Effect of yeast (Xanthophyllomyces dendrorhous) and plant (Saint John's wort, lemon balm, and rosemary) extract based functional diets on antioxidant and immune status of Atlantic salmon (Salmo salar) subjected to crowding stress.

PubMed

Reyes-Cerpa, Sebastián; Vallejos-Vidal, Eva; Gonzalez-Bown, María José; Morales-Reyes, Jonathan; Pérez-Stuardo, Diego; Vargas, Deborah; Imarai, Mónica; Cifuentes, Víctor; Spencer, Eugenio; Sandino, Ana María; Reyes-López, Felipe E

2018-03-01

Salmon farming may face stress due to the intensive culture conditions with negative impacts on overall performance. In this aspect, functional feed improves not only the basic nutritional requirements but also the health status and fish growth. However, to date no studies have been carried out to evaluate the effect of functional diets in salmon subjected to crowding stress. Thus, the aim of this study was to evaluate the effect of yeast extract (Xanthophyllomyces dendrorhous; diet A) and the combination of plant extracts (common Saint John's wort, lemon balm, and rosemary; diet B) on the antioxidant and immune status of Atlantic salmon grown under normal cultured conditions and then subjected to crowding stress. Fish were fed with functional diets during 30 days (12 kg/m 3 ) and then subjected to crowding stress (20 kg/m 3 ) for 10 days. The lipid peroxidation in gut showed that both diets induced a marked decrease on oxidative damage when fish were subjected to crowding stress. The protein carbonylation in muscle displayed at day 30 a marked decrease in both functional diets that was more marked on the stress condition. The expression of immune markers (IFNγ, CD4, IL-10, TGF-β, IgM mb , IgM sec , T-Bet, and GATA-3) indicated the upregulation of those associated to humoral-like response (CD4, IL-10, GATA-3) when fish were subjected to crowding stress. These results were confirmed with the expression of secreted IgM. Altogether, these functional diets improved the antioxidant status and increased the expression of genes related to Th2-like response suggesting a protective role on fish subjected to crowding stress. Copyright © 2017. Published by Elsevier Ltd.

Ochratoxin degradation and adsorption caused by astaxanthin-producing yeasts.

PubMed

Péteri, Z; Téren, J; Vágvölgyi, C; Varga, J

2007-05-01

Ochratoxin degrading and adsorbing activities of Phaffia rhodozyma and Xanthophyllomyces dendrorhous isolates were tested. P. rhodozyma CBS 5905 degraded more than 90% of ochratoxin A (OTA) in 15 days at 20 degrees C. The data presented indicate that P. rhodozyma is able to convert OTA to ochratoxin alpha, and this conversion is possibly mediated by an enzyme related to carboxypeptidases. Chelating agents like EDTA and 1,10-phenanthroline inhibited OTA degradation caused by P. rhodozyma indicating that the carboxypeptidase is a metalloprotease, similarly to carboxypeptidase A. The temperature optimum of this enzyme was found to be above 30 degrees C, which is much higher than the temperature optimum for growth of P. rhodozyma cells, which is around 20 degrees C. The enzyme responsible for ochratoxin degradation was found to be cell-bound. Besides, both viable and heat-treated (dead) P. rhodozyma cells were also able to adsorb significant amounts (up to 250 ng ml(-1)) of OTA. Heat treatment enhanced OTA adsorbing activities of the cells. Further studies are in progress to identify the enzyme responsible for OTA degradation in P. rhodozyma.

Red yeasts and carotenoid production: outlining a future for non-conventional yeasts of biotechnological interest.

PubMed

Mannazzu, Ilaria; Landolfo, Sara; Lopes da Silva, Teresa; Buzzini, Pietro

2015-11-01

Carotenoids are one of the most common classes of pigments that occur in nature. Due to their biological properties, they are widely used in phytomedicine and in the chemical, pharmaceutical, cosmetic, food and feed industries. Accordingly, their global market is continuously growing, and it is expected to reach about US$1.4 billion in 2018. Carotenoids can be easily produced by chemical synthesis, although their biotechnological production is rapidly becoming an appealing alternative to the chemical route, partly due to consumer concerns against synthetic pigments. Among the yeasts, and apart from the pigmented species Phaffia rhodozyma (and its teleomorph Xanthophyllomyces dendrorhous), a handful of species of the genera Rhodosporidium, Rhodotorula, Sporobolomyces and Sporidiobolus are well known carotenoid producers. These are known as 'red yeasts', and their ability to synthesize mixtures of carotenoids from low-cost carbon sources has been broadly studied recently. Here, in agreement with the renewed interest in microbial carotenoids, the recent literature is reviewed regarding the taxonomy of the genera Rhodosporidium, Rhodotorula, Sporobolomyces and Sporidiobolus, the stress factors that influence their carotenogenesis, and the most advanced analytical tools for evaluation of carotenoid production. Moreover, a synopsis of the molecular and "-omic" tools available for elucidation of the metabolic pathways of the microbial carotenoids is reported.

Cassava starch maltodextrinization/monomerization through thermopressurized aqueous phosphoric acid hydrolysis.

PubMed

Fontana, J D; Passos, M; Baron, M; Mendes, S V; Ramos, L P

2001-01-01

Kinetic conditions were established for the depolymerization of cassava starch for the production of maltodextrins and glucose syrups. Thin-layer chromatography and high-performance liquid chromatography analyses corroborated that the proper H3PO4 strength and thermopressurization range (e.g., 142-170 degrees C; 2.8-6.8 atm) can be successfully explored for such hydrolytic purposes of native starch granules. Because phosphoric acid can be advantageously maintained in the hydrolysate and generates, after controlled neutralization with ammonia, the strategic nutrient triplet for industrial fermentations (C, P, N), this pretreatment strategy can be easily recognized as a recommended technology for hydrolysis and upgrading of starch and other plant polysaccharides. Compared to the classic catalysts, the mandatory desalting step (chloride removal by expensive anion-exchange resin or sulfate precipitation as the calcium-insoluble salt) can be avoided. Furthermore, properly diluted phosphoric acid is well known as an allowable additive in several popular soft drinks such as colas since its acidic feeling in the mouth is compatible and synergistic with both natural and artificial sweeteners. Glycosyrups from phosphorolyzed cassava starch have also been upgraded to high-value single-cell protein such as the pigmented yeast biomass of Xanthophyllomyces dendrorhous (Phaffia rhodozyma), whose astaxanthin (diketo-dihydroxy-beta-carotene) content may reach 0.5-1.0 mg/g of dry yeast cell. This can be used as an ideal complement for animal feeding as well as a natural staining for both fish farming (meat) and poultry (eggs).

PCR-based method for the rapid identification of astaxanthin-accumulating yeasts (Phaffia spp.).

PubMed

Colabella, Fernando; Libkind, Diego

2016-01-01

It has been recently found that the natural distribution, habitat, and genetic diversity of astaxanthin-producing yeasts (i.e. Phaffia rhodozyma, synonym Xanthophyllomyces dendrorhous) is much greater than previously thought. P. rhodozyma is biotechnologically exploited due to its ability to produce the carotenoid pigment astaxanthin and thus, it is used as a natural source of this pigment for aquaculture. P. rhodozyma was also capable of synthesizing the potent UVB sunscreen mycosporine-glutaminol-glucoside (MGG). Therefore, further environmental studies are needed to elucidate its ecological aspects and detect new potential strains for the production of astaxanthin and MGG. However, obtaining new isolates of P. rhodozyma and related species is not always easy due to its low abundance and the presence of other sympatric and pigmented yeasts. In this work we report a successful development of a species-specific primer which has the ability to quickly and accurately detecting isolates representing all known lineages of the genus Phaffia (including novel species of the genus) and excluding closely related taxa. For this purpose, a primer of 20 nucleotides (called PhR) was designed to be used in combination with universal primers ITS3 and NL4 in a multiplex amplification. The proposed method has the sensitivity and specificity required for the precise detection of new isolates, and therefore represents an important tool for the environmental search for novel astaxanthin-producing yeasts. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Enantioselective separation of all-E-astaxanthin and its determination in microbial sources.

PubMed

Grewe, Claudia; Menge, Sieglinde; Griehl, Carola

2007-09-28

A method for the enantioselective separation of all-E-astaxanthin (3,3'-dihydroxy-beta,beta-carotene-4,4'-dione), an important colorant in the feed industry, was developed. Different chiral stationary phases (CSPs) such as Pirkle phases (R,R Ulmo and l-leucine), modified polysaccharides and a beta-cyclodextrin have been investigated on their separation performance of astaxanthin enantiomers. Direct resolution was only achieved employing the Chiralcel OD-RH (cellulose-tris-3,5-dimethylphenyl-carbamate) under reversed phase conditions. The chiral separation of the enantiomeric forms of astaxanthin produced in microalgae and yeasts was reported. The yeast Xanthophyllomyces sp. produces astaxanthin predominantly in the R,R configuration, whereas in the green microalgae Scenedesmus sp. astaxanthin is built primarily in the S,S form. The separation method for the identification of astaxanthin enantiomers is of great interest since astaxanthin is used as functional food additive in human nutrition. Moreover the method may be used as a food chain indicator in farmed salmon.

Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

PubMed

Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

2018-06-01

There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

Isolation and Characterization of Mms-Sensitive Mutants of SACCHAROMYCES CEREVISIAE

PubMed Central

Prakash, Louise; Prakash, Satya

1977-01-01

We have isolated mutants sensitive to methyl methanesulfonate (MMS) in Saccharomyces cerevisiae. Alleles of rad1, rad4, rad6, rad52, rad55 and rad57 were found among these mms mutants. Twenty-nine of the mms mutants which complement the existing radiation-sensitive (rad and rev ) mutants belong to 22 new complementation groups. Mutants from five complementation groups are sensitive only to MMS. Mutants of 11 complementation groups are sensitive to UV or X rays in addition to MMS, mutants of six complementation groups are sensitive to all three agents. The cross-sensitivities of these mms mutants to UV and X rays are discussed in terms of their possible involvement in DNA repair. Sporulation is reduced or absent in homozygous diploids of mms mutants from nine complementation groups. PMID:195865

An annotated database of Arabidopsis mutants of acyl lipid metabolism

DOE PAGES

McGlew, Kathleen; Shaw, Vincent; Zhang, Meng; ...

2014-12-10

Mutants have played a fundamental role in gene discovery and in understanding the function of genes involved in plant acyl lipid metabolism. The first mutant in Arabidopsis lipid metabolism ( fad4) was described in 1985. Since that time, characterization of mutants in more than 280 genes associated with acyl lipid metabolism has been reported. This review provides a brief background and history on identification of mutants in acyl lipid metabolism, an analysis of the distribution of mutants in different areas of acyl lipid metabolism and presents an annotated database (ARALIPmutantDB) of these mutants. The database provides information on the phenotypesmore » of mutants, pathways and enzymes/proteins associated with the mutants, and allows rapid access via hyperlinks to summaries of information about each mutant and to literature that provides information on the lipid composition of the mutants. Mutants for at least 30 % of the genes in the database have multiple names, which have been compiled here to reduce ambiguities in searches for information. Furthermore, the database should also provide a tool for exploring the relationships between mutants in acyl lipid-related genes and their lipid phenotypes and point to opportunities for further research.« less

Outer membrane protein e of Escherichia coli K-12 is co-regulated with alkaline phosphatase.

PubMed

Tommassen, J; Lugtenberg, B

1980-07-01

Outer membrane protein e is induced in wild-type cells, just like alkaline phosphatase and some other periplasmic proteins, by growth under phosphatase limitation. nmpA and nmpB mutants, which synthesize protein e constitutively, are shown also to produce the periplasmic enzyme alkaline phosphatase constitutively. Alternatively, individual phoS, phoT, and phoR mutants as well as pit pst double mutants, all of which are known to produce alkaline phosphatase constitutively, were found to be constitutive for protein e. Also, the periplasmic space of most nmpA mutants and of all nmpB mutants grown in excess phosphate was found to contain, in addition to alkaline phosphatase, at least two new proteins, a phenomenon known for individual phoT and phoR mutants as well as for pit pst double mutants. The other nmpA mutants as well as phoS mutants lacked one of these extra periplasmic proteins, namely the phosphate-binding protein. From these data and from the known positions of the mentioned genes on the chromosomal map, it is concluded that nmpB mutants are identical to phoR mutants. Moreover, some nmpA mutants were shown to be identical to phoS mutants, whereas other nmpA mutants are likely to contain mutations in one of the genes phoS, phoT, or pst.

Electrical phenotypes of calcium transport mutant strains of a filamentous fungus, Neurospora crassa.

PubMed

Hamam, Ahmed; Lew, Roger R

2012-05-01

We characterized the electrical phenotypes of mutants with mutations in genes encoding calcium transporters-a mechanosensitive channel homolog (MscS), a Ca(2+)/H(+) exchange protein (cax), and Ca(2+)-ATPases (nca-1, nca-2, nca-3)-as well as those of double mutants (the nca-2 cax, nca-2 nca-3, and nca-3 cax mutants). The electrical characterization used dual impalements to obtain cable-corrected current-voltage measurements. Only two types of mutants (the MscS mutant; the nca-2 mutant and nca-2-containing double mutants) exhibited lower resting potentials. For the nca-2 mutant, on the basis of unchanged conductance and cyanide-induced depolarization of the potential, the cause is attenuated H(+)-ATPase activity. The growth of the nca-2 mutant-containing strains was inhibited by elevated extracellular Ca(2+) levels, indicative of lesions in Ca(2+) homeostasis. However, the net Ca(2+) effluxes of the nca-2 mutant, measured noninvasively with a self-referencing Ca(2+)-selective microelectrode, were similar to those of the wild type. All of the mutants exhibited osmosensitivity similar to that of the wild type (the turgor of the nca-2 mutant was also similar to that of the wild type), suggesting that Ca(2+) signaling does not play a role in osmoregulation. The hyphal tip morphology and tip-localized mitochondria of the nca-2 mutant were similar to those of the wild type, even when the external [Ca(2+)] was elevated. Thus, although Ca(2+) homeostasis is perturbed in the nca-2 mutant (B. J. Bowman et al., Eukaryot. Cell 10:654-661, 2011), the phenotype does not extend to tip growth or to osmoregulation but is revealed by lower H(+)-ATPase activity.

Electrical Phenotypes of Calcium Transport Mutant Strains of a Filamentous Fungus, Neurospora crassa

PubMed Central

Hamam, Ahmed

2012-01-01

We characterized the electrical phenotypes of mutants with mutations in genes encoding calcium transporters—a mechanosensitive channel homolog (MscS), a Ca2+/H+ exchange protein (cax), and Ca2+-ATPases (nca-1, nca-2, nca-3)—as well as those of double mutants (the nca-2 cax, nca-2 nca-3, and nca-3 cax mutants). The electrical characterization used dual impalements to obtain cable-corrected current-voltage measurements. Only two types of mutants (the MscS mutant; the nca-2 mutant and nca-2-containing double mutants) exhibited lower resting potentials. For the nca-2 mutant, on the basis of unchanged conductance and cyanide-induced depolarization of the potential, the cause is attenuated H+-ATPase activity. The growth of the nca-2 mutant-containing strains was inhibited by elevated extracellular Ca2+ levels, indicative of lesions in Ca2+ homeostasis. However, the net Ca2+ effluxes of the nca-2 mutant, measured noninvasively with a self-referencing Ca2+-selective microelectrode, were similar to those of the wild type. All of the mutants exhibited osmosensitivity similar to that of the wild type (the turgor of the nca-2 mutant was also similar to that of the wild type), suggesting that Ca2+ signaling does not play a role in osmoregulation. The hyphal tip morphology and tip-localized mitochondria of the nca-2 mutant were similar to those of the wild type, even when the external [Ca2+] was elevated. Thus, although Ca2+ homeostasis is perturbed in the nca-2 mutant (B. J. Bowman et al., Eukaryot. Cell 10:654–661, 2011), the phenotype does not extend to tip growth or to osmoregulation but is revealed by lower H+-ATPase activity. PMID:22408225

Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes.

PubMed

Metts, J; West, J; Doares, S H; Matthysse, A G

1991-02-01

Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.

Production and characterization of streptomycin dependent mutants of Pasteurella multocida from bovine haemorrhagic septicaemia.

PubMed Central

de Alwis, M C; Carter, G R; Chengappa, M M

1980-01-01

A large number of streptomycin dependent mutants were produced from bovine haemorrhagic septicaemia strains of Pasteurella multocida. The mutants required a minimum concentration of 25-50 microgram/mL streptomycin for growth and tolerated a concentration of 200 mg/mL. These mutants were avirulent to mice, when inoculated alone, but some mutants killed mice when inoculated with streptomycin. Biochemically all mutants were uniform and similar to the wild type. Most mutants were stable, but a few produced streptomycin independent revertants. The rate of reversion varied with each mutant. Most revertants were highly virulent for mice, some totally avirulant and a few relatively avirulent. PMID:6778598

[Construction and stress tolerance of trehalase mutant in Saccharomyces cerevisiae].

PubMed

Lv, Ye; Xiao, Dongguang; He, Dongqin; Guo, Xuewu

2008-10-01

Accumulation of trehalose is critical in improving the stress tolerance of Saccharomyces cerevisiae. Two enzymes are capable of hydrolyzing trehalose: a neutral trehalase (NTH1) and an acidic trehalase (ATH1). We constructed trehalase disruption mutants to provide a basis for future commercial application. To retain the accumulation of trehalose in yeast cell, we constructed diploid homozygous neutral trehalase mutants (Deltanth1), acid trehalase mutants (Deltaath1) and double mutants (Deltaath1Deltanth1) by using gene disruption. We tested mutants'trehalose content and their tolerance to freezing, heat, high-sugar and ethanol concentrations. These trehalase disruption mutants were further confirmed by PCR amplification and southern blot. All mutant strains accumulated higher levels of cellular trehalose and grew to a higher cell density than the isogenic parent strain. In addition, the levels of trehalose in these mutants correlated with increased tolerance to freezing, heat, high-sugar and ethanol concentration. The improved tolerance of trehalase mutants may make them useful in commercial applications, including baking and brewing protein.

Isolation and preliminary characterization of temperature-sensitive mutants of influenza virus.

PubMed

Sugiura, A; Tobita, K; Kilbourne, E D

1972-10-01

Isolation of temperature-sensitive (ts) mutants was attempted from the WSN strain of influenza A virus which was grown and assayed in MDBK cells. After growth of wild-type virus in the presence of 5-fluorouracil, 15 ts mutants were selected for which the ratio of plaquing efficiency at 39.5 C to that at 33 C was 10(-3) or less. In pairwise crosses of ts mutants, recombination and complementation were either very efficient or undetectable. It is suggested, therefore, that the viral genome consists of physically discrete units and recombination occurs as an exchange of these units. All 15 mutants have been assigned with certainty into five recombination groups. Three mutants are suspected to be double mutants. Any two complementing mutants always recombined with each other, and noncomplementing mutants did not recombine. In physiological tests, mutants showed diverse patterns of functional defects at the nonpermissive temperature. However, it was not always possible to correlate these physiological defects with the results of genetic characterization.

Value of bilirubin oxidase and its mutants in the diagnosis of hyperbilirubinemia.

PubMed

Zhang, Lei; Zhang, Xiao; Luo, Zhi-Ying

2005-11-01

To elucidate the significance of the coordination amino acid residues in bilirubin oxidase (BO) and their kinetic characteristics, and evaluate whether BO mutants may serve as better diagnostic agent for hyperbilirubinemia. The BO mutants I402G and C457S were obtained by site-directed mutagenesis and confirmed by amino acid sequence analysis. Ru-incorporated C457S mutant was obtained by direct incubation of ruthenium compounds with the mutant. The electron paramagnetic resonance (EPR) spectra of the recombinant BO and the mutants were investigated, and the enzyme kinetics of the recombinant BO and I402G mutant were measured with bilirubin as the substrate at 25 degrees C. The BO mutants were expressed and purified successfully. The mutant I402G showed low enzyme activity, and had C457S virtually no enzyme activity. Nevertheless Ru-incorporation conferred higher enzyme activity to C457S mutant. The enzyme kinetic investigations revealed that the kinetic parameter k(cat) of the recombinant BO and I402G mutant was 235.8 min(-1) and 6.9 min(-1), respectively, suggesting higher enzyme activity of the recombinant BO. The coordinating amino acids have important significance in maintaining the integrity of active centers and enzyme activities of recombinant BO and its mutants. The enzyme activities of the mutants I402G and C457S are much lower than those of recombinant BO, therefore they are not appropriate for diagnostic purpose. Ru-incorporation facilitates the formation of a new intact active center in C457S mutant, which therefore acquires enzyme activity.

Rapid mutation of Spirulina platensis by a new mutagenesis system of atmospheric and room temperature plasmas (ARTP) and generation of a mutant library with diverse phenotypes.

PubMed

Fang, Mingyue; Jin, Lihua; Zhang, Chong; Tan, Yinyee; Jiang, Peixia; Ge, Nan; Heping Li; Xing, Xinhui

2013-01-01

In this paper, we aimed to improve the carbohydrate productivity of Spirulina platensis by generating mutants with increased carbohydrate content and growth rate. ARTP was used as a new mutagenesis tool to generate a mutant library of S. platensis with diverse phenotypes. Protocol for rapid mutation of S. platensis by 60 s treatment with helium driven ARTP and high throughput screening method of the mutants using the 96-well microplate and microplate reader was established. A mutant library of 62 mutants was then constructed and ideal mutants were selected out. The characteristics of the mutants after the mutagenesis inclined to be stable after around 9(th) subculture, where the total mutation frequency and positive mutation frequency in terms of specific growth rate reached 45% and 25%, respectively. The mutants in mutant library showed diverse phenotypes in terms of cell growth rate, carbohydrate content and flocculation intensity. The positive mutation frequency in terms of cellular carbohydrate content with the increase by more than 20% percent than the wild strain was 32.3%. Compared with the wild strain, the representative mutants 3-A10 and 3-B2 showed 40.3% and 78.0% increase in carbohydrate content, respectively, while the mutant 4-B3 showed 10.5% increase in specific growth rate. The carbohydrate contents of the representative mutants were stable during different subcultures, indicating high genetic stability. ARTP was demonstrated to be an effective and non-GMO mutagenesis tool to generate the mutant library for multicellular microalgae.

Rapid Mutation of Spirulina platensis by a New Mutagenesis System of Atmospheric and Room Temperature Plasmas (ARTP) and Generation of a Mutant Library with Diverse Phenotypes

PubMed Central

Zhang, Chong; Tan, Yinyee; Jiang, Peixia; Ge, Nan; Heping Li; Xing, Xinhui

2013-01-01

In this paper, we aimed to improve the carbohydrate productivity of Spirulina platensis by generating mutants with increased carbohydrate content and growth rate. ARTP was used as a new mutagenesis tool to generate a mutant library of S. platensis with diverse phenotypes. Protocol for rapid mutation of S. platensis by 60 s treatment with helium driven ARTP and high throughput screening method of the mutants using the 96-well microplate and microplate reader was established. A mutant library of 62 mutants was then constructed and ideal mutants were selected out. The characteristics of the mutants after the mutagenesis inclined to be stable after around 9th subculture, where the total mutation frequency and positive mutation frequency in terms of specific growth rate reached 45% and 25%, respectively. The mutants in mutant library showed diverse phenotypes in terms of cell growth rate, carbohydrate content and flocculation intensity. The positive mutation frequency in terms of cellular carbohydrate content with the increase by more than 20% percent than the wild strain was 32.3%. Compared with the wild strain, the representative mutants 3-A10 and 3-B2 showed 40.3% and 78.0% increase in carbohydrate content, respectively, while the mutant 4-B3 showed 10.5% increase in specific growth rate. The carbohydrate contents of the representative mutants were stable during different subcultures, indicating high genetic stability. ARTP was demonstrated to be an effective and non-GMO mutagenesis tool to generate the mutant library for multicellular microalgae. PMID:24319517

Sharing mutants and experimental information prepublication using FgMutantDB

USDA-ARS?s Scientific Manuscript database

There has been no central location for storing generated mutants of Fusarium graminearum or for data associated with these mutants. Instead researchers relied on several independent, non-integrated databases. FgMutantDB was designed as a simple spreadsheet that is accessible globally on the web th...

Defining the requirements for the pathogenic interaction between mutant calreticulin and MPL in MPN

PubMed Central

Elf, Shannon; Abdelfattah, Nouran S.; Baral, April J.; Beeson, Danielle; Rivera, Jeanne F.; Ko, Amy; Florescu, Natalie; Birrane, Gabriel; Chen, Edwin

2018-01-01

Mutations in calreticulin (CALR) are phenotypic drivers in the pathogenesis of myeloproliferative neoplasms. Mechanistic studies have demonstrated that mutant CALR binds to the thrombopoietin receptor MPL, and that the positive electrostatic charge of the mutant CALR C terminus is required for mutant CALR-mediated activation of JAK-STAT signaling. Here we demonstrate that although binding between mutant CALR and MPL is required for mutant CALR to transform hematopoietic cells; binding alone is insufficient for cytokine independent growth. We further show that the threshold of positive charge in the mutant CALR C terminus influences both binding of mutant CALR to MPL and activation of MPL signaling. We find that mutant CALR binds to the extracellular domain of MPL and that 3 tyrosine residues within the intracellular domain of MPL are required to activate signaling. With respect to mutant CALR function, we show that its lectin-dependent function is required for binding to MPL and for cytokine independent growth, whereas its chaperone and polypeptide-binding functionalities are dispensable. Together, our findings provide additional insights into the mechanism of the pathogenic mutant CALR-MPL interaction in myeloproliferative neoplasms. PMID:29288169

Defining the requirements for the pathogenic interaction between mutant calreticulin and MPL in MPN.

PubMed

Elf, Shannon; Abdelfattah, Nouran S; Baral, April J; Beeson, Danielle; Rivera, Jeanne F; Ko, Amy; Florescu, Natalie; Birrane, Gabriel; Chen, Edwin; Mullally, Ann

2018-02-15

Mutations in calreticulin ( CALR ) are phenotypic drivers in the pathogenesis of myeloproliferative neoplasms. Mechanistic studies have demonstrated that mutant CALR binds to the thrombopoietin receptor MPL, and that the positive electrostatic charge of the mutant CALR C terminus is required for mutant CALR-mediated activation of JAK-STAT signaling. Here we demonstrate that although binding between mutant CALR and MPL is required for mutant CALR to transform hematopoietic cells; binding alone is insufficient for cytokine independent growth. We further show that the threshold of positive charge in the mutant CALR C terminus influences both binding of mutant CALR to MPL and activation of MPL signaling. We find that mutant CALR binds to the extracellular domain of MPL and that 3 tyrosine residues within the intracellular domain of MPL are required to activate signaling. With respect to mutant CALR function, we show that its lectin-dependent function is required for binding to MPL and for cytokine independent growth, whereas its chaperone and polypeptide-binding functionalities are dispensable. Together, our findings provide additional insights into the mechanism of the pathogenic mutant CALR-MPL interaction in myeloproliferative neoplasms. © 2018 by The American Society of Hematology.

Molecular characterization of baculovirus Bombyx mori nucleopolyhedrovirus polyhedron mutants.

PubMed

Katsuma, S; Noguchi, Y; Shimada, T; Nagata, M; Kobayashi, M; Maeda, S

1999-01-01

Four newly isolated and two previously isolated polyhedron mutants of Bombyx mori nucleopolyhedrovirus (BmNPV) were studied. Two polyhedron deficient mutants, #126 and #136, produced small uncrystallized particles of polyhedrin in the nuclei and cytoplasm of infected cells. Mutant #211 produced a large number of variably sized polyhedra in the nucleus and #220 produced a few large cuboidal polyhedra in the nucleus. Mutant #24 and #128 were previously isolated BmNPV mutants. Mutant #24 could not produce polyhedrin mRNA and polyhedra produced by mutant #128 lacked oral infectivity. Nucleotide sequence analysis indicated that five mutants (#126, #136, #211, #220 and #128) had amino acid substitutions in polyhedrin and mutant #24 had a point mutation only in the promoter region of the polyhedrin gene. Cotransfection experiments showed that the altered phenotypes were due to the mutations found in the polyhedrin gene regions. In mutants #126 and #136, amino acid sequences of the nuclear localization signal of polyhedrin were identical to those of wild-type BmNPV, suggesting that this sequence was necessary but not sufficient for nuclear localization of polyhedrin. Electron microscopic observation revealed that fewer occluded virions were contained in polyhedra of #128 and #220.

Isolation and Characterization of Sex-Linked Female-Sterile Mutants in DROSOPHILA MELANOGASTER

PubMed Central

Gans, Madeleine; Audit, Claudie; Masson, Michele

1975-01-01

The purpose of the experiments described was to identify X chromosome genes functioning mainly or exclusively during oogenesis. Two mutagenesis experiments were carried out with ethyl methane sulfonate. Following treatment inducing 60% lethals, 9% of the treated X chromosomes carried a female sterility mutation which did not otherwise seriously affect viability. Among —95 isolated mutants, 19 were heat-sensitive and 5 cold-sensitive. The mutants have been classified as follows: I (16 mutants; 12 complementation groups): the females laid few or no eggs; the defect concerned either ovulation or oogenesis. II (37 mutants; 18 complementation groups): the female laid morphologically abnormal eggs, often with increased membrane permeability. III A (13 mutants; at least 8 complementation groups): the homozygous females were sterile if mated to mutant males; their progeny (homo- and hemizygous) died at a late embryonic stage (11 mutants), at the larval stage (1 mutant) or at the pupal stage (1 mutant). However fertility was partly restored by breeding to wild-type males as shown by survival of some heterozygous descendants. III B (29 mutants; 22 complementation groups): the fertility of the females was not restored by breeding to a wild-type male. Most of the eggs of 13 of the mutants died at a late stage of embryogenesis. The eggs of the others ceased development earlier or, perhaps, remained unfertilized. The distribution of the number of mutants per complementation group led to an estimation of a total of about 150 X-linked genes involved in female fertility. The females of three mutants, heat-sensitive and totally sterile at 29°, produced at a lower temperature descendants morphologically abnormal or deprived of germ cells. Three other mutants not described in detail showed a reduction in female fertility with many descendants lacking germ cells. A desirable mutant which was not recovered was one with normal fertile females producing descendants which, regardless of their genotype, bore specific morphological abnormalities. The value of the mutants isolated for analysis of the complex processes leading to egg formation and initiation of development is discussed. PMID:814037

Synthesis of L-threo-3,4-dihydroxyphenylserine (L-threo-DOPS) with thermostabilized low-specific L-threonine aldolase from Streptomyces coelicolor A3(2).

PubMed

Balk, Sang-Ho; Yoshioka, Hideki; Yukawa, Hideaki; Harayama, Shigeaki

2007-05-01

Stability-enhanced mutants, H44, 11-94, 5A2-84, and F8, of L-threonine aldolase (L-TA) from Streptomyces coelicolor A3(2) (SCO1085) were isolated by an error-prone PCR followed by a high-throughput screening. Each of these mutant, had a single amino acid substitution: H177Y in the H44 mutant, A169T in the 11-94 mutant, D104N in the 5A2-84 mutant and Fl81 in the F8 mutant. The residual L-TA activity of the wild-type L-TA after a heat treatment for 20 min at 60 degrees C was only 10.6%. However, those in the stability-enhanced mutants were 85.7% for the H44 mutant, 58.6% for the F8 mutant, 62.1% for the 5A2-84 mutant, and 67.6% for the 11-94 mutant. Although the half-life of the wild-type L-TA at 63 degrees C was 1.3 min, those of the mutant L-TAs were longer: 14.6 min for the H44 mutant, 3.7 min for the 11-94 mutant, 5.8 min for the 5A2-84 mutant, and 5.0 min for the F8 mutant. The specific activity did not change in most of the mutants, but it was decreased by 45% in the case of mutant F8. When the aldol condensation of glycine and 3,4-dihydroxybenzaldehyde was studied by using whole cells of Escherichia coli containing the wild-type L-TA gene, L-threo-3,4-dihydroxyphenylserine (L.-threo-DOPS) was successfully synthesized with a yield of 2.0 mg/ml after 20 repeated batch reactions for 100 h. However, the L-threo-DOPS synthesizing activity of the enzyme decreased with increased cycles of the batch reactions. Compared with the wild-type L-TA, H44 L-TA kept its L-threo-DOPS synthesizing activity almost constant during the 20 repeated batch reactions for 100 h, yielding 4.0 mg/ml of L-threo-DOPS. This result showed that H44 L-TA is more effective than the wild-type L-TA for the mass production of L-threo-DOPS.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

The Phenotype performance of M3 red rice mutant (Oryza sativa L.)

NASA Astrophysics Data System (ADS)

Kasim, N.; Sjahril, R.; Riadi, M.; Arbie, F.

2018-05-01

Local rice genotype generally has colour, flavour and scent more preferred by consumers, yet unfortunately it has long-lived planting period and low production. Therefore, the plant breeding practices in rice needs to be implemented for better rice varieties which are superior in terms of both quality and quantity. Our findings describe the growth character performance and the production of red rice mutant from M3 generation. This study was conducted in the Agriculture Faculty wetlands, Hasanuddin University, Makassar, by using ANOVA test with some red rice mutant genotypes i.e. 7 genotypes mutants (G1, G2, G3, G4, G5, G6 and G7) and controls/parent-plants (not the mutant). Results show that there were difference in growth performance and production of red rice mutant. Each parameter observed on each genotype had different results. Mutants produced best response in tillers production were G4 mutant with the tillers grain weight at 99.2 g, whereas by the results of the analysis of rank, mutants showed the best overall response were found in G6 mutants.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

PubMed

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes

PubMed Central

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-01-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404

Cell-to-cell stimulation of movement in nonmotile mutants of Myxococcus

PubMed Central

Hodgkin, Jonathan; Kaiser, Dale

1977-01-01

A large number of nonmotile mutants of the gliding bacterium Myxococcus xanthus have been isolated and partly characterized. About [unk] of these mutants are conditional mutants of a novel kind: mutant cells become transiently motile after contact with nonmutant cells or with cells of a different mutant type. These “stimulatable” mutants fall into five phenotypic classes (types B, C, D, E, and F). Most mutants are nonstimulatable (type A) and never become motile, but type A cells (and wild-type cells) can stimulate cells of any of the other five types. Stimulatable mutants of different types are capable of stimulating each other. For example, in a mixture of B and C cells, both become motile. Linkage analysis using a generalized transducing phage has shown that each of types B, C, D, E, and F corresponds to a single distinct genetic locus. Type A mutants, by contrast, belong to at least 17 different loci. Stimulation depends on close apposition of interacting cells, because stimulation does not occur when contact between cells is prevented. It is possible that the stimulatable mutants are defective in components of the gliding mechanism that can be exchanged between cells. Alternatively, they may be defective in a system of cell communication controlling the coordinated cell movements observed in Myxococcus. Images PMID:16592422

Characterization of a Weak Allele of Zebrafish cloche Mutant

PubMed Central

Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

2011-01-01

Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

Neurobehavioral Mutants Identified in an ENU Mutagenesis Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, Melloni N.; Dunning, Jonathan P; Wiley, Ronald G

2007-01-01

We report on a behavioral screening test battery that successfully identified several neurobehavioral mutants among a large-scale ENU-mutagenized mouse population. Large numbers of ENU mutagenized mice were screened for abnormalities in central nervous system function based on abnormal performance in a series of behavior tasks. We developed and employed a high-throughput screen of behavioral tasks to detect behavioral outliers. Twelve mutant pedigrees, representing a broad range of behavioral phenotypes, have been identified. Specifically, we have identified two open field mutants (one displaying hyper-locomotion, the other hypo-locomotion), four tail suspension mutants (all displaying increased immobility), one nociception mutant (displaying abnormal responsivenessmore » to thermal pain), two prepulse inhibition mutants (displaying poor inhibition of the startle response), one anxiety-related mutant (displaying decreased anxiety in the light/dark test), and one learning and memory mutant (displaying reduced response to the conditioned stimulus) These findings highlight the utility of a set of behavioral tasks used in a high throughput screen to identify neurobehavioral mutants. Further analysis (i.e., behavioral and genetic mapping studies) of mutants is in progress with the ultimate goal of identification of novel genes and mouse models relevant to human disorders as well as the identification of novel therapeutic targets.« less

Defined single-gene and multi-gene deletion mutant collections in Salmonella enterica sv Typhimurium.

PubMed

Porwollik, Steffen; Santiviago, Carlos A; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael

2014-01-01

We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available.

The genetics of green thorax, a new larval colour mutant, non-linked with ruby - eye locus in the malaria mosquito, Anopheles stephensi.

PubMed

Sanil, D; Shetty, N J

2009-06-01

Anopheles stephensi, an important vector of malaria continues to be distributed widely in the Indian subcontinent. The natural vigour of the species combined with its new tolerance, indeed resistance to insecticides has made it obligatory that we look for control methods involving genetic manipulation. Hence, there is an immediate need for greater understanding of the genetics of this vector species. One of the requirements for such genetic studies is the establishment of naturally occurring mutants, establishment of the genetic basis for the same and use of such mutants in the genetic transformation studies and other genetic control programme(s). This paper describes the isolation and genetic studies of a larval colour mutant, green thorax (gt), and linkage studies involving another autosomal recessive mutant ruby- eye (ru) in An. stephensi. After the initial discovery, the mutant green thorax was crossed inter se and pure homozygous stock of the mutant was established. The stock of the mutant ruby- eye, which has been maintained as a pure stock in the laboratory. Crosses were made between the wild type and mutant, green thorax to determine the mode of inheritance of green thorax. For linkage studies, crosses were made between the mutant green thorax and another autosomal recessive mutant ruby-eye. The percentage cross-over was calculated for the genes linkage relationship for gt and gt ru. Results of crosses between mutant and wild type showed that the inheritance of green thorax (gt) in An. stephensi is monofactorial in nature. The gt allele is recessive to wild type and is autosomal. The linkage studies showed no linkage between ru and gt. The mutant gt represents an excellent marker for An. stephensi as it is expressed in late III instar stage of larvae and is prominent in IV instar and pupal stages with complete penetrance and high viability. The said mutant could be easily identified without the aid of a microscope. This mutant can be used extensively to conduct basic and applied research. The mutant has been maintained in two large cages in our laboratory.

Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

PubMed

Wang, Limei; Beer, Steven V

2006-12-01

To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata.

PubMed

Fan, Lili; Fu, Kehe; Yu, Chuanjin; Ma, Jia; Li, Yaqian; Chen, Jie

2014-01-01

Agrobacterium tumefaciens-mediated transformation (ATMT) was used to generate an insertional mutant library of the mycelial fungus Trichoderma harzianum. From a total of 450 mutants, six mutants that showed significant influence on maize resistance to C. lunata were analyzed in detail. Maize coated with these mutants was more susceptible to C. lunata compared with those coated with a wild-type (WT) strain. Similar to other fungal ATMT libraries, all six mutants were single copy integrations, which occurred preferentially in noncoding regions (except two mutants) and were frequently accompanied by the loss of border sequences. Two mutants (T66 and T312) that were linked to resistance were characterized further. Maize seeds coated with T66 and T312 were more susceptible to C. lunata than those treated with WT. Moreover, the mutants affected the resistance of maize to C. lunata by enhancing jasmonate-responsive gene expression. T66 and T312 induced maize resistance to C. lunata infection through a jasmonic acid-dependent pathway.

Polysaccharide production by a reduced pigmentation mutant of Aureobasidium pullulans NYS-1.

PubMed

West, T P; Strohfus, B

2001-08-01

To isolate a reduced pigmentation mutant of Aureobasidium pullulans NYS-1 and characterize its cellular pigmentation plus its polysaccharide and biomass production relative to carbon source. Cellular pigmentation, polysaccharide levels and biomass production by the isolated mutant NYSRP-1 were analysed relative to carbon source. Cellular pigmentation of the mutant was lower than its parent strain using either carbon source. The mutant elaborated higher polysaccharide levels on sucrose than on corn syrup. The pullulan content of the polysaccharide synthesized and biomass production by the mutant rose as the carbon source concentration was increased. It is feasible to isolate a reduced pigmentation mutant from strain NYS-1 that exhibits elevated polysaccharide production using corn syrup as a carbon source. The mutant provides an advantage for commercial pullulan production because of its reduced pigmentation and enhanced polysaccharide synthesis.

Tissue-Specific Profiling Reveals Transcriptome Alterations in Arabidopsis Mutants Lacking Morphological Phenotypes[C][W

PubMed Central

Simon, Marissa; Bruex, Angela; Kainkaryam, Raghunandan M.; Zheng, Xiaohua; Huang, Ling; Woolf, Peter J.; Schiefelbein, John

2013-01-01

Traditional genetic analysis relies on mutants with observable phenotypes. Mutants lacking visible abnormalities may nevertheless exhibit molecular differences useful for defining gene function. To examine this, we analyzed tissue-specific transcript profiles from Arabidopsis thaliana transcription factor gene mutants with known roles in root epidermis development, but lacking a single-gene mutant phenotype due to genetic redundancy. We discovered substantial transcriptional changes in each mutant, preferentially affecting root epidermal genes in a manner consistent with the known double mutant effects. Furthermore, comparing transcript profiles of single and double mutants, we observed remarkable variation in the sensitivity of target genes to the loss of one or both paralogous genes, including preferential effects on specific branches of the epidermal gene network, likely reflecting the pathways of paralog subfunctionalization during evolution. In addition, we analyzed the root epidermal transcriptome of the transparent testa glabra2 mutant to clarify its role in the network. These findings provide insight into the molecular basis of genetic redundancy and duplicate gene diversification at the level of a specific gene regulatory network, and they demonstrate the usefulness of tissue-specific transcript profiling to define gene function in mutants lacking informative visible changes in phenotype. PMID:24014549

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain

PubMed Central

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-01-01

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.

PubMed

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-05-15

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.

A method for probing the mutational landscape of amyloid structure.

PubMed

O'Donnell, Charles W; Waldispühl, Jérôme; Lis, Mieszko; Halfmann, Randal; Devadas, Srinivas; Lindquist, Susan; Berger, Bonnie

2011-07-01

Proteins of all kinds can self-assemble into highly ordered β-sheet aggregates known as amyloid fibrils, important both biologically and clinically. However, the specific molecular structure of a fibril can vary dramatically depending on sequence and environmental conditions, and mutations can drastically alter amyloid function and pathogenicity. Experimental structure determination has proven extremely difficult with only a handful of NMR-based models proposed, suggesting a need for computational methods. We present AmyloidMutants, a statistical mechanics approach for de novo prediction and analysis of wild-type and mutant amyloid structures. Based on the premise of protein mutational landscapes, AmyloidMutants energetically quantifies the effects of sequence mutation on fibril conformation and stability. Tested on non-mutant, full-length amyloid structures with known chemical shift data, AmyloidMutants offers roughly 2-fold improvement in prediction accuracy over existing tools. Moreover, AmyloidMutants is the only method to predict complete super-secondary structures, enabling accurate discrimination of topologically dissimilar amyloid conformations that correspond to the same sequence locations. Applied to mutant prediction, AmyloidMutants identifies a global conformational switch between Aβ and its highly-toxic 'Iowa' mutant in agreement with a recent experimental model based on partial chemical shift data. Predictions on mutant, yeast-toxic strains of HET-s suggest similar alternate folds. When applied to HET-s and a HET-s mutant with core asparagines replaced by glutamines (both highly amyloidogenic chemically similar residues abundant in many amyloids), AmyloidMutants surprisingly predicts a greatly reduced capacity of the glutamine mutant to form amyloid. We confirm this finding by conducting mutagenesis experiments. Our tool is publically available on the web at http://amyloid.csail.mit.edu/. lindquist_admin@wi.mit.edu; bab@csail.mit.edu.

High-Throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants during Acute Infection

PubMed Central

Matsunaga, James; Haake, David A.

2016-01-01

Pathogenic species of Leptospira are the causative agents of leptospirosis, a zoonotic disease that causes mortality and morbidity worldwide. The understanding of the virulence mechanisms of Leptospira spp is still at an early stage due to the limited number of genetic tools available for this microorganism. The development of random transposon mutagenesis in pathogenic strains a decade ago has contributed to the identification of several virulence factors. In this study, we used the transposon sequencing (Tn-Seq) technique, which combines transposon mutagenesis with massive parallel sequencing, to study the in vivo fitness of a pool of Leptospira interrogans mutants. We infected hamsters with a pool of 42 mutants (input pool), which included control mutants with insertions in four genes previously analyzed by virulence testing (loa22, ligB, flaA1, and lic20111) and 23 mutants with disrupted signal transduction genes. We quantified the mutants in different tissues (blood, kidney and liver) at 4 days post-challenge by high-throughput sequencing and compared the frequencies of mutants recovered from tissues to their frequencies in the input pool. Control mutants that were less fit in the Tn-Seq experiment were attenuated for virulence when tested separately in the hamster model of lethal leptospirosis. Control mutants with unaltered fitness were as virulent as the wild-type strain. We identified two mutants with the transposon inserted in the same putative adenylate/guanylate cyclase gene (lic12327) that had reduced in vivo fitness in blood, kidney and liver. Both lic12327 mutants were attenuated for virulence when tested individually in hamsters. Growth of the control mutants and lic12327 mutants in culture medium were similar to that of the wild-type strain. These results demonstrate the feasibility of screening large pools of L. interrogans transposon mutants for those with altered fitness, and potentially attenuated virulence, by transposon sequencing. PMID:27824878

Exploring the regulatory role of isocitrate dehydrogenase mutant protein on glioma stem cell proliferation.

PubMed

Lu, H-C; Ma, J; Zhuang, Z; Qiu, F; Cheng, H-L; Shi, J-X

2016-08-01

Glioma is the most lethal form of cancer that originates mostly from the brain and less frequently from the spine. Glioma is characterized by abnormal regulation of glial cell differentiation. The severity of the glioma was found to be relaxed in isocitrate dehydrogenase 1 (IDH1) mutant. The present study focused on histological discrimination and regulation of cancer stem cell between IDH1 mutant and in non-IDH1 mutant glioma tissue. Histology, immunohistochemistry and Western blotting techniques are used to analyze the glioma nature and variation in glioma stem cells that differ between IDH1 mutant and in non-IDH1 mutant glioma tissue. The aggressive form of non-IDH1 mutant glioma shows abnormal cellular histological variation with prominent larger nucleus along with abnormal clustering of cells. The longer survival form of IDH1 mutant glioma has a control over glioma stem cell proliferation. Immunohistochemistry with stem cell markers, CD133 and EGFRvIII are used to demonstrate that the IDH1 mutant glioma shows limited dependence on cancer stem cells and it shows marked apoptotic signals in TUNEL assay to regulate abnormal cells. The non-IDH1 mutant glioma failed to regulate misbehaving cells and it promotes cancer stem cell proliferation. Our finding supports that the IDH1 mutant glioma has a regulatory role in glioma stem cells and their survival.

Imaginal Disc Abnormalities in Lethal Mutants of Drosophila

PubMed Central

Shearn, Allen; Rice, Thomas; Garen, Alan; Gehring, Walter

1971-01-01

Late lethal mutants of Drosophila melanogaster, dying after the larval stage of development, were isolated. The homozygous mutant larvae were examined for abnormal imaginal disc morphology, and the discs were injected into normal larval hosts to test their capacities to differentiate into adult structures. In about half of the mutants analyzed, disc abnormalities were found. Included among the abnormalities were missing discs, small discs incapable of differentiating, morphologically normal discs with limited capacities for differentiation, and discs with homeotic transformations. In some mutants all discs were affected, and in others only certain discs. The most extreme abnormal phenotype is a class of “discless” mutants. The viability of these mutant larvae indicates that the discs are essential only for the development of an adult and not of a larva. The late lethals are therefore a major source of mutants for studying the genetic control of disc formation. Images PMID:5002822

Reduced gravitropic sensitivity in roots of a starch-deficient mutant of Nicotiana sylvestris

NASA Technical Reports Server (NTRS)

Kiss, J. Z.; Sack, F. D.

1989-01-01

Gravitropism was studied in seedlings of Nicotiana sylvestris Speg. et Comes wild-type (WT) and mutant NS 458 which has a defective plastid phosphoglucomutase (EC 2.7.5.1.). Starch was greatly reduced in NS 458 compared to the WT, but small amounts of starch were detected in rootcap columella cells in NS 458 by light and electron microscopy. The roots of WT are more sensitive to gravity than mutant NS 458 roots since: (1) in mutant roots, curvature was reduced and delayed in the time course of curvature; (2) curvature of mutant roots was 24-56% that of WT roots over the range of induction periods tested; (3) in intermittent-stimulation experiments, curvature of mutant roots was 37% or less than that of WT roots in all treatments tested. The perception time, determined by intermittent-stimulation experiments, was < or = 5 s for WT roots and 30-60 s for mutant roots. The growth rates for WT and NS 458 roots were essentially equal. These results and our previous results with WT and starchless mutant Arabidopsis roots (Kiss et al. 1989, Planta 177, 198-206) support the conclusions that a full complement of starch is necessary for full gravitropic sensitivity and that amyloplasts function in gravity perception. Since a presumed relatively small increase in plastid buoyant mass (N. sylvestris mutant versus Arabidopsis mutant) significantly improves the orientation of the N. sylvestris mutant roots, we suggest that plastids are the likeliest candidates to be triggering gravity perception in roots of both mutants.

Cadmium-sensitive, cad1 mutants of Arabidopsis thaliana are phytochelatin deficient.

PubMed Central

Howden, R; Goldsbrough, P B; Andersen, C R; Cobbett, C S

1995-01-01

An allelic series of cad1, cadmium-sensitive mutants of Arabidopsis thaliana, was isolated. These mutants were sensitive to cadmium to different extents and were deficient in their ability to form cadmium-peptide complexes as detected by gel-filtration chromatography. Each mutant was deficient in its ability to accumulate phytochelatins (PCs) as detected by high-performance liquid chromatography and the amount of PCs accumulated by each mutant correlated with its degree of sensitivity to cadmium. The mutants had wild-type levels of glutathione, the substrate for PC biosynthesis, and in vitro assays demonstrated that each of the mutants was deficient in PC synthase activity. These results demonstrate conclusively the importance of PCs for cadmium tolerance in plants. PMID:7770517

Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

PubMed Central

Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

1998-01-01

Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

[The isolation and characteristics of mutants of the Saccharopolyspora erythraea strain resistant to thiostrepton].

PubMed

Nastasiak, I N; Fedorenko, V A; Danilenko, V N

1997-01-01

The formation of thiostreptone resistant spontaneous and nitrosoguanidine-induced mutants in the erythromycin-producing organism Saccharopolyspora erythraea was investigated. The investigated collection of the mutants was heterogeneous by the level of the thiostreptone resistance (2.5 to 20 micrograms/ml). The thiostreptone resistance mutations had a pleiotropic effect: 17 per cent of the mutants was characterized by the growth thermosensitivity and 26 and 5.8 per cent of the mutants were characterized by loss of the ability to form melanine and aerial mycelium respectively. Such phenotypes were most frequent in the mutants resistant to low concentrations of thiostreptone (2 to 5 micrograms/ml). The absolute majority of the isolated thiostreptone resistant mutants was unstable and formed both the antibiotic resistant and the antibiotic sensitive clones. The greatest portion of the strains with high antibiotic activity (20 per cent) was detected among the S. erythraea spontaneous mutants on the medium with 2.5 micrograms/ ml of thiostreptone. It was shown that the instability of the high antibiotic activity in the mutants was associated with loss of the thiostreptone resistance property.

Evolution and clinical impact of co-occurring genetic alterations in advanced-stage EGFR-mutant lung cancers. | Office of Cancer Genomics

Cancer.gov

A widespread approach to modern cancer therapy is to identify a single oncogenic driver gene and target its mutant-protein product (for example, EGFR-inhibitor treatment in EGFR-mutant lung cancers). However, genetically driven resistance to targeted therapy limits patient survival. Through genomic analysis of 1,122 EGFR-mutant lung cancer cell-free DNA samples and whole-exome analysis of seven longitudinally collected tumor samples from a patient with EGFR-mutant lung cancer, we identified critical co-occurring oncogenic events present in most advanced-stage EGFR-mutant lung cancers.

Effect of impaired twitching motility and biofilm dispersion on performance of Pseudomonas aeruginosa-powered microbial fuel cells.

PubMed

Shreeram, Devesh D; Panmanee, Warunya; McDaniel, Cameron T; Daniel, Susan; Schaefer, Dale W; Hassett, Daniel J

2018-02-01

Pseudomonas aeruginosa is a metabolically voracious bacterium that is easily manipulated genetically. We have previously shown that the organism is also highly electrogenic in microbial fuel cells (MFCs). Polarization studies were performed in MFCs with wild-type strain PAO1 and three mutant strains (pilT, bdlA and pilT bdlA). The pilT mutant was hyperpiliated, while the bdlA mutant was suppressed in biofilm dispersion chemotaxis. The double pilT bdlA mutant was expected to have properties of both mutations. Polarization data indicate that the pilT mutant showed 5.0- and 3.2-fold increases in peak power compared to the wild type and the pilT bdlA mutant, respectively. The performance of the bdlA mutant was surprisingly the lowest, while the pilT bdlA electrogenic performance fell between the pilT mutant and wild-type bacteria. Measurements of biofilm thickness and bacterial viability showed equal viability among the different strains. The thickness of the bdlA mutant, however, was twice that of wild-type strain PAO1. This observation implicates the presence of dead or dormant bacteria in the bdlA mutant MFCs, which increases biofilm internal resistance as confirmed by electrochemical measurements.

Tumours with class 3 BRAF mutants are sensitive to the inhibition of activated RAS.

PubMed

Yao, Zhan; Yaeger, Rona; Rodrik-Outmezguine, Vanessa S; Tao, Anthony; Torres, Neilawattie M; Chang, Matthew T; Drosten, Matthias; Zhao, Huiyong; Cecchi, Fabiola; Hembrough, Todd; Michels, Judith; Baumert, Hervé; Miles, Linde; Campbell, Naomi M; de Stanchina, Elisa; Solit, David B; Barbacid, Mariano; Taylor, Barry S; Rosen, Neal

2017-08-10

Approximately 200 BRAF mutant alleles have been identified in human tumours. Activating BRAF mutants cause feedback inhibition of GTP-bound RAS, are RAS-independent and signal either as active monomers (class 1) or constitutively active dimers (class 2). Here we characterize a third class of BRAF mutants-those that have impaired kinase activity or are kinase-dead. These mutants are sensitive to ERK-mediated feedback and their activation of signalling is RAS-dependent. The mutants bind more tightly than wild-type BRAF to RAS-GTP, and their binding to and activation of wild-type CRAF is enhanced, leading to increased ERK signalling. The model suggests that dysregulation of signalling by these mutants in tumours requires coexistent mechanisms for maintaining RAS activation despite ERK-dependent feedback. Consistent with this hypothesis, melanomas with these class 3 BRAF mutations also harbour RAS mutations or NF1 deletions. By contrast, in lung and colorectal cancers with class 3 BRAF mutants, RAS is typically activated by receptor tyrosine kinase signalling. These tumours are sensitive to the inhibition of RAS activation by inhibitors of receptor tyrosine kinases. We have thus defined three distinct functional classes of BRAF mutants in human tumours. The mutants activate ERK signalling by different mechanisms that dictate their sensitivity to therapeutic inhibitors of the pathway.

A Temporarily Red Light-Insensitive Mutant of Tomato Lacks a Light-Stable, B-Like Phytochrome.

PubMed Central

Van Tuinen, A.; Kerckhoffs, LHJ.; Nagatani, A.; Kendrick, R. E.; Koornneef, M.

1995-01-01

We have selected four recessive mutants in tomato (Lycopersicon esculentum Mill.) that, under continuous red light (R), have long hypocotyls and small cotyledons compared to wild type (WT), a phenotype typical of phytochrome B (phyB) mutants of other species. These mutants, which are allelic, are only insensitive to R during the first 2 days upon transition from darkness to R, and therefore we propose the gene symbol tri (temporarily red light insensitive). White light-grown mutant plants have a more elongated growth habit than that of the WT. An immunochemically and spectrophotometrically detectable phyB-like polypeptide detectable in the WT is absent or below detection limits in the tri1 mutant. In contrast to the absence of an elongation growth response to far-red light (FR) given at the end of the daily photoperiod (EODFR) in all phyB-deficient mutants so far characterized, the tri1 mutant responds to EODFR treatment. The tri1 mutant also shows a strong response to supplementary daytime far-red light. We propose that the phyB-like phytochrome deficient in the tri mutants plays a major role during de-etiolation and that other light-stable phytochromes can regulate the EODFR and shade-avoidance responses in tomato. PMID:12228517

Isolation and characterization of acid-sensitive mutants of Pediococcus acidilactici.

PubMed

Kurdi, Peter; Smitinont, Thitapha; Valyasevi, Ruud

2009-02-01

Acid-sensitive mutants of Pediococcus acidilactici BCC 9545, a starter culture of the Thai fermented pork sausage nham, were isolated as spontaneous neomycin resistant mutants. The mutants generally produced less acid and acidified the culture media less than the parent strain in a 72 h culturing period. Interestingly, the ATPase activities of the mutants did not differ considerably from that of the parent strain in acidic conditions. It was also found that the internal pH values of the mutant strains were somewhat lower in neutral environment, while at pH 5.0 their internal pHs were significantly lower compared to the parent's. Inhibiting the H(+)-ATPase activities in energized cells by N,N'-dicyclohexyl carbodiimide also revealed that protons were leaking from the mutants at neutral pH, which increased under acidic conditions. In contrast, the parent strain exhibited a smaller proton leak and only under acidic conditions. The membrane fatty acid analysis of the mutants indicated that under acidic conditions the mutants had a significantly smaller major unsaturated/saturated fatty acids ratio ((C(18:1)+C(18:3n6))/(C(16:0)+C(18:0))) compared to the parent strain's membrane. Taken together, these observations suggest there is a reasonable possibility that the membrane fatty acid profile differences in the mutants resulted in their acid-sensitivity.

Neutral lipid accumulation at elevated temperature in conditional mutants of two microalgae species.

PubMed

Yao, Shuo; Brandt, Anders; Egsgaard, Helge; Gjermansen, Claes

2012-12-01

Triacylglycerols, an energy storage compound in microalgae, are known to be accumulated after nitrogen starvation of microalgae cells. Microalgae could be of importance for future biodiesel production due to their fast growth rate and high oil content. In collections of temperature sensitive mutants of Chlamydomonas reinhardtii and Chlorella vulgaris, nine out of fourty-one mutants in C. reinhardtii and eleven out of fifty-three mutants in C. vulgaris contained increased amounts of neutral lipids, predominantly as triacylglycerols. Upon temperature induced cell-cycle arrest, these mutants showed enlarged cellular volume compared with the wild type. The C. reinhardtii mutants were analyzed further and one type of mutants displayed a shift in lipid composition from polar membrane lipids to neutral lipids after a temperature up-shift, while the second type of mutants accumulated more total lipid per cell, predominantly as neutral lipids as compared with the wild type. Three C. reinhardtii mutants were analyzed further and found to be arrested after DNA synthesis but prior to cell division in the cell cycle. These mutants will be useful in order to further understand neutral lipid accumulation in microalgae and suggest possibilities for biodiesel production by specific induction of lipid accumulation in miroalgal cultures by cell-cycle inhibition. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants.

PubMed

García-Contreras, Rodolfo; Lira-Silva, Elizabeth; Jasso-Chávez, Ricardo; Hernández-González, Ismael L; Maeda, Toshinari; Hashimoto, Takahiro; Boogerd, Fred C; Sheng, Lili; Wood, Thomas K; Moreno-Sánchez, Rafael

2013-12-01

Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed 4- to 12-fold higher Ga minimal inhibitory growth concentrations and a greater than 8-fold increase in the minimum biofilm eliminating Ga concentration. Both types of mutants produced Ga resistant biofilms whereas the formation of wild-type biofilms was strongly inhibited by Ga. The gene interrupted in the transposon mutant was hitA, which encodes a periplasmic iron binding protein that delivers Fe³⁺ to the HitB iron permease; complementation of the mutant with the hitA gene restored the Ga sensitivity. This hitA mutant showed a 14-fold decrease in Ga internalization versus the wild-type strain, indicating that the HitAB system is also involved in the Ga uptake. Ga uptake in the spontaneous mutant was also lower, although no mutations were found in the hitAB genes. Instead, this mutant harbored 64 non-silent mutations in several genes including those of the phenazine pyocyanin biosynthesis. The spontaneous mutant produced 2-fold higher pyocyanin basal levels than the wild-type; the addition of this phenazine to wild-type cultures protected them from the Ga bacteriostatic effect. The present data indicate that mutations affecting Ga transport and probably pyocyanin biosynthesis enable cells to develop resistance to Ga. Copyright © 2013 Elsevier GmbH. All rights reserved.

Analysis of in vivo correction of defined mismatches in the DNA mismatch repair mutants msh2, msh3 and msh6 of Saccharomyces cerevisiae.

PubMed

Lühr, B; Scheller, J; Meyer, P; Kramer, W

1998-02-01

We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.

Cloning, preparation and preliminary crystallographic studies of penicillin V acylase autoproteolytic processing mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, P. Manish; Brannigan, James A., E-mail: jab@ysbl.york.ac.uk; Prabhune, Asmita

The production, crystallization and characterization of three inactive mutants of penicillin V acylase from B. sphaericus in their respective precursor and processed forms are reported. The space groups are different for the native enzyme and the mutants. The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants willmore » provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme.« less

Towards a "Golden Standard" for computing globin stability: Stability and structure sensitivity of myoglobin mutants.

PubMed

Kepp, Kasper P

2015-10-01

Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports benchmarking of six protein stability calculators (POPMUSIC 2.1, I-Mutant 2.0, I-Mutant 3.0, CUPSAT, SDM, and mCSM) against 134 experimental stability changes for mutations of sperm-whale myoglobin. Six different high-resolution structures were used to test structure sensitivity that may impair protein calculations. The trend accuracy of the methods decreased as I-Mutant 2.0 (R=0.64-0.65), SDM (R=0.57-0.60), POPMUSIC2.1 (R=0.54-0.57), I-Mutant 3.0 (R=0.53-0.55), mCSM (R=0.35-0.47), and CUPSAT (R=0.25-0.48). The mean signed errors increased as SDM

Characterization of multilocus lesions in human cells exposed to X radiation and radon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chaudhry, M.A.; Jiang, Q.; Ricanati, M.

Human TK6 lymphoblasts were exposed to X radiation or radon, and thymidine kinase negative (TK{sup -/-}) mutants were selected, isolated and harvested for analysis of structural changes in the TK gene. A large majority (82%) of the radon-induced mutants, 74% of the X-radiation-induced mutants and 45% of the spontaneous mutants lost the entire active TK allele. To analyze these mutants further we measured the loss of heterozygosity at several loci neighboring the TK locus on chromosome 17q. A greater proportion (61%) of the radon-induced mutants than X-radiation-induced or spontaneous mutants harbored the smaller lesions involving the TK allele alone ormore » extending from the TK locus to one or both of the closest neighboring sequences tested. Further, 21% of the X-radiation-induced mutants but only 5% of the radon-induced mutants lost heterozygosity at the col1A1 locus, 31 Mb from the TK gene. These results are in agreement with a recent analysis of radon- and X-radiation-induced lesions inactivating the HPRT gene of TK6 cells, in which we reported that a lower percentage of radon- than X-radiation-induced mutants showed lesions extending to markers 800 kb or more from the HPRT gene on the X chromosome. In the present study, we observed that the percentage of slowly growing and very slowly growing TK{sup -/-} mutants was greater after treatment with radon than after treatment with X radiation, regardless of the type of lesion present. It is possible, therefore, that the radon-induced lesions are complex and/or less easily repaired, leading to slow growth in a large proportion of the surviving mutant cells. 36 refs., 6 figs., 2 tabs.« less

Dual MAPK inhibition is an effective therapeutic strategy for a subset of class II BRAF mutant melanoma.

PubMed

Dankner, Matthew; Lajoie, Mathieu; Moldoveanu, Dan; Nguyen, Tan-Trieu; Savage, Paul; Rajkumar, Shivshankari; Huang, Xiu; Lvova, Maria; Protopopov, Alexei; Vuzman, Dana; Hogg, David; Park, Morag; Guiot, Marie-Christine; Petrecca, Kevin; Mihalcioiu, Catalin; Watson, Ian R; Siegel, Peter M; Rose, April A N

2018-06-14

Dual MAPK pathway inhibition (dMAPKi) with BRAF and MEK inhibitors improves survival in BRAF V600E/K mutant melanoma, but the efficacy of dMAPKi in non-V600 BRAF mutant tumors is poorly understood. We sought to characterize the responsiveness of class II (enhanced kinase activity, dimerization dependent) BRAF mutant melanoma to dMAPKi. Tumors from patients with BRAF WT, V600E (class I) and L597S (class II) metastatic melanoma were used to generate patient-derived-xenografts (PDX). We assembled a panel of melanoma cell lines with class IIa (activation segment) or IIb (p-loop) mutations and compared these to wild-type or V600E/K BRAF mutant cells. Cell lines and PDXs were treated with BRAFi (vemurafenib, dabrafenib, encorafenib, LY3009120), MEKi (cobimetinib, trametinib, binimetinib) or the combination. We identified two patients with BRAF L597S metastatic melanoma who were treated with dMAPKi. BRAFi impaired MAPK signalling and cell growth in class I and II BRAF mutant cells. dMAPKi was more effective than either single MAPKi at inhibiting cell growth in all class II BRAF mutant cells tested. dMAPKi caused tumor regression in two melanoma PDXs with class II BRAF mutations, and prolonged survival of mice with class II BRAF mutant melanoma brain metastases. Two patients with BRAF L597S mutant melanoma clinically responded to dMAPKi. Class II BRAF mutant melanoma are growth inhibited by dMAPKi. Responses to dMAPKi have been observed in two patients with class II BRAF mutant melanoma. This data provides rationale for clinical investigation of dMAPKi in patients with class II BRAF mutant metastatic melanoma. Copyright ©2018, American Association for Cancer Research.

Both LOV1 and LOV2 domains of phototropin2 function as the photosensory domain for hypocotyl phototropic responses in Arabidopsis thaliana (Brassicaceae).

PubMed

Suetsugu, Noriyuki; Kong, Sam-Geun; Kasahara, Masahiro; Wada, Masamitsu

2013-01-01

Phototropins (phot) are blue light receptor proteins that mediate phototropism and control photomovement responses, such as chloroplast photorelocation movement and stomatal opening. Arabidopsis thaliana has two phototropins, phot1 and phot2. Although both phot1 and phot2 redundantly mediate photomovement responses, phot2 uniquely regulates phototropism and the chloroplast avoidance response under high-intensity blue light. However, compared to that of phot1, the mechanistic basis of phot2 function is poorly understood, and in particular, the importance of the LOV2 domain in phot2 function has not been clearly demonstrated. Indeed, photocycle-deficient LOV2 transgenic lines expressing phot2 in a phot1phot2 mutant background retained phototropism, although with less sensitivity than wild-type plants. We isolated 11 alleles of phot2 mutants and determined the molecular lesion in each allele. We analyzed hypocotyl phototropism, chloroplast photorelocation movement, and leaf flattening in the phot2 mutant and the respective phot1phot2 double mutant plants. We demonstrated that unlike the phot2 null mutant, the phot2-10 mutant, which has the defective phot2 LOV2 domain, retained the phototropic response and had unusual chloroplast movement. Mutants phot2-2 and phot2-6, which have a missense mutation in the kinase activation loop of phot2, had the phot2-null mutant phenotype. Furthermore, we convincingly demonstrated that the commonly used phot2-1 mutant allele is a phot2-null mutant. The analyses of the multiple phot2 mutant alleles provided strong evidence for the importance of both LOV domains and the kinase activation loop of phot2 in phototropism and other phot-dependent responses and also demonstrated that phot2-1 allele is a null mutant.

E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis.

PubMed

Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok

2015-10-26

Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.

Identification of Proteus mirabilis Mutants with Increased Sensitivity to Antimicrobial Peptides

PubMed Central

McCoy, Andrea J.; Liu, Hongjian; Falla, Timothy J.; Gunn, John S.

2001-01-01

Antimicrobial peptides (APs) are important components of the innate defenses of animals, plants, and microorganisms. However, some bacterial pathogens are resistant to the action of APs. For example, Proteus mirabilis is highly resistant to the action of APs, such as polymyxin B (PM), protegrin, and the synthetic protegrin analog IB-367. To better understand this resistance, a transposon mutagenesis approach was used to generate P. mirabilis mutants sensitive to APs. Four unique PM-sensitive mutants of P. mirabilis were identified (these mutants were >2 to >128 times more sensitive than the wild type). Two of these mutants were also sensitive to IB-367 (16 and 128 times more sensitive than the wild type). Lipopolysaccharide (LPS) profiles of the PM- and protegrin-sensitive mutants demonstrated marked differences in both the lipid A and O-antigen regions, while the PM-sensitive mutants appeared to have alterations of either lipid A or O antigen. Matrix-assisted laser desorption ionization–time of flight mass spectrometry analysis of the wild-type and PM-sensitive mutant lipid A showed species with one or two aminoarabinose groups, while lipid A from the PM- and protegrin-sensitive mutants was devoid of aminoarabinose. When the mutants were streaked on an agar-containing medium, the swarming motility of the PM- and protegrin-sensitive mutants was completely inhibited and the swarming motility of the mutants sensitive to only PM was markedly decreased. DNA sequence analysis of the mutagenized loci revealed similarities to an O-acetyltransferase (PM and protegrin sensitive) and ATP synthase and sap loci (PM sensitive). These data further support the role of LPS modifications as an elaborate mechanism in the resistance of certain bacterial species to APs and suggest that LPS surface charge alterations may play a role in P. mirabilis swarming motility. PMID:11408219

Analyses of tomato fruit brightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new hypomorphic allele of GDSL lipase.

PubMed

Petit, Johann; Bres, Cécile; Just, Daniel; Garcia, Virginie; Mauxion, Jean-Philippe; Marion, Didier; Bakan, Bénédicte; Joubès, Jérôme; Domergue, Frédéric; Rothan, Christophe

2014-02-01

The cuticle is a protective layer synthesized by epidermal cells of the plants and consisting of cutin covered and filled by waxes. In tomato (Solanum lycopersicum) fruit, the thick cuticle embedding epidermal cells has crucial roles in the control of pathogens, water loss, cracking, postharvest shelf-life, and brightness. To identify tomato mutants with modified cuticle composition and architecture and to further decipher the relationships between fruit brightness and cuticle in tomato, we screened an ethyl methanesulfonate mutant collection in the miniature tomato cultivar Micro-Tom for mutants with altered fruit brightness. Our screen resulted in the isolation of 16 glossy and 8 dull mutants displaying changes in the amount and/or composition of wax and cutin, cuticle thickness, and surface aspect of the fruit as characterized by optical and environmental scanning electron microscopy. The main conclusions on the relationships between fruit brightness and cuticle features were as follows: (1) screening for fruit brightness is an effective way to identify tomato cuticle mutants; (2) fruit brightness is independent from wax load variations; (3) glossy mutants show either reduced or increased cutin load; and (4) dull mutants display alterations in epidermal cell number and shape. Cuticle composition analyses further allowed the identification of groups of mutants displaying remarkable cuticle changes, such as mutants with increased dicarboxylic acids in cutin. Using genetic mapping of a strong cutin-deficient mutation, we discovered a novel hypomorphic allele of GDSL lipase carrying a splice junction mutation, thus highlighting the potential of tomato brightness mutants for advancing our understanding of cuticle formation in plants.

Analyses of Tomato Fruit Brightness Mutants Uncover Both Cutin-Deficient and Cutin-Abundant Mutants and a New Hypomorphic Allele of GDSL Lipase[C][W][OPEN

PubMed Central

Petit, Johann; Bres, Cécile; Just, Daniel; Garcia, Virginie; Mauxion, Jean-Philippe; Marion, Didier; Bakan, Bénédicte; Joubès, Jérôme; Domergue, Frédéric; Rothan, Christophe

2014-01-01

The cuticle is a protective layer synthesized by epidermal cells of the plants and consisting of cutin covered and filled by waxes. In tomato (Solanum lycopersicum) fruit, the thick cuticle embedding epidermal cells has crucial roles in the control of pathogens, water loss, cracking, postharvest shelf-life, and brightness. To identify tomato mutants with modified cuticle composition and architecture and to further decipher the relationships between fruit brightness and cuticle in tomato, we screened an ethyl methanesulfonate mutant collection in the miniature tomato cultivar Micro-Tom for mutants with altered fruit brightness. Our screen resulted in the isolation of 16 glossy and 8 dull mutants displaying changes in the amount and/or composition of wax and cutin, cuticle thickness, and surface aspect of the fruit as characterized by optical and environmental scanning electron microscopy. The main conclusions on the relationships between fruit brightness and cuticle features were as follows: (1) screening for fruit brightness is an effective way to identify tomato cuticle mutants; (2) fruit brightness is independent from wax load variations; (3) glossy mutants show either reduced or increased cutin load; and (4) dull mutants display alterations in epidermal cell number and shape. Cuticle composition analyses further allowed the identification of groups of mutants displaying remarkable cuticle changes, such as mutants with increased dicarboxylic acids in cutin. Using genetic mapping of a strong cutin-deficient mutation, we discovered a novel hypomorphic allele of GDSL lipase carrying a splice junction mutation, thus highlighting the potential of tomato brightness mutants for advancing our understanding of cuticle formation in plants. PMID:24357602

Aluminum-Resistant Arabidopsis Mutants That Exhibit Altered Patterns of Aluminum Accumulation and Organic Acid Release from Roots1

PubMed Central

Larsen, Paul B.; Degenhardt, Jörg; Tai, Chin-Yin; Stenzler, Laura M.; Howell, Stephen H.; Kochian, Leon V.

1998-01-01

Al-resistant (alr) mutants of Arabidopsis thaliana were isolated and characterized to gain a better understanding of the genetic and physiological mechanisms of Al resistance. alr mutants were identified on the basis of enhanced root growth in the presence of levels of Al that strongly inhibited root growth in wild-type seedlings. Genetic analysis of the alr mutants showed that Al resistance was semidominant, and chromosome mapping of the mutants with microsatellite and random amplified polymorphic DNA markers indicated that the mutants mapped to two sites in the Arabidopsis genome: one locus on chromosome 1 (alr-108, alr-128, alr-131, and alr-139) and another on chromosome 4 (alr-104). Al accumulation in roots of mutant seedlings was studied by staining with the fluorescent Al-indicator dye morin and quantified via inductively coupled argon plasma mass spectrometry. It was found that the alr mutants accumulated lower levels of Al in the root tips compared with wild type. The possibility that the mutants released Al-chelating organic acids was examined. The mutants that mapped together on chromosome 1 released greater amounts of citrate or malate (as well as pyruvate) compared with wild type, suggesting that Al exclusion from roots of these alr mutants results from enhanced organic acid exudation. Roots of alr-104, on the other hand, did not exhibit increased release of malate or citrate, but did alkalinize the rhizosphere to a greater extent than wild-type roots. A detailed examination of Al resistance in this mutant is described in an accompanying paper (J. Degenhardt, P.B. Larsen, S.H. Howell, L.V. Kochian [1998] Plant Physiol 117: 19–27). PMID:9576769

Dictyostelium myosin I double mutants exhibit conditional defects in pinocytosis.

PubMed

Novak, K D; Peterson, M D; Reedy, M C; Titus, M A

1995-12-01

The functional relationship between three Dictyostelium myosin Is, myoA, myoB, and myoC, has been examined through the creation of double mutants. Two double mutants, myoA-/B- and myoB-/C-, exhibit similar conditional defects in fluid-phase pinocytosis. Double mutants grown in suspension culture are significantly impaired in their ability to take in nutrients from the medium, whereas they are almost indistinguishable from wild-type and single mutant strains when grown on a surface. The double mutants are also found to internalize gp126, a 116-kD membrane protein, at a slower rate than either the wild-type or single mutant cells. Ultrastructural analysis reveals that both double mutants possess numerous small vesicles, in contrast to the wild-type or myosin I single mutants that exhibit several large, clear vacuoles. The alterations in fluid and membrane internalization in the suspension-grown double mutants, coupled with the altered vesicular profile, suggest that these cells may be compromised during the early stages of pinocytosis, a process that has been proposed to occur via actin-based cytoskeletal rearrangements. Scanning electron microscopy and rhodamine-phalloidin staining indicates that the myosin I double mutants appear to extend a larger number of actin-filled structures, such as filopodia and crowns, than wild-type cells. Rhodamine-phalloidin staining of the F-actin cytoskeleton of these suspension-grown cells also reveals that the double mutant cells are delayed in the rearrangement of cortical actin-rich structures upon adhesion to a substrate. We propose that myoA, myoB, and myoC play roles in controlling F-actin filled membrane projections that are required for pinosome internalization in suspension.

A Yersinia pestis tat mutant is attenuated in bubonic and small-aerosol pneumonic challenge models of infection but not as attenuated by intranasal challenge.

PubMed

Bozue, Joel; Cote, Christopher K; Chance, Taylor; Kugelman, Jeffrey; Kern, Steven J; Kijek, Todd K; Jenkins, Amy; Mou, Sherry; Moody, Krishna; Fritz, David; Robinson, Camenzind G; Bell, Todd; Worsham, Patricia

2014-01-01

Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge.

A Yersinia pestis tat Mutant Is Attenuated in Bubonic and Small-Aerosol Pneumonic Challenge Models of Infection but Not As Attenuated by Intranasal Challenge

PubMed Central

Bozue, Joel; Cote, Christopher K.; Chance, Taylor; Kugelman, Jeffrey; Kern, Steven J.; Kijek, Todd K.; Jenkins, Amy; Mou, Sherry; Moody, Krishna; Fritz, David; Robinson, Camenzind G.; Bell, Todd; Worsham, Patricia

2014-01-01

Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge. PMID:25101850

Comparison of effect of gamma ray irradiation on wild-type and N-terminal mutants of αA-crystallin.

PubMed

Ramkumar, Srinivasagan; Fujii, Noriko; Fujii, Norihiko; Thankappan, Bency; Sakaue, Hiroaki; Ingu, Kim; Natarajaseenivasan, Kalimuthusamy; Anbarasu, Kumarasamy

2014-01-01

To study the comparative structural and functional changes between wild-type (wt) and N-terminal congenital cataract causing αA-crystallin mutants (R12C, R21L, R49C, and R54C) upon exposure to different dosages of gamma rays. Alpha A crystallin N-terminal mutants were created with the site-directed mutagenesis method. The recombinantly overexpressed and purified wt and mutant proteins were used for further studies. A (60)Co source was used to generate gamma rays to irradiate wild and mutant proteins at dosages of 0.5, 1.0, and 2.0 kGy. The biophysical property of the gamma irradiated (GI) and non-gamma irradiated (NGI) αA-crystallin wt and N-terminal mutants were determined. Oligomeric size was determined by size exclusion high-performance liquid chromatography (HPLC), the secondary structure with circular dichroism (CD) spectrometry, conformation of proteins with surface hydrophobicity, and the functional characterization were determined regarding chaperone activity using the alcohol dehydrogenase (ADH) aggregation assay. αA-crystallin N-terminal mutants formed high molecular weight (HMW) cross-linked products as well as aggregates when exposed to GI compared to the NGI wt counterparts. Furthermore, all mutants exhibited changed β-sheet and random coil structure. The GI mutants demonstrated decreased surface hydrophobicity when compared to αA-crystallin wt at 0, 1.0, and 1.5 kGy; however, at 2.0 kGy a drastic increase in hydrophobicity was observed only in the mutant R54C, not the wt. In contrast, chaperone activity toward ADH was gradually elevated at the minimum level in all GI mutants, and significant elevation was observed in the R12C mutant. Our findings suggest that the N-terminal mutants of αA-crystallin are structurally and functionally more sensitive to GI when compared to their NGI counterparts and wt. Protein oxidation as a result of gamma irradiation drives the protein to cross-link and aggregate culminating in cataract formation.

Independent Origin of Plasmodium falciparum Antifolate Super-Resistance, Uganda, Tanzania, and Ethiopia

PubMed Central

Alifrangis, Michael; Schousboe, Mette L.; Ishengoma, Deus; Lusingu, John; Pota, Hirva; Kavishe, Reginald A.; Pearce, Richard; Ord, Rosalynn; Lynch, Caroline; Dejene, Seyoum; Cox, Jonathan; Rwakimari, John; Minja, Daniel T.R.; Lemnge, Martha M.; Roper, Cally

2014-01-01

Super-resistant Plasmodium falciparum threatens the effectiveness of sulfadoxine–pyrimethamine in intermittent preventive treatment for malaria during pregnancy. It is characterized by the A581G Pfdhps mutation on a background of the double-mutant Pfdhps and the triple-mutant Pfdhfr. Using samples collected during 2004–2008, we investigated the evolutionary origin of the A581G mutation by characterizing microsatellite diversity flanking Pfdhps triple-mutant (437G+540E+581G) alleles from 3 locations in eastern Africa and comparing it with double-mutant (437G+540E) alleles from the same area. In Ethiopia, both alleles derived from 1 lineage that was distinct from those in Uganda and Tanzania. Uganda and Tanzania triple mutants derived from the previously characterized southeastern Africa double-mutant lineage. The A581G mutation has occurred multiple times on local Pfdhps double-mutant backgrounds; however, a novel microsatellite allele incorporated into the Tanzania lineage since 2004 illustrates the local expansion of emergent triple-mutant lineages. PMID:25061906

Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya

2006-08-04

Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less

UV-induced lethal sectoring and pure mutant clones in yeast.

PubMed

Hannan, M A; Duck, P; Nasim, A

1976-08-01

The induction of lethal sectoring and pure mutant clones by ultraviolet light has been studied in a homogeneous G1 population of Saccharomyces cerevisiae grown in a normal growth medium. At the lowest UV dose of 250 ergs, which corresponds to a shoulder in the survival curve, all mutants appeared as pure clones. At higher doses the frequency of mosaic mutants progressively increased. These results indicate a relationship between the highest frequency of complete mutants and the maximum repair activity. In addition, the frequency of lethal sectoring at all doses tested was too low to account for the origin of pure mutant clones.

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Novel mutations in β-tubulin gene in Trichoderma harzianum mutants resistant to methyl benzimidazol-2-yl carbamate.

PubMed

Li, M; Zhang, H Y; Liang, B

2013-01-01

Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.

Dictyostelium discoideum mutants with conditional defects in phagocytosis

PubMed Central

1994-01-01

We have isolated and characterized Dictyostelium discoideum mutants with conditional defects in phagocytosis. Under suspension conditions, the mutants exhibited dramatic reductions in the uptake of bacteria and polystyrene latex beads. The initial binding of these ligands was unaffected, however, indicating that the defect was not in a plasma membrane receptor: Because of the phagocytosis defect, the mutants were unable to grow when cultured in suspensions of heat-killed bacteria. The mutants exhibited normal capacities for fluid phase endocytosis and grew as rapidly as parental (AX4) cells in axenic medium. Both the defects in phagocytosis and growth on bacteria were corrected when the mutant Dictyostelium cells were cultured on solid substrates. Reversion and genetic complementation analysis suggested that the mutant phenotypes were caused by single gene defects. While the precise site of action of the mutations was not established, the mutations are likely to affect an early signaling event because the binding of bacteria to mutant cells in suspension was unable to trigger the localized polymerization of actin filaments required for ingestion; other aspects of actin function appeared normal. This class of conditional phagocytosis mutant should prove to be useful for the expression cloning of the affected gene(s). PMID:7519624

Increased riboflavin production from activated bleaching earth by a mutant strain of Ashbya gossypii.

PubMed

Tajima, Satoshi; Itoh, Yoko; Sugimoto, Takashi; Kato, Tatsuya; Park, Enoch Y

2009-10-01

The production of riboflavin from vegetable oil was increased using a mutant strain of Ashbya gossypii. This mutant was generated by treating the wild-type strain with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). Riboflavin production was 10-fold higher in the mutant compared to the wild-type strain. The specific intracellular catalase activity after 3 d of culture was 6-fold higher in the mutant than in the wild-type strain. For the mutant, riboflavin production in the presence of 40 mM hydrogen peroxide was 16% less than that in the absence of hydrogen peroxide, whereas it was 56% less for the wild-type strain. The isocitrate lyase (ICL) activity of the mutant was 0.26 mU/mg of protein during the active riboflavin production phase, which was 2.6-fold higher than the wild-type strain. These data indicate that the mutant utilizes the carbon flux from the TCA cycle to the glyoxylate cycle more efficiently than the wild-type strain, resulting in enhanced riboflavin production. This novel mutant has the potential to be of use for industrial-scale riboflavin production from waste-activated bleaching earth (ABE), thereby transforming a useless material into a valuable bioproduct.

Characterization and classification of zebrafish brain morphology mutants

PubMed Central

Lowery, Laura Anne; De Rienzo, Gianluca; Gutzman, Jennifer H.; Sive, Hazel

2010-01-01

The mechanisms by which the vertebrate brain achieves its three-dimensional structure are clearly complex, requiring the functions of many genes. Using the zebrafish as a model, we have begun to define genes required for brain morphogenesis, including brain ventricle formation, by studying 16 mutants previously identified as having embryonic brain morphology defects. We report the phenotypic characterization of these mutants at several time-points, using brain ventricle dye injection, imaging, and immunohistochemistry with neuronal markers. Most of these mutants display early phenotypes, affecting initial brain shaping, while others show later phenotypes, affecting brain ventricle expansion. In the early phenotype group, we further define four phenotypic classes and corresponding functions required for brain morphogenesis. Although we did not use known genotypes for this classification, basing it solely on phenotypes, many mutants with defects in functionally related genes clustered in a single class. In particular, class 1 mutants show midline separation defects, corresponding to epithelial junction defects; class 2 mutants show reduced brain ventricle size; class 3 mutants show midbrain-hindbrain abnormalities, corresponding to basement membrane defects; and class 4 mutants show absence of ventricle lumen inflation, corresponding to defective ion pumping. Later brain ventricle expansion requires the extracellular matrix, cardiovascular circulation, and transcription/splicing-dependent events. We suggest that these mutants define processes likely to be used during brain morphogenesis throughout the vertebrates. PMID:19051268

Characterization of Staphylococcus aureus mutants expressing reduced susceptibility to common house-cleaners

PubMed Central

Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.

2013-01-01

Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191

Bacterial cell motility of Burkholderia gut symbiont is required to colonize the insect gut.

PubMed

Lee, Jun Beom; Byeon, Jin Hee; Jang, Ho Am; Kim, Jiyeun Kate; Yoo, Jin Wook; Kikuchi, Yoshitomo; Lee, Bok Luel

2015-09-14

We generated a Burkholderia mutant, which is deficient of an N-acetylmuramyl-l-alanine amidase, AmiC, involved in peptidoglycan degradation. When non-motile ΔamiC mutant Burkholderia cells harboring chain form were orally administered to Riptortus insects, ΔamiC mutant cells were unable to establish symbiotic association. But, ΔamiC mutant complemented with amiC gene restored in vivo symbiotic association. ΔamiC mutant cultured in minimal medium restored their motility with single-celled morphology. When ΔamiC mutant cells harboring single-celled morphology were administered to the host insect, this mutant established normal symbiotic association, suggesting that bacterial motility is essential for the successful symbiosis between host insect and Burkholderia symbiont. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Molecular basis of autosomal dominant neurohypophyseal diabetes insipidus. Cellular toxicity caused by the accumulation of mutant vasopressin precursors within the endoplasmic reticulum.

PubMed Central

Ito, M; Jameson, J L; Ito, M

1997-01-01

Mutations in the arginine vasopressin (AVP) gene cause autosomal dominant familial neurohypophyseal diabetes insipidus (FNDI). The dominant inheritance pattern has been postulated to reflect neuronal toxicity of the mutant proteins, but the mechanism for such cytotoxicity is unknown. In this study, wild-type or several different mutant AVP genes were stably expressed in neuro2A neuroblastoma cells. When cells were treated with valproic acid to induce neuronal differentiation, each of the mutants caused reduced viability. Metabolic labeling revealed diminished intracellular trafficking of mutant AVP precursors and confirmed inefficient secretion of immunoreactive AVP. Immunofluorescence studies demonstrated marked accumulation of mutant AVP precursors within the endoplasmic reticulum. These studies suggest that the cellular toxicity in FNDI may be caused by the intracellular accumulation of mutant precursor proteins. PMID:9109434

Misfolded rhodopsin mutants display variable aggregation properties.

PubMed

Gragg, Megan; Park, Paul S-H

2018-06-08

The largest class of rhodopsin mutations causing autosomal dominant retinitis pigmentosa (adRP) is mutations that lead to misfolding and aggregation of the receptor. The misfolding mutants have been characterized biochemically, and categorized as either partial or complete misfolding mutants. This classification is incomplete and does not provide sufficient information to fully understand the disease pathogenesis and evaluate therapeutic strategies. A Förster resonance energy transfer (FRET) method was utilized to directly assess the aggregation properties of misfolding rhodopsin mutants within the cell. Partial (P23H and P267L) and complete (G188R, H211P, and P267R) misfolding mutants were characterized to reveal variability in aggregation properties. The complete misfolding mutants all behaved similarly, forming aggregates when expressed alone, minimally interacting with the wild-type receptor when coexpressed, and were unresponsive to treatment with the pharmacological chaperone 9-cis retinal. In contrast, variability was observed between the partial misfolding mutants. In the opsin form, the P23H mutant behaved similarly as the complete misfolding mutants. In contrast, the opsin form of the P267L mutant existed as both aggregates and oligomers when expressed alone and formed mostly oligomers with the wild-type receptor when coexpressed. The partial misfolding mutants both reacted similarly to the pharmacological chaperone 9-cis retinal, displaying improved folding and oligomerization when expressed alone but aggregating with wild-type receptor when coexpressed. The observed differences in aggregation properties and effect of 9-cis retinal predict different outcomes in disease pathophysiology and suggest that retinoid-based chaperones will be ineffective or even detrimental. Copyright © 2018 Elsevier B.V. All rights reserved.

Mutagenesis in human cells with accelerated H and Fe ions

NASA Technical Reports Server (NTRS)

Kronenberg, Amy

1994-01-01

The overall goals of this research were to determine the risks of mutation induction and the spectra of mutations induced by energetic protons and iron ions at two loci in human lymphoid cells. During the three year grant period the research has focused in three major areas: (1) the acquisition of sufficient statistics for human TK6 cell mutation experiments using Fe ions (400 MeV/amu), Fe ions (600 MeV/amu) and protons (250 MeV/amu); (2) collection of thymidine kinase- deficient (tk) mutants or hypoxanthine phosphoribosyltransferase deficient (hprt) mutants induced by either Fe 400 MeV/amu, Fe 600 MeV/amu, or H 250 MeV/amu for subsequent molecular analysis; and (3) molecular characterization of mutants isolated after exposure to Fe ions (600 MeV/amu). As a result of the shutdown of the BEVALAC heavy ion accelerator in December 1992, efforts were rearranged somewhat in time to complete our dose-response studies and to complete mutant collections in particular for the Fe ion beams prior to the shutdown. These goals have been achieved. A major effort was placed on collection, re-screening, and archiving of 3 different series of mutants for the various particle beam exposures: tk-ng mutants, tk-sg mutants, and hprt-deficient mutants. Where possible, groups of mutants were isolated for several particle fluences. Comparative analysis of mutation spectra has occured with characterization of the mutation spectrum for hprt-deficient mutants obtained after exposure of TK6 cells to Fe ions (600 MeV/amu) and a series of spontaneous mutants.

Selective targeting of KRAS-Mutant cells by miR-126 through repression of multiple genes essential for the survival of KRAS-Mutant cells

PubMed Central

Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish

2014-01-01

MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095

Registration of two allelic erect leaf mutants of sorghum

USDA-ARS?s Scientific Manuscript database

Two allelic sorghum [Sorghum bicolor (L.) Moench] erect leaf (erl) mutants were isolated from an Annotated Individually-pedigreed Mutagenized Sorghum (AIMS) mutant library developed at the Plant Stress and Germplasm Development Unit, at Lubbock, Texas. The two mutants, erl1-1 and erl1-2, were isol...

Multiplex sequence analysis demonstrates the competitive growth advantage of the A-to-G mutants of clarithromycin-resistant Helicobacter pylori.

PubMed

Wang, G; Rahman, M S; Humayun, M Z; Taylor, D E

1999-03-01

Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates.

Multiplex Sequence Analysis Demonstrates the Competitive Growth Advantage of the A-to-G Mutants of Clarithromycin-Resistant Helicobacter pylori

PubMed Central

Wang, Ge; Rahman, M. Sayeedur; Humayun, M. Zafri; Taylor, Diane E.

1999-01-01

Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates. PMID:10049289

Isolation of ntrA-like mutants of Azotobacter vinelandii.

PubMed Central

Santero, E; Luque, F; Medina, J R; Tortolero, M

1986-01-01

A number of chlorate-resistant mutants of Azotobacter vinelandii affected in a general control of nitrogen metabolism were isolated. These mutants could not utilize dinitrogen, nitrate, or nitrite as a nitrogen source. The reason for this inability is that they were simultaneously deficient in nitrogenase and nitrate and nitrite reductase activities. They were complemented by a cosmid carrying a DNA fragment of A. vinelandii able to complement ntrA mutants of Escherichia coli, so they seemed to be ntrA-like mutants. PMID:3009406

Intragenic Mapping of Chemically Induced ad-7 Mutants of Schizosaccharomyces pombe

PubMed Central

Loprieno, Nicola

1967-01-01

Thirty adenine-requiring ad-7 mutants of Schizosaccharomyces pombe, induced by ethylmethanesulfonate, methyl-methanesulfonate, and hydroxylamine and exhibiting low spontaneous reversion frequencies, were located by intragenic recombination analysis. Their identification as ad-7 mutants was assessed in relation to two previously mapped ad-7 mutants. Each mutant was found to occupy a distinct mutational site; the smallest recombination fraction observed between the two closest mutational sites was of the order of 0.5 × 10−6. PMID:6051345

Poliovirus Mutants Resistant to Neutralization with Soluble Cell Receptors

NASA Astrophysics Data System (ADS)

Kaplan, Gerardo; Peters, David; Racaniello, Vincent R.

1990-12-01

Poliovirus mutants resistant to neutralization with soluble cellular receptor were isolated. Replication of soluble receptor-resistant (srr) mutants was blocked by a monoclonal antibody directed against the HeLa cell receptor for poliovirus, indicating that the mutants use this receptor to enter cells. The srr mutants showed reduced binding to HeLa cells and cell membranes. However, the reduced binding phenotype did not have a major impact on viral replication, as judged by plaque size and one-step growth curves. These results suggest that the use of soluble receptors as antiviral agents could lead to the selection of neutralization-resistant mutants that are able to bind cell surface receptors, replicate, and cause disease.

Repair of Ultraviolet Radiation Damage in Sensitive Mutants of Micrococcus radiodurans

PubMed Central

Moseley, B. E. B.

1969-01-01

Various aspects of the repair of ultraviolet (UV) radiation-induced damage were compared in wild-type Micrococcus radiodurans and two UV-sensitive mutants. Unlike the wild type, the mutants are more sensitive to radiation at 265 nm than at 280 nm. The delay in deoxyribonucleic acid (DNA) synthesis following exposure to UV is about seven times as long in the mutants as in the wild type. All three strains excise UV-induced pyrimidine dimers from their DNA, although the rate at which cytosine-thymine dimers are excised is slower in the mutants. The three strains also mend the single-strand breaks that appear in the irradiated DNA as a result of dimer excision, although the process is less efficient in the mutants. It is suggested that the increased sensitivity of the mutants to UV radiation may be caused by a partial defect in the second step of dimer excision. PMID:5773016

Use of NAP gene to manipulate leaf senescence in plants

DOEpatents

Gan, Susheng; Guo, Yongfeng

2013-04-16

The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

Improved Medium for Selecting Nitrate-Nonutilizing (nit) Mutants of Verticillium dahliae.

PubMed

Korolev, N; Katan, T

1997-10-01

ABSTRACT Nitrate-nonutilizing (nit) mutants are commonly used to determine vegetative compatibility between isolates of Verticillium dahliae by complementation (heterokaryon) testing. These mutants emerge spontaneously as chlorate-resistant sectors growing out of partially restricted, wild-type colonies on chlorate-amended media. The commonly used chlorate media are based on minimal medium (MMC) or cornmeal agar (CMC), amended with potassium chlorate. nit mutants recovered on these media constituted 10 to 36%(on MMC) and 25 to 45%(on CMC) of the apparently resistant sectors. An improved water agar chlorate medium (WAC) is described that is more effective for selecting chlorate-resistant nit mutants. WAC medium consists of agar (2%), glucose (0.02%), and potassium chlorate (2 to 5%). On WAC, growth of most V. dahliae isolates was strongly inhibited, and 66 to 100%(average >80%) of the chlorate-resistant sectors formed were nit mutants. Most mutants were characterized as nit1, and about 6% as NitM.

Increasing leaf longevity and disease resistance by altering salicylic acid catabolism

DOEpatents

Gan, Susheng; Zhang, Kewei

2018-01-23

The present invention relates to a transgenic plant having an altered level of salicylic acid 3-hydroxylase ("S3H") protein, compared to that of a non-transgenic plant, where the transgenic plant displays an altered leaf senescence phenotype, relative to a non-transgenic plant. The present invention relates to a mutant plant comprising an inactivated gene encoding S3H protein, where the mutant plant displays a premature or precocious leaf senescence phenotype, relative to a non-mutant plant. The present invention also relates to methods for promoting premature or precocious leaf senescence in a plant, delaying leaf senescence in a plant, and making a mutant plant having a decreased level of S3H protein compared to that of a non-mutant plant, where the mutant plant displays a premature or precocious leaf senescence phenotype relative to a non-mutant plant. The present invention also relates to inducing or promoting pathogen resistance in plants.

Identification of a novel Lymantria dispar nucleopolyhedrovirus mutant that exhibits abnormal polyhedron formation and virion occlusion

Treesearch

James M. Slavicek; Melissa J. Mercer; Dana Pohlman; Mary Ellen Kelly; David S. Bischoff

1998-01-01

In previous studies on the formation of Lymantria dispar nuclear polyhedrosis virus (LdMNPV) few polyhedra (FP) mutants, several polyhedron formation mutants (PFM) were identified that appeared to be unique. These viral mutants are being characterized to investigate the processes of polyhedron formation and virion occlusion. Ld

Intracistronic complementation in the simian virus 40 A gene.

PubMed Central

Tornow, J; Cole, C N

1983-01-01

A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

Genetics of Ustilago violacea. I. Carotenoid mutants and carotenogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garber, E.D.; Baird, M.L.; Chapman, D.J.

1975-12-01

Wild-type strains of Ustilago violacea produce pink colonies on laboratory medium and yield white, orange, pumpkin, and yellow colonies after uv mutagenesis. The wild-type strains contain neurosporene and lycopene; one orange mutant, $gamma$-carotene; and one yellow mutant, $beta$-carotene. One white mutant had no detectable carotenoids. Diploid colonies heterozygous for wild type and orange, pumpkin, yellow, or white are phenotypically wild type. Diploid colonies heterozygous for yellow and orange are also phenotypically wild type. Diploid colonies heterozygous for white and orange; white and yellow; and white, yellow, and orange are phenotypically light orange, light yellow, and orange- yellow, respectively. The whitemore » mutants give a circular complementation map; the color mutants fit a linear complementation map. We propose a multienzyme of four identical dehydrogenases and one or two identical cyclases for carotenogenesis in this species. The white and color mutants represent structural mutations altering the conformation of the dehydrogenase or cyclase, respectively. Furthermore, cyclases may or may not aggregate in association with the dehydrogenase aggregate to form the multienzyme aggregate responsible for the color mutants. (auth)« less

A low, adaptive dose of gamma-rays reduced the number and altered the spectrum of S1- mutants in human-hamster hybrid AL cells

NASA Technical Reports Server (NTRS)

Ueno, A. M.; Vannais, D. B.; Gustafson, D. L.; Wong, J. C.; Waldren, C. A.

1996-01-01

We examined the effects of a low, adaptive dose of 137Cs-gamma-irradiation (0.04 Gy) on the number and kinds of mutants induced in AL human-hamster hybrid cells by a later challenge dose of 4 Gy. The yield of S1- mutants was significantly less (by 53%) after exposure to both the adaptive and challenge doses compared to the challenge dose alone. The yield of hprt- mutants was similarly decreased. Incubation with cycloheximide (CX) or 3-aminobenzamide largely negated the decrease in mutant yield. The adaptive dose did not perturb the cell cycle, was not cytotoxic, and did not of itself increase the mutant yield above background. The adaptive dose did, however, alter the spectrum of S1- mutants from populations exposed only to the adaptive dose, as well as affecting the spectrum of S1- mutants generated by the challenge dose. The major change in both cases was a significant increase in the proportion of complex mutations compared to small mutations and simple deletions.

Analysis of Induced Pluripotent Stem Cells from a BRCA1 Mutant Family

PubMed Central

Soyombo, Abigail A.; Wu, Yipin; Kolski, Lauren; Rios, Jonathan J.; Rakheja, Dinesh; Chen, Alice; Kehler, James; Hampel, Heather; Coughran, Alanna; Ross, Theodora S.

2013-01-01

Summary Understanding BRCA1 mutant cancers is hampered by difficulties in obtaining primary cells from patients. We therefore generated and characterized 24 induced pluripotent stem cell (iPSC) lines from fibroblasts of eight individuals from a BRCA1 5382insC mutant family. All BRCA1 5382insC heterozygous fibroblasts, iPSCs, and teratomas maintained equivalent expression of both wild-type and mutant BRCA1 transcripts. Although no difference in differentiation capacity was observed between BRCA1 wild-type and mutant iPSCs, there was elevated protein kinase C-theta (PKC-theta) in BRCA1 mutant iPSCs. Cancer cell lines with BRCA1 mutations and hormone-receptor-negative breast cancers also displayed elevated PKC-theta. Genome sequencing of the 24 iPSC lines showed a similar frequency of reprogramming-associated de novo mutations in BRCA1 mutant and wild-type iPSCs. These data indicate that iPSC lines can be derived from BRCA1 mutant fibroblasts to study the effects of the mutation on gene expression and genome stability. PMID:24319668

Kasugamycin-dependent mutants of Escherichia coli.

PubMed Central

Dabbs, E R

1978-01-01

Kasugamycin-dependent mutants have been isolated from Escherichia coli B. They were obtained through mutagenesis with ethyl methane sulfonate or nitrosoguanidine in conjunction with an antibiotic underlay technique. In the case of nitrosoguanidine, dependent mutants were obtained at a frequency of about 3% of survivors growing up in the selection. In the case of ethyl methane sulfonate, the corresponding value was 1%. Nineteen mutants showing a kasugamycin-dependent phenotype were studied. In terms of response to various temperatures and antibiotic concentrations, they were very heterogeneous, although most fell into two general classes. Genetic analysis indicated that in at least some cases, the kasugamycin-dependent phenotype was the product of two mutations. Two-dimensional gel electropherograms revealed alterations in the ribosomal proteins of seven mutants. One mutant had an alteration in protein S13, and one had an alteration in protein L14. Three showed changes in protein S9. Each of two mutants had changes in two proteins, S18 and L11. Three of these mutants additionally had protein S18 occurring in a partly altered, partly unaltered form. Images PMID:363701

Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

PubMed

Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

2016-10-07

CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

Isolation and Identification of Pathogenicity Mutant of Curvularia lunata via Restriction Enzyme-Mediated Integration.

PubMed

Wang, Y J; Liu, T; Hou, J M; Zuo, Y H

2013-09-01

In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.

Gravitropism in roots of intermediate-starch mutants of Arabidopsis

NASA Technical Reports Server (NTRS)

Kiss, J. Z.; Wright, J. B.; Caspar, T.

1996-01-01

Gravitropism was studied in roots of wild type (WT) Arabidopsis thaliana (L.) Heynh. (strain Wassilewskija) and three starch-deficient mutants that were generated by T-DNA insertional mutagenesis. One of these mutants was starchless while the other two were intermediate mutants, which had 51% and 60%, respectively, of the WT amount of starch as determined by light and electron microscopy. The four parameters used to assay gravitropism were: orientation during vertical growth, time course of curvature, induction, and intermittent stimulation experiments. WT roots were much more responsive to gravity than were roots of the starchless mutant, and the intermediate starch mutants exhibited an intermediate graviresponse. Our data suggest that lowered starch content in the mutants primarily affects gravitropism rather than differential growth because both phototropic curvature and growth rates were approximately equal among all four genotypes. Since responses of intermediate-starch mutants were closer to the WT response than to the starchless mutant, it appears that 51-60% of the WT level of starch is near the threshold amount needed for full gravitropic sensitivity. While other interpretations are possible, the data are consistent with the starch statolith hypothesis for gravity perception in that the degree of graviresponsiveness is proportional to the total mass of plastids per cell.

Ultraviolet light-induced mutants of Streptococcus lactis subspecies diacetylactis with enhanced acid- or flavor-producing abilities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuila, R.K.; Ranganathan, B.

1978-04-01

A strain of Streptococcus lactis subspecies diacetylactis S/sub 1/ isolated from fresh milk was exposed to 7200 ergs/mm/sup 2/ of ultraviolet radiation. Over 8100 colonies surviving from 7.4 x 10/sup 6/ cells exposed to radiation were screened on citrate agar for detection and isolation of mutants with increased flavor and/or acid production. Of the survivors, 960 were type-I mutants that exhibited clear zone on citrate agar after 18 h (presumed to be high diacetyl producers), and 288 were type-II mutants which did not exhibit clear zones on citrate agar for up to 72 h (high acid producers). Type-II mutants producedmore » an average .93 percent titratable acidity which was 34 percent more than the .69 percent of the parent. Reduction in titratable acidity (56 percent less) was considerable in type-I mutants, compared with the parent culture. Diacetyl + acetoin production by type-I mutants was 137.9 ppM which has 4.5 times more than that of the parental strain. Acetaldehyde production in the mutants varied from 1.5 to 34.5 ppM (parent culture 3.0 ppM). The mutants with increased acid and high acetoin plus diacetyl production were stable after 50 subcultures in milk.« less

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Stability analysis of a high fibre yield and low lignin content "thick stem" mutant in tossa jute (Corchorus olitorius L.).

PubMed

Mandal, Aninda; Datta, Animesh K

2014-01-01

A "thick stem" mutant of Corchorus olitorius L. was induced at M2 (0.50%, 4 h, EMS) and the true breeding mutant is assessed across generations (M5 to M7) considering morphometric traits as well as SEM analysis of pollen grains and raw jute fibres, stem anatomy, cytogenetical attributes, and lignin content in relation to control. Furthermore, single fibre diameter and tensile strength are also analysed. The objective is to assess the stability of mutant for its effective exploration for raising a new plant type in tossa jute for commercial exploitation and efficient breeding. The mutant trait is monogenic recessive to normal. Results indicate that "thick stem" mutant is stable across generations (2n = 14) with distinctive high seed and fibre yield and significantly low lignin content. Stem anatomy of the mutant shows significant enhancement in fibre zone, number of fibre pyramids and fibre bundles per pyramid, and diameter of fibre cell in relation to control. Moreover, tensile strength of mutant fibre is significantly higher than control fibre and the trait is inversely related to fibre diameter. However the mutant is associated with low germination frequency, poor seed viability, and high pollen sterility, which may be eliminated through mutational approach followed by rigorous selection and efficient breeding.

Improvement of erythrose reductase activity, deletion of by-products and statistical media optimization for enhanced erythritol production from Yarrowia lipolytica mutant 49.

PubMed

Ghezelbash, Gholam Reza; Nahvi, Iraj; Emamzadeh, Rahman

2014-08-01

The purpose of the present investigation was to produce erythritol by Yarrowia lipolytica mutant without any by-products. Mutants of Y. lipolytica were generated by ultra-violet for enhancing erythrose reductase (ER) activity and erythritol production. The mutants showing the highest ER activity were screened by triphenyl tetrazolium chloride agar plate assay. Productivity of samples was analyzed by thin-layer chromatography and high-performance liquid chromatography equipped with the refractive index detector. One of the mutants named as mutant 49 gave maximum erythritol production without any other by-products (particularly glycerol). Erythritol production and specific ER activity in mutant 49 increased to 1.65 and 1.47 times, respectively, in comparison with wild-type strain. The ER gene of wild and mutant strains was sequenced and analyzed. A general comparison of wild and mutant gene sequences showed the replacement of Asp(270) with Glu(270) in ER protein. In order to enhance erythritol production, we used a three component-three level-one response Box-Behnken of response surface methodology model. The optimum medium composition for erythritol production was found to be (g/l) glucose 279.49, ammonium sulfate 9.28, and pH 5.41 with 39.76 erythritol production.

The Klebsiella pneumoniae wabG Gene: Role in Biosynthesis of the Core Lipopolysaccharide and Virulence

PubMed Central

Izquierdo, Luis; Coderch, Núria; Piqué, Nuria; Bedini, Emiliano; Michela Corsaro, Maria; Merino, Susana; Fresno, Sandra; Tomás, Juan M.; Regué, Miguel

2003-01-01

To determine the function of the wabG gene in the biosynthesis of the core lipopolysaccharide (LPS) of Klebsiella pneumoniae, we constructed wabG nonpolar mutants. Data obtained from the comparative chemical and structural analysis of LPS samples obtained from the wild type, the mutant strain, and the complemented mutant demonstrated that the wabG gene is involved in attachment to α-l-glycero-d-manno-heptopyranose II (l,d-HeppII) at the O-3 position of an α-d-galactopyranosyluronic acid (α-d-GalAp) residue. K. pneumoniae nonpolar wabG mutants were devoid of the cell-attached capsular polysaccharide but were still able to produce capsular polysaccharide. Similar results were obtained with K. pneumoniae nonpolar waaC and waaF mutants, which produce shorter LPS core molecules than do wabG mutants. Other outer core K. pneumoniae nonpolar mutants in the waa gene cluster were encapsulated. K. pneumoniae waaC, waaF, and wabG mutants were avirulent when tested in different animal models. Furthermore, these mutants were more sensitive to some hydrophobic compounds than the wild-type strains. All these characteristics were rescued by reintroduction of the waaC, waaF, and wabG genes from K. pneumoniae. PMID:14645282

Diaminopurine-Resistant Mutants of Cultured, Diploid Human Fibroblasts

PubMed Central

Rappaport, Harriet; DeMars, Robert

1973-01-01

Clones of cells resistant to 2,6-diaminopurine were detected in skin fibroblast cultures derived from 13 of 21 normal humans of both sexes from 17 unrelated families. Almost all of the cultures that yielded mutants were chosen for further study from among a total of 83 surveyed because they displayed a slight resistance to low concentrations of diaminopurine. The incidences of mutant colonies ranged between about 10-5 and 10-4 per cell surviving prior mutagenic treatment with MNNG. The incidences of spontaneous mutants were about 10-7 to 10-5 in three unrelated cultures. Most independent mutants had distinctly reduced activity of adenine phosphoribosyltransferase but some had apparently normal amounts of activity. Two mutants from unrelated boys had little or no detectable enzyme activity and were unable to effectively use exogenous adenine for growth when purine biosynthesis was blocked with azaserine. Most mutants could utilize exogenous adenine, just as most azaguanine-resistant fibroblast mutants can utilize exogenous hypoxanthine, even when their hypoxanthine-guanine phosphoribosyltransferase activity is reduced. Diverse genetic changes conferred diaminopurine resistance but their specific natures are still undefined. Gross numerical or structural chromosome abnormalities were not observed in the mutants examined so far. Since at least one gene responsible for adenine phosphoribosyltransferase activity is on autosome No. 16 our results suggest that at least some of the cultures yielding mutants were heterozygous and that alleles conferring diaminopurine resistance may be frequent enough to comprise a polymorphism. PMID:4358687

Creation, characterization and utilization of Cryptococcus neoformans mutants sensitive to micafungin.

PubMed

Toh-E, Akio; Ohkusu, Misako; Shimizu, Kiminori; Yamaguchi, Masashi; Ishiwada, Naruhiko; Watanabe, Akira; Kamei, Katsuhiko

2017-12-01

We constructed deletion mutants of Cryptococcus neoformans var neoformans (serotype D) genes encoding late ergosterol biosynthetic pathway enzymes and found that the mutations enhanced susceptibility to various drugs including micafungin, one of the echinocandins, to which wild-type Cryptococcus strains show no susceptibility. Furthermore, through isolation of a mutant resistant to micafungin from a micafungin-sensitive erg mutant and genetic analysis of it, we found that the responsible mutation occurred in the hotspot 2 of FKS1 encoding β-1, 3-glucan synthase, indicating that micafungin inhibited the growth of the erg mutant via inhibiting Fks1 activity. Addition of ergosterol to the culture of the erg mutants recovered the resistance to micafungin, suggesting that the presence of ergosterol in membrane inhibits the accession of micafungin to its target. We found that a loss of one of genes encoding subunits of v-ATPase, VPH1, made Cryptococcus cells sensitive to micafungin. Our observation that the erg2 vph1 double mutant was more sensitive to micafungin than either single mutant suggests that these two genes act differently in becoming resistant to micafungin. The erg mutants allowed us to study the physiological significance of β-1, 3-glucan synthesis in C. neoformans; the inhibition of β-1, 3-glucan synthesis induced cell death and changes in cellular morphology. By observing the erg mutant cells recovering from the growth inhibition imposed by micafungin, we recognized β-1, 3-glucan synthesis would suppress filamentous growth in C. neoformans.

The Kinase Activity of Ataxia-Telangiectasia Mutated Interferes with Adenovirus E4 Mutant DNA Replication

PubMed Central

Gautam, Dipendra

2013-01-01

Adenovirus (Ad) mutants that lack early region 4 (E4) are unable to produce the early regulatory proteins that normally inactivate the Mre11/Rad50/Nbs1 (MRN) sensor complex, which is a critical component for the ability of cells to respond to DNA damage. E4 mutant infection therefore activates a DNA damage response, which in turn interferes with a productive viral infection. MRN complex proteins localize to viral DNA replication centers in E4 mutant-infected cells, and this complex is critical for activating the kinases ataxia-telangiectasia mutated (ATM) and ATM and Rad3-related (ATR), which phosphorylate numerous substrates important for DNA repair, cell cycle checkpoint activation, and apoptosis. E4 mutant growth defects are substantially rescued in cells lacking an intact MRN complex. We have assessed the role of the downstream ATM and ATR kinases in several MRN-dependent E4 mutant phenotypes. We did not identify a role for either ATM or ATR in “repair” of E4 mutant genomes to form concatemers. ATR was also not observed to contribute to E4 mutant defects in late protein production. In contrast, the kinase activity of ATM was important for preventing efficient E4 mutant DNA replication and late gene expression. Our results suggest that the MRN complex interferes with E4 mutant DNA replication at least in part through its ability to activate ATM. PMID:23740981

Brucella abortus Cyclic β-1,2-Glucan Mutants Have Reduced Virulence in Mice and Are Defective in Intracellular Replication in HeLa Cells

PubMed Central

Briones, Gabriel; Iñón de Iannino, Nora; Roset, Mara; Vigliocco, Ana; Paulo, Patricia Silva; Ugalde, Rodolfo A.

2001-01-01

Null cyclic β-1,2-glucan synthetase mutants (cgs mutants) were obtained from Brucella abortus virulent strain 2308 and from B. abortus attenuated vaccinal strain S19. Both mutants show greater sensitivity to surfactants like deoxycholic acid, sodium dodecyl sulfate, and Zwittergent than the parental strains, suggesting cell surface alterations. Although not to the same extent, both mutants display reduced virulence in mice and defective intracellular multiplication in HeLa cells. The B. abortus S19 cgs mutant was completely cleared from the spleens of mice after 4 weeks, while the 2308 mutant showed a 1.5-log reduction of the number of brucellae isolated from the spleens after 12 weeks. These results suggest that cyclic β-1,2-glucan plays an important role in the residual virulence of the attenuated B. abortus S19 strain. Although the cgs mutant was cleared from the spleens earlier than the wild-type parental strain (B. abortus S19) and produced less inflammatory response, its ability to confer protection against the virulent strain B. abortus 2308 was fully retained. Equivalent levels of induction of spleen gamma interferon mRNA and anti-lipopolysaccharide (LPS) of immunoglobulin G2a (IgG2a) subtype antibodies were observed in mice injected with B. abortus S19 or the cgs mutant. However, the titer of anti-LPS antibodies of the IgG1 subtype induced by the cgs mutant was lower than that observed with the parental S19 strain, thus suggesting that the cgs mutant induces a relatively exclusive Th1 response. PMID:11401996

Isolation and Characterization of Mutants of Common Ice Plant Deficient in Crassulacean Acid Metabolism1[W][OA

PubMed Central

Cushman, John C.; Agarie, Sakae; Albion, Rebecca L.; Elliot, Stewart M.; Taybi, Tahar; Borland, Anne M.

2008-01-01

Crassulacean acid metabolism (CAM) is a specialized mode of photosynthesis that improves water use efficiency by shifting part or all of net atmospheric CO2 uptake to the night. Genetic dissection of regulatory and metabolic attributes of CAM has been limited by the difficulty of identifying a reliable phenotype for mutant screening. We developed a novel and simple colorimetric assay to measure leaf pH to screen fast neutron-mutagenized populations of common ice plant (Mesembryanthemum crystallinum), a facultative CAM species, to detect CAM-deficient mutants with limited nocturnal acidification. The isolated CAM-deficient mutants showed negligible net dark CO2 uptake compared with wild-type plants following the imposition of salinity stress. The mutants and wild-type plants accumulated nearly comparable levels of sodium in leaves, but the mutants grew more slowly than the wild-type plants. The mutants also had substantially reduced seed set and seed weight relative to wild type under salinity stress. Carbon-isotope ratios of seed collected from 4-month-old plants indicated that C3 photosynthesis made a greater contribution to seed production in mutants compared to wild type. The CAM-deficient mutants were deficient in leaf starch and lacked plastidic phosphoglucomutase, an enzyme critical for gluconeogenesis and starch formation, resulting in substrate limitation of nocturnal C4 acid formation. The restoration of nocturnal acidification by feeding detached leaves of salt-stressed mutants with glucose or sucrose supported this defect and served to illustrate the flexibility of CAM. The CAM-deficient mutants described here constitute important models for exploring regulatory features and metabolic consequences of CAM. PMID:18326789

Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

PubMed Central

Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří

2015-01-01

Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

Survival, growth, and localization of epiphytic fitness mutants of pseudomonas syringae on leaves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beattie, G.A.; Lindow, S.E.

Among 82 epiphytic fitness mutants of a Pseudomonas syringae pv. syringae strain that were characterized in a previous study, 4 mutants were particularly intolerant of the stresses associated with dry leaf surfaces. These four mutants each exhibited distinctive behaviors when inoculated into and into plant leaves. For example, while non showed measurable growth on dry potato leaf surfaces, they grew to different population sizes in the intercellular space of bean leaves and on dry bean leaf surfaces, and one mutant appeared incapable of growth in both environments although it grew well on moist bean leaves. The presence of the parentalmore » strain did not influence the survival of the mutants immediately following exposure of leaves to dry, high-light incubation conditions, suggesting that the reduced survival of the mutants did not result from an inability to produce extracellular factors in planta. On moist bean leaves that were colonized by either a mutant or the wild type, the proportion of the total epiphytic population that was located in sizes protected from a surface sterilant was smaller for the mutants than for the wild type, indicating that the mutants were reduced in their ability to locate, multiply in, and/or survive in such protected sites. This reduced ability was only one of possible several factors contributing to the reduced epiphytic fitness of each mutant. Their reduced fitness was not specific to the host plant bean, since they also exhibited reduced fitness on the nonhost plant potato; the functions altered in these strains are thus of interest for their contribution to the general fitness of bacterial epiphytes. 52 refs., 6 figs., 1 tab.« less

HoxB2 binds mutant SOD1 and is altered in transgenic model of ALS.

PubMed

Zhai, Jinbin; Lin, Hong; Canete-Soler, Rafaela; Schlaepfer, William W

2005-09-15

Mutations in Cu/Zn superoxide dismutase (SOD1) cause approximately 20% of familial amyotrophic lateral sclerosis by a toxic gain of function; however, the precise mechanisms remain unclear. Here, we report the identification of HoxB2, a homeodomain-containing transcription factor, as a G93A mutant SOD1 interactive protein in a yeast two-hybrid screen. We show that HoxB2 co-precipitates and co-localizes with mutant SOD1 in neuronal cell lines, as well as in brain and spinal cord of G93A mutant SOD1 transgenic mice. Mutagenesis further shows that this interaction is mediated by the central homeodomain of HoxB2. In motor neuron-like NSC-34 cells, overexpression of HoxB2 or its homeodomain decreases the insolubility of mutant SOD1 and inhibits G93A or G86R mutant SOD1-induced neuronal cell death. In human and mouse tissues, we show that expression of HoxB2 persists in adult spinal cord and is primarily localized in nuclei of motor neurons. In G93A transgenic mice, HoxB2 co-localizes with mutant SOD1 and is redistributed to perikarya and proximal neurites of motor neurons. In addition, there is progressive accumulation of HoxB2 and mutant SOD1 as punctate inclusions in the neuropil surrounding motor neurons. Taken together, our findings demonstrate that interaction of HoxB2 with mutant SOD1 occurs in motor neurons of G93A mutant SOD1 transgenic mice and suggest that this interaction may modulate the neurotoxicity of mutant SOD1.

Generation of a Uracil Auxotroph Strain of the Probiotic Yeast Saccharomyces boulardii as a Host for the Recombinant Protein Production

PubMed Central

Hamedi, Hassan; Misaghi, Ali; Modarressi, Mohammad Hossein; Salehi, Taghi Zahraei; Khorasanizadeh, Dorsa; Khalaj, Vahid

2013-01-01

Background Saccharomyces boulardii (S. boulardii) is the best known probiotic yeast. The genetic engineering of this probiotic strain requires the availability of appropriate mutants to accept various gene constructs carrying different selection markers. As the auxotrophy selection markers are under focus, we have generated a ura3 auxotroph mutant of S. boulardii for use in further genetic manipulations. Methods Classical UV mutagenesis was used for the generation of auxotroph mutants. The mutants were selected in the presence of 5-FOA (5-Fluoroorotic acid), uracil and uridine. Uracil auxotrophy phenotype was confirmed by the ability of mutants to grow in the presence of uracil and the lack of growth in the absence of this compound. To test whether the uracil auxotrophy phenotype is due to the inactivation of URA3, the mutants were transformed with a plasmid carrying the gene. An in vitro assay was used for the analysis of acid and bile resistance capacity of these mutants. Results Three mutants were found to be ura3 auxotroph as they were able to grow only in the presence of uracil. When the URA3 gene was added, these mutants were able to grow normally in the absence of uracil. Further in vitro analysis showed that the acid and bile resistance capacity of one of these mutants is intact and similar to the wild type. Conclusion A uracil auxotroph mutant of the probiotic yeast, S. boulardii, was generated and characterized. This auxotroph strain may have potential applications in the production and delivery of the recombinant pharmacuetics into the intestinal lumen. PMID:23626874

Isolation and characterization of xylitol-assimilating mutants of recombinant Saccharomyces cerevisiae.

PubMed

Tani, Tatsunori; Taguchi, Hisataka; Fujimori, Kazuhiro E; Sahara, Takehiko; Ohgiya, Satoru; Kamagata, Yoichi; Akamatsu, Takashi

2016-10-01

To clarify the mechanisms of xylitol utilization, three xylitol-assimilating mutants were isolated from recombinant Saccharomyces cerevisiae strains showing highly efficient xylose-utilization. The nucleotide sequences of the mutant genomes were analyzed and compared with those of the wild-type strains and the mutation sites were identified. gal80 mutations were common to all the mutants, and recessive to the wild-type allele. Hence we constructed a gal80Δ mutant and confirmed that the gal80Δ mutant showed a xylitol-assimilation phenotype. When the constructed gal80Δ mutant was crossed with the three isolated mutants, all diploid hybrids showed xylitol assimilation, indicating that the mutations were all located in the GAL80. We analyzed the role of the galactose permease Gal2, controlled by the regulatory protein Gal80, in assimilating xylitol. A gal2Δ gal80Δ double mutant did not show xylitol assimilation, whereas expression of GAL2 under the control of the TDH3 promoter in the GAL80 strain did result in assimilation. These data indicate that Gal2 was needed for xylitol assimilation in the wild-type strain. When the gal80 mutant with an initial cell concentration of A660 = 20 was used for batch fermentation in a complex medium containing 20 g/L xylose or 20 g/L xylitol at pH 5.0 and 30°C under oxygen limitation, the gal80 mutant consumed 100% of the xylose within 12 h, but <30% of the xylitol within 100 h, indicating that xylose reductase is required for xylitol consumption in oxygen-limited conditions. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Rhodobacter sphaeroides spd mutations allow cytochrome c2-independent photosynthetic growth.

PubMed Central

Rott, M A; Donohue, T J

1990-01-01

In Rhodobacter sphaeroides, cytochrome c2 (cyt c2) is a periplasmic redox protein required for photosynthetic electron transfer. cyt c2-deficient mutants created by replacing the gene encoding the apoprotein for cyt c2 (cycA) with a kanamycin resistance cartridge are photosynthetically incompetent. Spontaneous mutations that suppress this photosynthesis deficiency (spd mutants) arise at a frequency of 1 to 10 in 10(7). We analyzed the cytochrome content of several spd mutants spectroscopically and by heme peroxidase assays. These suppressors lacked detectable cyt c2, but they contained a new soluble cytochrome which was designated isocytochrome c2 (isocyt c2) that was not detectable in either cycA+ or cycA mutant cells. When spd mutants were grown photosynthetically, isocyt c2 was present at approximately 20 to 40% of the level of cyt c2 found in photosynthetically grown wild type cells, and it was found in the periplasm with cytochromes c' and c554. These spd mutants also had several other pleiotropic phenotypes. Although photosynthetic growth rates of the spd mutants were comparable to those of wild-type strains at all light intensities tested, they contained elevated levels of B800-850 pigment-protein complexes. Several spd mutants contained detectable amounts of isocyt c2 under aerobic conditions. Finally, heme peroxidase assays indicated that, under anaerobic conditions, the spd mutants may contain another new cytochrome in addition to isocyt c2. These pleiotropic phenotypes, the frequency at which the spd mutants arise, and the fact that a frameshift mutagen is very effective in generating the spd phenotype suggest that some spd mutants contain a mutation in loci which regulate cytochrome synthesis. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 PMID:2156806

phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens.

PubMed

Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan

2015-09-17

Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.

Functions of transmembrane domain 3 of human melanocortin-4 receptor.

PubMed

Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

2012-12-01

The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

Nonbehavioral Selection for Pawns, Mutants of PARAMECIUM AURELIA with Decreased Excitability

PubMed Central

Schein, Stanley J.

1976-01-01

The reversal response in Paramecium aurelia is mediated by calcium which carries the inward current during excitation. Electrophysiological studies indicate that strontium and barium can also carry the inward current. Exposure to high concentrations of barium rapidly paralyzes and later kills wild-type paramecia. Following mutagenesis with nitrosoguanidine, seven mutants which continued to swim in the `high-barium' solution were selected. All of the mutants show decreased reversal behavior, with phenotypes ranging from extremely non-reversing (`extreme' pawns) to nearly wild-type reversal behavior (`partial' pawns). The mutations fall into three complementation groups, identical to the pwA, pwB, and pwC genes of Kung et al. (1975). All of the pwA and pwB mutants withstand longer exposure to barium, the pwB mutants surviving longer than the pwA mutants. Among mutants of each gene, survival is correlated with loss of reversal behavior. Double mutants (A–B, A–C, B–C), identified in the exautogamous progeny of crosses between `partial' mutants, exhibited a more extreme non-reversing phenotype than either of their single-mutant (`partial' pawn) parents.———Inability to reverse could be expected from an alteration in the calcium-activated reversal mechanism or in excitation. A normal calcium-activated structure was demonstrated in all pawns by chlorpromazine treatment. In a separate report (Schein, Bennett and Katz 1976) the results of electrophysiological investigations directly demonstrate decreased excitability in all of the mutants, a decrease due to an altered calcium activation. The studies of the genetics, the survival in barium and the electro-physiology of the pawns demonstrate that the pwA and pwB genes have different effects on calcium activation. PMID:1001878

Mycothiol-Deficient Mycobacterium smegmatis Mutants Are Hypersensitive to Alkylating Agents, Free Radicals, and Antibiotics

PubMed Central

Rawat, Mamta; Newton, Gerald L.; Ko, Mary; Martinez, Gladys J.; Fahey, Robert C.; Av-Gay, Yossef

2002-01-01

Mycothiol (MSH; 1d-myo-inosityl 2-[N-acetyl-l-cysteinyl]amido-2-deoxy-α-d-glucopyranoside) is the major low-molecular-weight thiol produced by mycobacteria. Mutants of Mycobacterium smegmatis mc2155 deficient in MSH production were produced by chemical mutagenesis as well as by transposon mutagenesis. One chemical mutant (mutant I64) and two transposon mutants (mutants Tn1 and Tn2) stably deficient in MSH production were isolated by screening for reduced levels of MSH content. The MSH contents of transposon mutants Tn1 and Tn2 were found to be less than 0.1% that of the parent strain, and the MSH content of I64 was found to be 1 to 5% that of the parent strain. All three strains accumulated 1d-myo-inosityl 2-deoxy-α-d-glucopyranoside to levels 20- to 25-fold the level found in the parent strain. The cysteine:1d-myo-inosityl 2-amino-2-deoxy-α-d-glucopyranoside ligase (MshC) activities of the three mutant strains were ≤2% that of the parent strain. Phenotypic analysis revealed that these MSH-deficient mutants possess increased susceptibilities to free radicals and alkylating agents and to a wide range of antibiotics including erythromycin, azithromycin, vancomycin, penicillin G, rifamycin, and rifampin. Conversely, the mutants possess at least 200-fold higher levels of resistance to isoniazid than the wild type. We mapped the mutation in the chemical mutant by sequencing the mshC gene and showed that a single amino acid substitution (L205P) is responsible for reduced MSH production and its associated phenotype. Our results demonstrate that there is a direct correlation between MSH depletion and enhanced sensitivity to toxins and antibiotics. PMID:12384335

Novel Two-Step Hierarchical Screening of Mutant Pools Reveals Mutants under Selection in Chicks

PubMed Central

Yang, Hee-Jeong; Bogomolnaya, Lydia M.; Elfenbein, Johanna R.; Endicott-Yazdani, Tiana; Reynolds, M. Megan; Porwollik, Steffen; Cheng, Pui; Xia, Xiao-Qin

2016-01-01

Contaminated chicken/egg products are major sources of human salmonellosis, yet the strategies used by Salmonella to colonize chickens are poorly understood. We applied a novel two-step hierarchical procedure to identify new genes important for colonization and persistence of Salmonella enterica serotype Typhimurium in chickens. A library of 182 S. Typhimurium mutants each containing a targeted deletion of a group of contiguous genes (for a total of 2,069 genes deleted) was used to identify regions under selection at 1, 3, and 9 days postinfection in chicks. Mutants in 11 regions were under selection at all assayed times (colonization mutants), and mutants in 15 regions were under selection only at day 9 (persistence mutants). We assembled a pool of 92 mutants, each deleted for a single gene, representing nearly all genes in nine regions under selection. Twelve single gene deletion mutants were under selection in this assay, and we confirmed 6 of 9 of these candidate mutants via competitive infections and complementation analysis in chicks. STM0580, STM1295, STM1297, STM3612, STM3615, and STM3734 are needed for Salmonella to colonize and persist in chicks and were not previously associated with this ability. One of these key genes, STM1297 (selD), is required for anaerobic growth and supports the ability to utilize formate under these conditions, suggesting that metabolism of formate is important during infection. We report a hierarchical screening strategy to interrogate large portions of the genome during infection of animals using pools of mutants of low complexity. Using this strategy, we identified six genes not previously known to be needed during infection in chicks, and one of these (STM1297) suggests an important role for formate metabolism during infection. PMID:26857572

Lesions in two Escherichia coli type 1 pilus genes alter pilus number and length without affecting receptor binding.

PubMed Central

Russell, P W; Orndorff, P E

1992-01-01

We describe the characterization of two genes, fimF and fimG (also called pilD), that encode two minor components of type 1 pili in Escherichia coli. Defined, in-frame deletion mutations were generated in vitro in each of these two genes. A double mutation that had deletions identical to both single lesions was also constructed. Examination of minicell transcription and translation products of parental and mutant plasmids revealed that, as predicted from the nucleotide sequence and previous reports, the fimF gene product was a protein of ca. 16 kDa and that the fimG gene product was a protein of ca. 14 kDa. Each of the constructions was introduced, via homologous recombination, into the E. coli chromosome. All three of the resulting mutants produced type 1 pili and exhibited hemagglutination of guinea pig erythrocytes. The latter property was also exhibited by partially purified pili isolated from each of the mutants. Electron microscopic examination revealed that the fimF mutant had markedly reduced numbers of pili per cell, whereas the fimG mutant had very long pili. The double mutant displayed the characteristics of both single mutants. However, pili in the double mutant were even longer than those seen in the fimG mutant, and the numbers of pili were even fewer than those displayed by the fimF mutant. All three mutants could be complemented in trans with a single-copy-number plasmid bearing the appropriate parental gene or genes to give near-normal parental piliation. On the basis of the phenotypes exhibited by the single and double mutants, we believe that the fimF gene product may aid in initiating pilus assembly and that the fimG product may act as an inhibitor of pilus polymerization. In contrast to previous studies, we found that neither gene product was required for type 1 pilus receptor binding. Images PMID:1355769

Evaluation of vaccine candidate potential of deltaaroA, deltahtrA and deltaaroAdeltahtrA mutants of Salmonella enterica subspecies enterica serovar Abortusequi in guinea pigs.

PubMed

Singh, Bhoj Raj; Chandra, Mudit; Hansda, Dhananjoy; Alam, Javed; Babu, Narayanan; Siddiqui, Mehtab Z; Agrawal, Ravi K; Sharma, Gautam

2013-04-01

Salmonella enterica subspecies enterica serovar Abortusequi (S. Abortusequi), a host adapted Salmonella causes abortions, still births and foal mortality in equids. Though known since more than 100 years, it is still a problem in many of the developing countries including India. There is dearth of really good vaccine affording immunity lasting at least for one full gestation. In search of a potential vaccine candidate, three defined deletion mutants (deltaaroA, deltahtrA and deltaaroAdeltahtrA) of S. Abortusequi were tested in guinea pig model for attenuation, safety, immunogenicity, humoral immune response, protective efficacy and persistence in host. The deltahtrA and deltaaroAdeltahtrA mutants were found to be safe on oral inoculation in doses as high as 4.2 x 10(9) cfu/animal. Also through subcutaneous inoculation deltaaroAdeltahtrA mutant did not induce any abortion in pregnant guinea pigs. All the three mutants did not induce any illness or death in 1-2 week-old baby guinea pigs except deltahtrA mutant which caused mortality on intraperitoneal inoculation. Inoculation with mutants protected against challenge and increased breeding efficiency of guinea pigs. After >4.5 months of mutant inoculation, guinea pigs were protected against abortifacient dose of wild type S. Abortusequi and mother guinea pigs also conferred resistance to their babies to the similar challenge. Early humoral immune response of S. Abortusequi mutants was characteristic. Faecal excretion of deltaaroA and htrA mutants was detected up to 45 days of inoculation in guinea pigs while deltaaroAdeltahtrA mutant could not be detected after 21 days of inoculation. The results indicated that the double deletion mutant (deltaaroAdeltahtrA) was the most effective and safe candidate for vaccination against S. Abortusequi through mucosal route of inoculation.

Role of aromatic interactions in amyloid formation by islet amyloid polypeptide.

PubMed

Tu, Ling-Hsien; Raleigh, Daniel P

2013-01-15

Aromatic-aromatic and aromatic-hydrophobic interactions have been proposed to play a role in amyloid formation by a range of polypeptides, including islet amyloid polypeptide (IAPP or amylin). IAPP is responsible for amyloid formation in patients with type 2 diabetes. The polypeptide is 37 residues long and contains three aromatic residues, Phe-15, Phe-23, and Tyr-37. The ability of all single aromatic to leucine mutants, all double aromatic to leucine mutants, and the triple leucine mutant to form amyloid were examined. Amyloid formation was almost twice as rapid for the F15L mutant as for the wild type but was almost 3-fold slower for the Y37L mutant and almost 2-fold slower for the F23L mutant. Amyloid fibrils formed from each of the single mutants were effective at seeding amyloid formation by wild-type IAPP, implying that the fibril structures are similar. The F15L/F23L double mutant has a larger effect than the F15L/Y37L double mutant on the rate of amyloid formation, even though a Y37L substitution has more drastic consequences in the wild-type background than does the F23L mutation, suggesting nonadditive effects between the different sites. The triple leucine mutant and the F23L/Y37L double mutant are the slowest to form amyloid. F15 has been proposed to make important contacts early in the aggregation pathway, but the data for the F15L mutant indicate that they are not optimal. A set of variants containing natural and unnatural amino acids at position 15, which were designed to conserve hydrophobicity, but alter α-helix and β-sheet propensity, were analyzed to determine the properties of this position that control the rate of amyloid formation. There is no correlation between β-sheet propensity at this position and the rate of amyloid formation, but there is a correlation with α-helical propensity.

Thermo-labile stability of sigmaH (Spo0H) in temperature-sensitive spo0H mutants of Bacillus subtilis can be suppressed by mutations in RNA polymerase beta subunit.

PubMed

Ohashi, Y; Sugimaru, K; Nanamiya, H; Sebata, T; Asai, K; Yoshikawa, H; Kawamura, F

1999-03-18

We isolated novel temperature-sensitive mutants of spo0H, spo0H1 and spo0H5, having E61K and G30E amino-acid substitutions within the sigmaH protein, respectively, and located in the highly conserved region, "2", among prokaryotic sigma factors that participates in binding to core enzyme of RNA polymerase. These mutants showed a sporulation-deficient phenotype at 43 degrees C. Moreover, we successfully isolated suppressor mutants that were spontaneously generated from the spo0H mutants. Our genetic analysis of these suppressor mutations revealed that the suppressor mutations are within the rpoB gene coding for the beta subunit of RNA polymerase. The mutations caused single amino-acid substitutions, E857A and P1055S, in rpoB18 and rpoB532 mutants that were generated from spo0H1 and spo0H5, respectively. Whereas the sigmaH-dependent expression of a spo0A-bgaB fusion was greatly reduced in both spo0H mutants, their expression was partially restored in the suppressor mutants at 43 degrees C. Western blot analysis showed that the level of sigmaH protein in the wild type increased between T0 and T2 and decreased after T3, while the level of sigmaH protein in spo0H mutants was greatly reduced throughout growth, indicating that the mutant sigmaH proteins were rapidly degraded by some unknown proteolytic enzyme(s). The analysis of the half-life of sigmaH protein showed that the short life of sigmaH in spo0H mutants is prolonged in the suppressor mutants. These findings suggest that, at least to some extent, the process of E-sigmaH formation may be involved in stabilization of sigmaH at the onset of sporulation.

Analysis of Two Polyhydroxyalkanoate Synthases in Bradyrhizobium japonicum USDA 110

PubMed Central

Mongiardini, Elías J.; Pérez-Giménez, Julieta; Parisi, Gustavo; Lodeiro, Aníbal R.

2013-01-01

Bradyrhizobium japonicum USDA 110 has five polyhydroxyalkanoate (PHA) synthases (PhaC) annotated in its genome: bll4360 (phaC1), bll6073 (phaC2), blr3732 (phaC3), blr2885 (phaC4), and bll4548 (phaC5). All these proteins possess the catalytic triad and conserved amino acid residues of polyester synthases and are distributed into four different PhaC classes. We obtained mutants in each of these paralogs and analyzed phaC gene expression and PHA production in liquid cultures. Despite the genetic redundancy, only phaC1 and phaC2 were expressed at significant rates, while PHA accumulation in stationary-phase cultures was impaired only in the ΔphaC1 mutant. Meanwhile, the ΔphaC2 mutant produced more PHA than the wild type under this condition, and surprisingly, the phaC3 transcript increased in the ΔphaC2 background. A double mutant, the ΔphaC2 ΔphaC3 mutant, consistently accumulated less PHA than the ΔphaC2 mutant. PHA accumulation in nodule bacteroids followed a pattern similar to that seen in liquid cultures, being prevented in the ΔphaC1 mutant and increased in the ΔphaC2 mutant in relation to the level in the wild type. Therefore, we used these mutants, together with a ΔphaC1 ΔphaC2 double mutant, to study the B. japonicum PHA requirements for survival, competition for nodulation, and plant growth promotion. All mutants, as well as the wild type, survived for 60 days in a carbon-free medium, regardless of their initial PHA contents. When competing for nodulation against the wild type in a 1:1 proportion, the ΔphaC1 and ΔphaC1 ΔphaC2 mutants occupied only 13 to 15% of the nodules, while the ΔphaC2 mutant occupied 81%, suggesting that the PHA polymer is required for successful competitiveness. However, the bacteroid content of PHA did not affect the shoot dry weight accumulation. PMID:23667236

Deletion of the Braun Lipoprotein-Encoding Gene and Altering the Function of Lipopolysaccharide Attenuate the Plague Bacterium

PubMed Central

Sha, Jian; Kirtley, Michelle L.; van Lier, Christina J.; Wang, Shaofei; Erova, Tatiana E.; Kozlova, Elena V.; Cao, Anthony; Cong, Yingzi; Fitts, Eric C.; Rosenzweig, Jason A.

2013-01-01

Braun (murein) lipoprotein (Lpp) and lipopolysaccharide (LPS) are major components of the outer membranes of Enterobacteriaceae family members that are capable of triggering inflammatory immune responses by activating Toll-like receptors 2 and 4, respectively. Expanding on earlier studies that demonstrated a role played by Lpp in Yersinia pestis virulence in mouse models of bubonic and pneumonic plague, we characterized an msbB in-frame deletion mutant incapable of producing an acyltransferase that is responsible for the addition of lauric acid to the lipid A moiety of LPS, as well as a Δlpp ΔmsbB double mutant of the highly virulent Y. pestis CO92 strain. Although the ΔmsbB single mutant was minimally attenuated, the Δlpp single mutant and the Δlpp ΔmsbB double mutant were significantly more attenuated than the isogenic wild-type (WT) bacterium in bubonic and pneumonic animal models (mouse and rat) of plague. These data correlated with greatly reduced survivability of the aforementioned mutants in murine macrophages. Furthermore, the Δlpp ΔmsbB double mutant was grossly compromised in its ability to disseminate to distal organs in mice and in evoking cytokines/chemokines in infected animal tissues. Importantly, mice that survived challenge with the Δlpp ΔmsbB double mutant, but not the Δlpp or ΔmsbB single mutant, in a pneumonic plague model were significantly protected against a subsequent lethal WT CO92 rechallenge. These data were substantiated by the fact that the Δlpp ΔmsbB double mutant maintained an immunogenicity comparable to that of the WT strain and induced long-lasting T-cell responses against heat-killed WT CO92 antigens. Taken together, the data indicate that deletion of the msbB gene augmented the attenuation of the Δlpp mutant by crippling the spread of the double mutant to the peripheral organs of animals and by inducing cytokine/chemokine responses. Thus, the Δlpp ΔmsbB double mutant could provide a new live-attenuated background vaccine candidate strain, and this should be explored in the future. PMID:23275092

Tracing the tracks of genotoxicity by trivalent and hexavalent chromium in Drosophila melanogaster.

PubMed

Mishra, Manish; Sharma, Anurag; Negi, M P S; Dwivedi, U N; Chowdhuri, D Kar

2011-05-18

Mutagen sensitive strains (mus) in Drosophila are known for their hypersensitivity to mutagens and environmental carcinogens. Accordingly, these mutants were grouped in pre- and post-replication repair pathways. However, studying mutants belonging to one particular repair pathway may not be adequate for examining chemical-induced genotoxicity when other repair pathways may neutralize its effect. To test whether both pre-and post-replication pathways are involved and effect of Cr(III)- and Cr(VI)-induced genotoxicity in absence or presence of others, we used double mutant approach in D. melanogaster. We observed DNA damage as evident by changes in Comet assay DNA migration in cells of larvae of Oregon R(+) and single mutants of pre- (mei-9, mus201 and mus210) and post- (mei-41, mus209 and mus309) replication repair pathways and also in double mutants of different combinations (pre-pre, pre-post and post-post replication repair) exposed to increasing concentrations of Cr(VI) (0.0, 5.0, 10.0 and 20.0 μg/ml) for 48 h. The damage was greater in pre-replication repair mutants after exposure to 5.0 μg/ml Cr(VI), while effects on Oregon R(+) and post replication repair mutants were insignificant. Post-replication repair mutants revealed significant DNA damage after exposure to 20.0 μg/ml Cr(VI). Further, double mutants generated in the above repair categories were examined for DNA damage following Cr(VI) exposure and a comparison of damage was studied between single and double mutants. Combinations of double mutants generated in the pre-pre replication repair pathways showed an indifferent interaction between the two mutants after Cr(VI) exposure while a synergistic interaction was evident in exposed post-post replication repair double mutants. Cr(III) (20.0 μg/ml) exposure to these strains did not induce any significant DNA damage in their cells. The study suggests that both pre- and post-replication pathways are affected in Drosophila by Cr(VI) leading to genotoxicity, which may have consequences for metal-induced carcinogenesis. 2011 Elsevier B.V. All rights reserved.

Some properties of three αB-crystallin mutants carrying point substitutions in the C-terminal domain and associated with congenital diseases.

PubMed

Gerasimovich, Evgeniia S; Strelkov, Sergei V; Gusev, Nikolai B

2017-11-01

Physico-chemical properties of G154S, R157H and A171T mutants of αB-crystallin (HspB5) associated with congenital human diseases including certain myopathies and cataract were investigated. Oligomers formed by G154S and A171T mutants have the size and apparent molecular weight indistinguishable from those of the wild-type HspB5, whereas the size of oligomers formed by R157H mutant is slightly smaller. All mutants are less thermostable and start to aggregate at a lower temperature than the wild-type protein. All mutants effectively interact with a triple phosphomimicking mutant of HspB1 and form large heterooligomeric complexes of similar composition. All mutants interact with HspB6 forming heterooligomeric complexes with size and composition dependent on the molar ratio of two proteins. The wild-type HspB5 and its G154S and A171T mutants form only high molecular weight (300-450 kDa) heterooligomeric complexes with HspB6, whereas the R157H mutant forms both high and low (∼120 kDa) molecular weight complexes. The wild-type HspB5 and its G154S and A171T mutants form two types of heterooligomers with HspB4, whereas R157H mutant effectively forms only one type of heterooligomers with HspB4. G154S and A171T mutants have lower chaperone-like activity than the wild-type protein when subfragment S1 of myosin or β L -crystallin are used as a model substrates. With these substrates, the R157H mutant shows equal or higher chaperone activity than the wild-type HspB5. We hypothesize that the mutations in the C-terminal region modulate the binding of the IP(I/V) motif to the core α-crystallin domain. The R157H mutation is located in the immediate proximity of this motif. Such modulation could cause altered interaction of HspB5 with partners and substrates and eventually lead to pathological processes. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Isolation, characterization, and expression analyses of tryptophan aminotransferase genes in a maize dek18 mutant

USDA-ARS?s Scientific Manuscript database

The dek18 mutant of maize has decreased auxin content in kernels. Molecular and functional characterization of this mutant line offers the possibility to better understand auxin biology in maize seed development. Seeds of the dek18 mutants are smaller compared to wild type seeds and the vegetative d...

Problem-Solving Test: Tryptophan Operon Mutants

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Cloning, preparation and preliminary crystallographic studies of penicillin V acylase autoproteolytic processing mutants

PubMed Central

Chandra, P. Manish; Brannigan, James A.; Prabhune, Asmita; Pundle, Archana; Turkenburg, Johan P.; Dodson, G. Guy; Suresh, C. G.

2005-01-01

The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants will provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme. PMID:16508111

Growth and sporulation of a pyrimidine spore color mutant of Sordaria fimicola.

PubMed

el-Ani, A S

1967-04-07

A nonautonomous spore color mutant of Sordaria fimicola is a pyrimidine auxotroph that produces hyaline nonviable ascospores. Uracil, uridine, and cytidine are more effective growth factors than cytosine and thymine and, in high concentrations, render the mutant self-fertile by inducing the ascospores to resume development and maturation. Crosses with the unlinked arginine non-autonomus spore color mutant st-59 yielded the double mutant st-59 pyr that requires both arginine and a pyrimidine for growth, which indicates a lack of suppression of the pyrimidine requirement by the arginine locus.

Differentially expressed genes in the ovary of the sixth day of pupal "Ming" lethal egg mutant of silkworm, Bombyx mori.

PubMed

Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng

2013-09-15

The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.

Characterization and Complementation of a Chlorophyll-Less Dominant Mutant GL1 in Lagerstroemia indica.

PubMed

Wang, Shu'an; Wang, Peng; Gao, Lulu; Yang, Rutong; Li, Linfang; Zhang, Enliang; Wang, Qing; Li, Ya; Yin, Zengfang

2017-05-01

Crape myrtle (Lagerstroemia indica) is a woody ornamental plant popularly grown because of its long-lasting, midsummer blooms and beautiful colors. The GL1 dominant mutant is the first chlorophyll-less mutant identified in crape myrtle. It was obtained from a natural yellow leaf bud mutation. We previously revealed that leaf color of the GL1 mutant is affected by light intensity. However, the mechanism of the GL1 mutant on light response remained unclear. The acclimation response of mutant and wild-type (WT) plants was assessed in a time series after transferring from low light (LL) to high light (HL) by analyzing chlorophyll synthesis precursor content, photosynthetic performance, and gene expression. In LL conditions, coproporphyrinogen III (Coprogen III) content had the greatest amount of accumulation in the mutant compared with WT, increasing by 100%. This suggested that the yellow leaf phenotype of the GL1 dominant mutant might be caused by disruption of coproporphyrinogen III oxidase (CPO) biosynthesis. Furthermore, the candidate gene, oxygen-independent CPO (HEMN), might only affect expression of upstream genes involved in chlorophyll metabolism in the mutant. Moreover, two genes, photosystem II (PSII) 10 kDa protein (psbR) and chlorophyll a/b binding protein gene (CAB1), had decreased mRNA levels in the GL1 mutant within the first 96 h following LL/HL transfer compared with the WT. Hierarchical clustering revealed that these two genes shared a similar expression trend as the oxygen-dependent CPO (HEMF). These findings provide evidence that GL1 is highly coordinated with PSII stability and chloroplast biogenesis.

Increased Steady-State Mutant Huntingtin mRNA in Huntington's Disease Brain.

PubMed

Liu, Wanzhao; Chaurette, Joanna; Pfister, Edith L; Kennington, Lori A; Chase, Kathryn O; Bullock, Jocelyn; Vonsattel, Jean Paul G; Faull, Richard L M; Macdonald, Douglas; DiFiglia, Marian; Zamore, Phillip D; Aronin, Neil

2013-01-01

Huntington's disease is caused by expansion of CAG trinucleotide repeats in the first exon of the huntingtin gene, which is essential for both development and neurogenesis. Huntington's disease is autosomal dominant. The normal allele contains 6 to 35 CAG triplets (average, 18) and the mutant, disease-causing allele contains >36 CAG triplets (average, 42). We examined 279 postmortem brain samples, including 148 HD and 131 non-HD controls. A total of 108 samples from 87 HD patients that are heterozygous at SNP rs362307, with a normal allele (18 to 27 CAG repeats) and a mutant allele (39 to 73 CAG repeats) were used to measure relative abundance of mutant and wild-type huntingtin mRNA. We used allele-specific, quantitative RT-PCR based on SNP heterozygosity to estimate the relative amount of mutant versus normal huntingtin mRNA in postmortem brain samples from patients with Huntington's disease. In the cortex and striatum, the amount of mRNA from the mutant allele exceeds that from the normal allele in 75% of patients. In the cerebellum, no significant difference between the two alleles was evident. Brain tissues from non-HD controls show no significant difference between two alleles of huntingtin mRNAs. Allelic differences were more pronounced at early neuropathological grades (grades 1 and 2) than at late grades (grades 3 and 4). More mutant HTT than normal could arise from increased transcription of mutant HTT allele, or decreased clearance of mutant HTT mRNA, or both. An implication is that equimolar silencing of both alleles would increase the mutant HTT to normal HTT ratio.

Characterization of a Putative Spindle Assembly Checkpoint Kinase Mps1, Suggests Its Involvement in Cell Division, Morphogenesis and Oxidative Stress Tolerance in Candida albicans

PubMed Central

Ruhela, Deepa; Kamthan, Ayushi; Maiti, Protiti; Datta, Asis

2014-01-01

In Saccharomyces cerevisiae MPS1 is one of the major protein kinase that governs the spindle checkpoint pathway. The S. cerevisiae structural homolog of opportunistic pathogen Candida albicans CaMPS1, is indispensable for the cell viability. The essentiality of Mps1 was confirmed by Homozygote Trisome test. To determine its biological function in this pathogen conditional mutant was generated through regulatable MET3 promoter. Examination of heterozygous and conditional (+Met/Cys) mps1 mutants revealed a mitosis specific arrest phenotype, where mutants showed large buds with undivided nuclei. Flowcytometry analysis revealed abnormal ploidy levels in mps1mutant. In presence of anti-microtubule drug Nocodazole, mps1 mutant showed a dramatic loss of viability suggesting a role of Mps1 in Spindle Assembly Checkpoint (SAC) activation. These mutants were also defective in microtubule organization. Moreover, heterozygous mutant showed defective in-vitro yeast to hyphae morphological transition. Growth defect in heterozygous mutant suggest haploinsufficiency of this gene. qRT PCR analysis showed around 3 fold upregulation of MPS1 in presence of serum. This expression of MPS1 is dependent on Efg1and is independent of other hyphal regulators like Ras1 and Tpk2. Furthermore, mps1 mutants were also sensitive to oxidative stress. Heterozygous mps1 mutant did not undergo morphological transition and showed 5-Fold reduction in colony forming units in response to macrophage. Thus, the vital checkpoint kinase, Mps1 besides cell division also has a role in morphogenesis and oxidative stress tolerance, in this pathogenic fungus. PMID:25025778

Characterization of a putative spindle assembly checkpoint kinase Mps1, suggests its involvement in cell division, morphogenesis and oxidative stress tolerance in Candida albicans.

PubMed

Kamthan, Mohan; Nalla, Vijaya Kumar; Ruhela, Deepa; Kamthan, Ayushi; Maiti, Protiti; Datta, Asis

2014-01-01

In Saccharomyces cerevisiae MPS1 is one of the major protein kinase that governs the spindle checkpoint pathway. The S. cerevisiae structural homolog of opportunistic pathogen Candida albicans CaMPS1, is indispensable for the cell viability. The essentiality of Mps1 was confirmed by Homozygote Trisome test. To determine its biological function in this pathogen conditional mutant was generated through regulatable MET3 promoter. Examination of heterozygous and conditional (+Met/Cys) mps1 mutants revealed a mitosis specific arrest phenotype, where mutants showed large buds with undivided nuclei. Flowcytometry analysis revealed abnormal ploidy levels in mps1 mutant. In presence of anti-microtubule drug Nocodazole, mps1 mutant showed a dramatic loss of viability suggesting a role of Mps1 in Spindle Assembly Checkpoint (SAC) activation. These mutants were also defective in microtubule organization. Moreover, heterozygous mutant showed defective in-vitro yeast to hyphae morphological transition. Growth defect in heterozygous mutant suggest haploinsufficiency of this gene. qRT PCR analysis showed around 3 fold upregulation of MPS1 in presence of serum. This expression of MPS1 is dependent on Efg1 and is independent of other hyphal regulators like Ras1 and Tpk2. Furthermore, mps1 mutants were also sensitive to oxidative stress. Heterozygous mps1 mutant did not undergo morphological transition and showed 5-Fold reduction in colony forming units in response to macrophage. Thus, the vital checkpoint kinase, Mps1 besides cell division also has a role in morphogenesis and oxidative stress tolerance, in this pathogenic fungus.

Increased sensitivity to salt stress in tocopherol-deficient Arabidopsis mutants growing in a hydroponic system

PubMed Central

Ellouzi, Hasna; Hamed, Karim Ben; Cela, Jana; Müller, Maren; Abdelly, Chedly; Munné-Bosch, Sergi

2013-01-01

Recent studies suggest that tocopherols could play physiological roles in salt tolerance but the mechanisms are still unknown. In this study, we analyzed changes in growth, mineral and oxidative status in vte1 and vte4 Arabidopsis thaliana mutants exposed to salt stress. vte1 and vte4 mutants lack α-tocopherol, but only the vte1 mutant is additionally deficient in γ-tocopherol. Results showed that a deficiency in vitamin E leads to reduced growth and increased oxidative stress in hydroponically-grown plants. This effect was observed at early stages, not only in rosettes but also in roots. The vte1 mutant was more sensitive to salt-induced oxidative stress than the wild type and the vte4 mutant. Salt sensitivity was associated with (i) high contents of Na+, (ii) reduced efficiency of PSII photochemistry (Fv/Fm ratio) and (iii) more pronounced oxidative stress as indicated by increased hydrogen peroxide and malondialdeyde levels. The vte 4 mutant, which accumulates γ- instead of α-tocopherol showed an intermediate sensitivity to salt stress between the wild type and the vte1 mutant. Contents of abscisic acid, jasmonic acid and the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid were higher in the vte1 mutant than the vte4 mutant and wild type. It is concluded that vitamin E-deficient plants show an increased sensitivity to salt stress both in rosettes and roots, therefore indicating the positive role of tocopherols in stress tolerance, not only by minimizing oxidative stress, but also controlling Na+/K+ homeostasis and hormonal balance. PMID:23299430

Construction of a large-scale Burkholderia cenocepacia J2315 transposon mutant library

NASA Astrophysics Data System (ADS)

Wong, Yee-Chin; Pain, Arnab; Nathan, Sheila

2014-09-01

Burkholderia cenocepacia, a pathogenic member of the Burkholderia cepacia complex (Bcc), has emerged as a significant threat towards cystic fibrosis patients, where infection often leads to the fatal clinical manifestation known as cepacia syndrome. Many studies have investigated the pathogenicity of B. cenocepacia as well as its ability to become highly resistant towards many of the antibiotics currently in use. In addition, studies have also been undertaken to understand the pathogen's capacity to adapt and survive in a broad range of environments. Transposon based mutagenesis has been widely used in creating insertional knock-out mutants and coupled with recent advances in sequencing technology, robust tools to study gene function in a genome-wide manner have been developed based on the assembly of saturated transposon mutant libraries. In this study, we describe the construction of a large-scale library of B. cenocepacia transposon mutants. To create transposon mutants of B. cenocepacia strain J2315, electrocompetent bacteria were electrotransformed with the EZ-Tn5 transposome. Tetracyline resistant colonies were harvested off selective agar and pooled. Mutants were generated in multiple batches with each batch consisting of ˜20,000 to 40,000 mutants. Transposon insertion was validated by PCR amplification of the transposon region. In conclusion, a saturated B. cenocepacia J2315 transposon mutant library with an estimated total number of 500,000 mutants was successfully constructed. This mutant library can now be further exploited as a genetic tool to assess the function of every gene in the genome, facilitating the discovery of genes important for bacterial survival and adaptation, as well as virulence.

Mutants of feline immunodeficiency virus resistant to 2',3'-dideoxy-2',3'-didehydrothymidine.

PubMed Central

Zhu, Y Q; Remington, K M; North, T W

1996-01-01

We selected mutants of feline immunodeficiency virus (FIV) that are resistant to 2',3'-dideoxy-2',3'-didehydrothymidine (d4T). Two mutants were selected in cultured cells with a stepwise increase in d4T concentration, resulting in mutants able to replicate in 100 microM d4T. These mutants were three- to sixfold more resistant to d4T than wild-type FIV. They were also cross-resistant to 3'-azido-3'-deoxythymidine (AZT), 3'-fluoro-2',3'-dideoxythymidine, 2',3'-dideoxycytidine, 2',3'-dideoxyinosine, and 9-(2-phosphonylmethoxyethyl)adenine, and they were highly resistant to phosphonoformic acid (PFA). Plaque-purified mutants were isolated from each of the mutant populations. The mutant phenotype was stable, because both of the plaque-purified mutants remained d4T resistant even after three passages in the absence of d4T. One of the plaque-purified mutants, designated D4R-3c, was further characterized. Compared with wild-type reverse transcriptase (RT), RT purified from D4R-3c was 3-fold resistant to inhibition by the 5'-triphosphate of d4T, 10-fold resistant to inhibition by the 5'-triphosphate of AZT, and 6-fold resistant to PFA. D4R-3c had a single point mutation in the RT-encoding region of the pol gene at position 2474, resulting in a Val to Ile mutation at codon 47 of the FIV RT. The role of this mutation in d4T resistance was confirmed by site-directed mutagenesis. PMID:8878567

Spontaneous Gac Mutants of Pseudomonas Biological Control Strains: Cheaters or Mutualists? ▿

PubMed Central

Driscoll, William W.; Pepper, John W.; Pierson, Leland S.; Pierson, Elizabeth A.

2011-01-01

Bacteria rely on a range of extracellular metabolites to suppress competitors, gain access to resources, and exploit plant or animal hosts. The GacS/GacA two-component regulatory system positively controls the expression of many of these beneficial external products in pseudomonad bacteria. Natural populations often contain variants with defective Gac systems that do not produce most external products. These mutants benefit from a decreased metabolic load but do not appear to displace the wild type in nature. How could natural selection maintain the wild type in the presence of a mutant with enhanced growth? One hypothesis is that Gac mutants are “cheaters” that do not contribute to the public good, favored within groups but selected against between groups, as groups containing more mutants lose access to ecologically important external products. An alternative hypothesis is that Gac mutants have a mutualistic interaction with the wild type, so that each variant benefits by the presence of the other. In the biocontrol bacterium Pseudomonas chlororaphis strain 30-84, Gac mutants do not produce phenazines, which suppress competitor growth and are critical for biofilm formation. Here, we test the predictions of these alternative hypotheses by quantifying interactions between the wild type and the phenazine- and biofilm-deficient Gac mutant within growing biofilms. We find evidence that the wild type and Gac mutants interact mutualistically in the biofilm context, whereas a phenazine-defective structural mutant does not. Our results suggest that the persistence of alternative Gac phenotypes may be due to the stabilizing role of local mutualistic interactions. PMID:21873476

Understanding the loss-of-function in a triple missense mutant of DNA polymerase β found in prostate cancer.

PubMed

An, Changlong; Beard, William A; Chen, Desheng; Wilson, Samuel H; Makridakis, Nick M

2013-10-01

Human DNA polymerase (pol) β is essential for base excision repair. We previously reported a triple somatic mutant of pol β (p.P261L/T292A/I298T) found in an early onset prostate tumor. This mutation abolishes polymerase activity, and the wild-type allele was not present in the tumor, indicating a complete deficiency in pol β function. The effect on polymerase activity is unexpected because the point mutations that comprise the triple mutant are not part of the active site. Herein, we demonstrate the mechanism of this loss-of-function. In order to understand the effect of the individual point mutations we biochemically analyzed all single and double mutants that comprise the triple mutant. We found that the p.I298T mutation is responsible for a marked instability of the triple mutant protein at 37˚C. At room temperature the triple mutant's low efficiency is also due to a decrease in the apparent binding affinity for the dNTP substrate, which is due to the p.T292A mutation. Furthermore, the triple mutant displays lower fidelity for transversions in vitro, due to the p.T292A mutation. We conclude that distinct mutations of the triple pol β mutant are responsible for the loss of activity, lower fidelity, and instability observed in vitro.

Evidence that tRNA modifying enzymes are important in vivo targets for 5-fluorouracil in yeast

PubMed Central

Gustavsson, Marie; Ronne, Hans

2008-01-01

We have screened a collection of haploid yeast knockout strains for increased sensitivity to 5-fluorouracil (5-FU). A total of 138 5-FU sensitive strains were found. Mutants affecting rRNA and tRNA maturation were particularly sensitive to 5-FU, with the tRNA methylation mutant trm10 being the most sensitive mutant. This is intriguing since trm10, like many other tRNA modification mutants, lacks a phenotype under normal conditions. However, double mutants for nonessential tRNA modification enzymes are frequently temperature sensitive, due to destabilization of hypomodified tRNAs. We therefore tested if the sensitivity of our mutants to 5-FU is affected by the temperature. We found that the cytotoxic effect of 5-FU is strongly enhanced at 38°C for tRNA modification mutants. Furthermore, tRNA modification mutants show similar synthetic interactions for temperature sensitivity and sensitivity to 5-FU. A model is proposed for how 5-FU kills these mutants by reducing the number of tRNA modifications, thus destabilizing tRNA. Finally, we found that also wild-type cells are temperature sensitive at higher concentrations of 5-FU. This suggests that tRNA destabilization contributes to 5-FU cytotoxicity in wild-type cells and provides a possible explanation why hyperthermia can enhance the effect of 5-FU in cancer therapy. PMID:18314501

Escherichia coli mutants impaired in maltodextrin transport.

PubMed

Wandersman, C; Schwartz, M; Ferenci, T

1979-10-01

Wild-type Escherichia coli K-12 was found to grow equally well on maltose and on maltodextrins containing up to seven glucose residues. Three classes of mutants unable to grow on maltodextrins, but still able to grow on maltose, were investigated in detail. The first class, already known, was composed of phage lambda-resistant mutants, which lack the outer membrane protein coded by gene lamB. These mutants grow on maltose and maltotriose but not at all on maltotetraose and longer maltodextrins which cannot cross the outer membrane. A second class of mutants were affected in malE, the structural gene of the periplasmic maltose binding protein. The maltose binding proteins isolated from the new mutants were altered in their substrate binding properties, but not in a way that could account for the mutant phenotypes. Rather, the results of growth experiments and transport studies suggest that these malE mutants are impaired in their ability to transport maltodextrins across the outer membrane. This implies that the maltose binding protein (in wild-type strains) cooperates with the lambda receptor in permeation through the outer membrane. The last class of mutants described in this paper were affected in malG, or perhaps in an as yet undetected gene close to malG. They were defective in the transfer of maltodextrins from the periplasmic space to the cytoplasm but only slightly affected in the transport of maltose.

Phenotypic characterization of adenovirus type 12 temperature-sensitive mutants in productive infection and transformation.

PubMed

Hama, S; Kimura, G

1980-01-01

Eleven temperature-sensitive mutants of adenovirus type 12, capable of forming plaques in human cells at 33 C but not at 39.5 C, were isolated from a stock of a wild-type strain after treatment with either nitrous acid or hydroxylamine. Complementation tests in doubly infected human cells permitted a tentative assignment of eight of these mutants to six complementation groups. Temperature-shift experiments revealed that one mutant is affected early and most of the other mutants are affected late. Only the early mutant, H12ts505, was temperature sensitive in viral DNA replication. Infectious virions of all the mutants except H12ts505 and two of the late mutants produced at 33 C, appeared to be more heat labile than those of the wild type. Only H12ts505 was temperature sensitive for the establishment of transformation of rat 3Y1 cells. One of the late mutants (H12ts504) had an increased transforming ability at the permissive temperature. Results of temperature-shift transformation experiments suggest that a viral function affected in H12ts505 is required for "initiation" of transformation. Some of the growth properties of H12ts505-transformed cells were also temperature dependent, suggesting that a functional expression of a gene mutation in H12ts505 is required to maintain at least some aspects of the transformed state.

Genetic studies of cell fusion induced by herpes simplex virus type 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Read, G.S.; Person, S.; Keller, P.M.

1980-07-01

Eight cell fusion-causing syn mutants were isolated from the KOS strain of herpes simplex virus type 1. Unlike the wild-type virus, the mutants produced plaques containing multinucleated cells, or syncytia. Fusion kinetics curves were established with a Coulter Counter assay for the mutants and wild-type virus in single infections of human embryonic lung (HEL) cells, for the mutants and wild-type virus in mixed infections (dominance test), and for pairs of mutants in mixed infection and proceeded with an exponential decrease in the number of small single cells. At some later time that was characteristic of the mutant, there was amore » significant reduction in the rate of fusion for all but possibly one of the mutants. Although the wild-type virus did not produce syncytial plaques, it did induce a small amount of fusion that stopped abruptly about 2 h after it started. These data are consistent with the hypothesis that both mutants and wild type induce an active fusion inducer and that the activity of this inducer is subsequently inhibited. The extent of fusion is apparently determined by the length of the interval during which the fusion inducer is active. That fusion is actively inhibited in wild-type infections is indicated by the observation that syn mutant-infected cells fused more readily with uninfected cells than with wild type-infected cells.« less

Stability Analysis of a High Fibre Yield and Low Lignin Content “Thick Stem” Mutant in Tossa Jute (Corchorus olitorius L.)

PubMed Central

Mandal, Aninda; Datta, Animesh K.

2014-01-01

A “thick stem” mutant of Corchorus olitorius L. was induced at M2 (0.50%, 4 h, EMS) and the true breeding mutant is assessed across generations (M5 to M7) considering morphometric traits as well as SEM analysis of pollen grains and raw jute fibres, stem anatomy, cytogenetical attributes, and lignin content in relation to control. Furthermore, single fibre diameter and tensile strength are also analysed. The objective is to assess the stability of mutant for its effective exploration for raising a new plant type in tossa jute for commercial exploitation and efficient breeding. The mutant trait is monogenic recessive to normal. Results indicate that “thick stem” mutant is stable across generations (2n = 14) with distinctive high seed and fibre yield and significantly low lignin content. Stem anatomy of the mutant shows significant enhancement in fibre zone, number of fibre pyramids and fibre bundles per pyramid, and diameter of fibre cell in relation to control. Moreover, tensile strength of mutant fibre is significantly higher than control fibre and the trait is inversely related to fibre diameter. However the mutant is associated with low germination frequency, poor seed viability, and high pollen sterility, which may be eliminated through mutational approach followed by rigorous selection and efficient breeding. PMID:24860822

Tryptophan biosynthetic enzymes of Staphylococcus aureus.

PubMed

Proctor, A R; Kloos, W E

1973-04-01

Tryptophan biosynthetic enzymes were assayed in various tryptophan mutants of Staphylococcus aureus strain 655 and the wild-type parent. All mutants, except trpB mutants, lacked only the activity corresponding to the particular biosynthetic block, as suggested previously by analysis of accumulated intermediates and auxonography. Tryptophan synthetase A was not detected in extracts of either trpA or trpB mutants but appeared normal in other mutants. Mutants in certain other classes exhibited partial loss of another particular tryptophan enzyme activity. Tryptophan synthetase B activity was not detected in cell extract preparations but was detected in whole cells. The original map order proposed for the S. aureus tryptophan gene cluster was clarified by the definition of trpD (phosphoribosyl transferase(-)) and trpF (phosphoribosyl anthranilate isomerase(-)) mutants. These mutants were previously unresolved and designated as trp(DF) mutants (anthranilate accumulators). Phosphoribosyl anthranilate isomerase and indole-3-glycerol phosphate synthetase enzymes were separable by molecular sieve chromatography, suggesting that these functions are coded by separate loci. Molecular sieve chromatography failed to reveal aggregates involving anthranilate synthetase, phosphoribosyl transferase, phosphoribosyl anthranilate isomerase, and indole-3-glycerol phosphate synthetase, and this procedure provided an estimate of the molecular weights of these enzymes. Tryptophan was shown to repress synthesis of all six tryptophan biosynthetic enzymes, and derepression of all six activities was incident upon tryptophan starvation. Tryptophan inhibited the activity of anthranilate synthetase, the first enzyme of the pathway.

Registration of BTx623ms8 - a new and easily identifiable nuclear male sterile mutant in sorghum

USDA-ARS?s Scientific Manuscript database

The USDA-ARS has released a new nuclear male sterile sorghum mutant BTx623ms8 (Registration No.xxxx, PIxxxxx). Previously, seven nuclear male sterile mutants have been reported but three are no longer available for sorghum. Here we register a new nuclear male sterile mutant from a mutagenized BTx62...

2-deoxyglucose as a selective agent for derepressed mutants of Pichia stipitis

Treesearch

Hassan K. Sreenath; Thomas W. Jeffries

1998-01-01

The glucose analog 2-deoxyglucose (2-DOG) has been used to obtain mutants derepressed for pentose metabolism. Some researchers have used 2-DOG alone whereas others have used it in the presence of a glucoserepressible carbon source. We examined both methods and screened mutant strains for improved use of xylose in the presence of glucose. Pichia stipitis mutants...

A new fuzzless seed locus in an upland cotton (Gossypium hirsutum L.) mutant

USDA-ARS?s Scientific Manuscript database

Various fiber mutants of cotton have been reported since 1920. Two of the best characterized mutants are the naked seed loci, N1N1 and n2n2. Recently, a naked-tufted mutant called 9023n4t was developed from the cultivar SC 9023 through chemical mutagenesis. The objective of this research was to dete...

Diversity and stability study on rice mutants induced in space environment.

PubMed

Lu, Wei-Hong; Wang, Xin-Zhu; Zheng, Qi; Guan, Shuang-Hong; Xin, Ping; Sun, Ye-Qing

2008-03-01

To further study the characteristics of changes on the molecular level of rice mutants induced in space environment, we analyzed proteins in leaves and seeds of four rice mutants (two high-tillering and two low-tillering) in the 8(th) and 9(th) generations after a 15-day spaceflight, and compared with their ground controls by two-dimentional polyacrylamide gel electrophoresis and reverse phase liquid chromatography (RPLC). In addition, the albumin, globulin, prolamine, glutelin, and amylose of the mutant seeds were analyzed by RPLC and ultra-violet spectrometry. The results showed that the low-abundance proteins of leaves in the peak tillering stage are more likely to be induced compared with their corresponding controls. The albumin, globulin, and prolamine of the mutant seeds revealed changes when compared with their controls, and the characteristics of changes in different mutants were stably inherited in the 8(th) and 9(th) generations, suggesting that they can be used as bio markers to identity the mutants induced by spaceflight. Moreover, two proteins (SSP9111 and SSP6302) were found to be expressed with high intensity (two-fold change) in different mutants, which were both correlated with photosystem according to mass spectrometry and database searching.

In vitro selection of resistance in haemophilus influenzae by 4 quinolones and 5 beta-lactams.

PubMed

Clark, Catherine; Kosowska, Klaudia; Bozdogan, Bülent; Credito, Kim; Dewasse, Bonifacio; McGhee, Pamela; Jacobs, Michael R; Appelbaum, Peter C

2004-05-01

We tested abilities of ciprofloxacin, levofloxacin, gatifloxacin, moxifloxacin, amoxicillin, amoxicillin/clavulanate, cefixime, cefpodoxime, and cefdinir to select resistant mutants in 5 beta-lactamase positive and 5 beta-lactamase negative Haemophilus influenzae strains by single and multistep methodology. In multistep tests, amoxicillin, amoxicillin/clavulanate and cefpodoxime exposure did not cause >4-fold minimum inhibitory concentration (MIC) increase after 50 days. One mutant selected by cefdinir had one amino acid substitution (Gly490Glu) in PBP3 and became resistant to cefdinir. Cefixime exposure caused 8-fold MIC-increase in 1 strain with TEM but the mutant remained cefixime susceptible and had no alteration in PBP3 or TEM. Among 10 strains tested, ciprofloxacin, moxifloxacin, gatifloxacin, levofloxacin caused >4-fold MIC increase in 6, 6, 5, and 2 strain, respectively. Despite the increases in quinolone MICs, none of the mutants became resistant to quinolones by established criteria. Quinolone selected mutants had quindone resistance-determining region (QRDR) alterations in GyrA, GyrB, ParC, ParE. Four quinolone mutants had no QRDR alterations. Among beta-lactams cefdinir and cefixime selected one mutant each with higher MICs however amoxicillin, amoxicillin/clavulanate, and cefpodoxime exposure did not select resistant mutants.

The yersiniabactin transport system is critical for the pathogenesis of bubonic and pneumonic plague.

PubMed

Fetherston, Jacqueline D; Kirillina, Olga; Bobrov, Alexander G; Paulley, James T; Perry, Robert D

2010-05-01

Iron acquisition from the host is an important step in the pathogenic process. While Yersinia pestis has multiple iron transporters, the yersiniabactin (Ybt) siderophore-dependent system plays a major role in iron acquisition in vitro and in vivo. In this study, we determined that the Ybt system is required for the use of iron bound by transferrin and lactoferrin and examined the importance of the Ybt system for virulence in mouse models of bubonic and pneumonic plague. Y. pestis mutants unable to either transport Ybt or synthesize the siderophore were both essentially avirulent via subcutaneous injection (bubonic plague model). Surprisingly, via intranasal instillation (pneumonic plague model), we saw a difference in the virulence of Ybt biosynthetic and transport mutants. Ybt biosynthetic mutants displayed an approximately 24-fold-higher 50% lethal dose (LD(50)) than transport mutants. In contrast, under iron-restricted conditions in vitro, a Ybt transport mutant had a more severe growth defect than the Ybt biosynthetic mutant. Finally, a Delta pgm mutant had a greater loss of virulence than the Ybt biosynthetic mutant, indicating that the 102-kb pgm locus encodes a virulence factor, in addition to Ybt, that plays a role in the pathogenesis of pneumonic plague.

Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

PubMed

Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

2017-12-15

TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

Seven functional classes of Barth syndrome mutation.

PubMed

Whited, Kevin; Baile, Matthew G; Currier, Pamela; Claypool, Steven M

2013-02-01

Patients with Barth syndrome (BTHS), a rare X-linked disease, suffer from skeletal and cardiomyopathy and bouts of cyclic neutropenia. The causative gene encodes tafazzin, a transacylase, which is the major determinant of the final acyl chain composition of the mitochondrial-specific phospholipid, CL. In addition to numerous frame shift and splice-site mutations, 36 missense mutations have been associated with BTHS. Previously, we established a BTHS-mutant panel in the yeast Saccharomyces cerevisiae that successfully models 18/21 conserved pathogenic missense mutations and defined the loss-of-function mechanism associated with a subset of the mutant tafazzins. Here, we report the biochemical and cell biological characterization of the rest of the yeast BTHS-mutant panel and in so doing identify three additional modes of tafazzin dysfunction. The largest group of mutant tafazzins is catalytically null, two mutants encode hypomorphic alleles, and another two mutants are temperature sensitive. Additionally, we have expanded the defects associated with previously characterized matrix-mislocalized-mutant tafazzins to include the rapid degradation of aggregation-prone polypeptides that correctly localize to the mitochondrial IMS. In sum, our in-depth characterization of the yeast BTHS-mutant panel has identified seven functional classes of BTHS mutation.

C. elegans and mutants with chronic nicotine exposure as a novel model of cancer phenotype.

PubMed

Kanteti, Rajani; Dhanasingh, Immanuel; El-Hashani, Essam; Riehm, Jacob J; Stricker, Thomas; Nagy, Stanislav; Zaborin, Alexander; Zaborina, Olga; Biron, David; Alverdy, John C; Im, Hae Kyung; Siddiqui, Shahid; Padilla, Pamela A; Salgia, Ravi

2016-01-01

We previously investigated MET and its oncogenic mutants relevant to lung cancer in C. elegans. The inactive orthlogues of the receptor tyrosine kinase Eph and MET, namely vab-1 and RB2088 respectively, the temperature sensitive constitutively active form of KRAS, SD551 (let-60; GA89) and the inactive c-CBL equivalent mutants in sli-1 (PS2728, PS1258, and MT13032) when subjected to chronic exposure of nicotine resulted in a significant loss in egg-laying capacity and fertility. While the vab-1 mutant revealed increased circular motion in response to nicotine, the other mutant strains failed to show any effect. Overall locomotion speed increased with increasing nicotine concentration in all tested mutant strains except in the vab-1 mutants. Moreover, chronic nicotine exposure, in general, upregulated kinases and phosphatases. Taken together, these studies provide evidence in support of C. elegans as initial in vivo model to study nicotine and its effects on oncogenic mutations identified in humans.

Transforming Growth Factor Beta (TGFβ1, TGFβ2 and TGFβ3) Null-Mutant Phenotypes in Embryonic Gonadal Development

PubMed Central

Memon, Mushtaq A.; Anway, Matthew D.; Covert, Trevor R.; Uzumcu, Mehmet; Skinner, Michael K.

2008-01-01

The role transforming growth factor beta (TGFb) isoforms TGFb1, TGFb2 and TGFb3 have in the regulation of embryonic gonadal development was investigated with the use of null-mutant (i.e. knockout) mice for each of the TGFb isoforms. Late embryonic gonadal development was investigated because homozygote TGFb null-mutant mice generally die around birth, with some embryonic loss as well. In the testis, the TGFb1 null-mutant mice had a decrease in the number of germ cells at birth, postnatal day 0 (P0). In the testis, the TGFb2 null-mutant mice had a decrease in the number of seminiferous cords at embryonic day 15 (E15). In the ovary, the TGFb2 null-mutant mice had an increase in the number of germ cells at P0. TGFb isoforms appear to have a role in gonadal development, but interactions between the isoforms is speculated to compensate in the different TGFb isoform null-mutant mice. PMID:18790002

Distinct cellular properties of oncogenic KIT receptor tyrosine kinase mutants enable alternative courses of cancer cell inhibition

PubMed Central

Shi, Xiarong; Sousa, Leiliane P.; Mandel-Bausch, Elizabeth M.; Tome, Francisco; Reshetnyak, Andrey V.; Hadari, Yaron; Schlessinger, Joseph; Lax, Irit

2016-01-01

Large genomic sequencing analysis as part of precision medicine efforts revealed numerous activating mutations in receptor tyrosine kinases, including KIT. Unfortunately, a single approach is not effective for inhibiting cancer cells or treating cancers driven by all known oncogenic KIT mutants. Here, we show that each of the six major KIT oncogenic mutants exhibits different enzymatic, cellular, and dynamic properties and responds distinctly to different KIT inhibitors. One class of KIT mutants responded well to anti-KIT antibody treatment alone or in combination with a low dose of tyrosine kinase inhibitors (TKIs). A second class of KIT mutants, including a mutant resistant to imatinib treatment, responded well to a combination of TKI with anti-KIT antibodies or to anti-KIT toxin conjugates, respectively. We conclude that the preferred choice of precision medicine treatments for cancers driven by activated KIT and other RTKs may rely on clear understanding of the dynamic properties of oncogenic mutants. PMID:27482095

Morphological, Histobiochemical and Molecular Characterisation of Low Lignin Phloem Fibre (llpf) Mutant of Dark Jute (Corchorus olitorius L.).

PubMed

Choudhary, S B; Chowdhury, I; Singh, R K; Pandey, S P; Sharma, H K; Anil Kumar, A; Karmakar, P G; Kumari, N; Souframanien, J; Jambhulkar, S J

2017-11-01

Lignin is a versatile plant metabolite challenging high-end industrial applications of several plant products including jute. Application of developmental mutant in regulation of lignification in jute may open up door for much awaited jute based diversified products. In the present study, a novel dark jute (Corchorus olitorius L.) mutant with low lignin (7.23%) in phloem fibre being compared to wild-type JRO 204 (13.7%) was identified and characterised. Unique morphological features including undulated stem, petiole and leaf vein distinguished the mutant in gamma ray irradiated mutant population. Histological and biochemical analysis revealed reduced lignification of phloem fibre cells of the plant. RT-PCR analysis demonstrated temporal transcriptional regulation of CCoAMT1 gene in the mutant. The mutant was found an extremely useful model to study phloem fibre developmental biology in the crop besides acting as a donor genetic stock for low lignin containing jute fibre in dark jute improvement programme.

Selection and Characterization of Dunaliella salina Mutants Defective in Haloadaptation 1

PubMed Central

Chitlaru, Edith; Pick, Uri

1989-01-01

A technique for selection of Dunaliella mutants defective in their capacity to recover from osmotic shocks has been developed. The selection is based on physical separation of mutants on density gradients. This technique takes advantage of the fact that Dunaliella cells, when exposed to osmotic shocks, initially change volume and density due to water gain or loss and subsequently recover their volume and density by readjusting their intracellular glycerol. Eight mutants that do not recover their original density following hyperosmotic shocks have been isolated. The mutants grow similar to wild type cells in 1 molar NaCl, and recover like the wild type from hypotonic shocks but are defective in recovering from hypertonic shocks. A partial characterization of one of the mutants is described. Images Figure 1 PMID:16667101

Strain improvement of Aspergillus niger for enhanced lipase production.

PubMed

Sandana Mala, John Geraldine; Kamini, Numbi R.; Puvanakrishnan, Rengarajulu

2001-08-01

The enhancement of lipase production from Aspergillus niger was attempted by ultraviolet (UV) and nitrous acid mutagenesis, and the mutants were selected on media containing bile salts. Nitrous acid mutants exhibited increased efficiency for lipase production when compared with UV mutants in submerged fermentation. The hyperproducing UV and nitrous acid mutants were further subjected to a second step of mutagenesis to devise an economical and ecofriendly technique for lipase production by the effective use of hydrocarbons. One percent kerosene was found to be optimal for lipase production, and one of the mutant strains NAII exhibited 2.53 times more increased lipase activity than the parental strain did. This investigation indicates a possible role for the A. niger mutant strains in the biodegradation of oil-polluted environments for the development of ecofriendly technologies.

Metabolic characterization of isocitrate dehydrogenase (IDH) mutant and IDH wildtype gliomaspheres uncovers cell type-specific vulnerabilities.

PubMed

Garrett, Matthew; Sperry, Jantzen; Braas, Daniel; Yan, Weihong; Le, Thuc M; Mottahedeh, Jack; Ludwig, Kirsten; Eskin, Ascia; Qin, Yue; Levy, Rachelle; Breunig, Joshua J; Pajonk, Frank; Graeber, Thomas G; Radu, Caius G; Christofk, Heather; Prins, Robert M; Lai, Albert; Liau, Linda M; Coppola, Giovanni; Kornblum, Harley I

2018-01-01

There is considerable interest in defining the metabolic abnormalities of IDH mutant tumors to exploit for therapy. While most studies have attempted to discern function by using cell lines transduced with exogenous IDH mutant enzyme, in this study, we perform unbiased metabolomics to discover metabolic differences between a cohort of patient-derived IDH1 mutant and IDH wildtype gliomaspheres. Using both our own microarray and the TCGA datasets, we performed KEGG analysis to define pathways differentially enriched in IDH1 mutant and IDH wildtype cells and tumors. Liquid chromatography coupled to mass spectrometry analysis with labeled glucose and deoxycytidine tracers was used to determine differences in overall cellular metabolism and nucleotide synthesis. Radiation-induced DNA damage and repair capacity was assessed using a comet assay. Differences between endogenous IDH1 mutant metabolism and that of IDH wildtype cells transduced with the IDH1 (R132H) mutation were also investigated. Our KEGG analysis revealed that IDH wildtype cells were enriched for pathways involved in de novo nucleotide synthesis, while IDH1 mutant cells were enriched for pathways involved in DNA repair. LC-MS analysis with fully labeled 13 C-glucose revealed distinct labeling patterns between IDH1 mutant and wildtype cells. Additional LC-MS tracing experiments confirmed increased de novo nucleotide synthesis in IDH wildtype cells relative to IDH1 mutant cells. Endogenous IDH1 mutant cultures incurred less DNA damage than IDH wildtype cultures and sustained better overall growth following X-ray radiation. Overexpression of mutant IDH1 in a wildtype line did not reproduce the range of metabolic differences observed in lines expressing endogenous mutations, but resulted in depletion of glutamine and TCA cycle intermediates, an increase in DNA damage following radiation, and a rise in intracellular ROS. These results demonstrate that IDH1 mutant and IDH wildtype cells are easily distinguishable metabolically by analyzing expression profiles and glucose consumption. Our results also highlight important differences in nucleotide synthesis utilization and DNA repair capacity that could be exploited for therapy. Altogether, this study demonstrates that IDH1 mutant gliomas are a distinct subclass of glioma with a less malignant, but also therapy-resistant, metabolic profile that will likely require distinct modes of therapy.

Structure-Based Engineering of Methionine Residues in the Catalytic Cores of Alkaline Amylase from Alkalimonas amylolytica for Improved Oxidative Stability

PubMed Central

Yang, Haiquan; Wang, Mingxing; Li, Jianghua; Wang, Nam Sun; Du, Guocheng

2012-01-01

This work aims to improve the oxidative stability of alkaline amylase from Alkalimonas amylolytica through structure-based site-directed mutagenesis. Based on an analysis of the tertiary structure, five methionines (Met 145, Met 214, Met 229, Met 247, and Met 317) were selected as the mutation sites and individually replaced with leucine. In the presence of 500 mM H2O2 at 35°C for 5 h, the wild-type enzyme and the M145L, M214L, M229L, M247L, and M317L mutants retained 10%, 28%, 46%, 28%, 72%, and 43% of the original activity, respectively. Concomitantly, the alkaline stability, thermal stability, and catalytic efficiency of the M247L mutant were also improved. The pH stability of the mutants (M145L, M214L, M229L, and M317L) remained unchanged compared to that of the wild-type enzyme, while the stable pH range of the M247L mutant was extended from pH 7.0 to 11.0 for the wild type to pH 6.0 to 12.0 for the mutant. The wild-type enzyme lost its activity after incubation at 50°C for 2 h, and the M145L, M214L, M229L, and M317L mutants retained less than 14% of the activity, whereas the M247L mutant retained 34% of the activity under the same conditions. Compared to the wild-type enzyme, the kcat values of the M145L, M214L, M229L, and M317L mutants decreased, while that of the M247L mutant increased slightly from 5.0 × 104 to 5.6 × 104 min−1. The mechanism responsible for the increased oxidative stability, alkaline stability, thermal stability, and catalytic efficiency of the M247L mutant was further analyzed with a structure model. The combinational mutants were also constructed, and their biochemical properties were characterized. The resistance of the wild-type enzyme and the mutants to surfactants and detergents was also investigated. Our results indicate that the M247L mutant has great potential in the detergent and textile industries. PMID:22865059

Germination-defective mutant of Neurospora crassa that responds to siderophores

NASA Technical Reports Server (NTRS)

Charlang, G.; Williams, N. P.

1977-01-01

A conditionally germination-defective mutant of Neurospora crassa has been found to be partially curable by ferricrocin and other siderophores. The mutant conidia rapidly lose their membrane-bound siderophores when suspended in buffer or growth media. Germination is consequently delayed unless large numbers of conidia are present (positive population effect). This indicates that the mutant has a membrane defect involving the siderophore attachment site.

A methodology for evaluation of parent-mutant competition using a generalized non-linear ecosystem model

Treesearch

Raymond L. Czaplewski

1973-01-01

A generalized, non-linear population dynamics model of an ecosystem is used to investigate the direction of selective pressures upon a mutant by studying the competition between parent and mutant populations. The model has the advantages of considering selection as operating on the phenotype, of retaining the interaction of the mutant population with the ecosystem as a...

Chemotaxis-defective mutants of the nematode Caenorhabditis elegans.

PubMed

Dusenbery, D B; Sheridan, R E; Russell, R L

1975-06-01

The technique of countercurrent separation has been used to isolate 17 independent chemotaxis-defective mutants of the nematode Caenorhabditis elegans. The mutants, selected to be relatively insensitive to the normally attractive salt NaCl, show varying degrees of residual sensitivity; some are actually weakly repelled by NaCl. The mutants are due to single gene defects, are autosomal and recessive, and identify at least five complementation groups.

Characterization of two MODY2 mutations with different susceptibility to activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langer, Sara; Platz, Christian; Waterstradt, Rica

2015-09-04

Glucokinase plays a key role in glucose sensing in pancreatic beta cells and in liver metabolism. Heterozygous inactivating glucokinase mutations cause the autosomal dominantly inherited MODY2 subtype of maturity-onset diabetes of the young. The goal of this study was to elucidate the pathogenicity of the recently described glucokinase mutants L304P and L315H, located in an alpha-helix and connecting region, respectively, at the outer region of the large domain of glucokinase. Both mutants showed wild-type-like cytosolic localization, but faster protein degradation in insulin-secreting MIN6 cells. However, strongly reduced nuclear/cytoplasmic localization of the mutants was observed in primary hepatocytes suggesting reduced interactionmore » with the liver specific glucokinase regulatory protein. Both mutants displayed a significantly lowered glucokinase activity compared to the wild-type protein. Even though the L315H protein showed the lowest enzymatic activity, this mutant was very sensitive to allosteric activation. The endogenous activator fructose-2,6-bisphosphatase evoked an increase in glucokinase activity for both mutants, but much stronger for L315H compared to L304P. The synthetic activator RO281675 was ineffective against the L304P mutant. Expression of the mutant proteins evoked loss of glucose-induced insulin secretion in MIN6 cells. Administration of RO281675 increased insulin secretion, however, only for the L315H mutant. Thus, a glucokinase activator drug therapy may help MODY2 patients not in general, but seems to be a useful strategy for carriers of the L315H glucokinase mutation. - Highlights: • The GK mutants L304P and L315H display a highly reduced enzymatic activity. • In hepatocytes both mutations lower the nuclear/cytoplasmic localization ratio of GK. • Both mutants inhibit stimulus-secretion coupling in insulin-producing cells. • Activation by fructose-2,6-bisphosphatase and by RO281675 is stronger for L315H. • RO281675 stimulates insulin secretion only for the L315H mutant, not for L304P.« less

Directed evolution to re-adapt a co-evolved network within an enzyme.

PubMed

Strafford, John; Payongsri, Panwajee; Hibbert, Edward G; Morris, Phattaraporn; Batth, Sukhjeet S; Steadman, David; Smith, Mark E B; Ward, John M; Hailes, Helen C; Dalby, Paul A

2012-01-01

We have previously used targeted active-site saturation mutagenesis to identify a number of transketolase single mutants that improved activity towards either glycolaldehyde (GA), or the non-natural substrate propionaldehyde (PA). Here, all attempts to recombine the singles into double mutants led to unexpected losses of specific activity towards both substrates. A typical trade-off occurred between soluble expression levels and specific activity for all single mutants, but many double mutants decreased both properties more severely suggesting a critical loss of protein stability or native folding. Statistical coupling analysis (SCA) of a large multiple sequence alignment revealed a network of nine co-evolved residues that affected all but one double mutant. Such networks maintain important functional properties such as activity, specificity, folding, stability, and solubility and may be rapidly disrupted by introducing one or more non-naturally occurring mutations. To identify variants of this network that would accept and improve upon our best D469 mutants for activity towards PA, we created a library of random single, double and triple mutants across seven of the co-evolved residues, combining our D469 variants with only naturally occurring mutations at the remaining sites. A triple mutant cluster at D469, E498 and R520 was found to behave synergistically for the specific activity towards PA. Protein expression was severely reduced by E498D and improved by R520Q, yet variants containing both mutations led to improved specific activity and enzyme expression, but with loss of solubility and the formation of inclusion bodies. D469S and R520Q combined synergistically to improve k(cat) 20-fold for PA, more than for any previous transketolase mutant. R520Q also doubled the specific activity of the previously identified D469T to create our most active transketolase mutant to date. Our results show that recombining active-site mutants obtained by saturation mutagenesis can rapidly destabilise critical networks of co-evolved residues, whereas beneficial single mutants can be retained and improved upon by randomly recombining them with natural variants at other positions in the network. Copyright © 2011 Elsevier B.V. All rights reserved.

Water in the Active Site of Ketosteroid Isomerase

PubMed Central

Hanoian, Philip; Hammes-Schiffer, Sharon

2011-01-01

Classical molecular dynamics simulations were utilized to investigate the structural and dynamical properties of water in the active site of ketosteroid isomerase (KSI) to provide insight into the role of these water molecules in the enzyme-catalyzed reaction. This reaction is thought to proceed via a dienolate intermediate that is stabilized by hydrogen bonding with residues Tyr16 and Asp103. A comparative study was performed for the wild-type (WT) KSI and the Y16F, Y16S, and Y16F/Y32F/Y57F (FFF) mutants. These systems were studied with three different bound ligands: equilenin, which is an intermediate analog, and the intermediate states of two steroid substrates. Several distinct water occupation sites were identified in the active site of KSI for the WT and mutant systems. Three additional sites were identified in the Y16S mutant that were not occupied in WT KSI or the other mutants studied. The number of water molecules directly hydrogen bonded to the ligand oxygen was approximately two waters in the Y16S mutant, one water in the Y16F and FFF mutants, and intermittent hydrogen bonding of one water molecule in WT KSI. The molecular dynamics trajectories of the Y16F and FFF mutants reproduced the small conformational changes of residue 16 observed in the crystal structures of these two mutants. Quantum mechanical/molecular mechanical calculations of 1H NMR chemical shifts of the protons in the active site hydrogen-bonding network suggest that the presence of water in the active site does not prevent the formation of short hydrogen bonds with far-downfield chemical shifts. The molecular dynamics simulations indicate that the active site water molecules exchange much more frequently for WT KSI and the FFF mutant than for the Y16F and Y16S mutants. This difference is most likely due to the hydrogen-bonding interaction between Tyr57 and an active site water molecule that is persistent in the Y16F and Y16S mutants but absent in the FFF mutant and significantly less probable in WT KSI. PMID:21710970

A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair.

PubMed Central

Ayyagari, R; Impellizzeri, K J; Yoder, B L; Gary, S L; Burgers, P M

1995-01-01

The saccharomyces cerevisiae proliferating cell nuclear antigen (PCNA), encoded by the POL30 gene, is essential for DNA replication and DNA repair processes. Twenty-one site-directed mutations were constructed in the POL30 gene, each mutation changing two adjacently located charged amino acids to alanines. Although none of the mutant strains containing these double-alanine mutations as the sole source of PCNA were temperature sensitive or cold sensitive for growth, about a third of the mutants showed sensitivity to UV light. Some of those UV-sensitive mutants had elevated spontaneous mutation rates. In addition, several mutants suppressed a cold-sensitive mutation in the CDC44 gene, which encodes the large subunit of replication factor C. A cold-sensitive mutant, which was isolated by random mutagenesis, showed a terminal phenotype at the restrictive temperature consistent with a defect in DNA replication. Several mutant PCNAs were expressed and purified from Escherichia coli, and their in vitro properties were determined. The cold-sensitive mutant (pol30-52, S115P) was a monomer, rather than a trimer, in solution. This mutant was deficient for DNA synthesis in vitro. Partial restoration of DNA polymerase delta holoenzyme activity was achieved at 37 degrees C but not at 14 degrees C by inclusion of the macromolecular crowding agent polyethylene glycol in the assay. The only other mutant (pol30-6, DD41,42AA) that showed a growth defect was partially defective for interaction with replication factor C and DNA polymerase delta but completely defective for interaction with DNA polymerase epsilon. Two other mutants sensitive to DNA damage showed no defect in vitro. These results indicate that the latter mutants are specifically impaired in one or more DNA repair processes whereas pol30-6 and pol30-52 mutants show their primary defects in the basic DNA replication machinery with probable associated defects in DNA repair. Therefore, DNA repair requires interactions between repair-specific protein(s) and PCNA, which are distinct from those required for DNA replication. PMID:7623835

Water in the active site of ketosteroid isomerase.

PubMed

Hanoian, Philip; Hammes-Schiffer, Sharon

2011-08-09

Classical molecular dynamics simulations were utilized to investigate the structural and dynamical properties of water in the active site of ketosteroid isomerase (KSI) to provide insight into the role of these water molecules in the enzyme-catalyzed reaction. This reaction is thought to proceed via a dienolate intermediate that is stabilized by hydrogen bonding with residues Tyr16 and Asp103. A comparative study was performed for the wild-type (WT) KSI and the Y16F, Y16S, and Y16F/Y32F/Y57F (FFF) mutants. These systems were studied with three different bound ligands: equilenin, which is an intermediate analog, and the intermediate states of two steroid substrates. Several distinct water occupation sites were identified in the active site of KSI for the WT and mutant systems. Three additional sites were identified in the Y16S mutant that were not occupied in WT KSI or the other mutants studied. The number of water molecules directly hydrogen bonded to the ligand oxygen was approximately two in the Y16S mutant and one in the Y16F and FFF mutants, with intermittent hydrogen bonding of one water molecule in WT KSI. The molecular dynamics trajectories of the Y16F and FFF mutants reproduced the small conformational changes of residue 16 observed in the crystal structures of these two mutants. Quantum mechanical/molecular mechanical calculations of (1)H NMR chemical shifts of the protons in the active site hydrogen-bonding network suggest that the presence of water in the active site does not prevent the formation of short hydrogen bonds with far-downfield chemical shifts. The molecular dynamics simulations indicate that the active site water molecules exchange much more frequently for WT KSI and the FFF mutant than for the Y16F and Y16S mutants. This difference is most likely due to the hydrogen-bonding interaction between Tyr57 and an active site water molecule that is persistent in the Y16F and Y16S mutants but absent in the FFF mutant and significantly less probable in WT KSI. © 2011 American Chemical Society

Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

PubMed Central

Kim, Seok-Hyung; Kowalski, Marie L.; Carson, Robert P.; Bridges, L. Richard; Ess, Kevin C.

2013-01-01

SUMMARY Tuberous sclerosis complex (TSC) is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1) kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors. PMID:23580196

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

Effects of the Herbicide Imazethapyr on Photosynthesis in PGR5- and NDH-Deficient Arabidopsis thaliana at the Biochemical, Transcriptomic, and Proteomic Levels.

PubMed

Sun, Chongchong; Chen, Si; Jin, Yujian; Song, Hao; Ruan, Songlin; Fu, Zhengwei; Asad, Muhammad Asad Ullah; Qian, Haifeng

2016-06-08

Photosynthesis is a very important metabolic pathway for plant growth and crop yield. This report investigated the effect of the herbicide imazethapyr on photosynthesis in the Arabidopsis thaliana pnsB3 mutant (a defect in the NDH pathway) and pgr5 mutant (a defect in the PGR5 pathway) to determine which cyclic electron transport chain (CET) of the NDH and PGR5 pathways is more important for protecting the photosynthetic system under herbicide stress. The results showed that 20 μg/L imazethapyr markedly inhibited the growth of the three ecotypes of A. thaliana and produced more anthocyanins and reactive oxygen species (ROS), particularly in the pgr5 mutant. The chlorophyll fluorescence results showed that PSII was severely damaged in the pgr5 mutant. Additionally, the CET was significantly stimulated to protect the photosynthetic system from light damage in Wt and the pnsB3 mutant but not the pgr5 mutant. The real-time PCR analysis indicated that imazethapyr treatment considerably decreased the transcript levels of most photosynthesis-related genes in the three treated groups. Several genes in the PGR5 pathway were significantly induced in the pnsB3 mutant, but no genes in the NDH pathway were induced in the pgr5 mutant. The gene transcription analysis showed that the pgr5 mutant cannot compensate for the deficit in the PGR5 pathway by stimulating the NDH pathway, whereas the pnsB3 mutant can compensate for the deficit in the CET cycle by regulating the PGR5 pathway. The iTRAQ analyses also showed that the photosynthesis system, glycolysis, and TCA cycle suffered the most severe damage in the pgr5 mutant. All of these results showed that the PGR5 pathway is more critical for electron transfer around PSI than the NDH pathway to resist herbicide stress.

A novel pathogenicity gene is required in the rice blast fungus to suppress the basal defenses of the host.

PubMed

Chi, Myoung-Hwan; Park, Sook-Young; Kim, Soonok; Lee, Yong-Hwan

2009-04-01

For successful colonization and further reproduction in host plants, pathogens need to overcome the innate defenses of the plant. We demonstrate that a novel pathogenicity gene, DES1, in Magnaporthe oryzae regulates counter-defenses against host basal resistance. The DES1 gene was identified by screening for pathogenicity-defective mutants in a T-DNA insertional mutant library. Bioinformatic analysis revealed that this gene encodes a serine-rich protein that has unknown biochemical properties, and its homologs are strictly conserved in filamentous Ascomycetes. Targeted gene deletion of DES1 had no apparent effect on developmental morphogenesis, including vegetative growth, conidial germination, appressorium formation, and appressorium-mediated penetration. Conidial size of the mutant became smaller than that of the wild type, but the mutant displayed no defects on cell wall integrity. The Deltades1 mutant was hypersensitive to exogenous oxidative stress and the activity and transcription level of extracellular enzymes including peroxidases and laccases were severely decreased in the mutant. In addition, ferrous ion leakage was observed in the Deltades1 mutant. In the interaction with a susceptible rice cultivar, rice cells inoculated with the Deltades1 mutant exhibited strong defense responses accompanied by brown granules in primary infected cells, the accumulation of reactive oxygen species (ROS), the generation of autofluorescent materials, and PR gene induction in neighboring tissues. The Deltades1 mutant displayed a significant reduction in infectious hyphal extension, which caused a decrease in pathogenicity. Notably, the suppression of ROS generation by treatment with diphenyleneiodonium (DPI), an inhibitor of NADPH oxidases, resulted in a significant reduction in the defense responses in plant tissues challenged with the Deltades1 mutant. Furthermore, the Deltades1 mutant recovered its normal infectious growth in DPI-treated plant tissues. These results suggest that DES1 functions as a novel pathogenicity gene that regulates the activity of fungal proteins, compromising ROS-mediated plant defense.

Rapid Conversion of Mutant IDH1 from Driver to Passenger in a Model of Human Gliomagenesis

PubMed Central

Johannessen, Tor-Christian Aase; Mukherjee, Joydeep; Viswanath, Pavithra; Ohba, Shigeo; Ronen, Sabrina M.; Bjerkvig, Rolf; Pieper, Russell O.

2016-01-01

Missense mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. While mutant IDH1 expression is thought to drive the gliomagenesis process, the extent to which it remains a viable therapeutic target remains unknown. To address this question we exposed immortalized (p53/pRb-deficient), untransformed human astrocytes to the mutant IDH1 inhibitor AGI-5198 prior to, concomitant with, or at intervals after, introduction of transforming mutant IDH1, then measured effects on 2-HG levels, histone methylation (H3K4me3, H3K9me2, H3K9me3 or H3K27me3) and growth in soft-agar. Addition of AGI-5198 prior to, or concomitant with, introduction of mutant IDH1 blocked all mutant IDH1-driven changes including cellular transformation. Addition at time intervals as short as 4 days following introduction of mutant IDH1 also suppressed 2-HG levels, but had minimal effects on histone methylation, and lost the ability to suppress clonogenicity in a time-dependent manner. Furthermore, in two different models of mutant IDH1-driven gliomagenesis, AGI-5198 exposures that abolished production of 2-HG also failed to decrease histone methylation, adherent cell growth, or anchorage-independent growth in soft-agar over a prolonged period. These studies show although mutant IDH1 expression drives gliomagenesis, mutant IDH1 itself rapidly converts from driver to passenger. Implications Agents that target mutant IDH may be effective for a narrow time and may require further optimization or additional therapeutics in glioma. PMID:27430238

Polymorphic Variation in Susceptibility and Metabolism of Triclosan-Resistant Mutants of Escherichia coli and Klebsiella pneumoniae Clinical Strains Obtained after Exposure to Biocides and Antibiotics

PubMed Central

Curiao, Tânia; Marchi, Emmanuela; Viti, Carlo; Oggioni, Marco R.; Baquero, Fernando; Martinez, José Luis

2015-01-01

Exposure to biocides may result in cross-resistance to other antimicrobials. Changes in biocide and antibiotic susceptibilities, metabolism, and fitness costs were studied here in biocide-selected Escherichia coli and Klebsiella pneumoniae mutants. E. coli and K. pneumoniae mutants with various degrees of triclosan susceptibility were obtained after exposure to triclosan (TRI), benzalkonium chloride (BKC), chlorhexidine (CHX) or sodium hypochlorite (SHC), and ampicillin or ciprofloxacin. Alterations in antimicrobial susceptibility and metabolism in mutants were tested using Phenotype MicroArrays. The expression of AcrAB pump and global regulators (SoxR, MarA, and RamA) was measured by quantitative reverse transcription-PCR (qRT-PCR), and the central part of the fabI gene was sequenced. The fitness costs of resistance were assessed by a comparison of relative growth rates. Triclosan-resistant (TRIr) and triclosan-hypersusceptible (TRIhs) mutants of E. coli and K. pneumoniae were obtained after selection with biocides and/or antibiotics. E. coli TRIr mutants, including those with mutations in the fabI gene or in the expression of acrB, acrF, and marA, exhibited changes in susceptibility to TRI, CHX, and antibiotics. TRIr mutants for which the TRI MIC was high presented improved metabolism of carboxylic acids, amino acids, and carbohydrates. In TRIr mutants, resistance to one antimicrobial provoked hypersusceptibility to another one(s). TRIr mutants had fitness costs, particularly marA-overexpressing (E. coli) or ramA-overexpressing (K. pneumoniae) mutants. TRI, BKC, and CIP exposure frequently yielded TRIr mutants exhibiting alterations in AraC-like global regulators (MarA, SoxR, and RamA), AcrAB-TolC, and/or FabI, and influencing antimicrobial susceptibility, fitness, and metabolism. These various phenotypes suggest a trade-off of different selective processes shaping the evolution toward antibiotic/biocide resistance and influencing other adaptive traits. PMID:25824225

Arabidopsis Brassinosteroid-Insensitive dwarf12 Mutants Are Semidominant and Defective in a Glycogen Synthase Kinase 3β-Like Kinase1

PubMed Central

Choe, Sunghwa; Schmitz, Robert J.; Fujioka, Shozo; Takatsuto, Suguru; Lee, Mi-Ok; Yoshida, Shigeo; Feldmann, Kenneth A.; Tax, Frans E.

2002-01-01

Mutants defective in the biosynthesis or signaling of brassinosteroids (BRs), plant steroid hormones, display dwarfism. Loss-of-function mutants for the gene encoding the plasma membrane-located BR receptor BRI1 are resistant to exogenous application of BRs, and characterization of this protein has contributed significantly to the understanding of BR signaling. We have isolated two new BR-insensitive mutants (dwarf12-1D and dwf12-2D) after screening Arabidopsis ethyl methanesulfonate mutant populations. dwf12 mutants displayed the characteristic morphology of previously reported BR dwarfs including short stature, short round leaves, infertility, and abnormal de-etiolation. In addition, dwf12 mutants exhibited several unique phenotypes, including severe downward curling of the leaves. Genetic analysis indicates that the two mutations are semidominant in that heterozygous plants show a semidwarf phenotype whose height is intermediate between wild-type and homozygous mutant plants. Unlike BR biosynthetic mutants, dwf12 plants were not rescued by high doses of exogenously applied BRs. Like bri1 mutants, dwf12 plants accumulated castasterone and brassinolide, 43- and 15-fold higher, respectively, providing further evidence that DWF12 is a component of the BR signaling pathway that includes BRI1. Map-based cloning of the DWF12 gene revealed that DWF12 belongs to a member of the glycogen synthase kinase 3β family. Unlike human glycogen synthase kinase 3β, DWF12 lacks the conserved serine-9 residue in the auto-inhibitory N terminus. In addition, dwf12-1D and dwf12-2D encode changes in consecutive glutamate residues in a highly conserved TREE domain. Together with previous reports that both bin2 and ucu1 mutants contain mutations in this TREE domain, this provides evidence that the TREE domain is of critical importance for proper function of DWF12/BIN2/UCU1 in BR signal transduction pathways. PMID:12428015

The mitochondrial COB region in yeast codes for apocytochrome b and is mosaic.

PubMed

Haid, A; Schweyen, R J; Bechmann, H; Kaudewitz, F; Solioz, M; Schatz, G

1979-03-01

Mitochondrial mutants of Saccharomyces cerevisiae defective in cytochrome b were analyzed genetically and biochemically in order to elucidate the role of the mitochondrial genetic system in the biosynthesis of this cytochrome. The mutants mapped between OLI1 and OLI2 on mitochondrial DNA in a region called COB. A fine structure map of the COB region was constructed by rho- deletion mapping and recombination analysis. The combined genetic and biochemical data indicate that the COB region is mosaic and contains at least five distinct clusters of mutants, A-E, with A being closest to OLI2 and E being closest to OLI1. Clusters A, C and E are probably coding regions for apocytochrome b, whereas clusters B and D seem to be involved in as yet unknown functions. These conclusions rest on the following evidence. 1. Most mutants in clusters A, C and E have specifically lost cytochrome b. Many of them accumulate smaller mitochondrial translation products; some of these were identified as fragments of apocytochrome b by proteolytic fingerprinting. The molecular weight of these fragments depends on the map position of the mutant, increasing in the direction OLI2 leads to OLI1. The mutant closest to OLI1 accumulates an apocytochrome b which is slightly larger than that of wild type. 2. A mutant in cluster C exhibits a spectral absorption band of cytochrome b that is shifted 1.5 nm to the red. 3. Mutants in clusters B and D are pleiotropic. A majority of them are conditional and lack the absorption bands of both cytochrome b and cytochrome aa3; these mutants also fail to accumulate apocytochrome b and subunit I of cytochrome c oxidase and instead form a large number of abnormal translation products whose nature is unknown. 4. Zygotic complementation tests reveal at least two complementation groups: The first group includes all mutants in cluster B and the second group includes mutants in clusters (A + C + D + E).

Polymorphic variation in susceptibility and metabolism of triclosan-resistant mutants of Escherichia coli and Klebsiella pneumoniae clinical strains obtained after exposure to biocides and antibiotics.

PubMed

Curiao, Tânia; Marchi, Emmanuela; Viti, Carlo; Oggioni, Marco R; Baquero, Fernando; Martinez, José Luis; Coque, Teresa M

2015-01-01

Exposure to biocides may result in cross-resistance to other antimicrobials. Changes in biocide and antibiotic susceptibilities, metabolism, and fitness costs were studied here in biocide-selected Escherichia coli and Klebsiella pneumoniae mutants. E. coli and K. pneumoniae mutants with various degrees of triclosan susceptibility were obtained after exposure to triclosan (TRI), benzalkonium chloride (BKC), chlorhexidine (CHX) or sodium hypochlorite (SHC), and ampicillin or ciprofloxacin. Alterations in antimicrobial susceptibility and metabolism in mutants were tested using Phenotype MicroArrays. The expression of AcrAB pump and global regulators (SoxR, MarA, and RamA) was measured by quantitative reverse transcription-PCR (qRT-PCR), and the central part of the fabI gene was sequenced. The fitness costs of resistance were assessed by a comparison of relative growth rates. Triclosan-resistant (TRI(r)) and triclosan-hypersusceptible (TRI(hs)) mutants of E. coli and K. pneumoniae were obtained after selection with biocides and/or antibiotics. E. coli TRI(r) mutants, including those with mutations in the fabI gene or in the expression of acrB, acrF, and marA, exhibited changes in susceptibility to TRI, CHX, and antibiotics. TRI(r) mutants for which the TRI MIC was high presented improved metabolism of carboxylic acids, amino acids, and carbohydrates. In TRI(r) mutants, resistance to one antimicrobial provoked hypersusceptibility to another one(s). TRI(r) mutants had fitness costs, particularly marA-overexpressing (E. coli) or ramA-overexpressing (K. pneumoniae) mutants. TRI, BKC, and CIP exposure frequently yielded TRI(r) mutants exhibiting alterations in AraC-like global regulators (MarA, SoxR, and RamA), AcrAB-TolC, and/or FabI, and influencing antimicrobial susceptibility, fitness, and metabolism. These various phenotypes suggest a trade-off of different selective processes shaping the evolution toward antibiotic/biocide resistance and influencing other adaptive traits. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Evolution of a recombinant (gucoamylase-producing) strain of Fusarium venenatum A3/5 in chemostat culture.

PubMed

Wiebe, M G; Robson, G D; Shuster, J; Trinci, A P

2001-04-20

Fusarium venenatum JeRS 325 is a transformant of strain A3/5 which produces Aspergillus niger glucoamylase (GAM) under the control of a Fusarium oxysporum trypsin-like protease promoter. The evolution of JeRS 325 was studied in glucose-limited chemostat cultures grown on NaNO3 or (NH4)2SO4 as the nitrogen source. Thirteen mutants which were more highly branched and four mutants which were more sparsely branched than the parental strain were isolated from the NaNO3 chemostat. The highly branched mutants detected in this chemostat did not displace the sparsely branched population. The mutants isolated from the NaNO3 chemostat complemented representative strains previously isolated from glucose-limited chemostat cultures of F. venenatum A3/5 grown on (NH4)2SO4, but showed little complementation between themselves. By contrast, a highly branched mutant isolated from the (NH4)2SO4 chemostat culture displaced the sparsely branched mycelial population. None of the mutants isolated from the NaNO3 or (NH4)2SO4 chemostats produced as much GAM as JeRS 325. Southern blot analysis showed that all except one mutant had lost copies of both the glucoamylase and the acetamidase (the selectable marker) genes. However, specific GAM production was not necessarily correlated with the extent of glaA gene loss observed. Further, 10 of the mutants had lost the ability to grow on acetamide as the sole nitrogen source, although they retained copies of the amdS gene. In competition studies, mutants which could not utilize acetamide displaced mutants which could. The presence of foreign DNA in JeRS 325 resulted in a reduced specific growth rate (compared to A3/5), but the presence of the foreign DNA did not prevent the evolution of the strain or the isolation of mutants which had improved growth rates. Copyright 2001 John Wiley & Sons, Inc.

Mutants of the lactose carrier of Escherichia coli which show altered sugar recognition plus a severe defect in sugar accumulation.

PubMed

Varela, M F; Wilson, T H; Rodon-Rivera, V; Shepherd, S; Dehne, T A; Rector, A C

2000-04-01

Lactose and melibiose are actively accumulated by the wild-type Escherichia coli lactose carrier, which is an integral membrane protein energized by the proton motive force. Mutants of the E. coli lactose carrier were isolated by their ability to grow on minimal plates with succinate plus IPTG in the presence of the toxic lactose analog beta-thio-o-nitrophenylgalactoside (TONPG). TONPG-resistant mutants were streaked on melibiose MacConkey indicator plates, and red clones were picked. These melibiose positive mutants were then streaked on lactose MacConkey plates, and white clones were picked. Transport assays indicated that the mutants had altered sugar recognition and a defect in sugar accumulation. The mutants had a poor apparent K(m) for both lactose and melibiose in transport. One mutant had almost no ability to take up lactose, but melibiose downhill transport was 58% (V(max)) of normal. All of the mutants accumulated methyl-alpha-d-galactopyranoside (TMG) to only 8% or less of normal, and two failed to accumulate. Immunoblot analysis of the mutant lactose carrier proteins indicated that loss of sugar transport activity was not due to loss of expression in the membrane. Nucleotide sequencing of the lacY gene from the mutants revealed changes in the following amino acids of the lactose carrier: M23I, W151L, G257D, A295D and G377V. Two of the mutants (G257D and G377V) are novel in that they represent the first amino acids in periplasmic loops to be implicated with changes in sugar recognition. We conclude that the amino acids M23, W151, G257, A295 and G377 of the E. coli lactose carrier play either a direct or an indirect role in sugar recognition and accumulation.

Low ergosterol content in yeast adh1 mutant enhances chitin maldistribution and sensitivity to paraquat-induced oxidative stress.

PubMed

Marisco, G; Saito, S T; Ganda, I S; Brendel, M; Pungartnik, C

2011-05-01

Alcohol dehydrogenases catalyse the reversible oxidation of alcohols to aldehydes or ketones, with concomitant reduction of NAD(+) or NADP(+) . Adh1p is responsible for the reduction of acetaldehyde to ethanol, while Adh2p catalyses the reverse reaction, the oxidation of ethanol to acetaldehyde. Lack of Adh1p shifts the cellular redox balance towards excess NADH/NADPH and acetaldehyde, while absence of Adh2p does the opposite. Yeast mutant adh1Δ had a slow growth rate, whereas adh2Δ grew like the isogenic wild-type (WT) during prediauxic shift fermentative metabolism. After 48 h WT and mutants reached the same number of viable cells. When exponentially growing (LOG) cells were exposed to calcofluor white, only mutant adh1Δ displayed an irregular deposition of chitin. Quantitative analyses of both LOG and stationary-phase cells showed that adh1Δ mutant contained significantly less ergosterol than cells of WT and adh2Δ mutant, whereas the erg3Δ mutant contained extremely low ergosterol pools. Both adh1Δ and adh2Δ mutants showed higher-than-WT resistance to heat shock and to H(2) O(2) but had WT resistance when exposed to ultraviolet (UV) light and the DNA cross-linking agent diepoxyoctane, indicating normal DNA repair capacity. Mutant adh1Δ was specifically sensitive to acetaldehyde and to membrane peroxidizing paraquat. Our results link the pleiotropic phenotype of adh1Δ mutants to low pools of ergosterol and to reductive stress, and introduce the two new phenotypes, resistance to heat shock and to H(2) O(2) , for the adh2Δ mutant, most probably related to increased ROS production in mitochondria, which leads to the induction of oxidative stress protection. Copyright © 2011 John Wiley & Sons, Ltd.

Characterization of Synthetic-Lethal Mutants Reveals a Role for the Saccharomyces Cerevisiae Guanine-Nucleotide Exchange Factor Cdc24p in Vacuole Function and Na(+) Tolerance

PubMed Central

White, W. H.; Johnson, D. I.

1997-01-01

Cdc24p is the guanine-nucleotide exchange factor for the Cdc42p GTPase, which controls cell polarity in Saccharomyces cerevisiae. To identify new genes that may affect cell polarity, we characterized six UV-induced csl (CDC24 synthetic-lethal) mutants that exhibited synthetic-lethality with cdc24-4(ts) at 23°. Five mutants were not complemented by plasmid-borne CDC42, RSR1, BUD5, BEM1, BEM2, BEM3 or CLA4 genes, which are known to play a role in cell polarity. The csl3 mutant displayed phenotypes similar to those observed with calcium-sensitive, Pet(-) vma mutants defective in vacuole function. CSL5 was allelic to VMA5, the vacuolar H(+)-ATPase subunit C, and one third of csl5 cdc24-4(ts) cells were elongated or had misshapen buds. A cdc24-4(ts) Δvma5::LEU2 double mutant did not exhibit synthetic lethality, suggesting that the csl5/vma5 cdc24-4(ts) synthetic-lethality was not simply due to altered vacuole function. The cdc24-4(ts) mutant, like Δvma5::LEU2 and csl3 mutants, was sensitive to high levels of Ca(2+) as well as Na(+) in the growth media, which did not appear to be a result of a fragile cell wall because the phenotypes were not remedied by 1 M sorbitol. Our results indicated that Cdc24p was required in one V-ATPase mutant and another mutant affecting vacuole morphology, and also implicated Cdc24p in Na(+) tolerance. PMID:9286667

SUCROSE TRANSPORTER 5 supplies Arabidopsis embryos with biotin and affects triacylglycerol accumulation

PubMed Central

Pommerrenig, Benjamin; Popko, Jennifer; Heilmann, Mareike; Schulmeister, Sylwia; Dietel, Katharina; Schmitt, Bianca; Stadler, Ruth; Feussner, Ivo; Sauer, Norbert

2013-01-01

The Arabidopsis SUC5 protein represents a classical sucrose/H+ symporter. Functional analyses previously revealed that SUC5 also transports biotin, an essential co-factor for fatty acid synthesis. However, evidence for a dual role in transport of the structurally unrelated compounds sucrose and biotin in plants was lacking. Here we show that SUC5 localizes to the plasma membrane, and that the SUC5 gene is expressed in developing embryos, confirming the role of the SUC5 protein as substrate carrier across apoplastic barriers in seeds. We show that transport of biotin but not of sucrose across these barriers is impaired in suc5 mutant embryos. In addition, we show that SUC5 is essential for the delivery of biotin into the embryo of biotin biosynthesis-defective mutants (bio1 and bio2). We compared embryo and seedling development as well as triacylglycerol accumulation and fatty acid composition in seeds of single mutants (suc5, bio1 or bio2), double mutants (suc5 bio1 and suc5 bio2) and wild-type plants. Although suc5 mutants were like the wild-type, bio1 and bio2 mutants showed developmental defects and reduced triacylglycerol contents. In suc5 bio1 and suc5 bio2 double mutants, developmental defects were severely increased and the triacylglycerol content was reduced to a greater extent in comparison to the single mutants. Supplementation with externally applied biotin helped to reduce symptoms in both single and double mutants, but the efficacy of supplementation was significantly lower in double than in single mutants, showing that transport of biotin into the embryo is lower in the absence of SUC5. PMID:23031218

Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration of a transgene

PubMed Central

Furukawa, Tomoyuki; Angelis, Karel J.; Britt, Anne B.

2015-01-01

The DNA double-strand break (DSB) is a critical type of damage, and can be induced by both endogenous sources (e.g., errors of oxidative metabolism, transposable elements, programmed meiotic breaks, or perturbation of the DNA replication fork) and exogenous sources (e.g., ionizing radiation or radiomimetic chemicals). Although higher plants, like mammals, are thought to preferentially repair DSBs via nonhomologous end joining (NHEJ), much remains unclear about plant DSB repair pathways. Our reverse genetic approach suggests that DNA polymerase λ is involved in DSB repair in Arabidopsis. The Arabidopsis T-DNA insertion mutant (atpolλ-1) displayed sensitivity to both gamma-irradiation and treatment with radiomimetic reagents, but not to other DNA damaging treatments. The atpolλ-1 mutant showed a moderate sensitivity to DSBs, while Arabidopsis Ku70 and DNA ligase 4 mutants (atku70-3 and atlig4-2), both of which play critical roles in NHEJ, exhibited a hypersensitivity to these treatments. The atpolλ-1/atlig4-2 double mutant exhibited a higher sensitivity to DSBs than each single mutant, but the atku70/atpolλ-1 showed similar sensitivity to the atku70-3 mutant. We showed that transcription of the DNA ligase 1, DNA ligase 6, and Wee1 genes was quickly induced by BLM in several NHEJ deficient mutants in contrast to wild-type. Finally, the T-DNA transformation efficiency dropped in NHEJ deficient mutants and the lowest transformation efficiency was scored in the atpolλ-1/atlig4-2 double mutant. These results imply that AtPolλ is involved in both DSB repair and DNA damage response pathway. PMID:26074930

Deciphering the Dynamics of Non-Covalent Interactions Affecting Thermal Stability of a Protein: Molecular Dynamics Study on Point Mutant of Thermus thermophilus Isopropylmalate Dehydrogenase.

PubMed

Sharma, Reetu; Sastry, G Narahari

2015-01-01

Thermus thermophilius isopropylmalate dehydrogenase catalyzes oxidative decarboxylation and dehydrogenation of isopropylmalate. Substitution of leucine to alanine at position 172 enhances the thermal stability among the known point mutants. Exploring the dynamic properties of non-covalent interactions such as saltbridges, hydrogen bonds and hydrophobic interactions to explain thermal stability of a protein is interesting in its own right. In this study dynamic changes in the non-covalent interactions are studied to decipher the deterministic features of thermal stability of a protein considering a case study of a point mutant in Thermus thermophilus isopropylmalate dehydrogenase. A total of four molecular dynamic simulations of 0.2 μs were carried out on wild type and mutant's functional dimers at 300 K and 337 K. Higher thermal stability of the mutant as compared to wild type is revealed by root mean square deviation, root mean square fluctuations and Cα-Cα distance with an increase in temperature from 300 K to 337 K. Most of the regions of wild type fluctuate higher than the corresponding regions of mutant with an increase in temperature. Cα-Cα distance analysis suggests that long distance networks are significantly affected in wild type as compared to the mutant. Short lived contacts are higher in wild type, while long lived contacts are lost at 337 K. The mutant forms less hydrogen bonds with water as compared to wild type at 337 K. In contrast to wild type, the mutant shows significant increase in unique saltbridges, hydrogen bonds and hydrophobic contacts at 337 K. The current study indicates that there is a strong inter-dependence of thermal stability on the way in which non-covalent interactions reorganize, and it is rewarding to explore this connection in single mutant studies.

Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

PubMed Central

Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

1997-01-01

We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

Calreticulin mutants in mice induce an MPL-dependent thrombocytosis with frequent progression to myelofibrosis.

PubMed

Marty, Caroline; Pecquet, Christian; Nivarthi, Harini; El-Khoury, Mira; Chachoua, Ilyas; Tulliez, Micheline; Villeval, Jean-Luc; Raslova, Hana; Kralovics, Robert; Constantinescu, Stefan N; Plo, Isabelle; Vainchenker, William

2016-03-10

Frameshift mutations in the calreticulin (CALR) gene are seen in about 30% of essential thrombocythemia and myelofibrosis patients. To address the contribution of the CALR mutants to the pathogenesis of myeloproliferative neoplasms, we engrafted lethally irradiated recipient mice with bone marrow cells transduced with retroviruses expressing these mutants. In contrast to wild-type CALR, CALRdel52 (type I) and, to a lesser extent, CALRins5 (type II) induced thrombocytosis due to a megakaryocyte (MK) hyperplasia. Disease was transplantable into secondary recipients. After 6 months, CALRdel52-, in contrast to rare CALRins5-, transduced mice developed a myelofibrosis associated with a splenomegaly and a marked osteosclerosis. Monitoring of virus-transduced populations indicated that CALRdel52 leads to expansion at earlier stages of hematopoiesis than CALRins5. However, both mutants still specifically amplified the MK lineage and platelet production. Moreover, a mutant deleted of the entire exon 9 (CALRdelex9) did not induce a disease, suggesting that the oncogenic property of CALR mutants was related to the new C-terminus peptide. To understand how the CALR mutants target the MK lineage, we used a cell-line model and demonstrated that the CALR mutants, but not CALRdelex9, specifically activate the thrombopoietin (TPO) receptor (MPL) to induce constitutive activation of Janus kinase 2 and signal transducer and activator of transcription 5/3/1. We confirmed in c-mpl- and tpo-deficient mice that expression of Mpl, but not of Tpo, was essential for the CALR mutants to induce thrombocytosis in vivo, although Tpo contributes to disease penetrance. Thus, CALR mutants are sufficient to induce thrombocytosis through MPL activation. © 2016 by The American Society of Hematology.

Structural distortions due to missense mutations in human formylglycine-generating enzyme leading to multiple sulfatase deficiency.

PubMed

Meshach Paul, D; Chadah, Tania; Senthilkumar, B; Sethumadhavan, Rao; Rajasekaran, R

2017-11-03

The major candidate for multiple sulfatase deficiency is a defective formylglycine-generating enzyme (FGE). Though adequately produced, mutations in FGE stall the activation of sulfatases and prevent their activity. Missense mutations, viz. E130D, S155P, A177P, W179S, C218Y, R224W, N259I, P266L, A279V, C336R, R345C, A348P, R349Q and R349W associated with multiple sulfatase deficiency are yet to be computationally studied. Aforementioned mutants were initially screened through ws-SNPs&GO 3D program. Mutant R345C acquired the highest score, and hence was studied in detail. Discrete molecular dynamics explored structural distortions due to amino acid substitution. Therein, comparative analyses of wild type and mutant were carried out. Changes in structural contours were observed between wild type and mutant. Mutant had low conformational fluctuation, high atomic mobility and more compactness than wild type. Moreover, free energy landscape showed mutant to vary in terms of its conformational space as compared to wild type. Subsequently, wild type and mutant were subjected to single-model analyses. Mutant had lesser intra molecular interactions than wild type suggesting variations pertaining to its secondary structure. Furthermore, simulated thermal denaturation showed dissimilar pattern of hydrogen bond dilution. Effects of these variations were observed as changes in elements of secondary structure. Docking studies of mutant revealed less favourable binding energy towards its substrate as compared to wild type. Therefore, theoretical explanations for structural distortions of mutant R345C leading to multiple sulfatase deficiency were revealed. The protocol of the study could be useful to examine the effectiveness of pharmacological chaperones prior to experimental studies.

Dissecting the Role of CHITINASE-LIKE1 in Nitrate-Dependent Changes in Root Architecture1[C][W

PubMed Central

Hermans, Christian; Porco, Silvana; Vandenbussche, Filip; Gille, Sascha; De Pessemier, Jérôme; Van Der Straeten, Dominique; Verbruggen, Nathalie; Bush, Daniel R.

2011-01-01

The root phenotype of an Arabidopsis (Arabidopsis thaliana) mutant of CHITINASE-LIKE1 (CTL1), called arm (for anion-related root morphology), was previously shown to be conditional on growth on high nitrate, chloride, or sucrose. Mutants grown under restrictive conditions displayed inhibition of primary root growth, radial swelling, proliferation of lateral roots, and increased root hair density. We found here that the spatial pattern of CTL1 expression was mainly in the root and root tips during seedling development and that the protein localized to the cell wall. Fourier-transform infrared microspectroscopy of mutant root tissues indicated differences in spectra assigned to linkages in cellulose and pectin. Indeed, root cell wall polymer composition analysis revealed that the arm mutant contained less crystalline cellulose and reduced methylesterification of pectins. We also explored the implication of growth regulators on the phenotype of the mutant response to the nitrate supply. Exogenous abscisic acid application inhibited more drastically primary root growth in the arm mutant but failed to repress lateral branching compared with the wild type. Cytokinin levels were higher in the arm root, but there were no changes in mitotic activity, suggesting that cytokinin is not directly involved in the mutant phenotype. Ethylene production was higher in arm but inversely proportional to the nitrate concentration in the medium. Interestingly, eto2 and eto3 ethylene overproduction mutants mimicked some of the conditional root characteristics of the arm mutant on high nitrate. Our data suggest that ethylene may be involved in the arm mutant phenotype, albeit indirectly, rather than functioning as a primary signal. PMID:21949212

Revealing Differences in Metabolic Flux Distributions between a Mutant Strain and Its Parent Strain Gluconacetobacter xylinus CGMCC 2955

PubMed Central

Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano

2014-01-01

A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455

Identification and Characterization of an Arabidopsis thaliana Mutant lbt With High Tolerance to Boron Deficiency

PubMed Central

Huai, Zexun; Peng, Lishun; Wang, Sheliang; Zhao, Hua; Shi, Lei; Xu, Fangsen

2018-01-01

Boron (B) is an essential micronutrient of plants. In the present study, we characterized an Arabidopsis mutant lbt with significant low-boron tolerance that was identified based on our previous mapping of QTL for B efficiency in Arabidopsis. Multiple nutrient-deficiency analyses point out that lbt mutant is insensitive to only B-limitation stress. Compared with wild-type Col-0, the fresh weight, leaf area, root length and root elongation rate of lbt mutant were significantly improved under B deficiency during vegetative growth. lbt mutant also showed the improvements in plant height, branches and inflorescences compared with Col-0 during the reproductive stage under B limitation. Ultrastructure analysis of the leaves showed that starch accumulation in lbt mutant was significantly diminished compared with Col-0. Furthermore, there were no significant differences in the expression of transporter-related genes and B concentrations between Col-0 and lbt mutant under both normal B and low-B conditions. These results suggest that lbt mutant has a lower B demand than Col-0. Genetic analysis suggests that the low-B tolerant phenotype of lbt mutant is under the control of a monogenic recessive gene. Based on the high-density SNP linkage genetic map, only one QTL for low-B tolerance was mapped on chromosome 4 between 10.4 and 14.8 Mb. No any reported B-relative genes exist in the QTL interval, suggesting that a gene with unknown function controls the tolerance of lbt to B limitation. Taken together, lbt is a low-B tolerant mutant that does not depend on the uptake or transport of B and is controlled by a monogenic recessive gene mapped on chromosome 4, and cloning and functional analysis of LBT gene are expected to reveal novel mechanisms for plant resistance to B deficiency.

Inactivation and deficiency of core proteins of photosystems I and II caused by genetical phylloquinone and plastoquinone deficiency but retained lamellar structure in a T-DNA mutant of Arabidopsis.

PubMed

Shimada, Hiroshi; Ohno, Ryoichi; Shibata, Masaru; Ikegami, Isamu; Onai, Kiyoshi; Ohto, Masa-aki; Takamiya, Ken-ichiro

2005-02-01

Phylloquinone, a substituted 1,4-naphthoquinone with an 18-carbon-saturated phytyl tail, functions as a bound one-electron carrier cofactor at the A1 site of photosystem I (PSI). A Feldmann tag line mutant, no. 2755 (designated as abc4 hereafter), showed pale-green young leaves and white old leaves. The mutated nuclear gene encoded 1,4-dihydroxy-2-naphtoic acid phytyltransferase, an enzyme of phylloquinone biosynthesis, and high-performance liquid chromatography analysis revealed that the abc4 mutant contained no phylloquinone, and only about 3% plastoquinone. Photooxidation of P700 of PSI in the abc4 mutant was not observed, and reduced-versus-oxidized difference spectroscopy indicated that the abc4 mutant had no P700. The maximum quantum yield of photosystem II (PSII) in the abc4 mutant was much decreased, and the electron transfer from PSII to PSI in the abc4 mutant did not occur. For the pale-green leaves of the abc4 mutant plant, the ultrastructure of the chloroplasts was almost the same as that of the wild-type plant. However, the chloroplasts in the albino leaves of the mutant were smaller and had a lot of grana thylakoids and few stroma thylakoids. The amounts of PSI and PSII core subunits in the abc4 mutant were significantly decreased compared with those in the wild type. These results suggested that a deficiency of phylloquinone in PSI caused the abolishment of PSI and a partial defect of PSII due to a significant decrease of plastoquinone, but did not influence the ultrastructure of the chloroplasts in young leaves.

Phosphorodiamidate morpholino oligomers suppress mutant huntingtin expression and attenuate neurotoxicity

PubMed Central

Sun, Xin; Marque, Leonard O.; Cordner, Zachary; Pruitt, Jennifer L.; Bhat, Manik; Li, Pan P.; Kannan, Geetha; Ladenheim, Ellen E.; Moran, Timothy H.; Margolis, Russell L.; Rudnicki, Dobrila D.

2014-01-01

Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene. Disease pathogenesis derives, at least in part, from the long polyglutamine tract encoded by mutant HTT. Therefore, considerable effort has been dedicated to the development of therapeutic strategies that significantly reduce the expression of the mutant HTT protein. Antisense oligonucleotides (ASOs) targeted to the CAG repeat region of HTT transcripts have been of particular interest due to their potential capacity to discriminate between normal and mutant HTT transcripts. Here, we focus on phosphorodiamidate morpholino oligomers (PMOs), ASOs that are especially stable, highly soluble and non-toxic. We designed three PMOs to selectively target expanded CAG repeat tracts (CTG22, CTG25 and CTG28), and two PMOs to selectively target sequences flanking the HTT CAG repeat (HTTex1a and HTTex1b). In HD patient–derived fibroblasts with expanded alleles containing 44, 77 or 109 CAG repeats, HTTex1a and HTTex1b were effective in suppressing the expression of mutant and non-mutant transcripts. CTGn PMOs also suppressed HTT expression, with the extent of suppression and the specificity for mutant transcripts dependent on the length of the targeted CAG repeat and on the CTG repeat length and concentration of the PMO. PMO CTG25 reduced HTT-induced cytotoxicity in vitro and suppressed mutant HTT expression in vivo in the N171-82Q transgenic mouse model. Finally, CTG28 reduced mutant HTT expression and improved the phenotype of HdhQ7/Q150 knock-in HD mice. These data demonstrate the potential of PMOs as an approach to suppressing the expression of mutant HTT. PMID:25035419

Gravity-dependent differentiation and root coils in Arabidopsis thaliana wild type and phospholipase-A-I knockdown mutant grown on the International Space Station.

PubMed

Scherer, G F E; Pietrzyk, P

2014-01-01

Arabidopsis roots on 45° tilted agar in 1-g grow in wave-like figures. In addition to waves, formation of root coils is observed in several mutants compromised in gravitropism and/or auxin transport. The knockdown mutant ppla-I-1 of patatin-related phospholipase-A-I is delayed in root gravitropism and forms increased numbers of root coils. Three known factors contribute to waving: circumnutation, gravisensing and negative thigmotropism. In microgravity, deprivation of wild type (WT) and mutant roots of gravisensing and thigmotropism and circumnutation (known to slow down in microgravity, and could potentially lead to fewer waves or increased coiling in both WT and mutant). To resolve this, mutant ppla-I-1 and WT were grown in the BIOLAB facility in the International Space Station. In 1-g, roots of both types only showed waving. In the first experiment in microgravity, the mutant after 9 days formed far more coils than in 1-g but the WT also formed several coils. After 24 days in microgravity, in both types the coils were numerous with slightly more in the mutant. In the second experiment, after 9 days in microgravity only the mutant formed coils and the WT grew arcuated roots. Cell file rotation (CFR) on the mutant root surface in microgravity decreased in comparison to WT, and thus was not important for coiling. Several additional developmental responses (hypocotyl elongation, lateral root formation, cotyledon expansion) were found to be gravity-influenced. We tentatively discuss these in the context of disturbances in auxin transport, which are known to decrease through lack of gravity. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

Characterization of CpSte11, a MAPKKK gene of Cryphonectria parasitica, and initial evidence of its involvement in the pheromone response pathway.

PubMed

Park, Jin-Ah; Kim, Jung-Mi; Park, Seung-Moon; Kim, Dae-Hyuk

2012-04-01

The gene CpSte11 of Cryphonectria parasitica, which encodes a yeast Ste11 homologue, was cloned and characterized. Gene replacement analysis revealed a high frequency of CpSte11 null mutants. When compared with the wild-type parent strain, CpSte11 null mutants showed no difference in terms of growth rate or pigmentation. However, CpSte11 null mutants showed a marked decrease in both the number and size of stromal pustules on chestnut twigs. The virulence test showed that, in comparison with those of the wild-type and virus-infected hypovirulent strains, CpSte11 null mutants produced necrotic areas of intermediate size. Disruption of the CpSte11 gene also resulted in defects in female fertility. Down-regulation of transcripts for the mating pheromone precursor gene, Mf2/2, and mating response transcription factors, such as cpst12 and pro1, was observed in CpSte11 null mutants. The down-regulation of Mf2/2, cpst12 and pro1 was also observed in the mutant phenotype of Cpmk2, a mating response Fus3-like mitogen-activated protein kinase (MAPK) gene, but not in the mutant of Cpmk1, a high-osmolarity glycerol Hog1-like MAPK gene. These results indicate that the cloned CpSte11 gene is functionally involved in the mating response pathway and acts through downstream targets, including Cpmk2, cpst12, pro1 and Mf2/2. However, the characteristics of the CpSte11 null mutant were fully phenocopied only in the cpst12 null mutant, but not in other studied null mutants of components of the putative mating response pathway. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

Phage-Encoded Colanic Acid-Degrading Enzyme Permits Lytic Phage Infection of a Capsule-Forming Resistant Mutant Escherichia coli Strain

PubMed Central

Kim, Min Soo; Kim, Young Deuk; Hong, Sung Sik; Park, Kwangseo; Ko, Kwan Soo

2014-01-01

In this study, we isolated a bacteriophage T7-resistant mutant strain of Escherichia coli (named S3) and then proceeded to characterize it. The mutant bacterial colonies appeared to be mucoid. Microarray analysis revealed that genes related to colanic acid production were upregulated in the mutant. Increases in colanic acid production by the mutant bacteria were observed when l-fucose was measured biochemically, and protective capsule formation was observed under an electron microscope. We found a point mutation in the lon gene promoter in S3, the mutant bacterium. Overproduction of colanic acid was observed in some phage-resistant mutant bacteria after infection with other bacteriophages, T4 and lambda. Colanic acid overproduction was also observed in clinical isolates of E. coli upon phage infection. The overproduction of colanic acid resulted in the inhibition of bacteriophage adsorption to the host. Biofilm formation initially decreased shortly after infection but eventually increased after 48 h of incubation due to the emergence of the mutant bacteria. Bacteriophage PBECO4 was shown to infect the colanic acid-overproducing mutant strains of E. coli. We confirmed that the gene product of open reading frame 547 (ORF547) of PBECO4 harbored colanic acid-degrading enzymatic (CAE) activity. Treatment of the T7-resistant bacteria with both T7 and PBECO4 or its purified enzyme (CAE) led to successful T7 infection. Biofilm formation decreased with the mixed infection, too. This procedure, using a phage cocktail different from those exploiting solely receptor differences, represents a novel strategy for overcoming phage resistance in mutant bacteria. PMID:25416767

Misfolded opsin mutants display elevated β -sheet structure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Lisa M.; Gragg, Megan; Kim, Tae Gyun

Mutations in rhodopsin can cause misfolding and aggregation of the receptor, which leads to retinitis pigmentosa, a progressive retinal degenerative disease. The structure adopted by misfolded opsin mutants and the associated cell toxicity is poorly understood. Förster resonance energy transfer (FRET) and Fourier transform infrared (FTIR) microspectroscopy were utilized to probe within cells the structures formed by G188R and P23H opsins, which are misfolding mutants that cause autosomal dominant retinitis pigmentosa. Also, both mutants formed aggregates in the endoplasmic reticulum and exhibited altered secondary structure with elevated β-sheet and reduced α-helical content. The newly formed β-sheet structure may facilitate themore » aggregation of misfolded opsin mutants. In conclusion, the effects observed for the mutants were unrelated to retention of opsin molecules in the endoplasmic reticulum itself.« less

Misfolded opsin mutants display elevated β -sheet structure

DOE PAGES

Miller, Lisa M.; Gragg, Megan; Kim, Tae Gyun; ...

2015-09-07

Mutations in rhodopsin can cause misfolding and aggregation of the receptor, which leads to retinitis pigmentosa, a progressive retinal degenerative disease. The structure adopted by misfolded opsin mutants and the associated cell toxicity is poorly understood. Förster resonance energy transfer (FRET) and Fourier transform infrared (FTIR) microspectroscopy were utilized to probe within cells the structures formed by G188R and P23H opsins, which are misfolding mutants that cause autosomal dominant retinitis pigmentosa. Also, both mutants formed aggregates in the endoplasmic reticulum and exhibited altered secondary structure with elevated β-sheet and reduced α-helical content. The newly formed β-sheet structure may facilitate themore » aggregation of misfolded opsin mutants. In conclusion, the effects observed for the mutants were unrelated to retention of opsin molecules in the endoplasmic reticulum itself.« less

Degradation of misfolded proteins by autophagy: is it a strategy for Huntington's disease treatment?

PubMed

Lin, Fang; Qin, Zheng-Hong

2013-01-01

Autophagy is a degradation pathway for long-lived cytoplasmic proteins, protein complexes, or damaged organelles. The accumulation and aggregation of misfolded proteins are hallmarks of several neurodegenerative diseases. Many researchers have reported that autophagy degrades disease-causing misfolded and aggregated proteins, including mutant huntingtin (Htt) in Huntington's disease, mutant synuclein in familial Parkingson's disease, mutant Cu, Zn-Superoxide dismutase (SOD1) in familial amyotrophic lateral sclerosis. In this review, we will bring up new evidence to elucidate the involvement of autophagy in degradation of mutant Htt, discuss the mechanisms regulating the degradation of mutant Htt by autophagy and the therapeutic effects of drugs that enhance autophagy to improve clearance of mutant Htt. We propose that enhancement of autophagy by drugs may be a strategy to treat or retard progression of Huntington's disease.

Highly ordered crystals of channel-forming membrane proteins, of nucleoside-monophosphate kinases, of FAD-containing oxidoreductases and of sugar-processing enzymes and their mutants

NASA Astrophysics Data System (ADS)

Schulz, G. E.; Dreyer, M.; Klein, C.; Kreusch, A.; Mittl, P.; Mu¨ller, C. W.; Mu¨ller-Dieckmann, J.; Muller, Y. A.; Proba, K.; Schlauderer, G.; Spu¨rgin, P.; Stehle, T.; Weiss, M. S.

1992-08-01

Preparation and crystallization procedures as well as crystal properties are reported for 12 proteins plus numerous site-directed mutants. The proteins are: the integral membrane protein porin from Rhodobacter capsulatus which diffracts to at least 1.8A˚resolution, porin from Rhodopseudomonas blastica which diffracts to at least 2.0A˚resolution, adenylate kinase from yeast and mutants, adenylate kinase from Escherichia coli and mutants, bovine liver mitochondrial adenylate kinase, guanylate kinase from yeast, uridylate kinase from yeast, glutathione reductase from E. coli and mutants, NADH peroxidase from Streptococcus faecalis containing a sulfenic acid as redox-center, pyruvate oxidase from Lactobacillus plantarum containing FAD and TPP, cyclodextrin glycosyltransferase from Bacillus circulans and mutants, and a fuculose aldolase from E. coli.

Replication of transformation-defective mutants of the Prague strain of Rous sarcoma virus and isolation of a td mutant from duck-adapted PR-RSV-C.

PubMed

Geryk, J; Mazo, A; Svoboda, J; Hlozánek, I

1980-01-01

The replication of transformation-defective mutants of the Prague strain of Rous sarcoma virus subgroup C was studied using roller cultures. Under such conditions, 10(5)--10(6) infectous units of virus per 0.2 ml were produced, as revealed in both the reverse transcriptase and 16Q complementation tests. A new td daPR-RSV-C mutant was isolated from duck-adapted PR-RSV-C. This mutant replicated in roller cultures with equal efficiency as the original td PR-RSV-C. It was verified that td daPR-RSV-C does not transform chicken fibroblasts, is not oncogenic for 3-week-old chickens and has subgroup C host-range specificity. Both td mutants replicate in duck cells and reach the same titres.

Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo

PubMed Central

Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

2016-01-01

Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting “oncogene addiction” could be a promising strategy for combatting p53 mutant tumors. PMID:27765910

Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo.

PubMed

Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

2016-11-22

Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting "oncogene addiction" could be a promising strategy for combatting p53 mutant tumors.

Inhibition of Shp2 suppresses mutant EGFR-induced lung tumors in transgenic mouse model of lung adenocarcinoma

PubMed Central

Schneeberger, Valentina E.; Ren, Yuan; Luetteke, Noreen; Huang, Qingling; Chen, Liwei; Lawrence, Harshani R.; Lawrence, Nicholas J.; Haura, Eric B.; Koomen, John M.; Coppola, Domenico; Wu, Jie

2015-01-01

Epidermal growth factor receptor (EGFR) mutants drive lung tumorigenesis and are targeted for therapy. However, resistance to EGFR inhibitors has been observed, in which the mutant EGFR remains active. Thus, it is important to uncover mediators of EGFR mutant-driven lung tumors to develop new treatment strategies. The protein tyrosine phosphatase (PTP) Shp2 mediates EGF signaling. Nevertheless, it is unclear if Shp2 is activated by oncogenic EGFR mutants in lung carcinoma or if inhibiting the Shp2 PTP activity can suppress EGFR mutant-induced lung adenocarcinoma. Here, we generated transgenic mice containing a doxycycline (Dox)-inducible PTP-defective Shp2 mutant (tetO-Shp2CSDA). Using the rat Clara cell secretory protein (CCSP)-rtTA-directed transgene expression in the type II lung pneumocytes of transgenic mice, we found that the Gab1-Shp2 pathway was activated by EGFRL858R in the lungs of transgenic mice. Consistently, the Gab1-Shp2 pathway was activated in human lung adenocarcinoma cells containing mutant EGFR. Importantly, Shp2CSDA inhibited EGFRL858R-induced lung adenocarcinoma in transgenic animals. Analysis of lung tissues showed that Shp2CSDA suppressed Gab1 tyrosine phosphorylation and Gab1-Shp2 association, suggesting that Shp2 modulates a positive feedback loop to regulate its own activity. These results show that inhibition of the Shp2 PTP activity impairs mutant EGFR signaling and suppresses EGFRL858R-driven lung adenocarcinoma. PMID:25730908

Circulation of Pneumocystis dihydropteroate synthase mutants in France.

PubMed

Le Gal, Solène; Damiani, Céline; Perrot, Maëla; Rouillé, Amélie; Virmaux, Michèle; Quinio, Dorothée; Moalic, Elodie; Saliou, Philippe; Berthou, Christian; Le Meur, Yann; Totet, Anne; Nevez, Gilles

2012-10-01

Data on the prevalence of Pneumocystis jirovecii (P. jirovecii) dihydropteroate synthase (DHPS) mutants in France are still limited. In this study, mutant prevalence in the Brest region (western France) was determined. Archival pulmonary specimens from 85 patients infected with P. jirovecii and admitted to our institution (University Hospital, Brest) from October 2007 to February 2010 were retrospectively typed at the DHPS locus using a polymerase chain reaction-restriction fragment length polymorphism assay. Type identification was successful in 66 of 85 patients. Sixty-four patients were infected with a wild type, whereas mutants were found in 2 patients (2/66, 3%). Medical chart analysis revealed that these 2 patients usually lived in Paris. Another patient usually lived on the French Riviera, whereas 63 patients were from the city of Brest. Thus, the corrected prevalence of mutants in patients who effectively lived in our geographic area was 0% (0/63). Taking into account that i) Paris is characterized by a high prevalence of mutants from 18.5% to 40%, ii) infection diagnoses were performed in the 2 Parisians during their vacation <30 days, iii) infection incubation is assumed to last about 2 months, the results provide evidence of mutant circulation from Paris to Brest through infected vacationers. The study shows that the usual city of patient residence, rather than the city of infection diagnosis, is a predictor of mutants and that P. jirovecii infections involving mutants do not represent a public health issue in western France. Copyright © 2012 Elsevier Inc. All rights reserved.

Molecular genetic analysis of plant gravitropism

NASA Technical Reports Server (NTRS)

Lomax, T. L.

1997-01-01

The analysis of mutants is a powerful approach for elucidating the components of complex biological processes. A growing number of mutants have been isolated which affect plant gravitropism and the classes of mutants found thus far provide important information about the gravity response mechanism. The wide variety of mutants isolated, especially in Arabidopsis, indicates that gravitropism is a complex, multi-step process. The existence of mutants altered in either root gravitropism alone, shoot gravitropism alone, or both indicates that the root and shoot gravitropic mechanisms have both separate and common steps. Reduced starch mutants have confirmed the role of amyloplasts in sensing the gravity signal. The hormone auxin is thought to act as the transducing signal between the sites of gravity perception (the starch parenchyma cells surrounding the vascular tissue in shoots and the columella cells of root caps) and asymmetric growth (the epidermal cells of the elongation zone(s) of each organ). To date, all mutants that are resistant to high concentrations of auxin have also been found to exhibit a reduced gravitropic response, thus supporting the role of auxin. Not all gravitropic mutants are auxin-resistant, however, indicating that there are additional steps which do not involve auxin. Studies with mutants of tomato which exhibit either reduced or reversed gravitropic responses further support the role of auxin redistribution in gravitropism and suggest that both red light and cytokinin interact with gravitropism through controlling lateral auxin transport. Plant responses to gravity thus likely involve changes in both auxin transport and sensitivity.

Mutation Detection with Next-Generation Resequencing through a Mediator Genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wurtzel, Omri; Dori-Bachash, Mally; Pietrokovski, Shmuel

2010-12-31

The affordability of next generation sequencing (NGS) is transforming the field of mutation analysis in bacteria. The genetic basis for phenotype alteration can be identified directly by sequencing the entire genome of the mutant and comparing it to the wild-type (WT) genome, thus identifying acquired mutations. A major limitation for this approach is the need for an a-priori sequenced reference genome for the WT organism, as the short reads of most current NGS approaches usually prohibit de-novo genome assembly. To overcome this limitation we propose a general framework that utilizes the genome of relative organisms as mediators for comparing WTmore » and mutant bacteria. Under this framework, both mutant and WT genomes are sequenced with NGS, and the short sequencing reads are mapped to the mediator genome. Variations between the mutant and the mediator that recur in the WT are ignored, thus pinpointing the differences between the mutant and the WT. To validate this approach we sequenced the genome of Bdellovibrio bacteriovorus 109J, an obligatory bacterial predator, and its prey-independent mutant, and compared both to the mediator species Bdellovibrio bacteriovorus HD100. Although the mutant and the mediator sequences differed in more than 28,000 nucleotide positions, our approach enabled pinpointing the single causative mutation. Experimental validation in 53 additional mutants further established the implicated gene. Our approach extends the applicability of NGS-based mutant analyses beyond the domain of available reference genomes.« less

Combinations of mutant FAD2 and FAD3 genes to produce high oleic acid and low linolenic acid soybean oil.

PubMed

Pham, Anh-Tung; Shannon, J Grover; Bilyeu, Kristin D

2012-08-01

High oleic acid soybeans were produced by combining mutant FAD2-1A and FAD2-1B genes. Despite having a high oleic acid content, the linolenic acid content of these soybeans was in the range of 4-6 %, which may be high enough to cause oxidative instability of the oil. Therefore, a study was conducted to incorporate one or two mutant FAD3 genes into the high oleic acid background to further reduce the linolenic acid content. As a result, soybean lines with high oleic acid and low linolenic acid (HOLL) content were produced using different sources of mutant FAD2-1A genes. While oleic acid content of these HOLL lines was stable across two testing environments, the reduction of linolenic acid content varied depending on the number of mutant FAD3 genes combined with mutant FAD2-1 genes, on the severity of mutation in the FAD2-1A gene, and on the testing environment. Combination of two mutant FAD2-1 genes and one mutant FAD3 gene resulted in less than 2 % linolenic acid content in Portageville, Missouri (MO) while four mutant genes were needed to achieve the same linolenic acid in Columbia, MO. This study generated non-transgenic soybeans with the highest oleic acid content and lowest linolenic acid content reported to date, offering a unique alternative to produce a fatty acid profile similar to olive oil.

A fixed-time diffusion analysis method determines that the three cheV genes of Helicobacter pylori differentially affect motility

PubMed Central

Lowenthal, Andrew C.; Simon, Christopher; Fair, Amber S.; Mehmood, Khalid; Terry, Karianne; Anastasia, Stephanie; Ottemann, Karen M.

2009-01-01

Helicobacter pylori is a chemotactic bacterium that has three CheV proteins in its predicted chemotaxis signal transduction system. CheV proteins contain both CheW- and response-regulator-like domains. To determine the function of these proteins, we developed a fixed-time diffusion method that would quantify bacterial direction change without needing to define particular behaviours, to deal with the many behaviours that swimming H. pylori exhibit. We then analysed mutants that had each cheV gene deleted individually and found that the behaviour of each mutant differed substantially from wild-type and the other mutants. cheV1 and cheV2 mutants displayed smooth swimming behaviour, consistent with decreased cellular CheY-P, similar to a cheW mutant. In contrast, the cheV3 mutation had the opposite effect and the mutant cells appeared to change direction frequently. Additional analysis showed that the cheV mutants displayed aberrant behaviour as compared to the wild-type in the soft-agar chemotaxis assay. The soft-agar assay phenotype was less extreme compared to that seen in the fixed-time diffusion model, suggesting that the cheV mutants are able to partially compensate for their defects under some conditions. Each cheV mutant furthermore had defects in mouse colonization that ranged from severe to modest, consistent with a role in chemotaxis. These studies thus show that the H. pylori CheV proteins each differently affect swimming behaviour. PMID:19332820

A cataract-causing connexin 50 mutant is mislocalized to the ER due to loss of the fourth transmembrane domain and cytoplasmic domain.

PubMed

Somaraju Chalasani, Madhavi Latha; Muppirala, Madhavi; G Ponnam, Surya Prakash; Kannabiran, Chitra; Swarup, Ghanshyam

2013-01-01

Mutations in the eye lens gap junction protein connexin 50 cause cataract. Earlier we identified a frameshift mutant of connexin 50 (c.670insA; p.Thr203AsnfsX47) in a family with autosomal recessive cataract. The mutant protein is smaller and contains 46 aberrant amino acids at the C-terminus after amino acid 202. Here, we have analysed this frameshift mutant and observed that it localized to the endoplasmic reticulum (ER) but not in the plasma membrane. Moreover, overexpression of the mutant resulted in disintegration of the ER-Golgi intermediate compartment (ERGIC), reduction in the level of ERGIC-53 protein and breakdown of the Golgi in many cells. Overexpression of the frameshift mutant partially inhibited the transport of wild type connexin 50 to the plasma membrane. A deletion mutant lacking the aberrant sequence showed predominant localization in the ER and inhibited anterograde protein transport suggesting, therefore, that the aberrant sequence is not responsible for improper localization of the frameshift mutant. Further deletion analysis showed that the fourth transmembrane domain and a membrane proximal region (231-294 amino acids) of the cytoplasmic domain are needed for transport from the ER and localization to the plasma membrane. Our results show that a frameshift mutant of connexin 50 mislocalizes to the ER and causes disintegration of the ERGIC and Golgi. We have also identified a sequence of connexin 50 crucial for transport from the ER and localization to the plasma membrane.

Cellular Plasticity and Heterogeneity of EGFR Mutant Lung Cancer

DTIC Science & Technology

2015-09-01

AWARD NUMBER: W81XWH-14-1-0177 TITLE: Cellular Plasticity and Heterogeneity of EGFR Mutant Lung Cancer PRINCIPAL INVESTIGATOR: Katerina Politi...CONTRACT NUMBER Cellular Plasticity and Heterogeneity of EGFR Mutant Lung Cancer 5b. GRANT NUMBER W81XWH-14-1-0177 5c. PROGRAM ELEMENT NUMBER 6...Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Phenotypic changes have been observed in EGFR mutant lung cancers that become resistant to targeted

NRAS-mutant melanoma: current challenges and future prospect

PubMed Central

Muñoz-Couselo, Eva; Adelantado, Ester Zamora; Ortiz, Carolina; García, Jesús Soberino; Perez-Garcia, José

2017-01-01

Melanoma is one of the most common cutaneous cancers worldwide. Activating mutations in RAS oncogenes are found in a third of all human cancers and NRAS mutations are found in 15%–20% of melanomas. The NRAS-mutant subset of melanoma is more aggressive and associated with poorer outcomes, compared to non-NRAS-mutant melanoma. Although immune checkpoint inhibitors and targeted therapies for BRAF-mutant melanoma are transforming the treatment of metastatic melanoma, the ideal treatment for NRAS-mutant melanoma remains unknown. Despite promising preclinical data, current therapies for NRAS-mutant melanoma remain limited, showing a modest increase in progression-free survival but without any benefit in overall survival. Combining MEK inhibitors with agents inhibiting cell cycling and the PI3K–AKT pathway appears to provide additional benefit; in particular, a strategy of MEK inhibition and CDK4/6 inhibition is likely to be a viable treatment option in the future. Patients whose tumors had NRAS mutations had better response to immunotherapy and better outcomes than patients whose tumors had other genetic subtypes, suggesting that immune therapies – especially immune checkpoint inhibitors – may be particularly effective as treatment options for NRAS-mutant melanoma. Improved understanding of NRAS-mutant melanoma will be essential to develop new treatment strategies for this subset of patients with melanoma. PMID:28860801

Phenotypic characterization of spontaneously mutated rats showing lethal dwarfism and epilepsy.

PubMed

Suzuki, Hiroetsu; Takenaka, Motoo; Suzuki, Katsushi

2007-08-01

We have characterized the phenotype of spontaneously mutated rats, found during experimental inbreeding in a closed colony of Wistar Imamichi rats. Mutant rats showed severe dwarfism, short lifespan (early postnatal lethality), and high incidence of epileptic seizures. Mutant rats showed growth retardation after 3 d of age, and at 21 d their weight was about 56% that of normal rats. Most mutant rats died without reaching maturity, and 95% of the mutant rats had an ataxic gait. About 34% of the dwarf rats experienced epileptic seizures, most of which started as 'wild running' convulsions, progressing to generalized tonic-clonic convulsions. At age 28 d, the relative weight of the testes was significantly lower, and the relative weight of the brain was significantly higher, in mutant than in normal rats. Histologically, increased apoptotic germ cells, lack of spermatocytes, and immature Leydig cells were found in the mutant testes, and extracellular vacuoles of various sizes were present in the hippocampus and amygdala of the mutant brain. Mutant rats had significantly increased concentrations of plasma urea nitrogen, creatinine, and inorganic phosphate, as well as decreased concentrations of plasma growth hormone. Hereditary analysis showed that the defects were inherited as a single recessive trait. We have named the hypothetically mutated gene as lde (lethal dwarfism with epilepsy).

Secondary Metabolism and Interspecific Competition Affect Accumulation of Spontaneous Mutants in the GacS-GacA Regulatory System in Pseudomonas protegens

PubMed Central

Yan, Qing; Lopes, Lucas D.; Shaffer, Brenda T.; Kidarsa, Teresa A.; Vining, Oliver; Philmus, Benjamin; Song, Chunxu; Stockwell, Virginia O.; Raaijmakers, Jos M.; McPhail, Kerry L.; Andreote, Fernando D.; Chang, Jeff H.

2018-01-01

ABSTRACT Secondary metabolites are synthesized by many microorganisms and provide a fitness benefit in the presence of competitors and predators. Secondary metabolism also can be costly, as it shunts energy and intermediates from primary metabolism. In Pseudomonas spp., secondary metabolism is controlled by the GacS-GacA global regulatory system. Intriguingly, spontaneous mutations in gacS or gacA (Gac− mutants) are commonly observed in laboratory cultures. Here we investigated the role of secondary metabolism in the accumulation of Gac− mutants in Pseudomonas protegens strain Pf-5. Our results showed that secondary metabolism, specifically biosynthesis of the antimicrobial compound pyoluteorin, contributes significantly to the accumulation of Gac− mutants. Pyoluteorin biosynthesis, which poses a metabolic burden on the producer cells, but not pyoluteorin itself, leads to the accumulation of the spontaneous mutants. Interspecific competition also influenced the accumulation of the Gac− mutants: a reduced proportion of Gac− mutants accumulated when P. protegens Pf-5 was cocultured with Bacillus subtilis than in pure cultures of strain Pf-5. Overall, our study associated a fitness trade-off with secondary metabolism, with metabolic costs versus competitive benefits of production influencing the evolution of P. protegens, assessed by the accumulation of Gac− mutants. PMID:29339425

An efficient screen for peroxisome-deficient mutants of Pichia pastoris.

PubMed Central

Liu, H; Tan, X; Veenhuis, M; McCollum, D; Cregg, J M

1992-01-01

We describe a rapid and efficient screen for peroxisome-deficient (per) mutants in the yeast Pichia pastoris. The screen relies on the unusual ability of P. pastoris to grow on two carbon sources, methanol and oleic acid, both of which absolutely require peroxisomes to be metabolized. A collection of 280 methanol utilization-defective (Mut-) P. pastoris mutants was isolated, organized into 46 complementation groups, and tested for those that were also oleate-utilization defective (Out-) but still capable of growth on ethanol and glucose. Mutants in 10 groups met this phenotypic description, and 8 of these were observed by electron microscopy to be peroxisome deficient (Per-). In each per mutant, Mut-, Out-, and Per- phenotypes were tightly linked and therefore were most likely due to a mutation at a single locus. Subcellular fractionation experiments indicated that the peroxisomal marker enzyme catalase was mislocalized to the cytosol in both methanol- and oleate-induced cultures of the mutants. In contrast, alcohol oxidase, a peroxisomal methanol utilization pathway enzyme, was virtually absent from per mutant cells. The relative ease of per mutant isolation in P. pastoris, in conjunction with well-developed procedures for its molecular and genetic manipulation, makes this organism an attractive system for studies on peroxisome biogenesis. Images PMID:1629154

Genetic control of enhanced mutability of mitochondrial DNA and gamma-ray sensitivity in Saccharomyces cerevisiae.

PubMed Central

Foury, F; Goffeau, A

1979-01-01

Five nuclear mutants enhancing the spontaneous mutation rate of mtDNA have been isolated in Saccharomyces cerevisiae. These mutators fall into five complementation groups and are located at five genetic loci different from rad50 to rad57 loci. Three mutants (gam1, gam2, and gam4), insensitive or weakly sensitive to gamma-rays, exhibit increased frequency of spontaneous production of mutants with large deletions of the mtDNA (p-) and of all tested mitochondrial drug-resistant mutants. Two other mutants (gam3 and gam5), highly sensitive to gamma-rays, increase only the mutation rate of particular alleles of the mtDNA. The mutant gam5 enhances only the production of p- and erythromycin-resistant clones. The mutant gam3 exhibits an enhanced rate of oligomycin-resistant clones as well as a collateral increase of nuclear mutability. The existence of gam3 and gam5 mutants indicates that at least two common steps control both nuclear DNA repair and the mutability of particular alleles of the mtDNA. However, the general spontaneous mutability of the mtDNA includes at least three steps not involved in the repair of nuclear DNA, as revealed by the gam1, gam2, and gam4 mutations. PMID:392521

Gamma ray-induced small plaque mutants of western equine encephalitis virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simizu, B.; Yamazaki, S.; Suzuki, K.

1973-12-01

Small plaque mutants of Western equine encephalitis virus were obtained from the surviving fractions of wild-type virus which was irradiated with gamma rays. The frequency with which small plaque mutants appeared in the surviving fraction increased with the radiation dose. These mutants were not more resistant to radiation than wild-type virus. The growth rate of a mutant, S127, was lower than that of wild-type. Clonally purified mutant virions presented two peaks in a velocity sedimentation profile; peak 1 corresponded to the peak of wild type and peak 2 moved faster than peak 1. Virions of both peaks were infectious andmore » consistently formed small plaques in chicken embryo cells. Virions reisolated from either peak and grown in chicken embryo cells also revealed two peaks in sedimentation analysis. In the electron microscope examination peak 2 proved to consist of giant form particles, each of which contained more than one nucleoid surrounded with a common envelope. Despite this remarkable morphological difference, densities of the wild-type and S127 mutant virions were similar in cesium chloride gradients. The RNAs and proteins of mutant virions could not be distinguished from those of wild types on the basis of size or change. (auth)« less

Polyamines and Flower Development in the Male Sterile Stamenless-2 Mutant of Tomato (Lycopersicon esculentum Mill.) 1

PubMed Central

Rastogi, Rajeev; Sawhney, Vipen K.

1990-01-01

The floral organs of the male sterile stamenless-2 (sl-2/sl-2) mutant of tomato (Lycopersicon esculentum Mill.) contain significantly higher level of polyamines than those of the normal (R Rastogi, VK Sawhney [1990] Plant Physiol 93: 439-445). The effects of putrescine, spermidine and spermine, and three different inhibitors of polyamine biosynthesis on the in vitro development of floral buds of the normal and sl-2/sl-2 mutant were studied. The polyamines were inhibitory to the in vitro growth and development of both the normal and mutant floral buds and they induced abnormal stamen development in normal flowers. The inhibitors of polyamine biosynthesis also inhibited the growth and development of floral organs of the two genotypes, but the normal flowers showed greater sensitivity than the mutant. The inhibitors also promoted the formation of normal-looking pollen in stamens of some mutant flowers. The effect of the inhibitors on polyamine levels was not determined. The polyamine-induced abnormal stamen development in the normal, and the inhibitor-induced production of normal-looking pollen in mutant flowers support the suggestion that the elevated polyamine levels contribute to abnormal stamen development in the sl-2/sl-2 mutant of tomato. Images Figure 3 Figure 5 PMID:16667486

The Yersiniabactin Transport System Is Critical for the Pathogenesis of Bubonic and Pneumonic Plague▿

PubMed Central

Fetherston, Jacqueline D.; Kirillina, Olga; Bobrov, Alexander G.; Paulley, James T.; Perry, Robert D.

2010-01-01

Iron acquisition from the host is an important step in the pathogenic process. While Yersinia pestis has multiple iron transporters, the yersiniabactin (Ybt) siderophore-dependent system plays a major role in iron acquisition in vitro and in vivo. In this study, we determined that the Ybt system is required for the use of iron bound by transferrin and lactoferrin and examined the importance of the Ybt system for virulence in mouse models of bubonic and pneumonic plague. Y. pestis mutants unable to either transport Ybt or synthesize the siderophore were both essentially avirulent via subcutaneous injection (bubonic plague model). Surprisingly, via intranasal instillation (pneumonic plague model), we saw a difference in the virulence of Ybt biosynthetic and transport mutants. Ybt biosynthetic mutants displayed an ∼24-fold-higher 50% lethal dose (LD50) than transport mutants. In contrast, under iron-restricted conditions in vitro, a Ybt transport mutant had a more severe growth defect than the Ybt biosynthetic mutant. Finally, a Δpgm mutant had a greater loss of virulence than the Ybt biosynthetic mutant, indicating that the 102-kb pgm locus encodes a virulence factor, in addition to Ybt, that plays a role in the pathogenesis of pneumonic plague. PMID:20160020

RNA-Seq analysis of global transcriptomic changes suggests a roles for the MAPK pathway and carbon metabolism in cell wall maintenance in a Saccharomyces cerevisiae FKS1 mutant.

PubMed

Huang, Cong; Zhao, Fengguang; Lin, Ying; Zheng, Suiping; Liang, Shuli; Han, Shuangyan

2018-06-07

FKS1 encodes a β-1,3-glucan synthase, which is a key player in cell wall assembly in Saccharomyces cerevisiae. Here we analyzed the global transcriptomic changes in the FKS1 mutant to establish a correlation between the changes in the cell wall of the FKS1 mutant and the molecular mechanism of cell wall maintenance. These transcriptomic profiles showed that there are 1151 differentially expressed genes (DEGs) in the FKS1 mutant. Through KEGG pathway analysis of the DEGs, the MAPK pathway and seven pathways involved in carbon metabolism were significantly enriched. We found that the MAPK pathway is activated for FKS1 mutant survival and the synthesis of cell wall components are reinforced in the FKS1 mutant. Our results confirm that the FKS1 mutant has a β-1,3-glucan defect that affects the cell wall and partly elucidate the molecular mechanism responsible for cell wall synthesis. Our greater understanding of these mechanisms helps to explain how the FKS1 mutant survives, has useful implications for the study of similar pathways in other fungi, and increases the theoretical foundation for the regulation of the cell wall in S. cerevisiae. Copyright © 2018 Elsevier Inc. All rights reserved.

Isolation and characterization of Candida albicans morphological mutants derepressed for the formation of filamentous hypha-type structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gil, C.; Pomes, R.; Nombela, C.

1990-05-01

Several Candida albicans morphological mutants were obtained by a procedure based on a combined treatment with nitrous acid plus UV irradiation and a double-enrichment step to increase the proportion of mutants growing as long filamentous structures. Altered cell morphogenesis in these mutants correlated with an altered colonial phenotype. Two of these mutants, C. albicans NEL102 and NEL103, were selected and characterized. Mutant blastoconidia initiated budding but eventually gave rise to filamentous hypha-type formations. These filaments were long and septate, and they branched very regularly at positions near septa. Calcofluor white (which is known to bind chitin-rich areas) stained septa, branchingmore » zones, and filament tips very intensely, as observed under the fluorescence microscope. Wild-type hybrids were obtained by fusing protoplasts of strain NEL102 with B14, another morphological mutant previously described as being permanently pseudomycelial, indicating that genetic determinants responsible for the two altered phenotypes are different. The mutants characterized in this work seemed to sequentially express the morphogenic characteristics of C. albicans, from blastoconidia to hyphae, in the absence of any inducer. Further characterization of these strains could be relevant to gain understanding of the genetic control of dimorphism in this species.« less

Endocochlear potential generation is associated with intercellular communication in the stria vascularis: structural analysis in the viable dominant spotting mouse mutant.

PubMed

Carlisle, L; Steel, K; Forge, A

1990-11-01

Deafness in the viable dominant spotting mouse mutant is due to a primary defect of the stria vascularis which results in absence of the positive endocochlear potential in scala media. Endocochlear potentials were measured and the structure of stria vascularis of mutants with potentials close to zero was compared with that in normal littermate controls by use of morphometric methods. The stria vascularis was significantly thinner in mutants. Marginal cells were not significantly different from controls in terms of volume density or intramembrane particle density but the network density of tight junctions was significantly reduced in the mutants. A virtual absence of gap junctions between basal cells and marginal or intermediate cells was observed, but intramembrane particle density and junctional complexes between adjacent basal cells were not different from controls. The volume density of basal cells was significantly greater in mutants. Intermediate cells accounted for a significantly smaller volume density of the stria vascularis in mutants and had a lower density of intramembrane particles than controls. Melanocytes were not identified in the stria vascularis of mutants. These results suggest that communication between marginal, intermediate and basal cells might be important to the normal function of the stria vascularis.

Construction of Signature-tagged Mutant Library in Mesorhizobium loti as a Powerful Tool for Functional Genomics

PubMed Central

Shimoda, Yoshikazu; Mitsui, Hisayuki; Kamimatsuse, Hiroko; Minamisawa, Kiwamu; Nishiyama, Eri; Ohtsubo, Yoshiyuki; Nagata, Yuji; Tsuda, Masataka; Shinpo, Sayaka; Watanabe, Akiko; Kohara, Mitsuyo; Yamada, Manabu; Nakamura, Yasukazu; Tabata, Satoshi; Sato, Shusei

2008-01-01

Rhizobia are nitrogen-fixing soil bacteria that establish endosymbiosis with some leguminous plants. The completion of several rhizobial genome sequences provides opportunities for genome-wide functional studies of the physiological roles of many rhizobial genes. In order to carry out genome-wide phenotypic screenings, we have constructed a large mutant library of the nitrogen-fixing symbiotic bacterium, Mesorhizobium loti, by transposon mutagenesis. Transposon insertion mutants were generated using the signature-tagged mutagenesis (STM) technique and a total of 29 330 independent mutants were obtained. Along with the collection of transposon mutants, we have determined the transposon insertion sites for 7892 clones, and confirmed insertions in 3680 non-redundant M. loti genes (50.5% of the total number of M. loti genes). Transposon insertions were randomly distributed throughout the M. loti genome without any bias toward G+C contents of insertion target sites and transposon plasmids used for the mutagenesis. We also show the utility of STM mutants by examining the specificity of signature tags and test screenings for growth- and nodulation-deficient mutants. This defined mutant library allows for genome-wide forward- and reverse-genetic functional studies of M. loti and will serve as an invaluable resource for researchers to further our understanding of rhizobial biology. PMID:18658183

Methods of producing protoporphyrin IX and bacterial mutants therefor

DOEpatents

Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming

2016-03-01

The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.

Early nodule senescence is activated in symbiotic mutants of pea (Pisum sativum L.) forming ineffective nodules blocked at different nodule developmental stages.

PubMed

Serova, Tatiana A; Tsyganova, Anna V; Tsyganov, Viktor E

2018-04-03

Plant symbiotic mutants are useful tool to uncover the molecular-genetic mechanisms of nodule senescence. The pea (Pisum sativum L.) mutants SGEFix - -1 (sym40), SGEFix - -3 (sym26), and SGEFix - -7 (sym27) display an early nodule senescence phenotype, whereas the mutant SGEFix - -2 (sym33) does not show premature degradation of symbiotic structures, but its nodules show an enhanced immune response. The nodules of these mutants were compared with each other and with those of the wild-type SGE line using seven marker genes that are known to be activated during nodule senescence. In wild-type SGE nodules, transcript levels of all of the senescence-associated genes were highest at 6 weeks after inoculation (WAI). The senescence-associated genes showed higher transcript abundance in mutant nodules than in wild-type nodules at 2 WAI and attained maximum levels in the mutant nodules at 4 WAI. Immunolocalization analyses showed that the ethylene precursor 1-aminocyclopropane-1-carboxylate accumulated earlier in the mutant nodules than in wild-type nodules. Together, these results showed that nodule senescence was activated in ineffective nodules blocked at different developmental stages in pea lines that harbor mutations in four symbiotic genes.

Starvation induced cell death in autophagy-defective yeast mutants is caused by mitochondria dysfunction.

PubMed

Suzuki, Sho W; Onodera, Jun; Ohsumi, Yoshinori

2011-02-25

Autophagy is a highly-conserved cellular degradation and recycling system that is essential for cell survival during nutrient starvation. The loss of viability had been used as an initial screen to identify autophagy-defective (atg) mutants of the yeast Saccharomyces cerevisiae, but the mechanism of cell death in these mutants has remained unclear. When cells grown in a rich medium were transferred to a synthetic nitrogen starvation media, secreted metabolites lowered the extracellular pH below 3.0 and autophagy-defective mutants mostly died. We found that buffering of the starvation medium dramatically restored the viability of atg mutants. In response to starvation, wild-type (WT) cells were able to upregulate components of the respiratory pathway and ROS (reactive oxygen species) scavenging enzymes, but atg mutants lacked this synthetic capacity. Consequently, autophagy-defective mutants accumulated the high level of ROS, leading to deficient respiratory function, resulting in the loss of mitochondria DNA (mtDNA). We also showed that mtDNA deficient cells are subject to cell death under low pH starvation conditions. Taken together, under starvation conditions non-selective autophagy, rather than mitophagy, plays an essential role in preventing ROS accumulation, and thus in maintaining mitochondria function. The failure of response to starvation is the major cause of cell death in atg mutants.

Oncolytic reovirus preferentially induces apoptosis in KRAS mutant colorectal cancer cells, and synergizes with irinotecan

PubMed Central

Maitra, Radhashree; Seetharam, Raviraja; Tesfa, Lydia; Augustine, Titto A.; Klampfer, Lidija; Coffey, Matthew C.; Mariadason, John M.; Goel, Sanjay

2014-01-01

Reovirus is a double stranded RNA virus, with an intrinsic preference for replication in KRAS mutant cells. As 45% of human colorectal cancers (CRC) harbor KRAS mutations, we sought to investigate its efficacy in KRAS mutant CRC cells, and examine its impact in combination with the topoisimerase-1 inhibitor, irinotecan. Reovirus efficacy was examined in the KRAS mutant HCT116, and the isogenic KRAS WT Hke3 cell line, and in the non-malignant rat intestinal epithelial cell line. Apoptosis was determined by flow cytometry and TUNEL staining. Combination treatment with reovirus and irintoecan was investigated in 15 CRC cell lines, including the HCT116 p21 isogenic cell lines. Reovirus preferentially induced apoptosis in KRAS mutant HCT116 cells compared to its isogenic KRAS WT derivative, and in KRAS mutant IEC cells. Reovirus showed a greater degree of caspase 3 activation with PARP 1 cleavage, and preferential inhibition of p21 protein expression in KRAS mutant cells. Reovirus synergistically induced growth inhibition when combined with irinotecan. This synergy was lost upon p21 gene knock out. Reovirus preferentially induces apoptosis in KRAS mutant colon cancer cells. Reovirus and irinotecan combination therapy is synergistic, p21 mediated, and represents a novel potential treatment for patients with CRC. PMID:24798549

Aggressive behavior of the white-eye mutant crickets, Gryllus bimaculatus.

PubMed

Sakura, Midori; Watanabe, T; Aonuma, H

2012-01-01

Aggressive behavior of white-eye mutant crickets was investigated and compared with that of wild-type crickets. In the dark, wild-type pairs performed long-lasting fights with significantly higher aggressive levels compared to those in the light. In contrast, fights between two white-eye mutants were not significantly different with those between two wild-type crickets both in duration and the aggressive levels. Ethograms of aggressive behavior showed that the mutants could show typical sequentially escalating fight with the same behavioral categories as the wild-type crickets. These results indicate that the white-eye mutants are able to express normal aggressive behavior.

Genetic and Functional Studies of Genes That Regulate DNA-Damage-Induced Cell Death

DTIC Science & Technology

2005-11-01

SiRNA-resistant (silent) mutants of wild-type BACH1 and BACH1 BRCT-binding mutants (T989A, S990A , or F993A) were created by substituting four...induced G2/M checkpoint assay. First, we constructed Thr989-to-Ala (T989A), Ser990-to-Ala ( S990A ), or Phe993-to-Ala mutants of BACH1. BACH1 siRNA...expressed in HeLa cells. However, only wild-type BACH1 and the T989A mutant, but not the S990A or F993A mutant, were associated with BRCA1 (Fig. 3A

Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation.

PubMed

Toyama, H; Anthony, C; Lidstrom, M E

1998-09-01

Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.

Respiratory-deficient mutants of the unicellular green alga Chlamydomonas: a review.

PubMed

Salinas, Thalia; Larosa, Véronique; Cardol, Pierre; Maréchal-Drouard, Laurence; Remacle, Claire

2014-05-01

Genetic manipulation of the unicellular green alga Chlamydomonas reinhardtii is straightforward. Nuclear genes can be interrupted by insertional mutagenesis or targeted by RNA interference whereas random or site-directed mutagenesis allows the introduction of mutations in the mitochondrial genome. This, combined with a screen that easily allows discriminating respiratory-deficient mutants, makes Chlamydomonas a model system of choice to study mitochondria biology in photosynthetic organisms. Since the first description of Chlamydomonas respiratory-deficient mutants in 1977 by random mutagenesis, many other mutants affected in mitochondrial components have been characterized. These respiratory-deficient mutants increased our knowledge on function and assembly of the respiratory enzyme complexes. More recently some of these mutants allowed the study of mitochondrial gene expression processes poorly understood in Chlamydomonas. In this review, we update the data concerning the respiratory components with a special focus on the assembly factors identified on other organisms. In addition, we make an inventory of different mitochondrial respiratory mutants that are inactivated either on mitochondrial or nuclear genes. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Evolution and clinical impact of co-occurring genetic alterations in advanced-stage EGFR-mutant lung cancers

PubMed Central

Blakely, Collin M.; Watkins, Thomas B.K.; Wu, Wei; Gini, Beatrice; Chabon, Jacob J.; McCoach, Caroline E.; McGranahan, Nicholas; Wilson, Gareth A.; Birkbak, Nicolai J.; Olivas, Victor R.; Rotow, Julia; Maynard, Ashley; Wang, Victoria; Gubens, Matthew A.; Banks, Kimberly C.; Lanman, Richard B.; Caulin, Aleah F.; John, John St.; Cordero, Anibal R.; Giannikopoulos, Petros; Simmons, Andrew D.; Mack, Philip C.; Gandara, David R.; Husain, Hatim; Doebele, Robert C.; Riess, Jonathan W.; Diehn, Maximilian; Swanton, Charles; Bivona, Trever G.

2017-01-01

A widespread approach to modern cancer therapy is to identify a single oncogenic driver gene and target its mutant protein product (e.g. EGFR inhibitor treatment in EGFR-mutant lung cancers). However, genetically-driven resistance to targeted therapy limits patient survival. Through genomic analysis of 1122 EGFR-mutant lung cancer cell-free DNA samples and whole exome analysis of seven longitudinally collected tumor samples from an EGFR-mutant lung cancer patient, we identify critical co-occurring oncogenic events present in most advanced-stage EGFR-mutant lung cancers. We define new pathways limiting EGFR inhibitor response, including WNT/β-catenin and cell cycle gene (e.g. CDK4, CDK6) alterations. Tumor genomic complexity increases with EGFR inhibitor treatment and co-occurring alterations in CTNNB1, and PIK3CA exhibit non-redundant functions that cooperatively promote tumor metastasis or limit EGFR inhibitor response. This study challenges the prevailing single-gene driver oncogene view and links clinical outcomes to co-occurring genetic alterations in advanced-stage EGFR-mutant lung cancer patients. PMID:29106415

Bending patterns of chlamydomonas flagella: III. A radial spoke head deficient mutant and a central pair deficient mutant.

PubMed

Brokaw, C J; Luck, D J

1985-01-01

Flash photomicrography at frequencies up to 300 Hz and computer-assisted image analysis have been used to obtain parameters describing the flagellar bending patterns of mutants of Chlamydomonas reinhardtii. All strains contained the uni1 mutation, to facilitate photography. The radial spoke head deficient mutant pf17, and the central pair deficient mutant, pf15, in combination with suppressor mutations that restore motility without restoring the ultrastructural or biochemical deficiencies, both generate forward mode bending patterns with increased shear amplitude and decreased asymmetry relative to the "wild-type" uni1 flagella described previously. In the reverse beating mode, the suppressed pf17 mutants generate reverse bending patterns with large shear amplitudes. Reverse beating of the suppressed pf15 mutants is rare. There is a reciprocal relationship between increased shear amplitude and decreased beat frequency, so that the velocity of sliding between flagellar microtubules is not increased by an increase in shear amplitude. The suppressor mutations alone cause decreased frequency and sliding velocity in both forward and reverse mode beating, with little change in shear amplitude or symmetry.

Genetically engineered mutant of the cyanobacterium Synechocystis 6803 lacks the photosystem II chlorophyll-binding protein CP-47

PubMed Central

Vermaas, Wim F. J.; Williams, John G. K.; Rutherford, A. William; Mathis, Paul; Arntzen, Charles J.

1986-01-01

CP-47 is absent in a genetically engineered mutant of cyanobacterium Synechocystis 6803, in which the psbB gene [encoding the chlorophyll-binding photosystem II (PSII) protein CP-47] was interrupted. Another chlorophyll-binding PSII protein, CP-43, is present in the mutant, and functionally inactive PSII-enriched particles can be isolated from mutant thylakoids. We interpret these data as indicating that the PSII core complex of the mutant still assembles in the absence of CP-47. The mutant lacks a 77 K fluorescence emission maximum at 695 nm, suggesting that the PSII reaction center is not functional. The absence of primary photochemistry was indicated by EPR and optical measurements: no chlorophyll triplet originating from charge recombination between P680+ and Pheo- was observed in the mutant, and there were no flash-induced absorption changes at 820 nm attributable to chlorophyll P680 oxidation. These observations lead us to conclude that CP-47 plays an essential role in the activity of the PSII reaction center. Images PMID:16593788

Induction of mutations by bismuth-212 alpha particles at two genetic loci in human B-lymphoblasts.

PubMed

Metting, N F; Palayoor, S T; Macklis, R M; Atcher, R W; Liber, H L; Little, J B

1992-12-01

The human lymphoblast cell line TK6 was exposed to the alpha-particle-emitting radon daughter 212Bi by adding DTPA-chelated 212Bi directly to the cell suspension. Cytotoxicity and mutagenicity at two genetic loci were measured, and the molecular nature of mutant clones was studied by Southern blot analysis. Induced mutant fractions were 2.5 x 10(-5)/Gy at the hprt locus and 3.75 x 10(-5)/Gy at the tk locus. Molecular analysis of HPRT- mutant DNAs showed a high frequency (69%) of clones with partial or full deletions of the hprt gene among radiation-induced mutants compared with spontaneous mutants (31%). Chi-squared analyses of mutational spectra show a significant difference (P < or = 0.005) between spontaneous mutants and alpha-particle-induced mutants. Comparison with published studies of accelerator-produced heavy-ion exposures of TK6 cells indicates that the induction of mutations at the hprt locus, and perhaps a subset of mutations at the tk locus, is a simple linear function of particle fluence regardless of the ion species or its LET.

Identification of a negative regulatory region for the exchange activity and characterization of T332I mutant of Rho guanine nucleotide exchange factor 10 (ARHGEF10).

PubMed

Chaya, Taro; Shibata, Satoshi; Tokuhara, Yasunori; Yamaguchi, Wataru; Matsumoto, Hiroshi; Kawahara, Ichiro; Kogo, Mikihiko; Ohoka, Yoshiharu; Inagaki, Shinobu

2011-08-26

The T332I mutation in Rho guanine nucleotide exchange factor 10 (ARHGEF10) was previously found in persons with slowed nerve conduction velocities and thin myelination of peripheral nerves. However, the molecular and cellular basis of the T332I mutant is not understood. Here, we show that ARHGEF10 has a negative regulatory region in the N terminus, in which residue 332 is located, and the T332I mutant is constitutively active. An N-terminal truncated ARHGEF10 mutant, ARHGEF10 ΔN (lacking amino acids 1-332), induced cell contraction that was inhibited by a Rho kinase inhibitor Y27632 and had higher GEF activity for RhoA than the wild type. The T332I mutant also showed the phenotype similar to the N-terminal truncated mutant. These data suggest that the ARHGEF10 T332I mutation-associated phenotype observed in the peripheral nerves is due to activated GEF activity of the ARHGEF10 T332I mutant.

Identification of a Negative Regulatory Region for the Exchange Activity and Characterization of T332I Mutant of Rho Guanine Nucleotide Exchange Factor 10 (ARHGEF10)*

PubMed Central

Chaya, Taro; Shibata, Satoshi; Tokuhara, Yasunori; Yamaguchi, Wataru; Matsumoto, Hiroshi; Kawahara, Ichiro; Kogo, Mikihiko; Ohoka, Yoshiharu; Inagaki, Shinobu

2011-01-01

The T332I mutation in Rho guanine nucleotide exchange factor 10 (ARHGEF10) was previously found in persons with slowed nerve conduction velocities and thin myelination of peripheral nerves. However, the molecular and cellular basis of the T332I mutant is not understood. Here, we show that ARHGEF10 has a negative regulatory region in the N terminus, in which residue 332 is located, and the T332I mutant is constitutively active. An N-terminal truncated ARHGEF10 mutant, ARHGEF10 ΔN (lacking amino acids 1–332), induced cell contraction that was inhibited by a Rho kinase inhibitor Y27632 and had higher GEF activity for RhoA than the wild type. The T332I mutant also showed the phenotype similar to the N-terminal truncated mutant. These data suggest that the ARHGEF10 T332I mutation-associated phenotype observed in the peripheral nerves is due to activated GEF activity of the ARHGEF10 T332I mutant. PMID:21719701

The First Mutant of the Aequorea victoria Green Fluorescent Protein That Forms a Red Chromophore†

PubMed Central

Mishin, Alexander S.; Subach, Fedor V.; Yampolsky, Ilia V.; King, William; Lukyanov, Konstantin A.; Verkhusha, Vladislav V.

2010-01-01

Green fluorescent protein (GFP) from a jellyfish, Aequorea victoria, and its mutants are widely used in biomedical studies as fluorescent markers. In spite of the enormous efforts of academia and industry toward generating its red fluorescent mutants, no GFP variants with emission maximum at more than 529 nm have been developed during the 15 years since its cloning. Here, we used a new strategy of molecular evolution aimed at generating a red-emitting mutant of GFP. As a result, we have succeeded in producing the first GFP mutant that substantially matures to the red-emitting state with excitation and emission maxima at 555 and 585 nm, respectively. A novel, nonoxidative mechanism for formation of the red chromophore in this mutant that includes a dehydration of the Ser65 side chain has been proposed. Model experiments showed that the novel dual-color GFP mutant with green and red emission is suitable for multicolor flow cytometry as an additional color since it is clearly separable from both green and red fluorescent tags. PMID:18366185

Reduced Infectivity in Cattle for an Outer Membrane Protein Mutant of Anaplasma marginale

PubMed Central

Brayton, Kelly A.; Magunda, Forgivemore; Munderloh, Ulrike G.; Kelley, Karen L.; Barbet, Anthony F.

2015-01-01

Anaplasma marginale is the causative agent of anaplasmosis in cattle. Transposon mutagenesis of this pathogen using the Himar1 system resulted in the isolation of an omp10 operon insertional mutant referred to as the omp10::himar1 mutant. The work presented here evaluated if this mutant had morphological and/or growth rate defects compared to wild-type A. marginale. Results showed that the morphology, developmental cycle, and growth in tick and mammalian cell cultures are similar for the mutant and the wild type. Tick transmission experiments established that tick infection levels with the mutant were similar to those with wild-type A. marginale and that infected ticks successfully infected cattle. However, this mutant exhibited reduced infectivity and growth in cattle. The possibility of transforming A. marginale by transposon mutagenesis coupled with in vitro and in vivo assessment of altered phenotypes can aid in the identification of genes associated with virulence. The isolation of deliberately attenuated organisms that can be evaluated in their natural biological system is an important advance for the rational design of vaccines against this species. PMID:25595772

Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

PubMed

Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

2010-05-01

Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

Improved Properties of Baker's Yeast Mutants Resistant to 2-Deoxy-d-Glucose

PubMed Central

Rincón, Ana M.; Codón, Antonio C.; Castrejón, Francisco; Benítez, Tahía

2001-01-01

We isolated spontaneous mutants from Saccharomyces cerevisiae (baker's yeast V1) that were resistant to 2-deoxy-d-glucose and had improved fermentative capacity on sweet doughs. Three mutants could grow at the same rate as the wild type in minimal SD medium (0.17% Difco yeast nitrogen base without amino acids and ammonium sulfate, 0.5% ammonium sulfate, 2% glucose) and had stable elevated levels of maltase and/or invertase under repression conditions but lower levels in maltose-supplemented media. Two of the mutants also had high levels of phosphatase active on 2-deoxy-d-glucose-6-phosphate. Dough fermentation (CO2 liberation) by two of the mutants was faster and/or produced higher final volumes than that by the wild type, both under laboratory and industrial conditions, when the doughs were supplemented with glucose or sucrose. However, the three mutants were slower when fermenting plain doughs. Fermented sweet bakery products obtained with these mutants were of better quality than those produced by the wild type, with regard to their texture and their organoleptic properties. PMID:11526034

Mutant TDP-43 within motor neurons drives disease onset but not progression in amyotrophic lateral sclerosis.

PubMed

Ditsworth, Dara; Maldonado, Marcus; McAlonis-Downes, Melissa; Sun, Shuying; Seelman, Amanda; Drenner, Kevin; Arnold, Eveline; Ling, Shuo-Chien; Pizzo, Donald; Ravits, John; Cleveland, Don W; Da Cruz, Sandrine

2017-06-01

Mutations in TDP-43 cause amyotrophic lateral sclerosis (ALS), a fatal paralytic disease characterized by degeneration and premature death of motor neurons. The contribution of mutant TDP-43-mediated damage within motor neurons was evaluated using mice expressing a conditional allele of an ALS-causing TDP-43 mutant (Q331K) whose broad expression throughout the central nervous system mimics endogenous TDP-43. TDP-43 Q331K mice develop age- and mutant-dependent motor deficits from degeneration and death of motor neurons. Cre-recombinase-mediated excision of the TDP-43 Q331K gene from motor neurons is shown to delay onset of motor symptoms and appearance of TDP-43-mediated aberrant nuclear morphology, and abrogate subsequent death of motor neurons. However, reduction of mutant TDP-43 selectively in motor neurons did not prevent age-dependent degeneration of axons and neuromuscular junction loss, nor did it attenuate astrogliosis or microgliosis. Thus, disease mechanism is non-cell autonomous with mutant TDP-43 expressed in motor neurons determining disease onset but progression defined by mutant acting within other cell types.

Transcriptome sequencing and metabolic pathways of astaxanthin accumulated in Haematococcus pluvialis mutant under 15% CO2.

PubMed

Cheng, Jun; Li, Ke; Zhu, Yanxia; Yang, Weijuan; Zhou, Junhu; Cen, Kefa

2017-03-01

Transcriptome sequencing and annotation was performed on Haematococcus pluvialis mutant red cells induced with high light under 15% CO 2 to demonstrate why astaxanthin yield of the mutant was 1.7 times higher than that of a wild strain. It was found that 56% of 1947 differentially expressed genes were upregulated in mutant cells. Most significant differences were found in unigenes related to photosynthesis, carotenoid biosynthesis and fatty acid biosynthesis pathways. The pyruvate kinase increased by 3.5-fold in mutant cells. Thus, more pyruvate, which was beneficial to carotenoids and fatty acid biosynthesis, was generated. Phytoene synthase, zeta-carotene desaturase, lycopene beta-cyclase involved in β-carotene biosynthesis in mutant cells were upregulated by 10.4-, 4.4-, and 5.8-fold, respectively. Beta-carotene 3-hydroxylase catalyzing conversion of β-carotene into astaxanthin was upregulated by 18.4-fold. The fatty acid biosynthesis was promoted because of the upregulation of acetyl-CoA synthetase and acetyl-CoA carboxylase, thus increasing astaxanthin esterification and accumulation in mutant cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Benomyl-resistant mutant strain of Trichoderma sp. with increased mycoparasitic activity.

PubMed

Olejníková, P; Ondrusová, Z; Krystofová, S; Hudecová, D

2010-01-01

Application of UV radiation to the strain Trichoderma sp. T-bt (isolated from lignite) resulted in the T-brm mutant which was resistant to the systemic fungicide benomyl. The tub2 gene sequence in the T-brm mutant differed from the parent as well as the collection strain (replacing tyrosine with histidine in the TUB2 protein). Under in vitro conditions this mutant exhibited a higher mycoparasitic activity toward phytopathogenic fungi.

Smad3 mutant mice develop colon cancer with overexpression of COX-2

PubMed Central

Zhu, Yu-Ping; Liu, Zhuo; Fu, Zhi-Xuan; Li, De-Chuan

2017-01-01

Colon cancer is the second most common cause of cancer-associated mortality in human populations. The aim of the present study was to identify the role of cyclooxygenase-2 (COX-2) in Smad3 mutant mice, which are known to develop colon cancer. Homozygous Smad3 (−/−) mutant mice were generated from inbred and hybrid Smad3 mouse strains by intercrossing the appropriate heterozygotes. Immunohistochemistry with COX-2 antibody was performed throughout this experiment and the data was validated and cross-checked with reverse transcription-polymerase chain reaction (RT-PCR). Homozygous mutant Smad3 mice were generated and the overexpression pattern of COX-2 was identified by immunohistochemistry and validated with RT-PCR. The results of the present study demonstrated a link between the Smad3 mutant mice, colon cancer and COX-2. In addition, the overexpression pattern of COX-2 in Smad3 mutant mice that develop colon cancer was identified. PMID:28454287

Role of carotenoids in first positive phototropism of etiolated Arabidopsis thaliana seedlings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orbovic, V.; Poff, K.L.

1991-05-01

A mutant of Arabidopsis thaliana, chosen for is pale cotyledon phenotype in dark grown material, has been obtained from Klaus Apel (ETH-Zentrum, Zurich, Switzerland). Fluence response curves for this putative carotenoidless mutant and its wild-type parent have been measured. The shape of the fluence response curve for the pale mutant is similar to that of its wild-type parent. However, the amplitude of curvature by the mutant is considerably lower than curvature of the wild-type. If the amplitude of the curvature is enhanced with a red light pre-irradiation, peaks of the two photoreceptor pigments, P{sub I} and P{sub II} can bemore » seen in both the pale mutant and its wild-type parent. Based on these data, the authors conclude that neither photoreceptor pigment is altered in the pale mutant.« less

Analysis of the Light-harvesting Pigment-Protein Complex of Wild Type and a Chlorophyll-b-less Mutant of Barley 1

PubMed Central

Burke, John J.; Steinback, Katherine E.; Arntzen, Charles J.

1979-01-01

we have compared chloroplast lamellae isolated from a chlorophyll-b-less mutant and wild type barley (Hordeum vulgare). The results demonstrate that: (a) one of the two major polypeptides comprising the lightharvesting complex (LHC) is present in the chlorophyll-b-less mutant; (b) higher cation concentrations are required to maintain grana stacks in the mutant; and (c) cation effects on excitation energy distribution are present in the chlorophyll-b-less mutant but are reduced in amount and are dependent on higher concentrations of cations. We interpret these data to support the concept that the LHC mediates cation-induced grana stacking and cation regulation of excitation energy distribution between photosystems I and Ii in chloroplast lamellae. A partial LHC complement in the mutant alters the quantitative cation requirement for both phenomena, but not the over-all qualitative response. Images PMID:16660704

The RAD24 (= Rs1) Gene Product of Saccharomyces cerevisiae Participates in Two Different Pathways of DNA Repair

PubMed Central

Eckardt-Schupp, Friederike; Siede, Wolfram; Game, John C.

1987-01-01

The moderately UV- and X-ray-sensitive mutant of Saccharomyces cerevisiae originally designated rs1 complements all rad and mms mutants available. Therefore, the new nomination rad24-1 according to the RAD nomenclature is suggested. RAD24 maps on chromosome V, close to RAD3 (1.3 cM). In order to associate the RAD24 gene with one of the three repair pathways, double mutants of rad24 and various representative genes of each pathway were constructed. The UV and X-ray sensitivities of the double mutants compared to the single mutants indicate that RAD24 is involved in excision repair of UV damage (RAD3 epistasis group), as well as in recombination repair of UV and X-ray damage (RAD52 epistasis group). Properties of the mutant are discussed which hint at the control of late steps in the pathways. PMID:3549445

Reduced mycorrhizal colonization (rmc) tomato mutant lacks expression of SymRK signaling pathway genes

PubMed Central

Nair, Aswathy; Bhargava, Sujata

2012-01-01

Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680

φX-174 Bacteriophage Structural Mutants Which Affect Deoxyribonucleic Acid Synthesis

PubMed Central

Siegel, Jeff E. D.; Hayashi, Masaki

1969-01-01

Seven cistrons in φX-174 were identified and one in particular was studied intensively: cistron A, which is assigned a protein in the mature phage. Amber mutants in this cistron synthesize a new deoxyribonucleic acid (DNA) form in addition to circular phage DNA upon infection of the restrictive host. This DNA is linear, non-infectious, and single-stranded; it is formed from the phage strand of replicative form φX-174 DNA. These mutants produce two different defective particles in the restrictive host. One particle contains circular phage DNA but is not infectious; the other contains the new DNA form and is similar to the 70S particles found in wild-type phage lysates. The mutant A gene product acts independently of normal A protein upon mixed infection of the restrictive host with an A mutant and a mutant from any other cistron or wild type. PMID:5823229

Restoring de novo Coenzyme Q biosynthesis in Caenorhabditis elegans coq-3 mutants yields profound rescue compared to exogenous Coenzyme Q supplementation

PubMed Central

Gomez, Fernando; Saiki, Ryoichi; Chin, Randall; Srinivasan, Chandra; Clarke, Catherine F.

2012-01-01

Coenzyme Q (ubiquinone or Q) is an essential lipid component of the mitochondrial electron transport chain. In Caenorhabditis elegans Q biosynthesis involves at least nine steps, including the hydroxylation of the hydroquinone ring by CLK-1 and two O-methylation steps mediated by COQ-3. We characterize two C. elegans coq-3 deletion mutants, and show that while each has defects in Q synthesis, their phenotypes are distinct. First generation homozygous coq-3(ok506) mutants are fertile when fed the standard lab diet of Q-replete OP50 E. coli, but their second generation homozygous progeny do not reproduce. In contrast, the coq-3(qm188) deletion mutant remains sterile when fed Q-replete OP50. Quantitative PCR analyses suggest that the longer qm188 deletion may alter expression of the flanking nuo-3 and gdi-1 genes, located 5′ and 3′, respectively of coq-3 within an operon. We surmise that variable expression of nuo-3, a subunit of complex I, or of gdi-1, a guanine nucleotide dissociation inhibitor, may act in combination with defects in Q biosynthesis to produce a more severe phenotype. The phenotypes of both coq-3 mutants are more drastic as compared to the C. elegans clk-1 mutants. When fed OP50, clk-1 mutants reproduce for many generations, but show reduced fertility, slow behaviors, and enhanced life span. The coq-3 and clk-1 mutants all show arrested development and are sterile when fed the Q-deficient E. coli strain GD1 (harboring a mutation in the ubiG gene). However, unlike clk-1 mutant worms, neither coq-3 mutant strain responded to dietary supplementation with purified exogenous Q10. Here we show that the Q9 content can be determined in lipid extracts from just 200 individual worms, enabling the determination of Q content in the coq-3 mutants unable to reproduce. An extra-chromosomal array expressing wild-type C. elegans coq-3 rescued fertility of both coq-3 mutants and partially restored steady-state levels of COQ-3 polypeptide and Q9 content, indicating that primary defect in both is limited to coq-3. The limited response of the coq-3 mutants to dietary supplementation with Q provides a powerful model to probe the effectiveness of exogenous Q supplementation as compared to restoration of de novo Q biosynthesis. PMID:22735617

Restoring de novo coenzyme Q biosynthesis in Caenorhabditis elegans coq-3 mutants yields profound rescue compared to exogenous coenzyme Q supplementation.

PubMed

Gomez, Fernando; Saiki, Ryoichi; Chin, Randall; Srinivasan, Chandra; Clarke, Catherine F

2012-09-10

Coenzyme Q (ubiquinone or Q) is an essential lipid component of the mitochondrial electron transport chain. In Caenorhabditis elegans Q biosynthesis involves at least nine steps, including the hydroxylation of the hydroquinone ring by CLK-1 and two O-methylation steps mediated by COQ-3. We characterize two C. elegans coq-3 deletion mutants, and show that while each has defects in Q synthesis, their phenotypes are distinct. First generation homozygous coq-3(ok506) mutants are fertile when fed the standard lab diet of Q-replete OP50 Escherichia coli, but their second generation homozygous progeny does not reproduce. In contrast, the coq-3(qm188) deletion mutant remains sterile when fed Q-replete OP50. Quantitative PCR analyses suggest that the longer qm188 deletion may alter expression of the flanking nuo-3 and gdi-1 genes, located 5' and 3', respectively of coq-3 within an operon. We surmise that variable expression of nuo-3, a subunit of complex I, or of gdi-1, a guanine nucleotide dissociation inhibitor, may act in combination with defects in Q biosynthesis to produce a more severe phenotype. The phenotypes of both coq-3 mutants are more drastic as compared to the C. elegans clk-1 mutants. When fed OP50, clk-1 mutants reproduce for many generations, but show reduced fertility, slow behaviors, and enhanced life span. The coq-3 and clk-1 mutants all show arrested development and are sterile when fed the Q-deficient E. coli strain GD1 (harboring a mutation in the ubiG gene). However, unlike clk-1 mutant worms, neither coq-3 mutant strain responded to dietary supplementation with purified exogenous Q(10). Here we show that the Q(9) content can be determined in lipid extracts from just 200 individual worms, enabling the determination of Q content in the coq-3 mutants unable to reproduce. An extra-chromosomal array expressing wild-type C. elegans coq-3 rescued fertility of both coq-3 mutants and partially restored steady-state levels of COQ-3 polypeptide and Q(9) content, indicating that primary defect in both is limited to coq-3. The limited response of the coq-3 mutants to dietary supplementation with Q provides a powerful model to probe the effectiveness of exogenous Q supplementation as compared to restoration of de novo Q biosynthesis. Copyright © 2012 Elsevier B.V. All rights reserved.

A Dictyostelium mutant deficient in severin, an F-actin fragmenting protein, shows normal motility and chemotaxis

PubMed Central

1989-01-01

A severin deficient mutant of Dictyostelium discoideum has been isolated by the use of colony immunoblotting after chemical mutagenesis. In homogenates of wild-type cells, severin is easily detected as a very active F-actin fragmenting protein. Tests for severin in the mutant, HG1132, included viscometry for the assay of F- actin fragmentation in fractions from DEAE-cellulose columns, labeling of blots with monoclonal and polyclonal antibodies, and immunofluorescent-labeling of cryosections. Severin could not be detected in the mutant using these methods. The mutation in HG1132 is recessive and has been mapped to linkage group VII. The mutant failed to produce the normal severin mRNA, but small amounts of a transcript that was approximately 100 bases larger than the wild-type mRNA were detected in the mutant throughout all stages of development. On the DNA level a new Mbo II restriction site was found in the mutant within the coding region of the severin gene. The severin deficient mutant cells grew at an approximately normal rate, aggregated and formed fruiting bodies with viable spores. By the use of an image processing system, speed of cell movement, turning rates, and precision of chemotactic orientation in a stable gradient of cyclic AMP were quantitated, and no significant differences between wild-type and mutant cells were found. Thus, under the culture conditions used, severin proved to be neither essential for growth of D. discoideum nor for any cell function that is important for aggregation or later development. PMID:2537840

Immunogenicity and protection induced by a Mycobacterium tuberculosis sigE mutant in a BALB/c mouse model of progressive pulmonary tuberculosis.

PubMed

Hernandez Pando, Rogelio; Aguilar, Leon Diana; Smith, Issar; Manganelli, Riccardo

2010-07-01

Tuberculosis is still one of the main challenges to human global health, leading to about two million deaths every year. One of the reasons for its success is the lack of efficacy of the widely used vaccine Mycobacterium bovis BCG. In this article, we analyze the potential use of an attenuated mutant of Mycobacterium tuberculosis H37Rv lacking the sigma factor sigma(E) as a live vaccine. We have demonstrated that BALB/c mice infected by the intratracheal route with this mutant strain showed significantly higher survival rates and less tissue damage than animals infected with the parental or complemented mutant strain. Although animals infected with the sigE mutant had low bacillary loads, their lungs showed significantly higher production of the protective factors gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha), inducible nitric oxide synthase (iNOS), and beta-defensins than those of animals infected with the parental or complemented mutant strain. Moreover, we demonstrate that the sigE mutant, when inoculated subcutaneously, was more attenuated than BCG in immunodeficient nude mice, thus representing a good candidate for a novel attenuated live vaccine strain. Finally, when we used the sigE mutant as a subcutaneous vaccine, it was able to induce a higher level of protection than did BCG with both H37Rv and a highly virulent strain of M. tuberculosis (Beijing code 9501000). Taken together, our findings suggest that the sigE mutant is a very promising strain for the development of a new vaccine against tuberculosis.

New recombinant cyclohexylamine oxidase variants for deracemization of secondary amines by orthogonally assaying designed mutants with structurally diverse substrates

NASA Astrophysics Data System (ADS)

Li, Guangyue; Yao, Peiyuan; Cong, Peiqian; Ren, Jie; Wang, Lei; Feng, Jinhui; Lau, Peter C. K.; Wu, Qiaqing; Zhu, Dunming

2016-05-01

To further expand the substrate range of the cyclohexylamine oxidase (CHAO) from Brevibacterium oxydans, a library of diverse mutants was created and assayed toward a group of structurally diverse substrates. Among them, mutants T198A and M226A exhibited enhanced activity relative to wt CHAO for most (S)-enantiomers of primary amines and some secondary amines. While mutants T198I, L199I, L199F, M226I and M226T were more active than wt CHAO toward the primary amines, mutants T198F, L199T, Y321A, Y321T, Y321I and Y321F enhanced the enzyme activity toward the secondary amines. In particular, mutant Y321I displayed an enhanced catalytic efficiency toward 1-(4-methoxybenzyl)-1, 2, 3, 4, 5, 6, 7, 8-octahydroisoquinoline (13). Whereas a double mutant, Y321I/M226T, acted on (S)-N-(prop-2-yn-1-yl)-2, 3-dihydro-1H-inden-1-amine [(S)-8]. Since (R)-8 is an irreversible inhibitor of monoamine oxidase and (S)-13 is an intermediate of dextromethorphan, a cough suppressant drug, deracemizations of 8 and 13 were carried out with crude enzyme extracts of the respective mutants. This resulted in 51% and 78% isolated yields of (R)-8 and (S)-13, respectively, each with high enantiomeric excess (93% and 99% ee). The results demonstrated the application potential of the evolved CHAO mutants in drug synthesis requiring chiral secondary amines.

Biodiversity in the cyclic competition system of three species according to the emergence of mutant species

NASA Astrophysics Data System (ADS)

Park, Junpyo

2018-05-01

Understanding mechanisms which promote or hinder existing ecosystems are important issues in ecological sciences. In addition to fundamental interactions such as competition and migration among native species, existing ecosystems can be easily disturbed by external factors, and the emergence of new species may be an example in such cases. The new species which does not exist in a current ecosystem can be regarded as either alien species entered from outside or mutant species born by mutation in existing normal species. Recently, as existing ecosystems are getting influenced by various physical/chemical external factors, mutation due to anthropogenic and environmental factors can occur more frequently and is thus attracting much attention for the maintenance of ecosystems. In this paper, we consider emergences of mutant species among self-competing three species in the cyclic dominance. By defining mutation as the birth of mutant species, we investigate how mutant species can affect biodiversity in the existing ecosystem. Through microscopic and macroscopic approaches, we have found that the society of existing normal species can be disturbed by mutant species either the society is maintained accompanying with the coexistence of all species or jeopardized by occupying of mutant species. Due to the birth of mutant species, the existing society may be more complex by constituting two different groups of normal and mutant species, and our results can be contributed to analyze complex ecosystems of many species. We hope our findings may propose a new insight on mutation in cyclic competition systems of many species.

Mapping the neutralizing epitopes on the glycoprotein of infectious haematopoietic necrosis virus, a fish rhabdovirus

USGS Publications Warehouse

Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.

1996-01-01

Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.

New recombinant cyclohexylamine oxidase variants for deracemization of secondary amines by orthogonally assaying designed mutants with structurally diverse substrates

PubMed Central

Li, Guangyue; Yao, Peiyuan; Cong, Peiqian; Ren, Jie; Wang, Lei; Feng, Jinhui; Lau, Peter C.K.; Wu, Qiaqing; Zhu, Dunming

2016-01-01

To further expand the substrate range of the cyclohexylamine oxidase (CHAO) from Brevibacterium oxydans, a library of diverse mutants was created and assayed toward a group of structurally diverse substrates. Among them, mutants T198A and M226A exhibited enhanced activity relative to wt CHAO for most (S)-enantiomers of primary amines and some secondary amines. While mutants T198I, L199I, L199F, M226I and M226T were more active than wt CHAO toward the primary amines, mutants T198F, L199T, Y321A, Y321T, Y321I and Y321F enhanced the enzyme activity toward the secondary amines. In particular, mutant Y321I displayed an enhanced catalytic efficiency toward 1-(4-methoxybenzyl)-1, 2, 3, 4, 5, 6, 7, 8-octahydroisoquinoline (13). Whereas a double mutant, Y321I/M226T, acted on (S)-N-(prop-2-yn-1-yl)-2, 3-dihydro-1H-inden-1-amine [(S)-8]. Since (R)-8 is an irreversible inhibitor of monoamine oxidase and (S)-13 is an intermediate of dextromethorphan, a cough suppressant drug, deracemizations of 8 and 13 were carried out with crude enzyme extracts of the respective mutants. This resulted in 51% and 78% isolated yields of (R)-8 and (S)-13, respectively, each with high enantiomeric excess (93% and 99% ee). The results demonstrated the application potential of the evolved CHAO mutants in drug synthesis requiring chiral secondary amines. PMID:27138090

Molecular Mechanism of Terbinafine Resistance in Saccharomyces cerevisiae

PubMed Central

Leber, Regina; Fuchsbichler, Sandra; Klobučníková, Vlasta; Schweighofer, Natascha; Pitters, Eva; Wohlfarter, Kathrin; Lederer, Mojca; Landl, Karina; Ruckenstuhl, Christoph; Hapala, Ivan; Turnowsky, Friederike

2003-01-01

Ten mutants of the yeast Saccharomyces cerevisiae resistant to the antimycotic terbinafine were isolated after chemical or UV mutagenesis. Molecular analysis of these mutants revealed single base pair exchanges in the ERG1 gene coding for squalene epoxidase, the target of terbinafine. The mutants did not show cross-resistance to any of the substrates of various pleiotropic drug resistance efflux pumps tested. The ERG1 mRNA levels in the mutants did not differ from those in the wild-type parent strains. Terbinafine resistance was transmitted with the mutated alleles in gene replacement experiments, proving that single amino acid substitutions in the Erg1 protein were sufficient to confer the resistance phenotype. The amino acid changes caused by the point mutations were clustered in two regions of the Erg1 protein. Seven mutants carried the amino acid substitutions F402L (one mutant), F420L (one mutant), and P430S (five mutants) in the C-terminal part of the protein; and three mutants carried an L251F exchange in the central part of the protein. Interestingly, all exchanges identified involved amino acids which are conserved in the squalene epoxidases of yeasts and mammals. Two mutations that were generated by PCR mutagenesis of the ERG1 gene and that conferred terbinafine resistance mapped in the same regions of the Erg1 protein, with one resulting in an L251F exchange and the other resulting in an F433S exchange. The results strongly indicate that these regions are responsible for the interaction of yeast squalene epoxidase with terbinafine. PMID:14638499

Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.

PubMed

Wang, Weiping; Manna, David; Simmons, Daniel T

2007-05-01

The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.

A proteomic analysis of ferulic acid metabolism in Amycolatopsis sp. ATCC 39116.

PubMed

Meyer, Florian; Netzer, Julius; Meinert, Christina; Voigt, Birgit; Riedel, Katharina; Steinbüchel, Alexander

2018-05-16

The pseudonocardiate Amycolatopsis sp. ATCC 39116 is used for the biotechnical production of natural vanillin from ferulic acid. Our laboratory has performed genetic modifications of this strain previously, but there are still many gaps in our knowledge regarding its vanillin tolerance and the general metabolism. We performed cultivations with this bacterium and compared the proteomes of stationary phase cells before ferulic acid feeding with those during ferulic acid feeding. Thereby, we identified 143 differently expressed proteins. Deletion mutants were constructed and characterized to analyze the function of nine corresponding genes. Using these mutants, we identified an active ferulic acid β-oxidation pathway and the enzymes which constitute this pathway. A combined deletion mutant in which the β-oxidation as well as non-β-oxidation pathways of ferulic acid degradation were deleted was unable to grow on ferulic acid as the sole source of carbon and energy. This mutant differs from the single deletion mutants and was unable to grow on ferulic acid. Furthermore, we showed that the non-β-oxidation pathway is involved in caffeic acid degradation; however, its deletion is complemented even in the double deletion mutant. This shows that both pathways can complement each other. The β-oxidation deletion mutant produced significantly reduced amounts of vanillic acid (0.12 instead of 0.35 g/l). Therefore, the resulting mutant could be used as an improved production strain. The quinone oxidoreductase deletion mutant (ΔytfG) degraded ferulic acid slower at first but produced comparable amounts of vanillin and significantly less vanillyl alcohol when compared to the parent strain.

Surface Polysaccharide Mutants Reveal that Absence of O Antigen Reduces Biofilm Formation of Actinobacillus pleuropneumoniae

PubMed Central

Hathroubi, S.; Hancock, M. A.; Langford, P. R.; Tremblay, Y. D. N.; Labrie, J.

2015-01-01

Actinobacillus pleuropneumoniae is a Gram-negative bacterium belonging to the Pasteurellaceae family and the causative agent of porcine pleuropneumonia, a highly contagious lung disease causing important economic losses. Surface polysaccharides, including lipopolysaccharides (LPS) and capsular polysaccharides (CPS), are implicated in the adhesion and virulence of A. pleuropneumoniae, but their role in biofilm formation is still unclear. In this study, we investigated the requirement for these surface polysaccharides in biofilm formation by A. pleuropneumoniae serotype 1. Well-characterized mutants were used: an O-antigen LPS mutant, a truncated core LPS mutant with an intact O antigen, a capsule mutant, and a poly-N-acetylglucosamine (PGA) mutant. We compared the amount of biofilm produced by the parental strain and the isogenic mutants using static and dynamic systems. Compared to the findings for the biofilm of the parental or other strains, the biofilm of the O antigen and the PGA mutants was dramatically reduced, and it had less cell-associated PGA. Real-time PCR analyses revealed a significant reduction in the level of pgaA, cpxR, and cpxA mRNA in the biofilm cells of the O-antigen mutant compared to that in the biofilm cells of the parental strain. Specific binding between PGA and LPS was consistently detected by surface plasmon resonance, but the lack of O antigen did not abolish these interactions. In conclusion, the absence of the O antigen reduces the ability of A. pleuropneumoniae to form a biofilm, and this is associated with the reduced expression and production of PGA. PMID:26483403

A mutational approach for the detection of genetic factors affecting seed size in maize.

PubMed

Sangiorgio, Stefano; Carabelli, Laura; Gabotti, Damiano; Manzotti, Priscilla Sofia; Persico, Martina; Consonni, Gabriella; Gavazzi, Giuseppe

2016-12-01

Genes influencing seed size. The designation emp (empty pericarp) refers to a group of defective kernel mutants that exhibit a drastic reduction in endosperm tissue production. They allow the isolation of genes controlling seed development and affecting seed size. Nine independently isolated emp mutants have been analyzed in this study and in all cases longitudinal sections of mature seeds revealed the absence of morphogenesis in the embryo proper, an observation that correlates with their failure to germinate. Complementation tests with the nine emp mutants, crossed inter se in all pairwise combinations, identified complementing and non-complementing pairs in the F 1 progenies. Data were then validated in the F 2 /F 3 generations. Mutant chromosomal location was also established. Overall our study has identified two novel emp genes and a novel allele at the previously identified emp4 gene. The introgression of single emp mutants in a different genetic background revealed the existence of a cryptic genetic variation (CGV) recognizable as a variable increase in the endosperm tissue. The unmasking of CGV by introducing single mutants in different genetic backgrounds is the result of the interaction of the emp mutants with a suppressor that has no obvious phenotype of its own and is present in the genetic background of the inbred lines into which the emp mutants were transferred. On the basis of these results, emp mutants could be used as tools for the detection of genetic factors that enhance the amount of endosperm tissue in the maize kernel and which could thus become valuable targets to exploit in future breeding programs.

In Vitro Selection of ramR and soxR Mutants Overexpressing Efflux Systems by Fluoroquinolones as Well as Cefoxitin in Klebsiella pneumoniae▿

PubMed Central

Bialek-Davenet, Suzanne; Marcon, Estelle; Leflon-Guibout, Véronique; Lavigne, Jean-Philippe; Bert, Frédéric; Moreau, Richard; Nicolas-Chanoine, Marie-Hélène

2011-01-01

The relationship between efflux system overexpression and cross-resistance to cefoxitin, quinolones, and chloramphenicol has recently been reported in Klebsiella pneumoniae. In 3 previously published clinical isolates and 17 in vitro mutants selected with cefoxitin or fluoroquinolones, mutations in the potential regulator genes of the AcrAB efflux pump (acrR, ramR, ramA, marR, marA, soxR, soxS, and rob) were searched, and their impacts on efflux-related antibiotic cross-resistance were assessed. All mutants but 1, and 2 clinical isolates, overexpressed acrB. No mutation was detected in the regulator genes studied among the clinical isolates and 8 of the mutants. For the 9 remaining mutants, a mutation was found in the ramR gene in 8 of them and in the soxR gene in the last one, resulting in overexpression of ramA and soxS, respectively. Transformation of the ramR mutants and the soxR mutant with the wild-type ramR and soxR genes, respectively, abolished overexpression of acrB and ramA in the ramR mutants and of soxS in the soxR mutant, as well as antibiotic cross-resistance. Resistance due to efflux system overexpression was demonstrated for 4 new antibiotics: cefuroxime, cefotaxime, ceftazidime, and ertapenem. This study shows that the ramR and soxR genes control the expression of efflux systems in K. pneumoniae and suggests the existence of efflux pumps other than AcrAB and of other loci involved in the regulation of AcrAB expression. PMID:21464248

The Streptococcus mutans Serine/Threonine Kinase, PknB, Regulates Competence Development, Bacteriocin Production, and Cell Wall Metabolism ▿

PubMed Central

Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R.

2010-01-01

Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB. PMID:20231406

The Streptococcus mutans serine/threonine kinase, PknB, regulates competence development, bacteriocin production, and cell wall metabolism.

PubMed

Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R

2010-05-01

Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB.

Methylammonium-resistant mutants of Nicotiana plumbaginifolia are affected in nitrate transport.

PubMed

Godon, C; Krapp, A; Leydecker, M T; Daniel-Vedele, F; Caboche, M

1996-02-25

This work reports the isolation and preliminary characterization of Nicotiana plumbaginifolia mutants resistant to methylammonium. Nicotiana plumbaginifolia plants cannot grow on low levels of nitrate in the presence of methylammonium. Methylammonium is not used as a nitrogen source, although it can be efficiently taken up by Nicotiana plumbaginifolia cells and converted into methylglutamine, an analog of glutamine. Glutamine is known to repress the expression of the enzymes that mediate the first two steps in the nitrate assimilatory pathway, nitrate reductase (NR) and nitrite reductase (NiR). Methylammonium has therefore been used, in combination with low concentrations of nitrate, as a selective agent in order to screen for mutants in which the nitrate pathway is de-repressed. Eleven semi-dominant mutants, all belonging to the same complementation group, were identified. The mutant showing the highest resistance to methylammonium was not affected either in the utilization of ammonium, accumulation of methylammonium or in glutamine synthase activity. A series of experiments showed that utilization of nitrite by the wild-type and the mutant was comparable, in the presence or the absence of methylammonium, thus suggesting that the mutation specifically affected nitrate transport or reduction. Although NR mRNA levels were less repressed by methylammonium treatment of the wild-type than the mutant, NR activities of the mutant remained comparable with or without methylammonium, leading to the hypothesis that modified expression of NR is probably not responsible for resistance to methylammonium. Methylammonium inhibited nitrate uptake in the wild-type but had only a limited effect in the mutant. The implications of these results are discussed.

Nicotiana plumbaginifolia hlg mutants have a mutation in a PHYB-type phytochrome gene: they have elongated hypocotyls in red light, but are not elongated as adult plants.

PubMed

Hudson, M; Robson, P R; Kraepiel, Y; Caboche, M; Smith, H

1997-11-01

Two new allelic mutants of Nicotiana plumbaginifolia have been isolated which display a hypocotyl which is long (hlg) when seedlings are grown in continuous white light (W). This can be accounted for by the decreased response to red light (R) of the hypocotyl elongation rate in these mutants. Responses to other wavelengths are unaffected in the mutants. When grown in white light, mature hlg mutants are not elongated with respect to the wild-type; they also bolt and flower later. The shade-avoidance responses to red/far red ratio (R:FR) are intact in these mutants. Both mutants are deficient in phyB-like polypeptide that is immunodetectable in the wild-type; both have wild-type levels of a phyA-like polypeptide. These alleles are inherited in a partially dominant manner, and correspond to single-base missense mutations in a gene highly homologous to N. tabacum PHYB, which codes for a phytochrome B-type photoreceptor. One allele, hlg-1, has an introduced amino acid substitution; this may define a residue essential for phytochrome protein stability. The other allele, hlg-2, has a stop codon introduced C-terminal to the chromophore binding domain. As these phyB mutants are unaffected in shade-avoidance responses, but deficient in perception of R, it is concluded that the phyB absent in these mutants is responsible for R perception in the N. plumbaginifolia seedling, but is not a R:FR sensor in light-grown plants.

Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

PubMed

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

Impact of Fluoroquinolone Resistance Mutations on Gonococcal Fitness and In Vivo Selection for Compensatory Mutations

PubMed Central

Kunz, Anjali N.; Begum, Afrin A.; Wu, Hong; D'Ambrozio, Jonathan A.; Robinson, James M.; Shafer, William M.; Bash, Margaret C.; Jerse, Ann E.

2012-01-01

Background. Quinolone-resistant Neisseria gonorrhoeae (QRNG) arise from mutations in gyrA (intermediate resistance) or gyrA and parC (resistance). Here we tested the consequence of commonly isolated gyrA91/95 and parC86 mutations on gonococcal fitness. Methods. Mutant gyrA91/95 and parC86 alleles were introduced into wild-type gonococci or an isogenic mutant that is resistant to macrolides due to an mtrR−79 mutation. Wild-type and mutant bacteria were compared for growth in vitro and in competitive murine infection. Results. In vitro growth was reduced with increasing numbers of mutations. Interestingly, the gyrA91/95 mutation conferred an in vivo fitness benefit to wild-type and mtrR−79 mutant gonococci. The gyrA91/95, parC86 mutant, in contrast, showed a slight fitness defect in vivo, and the gyrA91/95, parC86, mtrR−79 mutant was markedly less fit relative to the parent strains. A ciprofloxacin-resistant (CipR) mutant was selected during infection with the gyrA91/95, parC86, mtrR−79 mutant in which the mtrR−79 mutation was repaired and the gyrA91 mutation was altered. This in vivo–selected mutant grew as well as the wild-type strain in vitro. Conclusions. gyrA91/95 mutations may contribute to the spread of QRNG. Further acquisition of a parC86 mutation abrogates this fitness advantage; however, compensatory mutations can occur that restore in vivo fitness and maintain CipR. PMID:22492860

Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

PubMed

Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

2016-04-16

Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p<0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434 (inlB), lmo0263 (inlH), lmo0543, lmo0057 (EsaA), lmo2563, lmo0453), caused enhanced biofilm formation in the bacterium at 15 °C. The remaining mutants harbored interruptions in 10 genetic loci previously associated with biofilm formation at higher temperatures, indicating some temperature driven differences in the formation of biofilm by L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Structure-guided systems-level engineering of oxidation-prone methionine residues in catalytic domain of an alkaline α-amylase from Alkalimonas amylolytica for significant improvement of both oxidative stability and catalytic efficiency.

PubMed

Yang, Haiquan; Liu, Long; Shin, Hyun-dong; Li, Jianghua; Du, Guocheng; Chen, Jian

2013-01-01

High oxidative stability and catalytic efficiency are required for the alkaline α-amylases to keep the enzymatic performance under the harsh conditions in detergent industries. In this work, we attempted to significantly improve both the oxidative stability and catalytic efficiency of an alkaline α-amylase from Alkalimonas amylolytica by engineering the five oxidation-prone methionine residues around the catalytic domain via a systematic approach. Specifically, based on the tertiary structure analysis, five methionines (Met 145, Met 214, Met 229, Met 247 and Met 317) were individually substituted with oxidation-resistant threonine, isoleucine and alaline, respectively. Among the created 15 mutants, 7 mutants M145A, M145I, M214A, M229A, M229T, M247T and M317I showed significantly enhanced oxidative stability or catalytic efficiency. In previous work, we found that the replacement of M247 with leucine could significantly improve the oxidative stability. Thus, these 8 positive mutants (M145A, M145I, M214A, M229A, M229T, M247T, M247L and M317I) were used to conduct the second round of combinational mutations. Among the constructed 85 mutants (25 two-point mutants, 36 three-point mutants, 16 four-point mutants and 8 five-point mutants), the mutant M145I-214A-229T-247T-317I showed a 5.4-fold increase in oxidative stability and a 3.0-fold increase in catalytic efficiency. Interestingly, the specific activity, alkaline stability and thermal stability of this mutant were also increased. The increase of salt bridge and hydrogen bonds around the catalytic domain contributed to the significantly improved catalytic efficiency and stability, as revealed by the three-dimensional structure model of wild-type alkaline α-amylase and its mutant M145I-214A-229T-247T-317I. With the significantly improved oxidative stability and catalytic efficiency, the mutant M145I-214A-229T-247T-317I has a great potential as a detergent additive, and this structure-guided systems engineering strategy may be useful for the protein engineering of the other microbial enzymes to fulfill industrial requirements.

Proton suicide: general method for direct selection of sugar transport- and fermentation-defective mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winkelman, J.W.; Clark, D.P.

A positive selection procedure was devised for bacterial mutants incapable of producing acid from sugars by fermentation. The method relied on the production of elemental bromine from a mixture of bromide and bromate under acidic conditions. When wild-type Escherichia coli cells were plated on media containing a fermentable sugar and an equimolar mixture of bromide and bromate, most of the cells were killed but a variety of mutants unable to produce acid from the sugar survived. Among these mutants were those defective in (i) sugar uptake, (ii) the glycolytic pathway, and (iii) the excretion. There were also novel mutants withmore » some presumed regulatory defects affecting fermentation.« less

The pathogenicity of thymidine kinase-deficient mutants of herpes simplex virus in mice.

PubMed Central

Field, H. J.; Wildy, P.

1978-01-01

The pathogenicity for mice of two mutants of herpes simplex virus (type 1 and type 2), which fail to induce thymidine kinase, were compared with their respective parent strains. The mutants were much less virulent than the parents following either intracerebral or peripheral inoculation. The replication of the virus at the site of inoculation and its progression into the nervous system were studied. Following a very large inoculum in the ear, the type 1 mutant was found to establish a latent infection in the cervical dorsal root ganglia. Mice inoculated intracerebrally with small doses of the mutant viruses were solidly immune to challenge with lethal doses of the parent strain. PMID:212476

The pathogenicity of thymidine kinase-deficient mutants of herpes simplex virus in mice.

PubMed

Field, H J; Wildy, P

1978-10-01

The pathogenicity for mice of two mutants of herpes simplex virus (type 1 and type 2), which fail to induce thymidine kinase, were compared with their respective parent strains. The mutants were much less virulent than the parents following either intracerebral or peripheral inoculation. The replication of the virus at the site of inoculation and its progression into the nervous system were studied. Following a very large inoculum in the ear, the type 1 mutant was found to establish a latent infection in the cervical dorsal root ganglia. Mice inoculated intracerebrally with small doses of the mutant viruses were solidly immune to challenge with lethal doses of the parent strain.

The α Glycerophosphate Cycle in Drosophila melanogaster V. Molecular Analysis of α Glycerophosphate Dehydrogenase and α Glycerophosphate Oxidase Mutants

PubMed Central

Carmon, Amber; Chien, Jeff; Sullivan, David

2010-01-01

Two enzymes, α glycerophosphate dehydrogenase (GPDH-1) in the cytoplasm and α glycerophosphate oxidase (GPO-1) in the mitochondrion cooperate in Drosophila flight muscles to generate the ATP needed for muscle contraction. Null mutants for either enzyme cannot fly. Here, we characterize 15 ethyl methane sulfonate (EMS)-induced mutants in GPDH-1 at the molecular level and assess their effects on structural and evolutionarily conserved domains of this enzyme. In addition, we molecularly characterize 3 EMS-induced GPO-1 mutants and excisions of a P element insertion in the GPO-1 gene. The latter represent the best candidate for null or amorphic mutants in this gene. PMID:19995806

The alpha glycerophosphate cycle in Drosophila melanogaster V. molecular analysis of alpha glycerophosphate dehydrogenase and alpha glycerophosphate oxidase mutants.

PubMed

Carmon, Amber; Chien, Jeff; Sullivan, David; MacIntyre, Ross

2010-01-01

Two enzymes, alpha glycerophosphate dehydrogenase (GPDH-1) in the cytoplasm and alpha glycerophosphate oxidase (GPO-1) in the mitochondrion cooperate in Drosophila flight muscles to generate the ATP needed for muscle contraction. Null mutants for either enzyme cannot fly. Here, we characterize 15 ethyl methane sulfonate (EMS)-induced mutants in GPDH-1 at the molecular level and assess their effects on structural and evolutionarily conserved domains of this enzyme. In addition, we molecularly characterize 3 EMS-induced GPO-1 mutants and excisions of a P element insertion in the GPO-1 gene. The latter represent the best candidate for null or amorphic mutants in this gene.

Immunological Study of the O-Antigens of Streptomycin-Dependent Mutants of Salmonella

DTIC Science & Technology

1974-10-23

AD/A-O00 361 IMMUNOLOGICAL STUDY OF THE O-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA L. S. Edvabnaya, et al Foreign Technology Division...U. S. Air Force SREPORT TITLE IMMUNOLOGICAL STUDY OF THE 0-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA 4 DCESCRIPTIVIE NOTES (?T’pe of...THE O-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA By: L. S. Yedvabnaya, Ye. S. Stanislavskiy, and V. V. Sergeyev Englihs pages: 10 Source

The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib

PubMed Central

Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul

2018-01-01

ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins. PMID:29219657

Goalpha regulates volatile anesthetic action in Caenorhabditis elegans.

PubMed Central

van Swinderen, B; Metz, L B; Shebester, L D; Mendel, J E; Sternberg, P W; Crowder, C M

2001-01-01

To identify genes controlling volatile anesthetic (VA) action, we have screened through existing Caenorhabditis elegans mutants and found that strains with a reduction in Go signaling are VA resistant. Loss-of-function mutants of the gene goa-1, which codes for the alpha-subunit of Go, have EC(50)s for the VA isoflurane of 1.7- to 2.4-fold that of wild type. Strains overexpressing egl-10, which codes for an RGS protein negatively regulating goa-1, are also isoflurane resistant. However, sensitivity to halothane, a structurally distinct VA, is differentially affected by Go pathway mutants. The RGS overexpressing strains, a goa-1 missense mutant found to carry a novel mutation near the GTP-binding domain, and eat-16(rf) mutants, which suppress goa-1(gf) mutations, are all halothane resistant; goa-1(null) mutants have wild-type sensitivities. Double mutant strains carrying mutations in both goa-1 and unc-64, which codes for a neuronal syntaxin previously found to regulate VA sensitivity, show that the syntaxin mutant phenotypes depend in part on goa-1 expression. Pharmacological assays using the cholinesterase inhibitor aldicarb suggest that VAs and GOA-1 similarly downregulate cholinergic neurotransmitter release in C. elegans. Thus, the mechanism of action of VAs in C. elegans is regulated by Goalpha, and presynaptic Goalpha-effectors are candidate VA molecular targets. PMID:11404329

RNA polymerase III mutants in TFIIFα-like C37 that cause terminator readthrough with no decrease in transcription output.

PubMed

Rijal, Keshab; Maraia, Richard J

2013-01-07

How eukaryotic RNA polymerases switch from elongation to termination is unknown. Pol III subunits Rpc53 and Rpc37 (C53/37) form a heterodimer homologous to TFIIFβ/α. C53/37 promotes efficient termination and together with C11 also mediates pol III recycling in vitro. We previously developed Schizosaccharomyces pombe strains that report on two pol III termination activities: RNA oligo(U) 3'-end cleavage, and terminator readthrough. We randomly mutagenized C53 and C37 and isolated many C37 mutants with terminator readthrough but no comparable C53 mutants. The majority of C37 mutants have strong phenotypes with up to 40% readthrough and map to a C-terminal tract previously localized near Rpc2p in the pol III active center while a minority represent a distinct class with weaker phenotype, less readthrough and 3'-oligo(U) lengthening. Nascent pre-tRNAs released from a terminator by C37 mutants have shorter 3'-oligo(U) tracts than in cleavage-deficient C11 double mutants indicating RNA 3'-end cleavage during termination. We asked whether termination deficiency affects transcription output in the mutants in vivo both by monitoring intron-containing nascent transcript levels and (14)C-uridine incorporation. Surprisingly, multiple termination mutants have no decrease in transcript output relative to controls. These data are discussed in context of current models of pol III transcription.

Mutation in Torenia fournieri Lind. UFO homolog confers loss of TfLFY interaction and results in a petal to sepal transformation.

PubMed

Sasaki, Katsutomo; Yamaguchi, Hiroyasu; Aida, Ryutaro; Shikata, Masahito; Abe, Tomoko; Ohtsubo, Norihiro

2012-09-01

We identified a Torenia fournieri Lind. mutant (no. 252) that exhibited a sepaloid phenotype in which the second whorls were changed to sepal-like organs. This mutant had no stamens, and the floral organs consisted of sepals and carpels. Although the expression of a torenia class B MADS-box gene, GLOBOSA (TfGLO), was abolished in the 252 mutant, no mutation of TfGLO was found. Among torenia homologs such as APETALA1 (AP1), LEAFY (LFY), and UNUSUAL FLORAL ORGANS (UFO), which regulate expression of class B genes in Arabidopsis, only accumulation of the TfUFO transcript was diminished in the 252 mutant. Furthermore, a missense mutation was found in the coding region of the mutant TfUFO. Intact TfUFO complemented the mutant phenotype whereas mutated TfUFO did not; in addition, the transgenic phenotype of TfUFO-knockdown torenias coincided with the mutant phenotype. Yeast two-hybrid analysis revealed that the mutated TfUFO lost its ability to interact with TfLFY protein. In situ hybridization analysis indicated that the transcripts of TfUFO and TfLFY were partially accumulated in the same region. These results clearly demonstrate that the defect in TfUFO caused the sepaloid phenotype in the 252 mutant due to the loss of interaction with TfLFY. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Furfural-tolerant Zymomonas mobilis derived from error-prone PCR-based whole genome shuffling and their tolerant mechanism.

PubMed

Huang, Suzhen; Xue, Tingli; Wang, Zhiquan; Ma, Yuanyuan; He, Xueting; Hong, Jiefang; Zou, Shaolan; Song, Hao; Zhang, Minhua

2018-04-01

Furfural-tolerant strain is essential for the fermentative production of biofuels or chemicals from lignocellulosic biomass. In this study, Zymomonas mobilis CP4 was for the first time subjected to error-prone PCR-based whole genome shuffling, and the resulting mutants F211 and F27 that could tolerate 3 g/L furfural were obtained. The mutant F211 under various furfural stress conditions could rapidly grow when the furfural concentration reduced to 1 g/L. Meanwhile, the two mutants also showed higher tolerance to high concentration of glucose than the control strain CP4. Genome resequencing revealed that the F211 and F27 had 12 and 13 single-nucleotide polymorphisms. The activity assay demonstrated that the activity of NADH-dependent furfural reductase in mutant F211 and CP4 was all increased under furfural stress, and the activity peaked earlier in mutant than in control. Also, furfural level in the culture of F211 was also more rapidly decreased. These indicate that the increase in furfural tolerance of the mutants may be resulted from the enhanced NADH-dependent furfural reductase activity during early log phase, which could lead to an accelerated furfural detoxification process in mutants. In all, we obtained Z. mobilis mutants with enhanced furfural and high concentration of glucose tolerance, and provided valuable clues for the mechanism of furfural tolerance and strain development.

The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib.

PubMed

Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

2018-02-01

The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Multiplex growth rate phenotyping of synthetic mutants in selection to engineer glucose and xylose co-utilization in Escherichia coli.

PubMed

Groot, Joost; Cepress-Mclean, Sidney C; Robbins-Pianka, Adam; Knight, Rob; Gill, Ryan T

2017-04-01

Engineering the simultaneous consumption of glucose and xylose sugars is critical to enable the sustainable production of biofuels from lignocellulosic biomass. In most major industrial microorganisms glucose completely inhibits the uptake of xylose, limiting efficient sugar mixture conversion. In E. coli removal of the major glucose transporter PTS allows for glucose and xylose co-consumption but only after prolonged adaptation, which is an effective process but hard to control and prone to co-evolving undesired traits. Here we synthetically engineer mutants to target sugar co-consumption properties; we subject a PTS - mutant to a short adaptive step and subsequently either delete or overexpress key genes previously suggested to affect sugar consumption. Screening the co-consumption properties of these mutants individually is very laborious. We show we can evaluate sugar co-consumption properties in parallel by culturing the mutants in selection and applying a novel approach that computes mutant growth rates in selection using chromosomal barcode counts obtained from Next-Generation Sequencing. We validate this multiplex growth rate phenotyping approach with individual mutant pure cultures, identify new instances of mutants cross-feeding on metabolic byproducts, and, importantly, find that the rates of glucose and xylose co-consumption can be tuned by altering glucokinase expression in our PTS - background. Biotechnol. Bioeng. 2017;114: 885-893. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Remote intracranial recurrence of IDH mutant gliomas is associated with TP53 mutations and an 8q gain

PubMed Central

Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi

2017-01-01

Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679

Altered Fermentative Metabolism in Chlamydomonas reinhardtii Mutants Lacking Pyruvate Formate Lyase and Both Pyruvate Formate Lyase and Alcohol Dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Catalanotti, C.; Dubini, A.; Subramanian, V.

2012-02-01

Chlamydomonas reinhardtii, a unicellular green alga, often experiences hypoxic/anoxic soil conditions that activate fermentation metabolism. We isolated three Chlamydomonas mutants disrupted for the pyruvate formate lyase (PFL1) gene; the encoded PFL1 protein catalyzes a major fermentative pathway in wild-type Chlamydomonas cells. When the pfl1 mutants were subjected to dark fermentative conditions, they displayed an increased flux of pyruvate to lactate, elevated pyruvate decarboxylation, ethanol accumulation, diminished pyruvate oxidation by pyruvate ferredoxin oxidoreductase, and lowered H2 production. The pfl1-1 mutant also accumulated high intracellular levels of lactate, succinate, alanine, malate, and fumarate. To further probe the system, we generated a doublemore » mutant (pfl1-1 adh1) that is unable to synthesize both formate and ethanol. This strain, like the pfl1 mutants, secreted lactate, but it also exhibited a significant increase in the levels of extracellular glycerol, acetate, and intracellular reduced sugars and a decrease in dark, fermentative H2 production. Whereas wild-type Chlamydomonas fermentation primarily produces formate and ethanol, the double mutant reroutes glycolytic carbon to lactate and glycerol. Although the metabolic adjustments observed in the mutants facilitate NADH reoxidation and sustained glycolysis under dark, anoxic conditions, the observed changes could not have been predicted given our current knowledge of the regulation of fermentation metabolism.« less

Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction

PubMed Central

Mochizuki, Nobuyoshi; Brusslan, Judy A.; Larkin, Robert; Nagatani, Akira; Chory, Joanne

2001-01-01

A plastid-derived signal plays an important role in the coordinated expression of both nuclear- and chloroplast-localized genes that encode photosynthesis-related proteins. Arabidopsis GUN (genomes uncoupled) loci have been identified as components of plastid-to-nucleus signal transduction. Unlike wild-type plants, gun mutants have nuclear Lhcb1 expression in the absence of chloroplast development. We observed a synergistic phenotype in some gun double-mutant combinations, suggesting there are at least two independent pathways in plastid-to-nucleus signal transduction. There is a reduction of chlorophyll accumulation in gun4 and gun5 mutant plants, and a gun4gun5 double mutant shows an albino phenotype. We cloned the GUN5 gene, which encodes the ChlH subunit of Mg-chelatase. We also show that gun2 and gun3 are alleles of the known photomorphogenic mutants, hy1 and hy2, which are required for phytochromobilin synthesis from heme. These findings suggest that certain perturbations of the tetrapyrrole biosynthetic pathway generate a signal from chloroplasts that causes transcriptional repression of nuclear genes encoding plastid-localized proteins. The comparison of mutant phenotypes of gun5 and another Mg-chelatase subunit (ChlI) mutant suggests a specific function for ChlH protein in the plastid-signaling pathway. PMID:11172074

The Mechanism of Starch Over-Accumulation in Chlamydomonas reinhardtii High-Starch Mutants Identified by Comparative Transcriptome Analysis

PubMed Central

Koo, Kwang M.; Jung, Sera; Lee, Beom S.; Kim, Jin-Baek; Jo, Yeong D.; Choi, Hong-Il; Kang, Si-Yong; Chung, Gook-H.; Jeong, Won-Joong; Ahn, Joon-Woo

2017-01-01

The focus of this study was the mechanism of starch accumulation in Chlamydomonas reinhardtii high-starch mutants. Three C. reinhardtii mutants showing high-starch content were generated using gamma irradiation. When grown under nitrogen-deficient conditions, these mutants had more than twice as much starch than a wild-type control. The mechanism of starch over-accumulation in these mutants was studied with comparative transcriptome analysis. In all mutants, induction of phosphoglucomutase 1 (PGM1) expression was detected; PGM1 catalyzes the inter-conversion of glucose 1-phosphate and glucose 6-phosphate in both starch biosynthetic and glycolytic pathway. Interestingly, transcript levels of phosphoglucose isomerase 1 (PGI1), fructose 1,6-bisphosphate aldolase 1 and 2 (FBA1 and FBA2) were down-regulated in all mutants; PGI1, FBA1, and FBA2 act on downstream of glucose 6-phosphate conversion in glycolytic pathway. Therefore, down-regulations of PGI1, FBA1, and FBA2 may lead to accumulation of upstream metabolites, notably glucose 6-phosphate, resulting in induction of PGM1 expression through feed-forward regulation and that PGM1 overexpression caused starch over-accumulation in mutants. These results suggest that PGI1, FBA1, FBA2, and PGM1 correlate with each other in terms of coordinated transcriptional regulation and play central roles for starch over-accumulation in C. reinhardtii. PMID:28588557

BRAF Inhibitors for BRAF V600E Mutant Colorectal Cancers: Literature Survey and Case Report

PubMed Central

Can, Mehmet Fatih; Ozerhan, Ismail Hakki; Yagci, Gokhan; Zeybek, Nazif; Kavakli, Kutan; Gurkok, Sedat; Gozubuyuk, Alper; Genc, Onur; Erdem, Gokhan; Ozet, Ahmet; Gerek, Mustafa; Peker, Yusuf

2018-01-01

The main method of fighting against colon cancer is targeted treatment. BRAF inhibitors, which are accepted as standard treatment for V600E mutant malign melanomas, are the newest approach for targeted treatment of V600E mutant colorectal cancers. In this case report, we share our experience about the use of BRAF inhibitor vemurafenib on a V600E mutant metastatic right colon adenocarcinoma patient. A 59-year-old male with only lung multiple metastatic V600E mutant right colon cancer presented to our clinic. The patient was evaluated and FOLFOX + bevacizumab treatment was initiated, which was then continued with vemurafenib. A remarkable response was achieved with vemurafenib treatment in which the drug resistance occurred approximately in the sixth month. Even though the patient benefited majorly from vemurafenib, he died on the 20th month of the diagnosis. The expected overall survival for metastatic V600E mutant colon adenocarcinoma patients is 4.7 months. BRAF inhibitors provide new treatment alternatives for V600E mutant colorectal cancers, with prolonged overall survival. BRAF inhibitors in combination with MEK inhibitors are reported as feasible treatment to overcome BRAF inhibitor drug resistance on which phase studies are still in progress. To conclude, BRAF inhibitors alone or in combination with other drugs provide a chance for curing BRAF V600E mutant colorectal cancer patients. PMID:29850361

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

A Novel Point Mutation at Position 156 of Reverse Transcriptase from Feline Immunodeficiency Virus Confers Resistance to the Combination of (−)-β-2′,3′-Dideoxy-3′-Thiacytidine and 3′-Azido-3′-Deoxythymidine

PubMed Central

Smith, Robert A.; Remington, Kathryn M.; Preston, Bradley D.; Schinazi, Raymond F.; North, Thomas W.

1998-01-01

Mutants of feline immunodeficiency virus (FIV) resistant to (−)-β-2′,3′-dideoxy-3′-thiacytidine (3TC) were selected by culturing virus in the presence of increasing stepwise concentrations of 3TC. Two plaque-purified variants were isolated from the original mutant population, and both of these mutants were resistant to 3TC. Surprisingly, these mutants were also phenotypically resistant to 3′-azido-3′-deoxythymidine (AZT) and to the combination of 3TC and AZT. Purified reverse transcriptase (RT) from one of these plaque-purified mutants was resistant to the 5′-triphosphates of 3TC and AZT. DNA sequence analysis of the RT-encoding region of the pol gene amplified from the plaque-purified mutants revealed a Pro-to-Ser mutation at position 156 of RT. A site-directed mutant of FIV engineered to contain this Pro-156-Ser mutation was resistant to 3TC, AZT, and the combination of 3TC and AZT, confirming the role of the Pro-156-Ser mutation in the resistance of FIV to these two nucleoside analogs. This represents the first report of a lentiviral mutant resistant to the combination of AZT and 3TC due to a single, unique point mutation. PMID:9499094

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism.

PubMed

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R; Raikhel, Natasha V

2015-01-06

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red staining suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.

Mutant DnaAs of Escherichia coli that are refractory to negative control

PubMed Central

Chodavarapu, Sundari; Felczak, Magdalena M.; Simmons, Lyle A.; Murillo, Alec; Kaguni, Jon M.

2013-01-01

DnaA is the initiator of DNA replication in bacteria. A mutant DnaA named DnaAcos is unusual because it is refractory to negative regulation. We developed a genetic method to isolate other mutant DnaAs that circumvent regulation to extend our understanding of mechanisms that control replication initiation. Like DnaAcos, one mutant bearing a tyrosine substitution for histidine 202 (H202Y) withstands the regulation exerted by datA, hda and dnaN (β clamp), and both DnaAcos and H202Y resist inhibition by the Hda-β clamp complex in vitro. Other mutant DnaAs carrying G79D, E244K, V303M or E445K substitutions are either only partially sensitive or refractory to inhibition by the Hda-β clamp complex in vitro but are responsive to hda expression in vivo. All mutant DnaAs remain able to interact directly with Hda. Of interest, both DnaAcos and DnaAE244K bind more avidly to Hda. These mutants, by sequestrating Hda, may limit its availability to regulate other DnaA molecules, which remain active to induce extra rounds of DNA replication. Other evidence suggests that a mutant bearing a V292M substitution hyperinitiates by escaping the effect of an unknown regulatory factor. Together, our results provide new insight into the mechanisms that regulate replication initiation in Escherichia coli. PMID:23990329

Mutant DnaAs of Escherichia coli that are refractory to negative control.

PubMed

Chodavarapu, Sundari; Felczak, Magdalena M; Simmons, Lyle A; Murillo, Alec; Kaguni, Jon M

2013-12-01

DnaA is the initiator of DNA replication in bacteria. A mutant DnaA named DnaAcos is unusual because it is refractory to negative regulation. We developed a genetic method to isolate other mutant DnaAs that circumvent regulation to extend our understanding of mechanisms that control replication initiation. Like DnaAcos, one mutant bearing a tyrosine substitution for histidine 202 (H202Y) withstands the regulation exerted by datA, hda and dnaN (β clamp), and both DnaAcos and H202Y resist inhibition by the Hda-β clamp complex in vitro. Other mutant DnaAs carrying G79D, E244K, V303M or E445K substitutions are either only partially sensitive or refractory to inhibition by the Hda-β clamp complex in vitro but are responsive to hda expression in vivo. All mutant DnaAs remain able to interact directly with Hda. Of interest, both DnaAcos and DnaAE244K bind more avidly to Hda. These mutants, by sequestrating Hda, may limit its availability to regulate other DnaA molecules, which remain active to induce extra rounds of DNA replication. Other evidence suggests that a mutant bearing a V292M substitution hyperinitiates by escaping the effect of an unknown regulatory factor. Together, our results provide new insight into the mechanisms that regulate replication initiation in Escherichia coli.

Mutation in the Fas Pathway Impairs CD8+ T Cell Memory1

PubMed Central

Dudani, Renu; Russell, Marsha; van Faassen, Henk; Krishnan, Lakshmi; Sad, Subash

2014-01-01

Fas death pathway is important for lymphocyte homeostasis, but the role of Fas pathway in T cell memory development is not clear. We show that whereas the expansion and contraction of CD8+ T cell response against Listeria monocytogenes were similar for wild-type (WT) and Fas ligand (FasL) mutant mice, the majority of memory CD8+ T cells in FasL mutant mice displayed an effector memory phenotype in the long-term in comparison with the mainly central memory phenotype displayed by memory CD8+ T cells in WT mice. Memory CD8+ T cells in FasL mutant mice expressed reduced levels of IFN-γ and displayed poor homeostatic and Ag-induced proliferation. Impairment in CD8+ T cell memory in FasL mutant hosts was not due to defective programming or the expression of mutant FasL on CD8+ T cells, but was caused by perturbed cytokine environment in FasL mutant mice. Although adoptively transferred WT memory CD8+ T cells mediated protection against L. monocytogenes in either the WT or FasL mutant hosts, FasL mutant memory CD8+ T cells failed to mediate protection even in WT hosts. Thus, in individuals with mutation in Fas pathway, impairment in the function of the memory CD8+ T cells may increase their susceptibility to recurrent/latent infections. PMID:18292515

Candidate genes for panhypopituitarism identified by gene expression profiling

PubMed Central

Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

2011-01-01

Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

A mutation that eliminates bundle sheath extensions reduces leaf hydraulic conductance, stomatal conductance and assimilation rates in tomato (Solanum lycopersicum).

PubMed

Zsögön, Agustin; Negrini, Ana Clarissa Alves; Peres, Lázaro Eustáquio Pereira; Nguyen, Hoa Thi; Ball, Marilyn C

2015-01-01

Bundle sheath extensions (BSEs) are key features of leaf structure whose distribution differs among species and ecosystems. The genetic control of BSE development is unknown, so BSE physiological function has not yet been studied through mutant analysis. We screened a population of ethyl methanesulfonate (EMS)-induced mutants in the genetic background of the tomato (Solanum lycopersicum) model Micro-Tom and found a mutant lacking BSEs. The leaf phenotype of the mutant strongly resembled the tomato mutant obscuravenosa (obv). We confirmed that obv lacks BSEs and that it is not allelic to our induced mutant, which we named obv-2. Leaves lacking BSEs had lower leaf hydraulic conductance and operated with lower stomatal conductance and correspondingly lower assimilation rates than wild-type leaves. This lower level of function occurred despite similarities in vein density, midvein vessel diameter and number, stomatal density, and leaf area between wild-type and mutant leaves, the implication being that the lack of BSEs hindered water dispersal within mutant leaves. Our results comparing near-isogenic lines within a single species confirm the hypothesised role of BSEs in leaf hydraulic function. They further pave the way for a genetic model-based analysis of a common leaf structure with deep ecological consequences. © 2014 The Authors New Phytologist © 2014 New Phytologist Trust.

Nexus of signaling and endocytosis in oncogenesis driven by non-small cell lung cancer-associated epidermal growth factor receptor mutants

PubMed Central

Chung, Byung Min; Tom, Eric; Zutshi, Neha; Bielecki, Timothy Alan; Band, Vimla; Band, Hamid

2014-01-01

Epidermal growth factor receptor (EGFR) controls a wide range of cellular processes, and aberrant EGFR signaling as a result of receptor overexpression and/or mutation occurs in many types of cancer. Tumor cells in non-small cell lung cancer (NSCLC) patients that harbor EGFR kinase domain mutations exhibit oncogene addiction to mutant EGFR, which confers high sensitivity to tyrosine kinase inhibitors (TKIs). As patients invariably develop resistance to TKIs, it is important to delineate the cell biological basis of mutant EGFR-induced cellular transformation since components of these pathways can serve as alternate therapeutic targets to preempt or overcome resistance. NSCLC-associated EGFR mutants are constitutively-active and induce ligand-independent transformation in nonmalignant cell lines. Emerging data suggest that a number of factors are critical for the mutant EGFR-dependent tumorigenicity, and bypassing the effects of TKIs on these pathways promotes drug resistance. For example, activation of downstream pathways such as Akt, Erk, STAT3 and Src is critical for mutant EGFR-mediated biological processes. It is now well-established that the potency and spatiotemporal features of cellular signaling by receptor tyrosine kinases such as EGFR, as well as the specific pathways activated, is determined by the nature of endocytic traffic pathways through which the active receptors traverse. Recent evidence indicates that NSCLC-associated mutant EGFRs exhibit altered endocytic trafficking and they exhibit reduced Cbl ubiquitin ligase-mediated lysosomal downregulation. More recent work has shown that mutant EGFRs undergo ligand-independent traffic into the endocytic recycling compartment, a behavior that plays a key role in Src pathway activation and oncogenesis. These studies are beginning to delineate the close nexus between signaling and endocytic traffic of EGFR mutants as a key driver of oncogenic processes. Therefore, in this review, we will discuss the links between mutant EGFR signaling and endocytic properties, and introduce potential mechanisms by which altered endocytic properties of mutant EGFRs may alter signaling and vice versa as well as their implications for NSCLC therapy. PMID:25493220

Role of Tir and Intimin in the Virulence of Rabbit Enteropathogenic Escherichia coli Serotype O103:H2

PubMed Central

Marchès, Olivier; Nougayrède, Jean-Philippe; Boullier, Séverine; Mainil, Jacques; Charlier, Gérard; Raymond, Isabelle; Pohl, Pierre; Boury, Michèle; De Rycke, Jean; Milon, Alain; Oswald, Eric

2000-01-01

Attaching and effacing (A/E) rabbit enteropathogenic Escherichia coli (REPEC) strains belonging to serogroup O103 are an important cause of diarrhea in weaned rabbits. Like human EPEC strains, they possess the locus of enterocyte effacement clustering the genes involved in the formation of the A/E lesions. In addition, pathogenic REPEC O103 strains produce an Esp-dependent but Eae (intimin)-independent alteration of the host cell cytoskeleton characterized by the formation of focal adhesion complexes and the reorganization of the actin cytoskeleton into bundles of stress fibers. To investigate the role of intimin and its translocated coreceptor (Tir) in the pathogenicity of REPEC, we have used a newly constructed isogenic tir null mutant together with a previously described eae null mutant. When human HeLa epithelial cells were infected, the tir mutant was still able to induce the formation of stress fibers as previously reported for the eae null mutant. When the rabbit epithelial cell line RK13 was used, REPEC O103 produced a classical fluorescent actin staining (FAS) effect, whereas both the eae and tir mutants were FAS negative. In a rabbit ligated ileal loop model, neither mutant was able to induce A/E lesions. In contrast to the parental strain, which intimately adhered to the enterocytes and destroyed the brush border microvilli, bacteria of both mutants were clustered in the mucus without reaching and damaging the microvilli. The role of intimin and Tir was then analyzed in vivo by oral inoculation of weaned rabbits. Although both mutants were still present in the intestinal flora of the rabbits 3 weeks after oral inoculation, neither mutant strain induced any clinical signs or significant weight loss in the inoculated rabbits whereas the parental strain caused the death of 90% of the inoculated rabbits. Nevertheless, an inflammatory infiltrate was present in the lamina propria of the rabbits infected with both mutants, with an inflammatory response greater for the eae null mutant. In conclusion, we have confirmed the role of intimin in virulence, and we have shown, for the first time, that Tir is also a key factor in vivo for pathogenicity. PMID:10722617

Role of tir and intimin in the virulence of rabbit enteropathogenic Escherichia coli serotype O103:H2.

PubMed

Marchès, O; Nougayrède, J P; Boullier, S; Mainil, J; Charlier, G; Raymond, I; Pohl, P; Boury, M; De Rycke, J; Milon, A; Oswald, E

2000-04-01

Attaching and effacing (A/E) rabbit enteropathogenic Escherichia coli (REPEC) strains belonging to serogroup O103 are an important cause of diarrhea in weaned rabbits. Like human EPEC strains, they possess the locus of enterocyte effacement clustering the genes involved in the formation of the A/E lesions. In addition, pathogenic REPEC O103 strains produce an Esp-dependent but Eae (intimin)-independent alteration of the host cell cytoskeleton characterized by the formation of focal adhesion complexes and the reorganization of the actin cytoskeleton into bundles of stress fibers. To investigate the role of intimin and its translocated coreceptor (Tir) in the pathogenicity of REPEC, we have used a newly constructed isogenic tir null mutant together with a previously described eae null mutant. When human HeLa epithelial cells were infected, the tir mutant was still able to induce the formation of stress fibers as previously reported for the eae null mutant. When the rabbit epithelial cell line RK13 was used, REPEC O103 produced a classical fluorescent actin staining (FAS) effect, whereas both the eae and tir mutants were FAS negative. In a rabbit ligated ileal loop model, neither mutant was able to induce A/E lesions. In contrast to the parental strain, which intimately adhered to the enterocytes and destroyed the brush border microvilli, bacteria of both mutants were clustered in the mucus without reaching and damaging the microvilli. The role of intimin and Tir was then analyzed in vivo by oral inoculation of weaned rabbits. Although both mutants were still present in the intestinal flora of the rabbits 3 weeks after oral inoculation, neither mutant strain induced any clinical signs or significant weight loss in the inoculated rabbits whereas the parental strain caused the death of 90% of the inoculated rabbits. Nevertheless, an inflammatory infiltrate was present in the lamina propria of the rabbits infected with both mutants, with an inflammatory response greater for the eae null mutant. In conclusion, we have confirmed the role of intimin in virulence, and we have shown, for the first time, that Tir is also a key factor in vivo for pathogenicity.

Genetic Characterization of Escherichia coli Type 1 Pilus Adhesin Mutants and Identification of a Novel Binding Phenotype

PubMed Central

Hamrick, Terri S.; Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Horton, John R.; Russell, Perry W.; Orndorff, Paul E.

2000-01-01

Five Escherichia coli type 1 pilus mutants that had point mutations in fimH, the gene encoding the type 1 pilus adhesin FimH, were characterized. FimH is a minor component of type 1 pili that is required for the pili to bind and agglutinate guinea pig erythrocytes in a mannose-inhibitable manner. Point mutations were located by DNA sequencing and deletion mapping. All mutations mapped within the signal sequence or in the first 28% of the predicted mature protein. All mutations were missense mutations except for one, a frameshift lesion that was predicted to cause the loss of approximately 60% of the mature FimH protein. Bacterial agglutination tests with polyclonal antiserum raised to a LacZ-FimH fusion protein failed to confirm that parental amounts of FimH cross-reacting material were expressed in four of the five mutants. The remaining mutant, a temperature-sensitive (ts) fimH mutant that agglutinated guinea pig erythrocytes after growth at 31°C but not at 42°C, reacted with antiserum at both temperatures in a manner similar to the parent. Consequently, this mutant was chosen for further study. Temperature shift experiments revealed that new FimH biosynthesis was required for the phenotypic change. Guinea pig erythrocyte and mouse macrophage binding experiments using the ts mutant grown at the restrictive and permissive temperatures revealed that whereas erythrocyte binding was reduced to a level comparable to that of a fimH insertion mutant at the restrictive temperature, mouse peritoneal macrophages were bound with parental efficiency at both the permissive and restrictive temperatures. Also, macrophage binding by the ts mutant was insensitive to mannose inhibition after growth at 42°C but sensitive after growth at 31°C. The ts mutant thus binds macrophages with one receptor specificity at 31°C and another at 42°C. PMID:10869080

Aggregation of ALS-linked FUS mutant sequesters RNA binding proteins and impairs RNA granules formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takanashi, Keisuke; Yamaguchi, Atsushi, E-mail: atsyama@restaff.chiba-u.jp

Highlights: • Aggregation of ALS-linked FUS mutant sequesters ALS-associated RNA-binding proteins (FUS wt, hnRNP A1, and hnRNP A2). • Aggregation of ALS-linked FUS mutant sequesters SMN1 in the detergent-insoluble fraction. • Aggregation of ALS-linked FUS mutant reduced the number of speckles in the nucleus. • Overproduced ALS-linked FUS mutant reduced the number of processing-bodies (PBs). - Abstract: Protein aggregate/inclusion is one of hallmarks for neurodegenerative disorders including amyotrophic lateral sclerosis (ALS). FUS/TLS, one of causative genes for familial ALS, encodes a multifunctional DNA/RNA binding protein predominantly localized in the nucleus. C-terminal mutations in FUS/TLS cause the retention and the inclusionmore » of FUS/TLS mutants in the cytoplasm. In the present study, we examined the effects of ALS-linked FUS mutants on ALS-associated RNA binding proteins and RNA granules. FUS C-terminal mutants were diffusely mislocalized in the cytoplasm as small granules in transiently transfected SH-SY5Y cells, whereas large aggregates were spontaneously formed in ∼10% of those cells. hnRNP A1, hnRNP A2, and SMN1 as well as FUS wild type were assembled into stress granules under stress conditions, and these were also recruited to FUS mutant-derived spontaneous aggregates in the cytoplasm. These aggregates stalled poly(A) mRNAs and sequestered SMN1 in the detergent insoluble fraction, which also reduced the number of nuclear oligo(dT)-positive foci (speckles) in FISH (fluorescence in situ hybridization) assay. In addition, the number of P-bodies was decreased in cells harboring cytoplasmic granules of FUS P525L. These findings raise the possibility that ALS-linked C-terminal FUS mutants could sequester a variety of RNA binding proteins and mRNAs in the cytoplasmic aggregates, which could disrupt various aspects of RNA equilibrium and biogenesis.« less

Aureusimines in Staphylococcus aureus are not involved in virulence.

PubMed

Sun, Fei; Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; He, Chuan; Bae, Taeok

2010-12-29

Recently, dipeptide aureusimines were reported to activate expression of staphylococcal virulence genes, such as alpha-hemolysin, and increase S. aureus virulence. Surprisingly, most of the virulence genes affected by aureusimines form part of the regulon of the SaeRS two component system (TCS), raising the possibility that SaeRS might be directly or indirectly involved in the aureusimine-dependent signaling process. Using HPLC analyses, we confirmed that a transposon mutant of ausA, the gene encoding the aureusimine dipeptide synthesis enzyme, does not produce dipeptides. However, the transposon mutant showed normal hemolysis activity and alpha-hemolysin/SaeP production. Furthermore, the P1 promoter of the sae operon, one of the targets of the SaeRS TCS, showed normal transcription activity. Moreover, in contrast to the original report, the ausA transposon mutant did not exhibit attenuated virulence in an animal infection model. DNA sequencing revealed that the ausA deletion mutant used in the original study has an 83 nt-duplication in saeS. Hemolysis activity of the original mutant was restored by a plasmid carrying the sae operon. A mutant of the sae operon showed elevated resistance to chloramphenicol and erythromycin, two antibiotics widely used during staphylococcal mutagenesis. At 43°C in the presence of erythromycin and aeration, the conditions typically employed for staphylococcal mutagenesis, an saeR transposon mutant grew much faster than a control mutant and the saeR mutant was highly enriched in a mixed culture experiment. Our results show that the previously reported roles of aureusimines in staphylococcal gene regulation and virulence were due to an unintended mutation in saeS, which was likely selected due to elevated resistance of the mutant to environmental stresses. Thus, there is no evidence indicating that the dipeptide aureusimines play a role in sae-mediated virulence factor production or contribute to staphylococcal virulence.

A chemically induced new pea (Pisum sativum) mutant SGECdt with increased tolerance to, and accumulation of, cadmium.

PubMed

Tsyganov, Viktor E; Belimov, Andrei A; Borisov, Alexey Y; Safronova, Vera I; Georgi, Manfred; Dietz, Karl-Josef; Tikhonovich, Igor A

2007-02-01

To date, there are no crop mutants described in the literature that display both Cd accumulation and tolerance. In the present study a unique pea (Pisum sativum) mutant SGECd(t) with increased Cd tolerance and accumulation was isolated and characterized. Ethylmethane sulfonate mutagenesis of the pea line SGE was used to obtain the mutant. Screening for Cd-tolerant seedlings in the M2 generation was performed using hydroponics in the presence of 6 microm CdCl2. Hybridological analysis was used to identify the inheritance of the mutant phenotype. Several physiological and biochemical characteristics of SGECd(t) were studied in hydroponic experiments in the presence of 3 microm CdCl2, and elemental analysis was conducted. The mutant SGECd(t) was characterized as having a monogenic inheritance and a recessive phenotype. It showed increased Cd concentrations in roots and shoots but no obvious morphological defects, demonstrating its capability to cope well with increased Cd levels in its tissues. The enhanced Cd accumulation in the mutant was accompanied by maintenance of homeostasis of shoot Ca, Mg, Zn and Mn contents, and root Ca and Mg contents. Through the application of La(+3) and the exclusion of Ca from the nutrient solution, maintenance of nutrient homeostasis in Cd-stressed SGECd(t) was shown to contribute to the increased Cd tolerance. Control plants of the mutant (i.e. no Cd treatment) had elevated concentrations of glutathione (GSH) in the roots. Through measurements of chitinase and guaiacol-dependent peroxidase activities, as well as proline and non-protein thiol (NPT) levels, it was shown that there were lower levels of Cd stress both in roots and shoots of SGECd(t). Accumulation of phytochelatins [(PCcalculated) = (NPT)-(GSH)] could be excluded as a cause of the increased Cd tolerance in the mutant. The SGECd(t) mutant represents a novel and unique model to study adaptation of plants to toxic heavy metal concentrations.

Secondary Metabolism and Interspecific Competition Affect Accumulation of Spontaneous Mutants in the GacS-GacA Regulatory System in Pseudomonas protegens.

PubMed

Yan, Qing; Lopes, Lucas D; Shaffer, Brenda T; Kidarsa, Teresa A; Vining, Oliver; Philmus, Benjamin; Song, Chunxu; Stockwell, Virginia O; Raaijmakers, Jos M; McPhail, Kerry L; Andreote, Fernando D; Chang, Jeff H; Loper, Joyce E

2018-01-16

Secondary metabolites are synthesized by many microorganisms and provide a fitness benefit in the presence of competitors and predators. Secondary metabolism also can be costly, as it shunts energy and intermediates from primary metabolism. In Pseudomonas spp., secondary metabolism is controlled by the GacS-GacA global regulatory system. Intriguingly, spontaneous mutations in gacS or gacA (Gac - mutants) are commonly observed in laboratory cultures. Here we investigated the role of secondary metabolism in the accumulation of Gac - mutants in Pseudomonas protegens strain Pf-5. Our results showed that secondary metabolism, specifically biosynthesis of the antimicrobial compound pyoluteorin, contributes significantly to the accumulation of Gac - mutants. Pyoluteorin biosynthesis, which poses a metabolic burden on the producer cells, but not pyoluteorin itself, leads to the accumulation of the spontaneous mutants. Interspecific competition also influenced the accumulation of the Gac - mutants: a reduced proportion of Gac - mutants accumulated when P. protegens Pf-5 was cocultured with Bacillus subtilis than in pure cultures of strain Pf-5. Overall, our study associated a fitness trade-off with secondary metabolism, with metabolic costs versus competitive benefits of production influencing the evolution of P. protegens , assessed by the accumulation of Gac - mutants. IMPORTANCE Many microorganisms produce antibiotics, which contribute to ecologic fitness in natural environments where microbes constantly compete for resources with other organisms. However, biosynthesis of antibiotics is costly due to the metabolic burdens of the antibiotic-producing microorganism. Our results provide an example of the fitness trade-off associated with antibiotic production. Under noncompetitive conditions, antibiotic biosynthesis led to accumulation of spontaneous mutants lacking a master regulator of antibiotic production. However, relatively few of these spontaneous mutants accumulated when a competitor was present. Results from this work provide information on the evolution of antibiotic biosynthesis and provide a framework for their discovery and regulation.

Characterization of a Lignified Secondary Phloem Fibre‐deficient Mutant of Jute (Corchorus capsularis)

PubMed Central

SENGUPTA, GARGI; PALIT, P.

2004-01-01

• Background and Aims High lignin content of lignocellulose jute fibre does not favour its utilization in making finer fabrics and other value‐added products. To aid the development of low‐lignin jute fibre, this study aimed to identify a phloem fibre mutant with reduced lignin. • Methods An x‐ray‐induced mutant line (CMU) of jute (Corchorus capsularis) was morphologically evaluated and the accession (CMU 013) with the most undulated phenotype was compared with its normal parent (JRC 212) for its growth, secondary fibre development and lignification of the fibre cell wall. • Key Results The normal and mutant plants showed similar leaf photosynthetic rates. The mutant grew more slowly, had shorter internodes and yielded much less fibre after retting. The fibre of the mutant contained 50 % less lignin but comparatively more cellulose than that of the normal type. Differentiation of primary and secondary vascular tissues throughout the CMU 013 stem was regular but it did not have secondary phloem fibre bundles as in JRC 212. Instead, a few thin‐walled, less lignified fibre cells formed uni‐ or biseriate radial rows within the phloem wedges of the middle stem. The lower and earliest developed part of the mutant stem had no lignified fibre cells. This developmental deficiency in lignification of fibre cells was correlated to a similar deficiency in phenylalanine ammonia lyase activity, but not peroxidase activity, in the bark tissue along the stem axis. In spite of severe reduction in lignin synthesis in the phloem cells this mutant functioned normally and bred true. • Conclusions In view of the observations made, the mutant is designated as deficient lignified phloem fibre (dlpf). This mutant may be utilized to engineer low‐lignin jute fibre strains and may also serve as a model to study the positional information that coordinates secondary wall thickening of fibre cells. PMID:14707004

Sequestosome 1/p62 links familial ALS mutant SOD1 to LC3 via an ubiquitin-independent mechanism.

PubMed

Gal, Jozsef; Ström, Anna-Lena; Kwinter, David M; Kilty, Renée; Zhang, Jiayu; Shi, Ping; Fu, Weisi; Wooten, Marie W; Zhu, Haining

2009-11-01

The p62/sequestosome 1 protein has been identified as a component of pathological protein inclusions in neurodegenerative diseases including amyotrophic lateral sclerosis (ALS). P62 has also been implicated in autophagy, a process of mass degradation of intracellular proteins and organelles. Autophagy is a critical pathway for degrading misfolded and/or damaged proteins, including the copper-zinc superoxide dismutase (SOD1) mutants linked to familial ALS. We previously reported that p62 interacted with ALS mutants of SOD1 and that the ubiquitin-association domain of p62 was dispensable for the interaction. In this study, we identified two distinct regions of p62 that were essential to its binding to mutant SOD1: the N-terminal Phox and Bem1 (PB1) domain (residues 1-104) and a separate internal region (residues 178-224) termed here as SOD1 mutant interaction region (SMIR). The PB1 domain is required for appropriate oligomeric status of p62 and the SMIR is the actual region interacting with mutant SOD1. Within the SMIR, the conserved W184, H190 and positively charged R183, R186, K187, and K189 residues are critical to the p62-mutant SOD1 interaction as substitution of these residues with alanine resulted in significantly abolished binding. In addition, SMIR and the p62 sequence responsible for the interaction with LC3, a protein essential for autophagy activation, are independent of each other. In cells lacking p62, the existence of mutant SOD1 in acidic autolysosomes decreased, suggesting that p62 can function as an adaptor between mutant SOD1 and the autophagy machinery. This study provides a novel molecular mechanism by which mutant SOD1 can be recognized by p62 in an ubiquitin-independent fashion and targeted for the autophagy-lysosome degradation pathway.

Listeria monocytogenes mutants with altered growth phenotypes at refrigeration temperature and high salt concentrations.

PubMed

Burall, Laurel S; Laksanalamai, Pongpan; Datta, Atin R

2012-02-01

Listeria monocytogenes can survive and grow in refrigerated temperatures and high-salt environments. In an effort to better understand the associated mechanisms, a library of ∼ 5,200 transposon mutants of LS411, a food isolate from the Jalisco cheese outbreak, were screened for their ability to grow in brain heart infusion (BHI) broth at 5°C or in the presence of 7% NaCl and two mutants with altered growth profiles were identified. The LS522 mutant has a transposon insertion between secA2 and iap and showed a significant reduction in growth in BHI broth at 5°C and in the presence of 7% NaCl. Reverse transcriptase quantitative PCR (RT-qPCR) revealed a substantial reduction in the expression of iap. Additionally, a hypothetical gene (met), containing a putative S-adenosylmethionine-dependent methyltransferase domain, downstream of iap had downregulated expression. In-frame deletion mutants of iap and met were created in LS411. The LS560 (LS411 Δiap) mutant showed reduced growth at 5°C and in the presence of 7% salt, confirming its role in cold and salt growth attenuation. Surprisingly, the LS655 (LS411 Δmet) mutant showed slightly increased growth during refrigeration, though no alteration was seen in salt growth relative to the wild-type strain. The LS527 mutant, containing an insertion 36 bp upstream of the gbu operon, showed reduced expression of the gbu transcript by RT-qPCR and also showed growth reduction at 5°C and in the presence of 7% salt. This attenuation was severely exacerbated when the mutant was grown under the combined stresses. Analysis of the gbu operon deletion mutant showed decreased growth in 7% salt and refrigeration, supporting the previously characterized role for this gene in cold and salt adaptation. These studies indicate the potential for an intricate relationship between environmental stress regulation and virulence in L. monocytogenes.

Listeria monocytogenes Mutants with Altered Growth Phenotypes at Refrigeration Temperature and High Salt Concentrations

PubMed Central

Burall, Laurel S.; Laksanalamai, Pongpan

2012-01-01

Listeria monocytogenes can survive and grow in refrigerated temperatures and high-salt environments. In an effort to better understand the associated mechanisms, a library of ∼ 5,200 transposon mutants of LS411, a food isolate from the Jalisco cheese outbreak, were screened for their ability to grow in brain heart infusion (BHI) broth at 5°C or in the presence of 7% NaCl and two mutants with altered growth profiles were identified. The LS522 mutant has a transposon insertion between secA2 and iap and showed a significant reduction in growth in BHI broth at 5°C and in the presence of 7% NaCl. Reverse transcriptase quantitative PCR (RT-qPCR) revealed a substantial reduction in the expression of iap. Additionally, a hypothetical gene (met), containing a putative S-adenosylmethionine-dependent methyltransferase domain, downstream of iap had downregulated expression. In-frame deletion mutants of iap and met were created in LS411. The LS560 (LS411 Δiap) mutant showed reduced growth at 5°C and in the presence of 7% salt, confirming its role in cold and salt growth attenuation. Surprisingly, the LS655 (LS411 Δmet) mutant showed slightly increased growth during refrigeration, though no alteration was seen in salt growth relative to the wild-type strain. The LS527 mutant, containing an insertion 36 bp upstream of the gbu operon, showed reduced expression of the gbu transcript by RT-qPCR and also showed growth reduction at 5°C and in the presence of 7% salt. This attenuation was severely exacerbated when the mutant was grown under the combined stresses. Analysis of the gbu operon deletion mutant showed decreased growth in 7% salt and refrigeration, supporting the previously characterized role for this gene in cold and salt adaptation. These studies indicate the potential for an intricate relationship between environmental stress regulation and virulence in L. monocytogenes. PMID:22179239

Evaluation of CLSI M44-A2 Disk Diffusion and Associated Breakpoint Testing of Caspofungin and Micafungin Using a Well-Characterized Panel of Wild-Type and fks Hot Spot Mutant Candida Isolates▿

PubMed Central

Arendrup, Maiken Cavling; Park, Steven; Brown, Steven; Pfaller, Michael; Perlin, David S.

2011-01-01

Disk diffusion testing has recently been standardized by the CLSI, and susceptibility breakpoints have been established for several antifungal compounds. For caspofungin, 5-μg disks are approved, and for micafungin, 10-μg disks are under evaluation. We evaluated the performances of caspofungin and micafungin disk testing using a panel of Candida isolates with and without known FKS echinocandin resistance mechanisms. Disk diffusion and microdilution assays were performed strictly according to CLSI documents M44-A2 and M27-A3. Eighty-nine clinical Candida isolates were included: Candida albicans (20 isolates/10 mutants), C. glabrata (19 isolates/10 mutants), C. dubliniensis (2 isolates/1 mutant), C. krusei (16 isolates/3 mutants), C. parapsilosis (14 isolates/0 mutants), and C. tropicalis (18 isolates/4 mutants). Quality control strains were C. parapsilosis ATCC 22019 and C. krusei ATCC 6258. The correlations between zone diameters and MIC results were good for both compounds, with identical susceptibility classifications for 93.3% of the isolates by applying the current CLSI breakpoints. However, the numbers of fks hot spot mutant isolates misclassified as being susceptible (S) (very major errors [VMEs]) were high (61% for caspofungin [S, ≥11 mm] and 93% for micafungin [S, ≥14 mm]). Changing the disk diffusion breakpoint to S at ≥22 mm significantly improved the discrimination. For caspofungin, 1 VME was detected (a C. tropicalis isolate with an F76S substitution) (3.5%), and for micafungin, 10 VMEs were detected, the majority of which were for C. glabrata (8/10). The broadest separation between zone diameter ranges for wild-type (WT) and mutant isolates was seen for caspofungin (6 to 12 mm versus −4 to 7 mm). In conclusion, caspofungin disk diffusion testing with a modified breakpoint led to excellent separation between WT and mutant isolates for all Candida species. PMID:21357293

Structure-activity relations of successful pharmacologic chaperones for rescue of naturally occurring and manufactured mutants of the gonadotropin-releasing hormone receptor.

PubMed

Janovick, Jo Ann; Goulet, Mark; Bush, Eugene; Greer, Jonathan; Wettlaufer, David G; Conn, P Michael

2003-05-01

We expressed a test system of wild-type (WT) rat (r) and human (h) gonadotropin-releasing hormone (GnRH) receptors (GnRHRs), including naturally occurring (13) and manufactured (five) "loss-of-function" mutants of the GnRHR. These were used to assess the ability of different GnRH peptidomimetics to rescue defective GnRHR mutants and determine their effect on the level of membrane expression of the WT receptors. Among the manufactured mutants were the shortest rGnRHR C-terminal truncation mutant that resulted in receptor loss-of-function (des(325-327)-rGnRHR), two nonfunctional deletion mutants (des(237-241)-rGnRHR and des(260-265)-rGnRHR), two nonfunctional Cys mutants (C(229)A-rGnRHR and C(278)A-rGnRHR); the naturally occurring mutants included all 13 full-length GnRHR point mutations reported to date that result in full or partial human hypogonadotropic hypogonadism. The 10 peptidomimetics assessed as potential rescue molecules ("pharmacoperones") are from three differing chemical pedigrees (indoles, quinolones, and erythromycin-derived macrolides) and were originally developed as GnRH peptidomimetic antagonists. These structures were selected for this study because of their predicted ability to permeate the cell membrane and interact with a defined affinity with the GnRH receptor. All peptidomimetics studied with an IC(50) value (for hGnRHR)

Superior triacylglycerol (TAG) accumulation in starchless mutants of Scenedesmus obliquus: (I) mutant generation and characterization

PubMed Central

2014-01-01

Background Microalgae are a promising platform for producing neutral lipids, to be used in the application for biofuels or commodities in the feed and food industry. A very promising candidate is the oleaginous green microalga Scenedesmus obliquus, because it accumulates up to 45% w/w triacylglycerol (TAG) under nitrogen starvation. Under these conditions, starch is accumulated as well. Starch can amount up to 38% w/w under nitrogen starvation, which is a substantial part of the total carbon captured. When aiming for optimized TAG production, blocking the formation of starch could potentially increase carbon allocation towards TAG. In an attempt to increase TAG content, productivity and yield, starchless mutants of this high potential strain were generated using UV mutagenesis. Previous studies in Chlamydomonas reinhardtii have shown that blocking the starch synthesis yields higher TAG contents, although these TAG contents do not surpass those of oleaginous microalgae yet. So far no starchless mutants in oleaginous green microalgae have been isolated that result in higher TAG productivities. Results Five starchless mutants have been isolated successfully from over 3,500 mutants. The effect of the mutation on biomass and total fatty acid (TFA) and TAG productivity under nitrogen-replete and nitrogen-depleted conditions was studied. All five starchless mutants showed a decreased or completely absent starch content. In parallel, an increased TAG accumulation rate was observed for the starchless mutants and no substantial decrease in biomass productivity was perceived. The most promising mutant showed an increase in TFA productivity of 41% at 4 days after nitrogen depletion, reached a TAG content of 49.4% (% of dry weight) and had no substantial change in biomass productivity compared to the wild type. Conclusions The improved S. obliquus TAG production strains are the first starchless mutants in an oleaginous green microalga that show enhanced TAG content under photoautotrophic conditions. These results can pave the way towards a more feasible microalgae-driven TAG production platform. PMID:24920957

ALS mutations in FUS cause neuronal dysfunction and death in Caenorhabditis elegans by a dominant gain-of-function mechanism

PubMed Central

Murakami, Tetsuro; Yang, Seung-Pil; Xie, Lin; Kawano, Taizo; Fu, Donald; Mukai, Asuka; Bohm, Christopher; Chen, Fusheng; Robertson, Janice; Suzuki, Hiroshi; Tartaglia, Gian Gaetano; Vendruscolo, Michele; Kaminski Schierle, Gabriele S.; Chan, Fiona T.S.; Moloney, Aileen; Crowther, Damian; Kaminski, Clemens F.; Zhen, Mei; St George-Hyslop, Peter

2012-01-01

It is unclear whether mutations in fused in sarcoma (FUS) cause familial amyotrophic lateral sclerosis via a loss-of-function effect due to titrating FUS from the nucleus or a gain-of-function effect from cytoplasmic overabundance. To investigate this question, we generated a series of independent Caenorhabditis elegans lines expressing mutant or wild-type (WT) human FUS. We show that mutant FUS, but not WT-FUS, causes cytoplasmic mislocalization associated with progressive motor dysfunction and reduced lifespan. The severity of the mutant phenotype in C. elegans was directly correlated with the severity of the illness caused by the same mutation in humans, arguing that this model closely replicates key features of the human illness. Importantly, the mutant phenotype could not be rescued by overexpression of WT-FUS, even though WT-FUS had physiological intracellular localization, and was not recruited to the cytoplasmic mutant FUS aggregates. Our data suggest that FUS mutants cause neuronal dysfunction by a dominant gain-of-function effect related either to neurotoxic aggregates of mutant FUS in the cytoplasm or to dysfunction in its RNA-binding functions. PMID:21949354

ALS mutations in FUS cause neuronal dysfunction and death in Caenorhabditis elegans by a dominant gain-of-function mechanism.

PubMed

Murakami, Tetsuro; Yang, Seung-Pil; Xie, Lin; Kawano, Taizo; Fu, Donald; Mukai, Asuka; Bohm, Christopher; Chen, Fusheng; Robertson, Janice; Suzuki, Hiroshi; Tartaglia, Gian Gaetano; Vendruscolo, Michele; Kaminski Schierle, Gabriele S; Chan, Fiona T S; Moloney, Aileen; Crowther, Damian; Kaminski, Clemens F; Zhen, Mei; St George-Hyslop, Peter

2012-01-01

It is unclear whether mutations in fused in sarcoma (FUS) cause familial amyotrophic lateral sclerosis via a loss-of-function effect due to titrating FUS from the nucleus or a gain-of-function effect from cytoplasmic overabundance. To investigate this question, we generated a series of independent Caenorhabditis elegans lines expressing mutant or wild-type (WT) human FUS. We show that mutant FUS, but not WT-FUS, causes cytoplasmic mislocalization associated with progressive motor dysfunction and reduced lifespan. The severity of the mutant phenotype in C. elegans was directly correlated with the severity of the illness caused by the same mutation in humans, arguing that this model closely replicates key features of the human illness. Importantly, the mutant phenotype could not be rescued by overexpression of WT-FUS, even though WT-FUS had physiological intracellular localization, and was not recruited to the cytoplasmic mutant FUS aggregates. Our data suggest that FUS mutants cause neuronal dysfunction by a dominant gain-of-function effect related either to neurotoxic aggregates of mutant FUS in the cytoplasm or to dysfunction in its RNA-binding functions.

Genetic analysis of indole-3-butyric acid responses in Arabidopsis thaliana reveals four mutant classes.

PubMed Central

Zolman, B K; Yoder, A; Bartel, B

2000-01-01

Indole-3-butyric acid (IBA) is widely used in agriculture because it induces rooting. To better understand the in vivo role of this endogenous auxin, we have identified 14 Arabidopsis mutants that are resistant to the inhibitory effects of IBA on root elongation, but that remain sensitive to the more abundant auxin indole-3-acetic acid (IAA). These mutants have defects in various IBA-mediated responses, which allowed us to group them into four phenotypic classes. Developmental defects in the absence of exogenous sucrose suggest that some of these mutants are impaired in peroxisomal fatty acid chain shortening, implying that the conversion of IBA to IAA is also disrupted. Other mutants appear to have normal peroxisomal function; some of these may be defective in IBA transport, signaling, or response. Recombination mapping indicates that these mutants represent at least nine novel loci in Arabidopsis. The gene defective in one of the mutants was identified using a positional approach and encodes PEX5, which acts in the import of most peroxisomal matrix proteins. These results indicate that in Arabidopsis thaliana, IBA acts, at least in part, via its conversion to IAA. PMID:11063705

CHO-cell mutant with a defect in cytokinesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, L.H.; Lindl, P.A.

1976-01-01

In a selection procedure designed to enrich for temperature-sensitive mutant cells blocked in mitosis a CHO-cell mutant was isolated which has a defect in cytokinesis as the basis of its temperature-sensitive phenotype. Cultures of the mutant had an abnormally high percentage (ie, 34 percent) of polyploid cells at the permissive temperature of 34/sup 0/C and showed further increased frequencies of polyploidy as well as many multinucleated cells at 38.5/sup 0/ and 39.5/sup 0/. When the mutant cells were synchronized in metaphase by Colcemid arrest and then placed into fresh medium at nonpermissive temperature, they did not divide although the completionmore » of mitosis appeared cytologically normal. Ultrastructural examination by electron microscopy of such synchronized cells at telophase revealed no specific defects in cellular components other than failure of development of a normal midbody. The sensitivity of the mutant to cytochalasin B and to Colcemid was the same as for wild-type cells. This mutation behaved as recessive in tetraploid cell hybrids constructed by fusing the mutant with a CHO strain which was wild-type with respect to temperature sensitivity.« less

Identification of Genes from the Fungal Pathogen Cryptococcus neoformans Related to Transmigration into the Central Nervous System

PubMed Central

Tseng, Hsiang-Kuang; Liu, Chang-Pan; Price, Michael S.; Jong, Ambrose Y.; Chang, Jui-Chih; Toffaletti, Dena L.; Betancourt-Quiroz, Marisol; Frazzitta, Aubrey E.; Cho, Wen-Long; Perfect, John R.

2012-01-01

Background A mouse brain transmigration assessment (MBTA) was created to investigate the central nervous system (CNS) pathogenesis of cryptococcal meningoencephalitis. Methodology/Principal Findings Two cryptococcal mutants were identified from a pool of 109 pre-selected mutants that were signature-tagged with the nourseothricin acetyltransferase (NAT) resistance cassette. These two mutants displayed abnormal transmigration into the central nervous system. One mutant displaying decreased transmigration contains a null mutation in the putative FNX1 gene, whereas the other mutant possessing a null mutation in the putative RUB1 gene exhibited increased transmigration into the brain. Two macrophage adhesion-defective mutants in the pool, 12F1 and 3C9, showed reduced phagocytosis by macrophages, but displayed no defects in CNS entry suggesting that transit within macrophages (the “Trojan horse” model of CNS entry) is not the primary mechanism for C. neoformans migration into the CNS in this MBTA. Conclusions/Significance This research design provides a new strategy for genetic impact studies on how Cryptococcus passes through the blood-brain barrier (BBB), and the specific isolated mutants in this assay support a transcellular mechanism of CNS entry. PMID:23028773

Structural symmetry in evolutionary games.

PubMed

McAvoy, Alex; Hauert, Christoph

2015-10-06

In evolutionary game theory, an important measure of a mutant trait (strategy) is its ability to invade and take over an otherwise-monomorphic population. Typically, one quantifies the success of a mutant strategy via the probability that a randomly occurring mutant will fixate in the population. However, in a structured population, this fixation probability may depend on where the mutant arises. Moreover, the fixation probability is just one quantity by which one can measure the success of a mutant; fixation time, for instance, is another. We define a notion of homogeneity for evolutionary games that captures what it means for two single-mutant states, i.e. two configurations of a single mutant in an otherwise-monomorphic population, to be 'evolutionarily equivalent' in the sense that all measures of evolutionary success are the same for both configurations. Using asymmetric games, we argue that the term 'homogeneous' should apply to the evolutionary process as a whole rather than to just the population structure. For evolutionary matrix games in graph-structured populations, we give precise conditions under which the resulting process is homogeneous. Finally, we show that asymmetric matrix games can be reduced to symmetric games if the population structure possesses a sufficient degree of symmetry. © 2015 The Author(s).

Quorum sensing control of Type VI secretion factors restricts the proliferation of quorum-sensing mutants

PubMed Central

Majerczyk, Charlotte; Schneider, Emily; Greenberg, E Peter

2016-01-01

Burkholderia thailandensis uses acyl-homoserine lactone-mediated quorum sensing systems to regulate hundreds of genes. Here we show that cell-cell contact-dependent type VI secretion (T6S) toxin-immunity systems are among those activated by quorum sensing in B. thailandensis. We also demonstrate that T6S is required to constrain proliferation of quorum sensing mutants in colony cocultures of a BtaR1 quorum-sensing signal receptor mutant and its parent. However, the BtaR1 mutant is not constrained by and outcompetes its parent in broth coculture, presumably because no cell contact occurs and there is a metabolic cost associated with quorum sensing gene activation. The increased fitness of the wild type over the BtaR1 mutant during agar surface growth is dependent on an intact T6SS-1 apparatus. Thus, quorum sensing activates B. thailandensis T6SS-1 growth inhibition and this control serves to police and constrain quorum-sensing mutants. This work defines a novel role for T6SSs in intraspecies mutant control. DOI: http://dx.doi.org/10.7554/eLife.14712.001 PMID:27183270

Analysis of a Partial Male-Sterile Mutant of Arabidopsis thaliana Isolated from a Low-Energy Argon Ion Beam Mutagenized Pool

NASA Astrophysics Data System (ADS)

Xu, Min; Bian, Po; Wu, Yuejin; Yu, Zengliang

2008-04-01

A screen for Arabidopsis fertility mutants, mutagenized by low-energy argon ion beam, yielded two partial male-sterile mutants tc243-1 and tc243-2 which have similar phenotypes. tc243-2 was investigated in detail. The segregation ratio of the mutant phenotypes in the M2 pools suggested that mutation behaved as single Mendelian recessive mutations. tc243 showed a series of mutant phenotypes, among which partial male-sterile was its striking mutant characteristic. Phenotype analysis indicates that there are four factors leading to male sterility. a. Floral organs normally develop inside the closed bud, but the anther filaments do not elongate sufficiently to position the locules above the stigma at anthesis. b. The anther locules do not dehisce at the time of flower opening (although limited dehiscence occurs later). c. Pollens of mutant plants develop into several types of pollens at the trinucleated stage, as determined by staining with DAPI (4',6-diamidino-2-phenylindole), which shows a variable size, shape and number of nucleus. d. The viability of pollens is lower than that of the wild type on the germination test in vivo and vitro.

Structural symmetry in evolutionary games

PubMed Central

McAvoy, Alex; Hauert, Christoph

2015-01-01

In evolutionary game theory, an important measure of a mutant trait (strategy) is its ability to invade and take over an otherwise-monomorphic population. Typically, one quantifies the success of a mutant strategy via the probability that a randomly occurring mutant will fixate in the population. However, in a structured population, this fixation probability may depend on where the mutant arises. Moreover, the fixation probability is just one quantity by which one can measure the success of a mutant; fixation time, for instance, is another. We define a notion of homogeneity for evolutionary games that captures what it means for two single-mutant states, i.e. two configurations of a single mutant in an otherwise-monomorphic population, to be ‘evolutionarily equivalent’ in the sense that all measures of evolutionary success are the same for both configurations. Using asymmetric games, we argue that the term ‘homogeneous’ should apply to the evolutionary process as a whole rather than to just the population structure. For evolutionary matrix games in graph-structured populations, we give precise conditions under which the resulting process is homogeneous. Finally, we show that asymmetric matrix games can be reduced to symmetric games if the population structure possesses a sufficient degree of symmetry. PMID:26423436

Simian virus 40 small t antigen is not required for the maintenance of transformation but may act as a promoter (cocarcinogen) during establishment of transformation in resting rat cells.

PubMed Central

Seif, R; Martin, R G

1979-01-01

Simian virus 40 deletion mutants affecting the 20,000-dalton (20K) t antigen and tsA mutants rendering the 90K T antigen temperature sensitive, as well as double mutants containing both mutations, induced host DNA synthesis in resting rat cells at the restrictive temperature. Nonetheless, the deletion mutants and double mutants did not induce transformation in resting cells even at the permissive temperature. On the other hand, the deletion mutants did induce full transformants when actively growing rat cells were infected; the transformants grew efficiently in agar and to high saturation densities on platic. The double mutants did not induce T-antigen-independent (temperature-insensitive) transformants which were shown previously to arise preferentially from resting cells. Thus, small t antigen was dispensable for the maintenance of the transformed phenotype in T-antigen-dependent rat transformants (transformants derived from growing cells) and may play a role in the establishment of T-antigen-independent transformants. We attempt to establish a parallel between transformation induced by chemical carcinogens and simian virus 40-induced transformation. Images PMID:229274

Simian virus 40 small t antigen is not required for the maintenance of transformation but may act as a promoter (cocarcinogen) during establishment of transformation in resting rat cells.

PubMed

Seif, R; Martin, R G

1979-12-01

Simian virus 40 deletion mutants affecting the 20,000-dalton (20K) t antigen and tsA mutants rendering the 90K T antigen temperature sensitive, as well as double mutants containing both mutations, induced host DNA synthesis in resting rat cells at the restrictive temperature. Nonetheless, the deletion mutants and double mutants did not induce transformation in resting cells even at the permissive temperature. On the other hand, the deletion mutants did induce full transformants when actively growing rat cells were infected; the transformants grew efficiently in agar and to high saturation densities on platic. The double mutants did not induce T-antigen-independent (temperature-insensitive) transformants which were shown previously to arise preferentially from resting cells. Thus, small t antigen was dispensable for the maintenance of the transformed phenotype in T-antigen-dependent rat transformants (transformants derived from growing cells) and may play a role in the establishment of T-antigen-independent transformants. We attempt to establish a parallel between transformation induced by chemical carcinogens and simian virus 40-induced transformation.

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant

PubMed Central

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2013-01-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.

PubMed

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V

2013-12-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.

Suppression of KRas-mutant cancer through the combined inhibition of KRAS with PLK1 and ROCK

PubMed Central

Wang, Jieqiong; Hu, Kewen; Guo, Jiawei; Cheng, Feixiong; Lv, Jing; Jiang, Wenhao; Lu, Weiqiang; Liu, Jinsong; Pang, Xiufeng; Liu, Mingyao

2016-01-01

No effective targeted therapies exist for cancers with somatic KRAS mutations. Here we develop a synthetic lethal chemical screen in isogenic KRAS-mutant and wild-type cells to identify clinical drug pairs. Our results show that dual inhibition of polo-like kinase 1 and RhoA/Rho kinase (ROCK) leads to the synergistic effects in KRAS-mutant cancers. Microarray analysis reveals that this combinatory inhibition significantly increases transcription and activity of cyclin-dependent kinase inhibitor p21WAF1/CIP1, leading to specific G2/M phase blockade in KRAS-mutant cells. Overexpression of p21WAF1/CIP1, either by cDNA transfection or clinical drugs, preferentially impairs the growth of KRAS-mutant cells, suggesting a druggable synthetic lethal interaction between KRAS and p21WAF1/CIP1. Co-administration of BI-2536 and fasudil either in the LSL-KRASG12D mouse model or in a patient tumour explant mouse model of KRAS-mutant lung cancer suppresses tumour growth and significantly prolongs mouse survival, suggesting a strong synergy in vivo and a potential avenue for therapeutic treatment of KRAS-mutant cancers. PMID:27193833

Mutant Copper-Zinc Superoxide Dismutase (SOD1) Induces Protein Secretion Pathway Alterations and Exosome Release in Astrocytes

PubMed Central

Basso, Manuela; Pozzi, Silvia; Tortarolo, Massimo; Fiordaliso, Fabio; Bisighini, Cinzia; Pasetto, Laura; Spaltro, Gabriella; Lidonnici, Dario; Gensano, Francesco; Battaglia, Elisa; Bendotti, Caterina; Bonetto, Valentina

2013-01-01

Amyotrophic lateral sclerosis is the most common motor neuron disease and is still incurable. The mechanisms leading to the selective motor neuron vulnerability are still not known. The interplay between motor neurons and astrocytes is crucial in the outcome of the disease. We show that mutant copper-zinc superoxide dismutase (SOD1) overexpression in primary astrocyte cultures is associated with decreased levels of proteins involved in secretory pathways. This is linked to a general reduction of total secreted proteins, except for specific enrichment in a number of proteins in the media, such as mutant SOD1 and valosin-containing protein (VCP)/p97. Because there was also an increase in exosome release, we can deduce that astrocytes expressing mutant SOD1 activate unconventional secretory pathways, possibly as a protective mechanism. This may help limit the formation of intracellular aggregates and overcome mutant SOD1 toxicity. We also found that astrocyte-derived exosomes efficiently transfer mutant SOD1 to spinal neurons and induce selective motor neuron death. We conclude that the expression of mutant SOD1 has a substantial impact on astrocyte protein secretion pathways, contributing to motor neuron pathology and disease spread. PMID:23592792

Suppression of mutants aberrant in light intensity responses of complementary chromatic adaptation.

PubMed Central

Casey, E S; Kehoe, D M; Grossman, A R

1997-01-01

Complementary chromatic adaptation is a process in which cyanobacteria alter the pigment protein (phycocyanin and phycoerythrin) composition of their light-harvesting complexes, the phycobilisomes, to help optimize the absorbance of prevalent wavelengths of light in the environment. Several classes of mutants that display aberrant complementary chromatic adaptation have been isolated. One of the mutant classes, designated "blue" or FdB, accumulates high levels of the blue chromoprotein phycocyanin in low-intensity green light, a condition that normally suppresses phycocyanin synthesis. We demonstrate here that the synthesis of the phycocyanin protein and mRNA in the FdB mutants can be suppressed by increasing the intensity of green light. Hence, these mutants have a decreased sensitivity to green light with respect to suppression of phycocyanin synthesis. Although we were unable to complement the blue mutants, we did isolate genes that could suppress the mutant phenotype. These genes, which have been identified previously, encode a histidine kinase sensor and response regulator protein that play key roles in controlling complementary chromatic adaptation. These findings are discussed with respect to the mechanism by which light quality and quantity control the biosynthesis of the phycobilisome. PMID:9226271

A Search for a General Phenomenon of Adaptive Mutability

PubMed Central

Galitski, T.; Roth, J. R.

1996-01-01

The most prominent systems for the study of adaptive mutability depend on the specialized activities of genetic elements like bacteriophage Mu and the F plasmid. Searching for general adaptive mutability, we have investigated the behavior of Salmonella typhimurium strains with chromosomal lacZ mutations. We have studied 30 revertible nonsense, missense, frameshift, and insertion alleles. One-third of the mutants produced >=10 late revertant colonies (appearing three to seven days after plating on selective medium). For the prolific mutants, the number of late revertants showed rank correlation with the residual β-galactosidase activity; for the same mutants, revertant number showed no correlation with the nonselective reversion rate (from fluctuation tests). Leaky mutants, which grew slowly on selective medium, produced late revertants whereas tight nongrowing mutants generally did not produce late revertants. However, the number of late revertants was not proportional to residual growth. Using total residual growth and the nonselective reversion rate, the expected number of late revertants was calculated. For several leaky mutants, the observed revertant number exceeded the expected number. We suggest that excess late revertants from these mutants arise from general adaptive mutability available to any chromosomal gene. PMID:8725216

Stress Tolerance in Doughs of Saccharomyces cerevisiae Trehalase Mutants Derived from Commercial Baker’s Yeast

PubMed Central

Shima, Jun; Hino, Akihiro; Yamada-Iyo, Chie; Suzuki, Yasuo; Nakajima, Ryouichi; Watanabe, Hajime; Mori, Katsumi; Takano, Hiroyuki

1999-01-01

Accumulation of trehalose is widely believed to be a critical determinant in improving the stress tolerance of the yeast Saccharomyces cerevisiae, which is commonly used in commercial bread dough. To retain the accumulation of trehalose in yeast cells, we constructed, for the first time, diploid homozygous neutral trehalase mutants (Δnth1), acid trehalase mutants (Δath1), and double mutants (Δnth1 ath1) by using commercial baker’s yeast strains as the parent strains and the gene disruption method. During fermentation in a liquid fermentation medium, degradation of intracellular trehalose was inhibited with all of the trehalase mutants. The gassing power of frozen doughs made with these mutants was greater than the gassing power of doughs made with the parent strains. The Δnth1 and Δath1 strains also exhibited higher levels of tolerance of dry conditions than the parent strains exhibited; however, the Δnth1 ath1 strain exhibited lower tolerance of dry conditions than the parent strain exhibited. The improved freeze tolerance exhibited by all of the trehalase mutants may make these strains useful in frozen dough. PMID:10388673

Conversion between parallel and antiparallel β -sheets in wild-type and Iowa mutant Aβ40 fibrils

NASA Astrophysics Data System (ADS)

Xi, Wenhui; Hansmann, Ulrich H. E.

2018-01-01

Using a variant of Hamilton-replica-exchange, we study for wild type and Iowa mutant Aβ40 the conversion between fibrils with antiparallel β-sheets and such with parallel β-sheets. We show that wild type and mutant form distinct salt bridges that in turn stabilize different fibril organizations. The conversion between the two fibril forms leads to the release of small aggregates that in the Iowa mutant may shift the equilibrium from fibrils to more toxic oligomers.

Mutant Kras copy number defines metabolic reprogramming and therapeutic susceptibilities

PubMed Central

Kerr, Emma; Gaude, Edoardo; Turrell, Frances; Frezza, Christian; Martins, Carla P

2016-01-01

Summary The RAS/MAPK-signalling pathway is frequently deregulated in non-small cell lung cancer (NSCLC), often through KRAS activating mutations1-3. A single endogenous mutant Kras allele is sufficient to promote lung tumour formation in mice but malignant progression requires additional genetic alterations4-7. We recently showed that advanced lung tumours from KrasG12D/+;p53-null mice frequently exhibit KrasG12D allelic enrichment (KrasG12D/Kraswild-type>1)7, implying that mutant Kras copy gains are positively selected during progression. Through a comprehensive analysis of mutant Kras homozygous and heterozygous MEFs and lung cancer cells we now show that these genotypes are phenotypically distinct. In particular, KrasG12D/G12D cells exhibit a glycolytic switch coupled to increased channelling of glucose-derived metabolites into the TCA cycle and glutathione biosynthesis, resulting in enhanced glutathione-mediated detoxification. This metabolic rewiring is recapitulated in mutant KRAS homozygous NSCLC cells and in vivo, in spontaneous advanced murine lung tumours (which display a high frequency of KrasG12D copy gain), but not in the corresponding early tumours (KrasG12D heterozygous). Finally, we demonstrate that mutant Kras copy gain creates unique metabolic dependences that can be exploited to selectively target these aggressive mutant Kras tumours. Our data demonstrate that mutant Kras lung tumours are not a single disease but rather a heterogeneous group comprised of two classes of tumours with distinct metabolic profiles, prognosis and therapeutic susceptibility, which can be discriminated based on their relative mutant allelic content. We also provide the first in vivo evidence of metabolic rewiring during lung cancer malignant progression. PMID:26909577

Calcium Signaling Regulates Trafficking of Familial Hypocalciuric Hypercalcemia (FHH) Mutants of the Calcium Sensing Receptor

PubMed Central

Grant, Michael P.; Stepanchick, Ann

2012-01-01

Calcium-sensing receptors (CaSRs) regulate systemic Ca2+ homeostasis. Loss-of-function mutations cause familial benign hypocalciuric hypercalcemia (FHH) or neonatal severe hyperparathyroidism (NSHPT). FHH/NSHPT mutations can reduce trafficking of CaSRs to the plasma membrane. CaSR signaling is potentiated by agonist-driven anterograde CaSR trafficking, leading to a new steady state level of plasma membrane CaSR, which is maintained, with minimal functional desensitization, as long as extracellular Ca2+ is elevated. This requirement for CaSR signaling to drive CaSR trafficking to the plasma membrane led us to reconsider the mechanism(s) contributing to dysregulated trafficking of FHH/NSHPT mutants. We simultaneously monitored dynamic changes in plasma membrane levels of CaSR and intracellular Ca2+, using a chimeric CaSR construct, which allowed explicit tracking of plasma membrane levels of mutant or wild-type CaSRs in the presence of nonchimeric partners. Expression of mutants alone revealed severe defects in plasma membrane targeting and Ca2+ signaling, which were substantially rescued by coexpression with wild-type CaSR. Biasing toward heterodimerization of wild-type and FHH/NSHPT mutants revealed that intracellular Ca2+ oscillations were insufficient to rescue plasma membrane targeting. Coexpression of the nonfunctional mutant E297K with the truncation CaSRΔ868 robustly rescued trafficking and Ca2+ signaling, whereas coexpression of distinct FHH/NSHPT mutants rescued neither trafficking nor signaling. Our study suggests that rescue of FHH/NSHPT mutants requires a steady state intracellular Ca2+ response when extracellular Ca2+ is elevated and argues that Ca2+ signaling by wild-type CaSRs rescues FHH mutant trafficking to the plasma membrane. PMID:23077345

Axonal abnormalities in vanishing white matter.

PubMed

Klok, Melanie D; Bugiani, Marianna; de Vries, Sharon I; Gerritsen, Wouter; Breur, Marjolein; van der Sluis, Sophie; Heine, Vivi M; Kole, Maarten H P; Baron, Wia; van der Knaap, Marjo S

2018-04-01

We aimed to study the occurrence and development of axonal pathology and the influence of astrocytes in vanishing white matter. Axons and myelin were analyzed using electron microscopy and immunohistochemistry on Eif2b4 and Eif2b5 single- and double-mutant mice and patient brain tissue. In addition, astrocyte-forebrain co-culture studies were performed. In the corpus callosum of Eif2b5- mutant mice, myelin sheath thickness, axonal diameter, and G-ratio developed normally up to 4 months. At 7 months, however, axons had become thinner, while in control mice axonal diameters had increased further. Myelin sheath thickness remained close to normal, resulting in an abnormally low G-ratio in Eif2b5- mutant mice. In more severely affected Eif2b4-Eif2b5 double-mutants, similar abnormalities were already present at 4 months, while in milder affected Eif2b4 mutants, few abnormalities were observed at 7 months. Additionally, from 2 months onward an increased percentage of thin, unmyelinated axons and increased axonal density were present in Eif2b5 -mutant mice. Co-cultures showed that Eif2b5 mutant astrocytes induced increased axonal density, also in control forebrain tissue, and that control astrocytes induced normal axonal density, also in mutant forebrain tissue. In vanishing white matter patient brains, axons and myelin sheaths were thinner than normal in moderately and severely affected white matter. In mutant mice and patients, signs of axonal transport defects and cytoskeletal abnormalities were minimal. In vanishing white matter, axons are initially normal and atrophy later. Astrocytes are central in this process. If therapy becomes available, axonal pathology may be prevented with early intervention.

Photosynthetic Electron Transport Chain of Chlamydomonas reinhardi VI. Electron Transport in Mutant Strains Lacking Either Cytochrome 553 or Plastocyanin 1

PubMed Central

Gorman, Donald S.; Levine, R. P.

1966-01-01

A mutant strain of Chlamydomonas reinhardi, ac-206, lacks cytochrome 553, at least in an active and detectable form. Chloroplast fragments of this mutant strain are inactive in the photoreduction of NADP when the source of electrons is water, but they are active when the electron source is 2,6-dichlorophenolindophenol and ascorbate. The addition of either cytochrome 553 or plastocyanin, obtained from the wild-type strain, has no effect upon the photosynthetic activities of the mutant strain. Cells of the mutant strain lack both the soluble and insoluble forms of cytochrome 553, but they possess the mitochondrial type cytochrome c. Thus, the loss of cytochrome 553 appears to be specific. Another mutant strain, ac-208, lacks plastocyanin, or possesses it in an inactive and undetectable form. Chloroplast fragments of ac-208 are inactive in the photoreduction of NADP with either water or 2,6-dichlorophenolindophenol and ascorbate as electron donors. However, these reactions are restored upon the addition of plastocyanin. The addition of cytochrome 553 has no effect. The measurement of light-induced absorbance changes with ac-208 reveal that, in the absence of plastocyanin, light fails to sensitize the oxidation of cytochrome 553, but it will sensitize its reduction. However, the addition of plastocyanin restores the light-induced cytochrome oxidation. A third mutant strain, ac-208 (sup.) carries a suppressor mutation that partially restores the wild phenotype. This mutant strain appears to possess a plastocyanin that is less stable than that of the wild-type strain. The observations with the mutant strains are discussed in terms of the sequence of electron transport System II → cytochrome 553 → plastocyanin → System I. PMID:16656453

Generation of a Mutant Mucor hiemalis Endoglycosidase That Acts on Core-fucosylated N-Glycans.

PubMed

Katoh, Toshihiko; Katayama, Takane; Tomabechi, Yusuke; Nishikawa, Yoshihide; Kumada, Jyunichi; Matsuzaki, Yuji; Yamamoto, Kenji

2016-10-28

Endo-β-N-acetylglucosaminidase M (Endo-M), an endoglycosidase from the fungus Mucor hiemalis, is a useful tool for chemoenzymatic synthesis of glycoconjugates, including glycoprotein-based therapeutics having a precisely defined glycoform, by virtue of its transglycosylation activity. Although Endo-M has been known to act on various N-glycans, it does not act on core-fucosylated N-glycans, which exist widely in mammalian glycoproteins, thus limiting its application. Therefore, we performed site-directed mutagenesis on Endo-M to isolate mutant enzymes that are able to act on mammalian-type core-α1,6-fucosylated glycans. Among the Endo-M mutant enzymes generated, those in which the tryptophan at position 251 was substituted with alanine or asparagine showed altered substrate specificities. Such mutant enzymes exhibited increased hydrolysis of a synthetic α1,6-fucosylated trimannosyl core structure, whereas their activity on the afucosylated form decreased. In addition, among the Trp-251 mutants, the W251N mutant was most efficient in hydrolyzing the core-fucosylated substrate. W251N mutants could act on the immunoglobulin G-derived core-fucosylated glycopeptides and human lactoferrin glycoproteins. This mutant was also capable of transferring the sialyl glycan from an activated substrate intermediate (sialyl glyco-oxazoline) onto an α1,6-fucosyl-N-acetylglucosaminyl biotin. Furthermore, the W251N mutant gained a glycosynthase-like activity when a N175Q substitution was introduced and it caused accumulation of the transglycosylation products. These findings not only give insights into the substrate recognition mechanism of glycoside hydrolase family 85 enzymes but also widen their scope of application in preparing homogeneous glycoforms of core-fucosylated glycoproteins for the production of potent glycoprotein-based therapeutics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.)

PubMed Central

2013-01-01

Background Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. Results The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. Conclusion These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes. PMID:24280269

Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.).

PubMed

Hanzawa, Eiko; Sasaki, Kazuhiro; Nagai, Shinsei; Obara, Mitsuhiro; Fukuta, Yoshimichi; Uga, Yusaku; Miyao, Akio; Hirochika, Hirohiko; Higashitani, Atsushi; Maekawa, Masahiko; Sato, Tadashi

2013-11-20

Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes.

Live Cell Imaging Reveals Differential Modifications to Cytoplasmic Dynein Properties by Phospho- and Dephospho-mimic Mutations of the Intermediate Chain 2C S84

PubMed Central

Blasier, Kiev R.; Humsi, Michael K.; Ha, Junghoon; Ross, Mitchell W.; Smiley, W. Russell; Inamdar, Nirja A.; Mitchell, David J.; Lo, Kevin W.-H.; Pfister, K. Kevin

2014-01-01

Cytoplasmic dynein is a multi-subunit motor protein responsible for intracellular cargo transport toward microtubule minus ends. There are multiple isoforms of the dynein intermediate chain (DYNC1I, IC) which is encoded by two genes. One way to regulate cytoplasmic dynein is by IC phosphorylation. The IC-2C isoform is expressed in all cells and the functional significance of phosphorylation on IC-2C serine 84 was investigated using live cell imaging of fluorescent protein-tagged wild type IC-2C (WT) and phospho- and dephospho-mimic mutant isoforms in axonal transport model systems. Both mutations modulated dynein functional properties. The dephospho-mimic mutant IC-2C S84A had greater co-localization with mitochondria than IC-2C wild-type (WT) or the phospho-mimic mutant IC-2C S84D. The dephospho-mimic mutant IC-2C S84A was also more likely to be motile than the phospho-mimic mutant IC-2C S84D or IC-2C WT. In contrast, the phospho-mimic mutant IC-2C S84D mutant was more likely to move in the retrograde direction than was the IC-2C S84A mutant. The phospho-mimic IC-2C S84D was also as likely as IC-2C WT to co-localize with mitochondria. Both the S84D phospho- and S84A, dephospho-mimic mutants were found to be capable of microtubule minus end directed (retrograde) movement in axons. They were also observed to be passively transported in the anterograde direction. These data suggest that the IC-2C S84 has a role in modulating dynein properties. PMID:24798412

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dunach, M.; Marti, T.; Khorana, H.G.

The light-dark adaptation reactions of a set of bacteriorhodopsin (bR) mutants that affect function and color of the chromophore were examined by using visible absorption spectroscopy. The absorbance spectra of the mutants Arg-82 in equilibrium Ala (Gln), Asp-85 in equilibrium Ala (Asn, Glu), Tyr-185 in equilibrium Phe, and Asp-212 in equilibrium Ala (Asn, Glu) were measured at different pH values during and after illumination. None of these mutants exhibited a normal dark-light adaptation, which in wild-type bR causes a red shift of the visible absorption maximum from 558 nm (dark-adapted bR) to 568 nm (light-adapted bR). Instead a reversible lightmore » reaction occurs in the Asp-85 and Asp-212 mutants from a blue form with lambda max near 600 nm to a pink form with lambda max near 480 nm. This light-induced shift explains the appearance of a reversed light adaptation previously observed for the Asp-212 mutants. In the case of the Tyr-185 and Arg-82 mutants, light causes a purple-to-blue transformation similar to the effect of lowering the pH. However, the blue forms observed in these mutants are not identical to those formed by acid titration or deionization of wild-type bR. It is suggested that in all of these mutants, the chromophore has lost the ability to undergo the normal 13-cis, 15-syn to all-trans, 15-anti light-driven isomerization, which occurs in native bR. Instead these mutants may have as stable forms all-trans,syn and 13-cis,anti chromophores, which are not allowed in native bR, except transiently.« less

Low-energy N-ion beam biotechnology application in the induction of Thai jasmine rice mutant with improved seed storability

NASA Astrophysics Data System (ADS)

Semsang, Nuananong; Techarang, Jiranat; Yu, Liangdeng; Phanchaisri, Boonrak

2018-06-01

Low-energy heavy-ion beam is a novel biotechnology used for mutation induction in plants. We used a low-energy N-ion beam to induce mutations in Thai jasmine rice (Oryza sativa L. cv. KDML 105) to improve the yield and seed quality. Seeds of BKOS6, a Thai jasmine rice mutant previously induced by ion beams, were re-bombarded with 60-kV-accelerated N-ions (N++N2+) to fluences of 1-2 × 1016 ions/cm2. The resulting mutant, named HyKOS21, exhibited photoperiod insensitivity, semi-dwarfness, and high yield potential. Seed storability of the mutant was studied in natural and accelerated ageing conditions and compared to that of KDML 105 and six other Thai rice varieties. In both testing conditions, HyKOS21 mutant had the highest seed storability among the tested varieties. After storage in the natural condition for 18 months, HyKOS21 had a seed germination percentage nearly two times as that of the original KDML 105. Biochemical analysis showed that the lipid peroxidation level of the mutant seeds was the lowest among those of the tested varieties. Furthermore, an expression analysis of genes encoding lipoxygenase isoenzyme (lox1, lox2, and lox3) revealed that the mutant lacked expression of lox1 and lox2 and expressed only lox3 in seeds. These results may explain the improved seed longevity of the mutant after storage. This work provides further evidence of the modification of biological materials using a low-energy ion beam to produce rice mutants with improved yield and seed storability. The benefits of this technology, to create new varieties with improved values, could serve for local economic development.

No Significant Increase in the Δ4- and Δ7-Dafachronic Acid Concentration in the Long-Lived glp-1 Mutant, nor in the Mutants Defective in Dauer Formation.

PubMed

Li, Tie-Mei; Liu, Weilong; Lu, Shan; Zhang, Yan-Ping; Jia, Le-Mei; Chen, Jie; Li, Xiangke; Lei, Xiaoguang; Dong, Meng-Qiu

2015-05-12

The steroid hormone dafachronic acid (DA) regulates dauer formation and lifespan in Caenorhabditis elegans by binding to the nuclear receptor DAF-12. However, little is known about how DA concentrations change under various physiologic conditions and about how DA/DAF-12 signaling interacts with other signaling pathways that also regulate dauer formation and lifespan. Using a sensitive bioanalytical method, we quantified the endogenous DA concentrations in a long-lived germline-less glp-1 mutant and in the Dauer formation-defective (Daf-d) mutants daf-12, daf-16, daf-5, and daf-3. We found that the DA concentration in the glp-1 mutant was similar to that in the wild type (WT). This result is contrary to the long-held belief that germline loss-induced longevity involves increased DA production and suggests instead that this type of longevity involves an enhanced response to DA. We also found evidence suggesting that increased DA sensitivity underlies lifespan extension triggered by exogenous DA. At the L2/L3 stage, the DA concentration in a daf-12 null mutant decreased to 22% of the WT level. This finding is consistent with the previously proposed positive feedback regulation between DAF-12 and DA production. Surprisingly, the DA concentrations in the daf-16, daf-5, and daf-3 mutants were only 19-34% of the WT level at the L2/L3 stage, slightly greater than those in the Dauer formation-constitutive (Daf-c) mutants at the pre-dauer stage (4-15% of the WT L2 control). Our experimental evidence suggested that the positive feedback between DA and DAF-12 was partially induced in the three Daf-d mutants. Copyright © 2015 Li et al.

The Stringent Response Is Essential for Pseudomonas aeruginosa Virulence in the Rat Lung Agar Bead and Drosophila melanogaster Feeding Models of Infection▿†

PubMed Central

Vogt, Stefanie L.; Green, Christopher; Stevens, Katarzyna M.; Day, Brad; Erickson, David L.; Woods, Donald E.; Storey, Douglas G.

2011-01-01

The stringent response is a regulatory system that allows bacteria to sense and adapt to nutrient-poor environments. The central mediator of the stringent response is the molecule guanosine 3′,5′-bispyrophosphate (ppGpp), which is synthesized by the enzymes RelA and SpoT and which is also degraded by SpoT. Our laboratory previously demonstrated that a relA mutant of Pseudomonas aeruginosa, the principal cause of lung infections in cystic fibrosis patients, was attenuated in virulence in a Drosophila melanogaster feeding model of infection. In this study, we examined the role of spoT in P. aeruginosa virulence. We generated an insertion mutation in spoT within the previously constructed relA mutant, thereby producing a ppGpp-devoid strain. The relA spoT double mutant was unable to establish a chronic infection in D. melanogaster and was also avirulent in the rat lung agar bead model of infection, a model in which the relA mutant is fully virulent. Synthesis of the virulence determinants pyocyanin, elastase, protease, and siderophores was impaired in the relA spoT double mutant. This mutant was also defective in swarming and twitching, but not in swimming motility. The relA spoT mutant and, to a lesser extent, the relA mutant were less able to withstand stresses such as heat shock and oxidative stress than the wild-type strain PAO1, which may partially account for the inability of the relA spoT mutant to successfully colonize the rat lung. Our results indicate that the stringent response, and SpoT in particular, is a crucial regulator of virulence processes in P. aeruginosa. PMID:21788391

A mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus, lacking flagella, has unusual growth physiology

DOE PAGES

Lewis, Derrick L.; Notey, Jaspreet S.; Chandrayan, Sanjeev K.; ...

2014-12-04

In this paper, a mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targetedmore » gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Finally, electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.« less

A homozygous recA mutant of Synechocystis PCC6803: construction strategy and characteristics eliciting a novel RecA independent UVC resistance in dark.

PubMed

Minda, Renu; Ramchandani, Jyoti; Joshi, Vasudha P; Bhattacharjee, Swapan Kumar

2005-12-01

We report here the construction of a homozygous recA460::cam insertion mutant of Synechocystis sp. PCC 6803 that may be useful for plant molecular genetics by providing a plant like host free of interference from homologous recombination. The homozygous recA460::cam mutant is highly sensitive to UVC under both photoreactivating and non-photoreactivating conditions compared to the wild type (WT). The liquid culture of the mutant growing in approximately 800 lx accumulates nonviable cells to the tune of 86% as estimated by colony counts on plates incubated at the same temperature and light intensity. The generation time of recA mutant in standard light intensity (2,500 lx) increases to 50 h compared to 28 h in lower light intensity (approximately 800 lx) that was used for selection, thus explaining the earlier failures to obtain a homozygous recA mutant. The WT, in contrast, grows at faster rate (23 h generation time) in standard light intensity compared to that at approximately 800 lx (26 h). The Synechocystis RecA protein supports homologous recombination during conjugation in recA (-) mutant of Escherichia coli, but not the SOS response as measured by UV sensitivity. It is suggested that using this homozygous recA460::cam mutant, investigations can now be extended to dissect the network of DNA repair pathways involved in housekeeping activities that may be more active in cyanobacteria than in heterotrophs. Using this mutant for the first time we provide a genetic evidence of a mechanism independent of RecA that causes enhanced UVC resistance on light to dark transition.

A mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus, lacking flagella, has unusual growth physiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, Derrick L.; Notey, Jaspreet S.; Chandrayan, Sanjeev K.

In this paper, a mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targetedmore » gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Finally, electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.« less

Assisted Design of Antibody and Protein Therapeutics (ADAPT)

PubMed Central

Vivcharuk, Victor; Baardsnes, Jason; Deprez, Christophe; Sulea, Traian; Jaramillo, Maria; Corbeil, Christopher R.; Mullick, Alaka; Magoon, Joanne; Marcil, Anne; Durocher, Yves; O’Connor-McCourt, Maureen D.

2017-01-01

Effective biologic therapeutics require binding affinities that are fine-tuned to their disease-related molecular target. The ADAPT (Assisted Design of Antibody and Protein Therapeutics) platform aids in the selection of mutants that improve/modulate the affinity of antibodies and other biologics. It uses a consensus z-score from three scoring functions and interleaves computational predictions with experimental validation, significantly enhancing the robustness of the design and selection of mutants. The platform was tested on three antibody Fab-antigen systems that spanned a wide range of initial binding affinities: bH1-VEGF-A (44 nM), bH1-HER2 (3.6 nM) and Herceptin-HER2 (0.058 nM). Novel triple mutants were obtained that exhibited 104-, 46- and 32-fold improvements in binding affinity for each system, respectively. Moreover, for all three antibody-antigen systems over 90% of all the intermediate single and double mutants that were designed and tested showed higher affinities than the parent sequence. The contributions of the individual mutants to the change in binding affinity appear to be roughly additive when combined to form double and triple mutants. The new interactions introduced by the affinity-enhancing mutants included long-range electrostatics as well as short-range nonpolar interactions. This diversity in the types of new interactions formed by the mutants was reflected in SPR kinetics that showed that the enhancements in affinities arose from increasing on-rates, decreasing off-rates or a combination of the two effects, depending on the mutation. ADAPT is a very focused search of sequence space and required only 20–30 mutants for each system to be made and tested to achieve the affinity enhancements mentioned above. PMID:28750054

The Sep1 Mutant of Saccharomyces Cerevisiae Arrests in Pachytene and Is Deficient in Meiotic Recombination

PubMed Central

Tishkoff, D. X.; Rockmill, B.; Roeder, G. S.; Kolodner, R. D.

1995-01-01

Strand exchange protein 1 (Sep1) from Saccharomyces cerevisiae promotes homologous pairing of DNA in vitro and sep1 mutants display pleiotropic phenotypes in both vegetative and meiotic cells. In this study, we examined in detail the ability of the sep1 mutant to progress through meiosis I prophase and to undergo meiotic recombination. In meiotic return-to-growth experiments, commitment to meiotic recombination began at the same time in wild type and mutant; however, recombinants accumulated at decreased rates in the mutant. Gene conversion eventually reached nearly wild-type levels, whereas crossing over reached 15-50% of wild type. In an assay of intrachromosomal pop-out recombination, the sep1, dmc1 and rad51 single mutations had only small effects; however, pop-out recombination was virtually eliminated in the sep1 dmc1 and sep1 rad51 double mutants, providing evidence for multiple recombination pathways. Analysis of meiotic recombination intermediates indicates that the sep1 mutant is deficient in meiotic double-strand break repair. In a physical assay, the formation of mature reciprocal recombinants in the sep1 mutant was delayed relative to wild type and ultimately reached only 50% of the wild-type level. Electron microscopic analysis of meiotic nuclear spreads indicates that the sep1δ mutant arrests in pachytene, with apparently normal synaptonemal complex. This arrest is RAD9-independent. We hypothesize that the Sep1 protein participates directly in meiotic recombination and that other strand exchange enzymes, acting in parallel recombination pathways, are able to substitute partially for the absence of the Sep1 protein. PMID:7713413

Potential complications when developing gene deletion clones in Xylella fastidiosa.

PubMed

Johnson, Kameka L; Cursino, Luciana; Athinuwat, Dusit; Burr, Thomas J; Mowery, Patricia

2015-04-16

The Gram-negative xylem-limited bacterium, Xylella fastidiosa, is an important plant pathogen that infects a number of high value crops. The Temecula 1 strain infects grapevines and induces Pierce's disease, which causes symptoms such as scorching on leaves, cluster collapse, and eventual plant death. In order to understand the pathogenesis of X. fastidiosa, researchers routinely perform gene deletion studies and select mutants via antibiotic markers. Site-directed pilJ mutant of X. fastidiosa were generated and selected on antibiotic media. Mutant cultures were assessed by PCR to determine if they were composed of purely transformant cells or included mixtures of non-transformants cells. Then pure pilJ mutant and wildtype cells were mixed in PD2 medium and following incubation and exposure to kanamycin were assessed by PCR for presence of mutant and wildtype populations. We have discovered that when creating clones of targeted mutants of X. fastidiosa Temecula 1 with selection on antibiotic plates, X. fastidiosa lacking the gene deletion often persist in association with targeted mutant cells. We believe this phenomenon is due to spontaneous antibiotic resistance and/or X. fastidiosa characteristically forming aggregates that can be comprised of transformed and non-transformed cells. A combined population was confirmed by PCR, which showed that targeted mutant clones were mixed with non-transformed cells. After repeated transfer and storage the non-transformed cells became the dominant clone present. We have discovered that special precautions are warranted when developing a targeted gene mutation in X. fastidiosa because colonies that arise following transformation and selection are often comprised of transformed and non-transformed cells. Following transfer and storage the cells can consist primarily of the non-transformed strain. As a result, careful monitoring of targeted mutant strains must be performed to avoid mixed populations and confounding results.

The E3 ubiquitin ligase CHIP selectively regulates mutant epidermal growth factor receptor by ubiquitination and degradation.

PubMed

Chung, Chaeuk; Yoo, Geon; Kim, Tackhoon; Lee, Dahye; Lee, Choong-Sik; Cha, Hye Rim; Park, Yeon Hee; Moon, Jae Young; Jung, Sung Soo; Kim, Ju Ock; Lee, Jae Cheol; Kim, Sun Young; Park, Hee Sun; Park, Myoungrin; Park, Dong Il; Lim, Dae-Sik; Jang, Kang Won; Lee, Jeong Eun

2016-10-14

Somatic mutation in the tyrosine kinase domain of epidermal growth factor receptor (EGFR) is a decisive factor for the therapeutic response to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in lung adenocarcinoma. The stability of mutant EGFR is maintained by various regulators, including heat shock protein 90 (Hsp90). The C terminus of Hsc70-interacting protein (CHIP) is a Hsp70/Hsp90 co-chaperone and exhibits E3 ubiquitin ligase activity. The high-affinity Hsp90-CHIP complex recognizes and selectively regulates their client proteins. CHIP also works with its own E3 ligase activity independently of Hsp70/Hsp90. Here, we investigated the role of CHIP in regulating EGFR in lung adenocarcinoma and also evaluated the specificity of CHIP's effects on mutant EGFR. In HEK 293T cells transfected with either WT EGFR or EGFR mutants, the overexpression of CHIP selectively decreased the expression of certain EGFR mutants (G719S, L747_E749del A750P and L858R) but not WT EGFR. In a pull-down assay, CHIP selectively interacted with EGFR mutants and simultaneously induced their ubiquitination and proteasomal degradation. The expressions of mutant EGFR in PC9 and H1975 were diminished by CHIP, while the expression of WT EGFR in A549 was nearly not affected. In addition, CHIP overexpression inhibited cell proliferation and xenograft's tumor growth of EGFR mutant cell lines, but not WT EGFR cell lines. EGFR mutant specific ubiquitination by CHIP may provide a crucial regulating mechanism for EGFR in lung adenocarcinoma. Our results suggest that CHIP can be novel therapeutic target for overcoming the EGFR TKI resistance. Copyright © 2016 Elsevier Inc. All rights reserved.

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roehrig, John T., E-mail: jtr1@cdc.gov; Butrapet, Siritorn; Liss, Nathan M.

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cellsmore » and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.« less

Interdependence of skeletal sclerosis and elevated circulating levels of 1,25-dihydroxyvitamin D in osteopetrotic (op and tl) rats.

PubMed

Popoff, S N; Osier, L K; Zerwekh, J E; Marks, S C

1994-01-01

Osteopetrosis describes a heterogeneous group of inherited, metabolic bone disorders characterized by reduced bone resorption which coexists with elevated circulating levels of 1,25-dihydroxyvitamin D [1,25(OH)2D]. To determine whether or not skeletal sclerosis and high concentrations of 1,25(OH)2D are interdependent, this study used two distinct, nonallelic osteopetrotic mutations in the rat, osteopetrosis (op) and toothless (tl). The op rat is a mutation in which skeletal sclerosis can be cured (mutant) or induced (normal) following the transfer of normal or mutant osteoclast progenitors, respectively. Although these procedures are ineffective in rats of tl stock, infusions of pharmacological doses of macrophage colony-stimulating factor (CSF-1) can stimulate bone resorption and eliminate most of the excess skeletal matrix in tl mutants. This study examined the effects of cure/induction in neonatal mutant/normal rats of op stock and CSF-1 infusions in mutant rats of tl stock on skeletal (bone resorption) and serum [1,25(OH)2D] parameters as a function of time after treatment. Osteopetrotic mutants transplanted (cured) with normal spleen cells demonstrated cellular changes in osteoclast phenotype within 2-3 days followed by histologic and radiographic evidence for increased bone resorption that culminated in a normal appearance of the skeleton by 4 weeks. The markedly elevated serum levels of 1,25(OH)2D observed in untreated mutants fell significantly in transplanted mutants by the end of the first week and were similar to those in normal littermates at 3 and 4 weeks. Normal littermates transplanted (induced) with mutant spleen cells showed a progressive increase in skeletal sclerosis paralleled by significant increases in circulating levels of 1,25(OH)2D.(ABSTRACT TRUNCATED AT 250 WORDS)

Sucrose intake and fasting glucose levels in 5-HT(1A) and 5-HT(1B) receptor mutant mice.

PubMed

Bechtholt, Anita J; Smith, Karen; Gaughan, Stephanie; Lucki, Irwin

2008-03-18

Serotonin (5-HT)(1A) and 5-HT(1B) receptors have been implicated in the incidence and treatment of depression in part through the examination of animals lacking these receptors. Although these receptors have been repeatedly implicated in ingestive behavior there is little information about how 5-HT(1A) and 5-HT(1B) receptor mutant mice react to solutions of varying palatability. In the present experiment male and female 5-HT(1A) and 5-HT(1B) mutant and wild-type mice were presented with increasing concentrations of sucrose using a two-bottle choice procedure. In addition fasting blood glucose levels were assessed. Both male and female 5-HT(1B) mutant mice drank more sucrose than WT mice but also consumed more water. Female, but not male, 5-HT(1A) mutant mice similarly showed increased sucrose consumption, but did not demonstrate increased consumption of water. In addition, the pattern of increased sucrose consumption over genotype and sex was related to fasting blood glucose concentrations such that levels in male 5-HT(1B) mutant mice were reduced relative to wild-type and 5-HT(1A) mutant males, but similar to those of females. The findings in 5-HT(1B) mutant mice emphasize the role of the 5-HT(1B) receptor in regulating ingestive behavior, whereas female sex hormones and 5-HT(1A) receptors may interact to alter sucrose consumption in 5-HT(1A) mutant mice. In addition, these findings may have implications for the role of these receptors in the incidence and treatment of depression since the intake of sucrose has been used as an index of anhedonia in animal models of depression and antidepressant efficacy.

Sodium 4-phenylbutyrate acts as a chemical chaperone on misfolded myocilin to rescue cells from endoplasmic reticulum stress and apoptosis.

PubMed

Yam, Gary Hin-Fai; Gaplovska-Kysela, Katarina; Zuber, Christian; Roth, Jürgen

2007-04-01

To evaluate the effect of chemical chaperones on the trafficking of secretion-incompetent primary open-angle glaucoma-associated mutant myocilin and the possibility to rescue cells coexpressing mutant and wild-type myocilin from endoplasmic reticulum (ER) stress and apoptosis. CHO-K1, HEK293 and human trabecular meshwork cells were transfected to express wild-type or mutant (C245Y, G364V, P370L, Y437H) myocilin-green fluorescent protein fusion protein and were treated or not with various chemical chaperones (glycerol, dimethylsulfoxide, or sodium 4-phenylbutyrate) for different time periods. The secretion, Triton X-100 solubility, and intracellular distribution of wild-type and mutant myocilin were analyzed by immunoprecipitation, Western blotting, and confocal double immunofluorescence. The effect of sodium 4-phenylbutyrate on ER stress proteins and apoptosis was examined in cells coexpressing mutant and wild-type myocilin. Treatment with sodium 4-phenylbutyrate, but not with glycerol or dimethylsulfoxide, reduced the amount of detergent-insoluble myocilin aggregates, diminished myocilin interaction with calreticulin, and restored the secretion of mutant myocilin. Heteromeric complexes formed by mutant and wild-type myocilin induced the ER stress-associated phosphorylated form of ER-localized eukaryotic initiation factor (eIF)-2alpha kinase and the active form of caspase 3, which resulted in an increased rate of apoptosis. Sodium 4-phenylbutyrate treatment of cells coexpressing mutant and wild-type myocilin relieved ER stress and significantly reduced the rate of apoptosis. These findings indicate that sodium 4-phenylbutyrate protects cells from the deleterious effects of ER-retained aggregated mutant myocilin. These data point to the possibility of a chemical chaperone treatment for myocilin-caused primary open-angle glaucoma.

Characterization of representative rpoB gene mutations leading to a significant change in toyocamycin production of Streptomyces diastatochromogenes 1628.

PubMed

Ma, Zheng; Luo, Shuai; Xu, Xianhao; Bechthold, Andreas; Yu, Xiaoping

2016-04-01

Modification of enzymes involved in transcription- or translation-processes is an interesting way to increase secondary metabolite production in Streptomycetes. However, application of such methods has not been widely described for strains which produce nucleoside antibiotics. The nucleoside antibiotic toyocamycin (TM) is produced by Streptomyces diastatochromogenes 1628. For improving TM production in S. diastatochromogenes 1628, the strain was spread on rifamycin-resistant (Rif(r)) medium. Several spontaneous mutants were obtained with mutations in the rpoB gene which encodes a RNA polymerase β-subunit. The mutants which showed increased TM production were detected at a frequency of 7.5 % among the total Rif(r) mutants. Mutant 1628-T15 harboring amino acid substitution His437Arg was the best TM producer with a 4.5-fold increase in comparison to that of the wild-type strain. The worst producer was mutant 1628-T62 which also showed a poor sporulation behavior. RT-PCR was performed to study the transcription levels of the TM biosynthetic gene toyG in the parental strain as well as in mutants 1628-T15 and 1628-T62. The transcriptional level of toyG was higher in mutant 1628-T15 than that in parental strain 1628, while much lower in mutant 1628-T62. In mutant strain 1628-T62 the expression of adpA sd gene, which is required for morphological differentiation, was also much lower. Our studies also indicate that the introduction of mutations into rpoB is an effective strategy to improve the production of TM which is an important nucleoside antibiotic.

Analysis of Distinct Roles of CaMKK Isoforms Using STO-609-Resistant Mutants in Living Cells.

PubMed

Fujiwara, Yuya; Hiraoka, Yuri; Fujimoto, Tomohito; Kanayama, Naoki; Magari, Masaki; Tokumitsu, Hiroshi

2015-06-30

To assess the isoform specificity of the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK)-mediated signaling pathway using a CaMKK inhibitor (STO-609) in living cells, we have established A549 cell lines expressing STO-609-resistant mutants of CaMKK isoforms. Following serial mutagenesis studies, we have succeeded in obtaining an STO-609-resistant CaMKKα mutant (Ala292Thr/Leu233Phe) and a CaMKKβ mutant (Ala328Thr/Val269Phe), which showed sensitivity to STO-609 that was 2-3 orders of magnitude lower without an appreciable effect on kinase activity or CaM requirement. These results are consistent with the results obtained for CaMKK activities in the extracts of A549 cells stably expressing the mutants of CaMKK isoforms. Ionomycin-induced 5'-AMP-activated protein kinase (AMPK) phosphorylation at Thr172 in A549 cells expressing either the wild-type or the STO-609-resistant mutant of CaMKKα was completely suppressed by STO-609 treatment but resistant to the inhibitor in the presence of the CaMKKβ mutant (Ala328Thr/Val269Phe). This result strongly suggested that CaMKKβ is responsible for ionomycin-induced AMPK activation, which supported previous reports. In contrast, ionomycin-induced CaMKIV phosphorylation at Thr196 was resistant to STO-609 treatment in A549 cells expressing STO-609-resistant mutants of both CaMKK isoforms, indicating that both CaMKK isoforms are capable of phosphorylating and activating CaMKIV in living cells. Considering these results together, STO-609-resistant CaMKK mutants developed in this study may be useful for distinguishing CaMKK isoform-mediated signaling pathways in combination with the use of an inhibitor compound.

The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro.

PubMed

Duan, Qiangde; Zhou, Mingxu; Zhu, Xiaofang; Bao, Wenbin; Wu, Shenglong; Ruan, Xiaosai; Zhang, Weiping; Yang, Yang; Zhu, Jun; Zhu, Guoqiang

2012-11-09

Bacterial flagella contribute to pathogen virulence; however, the role of flagella in the pathogenesis of F18ab E. coli-mediated swine edema disease (ED) is not currently known. We therefore evaluated the role of flagella in F18ab E. coli adhesion, invasion, biofilm formation, and IL-8 production using an in vitro cell infection model approach with gene-deletion mutant and complemented bacterial strains. We demonstrated that the flagellin-deficient fliC mutant had a marked decrease in the ability to adhere to and invade porcine epithelial IPEC-J2 cells. Surprisingly, there was no difference in adhesion between the F18 fimbriae-deficient ΔfedA mutant and its parent strain. In addition, both the ΔfedA and double ΔfliCΔfedA mutants exhibited an increased ability to invade IPEC-J2 cells compared to the wild-type strain, although this may be due to increased expression of other adhesins following the loss of F18ab fimbriae and flagella. Compared to the wild-type strain, the ΔfliC mutant showed significantly reduced ability to form biofilm, whereas the ΔfedA mutant increased biofilm formation. Although ΔfliC, ΔfedA, and ΔfliCΔfedA mutants had a reduced ability to stimulate IL-8 production from infected Caco-2 cells, the ΔfliC mutant impaired this ability to a greater extent than the ΔfedA mutant. The results from this study clearly demonstrate that flagella are required for efficient F18ab E. coli adhesion, invasion, biofilm formation, and IL-8 production in vitro. Copyright © 2012 Elsevier B.V. All rights reserved.

Mitochondria-targeted molecules MitoQ and SS31 reduce mutant huntingtin-induced mitochondrial toxicity and synaptic damage in Huntington's disease

PubMed Central

Yin, Xiangling; Manczak, Maria; Reddy, P. Hemachandra

2016-01-01

The objective of this study was to determine the protective effects of the mitochondria-targeted molecules MitoQ and SS31 in striatal neurons that stably express mutant huntingtin (Htt) (STHDhQ111/Q111) in Huntington's disease (HD). We studied mitochondrial and synaptic activities by measuring mRNA and the protein levels of mitochondrial and synaptic genes, mitochondrial function, and ultra-structural changes in MitoQ- and SS31-treated mutant Htt neurons relative to untreated mutant Htt neurons. We used gene expression analysis, biochemical methods, transmission electron microscopy (TEM) and confocal microscopy methods. In the MitoQ- and SS31-treated mutant Htt neurons, fission genes Drp1 and Fis1 were down-regulated, and fusion genes Mfn1, Mfn2 and Opa1 were up-regulated relative to untreated neurons, suggesting that mitochondria-targeted molecules reduce fission activity. Interestingly, the mitochondrial biogenesis genes PGC1α, PGC1β, Nrf1, Nrf2 and TFAM were up-regulated in MitoQ- and SS31-treated mutant Htt neurons. The synaptic genes synaptophysin and PSD95 were up-regulated, and mitochondrial function was normal in the MitoQ- and SS31-treated mutant Htt neurons. Immunoblotting findings of mitochondrial and synaptic proteins agreed with the mRNA findings. TEM studies revealed decreased numbers of structurally intact mitochondria in MitoQ- and SS31-treated mutant Htt neurons. These findings suggest that mitochondria-targeted molecules MitoQ and SS31 are protective against mutant Htt-induced mitochondrial and synaptic damage in HD neurons, and these mitochondria-targeted molecules are potential therapeutic molecules for the treatment of HD neurons. PMID:26908605

Mitochondria-targeted molecules MitoQ and SS31 reduce mutant huntingtin-induced mitochondrial toxicity and synaptic damage in Huntington's disease.

PubMed

Yin, Xiangling; Manczak, Maria; Reddy, P Hemachandra

2016-05-01

The objective of this study was to determine the protective effects of the mitochondria-targeted molecules MitoQ and SS31 in striatal neurons that stably express mutant huntingtin (Htt) (STHDhQ111/Q111) in Huntington's disease (HD). We studied mitochondrial and synaptic activities by measuring mRNA and the protein levels of mitochondrial and synaptic genes, mitochondrial function, and ultra-structural changes in MitoQ- and SS31-treated mutant Htt neurons relative to untreated mutant Htt neurons. We used gene expression analysis, biochemical methods, transmission electron microscopy (TEM) and confocal microscopy methods. In the MitoQ- and SS31-treated mutant Htt neurons, fission genes Drp1 and Fis1 were down-regulated, and fusion genes Mfn1, Mfn2 and Opa1 were up-regulated relative to untreated neurons, suggesting that mitochondria-targeted molecules reduce fission activity. Interestingly, the mitochondrial biogenesis genes PGC1α, PGC1β, Nrf1, Nrf2 and TFAM were up-regulated in MitoQ- and SS31-treated mutant Htt neurons. The synaptic genes synaptophysin and PSD95 were up-regulated, and mitochondrial function was normal in the MitoQ- and SS31-treated mutant Htt neurons. Immunoblotting findings of mitochondrial and synaptic proteins agreed with the mRNA findings. TEM studies revealed decreased numbers of structurally intact mitochondria in MitoQ- and SS31-treated mutant Htt neurons. These findings suggest that mitochondria-targeted molecules MitoQ and SS31 are protective against mutant Htt-induced mitochondrial and synaptic damage in HD neurons, and these mitochondria-targeted molecules are potential therapeutic molecules for the treatment of HD neurons. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Differential Regulation of Synaptic Vesicle Tethering and Docking by UNC-18 and TOM-1.

PubMed

Gracheva, Elena O; Maryon, Ed B; Berthelot-Grosjean, Martine; Richmond, Janet E

2010-01-01

The assembly of SNARE complexes between syntaxin, SNAP-25 and synaptobrevin is required to prime synaptic vesicles for fusion. Since Munc18 and tomosyn compete for syntaxin interactions, the interplay between these proteins is predicted to be important in regulating synaptic transmission. We explored this possibility, by examining genetic interactions between C. elegans unc-18(Munc18), unc-64(syntaxin) and tom-1(tomosyn). We have previously demonstrated that unc-18 mutants have reduced synaptic transmission, whereas tom-1 mutants exhibit enhanced release. Here we show that the unc-18 mutant release defect is associated with loss of two morphologically distinct vesicle pools; those tethered within 25 nm of the plasma membrane and those docked with the plasma membrane. In contrast, priming defective unc-13 mutants accumulate tethered vesicles, while docked vesicles are greatly reduced, indicating tethering is UNC-18-dependent and occurs in the absence of priming. C. elegans unc-64 mutants phenocopy unc-18 mutants, losing both tethered and docked vesicles, whereas overexpression of open syntaxin preferentially increases vesicle docking, suggesting UNC-18/closed syntaxin interactions are responsible for vesicle tethering. Given the competition between vertebrate tomosyn and Munc18, for syntaxin binding, we hypothesized that C. elegans TOM-1 may inhibit both UNC-18-dependent vesicle targeting steps. Consistent with this hypothesis, tom-1 mutants exhibit enhanced UNC-18 plasma membrane localization and a concomitant increase in both tethered and docked synaptic vesicles. Furthermore, in tom-1;unc-18 double mutants the docked, primed vesicle pool is preferentially rescued relative to unc-18 single mutants. Together these data provide evidence for the differential regulation of two vesicle targeting steps by UNC-18 and TOM-1 through competitive interactions with syntaxin.

Characterization of endoplasmic reticulum-associated degradation of a protein S mutant identified in a family of quantitative protein S deficiency.

PubMed

Tsuda, Hiroko; Tokunaga, Fuminori; Nagamitsu, Hiroshi; Koide, Takehiko

2006-01-01

Misfolded and unassembled glycoproteins are eliminated from the endoplasmic reticulum (ER) lumen by the ER-associated degradation (ERAD). We previously identified a Tyr595Cys (Y595C) mutation of protein S (PS) in a family of a quantitative PS deficiency. The mutation causes intracellular degradation and decreased secretion of the Y595C mutant PS. The aim of the present study was to further characterize the molecular basis of the intracellular degradation of the mutant. We stably expressed the mutant in mammalian cells, and analyzed the intracellular localization of the protein. The intracellular degradation pathway was determined by pulse-chase analyses in the presence of various inhibitors of ERAD. Endoglycosidase H digestion and immunofluorescence staining revealed the mutant being retained in the ER. Epoxomicin, a potent and specific proteasome inhibitor, and Ala-Ala-Phe-CH(2)Cl (AAF), an inhibitor of tripeptidyl peptidase II (TPPII), suppressed the intracellular degradation of the mutant by about 65% and 50%, respectively. When epoxomicin was combined with AAF, the inhibitory effect was substantially enhanced. Although castanospermine, an inhibitor of glucosidases I and II, did not affect the degradation, kifunensine, an inhibitor of ER mannosidase I, suppressed it. Thus, it appears that the Y595C mutant is degraded through more than one pathway of ERAD, including the proteasome-dependent pathway and an alternate proteasome-independent pathway where proteases such as TPPII may be involved. Production of the critical B isoform of Man(8)GlcNAc(2) targets the mutant for ERAD, however, the interaction with calnexin/calreticulin through monoglucosylated oligosaccharides may not be required for the degradation of the mutant.

Transcriptome analysis of the epidermis of the purple quail-like (q-lp) mutant of silkworm, Bombyx mori.

PubMed

Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling

2017-01-01

A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.

Characterization of a New Pink-Fruited Tomato Mutant Results in the Identification of a Null Allele of the SlMYB12 Transcription Factor.

PubMed

Fernandez-Moreno, Josefina-Patricia; Tzfadia, Oren; Forment, Javier; Presa, Silvia; Rogachev, Ilana; Meir, Sagit; Orzaez, Diego; Aharoni, Aspah; Granell, Antonio

2016-07-01

The identification and characterization of new tomato (Solanum lycopersicum) mutants affected in fruit pigmentation and nutritional content can provide valuable insights into the underlying biology, as well as a source of new alleles for breeding programs. To date, all characterized pink-pigmented tomato fruit mutants appear to result from low SlMYB12 transcript levels in the fruit skin. Two new mutant lines displaying a pink fruit phenotype (pf1 and pf2) were characterized in this study. In the pf mutants, SlMYB12 transcripts accumulated to wild-type levels but exhibited the same truncation, which resulted in the absence of the essential MYB activation domain coding region. Allelism and complementation tests revealed that both pf mutants were allelic to the y locus and showed the same recessive null allele in homozygosis: Δy A set of molecular and metabolic effects, reminiscent of those observed in the Arabidopsis (Arabidopsis thaliana) myb11 myb12 myb111 triple mutant, were found in the tomato Δy mutants. To our knowledge, these have not been described previously, and our data support the idea of their being null mutants, in contrast to previously described transcriptional hypomorphic pink fruit lines. We detected a reduction in the expression of several flavonol glycosides and some associated glycosyl transferases. Transcriptome analysis further revealed that the effects of the pf mutations extended beyond the flavonoid pathway into the interface between primary and secondary metabolism. Finally, screening for Myb-binding sites in the candidate gene promoter sequences revealed that 141 of the 152 co-down-regulated genes may be direct targets of SlMYB12 regulation. © 2016 American Society of Plant Biologists. All Rights Reserved.

P01.29 Mutant (R132H) IDH1-driven cellular transformation makes cells dependent on continued wild type IDH1 expression in a model of in vitro gliomagenesis

PubMed Central

Johannessen, T.; Mukherjee, J.; Wood, M.; Viswanath, P.; Ohba, S.; Ronen, S.; Berkvig, R.; Pieper, R.

2017-01-01

Abstract Introduction: Missense R132H mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. We recently showed (Mol Cancer Res 14: 976–983, 2016) that although mutant IDH1 expression in hTERT-immortalized, p53/pRb-deficient astrocytes can drive cellular transformation and gliomagenesis, selective pharmacologic inhibition and elimination of 2-HG by the mutant IDH1 inhibitor AGI-5198 has little effect on the growth or clonagenicity of these transformed cells. To address the possible role of WT IDH1 in the growth of mutant IDH-driven tumor cells, we used a slightly different gliomagenesis model in which the transformation of TERT-deficient, p53/pRb-deficient astrocytes (pre-crisis cells) occurs only after prolonged expression of mutant IDH and passage through cellular crisis (post-crisis cells, Cancer Res 76:6680–6689, 2016). METHODS AND MATERIALS: Using this system we introduced AGI-5198, or siRNA targeting both WT and mutant forms of IDH1 into p53/pRb-deficient, mutant IDH1-expressing human astrocytes prior to or following their transformation, and compared the effects on cell growth and clonagenicity. Results: AGI-5198 exposure decreased levels of 2HG by greater than 90%, and as previously reported had no effect on the growth of either the pre-or post-crisis cell populations. A one-day exposure to a pan IDH1 siRNA resulted in a similar, prolonged (greater than 6 day), 80% inhibition of both WT and mutant IDH1 protein levels and 2HG in both cell groups. While the growth of the mutant IDH-expressing, non-transformed cells was similar to that of scramble siRNA controls, the growth of the mutant IDH-transformed cells was significantly reduced. This growth suppression was also accompanied by a four-fold increase in annexin V-positive apoptotic cells. Furthermore, the growth suppression in the cells transformed by mutant IDH1 expression could not be reversed by addition of a cell-permeable form of 2-HG. Conclusions: These results show that the in vitro transformative events driven by expression of mutant IDH1 make cells dependent not on continued mutant IDH1 expression, but rather on continued WT IDH1 expression. The data also support the development and testing of agents that can inhibit both the WT and mutant forms of IDH1.

Identification and cloning of a regulatory gene for nitrogen assimilation in the cyanobacterium Synechococcus sp. strain PCC 7942.

PubMed Central

Vega-Palas, M A; Madueño, F; Herrero, A; Flores, E

1990-01-01

Twenty-seven mutants that were unable to assimilate nitrate were isolated from Synechococcus sp. strain PCC 7942. In addition to mutants that lacked nitrate reductase or nitrite reductase, seven pleiotropic mutants impaired in both reductases, glutamine synthetase, and methylammonium transport were also isolated. One of the pleiotropic mutants was complemented by transformation with a cosmid gene bank from wild-type strain PCC 7942. Three complementing cosmids were isolated, and a 3.1-kilobase-pair DNA fragment that was still able to complement the mutant was identified. The regulatory gene that was cloned (ntcA) appeared to be required for full expression of proteins subject to ammonium repression in Synechococcus sp. PMID:1967601

Use of the Hungate anaerobic technique in the isolation of phloroglucinol-negative mutants of Coprococcus species.

PubMed Central

Thompson, L A; Gates, D M; Ingledew, W M; Jones, G A

1976-01-01

The Hungate anaerobic technique was used with a standard procedure for bacterial mutagenesis employing N-methyl-N-nitro-N'-nitrosoguanidine to obtain mutants of an obligate anaerobe. Three mutant strains were derived from a Coprococcus sp., strain Pe15, a rumen anaerobe capable of growing on phloroglucinol. The mutants did not grow on phloroglucinol but did degrade the compound in anaerobic washed-cell suspensions, producing the same end products in approximately the same proportions as the wild type. It was concluded that the mutants were blocked in a unique step or steps necessary for carbon skeleton or energy synthesis from phloroglucinol and not in formation of an enzyme involved in the pathway of phloroglucinol degradation. PMID:782358

Use of the Hungate anaerobic technique in the isolation of phloroglucinol-negative mutants of Coprococcus species.

PubMed

Thompson, L A; Gates, D M; Ingledew, W M; Jones, G A

1976-01-01

The Hungate anaerobic technique was used with a standard procedure for bacterial mutagenesis employing N-methyl-N-nitro-N'-nitrosoguanidine to obtain mutants of an obligate anaerobe. Three mutant strains were derived from a Coprococcus sp., strain Pe15, a rumen anaerobe capable of growing on phloroglucinol. The mutants did not grow on phloroglucinol but did degrade the compound in anaerobic washed-cell suspensions, producing the same end products in approximately the same proportions as the wild type. It was concluded that the mutants were blocked in a unique step or steps necessary for carbon skeleton or energy synthesis from phloroglucinol and not in formation of an enzyme involved in the pathway of phloroglucinol degradation.

Cortex content of asporogenous mutants of Bacillus subtilis.

PubMed Central

Imae, Y; Strominger, J L

1976-01-01

A method for the measurement of muramic lactam, which is specifically located in the cortical peptidoglycan of bacterial spores, was developed as a quantitative assay method for spore cortex content. During sporulation of Bacillus subtilis 168, muramic lactam (i.e., spore cortex) began to appear at state IV of sporulation and continued to increase over most of the late stages of sporulation. Spore cortex contents of various spo mutants of B. subitils were surveyed. Cortex was not detected in mutants in which sporulation was blocked earlier than stage II sporulation. Spores of spo IV mutant had about 40% of the cortex content of the wild-type spores. One spo III mutant had a low amount of cortex, but four others had none. PMID:1262319

Graviresponsiveness and abscisic-acid content of roots of carotenoid-deficient mutants of Zea mays L

NASA Technical Reports Server (NTRS)

Moore, R.; Smith, J. D.

1985-01-01

The abscisic-acid (ABA) content of roots of the carotenoid-deficient w-3, vp-5, and vp-7 mutants of Z. mays was analyzed using gas chromatography-mass spectrometry with an analysis sensitivity of 6 ng ABA g-1 fresh weight (FW). Roots of normal seedlings of the same lines were characterized by the following amounts of ABA (as ng ABA g-1 FW, +/- standard deviation): w-3, 279 +/- 43; vp-5, 237 +/- 26; vp-7, 338 +/- 61. We did not detect any ABA in roots of any of the mutants. Thus, the lack of carotenoids in these mutants correlated positively with the apparent absence of ABA. Primary roots of normal and mutant seedlings were positively gravitropic, with no significant differences in the curvatures of roots of normal as compared with mutant seedlings. These results indicate that ABA 1) is synthesized in maize roots via the carotenoid pathway, and 2) is not necessary for positive gravitropism by primary roots of Z. mays.

The characterization of a zebrafish mid-hindbrain mutant, mid-hindbrain gone (mgo).

PubMed

Shima, Takaki; Znosko, Wade; Tsang, Michael

2009-04-01

The vertebrate mid-hindbrain boundary (MHB) is a crucial morphological structure required for patterning and neural differentiation of the midbrain and anterior hindbrain. We isolated a novel zebrafish mutant, MHB gone (mgo), that exhibited a defective MHB. Expression of engrailed3 in the prospective MHB was absent at the 1-somite stage, suggesting that initiation of the isthmic organizer was disrupted in mgo mutants. Complementation test with mgo and noi, in which the pax2a gene is mutated, infer that the mgo mutant may represent a novel noi allele. However, pronephric, otic vesicle, and commissural axonal defects described in noi mutants were not associated with mgo mutants. Genetic mapping revealed that the mgo mutation is linked to the Pax2a locus, but no mutation was detected in pax2a exons or within intron-exon boundaries. Based on these findings, we propose that the mgo mutation genetically interacts with pax2a required for the initiation of MHB formation. Copyright 2009 Wiley-Liss, Inc.

A cadmium-sensitive, glutathione-deficient mutant of Arabidopsis thaliana.

PubMed Central

Howden, R; Andersen, C R; Goldsbrough, P B; Cobbett, C S

1995-01-01

The roots of the cadmium-sensitive mutant of Arabidopsis thaliana, cad1-1, become brown in the presence of cadmium. A new cadmium-sensitive mutant affected at a second locus, cad2, has been identified using this phenotype. Genetic analysis has grown that the sensitive phenotype is recessive to the wild type and segregates as a single Mendelian locus. Assays of cadmium accumulation by intact plants indicated that the mutant is deficient in its ability to sequester cadmium. Undifferentiated callus tissue was also cadmium sensitive, suggesting that the mutant phenotype is expressed at the cellular level. The level of cadmium-binding complexes formed in vivo was decreased compared with the wild type and accumulation of phytochelatins was about 10% of that in the wild type. The level of glutathione, the substrate for phytochelatin biosynthesis, in tissues of the mutant was decreased to about 15 to 30% of that in the wild type. Thus, the deficiency in phytochelatin biosynthesis can be explained by a deficiency in glutathione. PMID:7770518

Enhancing the Production of D-Mannitol by an Artificial Mutant of Penicillium sp. T2-M10.

PubMed

Duan, Rongting; Li, Hongtao; Li, Hongyu; Tang, Linhuan; Zhou, Hao; Yang, Xueqiong; Yang, Yabin; Ding, Zhongtao

2018-05-26

D-Mannitol belongs to a linear polyol with six-carbon and has indispensable usage in medicine and industry. In order to obtain more efficient D-mannitol producer, this study has screened out a stable mutant Penicillium sp. T2-M10 that was isolated from the initial D-mannitol-produced strain Penicillium sp.T2-8 via UV irradiation as well as nitrosoguanidine (NTG) induction. The mutant had a considerable enhancement in yield of D-mannitol based on optimizing fermentation. The production condition was optimized as the PDB medium with 24 g/L glucose for 9 days. The results showed that the production of D-mannitol from the mutant strain T2-M10 increased 125% in contrast with the parental strain. Meanwhile, the fact that D-mannitol is the main product in the mutant simplified the process of purification. Our finding revealed the potential value of the mutant strain Penicillium sp. T2-M10 to be a D-mannitol-producing strain.

Genetic separation of phototropism and blue light inhibition of stem elongation

NASA Technical Reports Server (NTRS)

Liscum, E.; Young, J. C.; Poff, K. L.; Hangarter, R. P.

1992-01-01

Blue light-induced regulation of cell elongation is a component of the signal response pathway for both phototropic curvature and inhibition of stem elongation in higher plants. To determine if blue light regulates cell elongation in these responses through shared or discrete pathways, phototropism and hypocotyl elongation were investigated in several blue light response mutants in Arabidopsis thaliana. Specifically, the blu mutants that lack blue light-dependent inhibition of hypocotyl elongation were found to exhibit a normal phototropic response. In contrast, a phototropic null mutant (JK218) and a mutant that has a 20- to 30-fold shift in the fluence dependence for first positive phototropism (JK224) showed normal inhibition of hypocotyl elongation in blue light. F1 progeny of crosses between the blu mutants and JK218 showed normal phototropism and inhibition of hypocotyl elongation, and approximately 1 in 16 F2 progeny were double mutants lacking both responses. Thus, blue light-dependent inhibition of hypocotyl elongation and phototropism operate through at least some genetically distinct components.

Influence of the Testa on Seed Dormancy, Germination, and Longevity in Arabidopsis1

PubMed Central

Debeaujon, Isabelle; Léon-Kloosterziel, Karen M.; Koornneef, Maarten

2000-01-01

The testa of higher plant seeds protects the embryo against adverse environmental conditions. Its role is assumed mainly by controlling germination through dormancy imposition and by limiting the detrimental activity of physical and biological agents during seed storage. To analyze the function of the testa in the model plant Arabidopsis, we compared mutants affected in testa pigmentation and/or structure for dormancy, germination, and storability. The seeds of most mutants exhibited reduced dormancy. Moreover, unlike wild-type testas, mutant testas were permeable to tetrazolium salts. These altered dormancy and tetrazolium uptake properties were related to defects in the pigmentation of the endothelium and its neighboring crushed parenchymatic layers, as determined by vanillin staining and microscopic observations. Structural aberrations such as missing layers or a modified epidermal layer in specific mutants also affected dormancy levels and permeability to tetrazolium. Both structural and pigmentation mutants deteriorated faster than the wild types during natural aging at room temperature, with structural mutants being the most strongly affected. PMID:10677433

Structure based discovery of clomifene as a potent inhibitor of cancer-associated mutant IDH1

PubMed Central

Luan, Shanshan; Li, Dan; Chen, Renqi; Zhang, Qian; Chen, Lixia; Huang, Jiangeng; Li, Hua

2017-01-01

Isocitrate dehydrogenase (IDH) plays an indispensable role in the tricarboxylic acid cycle, and IDH mutations are present in nearly 75% of glioma and 20% of acute myeloid leukemia. One IDH1R132H inhibitor (clomifene citrate) was found by virtual screening method, which can selectively suppress mutant enzyme activities in vitro and in vivo with a dose-dependent manner. The molecular docking indicated that clomifene occupied the allosteric site of the mutant IDH1. Enzymatic kinetics also demonstrated that clomifene inhibited mutant enzyme in a non-competitive manner. Moreover, knockdown of mutant IDH1 in HT1080 cells decreased the sensitivity to clomifene. In vivo studies indicated that clomifene significantly suppressed the tumor growth of HT1080-bearing CB-17/Icr-scid mice with oral administration of 100 mg/kg and 50 mg/kg per day. In short, our findings highlight clomifene may have clinical potential in tumor therapies as a safe and effective inhibitor of mutant IDH1. PMID:28498812

Effect of Trehalose and Trehalose Transport on the Tolerance of Clostridium perfringens to Environmental Stress in a Wild Type Strain and Its Fluoroquinolone-Resistant Mutant

PubMed Central

Park, Miseon; Mitchell, Wilfrid J.

2016-01-01

Trehalose has been shown to protect bacterial cells from environmental stress. Its uptake and osmoprotective effect in Clostridium perfringens were investigated by comparing wild type C. perfringens ATCC 13124 with a fluoroquinolone- (gatifloxacin-) resistant mutant. In a chemically defined medium, trehalose and sucrose supported the growth of the wild type but not that of the mutant. Microarray data and qRT-PCR showed that putative genes for the phosphorylation and transport of sucrose and trehalose (via phosphoenolpyruvate-dependent phosphotransferase systems, PTS) and some regulatory genes were downregulated in the mutant. The wild type had greater tolerance than the mutant to salts and low pH; trehalose and sucrose further enhanced the osmotolerance of the wild type to NaCl. Expression of the trehalose-specific PTS was lower in the fluoroquinolone-resistant mutant. Protection of C. perfringens from environmental stress could therefore be correlated with the ability to take up trehalose. PMID:28058047

Treadmill performance of mice with cerebellar lesions: 1. Purkinje cell degeneration mutant mice.

PubMed

Le Marec, N; Lalonde, R

1998-02-01

The purpose of this study was to evaluate the sensorimotor skills of a spontaneous mouse mutant, Purkinje cell degeneration (PCD), marked by selective cerebellar cortical atrophy on a treadmill activated at 1 of 2 speeds and at 1 of 3 slopes, requiring forward movements to avoid footshocks. There was no difference in latencies before falling from the belt between PCD mutants and controls during acquisition. However, PCD mutants were impaired on the fast treadmill during retention, implicating the cerebellum in the memory of a motor skill. During acquisition of the slow treadmill task at the 2 lowest slopes of inclination, PCD mutants spent more time walking than controls, an indication of a decreased ability of coordinating whole body movements. The same pattern of higher walking time on the slow treadmill in PCD mutants was evident during retention. These results indicate that the cerebellar cortex is involved in the acquisition and the retention of a task requiring equilibrium.

Southern Analysis of Genomic Alterations in Gamma-Ray-Induced Aprt- Hamster Cell Mutants

PubMed Central

Grosovsky, Andrew J.; Drobetsky, Elliot A.; deJong, Pieter J.; Glickman, Barry W.

1986-01-01

The role of genomic alterations in mutagenesis induced by ionizing radiation has been the subject of considerable speculation. By Southern blotting analysis we show here that 9 of 55 (approximately 1/6) gamma-ray-induced mutants at the adenine phosphoribosyl transferase (aprt) locus of Chinese hamster ovary (CHO) cells have a detectable genomic rearrangement. These fall into two classes: intragenic deletions and chromosomal rearrangements. In contrast, no major genomic alterations were detected among 67 spontaneous mutants, although two restriction site loss events were observed. Three gamma-ray-induced mutants were found to be intragenic deletions; all may have identical break-points. The remaining six gamma-ray-induced mutants demonstrating a genomic alteration appear to be the result of chromosomal rearrangements, possibly translocation or inversion events. None of the remaining gamma-ray-induced mutants showed any observable alteration in blotting pattern indicating a substantial role for point mutation in gamma-ray-induced mutagenesis at the aprt locus. PMID:3013724

Mutant number distribution in an exponentially growing population

NASA Astrophysics Data System (ADS)

Keller, Peter; Antal, Tibor

2015-01-01

We present an explicit solution to a classic model of cell-population growth introduced by Luria and Delbrück (1943 Genetics 28 491-511) 70 years ago to study the emergence of mutations in bacterial populations. In this model a wild-type population is assumed to grow exponentially in a deterministic fashion. Proportional to the wild-type population size, mutants arrive randomly and initiate new sub-populations of mutants that grow stochastically according to a supercritical birth and death process. We give an exact expression for the generating function of the total number of mutants at a given wild-type population size. We present a simple expression for the probability of finding no mutants, and a recursion formula for the probability of finding a given number of mutants. In the ‘large population-small mutation’ limit we recover recent results of Kessler and Levine (2014 J. Stat. Phys. doi:10.1007/s10955-014-1143-3) for a fully stochastic version of the process.

Pleiotropic effects of polysaccharide capsule loss on selected biological properties of Streptococcus suis.

PubMed

Tanabe, Shin-Ichi; Bonifait, Laetitia; Fittipaldi, Nahuel; Grignon, Louis; Gottschalk, Marcelo; Grenier, Daniel

2010-01-01

In this study, an unencapsulated Streptococcus suis mutant was used to investigate the pleiotropic effects resulting from capsule loss. The capsule deficient mutant of S. suis acquired a biofilm-positive phenotype, which was associated with significantly increased cell surface hydrophobicity. Cell-associated fibrinogen-binding and chymotrypsin-like activities were decreased in the unencapsulated mutant. The mutant did not differ significantly from the encapsulated parent strain for minimal inhibitory concentrations to penicillin G, ampicillin, and tetracycline. However, while the encapsulated strain was highly resistant to the bactericidal action of penicillin G and ampicillin, the unencapsulated mutant was approximately 60-fold more sensitive. Compared with the parent strain, the unencapsulated mutant induced a much higher inflammatory response in monocyte-derived macrophages resulting in an increased secretion of tumor necrosis factor (TNF)-alpha, interleukin (IL)-1beta, IL-6, and IL-8. The capsule appears to hinder important adhesins or hydrophobic molecules that mediate biofilm formation, as well as cell wall components capable of stimulating immune cells.

Pleiotropic effects of polysaccharide capsule loss on selected biological properties of Streptococcus suis

PubMed Central

Tanabe, Shin-Ichi; Bonifait, Laetitia; Fittipaldi, Nahuel; Grignon, Louis; Gottschalk, Marcelo; Grenier, Daniel

2010-01-01

In this study, an unencapsulated Streptococcus suis mutant was used to investigate the pleiotropic effects resulting from capsule loss. The capsule deficient mutant of S. suis acquired a biofilm-positive phenotype, which was associated with significantly increased cell surface hydrophobicity. Cell-associated fibrinogen-binding and chymotrypsin-like activities were decreased in the unencapsulated mutant. The mutant did not differ significantly from the encapsulated parent strain for minimal inhibitory concentrations to penicillin G, ampicillin, and tetracycline. However, while the encapsulated strain was highly resistant to the bactericidal action of penicillin G and ampicillin, the unencapsulated mutant was approximately 60-fold more sensitive. Compared with the parent strain, the unencapsulated mutant induced a much higher inflammatory response in monocyte-derived macrophages resulting in an increased secretion of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and IL-8. The capsule appears to hinder important adhesins or hydrophobic molecules that mediate biofilm formation, as well as cell wall components capable of stimulating immune cells. PMID:20357962

Mutation-Screening of Pleurotus Ferulae with High Temperature Tolerance by Nitrogen Ion Implantation

NASA Astrophysics Data System (ADS)

Chen, Henglei; Wan, Honggui; Zhang, Jun; Zeng, Xianxian

2008-08-01

In order to obtain Pleurotus ferulae with high temperature tolerance, conidiophores of wild type strain ACK were implanted with nitrogen ions in energy of 5 ~15 keV and dose of 1.5 × 1015 ~ 1.5 × 1016 cm-2, and a mutant CGMCC1763 was isolated subsequently through thermotolerant screening method. It was found that during riper period the surface layer mycelium of the mutant in mushroom bag wasn't aging neither grew tegument even above 30° C. The mycelium endurable temperature of the mutant was increased by 5°C compared to that of the wild type strain. The fruiting bodies growth temperature of the mutant was 18 ~22°C in daytime and 8~14°C at night. The highest growth temperature of fruiting bodies of the mutant was increased about 7°C w.r.t. that of original strain. Through three generations investigations, it was found that the mutant CGMCC1763 was stable with high temperature tolerance.

Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants.

PubMed

Nicolson, T; Rüsch, A; Friedrich, R W; Granato, M; Ruppersberg, J P; Nüsslein-Volhard, C

1998-02-01

The molecular basis of sensory hair cell mechanotransduction is largely unknown. In order to identify genes that are essential for mechanosensory hair cell function, we characterized a group of recently isolated zebrafish motility mutants. These mutants are defective in balance and swim in circles but have no obvious morphological defects. We examined the mutants using calcium imaging of acoustic-vibrational and tactile escape responses, high resolution microscopy of sensory neuroepithelia in live larvae, and recordings of extracellular hair cell potentials (microphonics). Based on the analyses, we have identified several classes of genes. Mutations in sputnik and mariner affect hair bundle integrity. Mutant astronaut and cosmonaut hair cells have relatively normal microphonics and thus appear to affect events downstream of mechanotransduction. Mutant orbiter, mercury, and gemini larvae have normal hair cell morphology and yet do not respond to acoustic-vibrational stimuli. The microphonics of lateral line hair cells of orbiter, mercury, and gemini larvae are absent or strongly reduced. Therefore, these genes may encode components of the transduction apparatus.

Chromosome instability of HPRT-mutant subclones induced by ionising radiation of various LET.

PubMed

Govorun, R D; Koshlan, I V; Koshlan, N A; Krasavin, E A; Shmakova, N L

2002-01-01

The induction of HPRT-mutations and survival of Chinese hamster cells (line B11ii-FAF28, clone 431) were studied after irradiation by 4He and 12C-ions of various LET (20-360 keV/micrometers), produced by the U-200 heavy ion accelerator. The RBE increases with LET up to the maximum at 100-200 keV/micrometers and then decreases. Cytogenetic analysis was performed on the HPRT-mutant subclones selected from unirradiated Chinese hamster V-79 cells and from HPRT-mutant subclones that arose after exposure to gamma-rays, 1 GeV protons and 14N-ions (LET-77 keV/micrometers), produced by the synchrophasotron and the U-400M heavy ion accelerator. Slow growing mutant subclones were observed. The cytogenetic properties of individual clones were highly heterogeneous and chromosome instability was observed in both spontaneous and radiation-induced mutants. Chromosome instability was highest among spontaneous mutants and decreased with increasing LET. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

Mutants in the mouse NuRD/Mi2 component P66alpha are embryonic lethal.

PubMed

Marino, Susan; Nusse, Roel

2007-06-13

The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66alpha and p66beta. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. We made loss of function mutants in the mouse p66alpha gene (mp66alpha, official name Gatad2a, MGI:2384585). We found that mp66alpha is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66alpha in gene silencing. mp66alpha is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing.

Mutant KRAS as a critical determinant of the therapeutic response of colorectal cancer

PubMed Central

Knickelbein, Kyle; Zhang, Lin

2014-01-01

Mutations in the KRAS oncogene represent one of the most prevalent genetic alterations in colorectal cancer (CRC), the third leading cause of cancer-related death in the US. In addition to their well-characterized function in driving tumor progression, KRAS mutations have been recognized as a critical determinant of the therapeutic response of CRC. Recent studies demonstrate that KRAS-mutant tumors are intrinsically insensitive to clinically-used epidermal growth factor receptor (EGFR) targeting antibodies, including cetuximab and panitumumab. Acquired resistance to the anti-EGFR therapy was found to be associated with enrichment of KRAS-mutant tumor cells. However, the underlying molecular mechanism of mutant-KRAS-mediated therapeutic resistance has remained unclear. Despite intensive efforts, directly targeting mutant KRAS has been largely unsuccessful. This review summarizes the recent advances in understanding the biological function of KRAS mutations in determining the therapeutic response of CRC, highlighting several recently developed agents and strategies for targeting mutant KRAS, such as synthetic lethal interactions. PMID:25815366

Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

PubMed Central

Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

2008-01-01

Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

Mutants in three novel complementation groups inhibit membrane protein insertion into and soluble protein translocation across the endoplasmic reticulum membrane of Saccharomyces cerevisiae

PubMed Central

1992-01-01

We have isolated mutants that inhibit membrane protein insertion into the ER membrane of Saccharomyces cerevisiae. The mutants were contained in three complementation groups, which we have named SEC70, SEC71, and SEC72. The mutants also inhibited the translocation of soluble proteins into the lumen of the ER, indicating that they pleiotropically affect protein transport across and insertion into the ER membrane. Surprisingly, the mutants inhibited the translocation and insertion of different proteins to drastically different degrees. We have also shown that mutations in SEC61 and SEC63, which were previously isolated as mutants inhibiting the translocation of soluble proteins, also affect the insertion of membrane proteins into the ER. Taken together our data indicate that the process of protein translocation across the ER membrane involves a much larger number of gene products than previously appreciated. Moreover, different translocation substrates appear to have different requirements for components of the cellular targeting and translocation apparatus. PMID:1730771

Kinase inhibitor profiling reveals unexpected opportunities to inhibit disease-associated mutant kinases

PubMed Central

Duong-Ly, Krisna C.; Devarajan, Karthik; Liang, Shuguang; Horiuchi, Kurumi Y.; Wang, Yuren; Ma, Haiching; Peterson, Jeffrey R.

2016-01-01

Summary Small-molecule kinase inhibitors have typically been designed to inhibit wild-type kinases rather than the mutant forms that frequently arise in diseases such as cancer. Mutations can have serious clinical implications by increasing kinase catalytic activity or conferring therapeutic resistance. To identify opportunities to repurpose inhibitors against disease-associated mutant kinases, we conducted a large-scale functional screen of 183 known kinase inhibitors against 76 recombinant, mutant kinases. The results revealed lead compounds with activity against clinically important mutant kinases including ALK, LRRK2, RET, and EGFR as well as unexpected opportunities for repurposing FDA-approved kinase inhibitors as leads for additional indications. Furthermore, using T674I PDGFRα as an example, we show how single-dose screening data can provide predictive structure-activity data to guide subsequent inhibitor optimization. This study provides a resource for the development of inhibitors against numerous disease-associated mutant kinases and illustrates the potential of unbiased profiling as an approach to compound-centric inhibitor development. PMID:26776524

Identification and characterization of a putative cyclic nucleotide-gated channel, CNG-1, in C. elegans.

PubMed

Cho, Suk-Woo; Cho, Jeong-Hoon; Song, Hyun-Ok; Park, Chul-Seung

2005-02-28

Cyclic nucleotide-gated (CNG) channels encoded by the tax-4 and tax-2 genes are required for chemosensing and thermosensing in the nematode C. elegans. We identified a gene in the C. elegans genome, which we designated cng-1, that is highly homologous to tax-4. Partial CNG-1 protein tagged with green fluorescent protein was expressed in several sensory neurons of the amphid. We created a deletion mutant of cng-1, cng-1 (jh111), to investigate its in vivo function. The mutant worms had no detectable abnormalities in terms of their basic behavior or morphology. Whereas tax-4 and tax-2 mutants failed to respond to water-soluble or volatile chemical attractants, the cng-1 null mutant exhibited normal chemotaxis to such chemicals and a tax-4;cng-1 double mutant had a similar phenotype to tax-4 single mutants. Interestingly, cng-1 and tax-4 had a synergistic effect on brood size.

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd

2016-01-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

PubMed

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

Genome-Wide Mutagenesis in Borrelia burgdorferi.

PubMed

Lin, Tao; Gao, Lihui

2018-01-01

Signature-tagged mutagenesis (STM) is a functional genomics approach to identify bacterial virulence determinants and virulence factors by simultaneously screening multiple mutants in a single host animal, and has been utilized extensively for the study of bacterial pathogenesis, host-pathogen interactions, and spirochete and tick biology. The signature-tagged transposon mutagenesis has been developed to investigate virulence determinants and pathogenesis of Borrelia burgdorferi. Mutants in genes important in virulence are identified by negative selection in which the mutants fail to colonize or disseminate in the animal host and tick vector. STM procedure combined with Luminex Flex ® Map™ technology and next-generation sequencing (e.g., Tn-seq) are the powerful high-throughput tools for the determination of Borrelia burgdorferi virulence determinants. The assessment of multiple tissue sites and two DNA resources at two different time points using Luminex Flex ® Map™ technology provides a robust data set. B. burgdorferi transposon mutant screening indicates that a high proportion of genes are the novel virulence determinants that are required for mouse and tick infection. In this protocol, an effective signature-tagged Himar1-based transposon suicide vector was developed and used to generate a sequence-defined library of nearly 4800 mutants in the infectious B. burgdorferi B31 clone. In STM, signature-tagged suicide vectors are constructed by inserting unique DNA sequences (tags) into the transposable elements. The signature-tagged transposon mutants are generated when transposon suicide vectors are transformed into an infectious B. burgdorferi clone, and the transposable element is transposed into the 5'-TA-3' sequence in the B. burgdorferi genome with the signature tag. The transposon library is created and consists of many sub-libraries, each sub-library has several hundreds of mutants with same tags. A group of mice or ticks are infected with a mixed population of mutants with different tags, after recovered from different tissues of infected mice and ticks, mutants from output pool and input pool are detected using high-throughput, semi-quantitative Luminex ® FLEXMAP™ or next-generation sequencing (Tn-seq) technologies. Thus far, we have created a high-density, sequence-defined transposon library of over 6600 STM mutants for the efficient genome-wide investigation of genes and gene products required for wild-type pathogenesis, host-pathogen interactions, in vitro growth, in vivo survival, physiology, morphology, chemotaxis, motility, structure, metabolism, gene regulation, plasmid maintenance and replication, etc. The insertion sites of 4480 transposon mutants have been determined. About 800 predicted protein-encoding genes in the genome were disrupted in the STM transposon library. The infectivity and some functions of 800 mutants in 500 genes have been determined. Analysis of these transposon mutants has yielded valuable information regarding the genes and gene products important in the pathogenesis and biology of B. burgdorferi and its tick vectors.

RNA polymerase III mutants in TFIIFα-like C37 that cause terminator readthrough with no decrease in transcription output

PubMed Central

Rijal, Keshab; Maraia, Richard J.

2013-01-01

How eukaryotic RNA polymerases switch from elongation to termination is unknown. Pol III subunits Rpc53 and Rpc37 (C53/37) form a heterodimer homologous to TFIIFβ/α. C53/37 promotes efficient termination and together with C11 also mediates pol III recycling in vitro. We previously developed Schizosaccharomyces pombe strains that report on two pol III termination activities: RNA oligo(U) 3′-end cleavage, and terminator readthrough. We randomly mutagenized C53 and C37 and isolated many C37 mutants with terminator readthrough but no comparable C53 mutants. The majority of C37 mutants have strong phenotypes with up to 40% readthrough and map to a C-terminal tract previously localized near Rpc2p in the pol III active center while a minority represent a distinct class with weaker phenotype, less readthrough and 3′-oligo(U) lengthening. Nascent pre-tRNAs released from a terminator by C37 mutants have shorter 3′-oligo(U) tracts than in cleavage-deficient C11 double mutants indicating RNA 3′-end cleavage during termination. We asked whether termination deficiency affects transcription output in the mutants in vivo both by monitoring intron-containing nascent transcript levels and 14C-uridine incorporation. Surprisingly, multiple termination mutants have no decrease in transcript output relative to controls. These data are discussed in context of current models of pol III transcription. PMID:23093604

RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

PubMed Central

Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

2004-01-01

Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

Long-lived mitochondrial (Mit) mutants of Caenorhabditis elegans utilize a novel metabolism.

PubMed

Butler, Jeffrey A; Ventura, Natascia; Johnson, Thomas E; Rea, Shane L

2010-12-01

The Caenorhabditis elegans mitochondrial (Mit) mutants have disrupted mitochondrial electron transport chain (ETC) functionality, yet, surprisingly, they are long lived. We have previously proposed that Mit mutants supplement their energy needs by exploiting alternate energy production pathways normally used by wild-type animals only when exposed to hypoxic conditions. We have also proposed that longevity in the Mit mutants arises as a property of their new metabolic state. If longevity does arise as a function of metabolic state, we would expect to find a common metabolic signature among these animals. To test these predictions, we established a novel approach monitoring the C. elegans exometabolism as a surrogate marker for internal metabolic events. Using HPLC-ultraviolet-based metabolomics and multivariate analyses, we show that long-lived clk-1(qm30) and isp-1(qm150) Mit mutants have a common metabolic profile that is distinct from that of aerobically cultured wild-type animals and, unexpectedly, wild-type animals cultured under severe oxygen deprivation. Moreover, we show that 2 short-lived mitochondrial ETC mutants, mev-1(kn1) and ucr-2.3(pk732), also share a common metabolic signature that is unique. We show that removal of soluble fumarate reductase unexpectedly increases health span in several genetically defined Mit mutants, identifying at least 1 alternate energy production pathway, malate dismutation, that is operative in these animals. Our study suggests long-lived, genetically specified Mit mutants employ a novel metabolism and that life span may well arise as a function of metabolic state.

A high constitutive catalase activity confers resistance to methyl viologen-promoted oxidative stress in a mutant of the cyanobacterium Nostoc punctiforme ATCC 29133.

PubMed

Moirangthem, Lakshmipyari Devi; Bhattacharya, Sudeshna; Stensjö, Karin; Lindblad, Peter; Bhattacharya, Jyotirmoy

2014-04-01

A spontaneous methyl viologen (MV)-resistant mutant of the nitrogen-fixing cyanobacterium Nostoc punctiforme ATCC 29133 was isolated and the major enzymatic antioxidants involved in combating MV-induced oxidative stress were evaluated. The mutant displayed a high constitutive catalase activity as a consequence of which, the intracellular level of reactive oxygen species in the mutant was lower than the wild type (N. punctiforme) in the presence of MV. The superoxide dismutase (SOD) activity that consisted of a SodA (manganese-SOD) and a SodB (iron-SOD) was not suppressed in the mutant following MV treatment. The mutant was, however, characterised by a lower peroxidase activity compared with its wild type, and its improved tolerance to externally added H₂O₂ could only be attributed to enhanced catalase activity. Furthermore, MV-induced toxic effects on the wild type such as (1) loss of photosynthetic performance assessed as maximal quantum yield of photosystem II, (2) nitrogenase inactivation, and (3) filament fragmentation and cell lysis were not observed in the mutant. These findings highlight the importance of catalase in preventing MV-promoted oxidative damage and cell death in the cyanobacterium N. punctiforme. Such oxidative stress resistant mutants of cyanobacteria are likely to be a better source of biofertilisers, as they can grow and fix nitrogen in an unhindered manner in agricultural fields that are often contaminated with the herbicide MV, also commonly known as paraquat.

Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis

PubMed Central

Basu, Debarati; Showalter, Allan M.

2015-01-01

Hydroxyproline-O-galactosyltransferase (GALT) initiates O-glycosylation of arabinogalactan-proteins (AGPs). We previously characterized GALT2 (At4g21060), and now report on functional characterization of GALT5 (At1g74800). GALT5 was identified using heterologous expression in Pichia and an in vitro GALT assay. Product characterization showed GALT5 specifically adds galactose to hydroxyproline in AGP protein backbones. Functions of GALT2 and GALT5 were elucidated by phenotypic analysis of single and double mutant plants. Allelic galt5 and galt2 mutants, and particularly galt2 galt5 double mutants, demonstrated lower GALT activities and reductions in β-Yariv-precipitated AGPs compared to wild type. Mutant plants showed pleiotropic growth and development phenotypes (defects in root hair growth, root elongation, pollen tube growth, flowering time, leaf development, silique length, and inflorescence growth), which were most severe in the double mutants. Conditional mutant phenotypes were also observed, including salt-hypersensitive root growth and root tip swelling as well as reduced inhibition of pollen tube growth and root growth in response to β-Yariv reagent. These mutants also phenocopy mutants for an AGP, SOS5, and two cell wall receptor-like kinases, FEI1 and FEI2, which exist in a genetic signaling pathway. In summary, GALT5 and GALT2 function as redundant GALTs that control AGP O-glycosylation, which is essential for normal growth and development. PMID:25974423

[Pigment-protein complexes nd the number of the reaction photosystem centers in pea chlorophyll mutants].

PubMed

Ladygin, V G

2004-01-01

We studied fluorescent and absorption properties of the chloroplasts and pigment-protein complexes isolated by gel electrophoresis from the leaves of pea, the initial cultivar Torsdag and mutants chlorotica 2004 and 2014. Specific maxima of fluorescence and chlorophyll forms in individual complexes have been determined from the absorption and fluorescence spectra of the chloroplast chlorophyll and their secondary derivatives at 23 and -196 degrees C. Chlorotica 2004 mutant proved to have an increased intensity of a long-wave band at both 23 degrees C (745 nm) and -196 degrees C (728 nm) of the light-harvesting complex I. At the same time, this mutant featured a decreased accumulation of chlorophyll forms at 690, 697, and 708 nm forming the nearest-neighbor antenna of PSI reaction center. No spectral differences have been revealed between chlorotica 2014 mutant and the initial cultivar. Gel electrophoresis demonstrated synthesis of all chlorophyll-protein complexes in both mutants. At the same time, analysis of photochemical activity of PSI and PSII reaction centers and evaluation of the light-harvesting antenna as well as the number of reaction centers of the photosystems suggest that chlorotica 2004 mutant has 1.7 times less PSI reaction centers due to a mutation-disturbed chlorophyll a-protein complex of PSI. The primary effect of chlorotica 2014 mutation remains unclear. The proportional changes in the photosystem complexes in this mutant suggest that they are secondary and result from a 50% decrease in chlorophyll content.

Reduction of mutant huntingtin accumulation and toxicity by lysosomal cathepsins D and B in neurons

PubMed Central

2011-01-01

Background Huntington's disease is caused by aggregation of mutant huntingtin (mHtt) protein containing more than a 36 polyQ repeat. Upregulation of macroautophagy was suggested as a neuroprotective strategy to degrade mutant huntingtin. However, macroautophagy initiation has been shown to be highly efficient in neurons whereas lysosomal activities are rate limiting. The role of the lysosomal and other proteases in Huntington is not clear. Some studies suggest that certain protease activities may contribute to toxicity whereas others are consistent with protection. These discrepancies may be due to a number of mechanisms including distinct effects of the specific intermediate digestion products of mutant huntingtin generated by different proteases. These observations suggested a critical need to investigate the consequence of upregulation of individual lysosomal enzyme in mutant huntingtin accumulation and toxicity. Results In this study, we used molecular approaches to enhance lysosomal protease activities and examined their effects on mutant huntingtin level and toxicity. We found that enhanced expression of lysosomal cathepsins D and B resulted in their increased enzymatic activities and reduced both full-length and fragmented huntingtin in transfected HEK cells. Furthermore, enhanced expression of cathepsin D or B protected against mutant huntingtin toxicity in primary neurons, and their neuroprotection is dependent on macroautophagy. Conclusions These observations demonstrate a neuroprotective effect of enhancing lysosomal cathepsins in reducing mutant huntingtin level and toxicity in transfected cells. They highlight the potential importance of neuroprotection mediated by cathepsin D or B through macroautophagy. PMID:21631942

Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer

PubMed Central

Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

2017-01-01

Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo, erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity. PMID:29312548

Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer.

PubMed

Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

2017-12-12

Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo , erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity.

Multiple ABC transporters are involved in the acquisition of petrobactin in Bacillus anthracis

PubMed Central

Dixon, Shandee D.; Janes, Brian K.; Bourgis, Alexandra; Carlson, Paul E.; Hanna, Philip C.

2012-01-01

Summary In Bacillus anthracis the siderophore petrobactin is vital for iron acquisition and virulence. The petrobactin-binding receptor FpuA is required for these processes. Here additional components of petrobactin reacquisition are described. To identify these proteins, mutants of candidate permease and ATPase genes were generated allowing for characterization of multiple petrobactin ATP-binding cassette (ABC)-import systems. Either of two distinct permeases, FpuB or FatCD, are required for iron acquisition and play redundant roles in petrobactin transport. A mutant strain lacking both permeases, ΔfpuBΔfatCD, was incapable of using petrobactin as an iron source and exhibited attenuated virulence in a murine model of inhalational anthrax infection. ATPase mutants were generated in either of the permease mutant backgrounds to identify the ATPase(s) interacting with each individual permease channel. Mutants lacking the FpuB permease and FatE ATPase (ΔfpuBΔfatE) and a mutant lacking the distinct ATPases FpuC and FpuD generated in the ΔfatCD background (ΔfatCDΔfpuCΔfpuD) displayed phenotypic characteristics of a mutant deficient in petrobactin import. A mutant lacking all three of the identified ATPases (ΔfatEΔfpuCΔfpuD) exhibited the same growth defect in iron-depleted conditions. Taken together, these results provide the first description of the permease and ATPase proteins required for the import of petrobactin in B. anthracis. PMID:22429808

Genetic transformation of Neurospora tetrasperma, demonstration of repeat-induced point mutation (RIP) in self-crosses and a screen for recessive RIP-defective mutants.

PubMed Central

Bhat, Ashwin; Tamuli, Ranjan; Kasbekar, Durgadas P

2004-01-01

The pseudohomothallic fungus Neurospora tetrasperma is naturally resistant to the antibiotic hygromycin. We discovered that mutation of its erg-3 (sterol C-14 reductase) gene confers a hygromycin-sensitive phenotype that can be used to select transformants on hygromycin medium by complementation with the N. crassa erg-3+ and bacterial hph genes. Cotransformation of hph with PCR-amplified DNA of other genes enabled us to construct strains duplicated for the amplified DNA. Using transformation we constructed self-fertile strains that were homoallelic for an ectopic erg-3+ transgene and a mutant erg-3 allele at the endogenous locus. Self-crosses of these strains yielded erg-3 mutant ascospores that produced colonies with the characteristic morphology on Vogel's sorbose agar described previously for erg-3 mutants of N. crassa. The mutants were generated by repeat-induced point mutation (RIP), a genome defense process that causes numerous G:C to A:T mutations in duplicated DNA sequences. Homozygosity for novel recessive RIP-deficient mutations was signaled by self-crosses of erg-3-duplication strains that fail to produce erg-3 mutant progeny. Using this assay we isolated a UV-induced mutant with a putative partial RIP defect. RIP-induced mutants were isolated in rid-1 and sad-1, which are essential genes, respectively, for RIP and another genome defense mechanism called meiotic silencing by unpaired DNA. PMID:15280231

Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis.

PubMed

Basu, Debarati; Wang, Wuda; Ma, Siyi; DeBrosse, Taylor; Poirier, Emily; Emch, Kirk; Soukup, Eric; Tian, Lu; Showalter, Allan M

2015-01-01

Hydroxyproline-O-galactosyltransferase (GALT) initiates O-glycosylation of arabinogalactan-proteins (AGPs). We previously characterized GALT2 (At4g21060), and now report on functional characterization of GALT5 (At1g74800). GALT5 was identified using heterologous expression in Pichia and an in vitro GALT assay. Product characterization showed GALT5 specifically adds galactose to hydroxyproline in AGP protein backbones. Functions of GALT2 and GALT5 were elucidated by phenotypic analysis of single and double mutant plants. Allelic galt5 and galt2 mutants, and particularly galt2 galt5 double mutants, demonstrated lower GALT activities and reductions in β-Yariv-precipitated AGPs compared to wild type. Mutant plants showed pleiotropic growth and development phenotypes (defects in root hair growth, root elongation, pollen tube growth, flowering time, leaf development, silique length, and inflorescence growth), which were most severe in the double mutants. Conditional mutant phenotypes were also observed, including salt-hypersensitive root growth and root tip swelling as well as reduced inhibition of pollen tube growth and root growth in response to β-Yariv reagent. These mutants also phenocopy mutants for an AGP, SOS5, and two cell wall receptor-like kinases, FEI1 and FEI2, which exist in a genetic signaling pathway. In summary, GALT5 and GALT2 function as redundant GALTs that control AGP O-glycosylation, which is essential for normal growth and development.

Stability, frequency and multiplicity of transposon insertions in the pyoverdine region in the chromosomes of different fluorescent pseudomonads.

PubMed

Cornelis, P; Anjaiah, V; Koedam, N; Delfosse, P; Jacques, P; Thonart, P; Neirinckx, L

1992-07-01

Tn5 mutagenesis of different fluorescent pseudomonads was achieved by conjugational transfer of the suicide vector pSUP 10141. Pyoverdine negative (Pvd-) mutants were detected by the absence of fluorescence on King's B medium and by their inability to grow in the presence of the iron chelator EDDHA [ethylenediamine di(o-hydroxyphenylacetic acid)]. In P. fluorescens ATCC 17400 and three rhizosphere isolates (one P. putida and two P. fluorescens), the percentage of Pvd- mutants ranged between 0 and 0.54%. In a P. chlororaphis rhizosphere isolate, this percentage was higher (4%). In these mutants both of the Tn5 antibiotic resistances (Km and Tc) were stable and the transposon could be detected by hybridization. In Pvd- mutants of P. fluorescens ATCC 17400, the transposon was found to be inserted twice in the chromosome while single insertions were detected in the DNA of other, randomly tested mutants. In P. aeruginosa PAO1, where 13.1% of the mutants were Pvd-, both antibiotic resistances were rapidly lost and accordingly no transposon insertion could be detected by hybridization. However, the Pvd- phenotype was generally stable in these mutants. The plasmid pNK862 containing a mini-Tn10 transposon was introduced by electroporation into P. aeruginosa PAO1 and Kmr mutants were recovered, 89% of which were Pvd- and confirmed to be P. aeruginosa by PCR amplification of the P. aeruginosa lipoprotein gene. The mini-Tn10 insertions were also found to be unstable in PAO1.

Characterization of Novel Sorghum brown midrib Mutants from an EMS-Mutagenized Population

PubMed Central

Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L.; Vermerris, Wilfred; Pedersen, Jeffrey F.

2014-01-01

Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6, and bmr12, and, in addition, six bmr mutants were identified that were not allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Overall, most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles. PMID:25187038

Reduced starch granule number per chloroplast in the dpe2/phs1 mutant is dependent on initiation of starch degradation

PubMed Central

Malinova, Irina

2017-01-01

An Arabidopsis double knock-out mutant lacking cytosolic disproportionating enzyme 2 (DPE2) and the plastidial phosphorylase (PHS1) revealed a dwarf-growth phenotype, reduced starch content, an uneven distribution of starch within the plant rosette, and a reduced number of starch granules per chloroplast under standard growth conditions. In contrast, the wild type contained 5–7 starch granules per chloroplast. Mature and old leaves of the double mutant were essentially starch free and showed plastidial disintegration. Several analyses revealed that the number of starch granules per chloroplast was affected by the dark phase. So far, it was unclear if it was the dark phase per se or starch degradation in the dark that was connected to the observed decrease in the number of starch granules per chloroplast. Therefore, in the background of the double mutant dpe2/phs1, a triple mutant was generated lacking the initial starch degrading enzyme glucan, water dikinase (GWD). The triple mutant showed improved plant growth, a starch-excess phenotype, and a homogeneous starch distribution. Furthermore, the number of starch granules per chloroplast was increased and was similar to wild type. However, starch granule morphology was only slightly affected by the lack of GWD as in the triple mutant and, like in dpe2/phs1, more spherical starch granules were observed. The characterized triple mutant was discussed in the context of the generation of starch granules and the formation of starch granule morphology. PMID:29155859

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Reduced starch granule number per chloroplast in the dpe2/phs1 mutant is dependent on initiation of starch degradation.

PubMed

Malinova, Irina; Fettke, Joerg

2017-01-01

An Arabidopsis double knock-out mutant lacking cytosolic disproportionating enzyme 2 (DPE2) and the plastidial phosphorylase (PHS1) revealed a dwarf-growth phenotype, reduced starch content, an uneven distribution of starch within the plant rosette, and a reduced number of starch granules per chloroplast under standard growth conditions. In contrast, the wild type contained 5-7 starch granules per chloroplast. Mature and old leaves of the double mutant were essentially starch free and showed plastidial disintegration. Several analyses revealed that the number of starch granules per chloroplast was affected by the dark phase. So far, it was unclear if it was the dark phase per se or starch degradation in the dark that was connected to the observed decrease in the number of starch granules per chloroplast. Therefore, in the background of the double mutant dpe2/phs1, a triple mutant was generated lacking the initial starch degrading enzyme glucan, water dikinase (GWD). The triple mutant showed improved plant growth, a starch-excess phenotype, and a homogeneous starch distribution. Furthermore, the number of starch granules per chloroplast was increased and was similar to wild type. However, starch granule morphology was only slightly affected by the lack of GWD as in the triple mutant and, like in dpe2/phs1, more spherical starch granules were observed. The characterized triple mutant was discussed in the context of the generation of starch granules and the formation of starch granule morphology.

Identification and characterization of Escherichia coli RS218-derived islands in the pathogenesis of E. coli meningitis.

PubMed

Xie, Yi; Kolisnychenko, Vitaliy; Paul-Satyaseela, Maneesh; Elliott, Simon; Parthasarathy, Geetha; Yao, Yufeng; Plunkett, Guy; Blattner, Frederick R; Kim, Kwang Sik

2006-08-01

Escherichia coli K1 is the most common gram-negative bacterium causing neonatal meningitis, but the mechanisms by which E. coli K1 causes meningitis are not clear. We identified 22 E. coli RS218-derived genomic islands (RDIs), using a comparative genome analysis of meningitis-causing E. coli K1 strain RS218 (O18:K1:H7) and laboratory K-12 strain MG1655. Series of RDI deletion mutants were constructed and examined for phenotypes relevant to E. coli K1 meningitis. We identified 9 RDI deletion mutants (RDI 1, 4, 7, 12, 13, 16, 20, 21, and 22) that exhibited defects in meningitis development. RDI 16 and 21 mutants had profound defects in the induction of a high level of bacteremia in neonatal rats, and RDI 4 mutants exhibited a moderate defect in the induction of bacteremia. RDI 1 and 22 mutants showed defects in the ability to invade human brain microvascular endothelial cells (HBMECs), and RDI 12 mutants were defective in the ability to bind to HBMECs. RDI 13 and 20 mutants were defective in the ability to both bind to and invade HBMECs. RDI 7 mutants were defective in the induction of bacteremia and in the ability to both bind to and invade HBMECs. These results provide a framework for the future discovery and analysis of bacteremia and meningitis caused by E. coli K1 strain RS218.

Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.

PubMed

Paik, Sehmi; Senty, Lauren; Das, Sankar; Noe, Jody C; Munro, Cindy L; Kitten, Todd

2005-09-01

Streptococcus sanguinis is a gram-positive, facultative anaerobe and a normal inhabitant of the human oral cavity. It is also one of the most common agents of infective endocarditis, a serious endovascular infection. To identify virulence factors for infective endocarditis, signature-tagged mutagenesis (STM) was applied to the SK36 strain of S. sanguinis, whose genome is being sequenced. STM allows the large-scale creation, in vivo screening, and recovery of a series of mutants with altered virulence. Screening of 800 mutants by STM identified 38 putative avirulent and 5 putative hypervirulent mutants. Subsequent molecular analysis of a subset of these mutants identified genes encoding undecaprenol kinase, homoserine kinase, anaerobic ribonucleotide reductase, adenylosuccinate lyase, and a hypothetical protein. Virulence reductions ranging from 2-to 150-fold were confirmed by competitive index assays. One putatively hypervirulent strain with a transposon insertion in an intergenic region was identified, though increased virulence was not confirmed in competitive index assays. All mutants grew comparably to SK36 in aerobic broth culture except for the homoserine kinase mutant. Growth of this mutant was restored by the addition of threonine to the medium. Mutants containing an insertion or in-frame deletion in the anaerobic ribonucleotide reductase gene failed to grow under strictly anaerobic conditions. The results suggest that housekeeping functions such as cell wall synthesis, amino acid and nucleic acid synthesis, and the ability to survive under anaerobic conditions are important virulence factors in S. sanguinis endocarditis.

Identification of Virulence Determinants for Endocarditis in Streptococcus sanguinis by Signature-Tagged Mutagenesis†

PubMed Central

Paik, Sehmi; Senty, Lauren; Das, Sankar; Noe, Jody C.; Munro, Cindy L.; Kitten, Todd

2005-01-01

Streptococcus sanguinis is a gram-positive, facultative anaerobe and a normal inhabitant of the human oral cavity. It is also one of the most common agents of infective endocarditis, a serious endovascular infection. To identify virulence factors for infective endocarditis, signature-tagged mutagenesis (STM) was applied to the SK36 strain of S. sanguinis, whose genome is being sequenced. STM allows the large-scale creation, in vivo screening, and recovery of a series of mutants with altered virulence. Screening of 800 mutants by STM identified 38 putative avirulent and 5 putative hypervirulent mutants. Subsequent molecular analysis of a subset of these mutants identified genes encoding undecaprenol kinase, homoserine kinase, anaerobic ribonucleotide reductase, adenylosuccinate lyase, and a hypothetical protein. Virulence reductions ranging from 2-to 150-fold were confirmed by competitive index assays. One putatively hypervirulent strain with a transposon insertion in an intergenic region was identified, though increased virulence was not confirmed in competitive index assays. All mutants grew comparably to SK36 in aerobic broth culture except for the homoserine kinase mutant. Growth of this mutant was restored by the addition of threonine to the medium. Mutants containing an insertion or in-frame deletion in the anaerobic ribonucleotide reductase gene failed to grow under strictly anaerobic conditions. The results suggest that housekeeping functions such as cell wall synthesis, amino acid and nucleic acid synthesis, and the ability to survive under anaerobic conditions are important virulence factors in S. sanguinis endocarditis. PMID:16113327

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE PAGES

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.; ...

2014-12-22

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

TOMATOMA Update: Phenotypic and Metabolite Information in the Micro-Tom Mutant Resource.

PubMed

Shikata, Masahito; Hoshikawa, Ken; Ariizumi, Tohru; Fukuda, Naoya; Yamazaki, Yukiko; Ezura, Hiroshi

2016-01-01

TOMATOMA (http://tomatoma.nbrp.jp/) is a tomato mutant database providing visible phenotypic data of tomato mutant lines generated by ethylmethane sulfonate (EMS) treatment or γ-ray irradiation in the genetic background of Micro-Tom, a small and rapidly growing variety. To increase mutation efficiency further, mutagenized M3 seeds were subjected to a second round of EMS treatment; M3M1 populations were generated. These plants were self-pollinated, and 4,952 lines of M3M2 mutagenized seeds were generated. We checked for visible phenotypes in the M3M2 plants, and 618 mutant lines with 1,194 phenotypic categories were identified. In addition to the phenotypic information, we investigated Brix values and carotenoid contents in the fruits of individual mutants. Of 466 samples from 171 mutant lines, Brix values and carotenoid contents were between 3.2% and 11.6% and 6.9 and 37.3 µg g(-1) FW, respectively. This metabolite information concerning the mutant fruits would be useful in breeding programs as well as for the elucidation of metabolic regulation. Researchers are able to browse and search this phenotypic and metabolite information and order seeds of individual mutants via TOMATOMA. Our new Micro-Tom double-mutagenized populations and the metabolic information could provide a valuable genetic toolkit to accelerate tomato research and potential breeding programs. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Lactose carrier mutants of Escherichia coli with changes in sugar recognition (lactose versus melibiose).

PubMed

Varela, M F; Brooker, R J; Wilson, T H

1997-09-01

The purpose of this research was to identify amino acid residues that mediate substrate recognition in the lactose carrier of Escherichia coli. The lactose carrier transports the alpha-galactoside sugar melibiose as well as the beta-galactoside sugar lactose. Mutants from cells containing the lac genes on an F factor were selected by the ability to grow on succinate in the presence of the toxic galactoside beta-thio-o-nitrophenylgalactoside. Mutants that grew on melibiose minimal plates but failed to grow on lactose minimal plates were picked. In sugar transport assays, mutant cells showed the striking result of having low levels of lactose downhill transport but high levels of melibiose downhill transport. Accumulation (uphill) of melibiose was completely defective in all of the mutants. Kinetic analysis of melibiose transport in the mutants showed either no change or a greater than normal apparent affinity for melibiose. PCR was used to amplify the lacY DNA of each mutant, which was then sequenced by the Sanger method. The following six mutations were found in the lacY structural genes of individual mutants: Tyr-26-->Asp, Phe-27-->Tyr, Phe-29-->Leu, Asp-240-->Val, Leu-321-->Gln, and His-322-->Tyr. We conclude from these experiments that Tyr-26, Phe-27, Phe-29 (helix 1), Asp-240 (helix 7), Leu-321, and His-322 (helix 10) either directly or indirectly mediate sugar recognition in the lactose carrier of E. coli.

Engineered strains of Streptococcus macedonicus towards an osmotic stress resistant phenotype retain their ability to produce the bacteriocin macedocin under hyperosmotic conditions.

PubMed

Anastasiou, Rania; Driessche, Gonzalez Van; Boutou, Effrossyni; Kazou, Maria; Alexandraki, Voula; Vorgias, Constantinos E; Devreese, Bart; Tsakalidou, Effie; Papadimitriou, Konstantinos

2015-10-20

Streptococcus macedonicus ACA-DC 198 produces the bacteriocin macedocin in milk only under low NaCl concentrations (<1.0%w/v). The thermosensitive plasmid pGh9:ISS1 was employed to generate osmotic stress resistant (osmr) mutants of S. macedonicus. Three osmr mutants showing integration of the vector in unique chromosomal sites were identified and the disrupted loci were characterized. Interestingly, the mutants were able to grow and to produce macedocin at considerably higher concentrations of NaCl compared to the wild-type (up to 4.0%w/v). The production of macedocin under hyperosmotic conditions solely by the osmr mutants was validated by the well diffusion assay and by mass spectrometry analysis. RT-PCR experiments demonstrated that the macedocin biosynthetic regulon was transcribed at high salt concentrations only in the mutants. Mutant osmr3, the most robust mutant, was converted in its markerless derivative (osmr3f). Co-culture of S. macedonicus with spores of Clostridium tyrobutyricum in milk demonstrated that only the osmr3f mutant and not the wild-type inhibited the growth of the spores under hyperosmotic conditions (i.e., 2.5%w/v NaCl) due to the production of macedocin. Our study shows how genetic manipulation of a strain towards a stress resistant phenotype could improve bacteriocin production under conditions of the same stress. Copyright © 2015 Elsevier B.V. All rights reserved.

A Genetic Screen for Mutants with Supersized Lipid Droplets in Caenorhabditis elegans

PubMed Central

Li, Shiwei; Xu, Shibin; Ma, Yanli; Wu, Shuang; Feng, Yu; Cui, Qingpo; Chen, Lifeng; Zhou, Shuang; Kong, Yuanyuan; Zhang, Xiaoyu; Yu, Jialei; Wu, Mengdi; Zhang, Shaobing O.

2016-01-01

To identify genes that regulate the dynamics of lipid droplet (LD) size, we have used the genetically tractable model organism Caenorhabditis elegans, whose wild-type LD population displays a steady state of size with an upper limit of 3 μm in diameter. From a saturated forward genetic screen of 6.7 × 105 mutagenized haploid genomes, we isolated 118 mutants with supersized intestinal LDs often reaching 10 μm. These mutants define nine novel complementation groups, in addition to four known genes (maoc-1, dhs-28, daf-22, and prx-10). The nine groups are named drop (lipid droplet abnormal) and categorized into four classes. Class I mutants drop-5 and drop-9, similar to prx-10, are up-regulated in ACS-22-DGAT-2-dependent LD growth, resistant to LD hydrolysis, and defective in peroxisome import. Class II mutants drop-2, drop-3, drop-6, and drop-7 are up-regulated in LD growth, are resistant to LD hydrolysis, but are not defective in peroxisome import. Class III mutants drop-1 and drop-8 are neither up-regulated in LD growth nor resistant to LD hydrolysis, but seemingly up-regulated in LD fusion. Class IV mutant drop-4 is cloned as sams-1 and, different to the other three classes, is ACS-22-independent and hydrolysis-resistant. These four classes of supersized LD mutants should be valuable for mechanistic studies of LD cellular processes including growth, hydrolysis, and fusion. PMID:27261001

A Pharmacogenetic Approach to Identify Mutant Forms of α-Galactosidase A that Respond to a Pharmacological Chaperone for Fabry Disease

PubMed Central

Wu, Xiaoyang; Katz, Evan; Valle, Maria Cecilia Della; Mascioli, Kirsten; Flanagan, John J; Castelli, Jeffrey P; Schiffmann, Raphael; Boudes, Pol; Lockhart, David J; Valenzano, Kenneth J; Benjamin, Elfrida R

2011-01-01

Fabry disease is caused by mutations in the gene (GLA) that encodes α-galactosidase A (α-Gal A). The iminosugar AT1001 (GR181413A, migalastat hydrochloride, 1-deoxygalactonojirimycin) is a pharmacological chaperone that selectively binds and stabilizes α-Gal A, increasing total cellular levels and activity for some mutant forms (defined as “responsive”). In this study, we developed a cell-based assay in cultured HEK-293 cells to identify mutant forms of α-Gal A that are responsive to AT1001. Concentration-dependent increases in α-Gal A activity in response to AT1001 were shown for 49 (60%) of 81 mutant forms. The responses of α-Gal A mutant forms were generally consistent with the responses observed in male Fabry patient-derived lymphoblasts. Importantly, the HEK-293 cell responses of 19 α-Gal A mutant forms to a clinically achievable concentration of AT1001 (10 µM) were generally consistent with observed increases in α-Gal A activity in peripheral blood mononuclear cells from male Fabry patients orally administered AT1001 during Phase 2 clinical studies. This indicates that the cell-based responses can identify mutant forms of α-Gal A that are likely to respond to AT1001 in vivo. Thus, the HEK-293 cell-based assay may be a useful aid in the identification of Fabry patients with AT1001-responsive mutant forms. Hum Mutat 32:1–13, 2011. © 2011 Wiley-Liss, Inc. PMID:21598360

Cdx mutant axial progenitor cells are rescued by grafting to a wild type environment.

PubMed

Bialecka, Monika; Wilson, Valerie; Deschamps, Jacqueline

2010-11-01

Cdx transcription factors are required for axial extension. Cdx genes are expressed in the posterior growth zone, a region that supplies new cells for axial elongation. Cdx2(+/-)Cdx4(-/-) (Cdx2/4) mutant embryos show abnormalities in axis elongation from E8.5, culminating in axial truncation at E10.5. These data raised the possibility that the long-term axial progenitors of Cdx mutants are intrinsically impaired in their ability to contribute to posterior growth. We investigated whether we could identify cell-autonomous defects of the axial progenitor cells by grafting mutant cells into a wild type growth zone environment. We compared the contribution of GFP labeled mutant and wild type progenitors grafted to unlabeled wild type recipients subsequently cultured over the period during which Cdx2/4 defects emerge. Descendants of grafted cells were scored for their contribution to differentiated tissues in the elongating axis and to the posterior growth zone. No difference between the contribution of descendants from wild type and mutant grafted progenitors was detected, indicating that rescue of the Cdx mutant progenitors by the wild type recipient growth zone is provided non-cell autonomously. Recently, we showed that premature axial termination of Cdx mutants can be partly rescued by stimulating canonical Wnt signaling in the posterior growth zone. Taken together with the data shown here, this suggests that Cdx genes function to maintain a signaling-dependent niche for the posterior axial progenitors. Copyright © 2010 Elsevier Inc. All rights reserved.

Ionomic screening of field-grown soybeans identifies mutants with altered seed elemental composition

USDA-ARS?s Scientific Manuscript database

Soybean seeds contain high levels of mineral nutrients essential for human and animal nutrition. High throughput elemental profiling (ionomics) has identified mutants in model plant species grown in controlled environments. Here, we describe a method for identifying potential soybean ionomics mutant...

Description of a novel allelic “thick leafed” mutant of sorghum

USDA-ARS?s Scientific Manuscript database

An allelic sorghum [Sorghum bicolor (L.) Moench] mutant with thick and narrow erect leaves (thl) and reduced adaxial stomatal density was isolated from the Annotated Individually pedigreed Mutagenized Sorghum (AIMS) mutant library developed at the Plant Stress and Germplasm Development Unit at Lubbo...

Development and characterization of rice mutants for functional genomic studies and breeding

USDA-ARS?s Scientific Manuscript database

Mutagenesis is a powerful tool for creating genetic materials for studying functional genomics, breeding, and understanding the molecular basis of disease resistance. Approximately 100,000 putative mutants of rice (Oryza sativa L.) have been generated with mutagens. Numerous mutant genes involved in...

Double-strand break repair and genetic recombination in topoisomerase and primase mutants of bacteriophage T4.

PubMed

Shcherbakov, Victor P; Kudryashova, Elena

2014-09-01

The effects of primase and topoisomerase II deficiency on the double-strand break (DSB) repair and genetic recombination in bacteriophage T4 were studied in vivo using focused recombination. Site-specific DSBs were induced by SegC endonuclease in the rIIB gene of one of the parents. The frequency/distance relationship was determined in crosses of the wild-type phage, topoisomerase II mutant amN116 (gene 39), and primase mutant E219 (gene 61). Ordinary two-factor (i×j) and three-factor (i k×j) crosses between point rII mutations were also performed. These data provide information about the frequency and distance distribution of the single-exchange (splice) and double-exchange (patch) events. In two-factor crosses ets1×i, the topoisomerase and primase mutants had similar recombinant frequencies in crosses at ets1-i distances longer than 1000 bp, comprising about 80% of the corresponding wild-type values. They, however, differ remarkably in crosses at shorter distances. In the primase mutant, the recombinant frequencies are similar to those in the wild-type crosses at distances less than 100 bp, being a bit diminished at longer distances. In two-factor crosses ets1×i of the topoisomerase mutant, the recombinant frequencies were reduced ten-fold at the shortest distances. In three-factor crosses a6 ets1×i, where we measure patch-related recombination, the primase mutant was quite proficient across the entire range of distances. The topoisomerase mutant crosses demonstrated virtually complete absence of rII(+) recombinants at distances up to 33 bp, with the frequencies increasing steadily at longer distances. The data were interpreted as follows. The primase mutant is fully recombination-proficient. An obvious difference from the wild-type state is some shortage of EndoVII function leading to prolonged existence of HJs and thus stretched out ds-branch migration. This is also true for the topoisomerase mutant. However, the latter is deficient in the ss-branch migration step of the DSB repair pathway and partially deficient in HJ initiation. In apparent contradiction to their effects on the DSB-induced site-specific recombination, the topoisomerase and primase mutants demonstrated about 3-8-fold increase in the recombinant frequencies in the ordinary crosses, with the recombination running exclusively via patches. This implies that most of the spontaneous recombination events are not initiated by dsDNA ends in these mutants. Copyright © 2014 Elsevier B.V. All rights reserved.

Identical substitutions in magnesium chelatase paralogs result in chlorophyll deficient soybean mutants

USDA-ARS?s Scientific Manuscript database

The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...

Isolation, characterization, and expression analyses of tryptophan

USDA-ARS?s Scientific Manuscript database

The dek18 mutant of maize has decreased auxin content in kernels. Molecular and functional characterization of this mutant line offers the possibility to better understand auxin biology in maize seed development. Seeds of the dek18 mutants are smaller compared to wild type seeds and the vegetative d...

A Laboratory Exercise for Isolation and Characterizing Microbial Mutants with Metabolic Defects.

ERIC Educational Resources Information Center

Doe, Frank J.; Leslie, John F.

1993-01-01

Describes science experiments for undergraduate biology instruction on the concepts of mutation and characterization of the resulting mutant strains. The filamentous fungi "Fusarium moniliforme" is used to illustrate the induction of mutants (mutagenesis), identification of the mutated gene, construction of a biochemical pathway, and…

Characterization of a bi-pistil mutant in Medicago truncatula Gaertn

USDA-ARS?s Scientific Manuscript database

We propose the name bi-pistil, bip, for a floral organ mutant observed in transgenic Medicago truncatula plants. The mutant has two separate stigmas borne on two separate styles that emerge from a single superior carpel primordium. The bip plant was crossed to a previously reported male sterile mtap...

Genetics and physiology of the nuclearly inherited yellow foliar mutants in soybean

USDA-ARS?s Scientific Manuscript database

Plant photosynthetic pigments are important in harvesting the light energy and transfer of energy during photosynthesis. There are several yellow foliar mutants discovered in soybean and chromosomal locations for about half of them have been deduced. Viable-yellow mutants are capable of surviving wi...

[The inheritance of an ultra-dwarf plant mutant from upland cotton].

PubMed

Chen, Xu-Sheng; DI, Jia-Chun; Xu, Nai-Yin; Xiao, Song-Hua; Liu, Jian-Guang

2007-04-01

The inheritance of an ultra-dwarf plant mutant from upland cotton (Gossypium hirsutum L.) was studied, which showed that the mutant was controlled by single recessive quality gene. This gene was denominated as du tentatively. No similar mutant has been found in upland cotton. The mutation could not normally flower and produce bolls under natural conditions, and its mature height was only 10.5 cm. When treated with exogenous GA3, it could normally flower and boll, and plant height could reach 57.8 cm finally.

Comparative Study of the Mutant Prevention Concentrations of Moxifloxacin, Levofloxacin, and Gemifloxacin against Pneumococci▿ †

PubMed Central

Credito, Kim; Kosowska-Shick, Klaudia; McGhee, Pamela; Pankuch, Glenn A.; Appelbaum, Peter C.

2010-01-01

We tested the propensity of three quinolones to select for resistant Streptococcus pneumoniae mutants by determining the mutant prevention concentration (MPC) against 100 clinical strains, some of which harbored mutations in type II topoisomerases. Compared with levofloxacin and gemifloxacin, moxifloxacin had the lowest number of strains with MPCs above the susceptibility breakpoint (P < 0.001), thus representing a lower selective pressure for proliferation of resistant mutants. Only moxifloxacin gave a 50% MPC (MPC50) value (1 μg/ml) within the susceptible range. PMID:20008781

Comparative study of the mutant prevention concentrations of moxifloxacin, levofloxacin, and gemifloxacin against pneumococci.

PubMed

Credito, Kim; Kosowska-Shick, Klaudia; McGhee, Pamela; Pankuch, Glenn A; Appelbaum, Peter C

2010-02-01

We tested the propensity of three quinolones to select for resistant Streptococcus pneumoniae mutants by determining the mutant prevention concentration (MPC) against 100 clinical strains, some of which harbored mutations in type II topoisomerases. Compared with levofloxacin and gemifloxacin, moxifloxacin had the lowest number of strains with MPCs above the susceptibility breakpoint (P<0.001), thus representing a lower selective pressure for proliferation of resistant mutants. Only moxifloxacin gave a 50% MPC (MPC50) value (1 microg/ml) within the susceptible range.

Induction of diphtheria toxin-resistant mutants in human cells by ultraviolet light

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rocchi, P.; Ferreri, A.M.; Capucci, A.

1981-01-01

Stable spontaneous mutants resistant to the protein synthesis inhibitor diphtheria toxin (DT) have been selected in human cell line EUE at a very low frequency (less than 8 x 10(-6)). U.v.-induced mutation has been quantitatively measured: treatment of cells with u.v. light increased the frequencies of diphtheria toxin resistant (DTr) mutants up to 1000-fold. The maximum recovery of DTr mutants was observed after a short expression period, for all u.v. doses tested, and was followed by a decrease in mutation frequency on subsequent passages.

Induction of diphtheria toxin-resistant mutants in human cells by ultraviolet light

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rocchi, P.; Ferreri, A.M.; Capucci, A.

1981-01-01

Stable spontaneous mutants resistant to the protein synthesis inhibitor diphtheria toxin (DT) have been selected in human cell line EUE at a very low frequency (< 8 x 10/sup -6/). U.v.-induced mutation has been quantitatively measured: treatment of cells with u.v. light increased the frequencies of diphtheria toxin resistant (DTsup(r)) mutants up to 1000-fold. The maximum recovery of DTsup(r) mutants was observed after a short expression period, for all u.v. doses tested, and was followed by a decrease in mutation frequency on subsequent passages.

Induction of stable benomyl-tolerant phenotypic mutants of Trichoderma pseudokoningii MTCC 3011, and their evaluation for antagonistic and biocontrol potential.

PubMed

Mukherjee, P K; Sherkhane, P D; Murthy, N B

1999-07-01

Trichoderma pseudokoningii MTCC 3011 is a very useful strain for biological control of the plant pathogen Sclerotium rolfsii under post-harvest conditions. In the present investigation, several benomyl-tolerant phenotypic mutants of this strain have been generated using a two step mutagenesis-chemical followed by gamma irradiation. The mutants differed from the wild type strain in antibiotic and disease control potential. Some of the mutants are superior to the wild type in biocontrol potential on S. rolfsii.

Correlation of Resistance to Proflavine and Penicillin in Escherichia coli

PubMed Central

McKellar, Robin C.; McKenzie, Colin N.; Kushner, Donn J.

1976-01-01

A number of proflavine (PF)-resistant mutants of Escherichia coli B were also resistant to penicillin and cephalothin. Mutants resistant to 1.0 mM PF were 10 times more penicillin resistant than were the PF-susceptible, wild-type cells. Single-step mutants selected for resistance to either PF or penicillin were also resistant to the other drug. None of the resistant mutants tested possessed β-lactamase activity. These results suggest that resistance to PF and penicillin in E. coli B may be due to permeability changes in the cell envelope. PMID:791110

Elucidating the Mechanism of Gain of Toxic Function from Mutant C1 Inhibitor Proteins in Hereditary Angioedema

DTIC Science & Technology

2016-10-01

this is due, at least in part, to an additional acquired GOTF defect caused by the mutant protein that interferes with the secretion of WT C1INH. Our...overall hypothesis is that mutant C1INH proteins exert a variable GOTF phenotype that inhibit secretion of WT C1INH protein and worsen disease...will assess the mechanisms of the GOTF with a hypothesis that misfolding of mutant C1INH protein in the ER causes impairment of WT C1INH secretion

Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants.

PubMed Central

Felser, J M; Straus, S E; Ostrove, J M

1987-01-01

Varicella-zoster virus (VZV) can complement temperature-sensitive mutants of herpes simplex virus. Of seven mutants tested, two, carrying mutations in the immediate-early ICP4 and ICP27 proteins, were complemented. This complementation was not seen in coinfections with adenovirus type 5 or cytomegalovirus. Following transfection into CV-1 cells, a DNA fragment containing the VZV short repeat sequence complemented the ICP4 mutant. These data demonstrate a functional relationship between VZV and herpes simplex virus and have allowed localization of a putative VZV immediate-early gene. PMID:3023701

A dinoflagellate mutant with higher frequency of multiple fission.

PubMed

Lam, C M; Chong, C; Wong, J T

2001-01-01

The dinoflagellate Crypthecodinium cohnii Biecheler propagates by both binary and multiple fission. By a newly developed mutagenesis protocol based on using ethyl methanesulfonate and a cell size screening method, a cell cycle mutant, mf2, was isolated with giant cells which predominantly divide by multiple fission. The average cell size of the mutant mf2 is larger than the control C. cohnii. Cell cycle synchronization experiments suggest that mutant mf2, when compared with the control strain, has a prolonged G1 phase with a corresponding delay of the G2 + M phase.

Functional census of mutation sequence spaces: The example of p53 cancer rescue mutants

PubMed Central

Danziger, Samuel A.; Swamidass, S. Joshua; Zeng, Jue; Dearth, Lawrence R.; Lu, Qiang; Chen, Jonathan H.; Cheng, Jainlin; Hoang, Vinh P.; Saigo, Hiroto; Luo, Ray; Baldi, Pierre; Brachmann, Rainer K.; Lathrop, Richard H.

2009-01-01

Many biomedical problems relate to mutant functional properties across a sequence space of interest, e.g., flu, cancer, and HIV. Detailed knowledge of mutant properties and function improves medical treatment and prevention. A functional census of p53 cancer rescue mutants would aid the search for cancer treatments from p53 rescue. We devised a general methodology for conducting a functional census of a mutation sequence space, and conducted a double-blind predictive test on the functional rescue property of 71 novel putative p53 cancer rescue mutants iteratively predicted in sets of 3. Double-blind predictive accuracy (15-point moving window) rose from 47% to 86% over the trial (r = 0.74). Code and data are available upon request1. PMID:17048398

Not just gRASping at flaws: Finding vulnerabilities to develop novel therapies for treating KRAS mutant cancers

PubMed Central

Ebi, Hiromichi; Faber, Anthony C; Engelman, Jeffrey A; Yano, Seiji

2014-01-01

Mutations in Kirsten rat-sarcoma (KRAS) are well appreciated to be major drivers of human cancers through dysregulation of multiple growth and survival pathways. Similar to many other non-kinase oncogenes and tumor suppressors, efforts to directly target KRAS pharmaceutically have not yet materialized. As a result, there is broad interest in an alternative approach to develop therapies that induce synthetic lethality in cancers with mutant KRAS, therefore exposing the particular vulnerabilities of these cancers. Fueling these efforts is our increased understanding into the biology driving KRAS mutant cancers, in particular the important pathways that mutant KRAS governs to promote survival. In this mini-review, we summarize the latest approaches to treat KRAS mutant cancers and the rationale behind them. PMID:24612015

The Broad Spectrum Receptor Tyrosine Kinase Inhibitor Dovitinib Suppresses Growth of BRAF Mutant Melanoma Cells in Combination with Other Signaling Pathway Inhibitors

PubMed Central

Langdon, Casey G.; Held, Matthew A.; Platt, James T.; Meeth, Katrina; Iyidogan, Pinar; Mamillapalli, Ramanaiah; Koo, Andrew B.; Klein, Michael; Liu, Zongzhi; Bosenberg, Marcus W.; Stern, David F.

2016-01-01

Summary BRAF inhibitors have revolutionized treatment of mutant BRAF metastatic melanomas. However, resistance develops rapidly following BRAF inhibitor treatment. We have found that BRAF-mutant melanoma cell lines are more sensitive than wild-type BRAF cells to the small molecule tyrosine kinase inhibitor dovitinib. Sensitivity is associated with inhibition of a series of known dovitinib targets. Dovitinib in combination with several agents inhibits growth more effectively than either agent alone. These combinations inhibit BRAF-mutant melanoma and colorectal carcinoma cell lines, including cell lines with intrinsic or selected BRAF inhibitor resistance. Hence, combinations of dovitinib with second agents are potentially effective therapies for BRAF-mutant melanomas, regardless of their sensitivity to BRAF inhibitors. PMID:25854919

Fused pulmonary lobes is a rat model of human Fraser syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiyozumi, Daiji; Nakano, Itsuko; Takahashi, Ken L.

Highlights: {yields} Fused pulmonary lobes (fpl) mutant rats exhibit similar phenotypes to Fraser syndrome. {yields} The fpl gene harbors a nonsense mutation in Fraser syndrome-associated gene Frem2. {yields} Fpl mutant is defined as a first model of human Fraser syndrome in rats. -- Abstract: Fused pulmonary lobes (fpl) is a mutant gene that is inherited in an autosomal recessive manner and causes various developmental defects, including fusion of pulmonary lobes, and eyelid and digit anomalies in rats. Since these developmental defects closely resemble those observed in patients with Fraser syndrome, a recessive multiorgan disorder, and its model animals, we investigatedmore » whether the abnormal phenotypes observed in fpl/fpl mutant rats are attributable to a genetic disorder similar to Fraser syndrome. At the epidermal basement membrane in fpl/fpl mutant neonates, the expression of QBRICK, a basement membrane protein whose expression is attenuated in Fraser syndrome model mice, was greatly diminished compared with control littermates. Quantitative RT-PCR analyses of Fraser syndrome-related genes revealed that Frem2 transcripts were markedly diminished in QBRICK-negative embryos. Genomic DNA sequencing of the fpl/fpl mutant identified a nonsense mutation that introduced a stop codon at serine 2005 in Frem2. These findings indicate that the fpl mutant is a rat model of human Fraser syndrome.« less

Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor

PubMed Central

Patel, Dhaval S.; Garza-Garcia, Acely; Nanji, Manoj; McElwee, Joshua J.; Ackerman, Daniel; Driscoll, Paul C.; Gems, David

2008-01-01

The DAF-2 insulin/IGF-1 receptor regulates development, metabolism, and aging in the nematode Caenorhabditis elegans. However, complex differences among daf-2 alleles complicate analysis of this gene. We have employed epistasis analysis, transcript profile analysis, mutant sequence analysis, and homology modeling of mutant receptors to understand this complexity. We define an allelic series of nonconditional daf-2 mutants, including nonsense and deletion alleles, and a putative null allele, m65. The most severe daf-2 alleles show incomplete suppression by daf-18(0) and daf-16(0) and have a range of effects on early development. Among weaker daf-2 alleles there exist distinct mutant classes that differ in epistatic interactions with mutations in other genes. Mutant sequence analysis (including 11 newly sequenced alleles) reveals that class 1 mutant lesions lie only in certain extracellular regions of the receptor, while class 2 (pleiotropic) and nonconditional missense mutants have lesions only in the ligand-binding pocket of the receptor ectodomain or the tyrosine kinase domain. Effects of equivalent mutations on the human insulin receptor suggest an altered balance of intracellular signaling in class 2 alleles. These studies consolidate and extend our understanding of the complex genetics of daf-2 and its underlying molecular biology. PMID:18245374

Proteomic analysis of the flooding tolerance mechanism in mutant soybean.

PubMed

Komatsu, Setsuko; Nanjo, Yohei; Nishimura, Minoru

2013-02-21

Flooding stress of soybean is a serious problem because it reduces growth; however, flooding-tolerant cultivars have not been identified. To analyze the flooding tolerance mechanism of soybean, the flooding-tolerant mutant was isolated and analyzed using a proteomic technique. Flooding-tolerance tests were repeated five times using gamma-ray irradiated soybeans, whose root growth (M6 stage) was not suppressed even under flooding stress. Two-day-old wild-type and mutant plants were subjected to flooding stress for 2days, and proteins were identified using a gel-based proteomic technique. In wild-type under flooding stress, levels of proteins related to development, protein synthesis/degradation, secondary metabolism, and the cell wall changed; however, these proteins did not markedly differ in the mutant. In contrast, an increased number of fermentation-related proteins were identified in the mutant under flooding stress. The root tips of mutant plants were not affected by flooding stress, even though the wild-type plants had damaged root. Alcohol dehydrogenase activity in the mutant increased at an early stage of flooding stress compared with that of the wild-type. Taken together, these results suggest that activation of the fermentation system in the early stages of flooding may be an important factor for the acquisition of flooding tolerance in soybean. Copyright © 2012 Elsevier B.V. All rights reserved.

Isolation and characterization of mutants with lesions affecting pellicle formation and erythrocyte agglutination by type 1 piliated Escherichia coli.

PubMed Central

Harris, S L; Elliott, D A; Blake, M C; Must, L M; Messenger, M; Orndorff, P E

1990-01-01

The product of the pilE (also called fimH) gene is a minor component of type 1 pili in Escherichia coli. Mutants that have insertions in the pilE gene are fully piliated but unable to bind to and agglutinate guinea pig erythrocytes, a characteristic of wild-type type 1 piliated E. coli. In this paper we describe the isolation of 48 mutants with point lesions that map to the pilE gene. Such mutants were isolated by using mutT mutagenesis and an enrichment procedure devised to favor the growth of individuals that could form a pellicle in static broth containing alpha-methylmannoside, an inhibitor of erythrocyte binding and pellicle formation. Results indicated that the enrichment favored mutants expressing pilE gene products that were defective in mediating erythrocyte binding. Characterization of 12 of the mutants in greater detail revealed that certain lesions affected pilus number and length. In addition, a mutant that was temperature sensitive for erythrocyte binding was isolated and used to provide evidence that pellicle formation relies on the intercellular interaction of pilE gene products. Our results suggest a molecular explanation for the old and paradoxical observations connecting pellicle formation and erythrocyte agglutination by type 1 piliated E. coli. Images PMID:1977736

Glucose Starvation Alters Heat Shock Response, Leading to Death of Wild Type Cells and Survival of MAP Kinase Signaling Mutant

PubMed Central

Higgins, LeeAnn; Markowski, Todd; Brambl, Robert

2016-01-01

A moderate heat shock induces Neurospora crassa to synthesize large quantities of heat shock proteins that are protective against higher, otherwise lethal temperatures. However, wild type cells do not survive when carbohydrate deprivation is added to heat shock. In contrast, a mutant strain defective in a stress-activated protein kinase does survive the combined stresses. In order to understand the basis for this difference in survival, we have determined the relative levels of detected proteins in the mutant and wild type strain during dual stress, and we have identified gene transcripts in both strains whose quantities change in response to heat shock or dual stress. These data and supportive experimental evidence point to reasons for survival of the mutant strain. By using alternative respiratory mechanisms, these cells experience less of the oxidative stress that proves damaging to wild type cells. Of central importance, mutant cells recycle limited resources during dual stress by undergoing autophagy, a process that we find utilized by both wild type and mutant cells during heat shock. Evidence points to inappropriate activation of TORC1, the central metabolic regulator, in wild type cells during dual stress, based upon behavior of an additional signaling mutant and inhibitor studies. PMID:27870869

Plastidial Folate Prevents Starch Biosynthesis Triggered by Sugar Influx into Non-Photosynthetic Plastids of Arabidopsis

PubMed Central

Hayashi, Makoto; Tanaka, Mina; Yamamoto, Saki; Nakagawa, Taro; Kanai, Masatake; Anegawa, Aya; Ohnishi, Miwa; Mimura, Tetsuro; Nishimura, Mikio

2017-01-01

Abstract Regulation of sucrose–starch interconversion in plants is important to maintain energy supplies necessary for viability and growth. Arabidopsis mutants were screened for aberrant responses to sucrose to identify candidates with a defect in the regulation of starch biosynthesis. One such mutant, fpgs1-4, accumulated substantial amounts of starch in non-photosynthetic cells. Dark-grown mutant seedlings exhibited shortened hypocotyls and accumulated starch in etioplasts when supplied with exogenous sucrose/glucose. Similar starch accumulation from exogenous sucrose was observed in mutant chloroplasts, when photosynthesis was prevented by organ culture in darkness. Molecular genetic analyses revealed that the mutant was defective in plastidial folylpolyglutamate synthetase, one of the enzymes engaged in folate biosynthesis. Active folate derivatives are important biomolecules that function as cofactors for a variety of enzymes. Exogenously supplied 5-formyl-tetrahydrofolate abrogated the mutant phenotypes, indicating that the fpgs1-4 mutant produced insufficient folate derivative levels. In addition, the antifolate agents methotrexate and 5-fluorouracil induced starch accumulation from exogenously supplied sucrose in dark-grown seedlings of wild-type Arabidopsis. These results indicate that plastidial folate suppresses starch biosynthesis triggered by sugar influx into non-photosynthetic cells, demonstrating a hitherto unsuspected link between plastidial folate and starch metabolism. PMID:28586467

Effect of the deletion of the C region on the structure and hydration of insulin-like growth factor 1: a molecular dynamics investigation

NASA Astrophysics Data System (ADS)

Degreve, Leo; Silva, Luciene B.

The structure and hydration of insulin-like growth factor 1 and an inactive mutant lacking the C region have been investigated in aqueous solution by molecular dynamics simulation. The overall structures of the two polypeptide resemble those determined by NMR spectroscopy. The deletion of the C region in the wild polypeptide introduces structural stability in the mutant, leading to a better definition of the secondary structure elements. A detailed hydration analysis was performed using the radial distribution functions and energy distributions. The backbone of the mutant is in general more solvent accessible than the wild polypeptide backbone. The structural rearrangements induced in the mutant led to changes in the solvent exposition of Tyr24 and Tyr60, which are residues important for ligand-receptor complex formation. Tyr24 exhibited a similar degree of solvent exposition in both IGF-1 and in the mutant; however, its hydroxyl group in the wild polypeptide is better solvated than in the mutant. Tyr60 was found to be solvent exposed in the wild protein, while in the mutant the involvement of its hydroxyl group in intramolecular hydrogen bonds led to it being buried away from the solvent.

Characterization of a novel gravitropic mutant of morning glory, weeping2

NASA Astrophysics Data System (ADS)

Kitazawa, Daisuke; Miyazawa, Yutaka; Fujii, Nobuharu; Nitasaka, Eiji; Takahashi, Hideyuki

2008-09-01

In higher plants, gravity is a major environmental cue that governs growth orientation, a phenomenon termed gravitropism. It has been suggested that gravity also affects other aspects of morphogenesis, such as circumnutation and winding movements. Previously, we showed that these aspects of plant growth morphology require amyloplast sedimentation inside gravisensing endodermal cells. However, the molecular mechanism of the graviresponse and its relationship to circumnutation and winding remains obscure. Here, we have characterized a novel shoot gravitropic mutant of morning glory, weeping2 ( we2). In the we2 mutant, the gravitropic response of the stem was absent, and hypocotyls exhibited a severely reduced gravitropic response, whereas roots showed normal gravitropism. In agreement with our previous studies, we found that we2 mutant has defects in shoot circumnutation and winding. Histological analysis showed that we2 mutant forms abnormal endodermal cells. We identified a mutation in the morning glory homolog of SHORT-ROOT ( PnSHR1) that was genetically linked to the agravitropic phenotype of we2 mutant, and which may underlie the abnormal differentiation of endodermal cells in this plant. These results suggest that the phenotype of we2 mutant is due to a mutation of PnSHR1, and that PnSHR1 regulates gravimorphogenesis, including circumnutation and winding movements, in morning glory.

The Greening after Extended Darkness1 Is an N-End Rule Pathway Mutant with High Tolerance to Submergence and Starvation1[OPEN

PubMed Central

Riber, Willi; Müller, Jana T.; Visser, Eric J.W.; Sasidharan, Rashmi; Voesenek, Laurentius A.C.J.; Mustroph, Angelika

2015-01-01

Plants respond to reductions in internal oxygen concentrations with adaptive mechanisms (for example, modifications of metabolism to cope with reduced supply of ATP). These responses are, at the transcriptional level, mediated by the group VII Ethylene Response Factor transcription factors, which have stability that is regulated by the N-end rule pathway of protein degradation. N-end rule pathway mutants are characterized by a constitutive expression of hypoxia response genes and abscisic acid hypersensitivity. Here, we identify a novel proteolysis6 (prt6) mutant allele, named greening after extended darkness1 (ged1), which was previously discovered in a screen for genomes uncoupled-like mutants and shows the ability to withstand long periods of darkness at the seedling stage. Interestingly, this ethyl methanesulfonate-derived mutant shows unusual chromosomal rearrangement instead of a point mutation. Furthermore, the sensitivity of N-end rule pathway mutants ged1 and prt6-1 to submergence was studied in more detail to understand previously contradicting experiments on this topic. Finally, it was shown that mutants for the N-end rule pathway are generally more tolerant to starvation conditions, such as prolonged darkness or submergence, which was partially associated with carbohydrate conservation. PMID:25667318

Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

PubMed

Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

2018-05-11

Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

Parallel analysis of tagged deletion mutants efficiently identifies genes involved in endoplasmic reticulum biogenesis.

PubMed

Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D

2003-07-30

Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.

Diversion of phagosome trafficking by pathogenic Rhodococcus equi depends on mycolic acid chain length

PubMed Central

Sydor, Tobias; Bargen, Kristine; Hsu, Fong-Fu; Huth, Gitta; Holst, Otto; Wohlmann, Jens; Becken, Ulrike; Dykstra, Tobias; Söhl, Kristina; Lindner, Buko; Prescott, John F; Schaible, Ulrich E; Utermöhlen, Olaf; Haas, Albert

2013-01-01

Rhodococcus equi is a close relative of Mycobacterium spp. and a facultative intracellular pathogen which arrests phagosome maturation in macrophages before the late endocytic stage. We have screened a transposon mutant library of R. equi for mutants with decreased capability to prevent phagolysosome formation. This screen yielded a mutant in the gene for β-ketoacyl-(acyl carrier protein)-synthase A (KasA), a key enzyme of the long-chain mycolic acid synthesizing FAS-II system. The longest kasA mutant mycolic acid chains were 10 carbon units shorter than those of wild-type bacteria. Coating of non-pathogenic E. coli with purified wild-type trehalose dimycolate reduced phagolysosome formation substantially which was not the case with shorter kasA mutant-derived trehalose dimycolate. The mutant was moderately attenuated in macrophages and in a mouse infection model, but was fully cytotoxic.Whereas loss of KasA is lethal in mycobacteria, R. equi kasA mutant multiplication in broth was normal proving that long-chain mycolic acid compounds are not necessarily required for cellular integrity and viability of the bacteria that typically produce them. This study demonstrates a central role of mycolic acid chain length in diversion of trafficking by R. equi. PMID:23078612

Diversion of phagosome trafficking by pathogenic Rhodococcus equi depends on mycolic acid chain length.

PubMed

Sydor, Tobias; von Bargen, Kristine; Hsu, Fong-Fu; Huth, Gitta; Holst, Otto; Wohlmann, Jens; Becken, Ulrike; Dykstra, Tobias; Söhl, Kristina; Lindner, Buko; Prescott, John F; Schaible, Ulrich E; Utermöhlen, Olaf; Haas, Albert

2013-03-01

Rhodococcus equi is a close relative of Mycobacterium spp. and a facultative intracellular pathogen which arrests phagosome maturation in macrophages before the late endocytic stage. We have screened a transposon mutant library of R. equi for mutants with decreased capability to prevent phagolysosome formation. This screen yielded a mutant in the gene for β-ketoacyl-(acyl carrier protein)-synthase A (KasA), a key enzyme of the long-chain mycolic acid synthesizing FAS-II system. The longest kasA mutant mycolic acid chains were 10 carbon units shorter than those of wild-type bacteria. Coating of non-pathogenic E. coli with purified wild-type trehalose dimycolate reduced phagolysosome formation substantially which was not the case with shorter kasA mutant-derived trehalose dimycolate. The mutant was moderately attenuated in macrophages and in a mouse infection model, but was fully cytotoxic.Whereas loss of KasA is lethal in mycobacteria, R. equi kasA mutant multiplication in broth was normal proving that long-chain mycolic acid compounds are not necessarily required for cellular integrity and viability of the bacteria that typically produce them. This study demonstrates a central role of mycolic acid chain length in diversion of trafficking by R. equi. © 2012 Blackwell Publishing Ltd.

Starch Biosynthesis in Guard Cells But Not in Mesophyll Cells Is Involved in CO2-Induced Stomatal Closing1[OPEN

PubMed Central

Stephan, Aaron B.; Schroeder, Julian I.

2016-01-01

Starch metabolism is involved in stomatal movement regulation. However, it remains unknown whether starch-deficient mutants affect CO2-induced stomatal closing and whether starch biosynthesis in guard cells and/or mesophyll cells is rate limiting for high CO2-induced stomatal closing. Stomatal responses to [CO2] shifts and CO2 assimilation rates were compared in Arabidopsis (Arabidopsis thaliana) mutants that were either starch deficient in all plant tissues (ADP-Glc-pyrophosphorylase [ADGase]) or retain starch accumulation in guard cells but are starch deficient in mesophyll cells (plastidial phosphoglucose isomerase [pPGI]). ADGase mutants exhibited impaired CO2-induced stomatal closure, but pPGI mutants did not, showing that starch biosynthesis in guard cells but not mesophyll functions in CO2-induced stomatal closing. Nevertheless, starch-deficient ADGase mutant alleles exhibited partial CO2 responses, pointing toward a starch biosynthesis-independent component of the response that is likely mediated by anion channels. Furthermore, whole-leaf CO2 assimilation rates of both ADGase and pPGI mutants were lower upon shifts to high [CO2], but only ADGase mutants caused impairments in CO2-induced stomatal closing. These genetic analyses determine the roles of starch biosynthesis for high CO2-induced stomatal closing. PMID:27208296

Isolation of New Gravitropic Mutants under Hypergravity Conditions.

PubMed

Mori, Akiko; Toyota, Masatsugu; Shimada, Masayoshi; Mekata, Mika; Kurata, Tetsuya; Tasaka, Masao; Morita, Miyo T

2016-01-01

Forward genetics is a powerful approach used to link genotypes and phenotypes, and mutant screening/analysis has provided deep insights into many aspects of plant physiology. Gravitropism is a tropistic response in plants, in which hypocotyls and stems sense the direction of gravity and grow upward. Previous studies of gravitropic mutants have suggested that shoot endodermal cells in Arabidopsis stems and hypocotyls are capable of sensing gravity (i.e., statocytes). In the present study, we report a new screening system using hypergravity conditions to isolate enhancers of gravitropism mutants, and we also describe a rapid and efficient genome mapping method, using next-generation sequencing (NGS) and single nucleotide polymorphism (SNP)-based markers. Using the endodermal-amyloplast less 1 ( eal1 ) mutant, which exhibits defective development of endodermal cells and gravitropism, we found that hypergravity (10 g) restored the reduced gravity responsiveness in eal1 hypocotyls and could, therefore, be used to obtain mutants with further reduction in gravitropism in the eal1 background. Using the new screening system, we successfully isolated six ene ( enhancer of eal1 ) mutants that exhibited little or no gravitropism under hypergravity conditions, and using NGS and map-based cloning with SNP markers, we narrowed down the potential causative genes, which revealed a new genetic network for shoot gravitropism in Arabidopsis .

Isolation of New Gravitropic Mutants under Hypergravity Conditions

PubMed Central

Mori, Akiko; Toyota, Masatsugu; Shimada, Masayoshi; Mekata, Mika; Kurata, Tetsuya; Tasaka, Masao; Morita, Miyo T.

2016-01-01

Forward genetics is a powerful approach used to link genotypes and phenotypes, and mutant screening/analysis has provided deep insights into many aspects of plant physiology. Gravitropism is a tropistic response in plants, in which hypocotyls and stems sense the direction of gravity and grow upward. Previous studies of gravitropic mutants have suggested that shoot endodermal cells in Arabidopsis stems and hypocotyls are capable of sensing gravity (i.e., statocytes). In the present study, we report a new screening system using hypergravity conditions to isolate enhancers of gravitropism mutants, and we also describe a rapid and efficient genome mapping method, using next-generation sequencing (NGS) and single nucleotide polymorphism (SNP)-based markers. Using the endodermal-amyloplast less 1 (eal1) mutant, which exhibits defective development of endodermal cells and gravitropism, we found that hypergravity (10 g) restored the reduced gravity responsiveness in eal1 hypocotyls and could, therefore, be used to obtain mutants with further reduction in gravitropism in the eal1 background. Using the new screening system, we successfully isolated six ene (enhancer of eal1) mutants that exhibited little or no gravitropism under hypergravity conditions, and using NGS and map-based cloning with SNP markers, we narrowed down the potential causative genes, which revealed a new genetic network for shoot gravitropism in Arabidopsis. PMID:27746791

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Arabidopsis ILITHYIA protein is necessary for proper chloroplast biogenesis and root development independent of eIF2α phosphorylation.

PubMed

Faus, I; Niñoles, R; Kesari, V; Llabata, P; Tam, E; Nebauer, S G; Santiago, J; Hauser, M T; Gadea, J

One of the main mechanisms blocking translation after stress situations is mediated by phosphorylation of the α-subunit of the eukaryotic initiation factor 2 (eIF2), performed in Arabidopsis by the protein kinase GCN2 which interacts and is activated by ILITHYIA(ILA). ILA is involved in plant immunity and its mutant lines present phenotypes not shared by the gcn2 mutants. The functional link between these two genes remains elusive in plants. In this study, we show that, although both ILA and GCN2 genes are necessary to mediate eIF2α phosphorylation upon treatments with the aromatic amino acid biosynthesis inhibitor glyphosate, their mutants develop distinct root and chloroplast phenotypes. Electron microscopy experiments reveal that ila mutants, but not gcn2, are affected in chloroplast biogenesis, explaining the macroscopic phenotype previously observed for these mutants. ila3 mutants present a complex transcriptional reprogramming affecting defense responses, photosynthesis and protein folding, among others. Double mutant analyses suggest that ILA has a distinct function which is independent of GCN2 and eIF2α phosphorylation. These results suggest that these two genes may have common but also distinct functions in Arabidopsis. Copyright © 2018 Elsevier GmbH. All rights reserved.

Functional Loss of Bmsei Causes Thermosensitive Epilepsy in Contractile Mutant Silkworm, Bombyx mori

NASA Astrophysics Data System (ADS)

Nie, Hongyi; Cheng, Tingcai; Huang, Xiaofeng; Zhou, Mengting; Zhang, Yinxia; Dai, Fangyin; Mita, Kazuei; Xia, Qingyou; Liu, Chun

2015-07-01

The thermoprotective mechanisms of insects remain largely unknown. We reported the Bombyx mori contractile (cot) behavioral mutant with thermo-sensitive seizures phenotype. At elevated temperatures, the cot mutant exhibit seizures associated with strong contractions, rolling, vomiting, and a temporary lack of movement. We narrowed a region containing cot to ~268 kb by positional cloning and identified the mutant gene as Bmsei which encoded a potassium channel protein. Bmsei was present in both the cell membrane and cytoplasm in wild-type ganglia but faint in cot. Furthermore, Bmsei was markedly decreased upon high temperature treatment in cot mutant. With the RNAi method and injecting potassium channel blockers, the wild type silkworm was induced the cot phenotype. These results demonstrated that Bmsei was responsible for the cot mutant phenotype and played an important role in thermoprotection in silkworm. Meanwhile, comparative proteomic approach was used to investigate the proteomic differences. The results showed that the protein of Hsp-1 and Tn1 were significantly decreased and increased on protein level in cot mutant after thermo-stimulus, respectively. Our data provide insights into the mechanism of thermoprotection in insect. As cot phenotype closely resembles human epilepsy, cot might be a potential model for the mechanism of epilepsy in future.

Mutational analysis of polyomavirus small-T-antigen functions in productive infection and in transformation.

PubMed Central

Martens, I; Nilsson, S A; Linder, S; Magnusson, G

1989-01-01

The function of polyomavirus small T antigen in productive infection and in transformation was studied. Transfection of permissive mouse cells with mixtures of mutants that express only one type of T antigen showed that small T antigen increased large-T-antigen-dependent viral DNA synthesis approximately 10-fold. Under the same conditions, small T antigen was also essential for the formation of infectious virus particles. To analyze these activities of small T antigen, mutants producing protein with single amino acid replacements were constructed. Two mutants, bc1073 and bc1075, were characterized. Although both mutations led to the substitution of amino acid residues of more than one T antigen, the phenotype of both mutants was associated with alterations of the small T antigen. Both mutant proteins had lost their activity in the maturation of infectious virus particles. The bc1075 but not the bc1073 small T antigen had also lost its ability to stimulate viral DNA synthesis in mouse 3T6 cells. Finally, both mutants retained a third activity of small T antigen: to confer on rat cells also expressing middle T antigen the ability to grow efficiently in semisolid medium. The phenotypes of the mutants in these three assays suggest that small T antigen has at least three separate functions. Images PMID:2704075

Mutational analysis of polyomavirus small-T-antigen functions in productive infection and in transformation.

PubMed

Martens, I; Nilsson, S A; Linder, S; Magnusson, G

1989-05-01

The function of polyomavirus small T antigen in productive infection and in transformation was studied. Transfection of permissive mouse cells with mixtures of mutants that express only one type of T antigen showed that small T antigen increased large-T-antigen-dependent viral DNA synthesis approximately 10-fold. Under the same conditions, small T antigen was also essential for the formation of infectious virus particles. To analyze these activities of small T antigen, mutants producing protein with single amino acid replacements were constructed. Two mutants, bc1073 and bc1075, were characterized. Although both mutations led to the substitution of amino acid residues of more than one T antigen, the phenotype of both mutants was associated with alterations of the small T antigen. Both mutant proteins had lost their activity in the maturation of infectious virus particles. The bc1075 but not the bc1073 small T antigen had also lost its ability to stimulate viral DNA synthesis in mouse 3T6 cells. Finally, both mutants retained a third activity of small T antigen: to confer on rat cells also expressing middle T antigen the ability to grow efficiently in semisolid medium. The phenotypes of the mutants in these three assays suggest that small T antigen has at least three separate functions.

Data on quantification of signaling pathways activated by KIT and PDGFRA mutants.

PubMed

Bahlawane, Christelle; Schmitz, Martine; Letellier, Elisabeth; Arumugam, Karthik; Nicot, Nathalie; Nazarov, Petr V; Haan, Serge

2016-12-01

The present data are related to the article entitled "Insights into ligand stimulation effects on gastro-intestinal stromal tumors signaling" (C. Bahlawane, M. Schmitz, E. Letellier, K. Arumugam, N. Nicot, P.V. Nazarov, S. Haan, 2016) [1]. Constitutive and ligand-derived signaling pathways mediated by KIT and PDGFRA mutated proteins found in gastrointestinal stromal tumors (GIST) were compared. Expression of mutant proteins was induced by doxycycline in an isogenic background (Hek293 cells). Kit was identified by FACS at the cell surface and found to be quickly degraded or internalized upon SCF stimulation for both Kit Wild type and Kit mutant counterparts. Investigation of the main activated pathways in GIST unraveled a new feature specific for oncogenic KIT mutants, namely their ability to be further activated by Kit ligand, the stem cell factor (scf). We were also able to identify the MAPK pathway as the most prominent target for a common inhibition of PDGFRA and KIT oncogenic signaling. Western blotting and micro-array analysis were applied to analyze the capacities of the mutant to induce an effective STATs response. Among all Kit mutants, only Kit Ex11 deletion mutant was able to elicit an effective STATs response whereas all PDGFRA were able to do so.

Diffusible signal factor-repressed extracellular traits enable attachment of Xylella fastidiosa to insect vectors and transmission.

PubMed

Baccari, Clelia; Killiny, Nabil; Ionescu, Michael; Almeida, Rodrigo P P; Lindow, Steven E

2014-01-01

The hypothesis that a wild-type strain of Xylella fastidiosa would restore the ability of rpfF mutants blocked in diffusible signal factor production to be transmitted to new grape plants by the sharpshooter vector Graphocephala atropunctata was tested. While the rpfF mutant was very poorly transmitted by vectors irrespective of whether they had also fed on plants infected with the wild-type strain, wild-type strains were not efficiently transmitted if vectors had fed on plants infected with the rpfF mutant. About 100-fewer cells of a wild-type strain attached to wings of a vector when suspended in xylem sap from plants infected with an rpfF mutant than in sap from uninfected grapes. The frequency of transmission of cells suspended in sap from plants that were infected by the rpfF mutant was also reduced over threefold. Wild-type cells suspended in a culture supernatant of an rpfF mutant also exhibited 10-fold less adherence to wings than when suspended in uninoculated culture media. A factor released into the xylem by rpfF mutants, and to a lesser extent by the wild-type strain, thus inhibits their attachment to, and thus transmission by, sharpshooter vectors and may also enable them to move more readily through host plants.

Differential effects of lesion mimic mutants in barley on disease development by facultative pathogens

PubMed Central

McGrann, Graham R. D.; Steed, , Andrew; Burt, Christopher; Nicholson, Paul; Brown, James K. M.

2015-01-01

Lesion mimic mutants display spontaneous necrotic spots and chlorotic leaves as a result of mis-regulated cell death programmes. Typically these mutants have increased resistance to biotrophic pathogens but their response to facultative fungi that cause necrotrophic diseases is less well studied. The effect of altered cell death regulation on the development of disease caused by Ramularia collo-cygni, Fusarium culmorum and Oculimacula yallundae was explored using a collection of barley necrotic (nec) lesion mimic mutants. nec8 mutants displayed lower levels of all three diseases compared to nec9 mutants, which had increased R. collo-cygni but decreased F. culmorum disease symptoms. nec1 mutants reduced disease development caused by both R. collo-cygni and F. culmorum. The severity of the nec1-induced lesion mimic phenotype and F. culmorum symptom development was reduced by mutation of the negative cell death regulator MLO. The significant reduction in R. collo-cygni symptoms caused by nec1 was completely abolished in the presence of the mlo-5 allele and both symptoms and fungal biomass were greater than in the wild-type. These results indicate that physiological pathways involved in regulation of cell death interact with one another in their effects on different fungal pathogens. PMID:25873675