly aligned. Diffraction patterns from the keel (adaxial web) and from the abaxial flange (containing primary plates and the stone part) differed markedly. The flange contained two populations of identically oriented crystal elements with lattice parameters corresponding to x=0.13 and x=0.32. The keel produced one set of diffraction spots corresponding to the lower x. The compositions were more or less equivalent to those determined by others for camarodont teeth, and the high Mg phase is expected to be disks of secondary mineral epitaxially related to the underlying primary mineral element. Lattice parameter gradients were not noted in the keel or flange. Taken together, the microCT and diffraction results indicated that there was a band of relatively high protein content, of up to approximately 0.25 volume fraction, in the central part of the flange and paralleling its adaxial and abaxial faces. X-ray microCT and microdiffraction data used in conjunction with protein distribution data will be crucial for understanding the properties of various biocomposites and their mechanical functions.

  6. Reconstructive colour X-ray diffraction imaging--a novel TEDDI imaging method.

    PubMed

    Lazzari, Olivier; Jacques, Simon; Sochi, Taha; Barnes, Paul

    2009-09-01

    Tomographic Energy-Dispersive Diffraction Imaging (TEDDI) enables a unique non-destructive mapping of the interior of bulk objects, exploiting the full range of X-ray signals (diffraction, fluorescence, scattering, background) recorded. By analogy to optical imaging, a wide variety of features (structure, composition, orientation, strain) dispersed in X-ray wavelengths can be extracted and colour-coded to aid interpretation. The ultimate aim of this approach is to realise real-time high-definition colour X-ray diffraction imaging, on the timescales of seconds, so that one will be able to 'look inside' optically opaque apparatus and unravel the space/time-evolution of the materials chemistry taking place. This will impact strongly on many fields of science but there are currently two barriers to this goal: speed of data acquisition (a 2D scan currently takes minutes to hours) and loss of image definition through spatial distortion of the X-ray sampling volume. Here we present a data-collection scenario and reconstruction routine which overcomes the latter barrier and which has been successfully applied to a phantom test object and to real materials systems such as a carbonating cement block. These procedures are immediately transferable to the promising technology of multi-energy-dispersive-detector-arrays which are planned to deliver the other breakthrough, that of one-two orders of magnitude improvement in data acquisition rates, that will be needed to realise real-time high-definition colour X-ray diffraction imaging.

  7. Nondestructive strain depth profiling with high energy X-ray diffraction: System capabilities and limitations

    NASA Astrophysics Data System (ADS)

    Zhang, Zhan; Wendt, Scott; Cosentino, Nicholas; Bond, Leonard J.

    2018-04-01

    Limited by photon energy, and penetration capability, traditional X-ray diffraction (XRD) strain measurements are only capable of achieving a few microns depth due to the use of copper (Cu Kα1) or molybdenum (Mo Kα1) characteristic radiation. For deeper strain depth profiling, destructive methods are commonly necessary to access layers of interest by removing material. To investigate deeper depth profiles nondestructively, a laboratory bench-top high-energy X-ray diffraction (HEXRD) system was previously developed. This HEXRD method uses an industrial 320 kVp X-Ray tube and the Kα1 characteristic peak of tungsten, to produces a higher intensity X-ray beam which enables depth profiling measurement of lattice strain. An aluminum sample was investigated with deformation/load provided using a bending rig. It was shown that the HEXRD method is capable of strain depth profiling to 2.5 mm. The method was validated using an aluminum sample where both the HEXRD method and the traditional X-ray diffraction method gave data compared with that obtained using destructive etching layer removal, performed by a commercial provider. The results demonstrate comparable accuracy up to 0.8 mm depth. Nevertheless, higher attenuation capabilities in heavier metals limit the applications in other materials. Simulations predict that HEXRD works for steel and nickel in material up to 200 µm, but experiment results indicate that the HEXRD strain profile is not practical for steel and nickel material, and the measured diffraction signals are undetectable when compared to the noise.

  8. Three NiAs-Ni 2In Type Structures in the Mn-Sn System

    NASA Astrophysics Data System (ADS)

    Elding-Pontén, Margareta; Stenberg, Lars; Larsson, Ann-Kristin; Lidin, Sven; Ståhl, Kenny

    1997-03-01

    TheB8-type structure field of the Mn-Sn system has been investigated. Two high temperature phases (HTP1 and HTP2) and one low temperature phase (Mn3Sn2) were found. They all crystallize with the NiAs structure type with part of the trigonal bipyramidal interstices filled by manganese atoms in an ordered manner. The ordering as well as the manganese content is different for the three phases, giving rise to three different orthorhombic superstructures. Mn3Sn2seems to have the lowest manganese content, since the corresponding basal unit cell is smaller than for HTP1-2. Structural models of the phases are based on selected area electron diffraction, X-ray powder diffraction, and preliminary single crystal X-ray measurements. The ideal cell parameters found are (a=7ahex,b=3ahex,c=chex), (a=5ahex,b=3ahex,c=chex), and (a=2ahex,b=3ahex,c=chex) for HTP1, HTP2, and Mn3Sn2, respectively. The crystal structure of Mn3Sn2has been refined by means of the Rietveld method from X-ray powder diffraction data. Mn3Sn2is orthorhombic,Pnma,a=7.5547(2),b=5.4994(2),c=8.5842(2) Å,Z=4. (Pbnmin the setting above.) The compound is isostructural with Ni3Sn2andγ‧-Co3Sn2(H. Fjellvåg and A. Kjekshus,Acta Chem. Scand.A40, 23-30 (1986)). FinalRp=8.97%,Rwp=11.44%, GOF=2.86, andRBragg=4.11% using 43 parameters and 5701 observations and 330 Bragg reflections.

  9. Membrane protein structure determination by SAD, SIR, or SIRAS phasing in serial femtosecond crystallography using an iododetergent

    PubMed Central

    Nakane, Takanori; Hanashima, Shinya; Suzuki, Mamoru; Saiki, Haruka; Hayashi, Taichi; Kakinouchi, Keisuke; Sugiyama, Shigeru; Kawatake, Satoshi; Matsuoka, Shigeru; Matsumori, Nobuaki; Nango, Eriko; Kobayashi, Jun; Shimamura, Tatsuro; Kimura, Kanako; Mori, Chihiro; Kunishima, Naoki; Sugahara, Michihiro; Takakyu, Yoko; Inoue, Shigeyuki; Masuda, Tetsuya; Hosaka, Toshiaki; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Inoue, Tsuyoshi; Nureki, Osamu; Iwata, So; Murata, Michio; Mizohata, Eiichi

    2016-01-01

    The 3D structure determination of biological macromolecules by X-ray crystallography suffers from a phase problem: to perform Fourier transformation to calculate real space density maps, both intensities and phases of structure factors are necessary; however, measured diffraction patterns give only intensities. Although serial femtosecond crystallography (SFX) using X-ray free electron lasers (XFELs) has been steadily developed since 2009, experimental phasing still remains challenging. Here, using 7.0-keV (1.771 Å) X-ray pulses from the SPring-8 Angstrom Compact Free Electron Laser (SACLA), iodine single-wavelength anomalous diffraction (SAD), single isomorphous replacement (SIR), and single isomorphous replacement with anomalous scattering (SIRAS) phasing were performed in an SFX regime for a model membrane protein bacteriorhodopsin (bR). The crystals grown in bicelles were derivatized with an iodine-labeled detergent heavy-atom additive 13a (HAD13a), which contains the magic triangle, I3C head group with three iodine atoms. The alkyl tail was essential for binding of the detergent to the surface of bR. Strong anomalous and isomorphous difference signals from HAD13a enabled successful phasing using reflections up to 2.1-Å resolution from only 3,000 and 4,000 indexed images from native and derivative crystals, respectively. When more images were merged, structure solution was possible with data truncated at 3.3-Å resolution, which is the lowest resolution among the reported cases of SFX phasing. Moreover, preliminary SFX experiment showed that HAD13a successfully derivatized the G protein-coupled A2a adenosine receptor crystallized in lipidic cubic phases. These results pave the way for de novo structure determination of membrane proteins, which often diffract poorly, even with the brightest XFEL beams. PMID:27799539

  10. Membrane protein structure determination by SAD, SIR, or SIRAS phasing in serial femtosecond crystallography using an iododetergent.

    PubMed

    Nakane, Takanori; Hanashima, Shinya; Suzuki, Mamoru; Saiki, Haruka; Hayashi, Taichi; Kakinouchi, Keisuke; Sugiyama, Shigeru; Kawatake, Satoshi; Matsuoka, Shigeru; Matsumori, Nobuaki; Nango, Eriko; Kobayashi, Jun; Shimamura, Tatsuro; Kimura, Kanako; Mori, Chihiro; Kunishima, Naoki; Sugahara, Michihiro; Takakyu, Yoko; Inoue, Shigeyuki; Masuda, Tetsuya; Hosaka, Toshiaki; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Yabashi, Makina; Inoue, Tsuyoshi; Nureki, Osamu; Iwata, So; Murata, Michio; Mizohata, Eiichi

    2016-11-15

    The 3D structure determination of biological macromolecules by X-ray crystallography suffers from a phase problem: to perform Fourier transformation to calculate real space density maps, both intensities and phases of structure factors are necessary; however, measured diffraction patterns give only intensities. Although serial femtosecond crystallography (SFX) using X-ray free electron lasers (XFELs) has been steadily developed since 2009, experimental phasing still remains challenging. Here, using 7.0-keV (1.771 Å) X-ray pulses from the SPring-8 Angstrom Compact Free Electron Laser (SACLA), iodine single-wavelength anomalous diffraction (SAD), single isomorphous replacement (SIR), and single isomorphous replacement with anomalous scattering (SIRAS) phasing were performed in an SFX regime for a model membrane protein bacteriorhodopsin (bR). The crystals grown in bicelles were derivatized with an iodine-labeled detergent heavy-atom additive 13a (HAD13a), which contains the magic triangle, I3C head group with three iodine atoms. The alkyl tail was essential for binding of the detergent to the surface of bR. Strong anomalous and isomorphous difference signals from HAD13a enabled successful phasing using reflections up to 2.1-Å resolution from only 3,000 and 4,000 indexed images from native and derivative crystals, respectively. When more images were merged, structure solution was possible with data truncated at 3.3-Å resolution, which is the lowest resolution among the reported cases of SFX phasing. Moreover, preliminary SFX experiment showed that HAD13a successfully derivatized the G protein-coupled A2a adenosine receptor crystallized in lipidic cubic phases. These results pave the way for de novo structure determination of membrane proteins, which often diffract poorly, even with the brightest XFEL beams.

  11. New software to model energy dispersive X-ray diffraction in polycrystalline materials

    NASA Astrophysics Data System (ADS)

    Ghammraoui, B.; Tabary, J.; Pouget, S.; Paulus, C.; Moulin, V.; Verger, L.; Duvauchelle, Ph.

    2012-02-01

    Detection of illicit materials, such as explosives or drugs, within mixed samples is a major issue, both for general security and as part of forensic analyses. In this paper, we describe a new code simulating energy dispersive X-ray diffraction patterns in polycrystalline materials. This program, SinFullscat, models diffraction of any object in any diffractometer system taking all physical phenomena, including amorphous background, into account. Many system parameters can be tuned: geometry, collimators (slit and cylindrical), sample properties, X-ray source and detector energy resolution. Good agreement between simulations and experimental data was obtained. Simulations using explosive materials indicated that parameters such as the diffraction angle or the energy resolution of the detector have a significant impact on the diffraction signature of the material inspected. This software will be a convenient tool to test many diffractometer configurations, providing information on the one that best restores the spectral diffraction signature of the materials of interest.

  12. Femtosecond X-ray coherent diffraction of aligned amyloid fibrils on low background graphene.

    PubMed

    Seuring, Carolin; Ayyer, Kartik; Filippaki, Eleftheria; Barthelmess, Miriam; Longchamp, Jean-Nicolas; Ringler, Philippe; Pardini, Tommaso; Wojtas, David H; Coleman, Matthew A; Dörner, Katerina; Fuglerud, Silje; Hammarin, Greger; Habenstein, Birgit; Langkilde, Annette E; Loquet, Antoine; Meents, Alke; Riek, Roland; Stahlberg, Henning; Boutet, Sébastien; Hunter, Mark S; Koglin, Jason; Liang, Mengning; Ginn, Helen M; Millane, Rick P; Frank, Matthias; Barty, Anton; Chapman, Henry N

    2018-05-09

    Here we present a new approach to diffraction imaging of amyloid fibrils, combining a free-standing graphene support and single nanofocused X-ray pulses of femtosecond duration from an X-ray free-electron laser. Due to the very low background scattering from the graphene support and mutual alignment of filaments, diffraction from tobacco mosaic virus (TMV) filaments and amyloid protofibrils is obtained to 2.7 Å and 2.4 Å resolution in single diffraction patterns, respectively. Some TMV diffraction patterns exhibit asymmetry that indicates the presence of a limited number of axial rotations in the XFEL focus. Signal-to-noise levels from individual diffraction patterns are enhanced using computational alignment and merging, giving patterns that are superior to those obtainable from synchrotron radiation sources. We anticipate that our approach will be a starting point for further investigations into unsolved structures of filaments and other weakly scattering objects.

  13. Diffracted diffraction radiation and its application to beam diagnostics

    NASA Astrophysics Data System (ADS)

    Goponov, Yu. A.; Shatokhin, R. A.; Sumitani, K.; Syshchenko, V. V.; Takabayashi, Y.; Vnukov, I. E.

    2018-03-01

    We present theoretical considerations for diffracted diffraction radiation and also propose an application of this process to diagnosing ultra-relativistic electron (positron) beams for the first time. Diffraction radiation is produced when relativistic particles move near a target. If the target is a crystal or X-ray mirror, diffraction radiation in the X-ray region is expected to be diffracted at the Bragg angle and therefore be detectable. We present a scheme for applying this process to measurements of the beam angular spread, and consider how to conduct a proof-of-principle experiment for the proposed method.

  14. Absolute x-ray energy calibration and monitoring using a diffraction-based method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hong, Xinguo, E-mail: xhong@bnl.gov; Weidner, Donald J.; Duffy, Thomas S.

    2016-07-27

    In this paper, we report some recent developments of the diffraction-based absolute X-ray energy calibration method. In this calibration method, high spatial resolution of the measured detector offset is essential. To this end, a remotely controlled long-translation motorized stage was employed instead of the less convenient gauge blocks. It is found that the precision of absolute X-ray energy calibration (ΔE/E) is readily achieved down to the level of 10{sup −4} for high-energy monochromatic X-rays (e.g. 80 keV). Examples of applications to pair distribution function (PDF) measurements and energy monitoring for high-energy X-rays are presented.

  15. High-energy cryo x-ray nano-imaging at the ID16A beamline of ESRF

    NASA Astrophysics Data System (ADS)

    da Silva, Julio C.; Pacureanu, Alexandra; Yang, Yang; Fus, Florin; Hubert, Maxime; Bloch, Leonid; Salome, Murielle; Bohic, Sylvain; Cloetens, Peter

    2017-09-01

    The ID16A beamline at ESRF offers unique capabilities for X-ray nano-imaging, and currently produces the worlds brightest high energy diffraction-limited nanofocus. Such a nanoprobe was designed for quantitative characterization of the morphology and the elemental composition of specimens at both room and cryogenic temperatures. Billions of photons per second can be delivered in a diffraction-limited focus spot size down to 13 nm. Coherent X-ray imaging techniques, as magnified holographic-tomography and ptychographic-tomography, are implemented as well as X-ray fluorescence nanoscopy. We will show the latest developments in coherent and spectroscopic X-ray nanoimaging implemented at the ID16A beamline

  16. X-ray monitoring optical elements

    DOEpatents

    Stoupin, Stanislav; Shvydko, Yury; Katsoudas, John; Blank, Vladimir D.; Terentyev, Sergey A.

    2016-12-27

    An X-ray article and method for analyzing hard X-rays which have interacted with a test system. The X-ray article is operative to diffract or otherwise process X-rays from an input X-ray beam which have interacted with the test system and at the same time provide an electrical circuit adapted to collect photoelectrons emitted from an X-ray optical element of the X-ray article to analyze features of the test system.

  17. Macromolecular Topography Leaps into the Digital Age

    NASA Technical Reports Server (NTRS)

    Lovelace, J.; Bellamy, H.; Snell, E. H.; Borgstahl, G.

    2003-01-01

    A low-cost, real-time digital topography system is under development which will replace x-ray film and nuclear emulsion plates. The imaging system is based on an inexpensive surveillance camera that offers a 1000x1000 array of 8 im square pixels, anti-blooming circuitry, and very quick read out. Currently, the system directly converts x-rays to an image with no phosphor. The system is small and light and can be easily adapted to work with other crystallographic equipment. Preliminary images have been acquired of cubic insulin at the NSLS x26c beam line. NSLS x26c was configured for unfocused monochromatic radiation. Six reflections were collected with stills spaced from 0.002 to 0.001 degrees apart across the entire oscillation range that the reflections were in diffracting condition. All of the reflections were rotated to the vertical to reduce Lorentz and beam related effects. This particular CCD is designed for short exposure applications (much less than 1 sec) and so has a relatively high dark current leading to noisy raw images. The images are processed to remove background and other system noise with a multi-step approach including the use of wavelets, histogram, and mean window filtering. After processing, animations were constructed with the corresponding reflection profile to show the diffraction of the crystal volume vs. the oscillation angle as well as composite images showing the parts of the crystal with the strongest diffraction for each reflection. The final goal is to correlate features seen in reflection profiles captured with fine phi slicing to those seen in the topography images. With this development macromolecular topography finally comes into the digital age.

  18. Spin orbit and tetragonal crystalline field interaction in the valence band of CuInSe2-related ordered vacancy compound CuIn7Se12

    NASA Astrophysics Data System (ADS)

    Reena Philip, Rachel; Pradeep, B.; Shripathi, T.

    2005-04-01

    Thin films of the off-tie-line ordered vacancy compound CuIn7Se12 were deposited on optically flat glass substrates by multi-source co-evaporation method. The preliminary structural, compositional and morphological characterizations were done using X-ray diffraction, energy dispersive X-ray analysis and atomic force microscopy. The X-ray diffraction data were further analysed applying the Nelson-Riley method and CTB plus = experiment rule, respectively, for lattice constants (a = 5.746 Å and c = 11.78 Å) and bond length estimations (RCu-Se = 2.465 Å and RIn-Se = 2.554 Å). A detailed analysis of the optical absorption spectra of the compound, which exhibited a three-fold optical absorption structure in the fundamental gap region, yielded three characteristic direct energy gaps at 1.37, 1.48(7) and 1.72(8) eV indicative of valence band splitting, which were evaluated using Hopfield's quasi-cubic model. The 0.04 eV increase in spin-orbit splitting parameter of the compound (0.27 eV) compared to that of CuInSe2 (0.23 eV) is found to be suggestive of the smaller contribution of Cu d orbitals to hybridization (determined by the linear hybridization model) in this Cu-deficient compound. Spectral response spectra exhibit, in addition to a maximum around 1.34 ± 0.03 eV, two other defect transition peaks near 1.07 and 0.85 eV. The binding energies of Cu, In and Se in the compound were determined using X-ray photoelectron spectroscopy.

  19. Publications - GMC 45 | Alaska Division of Geological & Geophysical Surveys

    Science.gov Websites

    DGGS GMC 45 Publication Details Title: X-ray diffraction mineral percentages of chips from Exxon Pt , 1983, X-ray diffraction mineral percentages of chips from Exxon Pt. Thomson Unit #1 and #3 wells

  20. Publications - GMC 361 | Alaska Division of Geological & Geophysical

    Science.gov Websites

    DGGS GMC 361 Publication Details Title: X-ray Diffraction Analysis of: Drew Point #1, East Simpson Test , 2009, X-ray Diffraction Analysis of: Drew Point #1, East Simpson Test Well #1, East Simpson #2

  1. Publications - GMC 41 | Alaska Division of Geological & Geophysical Surveys

    Science.gov Websites

    DGGS GMC 41 Publication Details Title: X-ray diffraction clay mineralogy analysis of core samples from Unknown, [n.d.], X-ray diffraction clay mineralogy analysis of core samples from Mobil West Staines State

  2. TAKASAGO-6 apparatus for cryogenic coherent X-ray diffraction imaging of biological non-crystalline particles using X-ray free electron laser at SACLA.

    PubMed

    Kobayashi, Amane; Sekiguchi, Yuki; Takayama, Yuki; Oroguchi, Tomotaka; Shirahama, Keiya; Torizuka, Yasufumi; Manoda, Masahiro; Nakasako, Masayoshi; Yamamoto, Masaki

    2016-05-01

    Coherent X-ray diffraction imaging (CXDI) is a technique for structure analyses of non-crystalline particles with dimensions ranging from micrometer to sub-micrometer. We have developed a diffraction apparatus named TAKASAGO-6 for use in single-shot CXDI experiments of frozen-hydrated non-crystalline biological particles at cryogenic temperature with X-ray free electron laser pulses provided at a repetition rate of 30 Hz from the SPring-8 Angstrom Compact free-electron LAser. Specimen particles are flash-cooled after being dispersed on thin membranes supported by specially designed disks. The apparatus is equipped with a high-speed translation stage with a cryogenic pot for raster-scanning of the disks at a speed higher than 25 μm/33 ms. In addition, we use devices assisting the easy transfer of cooled specimens from liquid-nitrogen storages to the cryogenic pot. In the current experimental procedure, more than 20 000 diffraction patterns can be collected within 1 h. Here we report the key components and performance of the diffraction apparatus. Based on the efficiency of the diffraction data collection and the structure analyses of metal particles, biological cells, and cellular organelles, we discuss the future application of this diffraction apparatus for structure analyses of biological specimens.

  3. Thermal expansion in UO 2 determined by high-energy X-ray diffraction

    DOE PAGES

    Guthrie, M.; Benmore, C. J.; Skinner, L. B.; ...

    2016-06-24

    In this study, we present crystallographic analyses of high-energy X-ray diffraction data on polycrystalline UO 2 up to the melting temperature. The Rietveld refinements of our X-ray data are in agreement with previous measurements, but are systematically located around the upper bound of their uncertainty, indicating a slightly steeper trend of thermal expansion compared to established values. This observation is consistent with recent first principles calculations.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hunter, Mark S.; Yoon, Chun Hong; DeMirci, Hasan

    Structural information about biological macromolecules near the atomic scale provides important insight into the functions of these molecules. To date, X-ray crystallography has been the predominant method used for macromolecular structure determination. However, challenges exist when solving structures with X-rays, including the phase problem and radiation damage. X-ray-free electron lasers (X-ray FELs) have enabled collection of diffraction information before the onset of radiation damage, yet the majority of structures solved at X-ray FELs have been phased using external information via molecular replacement. De novo phasing at X-ray FELs has proven challenging due in part to per-pulse variations in intensity andmore » wavelength. Here we report the solution of a selenobiotinyl-streptavidin structure using phases obtained by the anomalous diffraction of selenium measured at a single wavelength (Se-SAD) at the Linac Coherent Light Source. Finally, our results demonstrate Se-SAD, routinely employed at synchrotrons for novel structure determination, is now possible at X-ray FELs.« less

  5. Phase modulation due to crystal diffraction by ptychographic imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Civita, M.; Diaz, A.; Bean, R. J.

    Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

  6. Track membranes with open pores used as diffractive filters for space-based x-ray and EUV solar observations.

    PubMed

    Dominique, Marie; Mitrofanov, A V; Hochedez, J-F; Apel, P Yu; Schühle, U; Pudonin, F A; Orelovich, O L; Zuev, S Yu; Bolsée, D; Hermans, C; BenMoussa, A

    2009-02-10

    We describe the fabrication and performance of diffractive filters designed for space-based x-ray and EUV solar observations. Unlike traditional thin film filters, diffractive filters can be made to have a high resistance against the destructive mechanical and acoustic loads of a satellite launch. The filters studied are made of plastic track-etched membranes that are metal-coated on one side only. They have all-through open cylindrical pores with diameters as small as 500 nm, limiting their transmittance to very short wavelengths. The spectral transmittance of various diffractive filters with different pore parameters was measured from the soft x-ray to the near IR range (namely, from 1-1100 nm).

  7. Phase modulation due to crystal diffraction by ptychographic imaging

    DOE PAGES

    Civita, M.; Diaz, A.; Bean, R. J.; ...

    2018-03-06

    Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

  8. Phase modulation due to crystal diffraction by ptychographic imaging

    NASA Astrophysics Data System (ADS)

    Civita, M.; Diaz, A.; Bean, R. J.; Shabalin, A. G.; Gorobtsov, O. Yu.; Vartanyants, I. A.; Robinson, I. K.

    2018-03-01

    Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samples using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.

  9. Nanomodulated electron beams via electron diffraction and emittance exchange for coherent x-ray generation

    DOE PAGES

    Nanni, E. A.; Graves, W. S.; Moncton, D. E.

    2018-01-19

    We present a new method for generation of relativistic electron beams with current modulation on the nanometer scale and below. The current modulation is produced by diffracting relativistic electrons in single crystal Si, accelerating the diffracted beam and imaging the crystal structure, then transferring the image into the temporal dimension via emittance exchange. The modulation period can be tuned by adjusting electron optics after diffraction. This tunable longitudinal modulation can have a period as short as a few angstroms, enabling production of coherent hard x-rays from a source based on inverse Compton scattering with total accelerator length of approximately tenmore » meters. Electron beam simulations from cathode emission through diffraction, acceleration, and image formation with variable magnification are presented along with estimates of the coherent x-ray output properties.« less

  10. Nanomodulated electron beams via electron diffraction and emittance exchange for coherent x-ray generation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nanni, E. A.; Graves, W. S.; Moncton, D. E.

    We present a new method for generation of relativistic electron beams with current modulation on the nanometer scale and below. The current modulation is produced by diffracting relativistic electrons in single crystal Si, accelerating the diffracted beam and imaging the crystal structure, then transferring the image into the temporal dimension via emittance exchange. The modulation period can be tuned by adjusting electron optics after diffraction. This tunable longitudinal modulation can have a period as short as a few angstroms, enabling production of coherent hard x-rays from a source based on inverse Compton scattering with total accelerator length of approximately tenmore » meters. Electron beam simulations from cathode emission through diffraction, acceleration, and image formation with variable magnification are presented along with estimates of the coherent x-ray output properties.« less

  11. Coherent diffraction imaging analysis of shape-controlled nanoparticles with focused hard X-ray free-electron laser pulses.

    PubMed

    Takahashi, Yukio; Suzuki, Akihiro; Zettsu, Nobuyuki; Oroguchi, Tomotaka; Takayama, Yuki; Sekiguchi, Yuki; Kobayashi, Amane; Yamamoto, Masaki; Nakasako, Masayoshi

    2013-01-01

    We report the first demonstration of the coherent diffraction imaging analysis of nanoparticles using focused hard X-ray free-electron laser pulses, allowing us to analyze the size distribution of particles as well as the electron density projection of individual particles. We measured 1000 single-shot coherent X-ray diffraction patterns of shape-controlled Ag nanocubes and Au/Ag nanoboxes and estimated the edge length from the speckle size of the coherent diffraction patterns. We then reconstructed the two-dimensional electron density projection with sub-10 nm resolution from selected coherent diffraction patterns. This method enables the simultaneous analysis of the size distribution of synthesized nanoparticles and the structures of particles at nanoscale resolution to address correlations between individual structures of components and the statistical properties in heterogeneous systems such as nanoparticles and cells.

  12. Cryogenic X-Ray Diffraction Microscopy for Biological Samples

    NASA Astrophysics Data System (ADS)

    Lima, Enju; Wiegart, Lutz; Pernot, Petra; Howells, Malcolm; Timmins, Joanna; Zontone, Federico; Madsen, Anders

    2009-11-01

    X-ray diffraction microscopy (XDM) is well suited for nondestructive, high-resolution biological imaging, especially for thick samples, with the high penetration power of x rays and without limitations imposed by a lens. We developed nonvacuum, cryogenic (cryo-) XDM with hard x rays at 8 keV and report the first frozen-hydrated imaging by XDM. By preserving samples in amorphous ice, the risk of artifacts associated with dehydration or chemical fixation is avoided, ensuring the imaging condition closest to their natural state. The reconstruction shows internal structures of intact D. radiodurans bacteria in their natural contrast.

  13. Single-pulse coherent diffraction imaging using soft x-ray laser.

    PubMed

    Kang, Hyon Chol; Kim, Hyung Taek; Kim, Sang Soo; Kim, Chan; Yu, Tae Jun; Lee, Seong Ku; Kim, Chul Min; Kim, I Jong; Sung, Jae Hee; Janulewicz, Karol A; Lee, Jongmin; Noh, Do Young

    2012-05-15

    We report a coherent diffraction imaging (CDI) using a single 8 ps soft x-ray laser pulse at a wavelength of 13.9 nm. The soft x-ray pulse was generated by a laboratory-scale intense pumping laser providing coherent x-ray pulses up to the level of 10(11) photons/pulse. A spatial resolution below 194 nm was achieved with a single pulse, and it was shown that a resolution below 55 nm is feasible with improved detector capability. The single-pulse CDI might provide a way to investigate dynamics of nanoscale molecules or particles.

  14. Observation of the strain field near the Si(111) 7 x 7 surface with a new X-ray diffraction technique.

    PubMed

    Emoto, T; Akimoto, K; Ichimiya, A

    1998-05-01

    A new X-ray diffraction technique has been developed in order to measure the strain field near a solid surface under ultrahigh vacuum (UHV) conditions. The X-ray optics use an extremely asymmetric Bragg-case bulk reflection. The glancing angle of the X-rays can be set near the critical angle of total reflection by tuning the X-ray energy. Using this technique, rocking curves for Si surfaces with different surface structures, i.e. a native oxide surface, a slightly oxide surface and an Si(111) 7 x 7 surface, were measured. It was found that the widths of the rocking curves depend on the surface structures. This technique is efficient in distinguishing the strain field corresponding to each surface structure.

  15. Preparation, crystallization and preliminary X-ray diffraction analysis of two intestinal fatty-acid binding proteins in the presence of 11-(dansylamino)undecanoic acid

    PubMed Central

    Laguerre, Aisha; Wielens, Jerome; Parker, Michael W.; Porter, Christopher J. H.; Scanlon, Martin J.

    2011-01-01

    Fatty-acid binding proteins (FABPs) are abundantly expressed proteins that bind a range of lipophilic molecules. They have been implicated in the import and intracellular distribution of their ligands and have been linked with metabolic and inflammatory responses in the cells in which they are expressed. Despite their high sequence identity, human intestinal FABP (hIFABP) and rat intestinal FABP (rIFABP) bind some ligands with different affinities. In order to address the structural basis of this differential binding, diffraction-quality crystals have been obtained of hIFABP and rIFABP in complex with the fluorescent fatty-acid analogue 11-(dansylamino)undecanoic acid. PMID:21301109

  16. Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

    PubMed

    Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

    2007-02-01

    D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

  17. Development of a synchrotron biaxial tensile device for in situ characterization of thin films mechanical response.

    PubMed

    Geandier, G; Thiaudière, D; Randriamazaoro, R N; Chiron, R; Djaziri, S; Lamongie, B; Diot, Y; Le Bourhis, E; Renault, P O; Goudeau, P; Bouaffad, A; Castelnau, O; Faurie, D; Hild, F

    2010-10-01

    We have developed on the DIFFABS-SOLEIL beamline a biaxial tensile machine working in the synchrotron environment for in situ diffraction characterization of thin polycrystalline films mechanical response. The machine has been designed to test compliant substrates coated by the studied films under controlled, applied strain field. Technological challenges comprise the sample design including fixation of the substrate ends, the related generation of a uniform strain field in the studied (central) volume, and the operations from the beamline pilot. Preliminary tests on 150 nm thick W films deposited onto polyimide cruciform substrates are presented. The obtained results for applied strains using x-ray diffraction and digital image correlation methods clearly show the full potentialities of this new setup.

  18. Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

    PubMed Central

    Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya

    2006-01-01

    A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326

  19. Single-particle coherent diffractive imaging with a soft x-ray free electron laser: towards soot aerosol morphology

    NASA Astrophysics Data System (ADS)

    Bogan, Michael J.; Starodub, Dmitri; Hampton, Christina Y.; Sierra, Raymond G.

    2010-10-01

    The first of its kind, the Free electron LASer facility in Hamburg, FLASH, produces soft x-ray pulses with unprecedented properties (10 fs, 6.8-47 nm, 1012 photons per pulse, 20 µm diameter). One of the seminal FLASH experiments is single-pulse coherent x-ray diffractive imaging (CXDI). CXDI utilizes the ultrafast and ultrabright pulses to overcome resolution limitations in x-ray microscopy imposed by x-ray-induced damage to the sample by 'diffracting before destroying' the sample on sub-picosecond timescales. For many lensless imaging algorithms used for CXDI it is convenient when the data satisfy an oversampling constraint that requires the sample to be an isolated object, i.e. an individual 'free-standing' portion of disordered matter delivered to the centre of the x-ray focus. By definition, this type of matter is an aerosol. This paper will describe the role of aerosol science methodologies used for the validation of the 'diffract before destroy' hypothesis and the execution of the first single-particle CXDI experiments being developed for biological imaging. FLASH CXDI now enables the highest resolution imaging of single micron-sized or smaller airborne particulate matter to date while preserving the native substrate-free state of the aerosol. Electron microscopy offers higher resolution for single-particle analysis but the aerosol must be captured on a substrate, potentially modifying the particle morphology. Thus, FLASH is poised to contribute significant advancements in our knowledge of aerosol morphology and dynamics. As an example, we simulate CXDI of combustion particle (soot) morphology and introduce the concept of extracting radius of gyration of fractal aggregates from single-pulse x-ray diffraction data. Future upgrades to FLASH will enable higher spatially and temporally resolved single-particle aerosol dynamics studies, filling a critical technological need in aerosol science and nanotechnology. Many of the methodologies described for FLASH will directly translate to use at hard x-ray free electron lasers.

  20. Electronic and atomic structures of Ti{sub 1-x}Al{sub x}N thin films related to their damage behavior

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tuilier, M.-H.; Pac, M.-J.; Girleanu, M.

    2008-04-15

    Ti and Al K-edge x-ray absorption spectroscopy is used to investigate the electronic structure of Ti{sub 1-x}Al{sub x}N thin films deposited by reactive magnetron sputtering. The experimental near edge spectra of TiN and AlN are interpreted in the light of unoccupied density of state band structure calculations. The comparison of the structural parameters derived from x-ray absorption fine structure and x-ray diffraction reveals segregation between Al-rich and Ti-rich domains within the Ti{sub 1-x}Al{sub x}N films. Whereas x-ray diffraction probes only the crystallized domains, the structural information derived from extended x-ray absorption fine structure analysis turns on both crystalline and grainmore » boundaries. The results are discussed by considering the damage behavior of the films depending on the composition.« less

  1. Purification, crystallization and preliminary X-ray crystallographic analysis of a cysteine-rich secretory protein (CRISP) from Naja atra venom.

    PubMed

    Wang, Yu-Ling; Goh, King-Xiang; Wu, Wen-guey; Chen, Chun-Jung

    2004-10-01

    Cysteine-rich secretory proteins (CRISPs) play an important role in the innate immune system and are transcriptionally regulated by androgens in several tissues. The proteins are mostly found in the epididymis and granules of mammals, whilst a number of snake venoms also contain CRISP-family proteins. The natrin protein from the venom of Naja atra (Taiwan cobra), which belongs to a family of CRISPs and has a cysteine-rich C-terminal amino-acid sequence, has been purified using a three-stage chromatography procedure and crystals suitable for X-ray analysis have been obtained using the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.58 A resolution using synchrotron radiation; the crystals belong to space group C222(1), with unit-cell parameters a = 59.172, b = 65.038, c = 243.156 A. There are two protein molecules in the asymmetric unit and the Matthews coefficient is estimated to be 2.35 A3 Da(-1), corresponding to a solvent content of 47.60%.

  2. Mesozoic clay diagenesis in the Appalachian Plateau

    NASA Astrophysics Data System (ADS)

    Boles, A.; Mulch, A.; van der Pluijm, B.

    2017-12-01

    Integrated investigation of authigenic clays in the Appalachian Plateau of the northeastern US Midcontinent using X-ray goniometry, Rietveld-method based illite polytype analysis, and 40Ar/39Ar geochronology yields novel insights about the structural diagenetic history of the North American sedimentary cover sequence. Texture analysis by High Resolution X-ray Texture Goniometry records the presence of a bedding-parallel diagenetic fabric, corresponding to a burial depth of 2-5 km. New development of polytype modeling using BGMN®, a quantitative X-ray powder diffraction forward modeling and whole-pattern matching program matches mineralic characteristic of illite at those depths and reduces uncertainty estimates in age analysis. Based on dating size fractions, the diagenetic age is constrained to 225-250 Ma (Triassic) by four authigenic illite samples, reflecting protracted, regional diagenesis in the area. Preliminary H isotopic analysis points to a surface-derived diagenetic fluid with δD values ranging from -48 to -72‰ (in the range of predicted Pangea meteoric fluid), with a dependence on proximity to the Appalachian Mountains that may reflect a rain shadow effect.

  3. Structure of rare-earth chalcogenide glasses by neutron and x-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drewitt, James W. E.; Salmon, Philip S.; Zeidler, Anita

    The method of neutron diffraction with isomorphic substitution was used to measure the structure of the rare-earth chalcogenide glasses (R 2X 3) 0.07(Ga 2X 3) 0.33(GeX 2) 0.60 with R = La or Ce and X = S or Se. X-ray diffraction was also used to measure the structure of the sulphide glass. The results are consistent with networks that are built from GeX 4 and GaX 4 tetrahedra, and give R-S and R-Se coordination numbers of 8.0(2) and 8.5(4), respectively. The minimum nearest-neighbour R-R distance associated with rare-earth clustering is discussed.

  4. Structure of rare-earth chalcogenide glasses by neutron and x-ray diffraction

    DOE PAGES

    Drewitt, James W. E.; Salmon, Philip S.; Zeidler, Anita; ...

    2017-04-28

    The method of neutron diffraction with isomorphic substitution was used to measure the structure of the rare-earth chalcogenide glasses (R 2X 3) 0.07(Ga 2X 3) 0.33(GeX 2) 0.60 with R = La or Ce and X = S or Se. X-ray diffraction was also used to measure the structure of the sulphide glass. The results are consistent with networks that are built from GeX 4 and GaX 4 tetrahedra, and give R-S and R-Se coordination numbers of 8.0(2) and 8.5(4), respectively. The minimum nearest-neighbour R-R distance associated with rare-earth clustering is discussed.

  5. Publications - GMC 145 | Alaska Division of Geological & Geophysical

    Science.gov Websites

    DGGS GMC 145 Publication Details Title: Analytical results of x-ray diffraction studies on tuff beds , Analytical results of x-ray diffraction studies on tuff beds from core of the following 5 NPRA wells: U.S

  6. Coherent Soft X-ray Diffraction Imaging of Coliphage PR772 at the Linac Coherent Light Source

    DOE Data Explorer

    Reddy, Hemanth, K.N.

    2017-01-05

    A dataset of coherent soft X-ray diffraction images of Coliphage PR772 virus, collected at the Atomic Molecular Optics (AMO) beamline with pnCCD detectors in the LAMP instrument at the Linac Coherent Light Source.

  7. Combined synchrotron X-ray tomography and X-ray powder diffraction using a fluorescing metal foil.

    PubMed

    Kappen, P; Arhatari, B D; Luu, M B; Balaur, E; Caradoc-Davies, T

    2013-06-01

    This study realizes the concept of simultaneous micro-X-ray computed tomography and X-ray powder diffraction using a synchrotron beamline. A thin zinc metal foil was placed in the primary, monochromatic synchrotron beam to generate a divergent wave to propagate through the samples of interest onto a CCD detector for tomographic imaging, thus removing the need for large beam illumination and high spatial resolution detection. Both low density materials (kapton tubing and a piece of plant) and higher density materials (Egyptian faience) were investigated, and elemental contrast was explored for the example of Cu and Ni meshes. The viability of parallel powder diffraction using the direct beam transmitted through the foil was demonstrated. The outcomes of this study enable further development of the technique towards in situ tomography∕diffraction studies combining micrometer and crystallographic length scales, and towards elemental contrast imaging and reconstruction methods using well defined fluorescence outputs from combinations of known fluorescence targets (elements).

  8. AUSPEX: a graphical tool for X-ray diffraction data analysis.

    PubMed

    Thorn, Andrea; Parkhurst, James; Emsley, Paul; Nicholls, Robert A; Vollmar, Melanie; Evans, Gwyndaf; Murshudov, Garib N

    2017-09-01

    In this paper, AUSPEX, a new software tool for experimental X-ray data analysis, is presented. Exploring the behaviour of diffraction intensities and the associated estimated uncertainties facilitates the discovery of underlying problems and can help users to improve their data acquisition and processing in order to obtain better structural models. The program enables users to inspect the distribution of observed intensities (or amplitudes) against resolution as well as the associated estimated uncertainties (sigmas). It is demonstrated how AUSPEX can be used to visually and automatically detect ice-ring artefacts in integrated X-ray diffraction data. Such artefacts can hamper structure determination, but may be difficult to identify from the raw diffraction images produced by modern pixel detectors. The analysis suggests that a significant portion of the data sets deposited in the PDB contain ice-ring artefacts. Furthermore, it is demonstrated how other problems in experimental X-ray data caused, for example, by scaling and data-conversion procedures can be detected by AUSPEX.

  9. Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

    DOE PAGES

    Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

    2016-08-09

    In this paper, we present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional datamore » cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. Finally, we demonstrate this 'big data' approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.« less

  10. Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

    In this paper, we present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional datamore » cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. Finally, we demonstrate this 'big data' approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.« less

  11. A laboratory based system for laue micro x-ray diffraction.

    PubMed

    Lynch, P A; Stevenson, A W; Liang, D; Parry, D; Wilkins, S; Tamura, N

    2007-02-01

    A laboratory diffraction system capable of illuminating individual grains in a polycrystalline matrix is described. Using a microfocus x-ray source equipped with a tungsten anode and prefigured monocapillary optic, a micro-x-ray diffraction system with a 10 microm beam was developed. The beam profile generated by the ellipsoidal capillary was determined using the "knife edge" approach. Measurement of the capillary performance, indicated a beam divergence of 14 mrad and a useable energy bandpass from 5.5 to 19 keV. Utilizing the polychromatic nature of the incident x-ray beam and application of the Laue indexing software package X-Ray Micro-Diffraction Analysis Software, the orientation and deviatoric strain of single grains in a polycrystalline material can be studied. To highlight the system potential the grain orientation and strain distribution of individual grains in a polycrystalline magnesium alloy (Mg 0.2 wt % Nd) was mapped before and after tensile loading. A basal (0002) orientation was identified in the as-rolled annealed alloy; after tensile loading some grains were observed to undergo an orientation change of 30 degrees with respect to (0002). The applied uniaxial load was measured as an increase in the deviatoric tensile strain parallel to the load axis.

  12. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging

    PubMed Central

    Warren, Anna J.; Armour, Wes; Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R.; Horrell, Sam; McAuley, Katherine E.; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf

    2013-01-01

    The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required. PMID:23793151

  13. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging.

    PubMed

    Warren, Anna J; Armour, Wes; Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R; Horrell, Sam; McAuley, Katherine E; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf

    2013-07-01

    The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required.

  14. Monochromatic X-ray sources based on a mechanism of real and virtual photon diffraction in crystals

    NASA Astrophysics Data System (ADS)

    Wagner, A. R.; Kuznetsov, S. I.; Potylitsyn, A. P.; Razin, S. V.; Uglov, S. R.; Zabaev, V. N.

    2008-09-01

    A source of monochromatic X-ray radiation is wanted in industry, science, medicine and so on. Many ways of making such a source are known. The present work describes two mechanisms for the creation of a monochromatic X-ray beam, which are parametric X-ray radiation (PXR) and bremsstrahlung diffraction (DBS). Both the experiments were carried out using an electron beam at a microtron. During the first experiment, the DBS process was investigated as a scattering of the Bremsstrahlung (BS) beam on the crystallographic surfaces of tungsten and pyrolytic graphite crystals. The second experiment consisted in the registration of the PXR and DBS yield during the passage of the electrons through the same crystals as in the first experiment. The spectral and orientation radiation characteristics and simulation results obtained for the DBS and PXR processes are presented. It is shown that the usage of mosaic crystalline targets is rather useful in order to obtain a monochromatic X-ray source based on bremsstrahlung diffraction from moderately relativistic electrons.

  15. Insights into photosystem II from isomorphous difference Fourier maps of femtosecond X-ray diffraction data and quantum mechanics/molecular mechanics structural models

    DOE PAGES

    Wang, Jimin; Askerka, Mikhail; Brudvig, Gary W.; ...

    2017-01-12

    Understanding structure–function relations in photosystem II (PSII) is important for the development of biomimetic photocatalytic systems. X-ray crystallography, computational modeling, and spectroscopy have played central roles in elucidating the structure and function of PSII. Recent breakthroughs in femtosecond X-ray crystallography offer the possibility of collecting diffraction data from the X-ray free electron laser (XFEL) before radiation damage of the sample, thereby overcoming the main challenge of conventional X-ray diffraction methods. However, the interpretation of XFEL data from PSII intermediates is challenging because of the issues regarding data-processing, uncertainty on the precise positions of light oxygen atoms next to heavy metalmore » centers, and different kinetics of the S-state transition in microcrystals compared to solution. Lastly, we summarize recent advances and outstanding challenges in PSII structure–function determination with emphasis on the implementation of quantum mechanics/molecular mechanics techniques combined with isomorphous difference Fourier maps, direct methods, and high-resolution spectroscopy.« less

  16. Single-shot full strain tensor determination with microbeam X-ray Laue diffraction and a two-dimensional energy-dispersive detector.

    PubMed

    Abboud, A; Kirchlechner, C; Keckes, J; Conka Nurdan, T; Send, S; Micha, J S; Ulrich, O; Hartmann, R; Strüder, L; Pietsch, U

    2017-06-01

    The full strain and stress tensor determination in a triaxially stressed single crystal using X-ray diffraction requires a series of lattice spacing measurements at different crystal orientations. This can be achieved using a tunable X-ray source. This article reports on a novel experimental procedure for single-shot full strain tensor determination using polychromatic synchrotron radiation with an energy range from 5 to 23 keV. Microbeam X-ray Laue diffraction patterns were collected from a copper micro-bending beam along the central axis (centroid of the cross section). Taking advantage of a two-dimensional energy-dispersive X-ray detector (pnCCD), the position and energy of the collected Laue spots were measured for multiple positions on the sample, allowing the measurement of variations in the local microstructure. At the same time, both the deviatoric and hydrostatic components of the elastic strain and stress tensors were calculated.

  17. Demonstration of the feasibility of an integrated x ray laboratory for planetary exploration

    NASA Technical Reports Server (NTRS)

    Franco, E. D.; Kerner, J. A.; Koppel, L. N.; Boyle, M. J.

    1993-01-01

    The identification of minerals and elemental compositions is an important component in the geological and exobiological exploration of the solar system. X ray diffraction and fluorescence are common techniques for obtaining these data. The feasibility of combining these analytical techniques in an integrated x ray laboratory compatible with the volume, mass, and power constraints imposed by many planetary missions was demonstrated. Breadboard level hardware was developed to cover the range of diffraction lines produced by minerals, clays, and amorphous; and to detect the x ray fluorescence emissions of elements from carbon through uranium. These breadboard modules were fabricated and used to demonstrate the ability to detect elements and minerals. Additional effort is required to establish the detection limits of the breadboard modules and to integrate diffraction and fluorescence techniques into a single unit. It was concluded that this integrated x ray laboratory capability will be a valuable tool in the geological and exobiological exploration of the solar system.

  18. Insights into Photosystem II from Isomorphous Difference Fourier Maps of Femtosecond X-ray Diffraction Data and Quantum Mechanics/Molecular Mechanics Structural Models.

    PubMed

    Wang, Jimin; Askerka, Mikhail; Brudvig, Gary W; Batista, Victor S

    2017-02-10

    Understanding structure-function relations in photosystem II (PSII) is important for the development of biomimetic photocatalytic systems. X-ray crystallography, computational modeling, and spectroscopy have played central roles in elucidating the structure and function of PSII. Recent breakthroughs in femtosecond X-ray crystallography offer the possibility of collecting diffraction data from the X-ray free electron laser (XFEL) before radiation damage of the sample, thereby overcoming the main challenge of conventional X-ray diffraction methods. However, the interpretation of XFEL data from PSII intermediates is challenging because of the issues regarding data-processing, uncertainty on the precise positions of light oxygen atoms next to heavy metal centers, and different kinetics of the S-state transition in microcrystals compared to solution. Here, we summarize recent advances and outstanding challenges in PSII structure-function determination with emphasis on the implementation of quantum mechanics/molecular mechanics techniques combined with isomorphous difference Fourier maps, direct methods, and high-resolution spectroscopy.

  19. Insights into photosystem II from isomorphous difference Fourier maps of femtosecond X-ray diffraction data and quantum mechanics/molecular mechanics structural models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jimin; Askerka, Mikhail; Brudvig, Gary W.

    Understanding structure–function relations in photosystem II (PSII) is important for the development of biomimetic photocatalytic systems. X-ray crystallography, computational modeling, and spectroscopy have played central roles in elucidating the structure and function of PSII. Recent breakthroughs in femtosecond X-ray crystallography offer the possibility of collecting diffraction data from the X-ray free electron laser (XFEL) before radiation damage of the sample, thereby overcoming the main challenge of conventional X-ray diffraction methods. However, the interpretation of XFEL data from PSII intermediates is challenging because of the issues regarding data-processing, uncertainty on the precise positions of light oxygen atoms next to heavy metalmore » centers, and different kinetics of the S-state transition in microcrystals compared to solution. Lastly, we summarize recent advances and outstanding challenges in PSII structure–function determination with emphasis on the implementation of quantum mechanics/molecular mechanics techniques combined with isomorphous difference Fourier maps, direct methods, and high-resolution spectroscopy.« less

  20. Coherent convergent-beam time-resolved X-ray diffraction

    PubMed Central

    Spence, John C. H.; Zatsepin, Nadia A.; Li, Chufeng

    2014-01-01

    The use of coherent X-ray lasers for structural biology allows the use of nanometre diameter X-ray beams with large beam divergence. Their application to the structure analysis of protein nanocrystals and single particles raises new challenges and opportunities. We discuss the form of these coherent convergent-beam (CCB) hard X-ray diffraction patterns and their potential use for time-resolved crystallography, normally achieved by Laue (polychromatic) diffraction, for which the monochromatic laser radiation of a free-electron X-ray laser is unsuitable. We discuss the possibility of obtaining single-shot, angle-integrated rocking curves from CCB patterns, and the dependence of the resulting patterns on the focused beam coordinate when the beam diameter is larger or smaller than a nanocrystal, or smaller than one unit cell. We show how structure factor phase information is provided at overlapping interfering orders and how a common phase origin between different shots may be obtained. Their use in refinement of the phase-sensitive intensity between overlapping orders is suggested. PMID:24914153

  1. Nondestructive method and apparatus for imaging grains in curved surfaces of polycrystalline articles

    DOEpatents

    Carpenter, Donald A.

    1995-01-01

    A nondestructive method, and associated apparatus, are provided for determining the grain flow of the grains in a convex curved, textured polycrystalline surface. The convex, curved surface of a polycrystalline article is aligned in a horizontal x-ray diffractometer and a monochromatic, converging x-ray beam is directed onto the curved surface of the polycrystalline article so that the converging x-ray beam is diffracted by crystallographic planes of the grains in the polycrystalline article. The diffracted x-ray beam is caused to pass through a set of horizontal, parallel slits to limit the height of the beam and thereafter. The linear intensity of the diffracted x-ray is measured, using a linear position sensitive proportional counter, as a function of position in a direction orthogonal to the counter so as to generate two dimensional data. An image of the grains in the curved surface of the polycrystalline article is provided based on the two-dimensional data.

  2. Nondestructive method and apparatus for imaging grains in curved surfaces of polycrystalline articles

    DOEpatents

    Carpenter, D.A.

    1995-05-23

    A nondestructive method, and associated apparatus, are provided for determining the grain flow of the grains in a convex curved, textured polycrystalline surface. The convex, curved surface of a polycrystalline article is aligned in a horizontal x-ray diffractometer and a monochromatic, converging x-ray beam is directed onto the curved surface of the polycrystalline article so that the converging x-ray beam is diffracted by crystallographic planes of the grains in the polycrystalline article. The diffracted x-ray beam is caused to pass through a set of horizontal, parallel slits to limit the height of the beam and thereafter. The linear intensity of the diffracted x-ray is measured, using a linear position sensitive proportional counter, as a function of position in a direction orthogonal to the counter so as to generate two dimensional data. An image of the grains in the curved surface of the polycrystalline article is provided based on the two-dimensional data. 7 Figs.

  3. Observation of femtosecond X-ray interactions with matter using an X-ray–X-ray pump–probe scheme

    PubMed Central

    Inoue, Ichiro; Inubushi, Yuichi; Sato, Takahiro; Tono, Kensuke; Katayama, Tetsuo; Kameshima, Takashi; Ogawa, Kanade; Togashi, Tadashi; Owada, Shigeki; Amemiya, Yoshiyuki; Tanaka, Takashi; Hara, Toru

    2016-01-01

    Resolution in the X-ray structure determination of noncrystalline samples has been limited to several tens of nanometers, because deep X-ray irradiation required for enhanced resolution causes radiation damage to samples. However, theoretical studies predict that the femtosecond (fs) durations of X-ray free-electron laser (XFEL) pulses make it possible to record scattering signals before the initiation of X-ray damage processes; thus, an ultraintense X-ray beam can be used beyond the conventional limit of radiation dose. Here, we verify this scenario by directly observing femtosecond X-ray damage processes in diamond irradiated with extraordinarily intense (∼1019 W/cm2) XFEL pulses. An X-ray pump–probe diffraction scheme was developed in this study; tightly focused double–5-fs XFEL pulses with time separations ranging from sub-fs to 80 fs were used to excite (i.e., pump) the diamond and characterize (i.e., probe) the temporal changes of the crystalline structures through Bragg reflection. It was found that the pump and probe diffraction intensities remain almost constant for shorter time separations of the double pulse, whereas the probe diffraction intensities decreased after 20 fs following pump pulse irradiation due to the X-ray–induced atomic displacement. This result indicates that sub-10-fs XFEL pulses enable conductions of damageless structural determinations and supports the validity of the theoretical predictions of ultraintense X-ray–matter interactions. The X-ray pump–probe scheme demonstrated here would be effective for understanding ultraintense X-ray–matter interactions, which will greatly stimulate advanced XFEL applications, such as atomic structure determination of a single molecule and generation of exotic matters with high energy densities. PMID:26811449

  4. Fine Structure of Diffuse Scattering Rings in Al-Li-Cu Quasicrystal: A Comparative X-ray and Electron Diffraction Study

    NASA Astrophysics Data System (ADS)

    Donnadieu, P.; Dénoyer, F.

    1996-11-01

    A comparative X-ray and electron diffraction study has been performed on Al-Li-Cu icosahedral quasicrystal in order to investigate the diffuse scattering rings revealed by a previous work. Electron diffraction confirms the existence of rings but shows that the rings have a fine structure. The diffuse aspect on the X-ray diffraction patterns is then due to an averaging effect. Recent simulations based on the model of canonical cells related to the icosahedral packing give diffractions patterns in agreement with this fine structure effect. Nous comparons les diagrammes de diffraction des rayon-X et des électrons obtenus sur les mêmes échantillons du quasicristal icosaèdrique Al-Li-Cu. Notre but est d'étudier les anneaux de diffusion diffuse mis en évidence par un travail précédent. Les diagrammes de diffraction électronique confirment la présence des anneaux mais ils montrent aussi que ces anneaux possèdent une structure fine. L'aspect diffus des anneaux révélés par la diffraction des rayons X est dû à un effet de moyenne. Des simulations récentes basées sur la décomposition en cellules canoniques de l'empilement icosaédrique produisent des diagrammes de diffraction en accord avec ces effects de structure fine.

  5. Effect of Ar9+ irradiation on Zr-1Nb-1Sn-0.1Fe alloy characterized by Grazing Incidence X-ray diffraction technique

    NASA Astrophysics Data System (ADS)

    Dutta, Argha; Das, Kalipada; Gayathri, N.; Menon, Ranjini; Nabhiraj, P. Y.; Mukherjee, Paramita

    2018-03-01

    The microstructural parameters such as domain size and microstrain have been estimated from Grazing Incidence X-ray Diffraction (GIXRD) data for Ar9+ irradiated Zr-1Nb-1Sn-0.1Fe sample as a function of dpa (dose). Detail studies using X-ray Diffraction Line Profile Analysis (XRDLPA) from GIXRD data has been carried out to characterize the microstructural parameters like domain size and microstrain. The reorientation of the grains due to effect of irradiation at high dpa (dose) has been qualitatively assessed by the texture parameter P(hkl).

  6. Biological imaging by soft x-ray diffraction microscopy

    DOE PAGES

    Shapiro, D.; Thibault, P.; Beetz, T.; ...

    2005-10-25

    We have used the method of x-ray diffraction microscopy to image the complex-valued exit wave of an intact and unstained yeast cell. The images of the freeze-dried cell, obtained by using 750-eV x-rays from different angular orientations, portray several of the cell's major internal components to 30-nm resolution. The good agreement among the independently recovered structures demonstrates the accuracy of the imaging technique. To obtain the best possible reconstructions, we have implemented procedures for handling noisy and incomplete diffraction data, and we propose a method for determining the reconstructed resolution. This work represents a previously uncharacterized application of x-ray diffractionmore » microscopy to a specimen of this complexity and provides confidence in the feasibility of the ultimate goal of imaging biological specimens at 10-nm resolution in three dimensions.« less

  7. X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation in Ni-Pt multilayers [X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation

    DOE PAGES

    Kelly, B. G.; Loether, A.; Unruh, K. M.; ...

    2017-02-01

    An in situ optical pump and x-ray probe technique has been utilized to study photoinitiated solid-state diffusion in a Ni-Pt multilayer system. Hard x-ray diffraction has been used to follow the systematic growth of the NiPt alloy as a function of laser intensity and total energy deposited. It is observed that new phase growth can be driven in as little as one laser pulse, and that repeated photoexcitation can completely convert the entire multilayer structure into a single metallic alloy. In conclusion, the data suggest that lattice strain relaxation takes place prior to atomic diffusion and the formation of amore » NiPt alloy.« less

  8. X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation in Ni-Pt multilayers [X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kelly, B. G.; Loether, A.; Unruh, K. M.

    An in situ optical pump and x-ray probe technique has been utilized to study photoinitiated solid-state diffusion in a Ni-Pt multilayer system. Hard x-ray diffraction has been used to follow the systematic growth of the NiPt alloy as a function of laser intensity and total energy deposited. It is observed that new phase growth can be driven in as little as one laser pulse, and that repeated photoexcitation can completely convert the entire multilayer structure into a single metallic alloy. In conclusion, the data suggest that lattice strain relaxation takes place prior to atomic diffusion and the formation of amore » NiPt alloy.« less

  9. Spread spectrum phase modulation for coherent X-ray diffraction imaging.

    PubMed

    Zhang, Xuesong; Jiang, Jing; Xiangli, Bin; Arce, Gonzalo R

    2015-09-21

    High dynamic range, phase ambiguity and radiation limited resolution are three challenging issues in coherent X-ray diffraction imaging (CXDI), which limit the achievable imaging resolution. This paper proposes a spread spectrum phase modulation (SSPM) method to address the aforementioned problems in a single strobe. The requirements on phase modulator parameters are presented, and a practical implementation of SSPM is discussed via ray optics analysis. Numerical experiments demonstrate the performance of SSPM under the constraint of available X-ray optics fabrication accuracy, showing its potential to real CXDI applications.

  10. Nanofiber-Based Bulk-Heterojunction Organic Solar Cells Using Coaxial Electrospinning

    DTIC Science & Technology

    2012-01-01

    chains are likely oriented with the [010] direction, perpendicular to the substrate, in the fi lm device. Glancing incidence X - ray diffraction (GIXD...Electron and X - ray diffraction measurements were per- formed in order to study the structural order in annealed fi bers and devices. For reference... angle X - ray scattering (SAXS/WAXS) beamline 7.3.3 of the Advanced Light Source at Lawrence Berkeley National Laboratory at 10 keV (1.24 Å) from a bend

  11. Three-dimensional x-ray diffraction nanoscopy

    NASA Astrophysics Data System (ADS)

    Nikulin, Andrei Y.; Dilanian, Ruben A.; Zatsepin, Nadia A.; Muddle, Barry C.

    2008-08-01

    A novel approach to x-ray diffraction data analysis for non-destructive determination of the shape of nanoscale particles and clusters in three-dimensions is illustrated with representative examples of composite nanostructures. The technique is insensitive to the x-rays coherence, which allows 3D reconstruction of a modal image without tomographic synthesis and in-situ analysis of large (over a several cubic millimeters) volume of material with a spatial resolution of few nanometers, rendering the approach suitable for laboratory facilities.

  12. A Compact X-Ray System for Support of High Throughput Crystallography

    NASA Technical Reports Server (NTRS)

    Ciszak, Ewa; Gubarev, Mikhail; Gibson, Walter M.; Joy, Marshall K.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Standard x-ray systems for crystallography rely on massive generators coupled with optics that guide X-ray beams onto the crystal sample. Optics for single-crystal diffractometry include total reflection mirrors, polycapillary optics or graded multilayer monochromators. The benefit of using polycapillary optic is that it can collect x-rays over tile greatest solid angle, and thus most efficiently, utilize the greatest portion of X-rays emitted from the Source, The x-ray generator has to have a small anode spot, and thus its size and power requirements can be substantially reduced We present the design and results from the first high flux x-ray system for crystallography that combine's a microfocus X-ray generator (40microns FWHM Spot size at a power of 45 W) and a collimating, polycapillary optic. Diffraction data collected from small test crystals with cell dimensions up to 160A (lysozyme and thaumatin) are of high quality. For example, diffraction data collected from a lysozyme crystal at RT yielded R=5.0% for data extending to 1.70A. We compare these results with measurements taken from standard crystallographic systems. Our current microfocus X-ray diffraction system is attractive for supporting crystal growth research in the standard crystallography laboratory as well as in remote, automated crystal growth laboratory. Its small volume, light-weight, and low power requirements are sufficient to have it installed in unique environments, i.e.. on-board International Space Station.

  13. Expression, crystallization and preliminary X-ray diffraction studies of recombinant Clostridium perfringens β2-toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gurjar, Abhijit A.; Yennawar, Neela H.; Yennawar, Hemant P.

    2007-06-01

    The cloning, expression, purification and crystallization of recombinant Clostridium perfringens β2-toxin is described. The crystals diffracted to 2.9 Å resolution. Clostridium perfringens is a Gram-positive sporulating anaerobic bacterium that is responsible for a wide spectrum of diseases in animals, birds and humans. The virulence of C. perfringens is associated with the production of several enterotoxins and exotoxins. β2-toxin is a 28 kDa exotoxin produced by C. perfringens. It is implicated in necrotic enteritis in animals and humans, a disease characterized by a sudden acute onset with lethal hemorrhagic mucosal ulceration. The recombinant expression, purification and crystallization of β2-toxin using themore » batch-under-oil technique are reported here. Native X-ray diffraction data were obtained to 2.9 Å resolution on a synchrotron beamline at the F2 station at Cornell High Energy Synchrotron Source (CHESS) using an ADSC Quantum-210 CCD detector. The crystals belong to space group R3, with a dimer in the asymmetric unit; the unit-cell parameters are a = b = 103.71, c = 193.48 Å, α = β = 90, γ = 120° using the hexagonal axis setting. A self-rotation function shows that the two molecules are related by a noncrystallographic twofold axis with polar angles ω = 90.0, ϕ = 210.3°.« less

  14. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain

    PubMed Central

    Rodamilans, Bernardo; Montoya, Guillermo

    2007-01-01

    DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195

  15. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain.

    PubMed

    Rodamilans, Bernardo; Montoya, Guillermo

    2007-04-01

    DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).

  16. Characterization of ion beam sputtered deposited W/Si multilayers by grazing incidence x-ray diffraction and x-ray reflectivity technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dhawan, Rajnish, E-mail: rajnish@rrcat.gov.in; Rai, Sanjay

    2016-05-23

    W/Si multilayers four samples have been deposited on silicon substrate using ion beam sputtering system. Thickness of tungsten (W) varies from around 10 Å to 40 Å while the silicon (Si) thickness remains constant at around 30 Å in multilayers [W-Si]{sub x4}. The samples have been characterized by grazing incidence X-ray diffraction (GIXRD) and X-ray reflectivity technique (XRR). GIXRD study shows the crystalline behaviour of W/Si multilayer by varying W thickness and it is found that above 20 Å the W film transform from amorphous to crystalline phase and X-ray reflectivity data shows that the roughnesses of W increases onmore » increasing the W thicknesses in W/Si multilayers.« less

  17. Single-crystal films of a combination of materials (co-crystal) involving DAST and IR-125 for electro-optic applications

    NASA Astrophysics Data System (ADS)

    Narayanan, A.; Titus, J.; Rajagopalan, H.; Vippa, P.; Thakur, M.

    2006-03-01

    Single-crystal film of DAST (4'-dimethylamino-N-methyl-4-stilbazolium tosylate) has been shown [1] to have exceptionally large electro-optic coefficients (r11 ˜ 770 pm/V at 633 nm). In this report, single crystal film of a combination of materials (co-crystal) involving DAST and a dye molecule IR-125 will be discussed. Modified shear method was used to prepare the co-crystal films. The film has been characterized using polarized optical microscopy, optical absorption spectroscopy and x-ray diffraction. The optical absorption spectrum has two major bands: one at about 350--600 nm corresponding to DAST and the other at about 600-900 nm corresponding to IR-125. The x-ray diffraction results show peaks involving the presence of DAST and IR-125 within the co-crystal film. Since the co-crystal has strong absorption at longer wavelengths it is expected to show higher electro-optic coefficients at longer wavelengths. Preliminary measurements at 1.55 μm indicate a high electro-optic coefficient of the co-crystal film. [1] Swamy, Kutty, Titus, Khatavkar, Thakur, Appl. Phys. Lett. 2004, 85, 4025; Kutty, Thakur, Appl. Phys. Lett. 2005, 87, 191111.

  18. Near-surface density profiling of Fe ion irradiated Si (100) using extremely asymmetric x-ray diffraction by variation of the wavelength

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khanbabaee, B., E-mail: khanbabaee@physik.uni-siegen.de; Pietsch, U.; Facsko, S.

    2014-10-20

    In this work, we report on correlations between surface density variations and ion parameters during ion beam-induced surface patterning process. The near-surface density variations of irradiated Si(100) surfaces were investigated after off-normal irradiation with 5 keV Fe ions at different fluences. In order to reduce the x-ray probing depth to a thickness below 5 nm, the extremely asymmetrical x-ray diffraction by variation of wavelength was applied, exploiting x-ray refraction at the air-sample interface. Depth profiling was achieved by measuring x-ray rocking curves as function of varying wavelengths providing incidence angles down to 0°. The density variation was extracted from the deviationsmore » from kinematical Bragg angle at grazing incidence angles due to refraction of the x-ray beam at the air-sample interface. The simulations based on the dynamical theory of x-ray diffraction revealed that while a net near-surface density decreases with increasing ion fluence which is accompanied by surface patterning, there is a certain threshold of ion fluence to surface density modulation. Our finding suggests that the surface density variation can be relevant with the mechanism of pattern formation.« less

  19. Mineralogy, Three Dimensional Structure, and Oxygen Isotope Ratios of Four Crystalline Particles from Comet 81P/Wild 2

    NASA Technical Reports Server (NTRS)

    Nakamura, T.; Noguchi, T.; Tsuchiyama, A.; Ushikubo, T.; Kita, N. T.; Valley, J. W.; Zolensky, M. E.; Kakazu, Y.; Sakamoto, K.; Mashio, E.; hide

    2008-01-01

    Preliminary examinations of small dust particles from comet 82P/Wild 2 revealed many expected and unexpected features. Among them the most striking feature is the presence of abundant crystalline material in the comet. Synchrotron radiation X-ray diffraction and microtomography are the most efficient methods to detect and describe bulk mineralogical features of crystalline cometary particles. In the present study, in addition to these two non-destructive techniques, electron microscopy and ion-probe mass spectrometry were carried out on the four crystalline particles.

  20. Expression, purification, crystallization and preliminary X-ray crystallographic data from TktA, a transketolase from the lactic acid bacterium Lactobacillus salivarius

    PubMed Central

    Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan

    2010-01-01

    The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662

Top